Compositions and methods for targeting antibiotic tolerance

Abstract

Compositions and methods of preventing, slowing the progression of, or targeting antibiotic tolerance and increasing antibiotic sensitivity in intracellular bacteria. Compositions and methods of reducing the production of reactive oxygen and nitrogen species in a subject and methods of reducing antibiotic-tolerant persister cells. Methods can further include administration of antibiotics.

Description

Attorney Docket No.5470.986.WO COMPOSITIONS AND METHODS FOR TARGETING ANTIBIOTIC TOLERANCE STATEMENT OF PRIORITY

[0001] The application claims the benefit of U.S. Provisional Application No. 63 / 699,966, filed on September 27, 2024, the entire contents of which are incorporated by reference herein. GOVERNMENT INTEREST

[0002] This invention was made with government support under Grant Number AI173004 awarded by the National Institutes of Health. The government has certain rights regarding inventions. STATEMENT REGARDING ELECTRONIC FILING OF A SEQUENCE LISTING

[0003] A Sequence Listing in XML format, entitled 5470-986WO_ST26.xml, 5,473 bytes in size, generated on September 25, 2025 and filed herewith, is hereby incorporated by reference into the specification for its disclosures. FIELD OF THE INVENTION

[0004] The present invention relates to compositions and methods of preventing, slowing the progression of, or targeting antibiotic tolerance and increasing antibiotic sensitivity, by increasing intracellular bacterial energy. BACKGROUND OF THE INVENTION

[0005] There are two major problems in the field of antimicrobial chemotherapy – antibiotic resistance and antibiotic tolerance. In the case of antibiotic tolerance, antibiotics fail to kill the bacteria as their phenotypic state affords them protection from the bactericidal activity of the antibiotic. Antibiotic tolerance has been frequently connected with poor treatment outcomes in the clinic (1-3). Unlike antibiotic resistance, which permits bacterial growth in the presence of drugs, antibiotic tolerance allows a subpopulation of genetically identical bacteria to withstand multiple antibiotics for prolonged periods (4, 5). This phenomenon is best illustrated by clinical observations in which bacterial isolates that fail to respond to treatment in patients remain susceptible to the prescribed antibiotics (6, 7). The extended survival of tolerant bacteria furtherAttorney Docket No.5470.986.WO predisposes them to evolve antibiotic resistance over time, underscoring the critical need to address antibiotic tolerance (8, 9).

[0006] Staphylococcus aureus is one of the most recalcitrant bacteria, posing a significant health and economic challenge with a mortality rate ranging from 15–50% and an estimated annual cost of 3 billion dollars (7, 10). Despite appropriate use of antibiotics, patients may often encounter treatment failure and recurrent infections due to antibiotic tolerance. As a versatile facultative intracellular pathogen, S. aureus is capable of surviving within various cell types, including Kupffer cells, the specialized macrophages of the liver (11-15). These intracellular environments not only provide physical barriers against antimicrobial attacks but also foster conditions that promote bacterial persistence and tolerance (16-18). When conditions become favorable, the bacteria can resume growth, leading to relapsing infections. Therefore, developing innovative strategies to target intracellular bacterial persisters is essential for achieving complete eradication.

[0007] A principal characteristic of tolerant bacteria is their lower energy level and metabolic activities, rendering a non-growing state which prevents them from being targeted by antibiotics that are directed at growth-centered processes (3, 19-21). Mammalian host cells, particularly professional phagocytes, possess a plethora of antimicrobial mechanisms, including enzymatic degradation, nutritional deprivation, and oxidative and nitrosative stress, to combat internalized bacteria. However, these mechanisms also compel bacteria to enter a low-energy, low-metabolic activity state in response to the associated stresses, rendering them tolerant to antibiotics (16, 22, 23). SUMMARY OF THE INVENTION

[0008] The present disclosure is based, at least in part, on the discovery of compositions and methods to pharmacologically sensitize intracellular bacteria to antibiotics. The developed compound screen provides a pathway to uncover host-directed therapies that synergize with antibiotics and aid in the clearance of intracellular persisters. Accordingly, the present invention is based on methods of targeting antibiotic tolerance in bacteria using compounds.

[0009] In some embodiments, a compound, or a pharmaceutically acceptable salt thereof, is provided according to the formula I:Attorney Docket No.5470.986.WO O R R3N5wherein R1is an alkyl, amidyl, or R3is N or NH; and R4and R5are each independently a heteroaryl oraryl, wherein the compound is O . of sensitizing an antibiotic tolerant pathogen in a subjectto the subject a therapeutically effective amount of a compound of the disclosure or pharmaceutically acceptable salt thereof, wherein the pathogen is sensitized to an antibiotic.

[0011] In some embodiments, a method of treating a pathogen infection in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective amount of a compound of the disclosure or pharmaceutically acceptable salt thereof and an antibiotic, wherein the amount of antibiotic-tolerant persister cells is reduced.

[0012] In some embodiments, a method of reducing antibiotic-tolerant persister cells in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective amount of a compound of the disclosure or pharmaceutically acceptable salt thereof and an antibiotic, wherein the growth of the pathogen is reduced.

[0013] In some embodiments, a method of reducing the production of reactive oxygen and nitrogen species in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective amount of a compound of the disclosure or pharmaceutically acceptable salt thereof and an antibiotic, wherein the production of reactive oxygen and nitrogen species in the subject is reduced.

[0014] In some embodiments, a method of preventing antibiotic tolerance in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective amount of a compound of the disclosure or pharmaceutically acceptable salt thereof, wherein the antibiotic tolerance in the subject is prevented.Attorney Docket No.5470.986.WO

[0015] In some embodiments, a method of increasing antibiotic sensitivity in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective amount of a compound of the disclosure or pharmaceutically acceptable salt thereof, wherein the antibiotic sensitivity in the subject is increased.

[0016] In some embodiments, a method of slowing the progression of antibiotic tolerance in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective amount of a compound of the disclosure or pharmaceutically acceptable salt thereof, wherein the progression of antibiotic tolerance in the subject is decreased.

[0017] In some embodiments, the antibiotic tolerant pathogen has low metabolic activity. In some embodiments, the pathogen is an antibiotic-tolerant bacteria.

[0018] In some embodiments, the compound and the antibiotic are co-administered, wherein the antibiotic is administered before the compound, or wherein the compound is administered before the antibiotic. In some embodiments, two or more antibiotics are administered to the subject. In some embodiments the therapeutically effective amount of the compound is a dose of about 0.1 mg / kg to about 100 mg / kg once per day or twice per day.

[0019] In some embodiments, administering the compound and the antibiotic comprises oral administration, intravenous administration, intrathecal administration, intraperitoneal administration, intra-articular administration, epidural administration, or any combination thereof.

[0020] These and other aspects of the invention are set forth in more detail in the description of the invention below. DESCRIPTION OF THE DRAWINGS

[0021] FIGS.1A-1D. Intracellular environments provide a niche for antibiotic-tolerant S. aureus persisters. 1A. Clinical isolates from S. aureus bacteremia patients exhibited variable antibiotic tolerability in planktonic cultures. Rifampicin (Rif) was washed away to enumerate surviving bacteria (CFU). 1B. High- and low-persister isolates from (1A) became more tolerant and produced similar numbers of persisters in bone marrow-derived macrophages. Gentamicin (Gen) and vancomycin (Van) were added to eliminate extracellular bacteria. Surviving intracellular bacteria were normalized to CFU counts at the time of antibiotic addition to calculate persister frequencies (n = 4). *p<0.05; ns, not significant (unpaired t-test). Bars represent mean ± SEM. Assay schematics are shown above plots.1C. Confocal z-sectioning visualized viable intracellularAttorney Docket No.5470.986.WO S. aureus. RAW 264.7 macrophages were infected with an inducible GFP reporter strain and treated with 50 µg / mL Gen to exclude extracellular bacteria. Intracellular bacteria were probed by anhydrotetracycline (aTc) induction. 1D. Intracellular persisters in mouse kidneys were detected using ImageStream analysis. C57BL / 6J mice were infected with the inducible reporter strain via the intravenous route and intraperitoneally treated with 10 mg / kg Rif at 1 day post-infection (dpi) for 24 h. Kidney cells were extracted at 2 dpi and incubated with 2 µM aTc to induce GFP expression. Representative images shown.

[0022] FIGS.2A-2E. A high-throughput screen identifies compounds that modulate the metabolic activity of intracellular S. aureus. 2A. Schematic of the compound screening platform. 2B. The metabolic activity of intracellular S. aureus was monitored using a bioluminescent MRSA strain JE2-lux. RAW 264.7 macrophages were infected with JE2-lux and treated with 20 µg / mL vancomycin (Van) or 10 µg / mL rifampicin (Rif) for 4 h before luminescence detection. Gentamicin (Gen; 50 µg / mL) was included to eliminate extracellular bacteria. Only Rif penetrates host membranes to target intracellular bacteria. Representative of two independent experiments (n = 3). *p<0.05; ns, not significant (unpaired t-test). Bars represent mean ± SEM. 2C. Host cell viability was assessed using CellTiter-Fluor (CTF), which correlated with viable RAW 264.7 cell numbers (Pearson r >0.97, p<0.05) and was not affected by S. aureus. The multiplicities of infection (MOIs) of 0, 20 and 100 shown (n = 3).2D,2E. Dose-response curves for Rif (2D) and Van (2E) inhibition of intracellular S. aureus activity (closed circle) and corresponding host cell viability (open circle). Representative of two independent experiments (n = 3). Bars represent mean ± SEM. Assay schematics are shown above plots.

[0023] FIGS. 3A-3E. Screening a kinase-targeted compound library identifies a small molecule that sensitizes intracellular S. aureus to antibiotic killing. 3A. Forty-five compounds (10 µM) enhanced luminescence signal >1.5-fold relative to vehicle control (0.1% DMSO) without causing cytotoxicity (circles) during a 4-h treatment. The structure of the top candidate, KL1, is shown. Rifampicin (Rif)-treated cells served as a reference (RIF). 3B. KL1 (open circles) enhanced the killing activity of Rif (10 µg / mL) and moxifloxacin (Mox; 50 µg / mL) against intracellular MRSA in RAW 264.7 macrophages. Gentamicin (Gen; 50 µg / mL) was included to eliminate extracellular bacteria. Surviving intracellular bacteria were normalized to the untreated control (Gen-only, no antibiotics (Abx), no KL1). Representative data from 2–3 independent experiments (n≥3). 3C. KL1’s sensitizing effect was not affected by antibiotic pre-exposure. Infected cells were pretreatedAttorney Docket No.5470.986.WO with 10 µg / mL Rif (±Rif±KL1) or 40 µM KL1 (±KL1±Rif) for 1 h, followed by the addition of the complementary treatment. Untreated (-Rif-KL1) served as control. Representative of three independent experiments (n = 3).3D, 3E. KL1 retains adjuvant activity in human THP-1-derived macrophages. Cells were pretreated with 0–100 µM KL1, Infected at MOI 20, then treated with Rif (10 µg / mL) and 0–100 µM KL1 for 6 h (3D) or 24 h (3E). Surviving bacteria were normalized to the Gen-only control. Representative data from 3–4 independent experiments (n = 3). *p<0.05; **p<0.01; ns, not significant (unpaired t-test). Bars represent mean ± SEM. Assay schematics are shown above plots.

[0024] FIGS.4A-4G. KL1 enhances antibiotic killing of S. aureus in a murine bacteremia model and boosts antibiotic efficacy against S. Typhimurium and M. tuberculosis in macrophages. 4A. Schematic of the murine model. C57BL / 6J mice were infected via intravenous (i.v.) injection and treated intraperitoneally (i.p.) with rifampicin (Rif; 10 mg / kg, q.d.) ± KL1 (100 mg / kg, b.i.d.) starting 6 hours post-infection (hpi) for 2 days. Organs were harvested to quantify bacterial burden. 4B, 4C. Co-administration of KL1 and Rif significantly reduced S. aureus CFUs in liver (4B) and spleen (4C). Representative of two experiments (n = 8). ***p<0.001 (unpaired t-test). 4D. Combined Rif and KL1 improved mouse survival (red) compared to a single dose of Rif alone (black). Each group included 12–13 mice from two experiments (p<0.05, Mantel-Cox test). 4E. KL1 enhanced ciprofloxacin (Cip; 5 µg / mL) killing of intracellular S. Typhimurium. Surviving bacteria were normalized to input CFU (n≥7). *p<0.05; **p<0.01 (unpaired t-test).4F, 4G. KL1 boosted Rif activity against clinical M. tuberculosis strains from the globally prevalent lineage 2 (4F) and lineage 4 (4G) in macrophages. CFUs were normalized to the untreated control (Gen- only) (n = 3). *p<0.05; ns, not significant (unpaired t-test). Bars represent mean ± SEM.

[0025] FIGS. 5A-5D. KL1 reduces the production of reactive species upon infection. 5A, Inhibition of EHMT2 / G9a phenocopies KL1-mediated sensitization in intracellular S. aureus. A selective EHMT2 / G9a inhibitor, BIX-01294 (BIX; 2.5–10 µM), increased the bioluminescence signal (grey bars) of strain JE2-lux comparing to the vehicle control (Veh; 0.1% DMSO). Cytotoxicity of BIX was also assessed (white circles). Representative data of three experiments (n = 6). 5B, BIX increased rifampicin (Rif; 10 µg / mL) killing of intracellular MRSA in a dose- dependent manner (1–5 µM). Gentamicin (Gen; 50 µg / mL) was added to eliminate extracellular bacteria. Surviving bacteria were normalized to the untreated control (no Rif, no BIX, Gen-only). Representative data of three experiments (n = 3).5C, 5D, Both KL1 (40, 100 µM) and BIX (1, 4Attorney Docket No.5470.986.WO µM) reduced ROS levels at 4 h post-infection (hpi). Chemiluminescent L-012 (5C) and fluorescent fluorescein-boronate (Fl-B) (5D) probes were used to quantify reactive species. Antioxidant butylated hydroxyanisole (BHA; 20 µM) served as a control. Representative data from 3–4 experiments (n = 5). Assay schematics are shown above plots. **p<0.01; ***p<0.001; ****p<0.0001 (unpaired t-test). Bars represent mean ± SEM.

[0026] FIG.6. Mechanistic model of KL1-mediated sensitization of intracellular S. aureus. Host- derived reactive oxygen and nitrogen species (ROS / RNS) help contain intracellular S. aureus infections but also antagonize antibiotics by collapsing the bacterial metabolism and forcing the bacteria into antibiotic-tolerant persister cells. The identified compound KL1 sensitizes intracellular bacteria to antibiotic killing by reducing the production of reactive species upon infection, presumably by targeting the EHMT2 / G9a activity.

[0027] FIGS. 7A-7K. High-throughput screening of a kinase-targeted library identifies compounds that modulate the metabolic activity of intracellular S. aureus. The bioluminescent MRSA strain JE2-lux serves as a proxy for bacterial metabolic activity. 7A-7C, ATP depletion using sodium arsenate (Ars; 0‒0.5 mM, 30 min) shows a positive correlation between ATP levels and bioluminescence signal (Pearson’s r = 0.84; p<0.0001). ATP was measured using BacTiter- Glo in wild-type JE2. No change in viable bacteria (CFU) was observed. Representative data of two experiments (n = 3).7D-7F, Nutrient supplementation (1% glucose, 5 mM sodium pyruvate, 0.5% casamino acids (+++) for 30 min elevated both bioluminescence in JE2-lux and ATP levels in wild-type JE2. No change in CFU after nutrient supplementation or between strains. Representative data of two experiments (n = 3). 7G, Short-term treatment (4 h) with rifampicin (Rif) had no effect on the number of intracellular bacteria.7H, A library of >4,700 compounds (10 µM), structurally similar to kinase inhibitors and compliant with Lipinski's rules, was screened for intracellular MRSA activity. Luminescence signals (black bars) were normalized to the vehicle (0.1% DMSO). Host cell viability (circles) was measured by CellTiter-Fluor. Rifampicin-treated cells are shown as a reference (dashed line).7I, Infected macrophages with JE2-lux (within Mφ) were treated with 10 µM or 40 µM KL1. Gentamicin (Gen; 50 µg / mL) was added to eliminate extracellular bacteria. Bacterial cultures without macrophages (no Mφ) but with Gen and the input CFU were used for comparison. Representative data of three experiments (n≥3). 7J, Uninfected macrophages treated with KL1 (10 or 40 µM) were assessed for viability (CellTiter-Fluor; circles). Rif-treated and infectedmacrophages served as controls (n≥3). These data indicate that KL1’sAttorney Docket No.5470.986.WO phenotype is not caused by background noise from the compound, the host cells or dead extracellular bacteria.7K, CFU data of FIG.3B. Representative data from 2–3 experiments (n≥3). Assay schematics are shown above plots. **p<0.01; ***p<0.001; ****p<0.0001; ns, not significant (unpaired t-test). Bars represent mean ± SEM.

[0028] FIGS.8A-8C. The adjuvant activity of KL1 was consistent across compound sources.8A, 8B, KL1 (10 and 40 µM) from two suppliers, ChemBridge (1) and Enamine (2), consistently elevated the metabolic activity of intracellular S. aureus (n = 4) and enhanced rifampicin (Rif; 10 µg / mL) killing (n = 3).8C, in-house synthesized KL1 (Syn) showed comparable adjuvant activity to commercial KL1 (n = 3). Gentamicin (Gen; 50 µg / mL) was used to eliminate extracellular bacteria. CFU counts were normalized to untreated controls (no Rif, no KL1, Gen-only). Assay schematics are shown above plots. *p<0.05; **p<0.01; ****p<0.0001; ns, not significant (unpaired t-test). Bars represent mean ± SEM.

[0029] FIGS. 9A-9N. Compound KL1 sensitizes intracellular MRSA and MSSA to antibiotic killing in a dose-dependent manner.9A, RAW 264.7 cells were infected with MRSA strain JE2- lux and treated with 10 or 40 µM KL1 with or without 10 µg / mL rifampicin (Rif). Gentamicin (Gen; 50 µg / mL) was used to eliminate extracellular bacteria.9B, 9C, KL1-mediated sensitization was observed in clinical isolates with high (9B) and low (9C) persister phenotypes (see Figure 1A). A dose-dependent response was observed with 0–40 µM KL1. Representative data of three experiments (n = 3).9D-9N, KL1 showed consistent adjuvant activity across multiple MRSA and MSSA isolates: MW2 (9D), SA03739 (9E), SA03740 (9F), SA03758 (9G), SA03775 (9H), SA03803 (9I), SA03809 (9J), SA03815 (9K), SA03833 (9L) and SA03850 (9N), but not SA03847 (9M), which was highly Rif-resistant (Table 1). The number of surviving bacteria was normalized to the untreated control (no Rif, no KL1, Gen-only). Corresponding CFU data are shown (right). Representative data of two experiments (n = 3). *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001; ns, not significant (unpaired t-test). Bars represent mean ± SEM.

[0030] FIGS. 10A-10K. KL1 enhances antibiotic killing in human primary neutrophils. 10A, 10B, CFU data of FIG.3D and 3E, respectively. Representative data of 3–4 experiments (n = 3). 10C-10E, KL1 increases antibiotic efficacy in human primary neutrophils. Infected neutrophils were treated with 10 µg / mL rifampicin and 25 µg / mL gentamicin (R+G) for 4 h (10C) or 25 µg / mL moxifloxacin for 13 h (10D) and 24 h (10E). Bacteria survival was normalized to the untreated control (no abx, no KL1). Corresponding CFU data shown (right). Representative data of threeAttorney Docket No.5470.986.WO experiments. Neutrophils were isolated from fresh blood of four healthy donors.10F-10K, Human PBMC-derived macrophages do not recapitulate ex vivo ROS / RNS levels, and neither KL1 (40– 100 µM) nor the antioxidant BHA (20 µM; positive control) synergizes with antibiotics in this setting. PBMCs from healthy donors were differentiated with GM-CSF (20–50 ng / mL) for 6 days, followed by polarization with LPS (100 ng / mL) and IFN-γ (20–50 ng / mL) for 1–2 days. Cells with (10G) or without (10F) PMA (250–500 nM, 2–3 h) did not phenocopy the adjuvant activity observed with KL1 and BHA. Representative data from 3–5 experiments (n = 3). 10H-10K, A shortened differentiation protocol (4-day GM-CSF, 16-h LPS / IFN-γ, 2-h PMA) yielded inconsistent results across blood donors (donor 1: 10H, 10J; donor 2: 10I, 10K) and treatment durations (6-h: 10H, 10I; 18-h: 10J, 10K) (n = 3). *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001; ns, not significant (unpaired t-test). Bars represent mean ± SEM.

[0031] FIGS.11A-11C. KL1 alone does not cause bacterial outgrowth in the bacteremia murine model. C57BL / 6J mice were infected via intravenous (i.v.) tail vein injections and intraperitoneally treated with 10 mg / kg rifampicin (Rif) (q.d.), 100 mg / kg KL1 (b.i.d.) or the vehicle control (Veh) at 6 hours post-infection (hpi) for 2 days. The livers (11A), spleens (11B) and kidneys (11C) were harvested and homogenized to enumerate the number of surviving bacteria (CFU) (n = 4). ****p<0.0001; ns, not significant (unpaired t-test).

[0032] FIGS. 12A-12H. KL1 exhibits antibiotic adjuvant activity in a Salmonella murine infection model and Mycobacterium tuberculosis in macrophages.12A-12C, CFU data of FIGS. 4E–4G, respectively.12D, Schematic of the Salmonella murine infection model. C57BL / 6J mice were infected via oral gavage and intraperitoneally (i.p.) treated with 150 mg / kg cefotaxime (CTX) with and without 100 mg / kg KL1 (b.i.d.) at 2 days post-infection (dpi) for 6 days.12E-12H, Tissue samples were harvested to enumerate the number of surviving bacteria (CFU) at 4 dpi (12E) and 8 dpi (12F). Co-administration of KL1 and CTX reduced the bacterial burden in Peyer's patches (PP) (12E,12F,12H) but not in Mesenteric lymph nodes (MLN) (12E-12G). A group of 5 mice was examined over the time course (n = 5). *p<0.05; ***p<0.001; ****p<0.0001; ns, not significant (unpaired t-test). Bars represent mean ± SEM.

[0033] FIGS. 13A-13K. Compound KL1 does not synergize with antibiotics in killing extracellular bacteria, nor does it affect metabolic activity or ATP levels in planktonic cultures. 13A, Glucose uptake is important for KL1-antibiotic synergism. RAW 264.7 cells were infected with wild-type LAC or the ΔG4 mutant lacking four glucose transporters and treated with 40 µMAttorney Docket No.5470.986.WO KL1 and 10 µg / mL rifampicin (Rif). Gentamicin (Gen) was included to eliminate extracellular bacteria. Surviving bacteria were normalized to the control (no KL1, Gen- and Rif-only) (black circles). Representative data of two experiments (n = 3). *p<0.05; ****p<0.0001 (unpaired t-test). 13B,13D, Exponential-phase (13B) and stationary-phase (13D) S. aureus (JE2-lux) cultures were incubated with 10 or 40 µM KL1 for 4 h, followed by luminescence detection. The vehicle control (0.1% DMSO, black) and rifampicin (Rif; 2 µg / mL)-treated group served as references. Representative of 2–3 experiments (n = 3). 13C,13E, Exponential-phase (13C) and stationary- phase (13E) cultures were treated with and without 40 µM KL1 and 2 µg / mL Rif for 24 h, followed by a wash step and plating to enumerate surviving bacteria. Assay schematics are shown above plots. *p<0.05; ***p<0.001; ns, not significant (unpaired t-test).13F,13G, KL1 (40 µM) does not affect oxygen consumption rate (OCR) (13F) or extracellular acidification rate (ECAR) (13G) in extracellular S. aureus, compared to vehicle control (Veh, 0.1–0.5% DMSO). Representative data of four experiments (n = 3). Bars represent mean ± SD.13H-13J, Exponential-phase cultures were treated with KL1 (40 µM) or DMSO (0.1%) for 4 h, followed by measuring relative ATP levels. Luminescent signal was normalized to CFU. S. aureus HG003 (13H), JE2 (13I) and LAC (13J) were examined (n≥3). 13K, Pre-treatment of JE2-lux with 40 µM KL1 before macrophage infection did not enhance antibiotic killing. KL1 was washed off before infection, indicating host- targeted adjuvant activity. Corresponding CFU data shown (right). Representative of three experiments (n = 3). ns, not significant (unpaired t-test).

[0034] FIGS.14A-14D. KL1 modulates the expression of host immune response genes regulating reactive oxygen and nitrogen species. Principle component analysis (14A), differential expression (14B) and String network (14C) analysis illustrate KL1-mediated transcriptional modulation in S. aureus-infected macrophages (n = 3). Host genes associated with reactive species production are indicated. Edge thickness represents the confidence in the interactions. Interactions with high confidence (interaction score >0.7) are shown.14D, Gene ontology enrichment with an adjusted p-value <0.01 is shown.

[0035] FIGS. 15A-15E. KL1 reduces reactive species in both infected and uninfected macrophages.15A, CFU data of FIG.5B. Representative data of three experiments (n = 3).15B- 15E, KL1 (40, 100 µM) and EHMT2 / G9a inhibitor, BIX-01294 (BIX; 1, 4 µM) reduced ROS / RNS levels in S. aureus-infected macrophages at 8 hours post-infection (hpi) (15B, 15D) and in uninfected macrophages (15C, 15E). L-012 (15B, 15C) and fluorescein-boronate (Fl-B) (15D,Attorney Docket No.5470.986.WO 15E) were used for detection. DMSO (Veh; 0.25%) and BHA (20 µM) served as controls. Representative data of 3–4 experiments (n = 5). *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001 (unpaired t-test). Bars represent mean ± SEM.

[0036] FIGS.16A-16F. KL1 analogs with attenuated adjuvant activity lose the ability to regulate reactive species production. 16A, Chemical structures of KL1 and analogs with modified functional groups.16B, KL1 analogs (40 µM) showed varying abilities to sensitize intracellular S. aureus to antibiotic killing. Infected cells were treated with (open circle) and without (solid circle) rifampicin (Rif; 10 µg / mL) and various analogs. Gentamicin (50 µg / mL) was added to eliminate extracellular bacteria. Relative bacterial loads (left) were normalized to the -Rif controls. Representative data of three experiments (n = 3). 16C-16F, Inactive analog KL7 (40, 100 µM) and weak analog KL2 (100 µM) showed minimal to no effect on ROS / RNS levels in infected (16C, 16D) and uninfected (16E, 16F) macrophages after 4 h (16C, 16E) and 8 h (16D, 16F) treatment. DMSO (Veh) and antioxidant BHA (20 µM) were included as controls. Reactive species were quantified using fluorescein-boronate (Fl-B). Representative of three experiments (n = 5). *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001; ns, not significant (unpaired t-test). Bars represent mean ± SEM.

[0037] FIG. 17. Compounds that most strongly reduced bacterial metabolism do not decrease intracellular persister frequencies. Of the 32 compounds that most strongly reduced bacterial metabolic activity, 31 did not reduce the burden of intracellular bacteria. UNC10104798A appeared to lower bacterial load; however, this effect was attributable to the loss of infected macrophages during the 24-hour treatment period, rather than bactericidal activity against intracellular bacteria. Rifampicin (Rif)-treated cells were included as a reference control (RIF).

[0038] FIG. 18. KL1 enhances antibiotic efficacy against intracellular MRSA. Among the top nine candidate hits, only KL1 potentiated the activity of rifampicin (Rif; 10 µg / mL) against intracellular S. aureus in RAW 264.7 macrophages. Gentamicin (Gen; 50 µg / mL) was included to eliminate extracellular bacteria. Results shown are from one experiment with two biological replicates. DETAILED DESCRIPTION

[0039] The present invention will now be described in more detail with reference to the accompanying drawings, in which preferred embodiments of the invention are shown. ThisAttorney Docket No.5470.986.WO invention may, however, be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. In addition, any references cited herein are incorporated by reference in their entireties.

[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. All publications, patent applications, patents, patent publications and other references cited herein are incorporated by reference in their entireties for the teachings relevant to the sentence and / or paragraph in which the reference is presented.

[0041] Amino acids are represented herein in the manner recommended by the IUPAC-IUB Biochemical Nomenclature Commission, or (for amino acids) by either the one-letter code, or the three-letter code, both in accordance with 37 C.F.R. §1.822 and established usage.

[0042] Except as otherwise indicated, standard methods known to those skilled in the art may be used for cloning genes, amplifying and detecting nucleic acids, and the like. Such techniques are known to those skilled in the art. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual 4th Ed. (Cold Spring Harbor, NY, 2012); Ausubel et al. Current Protocols in Molecular Biology (Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York).

[0043] Unless the context indicates otherwise, it is specifically intended that the various features of the invention described herein can be used in any combination.

[0044] Moreover, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted.

[0045] To illustrate, if the specification states that a complex comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination.

[0046] As used in the description of the invention and the appended claims, the singular forms “a,” “an,” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise.Attorney Docket No.5470.986.WO

[0047] Also as used herein, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).

[0048] The term “about,” as used herein when referring to a measurable value such as an amount of compound, antibiotic dose, time, temperature, or purity and the like, is meant to encompass variations of ± 10%, ± 5%, ± 1%, ± 0.5%, or even ± 0.1% of the specified amount.

[0049] As used herein, the transitional phrase “consisting essentially of” (and grammatical variants) is to be interpreted as encompassing the recited materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. Thus, the term “consisting essentially of” as used herein should not be interpreted as equivalent to “comprising.”

[0050] It will be understood that “substitution” or “substituted with” includes the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g., which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc. In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and nonaromatic substituents of organic compounds. The permissible substituents can be one or more and the same or different for appropriate organic compounds. For purposes of this disclosure, heteroatoms such as nitrogen may have hydrogen substituents and / or any permissible substituents of organic compounds described herein which satisfy the valences of the heteroatoms. Non-limiting examples of optional substituents as referred to herein include halogen, alkyl, arylalkyl, heteroalkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, alkoxy, amino, amido, nitro, cyano, amido, carbonyl, carboxyl, silyl, ether, alkylthio, sulfonyl, sulfonamido, ketone, aldehyde, ester, heterocyclyl, aryl, and heteroaryl. Exemplary aromatics include, but are not limited to, benzene, maleimide, succinimide, benzonitrile, aniline, pyrrole, pyridine, indole, isoquinoline, carbazole, pyrolline, pyrazine, imidazole, naphthalene, furan, and thiophene.

[0051] As used herein, the term “alkyl”, used either alone or in compound words such as “haloalkyl” includes straight-chain or branched alkyl, such as methyl, ethyl, n-propyl, i-propyl, or the different butyl, pentyl or hexyl isomers, etc.

[0052] As used herein, “unsaturated” refers to compounds or structures having at least one degree of unsaturation (e.g., at least one double or triple bond).Attorney Docket No.5470.986.WO

[0053] Substituents around a carbon-carbon double bond alternatively can be referred to as "cis" or "trans," where "cis" represents substituents on the same side of the double bond and "trans" represents substituents on opposite sides of the double bond. The arrangement of substituents around a carbocyclic ring can also be designated as "cis" or "trans." The term "cis" represents substituents on the same side of the plane of the ring, and the term "trans" represents substituents on opposite sides of the plane of the ring. Mixtures of compounds wherein the substituents are disposed on both the same and opposite sides of plane of the ring are designated "cis / trans."

[0054] All chiral, diastereomeric, racemic, and geometric isomeric forms of a structure are intended, unless specific stereochemistry or isomeric form is specifically indicated. All processes used to prepare compounds and intermediates made therein are encompassed by the present disclosure. All tautomers of shown or described compounds are also encompassed by the present disclosure.

[0055] When any variable (e.g., Ri) occurs more than one time in any constituent or formula for a compound, its definition at each occurrence is independent of its definition at every other occurrence. Thus, for example, if a group is shown to be substituted with one or more Ri moieties, then Ri at each occurrence is selected independently from the Markush group recited for Ri. Also, combinations of substituents and / or variables are permissible, but only if such combinations result in stable compounds within a designated atom’s normal valency.

[0056] Recitation of a chemical compound or structure encompasses any and all polymorphs of that chemical compound or structure unless otherwise specified.

[0057] Analogues as used herein refer to structural analogues, e.g., compounds that share similarity in chemical structure with another compound but vary in specific atoms, and functional analogues, e.g., compounds that share similar physical, chemical, or biochemical properties, such as luminescence.

[0058] Low metabolic activity in bacteria as used herein includes metabolic indolence and / or reduced growth-centered processes (e.g., reduced transcription) relative to typical bacterial activity. In some embodiments, low metabolic activity may result in antibiotic tolerance and / or persister formation. Low metabolic activity can be measured, for example, by an ATP-dependent bioluminescent reporter to probe metabolic activity of intracellular bacteria, as described further herein.Attorney Docket No.5470.986.WO

[0059] Progression of antibiotic tolerance as used herein means an increase in the number of bacteria that are resistant or tolerant to antibiotic treatment. In some embodiments, progression of antibiotic tolerance is a measure of the increase in the amount of persister bacteria, e.g., bacteria that are not sensitive to one or more antibiotics.

[0060] Antibiotic tolerant pathogen as used herein is a pathogen (e.g., bacteria) that is partially or fully resistant to antibiotic treatment. In some embodiments, antibiotic tolerant bacteria (e.g., bacterial populations or sub-populations) are capable of surviving a bactericidal concentration of antibiotics for a period of time. In some embodiments, the antibiotic tolerant pathogen can survive for extended periods of time and may lack resistance mutations.

[0061] “Pharmaceutically acceptable carrier” (sometimes referred to as a “carrier”) refers to a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic and includes a carrier that is acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms “carrier” or “pharmaceutically acceptable carrier” can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents. As used herein, the term “carrier” encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further herein.

[0062] The term “modulate,” “modulates,” or “modulation” refers to enhancement (e.g., an increase) or inhibition (e.g., a decrease) in the specified level or activity.

[0063] The term “enhance” or “increase” refers to an increase in the specified parameter of at least about 1.25-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, twelve-fold, or even fifteen-fold and / or can be expressed in the enhancement and / or increase of a specified level and / or activity of at least about 1%, 5%, 10%, 15%, 25%, 35%, 40%, 50%, 60%, 75%, 80%, 90%, 95% or more.

[0064] “Inhibit” or “reduce” or grammatical variations thereof as used herein refers to a decrease or diminishment in the specified level or activity of at least about 1, 5, 10, 15%, 25%, 35%, 40%, 50%, 60%, 75%, 80%, 90%, 95% or more. In particular embodiments, the inhibition or reduction results in little or essentially no detectible activity (at most, an insignificant amount, e.g., less than about 10% or even 5%).Attorney Docket No.5470.986.WO

[0065] The term “contact” or grammatical variations thereof as used with respect to a compound and a cell or aggregate, refers to bringing the compound and the cell or aggregate in sufficiently close proximity to each other for one to exert effect (e.g., biological) on the other.

[0066] A “subject” may be any vertebrate organism in various embodiments. A subject may be individual to whom an agent is administered, e.g., for experimental, diagnostic, and / or therapeutic purposes or from whom a sample is obtained or on whom a procedure is performed. In some embodiments a subject is a mammal, e.g., a human, non-human primate, lagomorph (e.g., rabbit), or rodent (e.g., mouse, rat). In some embodiments a human subject is a neonate, child, adult or geriatric subject. In some embodiments a human subject is at least 50, 60, 70, 80, or 90 years old.

[0067] Grammatical variations of “administer,” “administration,” and “administering” to a subject include any route of introducing or delivering to a subject an agent. Administration can be carried out by any suitable route, including oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted reservoir, parenteral (e.g., subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intraperitoneal, intrahepatic, intralesional, and intracranial injections or infusion techniques), and the like. “Concurrent administration,” “administration in combination,” “simultaneous administration,” or “administered simultaneously” as used herein, means that the compounds are administered at the same point in time, overlapping in time, or one following the other. In the latter case, the two compounds are administered at times sufficiently close that the results observed are indistinguishable from those achieved when the compounds are administered at the same point in time. “Systemic administration” refers to the introducing or delivering to a subject an agent via a route which introduces or delivers the agent to extensive areas of the subject’s body (e.g., greater than 50% of the body), for example through entrance into the circulatory or lymph systems. By contrast, “local administration” refers to the introducing or delivery to a subject an agent via a route which introduces or delivers the agent to the area or area immediately adjacent to the point of administration and does not introduce the agent systemically in a therapeutically significant amount. For example, locally administered agents are easily detectable in the local vicinity of the point of administration but are undetectable or detectable at negligible amounts in distal parts of the subject's body. Administration includes self-administration and the administration by another.Attorney Docket No.5470.986.WO

[0068] In some embodiments, a compound according to formula (I) is provided: O R R53N wherein R1is a C1-C8alkyl, C(=O) C6haloalkoxy, C3-C7cycloalkyl or amino; R2is CH, NH, or C-CN; R3 each independently unsubstituted or substituted aryl or heteroaryl; and O HN N R6and R7are independently H or C1-C8alkyl, wherein the compound is (KL1).

[0069] In some embodiments in formula (I), R4and R5are each independently pyridine, or a phenyl substituted at one or more positions with a C1-C8alkyl, C1-C6haloalkyl, C1-C6alkoxy, C1- C6haloalkoxy, C3-C7cycloalkyl, C1-C8hydroxyalkyl, C3-C18aromatic, C3-C18heteroaromatic, C3- C8heterocyclic, or halide. H N R6

[0070] In some embodiments in formula (I), R1isO, C1-C6alkoxy, C1-C6haloalkoxy, C3-C7cycloalkyl, or a C1-C8alkyl, wherein R8 is a C1-C8alkyl.

[0071] In some embodiments, the compound is selected from the group consisting ofAttorney Docket No.5470.986.WO .

[0072] In some embodiments, a method of sensitizing an antibiotic tolerant pathogen in a subject is provided, comprising administering to the subject a therapeutically effective amount of a compound or pharmaceutically acceptable salt thereof, wherein the pathogen is sensitized to an antibiotic. In some embodiments, the method comprises administering to the subject a therapeutically effective amount of a compound according to formula I: O R5wherein R1is a C1-C8alkyl, C(=O) C6haloalkoxy, C3-C7cycloalkyl oramino; R2is CH, NH, or C-CN; R3is N or NH; and R4and R5are each independently a heteroaryl or unsubstituted or substituted aryl; and R6and R7are independently H or C1-C8alkyl; or a pharmaceutically acceptable salt thereof. In some embodiments, sensitizing an antibiotic tolerant pathogen improves sensitization of the antibiotic tolerant pathogen such that the pathogen can be treated by an antibiotic. In an example embodiment, treating the sensitized antibiotic tolerant pathogen with an antibiotic reduces the amount of pathogen in the subject by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or more, or any range therein. In some embodiments, administration of the compound of the disclosure sensitizes intracellular bacteria to antibiotic killing by reducing the production of reactive species.

[0073] In some embodiments, a method of treating a pathogen infection in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective amount of a compound of the disclosure or pharmaceutically acceptable salt thereof and an antibiotic, wherein the amount of antibiotic-tolerant persister cells is reduced. In some embodiments, the method of treating a pathogen infection comprises administering to the subject a therapeutically effective amount of a compound according to formula I:Attorney Docket No.5470.986.WO O R R53N wherein R1is a C1-C8alkyl, C(=O) C6haloalkoxy, C3-C7cycloalkyl or amino; R2is CH, NH, or C-CN; R3 R5are each independently a heteroaryl or unsubstituted or substituted aryl; and R6and R7are independently H or C1-C8alkyl; or a pharmaceutically acceptable salt thereof. In some embodiments, the amount of antibiotic- tolerant persister cells is reduced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or more, or any range therein.

[0074] In some embodiments, a method of reducing antibiotic-tolerant persister cells in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective amount of a compound of the disclosure or pharmaceutically acceptable salt thereof and an antibiotic, wherein the growth of the pathogen is reduced. In some embodiments, the method of reducing antibiotic-tolerant persister cells comprises administering to the subject a therapeutically effective amount of a compound according to formula I: O R wherein R1is a C1-C8alkyl, CC6haloalkoxy, C3-C7cycloalkyl or amino; R2is CH, NH, or C-CN; R3is N or NH; and R4and R5are each independently a heteroaryl or unsubstituted or substituted aryl; and R6and R7are independently H or C1-C8alkyl; or a pharmaceutically acceptable salt thereof. In some embodiments, the growth of the pathogen is reduced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or more, or any range therein relative to the growth of pathogen in a subject without administration of the compound.

[0075] In some embodiments, a method of reducing the production of reactive oxygen and nitrogen species in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective amount of a compound of the disclosure or pharmaceutically acceptable salt thereof and an antibiotic, wherein the production of reactive oxygen and nitrogen species in the subject is reduced. In some embodiments, the method of reducing the production of reactiveAttorney Docket No.5470.986.WO oxygen and nitrogen species comprises administering to the subject a therapeutically effective amount of a compound according to formula I: O R R53N wherein R1is a C1-C8alkyl, C(=O) C6haloalkoxy, C3-C7cycloalkyl oramino; R2is CH, NH, or C-CN; R3R5are each independently a heteroaryl or unsubstituted or substituted aryl; and R6and R7are independently H or C1-C8alkyl; or a pharmaceutically acceptable salt thereof. In some embodiments, production of reactive oxygen and nitrogen species in the subject, e.g., by antibiotic-tolerant persister cells, is reduced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or more, or any range therein antibiotic relative to the production of reactive oxygen and nitrogen species in a subject without administration of the compound.

[0076] In some embodiments, a method of preventing antibiotic tolerance in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective amount of a compound of the disclosure or pharmaceutically acceptable salt thereof, wherein the antibiotic tolerance in the subject is prevented. In some embodiments, a method of preventing antibiotic tolerance in a subject comprises administering to the subject a therapeutically effective amount of a compound according to formula I: O R wherein R1is a C1-C8alkyl, C(=O)C6haloalkoxy, C3-C7cycloalkyl or amino; R2is CH, NH, or C-CN; R3is N or NH; and R4and R5are each independently a heteroaryl or unsubstituted or substituted aryl; and R6and R7are independently H or C1-C8alkyl; or a pharmaceutically acceptable salt thereof. In some embodiments, the subject has previously had antibiotic tolerance, or is at risk of antibiotic tolerance, for example, by having multiple antibiotic-treated infections previously, or from having an infection that is at risk of antibiotic tolerance (e.g., urinary tract infection). In some embodiments, the antibiotic tolerance in the subject is prevented relative to antibiotic tolerance in the subject without administration of the compound.Attorney Docket No.5470.986.WO

[0077] In some embodiments, a method of increasing antibiotic sensitivity in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective amount of a compound of the disclosure or pharmaceutically acceptable salt thereof, wherein the antibiotic sensitivity in the subject is increased . In some embodiments, a method of increasing antibiotic sensitivity in a subject comprises administering to the subject a therapeutically effective amount of a compound according to formula I: O R R N5wherein R1is a C1-C8alkyl, C(=O) C6haloalkoxy, C3-C7cycloalkyl oramino; R2is CH, NH, or C-CN; R3or R5are each independently a heteroaryl or unsubstituted or substituted aryl; and R6and R7are independently H or C1-C8alkyl; or a pharmaceutically acceptable salt thereof. In some embodiments, antibiotic sensitivity in the subject is increased by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or more, or any range therein relative to an increase in antibiotic sensitivity in the subject without administration of the compound.

[0078] In some embodiments, a method of slowing the progression of antibiotic tolerance in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective amount of a compound of the disclosure or pharmaceutically acceptable salt thereof, wherein the progression of antibiotic tolerance in the subject is decreased. In some embodiments, the method comprises administering to the subject a therapeutically effective amount of a compound according to formula I: O wherein R1is a C1-C8alkyl, CC6haloalkoxy, C3-C7cycloalkyl or amino; R2is CH, NH, or C-CN; R3is N or NH; and R4and R5are each independently a heteroaryl or unsubstituted or substituted aryl; and R6and R7are independently H or C1-C8alkyl; or a pharmaceutically acceptable salt thereof. In some embodiments, the progression of antibiotic tolerance in the subject is decreased in the subject by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%,Attorney Docket No.5470.986.WO 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or more, or any range therein relative to the progression of antibiotic tolerance in the subject without administration of the compound.

[0079] In some embodiments, the antibiotic tolerant pathogen has low metabolic activity relative to an antibiotic sensitive pathogen. In some embodiments, the pathogen is an antibiotic tolerant bacteria. In some embodiments, the antibiotic-tolerant pathogen is selected from species of Salmonella, Mycobacterium, Staphylococcus, Klebsiella, Pseudomonas, Escherichia, Brucella, Borrelia, or Chlamydia. In some embodiments, the antibiotic-tolerant pathogen is Salmonella typhimurium, Mycobacterium tuberculosis, or Staphylococcus aureus. In some embodiments, the methods disclosed herein treat intracellular bacteria.

[0080] In some embodiments, the compound and the antibiotic are co-administered, wherein the antibiotic is administered before the compound, or wherein the compound is administered before the antibiotic. In some embodiments, the compound and the antibiotic are administered in the same composition or in separate compositions.

[0081] In some embodiments, one antibiotic is administered to the subject. In some embodiments, two or more antibiotics are administered to the subject. Administration of two of more antibiotics can be performed concurrently, or at different times and / or time intervals. The antibiotic or antibiotics used are antibiotics known to be effective for the pathogen to be treated. In some embodiments, antibiotics that can be used include, but are not limited to, rifampicin, moxifloxacin, vancomycin, teicoplanin, sulfamethoxazole, trimethoprim, linezolid, daptomycin, ceftaroline, clindamycin, doxycycline, minocycline, oritavancin, epidemicin NI01, carbapenems, and lariocidin. Topical antibiotic treatments include, but are not limited to, mupirocin, chlorhexidine gluconate, and clindamycin.

[0082] In some embodiments, the therapeutically effective amount of the compound is a dose of about 0.1 mg / kg to about 100 mg / kg once per day or twice per day, e.g., 0.1 mg / kg, 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, or any range therein. Any administration regimen well known to those skilled in the art for regulating the timing and sequence of compound delivery can be used and repeated as necessary to effect treatment in the methods of the invention. For example, the compounds may be administered 1, 2, 3, or 4 times daily, by a single dose, multiple discrete doses, or continuous infusion.Attorney Docket No.5470.986.WO

[0083] In some embodiments, administering the compound and / or the antibiotic comprises oral administration, intravenous administration, intrathecal administration, intraperitoneal administration, intra-articular administration, epidural administration, topical administration, or any combination thereof.

[0084] These and other aspects of the invention are set forth in more detail in the description below. EXAMPLES Intracellular environment is an important niche driving antibiotic-tolerant S. aureus

[0085] Antibiotic tolerance measured in test tubes is often poorly correlated with clinical outcomes, highlighting the importance of probing bacterial drug responses within the context of host–pathogen interactions24. Evidence suggests that the host intracellular environment antagonizes antimicrobial agents for obligate and facultative intracellular pathogens, including S. aureus7,9,25-27. This can be illustrated by testing clinical isolates with varying persister frequencies in tube assays versus cell-based models. We found that although two S. aureus isolates displayed a dramatic 200-fold difference in persister formation in tubes, both produced similar high-level antibiotic tolerance after internalization by bone marrow-derived macrophages (BMDMs) (FIGS. 1A,1B). Both isolates yielded more tolerant bacteria inside macrophages (26–51%) compared to their planktonic cultures (0.05–9%) (FIGS. 1A,1B). These isolates shared identical minimum inhibitory concentrations (MICs) for rifampicin (6–8 ng / mL) and other antibiotics (Table 1). These data indicate that host interaction plays a dominant role in promoting antibiotic tolerance.

[0086] As a versatile pathogen, S. aureus can adapt to multiple intracellular niches and colonize diverse mammalian cells. To track intracellular persister cells in vivo, we constructed inducible S. aureus fluorescent reporter strains and demonstrated the feasibility of using these strains to probe intracellular bacteria. Viable bacteria inside macrophages were visualized via confocal microscopy following induction with anhydrotetracycline (aTc) (FIG. 1C). To determine whether S. aureus survives antibiotic treatment inside mammalian cells, C57BL / 6J mice were infected via tail vein (i.v.) with the reporter strains and treated with 10 mg / kg rifampicin intraperitoneally (i.p.) at 1 day post-infection (dpi). Rifampicin was chosen for its ability to penetrate mammalian cells7. Kidney cells were extracted at 2 dpi, followed by aTc induction of GFP expression in the presence ofAttorney Docket No.5470.986.WO gentamicin to exclude extracellular bacteria. Using ImageStream analysis, we observed live cells harboring GFP-expressing S. aureus that survived rifampicin (FIG. 1D). Thus, the intracellular environment not only provides a physical barrier but also promotes antibiotic tolerance. These findings underscore the need to devise strategies to eradicate intracellular persisters, especially given the limited antibiotic options available for intracellular infections. A high-throughput screen identifies a compound that sensitizes intracellular S. aureus to antibiotics

[0087] Professional phagocytes, including macrophages, facilitate bacterial clearance during bloodstream infections. However, S. aureus can survive this hostile environment after engulfment by adopting a less metabolically active lifestyle17. This metabolic indolence favors antibiotic tolerance and persister formation, as most antibiotics target growth-centered processes. To address this, we developed a high-throughput platform to screen compounds that resuscitate intracellular S. aureus, aiming to sensitize the intracellular population to antibiotics (FIG. 2A). We used a bioluminescent methicillin-resistant S. aureus (MRSA) strain JE2-lux to probe intracellular bacterial metabolic activity28. Lux-based bioluminescent reporters are effective for real-time probing of bacterial energy status29-31. The lux reaction requires reducing cofactors (NAD(P)H and FMNH₂), oxygen, and ATP, thus tightly coupling it to cellular metabolism32.

[0088] To validate the reporter, we treated JE2-lux and wild-type JE2 with 0–0.5 mM sodium arsenate, which induces ATP depletion1, and measured bioluminescence and ATP levels. We observed a dose-dependent correlation between the bioluminescence signal and intracellular ATP levels (FIGS. 7A-7C). Similarly, nutrient supplementation elevated both ATP levels and bioluminescent output without affecting bacterial numbers, supporting the use of lux-based bioluminescence as a readout of metabolic activity (FIGS. 7D-7F). We then evaluated the reporter’s utility intracellularly. Rifampicin reduced the bioluminescence of intracellular bacteria, consistent with its ability to penetrate mammalian cell membranes and inhibit bacterial transcription, thereby reducing metabolic activity (FIG.2B). In contrast, vancomycin, which does not penetrate mammalian cells, had no effect. Importantly, short-term treatment with rifampicin (4 h) did not reduce intracellular bacterial viability (FIG. 7G), consistent with the notion that rifampicin first suppresses bacterial metabolism prior to killing. This observation suggests that the bioluminescence signal in this context more likely reflects bacterial metabolic activity than totalAttorney Docket No.5470.986.WO burden. While we cannot fully exclude contributions from bacterial number, we primarily used the reporter to infer bacterial metabolic activity and energy state.

[0089] Next, we incorporated a cell viability assay to monitor drug cytotoxicity. We verified that the readout reflected live mammalian cell number and was not influenced by bacterial presence (FIG. 2C). We then assessed the assay’s dynamic range by measuring bioluminescence as a function of rifampicin concentrations. The dose-response showed that 2 ng / mL rifampicin resulted in 50% reduction in bacterial activity without compromising host viability (FIG. 2D). This EC50value (2 ng / mL) aligned with the rifampicin MIC (6 ng / mL) for JE2-lux (Table 1). In comparison, vancomycin had no effect across concentrations (FIG.2E).

[0090] To identify compounds that modulate intracellular S. aureus metabolism as antibiotic adjuvants, macrophages infected with JE2-lux were harvested from gentamicin-containing media to eliminate extracellular bacteria and dispensed into 384-well plates with various compounds. Bioluminescence and host viability were measured after 4 hours. We screened >4,700 drug-like compounds that share structural similarity to kinase inhibitors (FIG. 7H). Among them, 77 compounds reduced bioluminescence below rifampicin-treated controls. This reduction may reflect lower bacterial burden or reduced metabolism. Among the 32 compounds that most strongly reduced bioluminescence, 31 did not alter persister frequencies, indicating that they likely suppressed bacterial metabolism rather than killing persisters (FIG.17). The one compound that appeared to reduce bacterial burden did so because infected macrophages were washed away after 24-hour treatment, rather than through bactericidal activity against intracellular bacteria.

[0091] Intriguingly, we identified 45 compounds that increased bioluminescence by >1.5-fold without cytotoxicity (FIG. 3A). The top hit, KL1 (PubChem CID: 2881454), consistently increased the bioluminescence of intracellular S. aureus (FIG.7I). This was not due to host cells, gentamicin-killed extracellular bacteria, or KL1 itself (FIGS.7I, 7J). Co-administering KL1 with rifampicin and moxifloxacin enhanced killing of intracellular MRSA by up to 10-fold (FIG. 3B and FIG. 7K). Notably, while increasing bacterial metabolism could risk promoting bacterial growth when antibiotic levels fall below inhibitory concentrations, KL1 alone did not induce outgrowth, supporting its potential as a safe therapeutic adjuvant. Compounds ranked 2–9 at 10 µM did not exhibit adjuvant activity, suggesting they did not sufficiently enhance metabolic activity to enable sensitization (FIG.18).Attorney Docket No.5470.986.WO

[0092] To confirm reliability, we repeated the experiments using KL1 from two independent suppliers and one in-house synthesis. In all cases, KL1 increased S. aureus metabolic activity and rifampicin efficacy (FIGS. 8A-8C). This enhanced killing was observed across lab strains and clinical isolates, and it was proportional to KL1 concentration (FIG.9). KL1 also synergized with rifampicin even when infected macrophages were pretreated with antibiotics, suggesting that low- energy persisters may be resuscitated and sensitized (FIG.9C).

[0093] We next conducted the same experiments using THP-1 cells, a human monocyte-derived macrophage model and showed that KL1 similarly enhanced antibiotic killing in human macrophages (FIGS. 3D, 3E and FIGS. 10B, 10C). Additionally, we extended the analysis to human primary neutrophils. Importantly, KL1 sensitized S. aureus to both moxifloxacin and rifampicin plus gentamicin killing in neutrophils from healthy donors (FIGS.10C-10E). Together, we demonstrated the feasibility of pharmacologically sensitizing the intracellular S. aureus persisters to antibiotics and confirmed that screening these sensitizers using our newly established semi-automated high-throughput platform is viable. Compound KL1 exhibits adjuvant activity in a mouse model for S. aureus sepsis

[0094] We next evaluated KL1’s in vivo efficacy using a S. aureus bacteremia model7. Briefly, C57BL / 6J mice were intravenously injected with S. aureus to induce a systemic infection. At 6 hours post-infection (hpi), mice were administered 10 mg / kg rifampicin once daily, either alone or in combination with 100 mg / kg KL1 twice daily, via intraperitoneal injections (FIG.4A). After a 48-hour treatment regimen, livers and spleens were harvested, and the tissue homogenates were plated to quantify bacterial burden. Our data showed that combined administration of KL1 and rifampicin further reduced the bacterial burden in both organs compared to rifampicin alone (FIGS. 4B, 4C). This experiment was repeated on separate days with male and female mice from different litters, in which each group consisting of 6 to 8 mice, to ensure reproducibility (n = 14 per group). Notably, we previously showed that administering Tempol (a potent ROS scavenger) or genetically deleting Ncf1 (which impairs the respiratory burst) led to bacterial outgrowth in mice7. Similarly, macrophage depletion via clodronate liposomes caused S. aureus outgrowth in a related model17. Here, we found that KL1 alone did not induce bacterial outgrowth in the liver, spleen or kidneys, indicating it did not compromise host immune control over the infection (FIG.11).

[0095] To further examine whether KL1 improves treatment outcomes, we established a murine survival assay. Mice were infected with a higher inoculum of MRSA JE2 and treated withAttorney Docket No.5470.986.WO rifampicin (1 mg / kg) with or without KL1 (100 mg / kg, two doses). Mice were monitored daily and euthanized upon reaching a humane endpoint or at the conclusion of the study. Interestingly, co-administration of KL1 improved survival rates by two-fold (p<0.05, n>12 across two experiments), suggesting potential therapeutic activity (FIG.4D). KL1 retains adjuvant activity in Salmonella and Mycobacterium infection models

[0096] Since KL1 may or may not directly target the bacteria and may instead modulate host– pathogen interactions, we explored whether KL1 also affects other intracellular pathogens. We opted to investigate S. typhimurium and M. tuberculosis because they also survive and form antibiotic-tolerant persister cells within macrophages10,12,33. Strikingly, KL1 enhanced antibiotic- mediated killing of both pathogens in macrophages (FIGS. 4E-4G and FIGS. 12A-12C). In a murine Salmonella infection model34, we observed a small but significant reduction in bacterial burden in Peyer's patches at both day 2 and day 6 post-treatment when antibiotics were combined with KL1 (FIGS. 12D-12H). These data suggest KL1 may act as a broad-spectrum antibiotic adjuvant against intracellular bacteria. KL1 does not directly act on S. aureus

[0097] Since KL1’s synergy likely depends on metabolism, we tested a mutant MRSA strain lacking all four glucose transporters (ΔG4) to determine whether central metabolism was required35. KL1’s adjuvant activity was substantially attenuated in the absence of glucose uptake (FIG.13A), supporting the idea that KL1 enhances antibiotic efficacy by stimulating intracellular bacterial metabolism. To deconvolute KL1’s mechanism, we interrogated whether KL1 affected extracellular S. aureus in planktonic cultures. In actively growing bacteria (mid-exponential phase), KL1 did not consistently increase metabolic activity (FIG.13B). Treatment with KL1 did not alter bacterial growth, nor did it alter growth or affect persister frequency after rifampicin treatment (FIG. 13C). Likewise, KL1 did not affect metabolic activity or growth of stationary-phase bacteria, with or without antibiotics (FIG.13D, 13E).

[0098] We subsequently employed Seahorse analysis to investigate whether KL1 altered metabolic activity of extracellular S. aureus. Our data clearly showed that KL1 had no effect on oxygen consumption rate (OCR) or extracellular acidification rate (ECAR) (FIGS. 13F, 13G). Additionally, relative ATP levels were unchanged across multiple S. aureus strains (FIGS.13H- 13J). Furthermore, pre-treatment of S. aureus with KL1, followed by washing prior to macrophageAttorney Docket No.5470.986.WO infection, did not enhance antibiotic-mediated killing (FIG.13K). Collectively, our data strongly suggest KL1 does not act on bacteria but instead perturbs the intracellular environment to alter host–pathogen interaction. KL1 modulates the host cells and reduces the level of reactive species

[0099] To elucidate KL1’s mode of action, we profiled transcriptomic changes in S. aureus- infected macrophages following KL1 treatment using bulk RNA-sequencing. Compared with vehicle control, KL1 treatment led to up-regulation of 24 genes and down-regulation of 90 host genes (FIG. 14). These changes predominantly affected pathways involved in inflammatory responses, cytokine production and macrophage activation. However, KL1 did not appear to obliterate the immune response, and KL1 treatment alone did not cause bacterial outgrowth in either cell-based or murine infection models. Intriguingly, multiple host genes involved in regulating reactive oxygen and nitrogen species (ROS / RNS) were differentially expressed (FIGS. 14B, 14C). Key genes promoting ROS / RNS production–Thbs1, S100a8, and Nos2–were significantly down-regulated, while the glutathione S-transferase gene Gsta2, involved in cellular anti-oxidative defense, was up-regulated36,37. As such, KL1 may alleviate oxidative and nitrosative stress in the intracellular niche, aligning with previous findings that ROS / RNS contribute to antibiotic tolerance and persister formation in S. aureus and other bacteria7,8,10-13,38.

[0100] Although KL1’s mechanism is not fully characterized, this compound has been tested in hundreds of biological screens (PubChem CID: 2881454)39. KL1 showed activity in five assays targeting four proteins (Table 2). EHMT2 / G9a stood out as a potential target: it is an epigenetic regulator expressed in immune cells, including macrophages, and its previously determined EC50(PubChem AID: 504332) matches the effect range (10–100 µM) seen in our study39. Intriguingly, EHMT2 / G9a regulates intracellular innate immunity and macrophage polarization by modulating inflammatory genes such as Il6 and Il1b, and also influences NF-κB and JAK / STAT signaling40-44. This downstream regulatory profile resembles the transcriptional shift induced by KL1 (FIG. 14). To explore EHMT2 / G9a’s role, we examined whether its inhibition would affect the antibiotic susceptibility of intracellular S. aureus. Intriguingly, treatment with the selective EHMT2 inhibitor BIX-01294 elevated bacterial metabolic activity and enhanced rifampicin efficacy in a dose- dependent manner, phenocopying KL1’s activity (FIGS.5A, 5B and FIG.15A).

[0101] Given EHMT2 / G9a’s role in inflammatory regulation and KL1’s impact on ROS / RNS- related gene expression, we hypothesized that KL1 facilitates antibiotic killing by reducingAttorney Docket No.5470.986.WO ROS / RNS production. To test this, we used two detection methods: the chemiluminescent probe L-012 and the fluorescent probe fluorescein-boronate (Fl-B)8,45. Both probes consistently showed that KL1 at 40 and 100 µM significantly reduced ROS / RNS levels in S. aureus-infected macrophages at 4 and 8 hours post-treatment (FIGS.5C, 5D and FIGS.15B, 15D). Notably, BIX- 01294 and the antioxidant control BHA similarly decreased ROS / RNS levels. KL1 also reduced ROS / RNS in uninfected macrophages, highlighting its ability to modulate the host environment (FIGS.15C, 15E). Inactive analog of KL1 loses the ability to modulate reactive species

[0102] To gain medicinal chemistry insight, we conducted a structure–activity relationship study using six KL1 analogs (FIG. 16A). The substitution of carboxamide at the alkyl terminal (KL2, KL4 and KL5) or removal of the nitrile group from the dihydropyridine ring (KL6) moderately reduced their adjuvant activity (FIG. 10B). The hexyl substitution on sulfur (KL3) resulted in a high cytotoxicity against host macrophages, indicating a poor therapeutic index. Notably, the 1,4- dihydropyridine ring oxidized analog (KL7) completely lost the adjuvant activity, presumably due to altered electronic structure, reduced conformational flexibility, or lost hydrogen bonding capacity (FIG. 16B). Importantly, KL7 also failed to reduce ROS / RNS in both infected and uninfected macrophages (FIGS. 16C-16F). Altogether, these results strongly support the hypothesis that KL1 enhances intracellular antibiotic efficacy by reducing oxidative and / or nitrosative stress in the host cell. Discussion

[0103] The ability of bacterial populations or sub-populations of persister cells to survive high concentrations of bactericidal antibiotics for extended periods, despite lacking resistance mutations, is likely a major factor contributing to treatment failure2,22,24,46-49. Approximately 20– 30% of patients with S. aureus bacteremia fail to clear the infection despite receiving appropriate antibiotic therapy50-52. The weak correlation between in vitro antimicrobial susceptibility and clinical outcomes highlights the importance of considering the physiological context when addressing the poor antibiotic efficacy24.

[0104] Devising novel strategies to target antibiotic-tolerant persister cells has drawn increasing attention6,53-57. Conceptually, eradication of persisters can be achieved either by directly targeting them or by reverting them to a metabolically active state, thereby making them vulnerable to antibiotics. The intracellular environment is a well-established reservoir for persister cells7-11. InAttorney Docket No.5470.986.WO this study, we demonstrated the potential of modulating the host microenvironment to sensitize intracellular persisters to antibiotics and improve treatment outcomes. Although different stress stimuli can induce antibiotic-tolerant persisters, most produce a metabolically indolent state that can withstand antibiotics. We therefore employed an ATP-dependent bioluminescent reporter to probe metabolic activity of intracellular bacteria as part of a phenotypic screen. When combined with host cell viability and CFU determination, this platform allowed us to identify molecules that stimulate intracellular bacterial metabolism without compromising host viability or expanding the pathogen. Given that the low-energy, low-metabolic activity state is central to antibiotic tolerance in multiple species, this screening may be adapted for other intracellular pathogens across various host cell types and will be agnostic to the mechanism responsible for tolerance58-61. Notably, our lead compound KL1 reduced ROS / RNS production in macrophages, sensitized intracellular persisters to antibiotics, and enhanced antibiotic efficacy in murine infection models. This adjuvant activity was observed across three clinically important pathogens in three laboratories. Transcriptomic analysis supports a mechanism involving altered inflammatory responses and reduced ROS / RNS. These observations align with a previous biochemical screen in which KL1 inhibited EHMT2 / G9a, which epigenetically regulates diverse processes, including macrophage polarization40-44. Inhibiting EHMT2 / G9a mirrored KL1’s effect and sensitized intracellular S. aureus, suggesting that EHMT2 / G9a may be KL1’s primary target (FIG.6). Whether KL1 directly binds to and inhibits EHMT2 / G9a remains to be determined.

[0105] In addition to demonstrating KL1’s activity in THP-1-derived human macrophages and primary human neutrophils, we further examined whether macrophages derived from human PBMCs could recapitulate the response. We tested polarized and non-polarized macrophages, under stimulated and unstimulated conditions, using various differentiation protocols and treatment regimens. However, none produced consistent results (FIGS. 10F-10K). Notably, current evidence strongly supports that human macrophages generate nitric oxide and reactive species in vivo62. However, it is notoriously difficult to recapitulate these levels ex vivo, likely due to the prolonged differentiation process or absence of physiological stimuli. This apparent loss of reactive species production ex vivo is further supported by our observation that the antioxidant butylated hydroxyanisole (BHA), used as a positive control, did not enhance antibiotic killing in these conditions (FIGS.10F-10K).Attorney Docket No.5470.986.WO

[0106] Together, these findings support that: 1) Targeting host pathways can render intracellular persisters more susceptible to antibiotics; 2) ROS / RNS are key drivers of antibiotic tolerance in vivo; 3) Inhibiting ROS / RNS production can sensitize persisters across bacterial species; and 4) Sensitizing intracellular persisters improves antibiotic efficacy against active infections. This work underscores the potential of host-directed therapeutics, in conjunction with antibiotics, to improve treatment outcomes. Continued development of our screening platform promises identification of additional host-targeted drugs that sensitize intracellular persisters. Ongoing studies on KL1’s mechanism, along with medicinal chemistry optimization and in vivo testing in combination with diverse antibiotics against multiple pathogens, will be critical to determine the full therapeutic potential of this host-directed adjuvant in eradicating deep-seated infections. Materials and methods General materials

[0107] Antibiotics including rifampicin (Rif), moxifloxacin hydrochloride (Mox), gentamicin sulfate (Gen) were purchased from Fisher Scientific with >95% purity. Vancomycin hydrochloride (Van) (>99% purity) was purchased from Alfa Aesar. Compound KL1 was obtained from multiple sources (ChemBridge Corporation, Enamine and synthesized in-house (Supplementary Information)) with >90% purity to validate the fidelity of this compound. Analogs KL2–6 were purchased from ChemDiv, ChemBridge Corporation and Vitas M Chemical Limited (>90% purity). Analog KL7 was synthesized in-house with >90% purity (Supplementary Information). The EHMT2 / G9a inhibitor, BIX-01294 (>98% purity), was purchased from MedChemExpress. RAW 264.7 macrophages (TIB-71) and THP-1 (TIB-202) monocytes were obtained from ATCC and distributed by the Tissue Culture Facility at the University of North Carolina at Chapel Hill. RAW 264.7 cells were maintained in complete DMEM (Dulbecco’s Modified Eagle Medium (Gibco) supplemented with 10% (vol / vol) heat-inactivated fetal bovine serum (FBS) (Avantor Seradigm, premium grade), 2 mM L-glutamine (Gibco), 1x non-essential amino acids solution (Gibco) and 1 mM sodium pyruvate (Gibco)) below 18 passages without reaching more than 90% confluency. THP-1 monocytes were maintained in RPMI 1640 (Gibco) supplemented with 10% FBS, 2 mM L-glutamine and 50 µM 2-mercaptoethanol (Gibco). Bone marrow-derived macrophages (BMDMs) were isolated from C57BL / 6J mice (The Jackson Laboratory; strain number 000664) and cultivated in complete DMEM as previously described63. ImmortalizedAttorney Docket No.5470.986.WO BMDMs were generated using a CRE-J2 retroviral infection method64. Briefly, C57BL / 6J mouse- derived BMDMs were cultured in 50% (vol / vol) L929 fibroblast-conditioned medium and infected with CRE-J2 retrovirus on day 5 and day 7. Transduced cells were continuously cultured in the conditioned medium, with the concentration gradually reduced to 20% conditioned medium. The immortalized BMDMs were maintained in RPMI 1640 supplemented with 2 mM L-glutamine, 1x Penicillin-Streptomycin (GenClone), 10% (vol / vol) heat-inactivated FBS (R&D Systems) and 20% conditioned medium. Bacterial strains and growth conditions

[0108] S. aureus strains LAC (USA300), HG003 (USA300), MW2 (USA400), JE2 (USA300), JE2-lux (JE2luxABDCE) (kindly provided by Roger Plaut, Center for Biologics Evaluation and Research, Silver Spring, United States)28, ΔG4 (kindly provided by Anthony Richardson, University of Pittsburgh, Pittsburgh, United States)35and the S. aureus bacteremia isolates8were routinely cultured in tryptic soy broth (TSB) (Fisher Scientific) or Mueller–Hinton broth (MHB) (Oxoid) at 37 °C and 225 rpm unless otherwise stated. The clinical isolates were obtained under an IRB exemption from a preexisting collection. Salmonella enterica serovar Typhimurium strain 14028S was cultured in LB broth (Lennox) at 37 °C with shaking. Mycobacterium tuberculosis strains from the globally prevalent lineages 2 (N0155) and 4 (N1283), selected from a global collection of representative strains65, were grown in Middlebrook 7H9 broth (BD Difco) supplemented with 10% (vol / vol) oleic albumin dextrose catalase (OADC), 0.2% (vol / vol) glycerol, 0.05% Tyloxapol (wt / vol) and 0.1 mM sodium propionate (ThermoFisher Scientific) to an OD600value of 0.6. Sodium propionate (0.1 mM) was added to prevent loss of phthiocerol dimycocerosate (PDIM)66. Minimum inhibitory concentration assay

[0109] Stationary-phase bacterial cultures were diluted at 1:1,000 in MHB containing serially diluted Rif (0–200 µg / mL), Mox (0–20 µg / mL) or Van (0–16 µg / mL) in 96-well assay plates (Corning) in triplicates (200 µL / well). Plates were sealed with Breathe-EASIER membranes (Diversified Biotech) and incubated statically at 37 °C for 24 h. The minimum inhibitory concentrations (MICs) were determined by the absence of bacterial growth. Three independent assays were performed to ensure the reproducibility. Construction of the inducible reporter strainsAttorney Docket No.5470.986.WO

[0110] The plasmid pALC2084 containing a tetracycline (Tet)-inducible GFP-expressing cassette67(kindly provided by Ambrose Cheung, Dartmouth College, Hanover, United States) was transformed into a S. aureus intermediate strain RN4220 using a Gene Pulser Xcell electroporation system (Bio-Rad) as previously described68. The plasmid was subsequently purified and transformed into the recipient S. aureus strain HG003. Single colonies were isolated and cultured in TSB containing 10 µg / mL Cam and 0–2 µM anhydrotetracycline hydrochloride (aTc) (Sigma) for 2–3 h. The induction of GFP expression was verified at an excitation and emission wavelength of 475 nm and 508 nm using a Synergy H1 microplate reader (BioTek). To construct the mKate reporter plasmid, the DNA fragment of mKate2 was amplified from pRN10 (Addgene plasmid: 84454)69using a specific primer pair (Supplementary table 3) and Q5 High-Fidelity DNA Polymerase (New England Biolabs). The PCR product was purified using a MinElute Reaction Cleanup kit (Qiagen). A Tet-inducible expression vector pRMC2 (Addgene plasmid: 68940)70and the mKate DNA fragments were subjected to KpnI-HF and EcoRI-HF (New England Biolabs) enzymatic digestion and agarose gel electrophoresis. The DNA fragments were gel purified using a QIAquick PCR purification kit (Qiagen) and underwent ligation with T4 DNA ligase (New England Biolabs) at 16 °C for 16 h. The ligation product was transformed into MAX Efficiency DH5α competent cells (ThermoFisher Scientific) according to the manufacturer’s instruction. Site- directed mutagenesis was performed using a QuikChange kit (Agilent Technologies) and a primer pair (Supplementary table 3) to incorporate an upstream ribosomal binding site. The final pRMC2- mKate construct was verified by restriction digest mapping and Sanger sequencing. The plasmid pRMC2-mKate was transformed into strain RN4220, followed by the recipient strain HG003 as described above. The aTc-induced mKate expression was confirmed by measuring at 633 nm with excitation at 588 nm using a Synergy H1 microplate reader. Live cell microscopy

[0111] RAW 264.7 macrophages were seeded in a Nunc 8-well Lab-Tek chambered coverglass (ThermoFisher Scientific) (500 µL of 2–3x105cells per well) in complete MEM (Minimum Essential Medium (Gibco) supplemented with 10% (vol / vol) heat-inactivated fetal bovine serum and 2 mM L-glutamine) at 37 °C and 5% CO2for 16 h. Cells were infected with the Tet-inducible GFP- or mKate-expressing S. aureus strains at an MOI of 20 (without Rif) or 100 (with Rif) by centrifugation at 1,000 g for 2 min and incubating at 37 °C for 35 min. Cells were washed once in 500 µL complete MEM and treated with and without 10 µg / mL Rif in the presence of 50 µg / mLAttorney Docket No.5470.986.WO Gen at 37 °C for 1.5 h (without Rif) and 4 h (with Rif). Rif-treated cells were washed three times with 500 µL complete MEM and incubated in the medium containing 50 µg / mL Gen at 37 °C for 2–3 h to allow for resuscitation of the intracellular S. aureus persisters. Infected cells were then treated with 2 µM aTc in the presence of 50 µg / mL Gen at 37 °C for 3 h to induce GFP and mKate expression. Macrophages harboring GFP-expressing S. aureus were imaged using a Leica SP8X Falcon (Leica Microsystems) with the following settings: (1) a tunable white light laser (WLL2) set to 484 nm was used for excitation with fluorescence detection at 495–570 nm and a detector gain of 100 V; (2) a 1024 X 1024 pixel scan at 16-bit with a scanning speed set to 600 was applied; (3) the pixel averaging was set to 2; (4) the pinhole size was set to 1 AU; (5) single images were obtained using a 63x oil-immersion objective lens (Plan-Apochromat, NA 1.4) with an 1 to 4-fold zoom. Macrophages infected with mKate-expressing S. aureus were stained with 100–300 nM LysoTracker Green DND-26 (ThermoFisher Scientific) at 37 °C for 30 min. The dye-loaded cells were washed once and kept in 200 µL complete MEM containing 1 µg / mL Hoechst 33342, 50 µg / mL Gen and 2 µM aTc. The z-stack acquisition and time-lapse live imaging were carried out using an Olympus FV3000RS confocal microscope (Olympus Life Science) equipped with a stage- top incubator at 37 °C, 5% CO2and 100% humidity. The microscope settings were as follows: (1) 405-nm (Hoechst 33342), 488-nm (LysoTracker Green) and 594-nm (mKate) diode lasers were used for excitation with highly sensitive fluorescence spectral GaAsP detectors; (2) a 516 X 516 pixel scan was applied; (3) the pixel averaging was set to 10; (4) the pinhole size was set to 1 AU; (5) single images were obtained using a 60x oil-immersion objective lens (Super Correction, NA 1.4). All confocal images were exported as the default with no gamma correction by ImageJ / FIJI71. ImageStream analysis

[0112] Cell suspensions were loaded into an Amnis ImageStreamX Mark II (EMD Millipore) for single-cell imaging and fluorescence detection. For capturing live cells harboring viable GFP- expressing S. aureus, 405-nm and 488-nm colinear lasers were set to 40 mW and 70–90 mW for live / dead cell discrimination and GFP expression, respectively. In-focus single-cell images were acquired with a 60X magnification and a low-speed flow rate using the INSPIRE software (EMD Millipore). The exported data were analyzed using IDEAS 6.2 software (EMD Millipore). High-throughput screen for intracellular S. aureus energy modulators

[0113] RAW 264.7 macrophages were seeded in 4 mL complete MEM in Costar 6-well tissue culture-treated plates (Corning) (8x105cells / well) at 37 °C and 5% CO2for 16 h. Cells wereAttorney Docket No.5470.986.WO infected with S. aureus strain JE2-Lux at an MOI of 100 at 37 °C for 25 min. The infected macrophages were washed once with 2 mL PBS and incubated with 10 mM EDTA in PBS (2 mL / well) at 37 °C for 5–10 min. After dissociation, cells were pelleted at 300 g for 6 min, resuspended in complete MEM containing 50 µg / mL Gen at a density of 2.5x105cells / mL and dispensed 80 µL of the cell suspension into each well of 384-well tissue culture-treated white plates and optically clear polymer bottom black plates (ThermoFisher Scientific) for luminescence and fluorescence detections, respectively. Uninfected macrophages were also added to column 1 and 24 of each plates as controls for the luminescence background and the baseline of host cell viability. The plates were preloaded with 80 nL of 10 mM compounds using a Mosquito LV multichannel pipetting system (SPT Labtech, Covina). Vehicle control (0.1% DMSO) and 10 µg / mL Rif were included in each experiment for quality control and data normalization. After cell dispensing, the plates were centrifuged at 500 g for 2 min and incubated in a humidified chamber at 37 °C and 5% CO2for 4 h. The luminescence signals were measured at an 1.25-mm depth with a detector gain of 250 at 37 °C using a Synergy H1 microplate reader. To monitor the cell viabilities after compound treatment, 10 µL CellTiter-Fluor reagent (Promega) were added to the black plates and incubated in the dark at 37 °C and 5% CO2for 30 min. The fluorescence intensities were measured at a 7-mm depth with a detector gain of 100 at 37 °C. The kinase-targeted compound library containing >4,700 rule of five-compliant compounds were part of the chemical collection at the Center for Integrative Chemical Biology and Drug Discovery (CICBDD) at the University of North Carolina at Chapel Hill (Supplementary table 4). The luminescence and fluorescence signals were normalized to the corresponding vehicle controls (0.1% DMSO). EC50values of Van and Rif for the intracellular MRSA strain JE2-Lux were determined by fitting the luminescence data to a standard dose response equation (GraphPad Prism). The screen was performed once to identify candidate compounds for subsequent validation. Antibiotic survival assays

[0114] For S. aureus planktonic cultures, 16- to 18-h stationary cultures were diluted at 1:100 in MHB and incubated at 37 °C and 225 rpm for 3 h to reach the mid-exponential phase. The bacterial cultures were then treated with 10 µg / mL Rif and / or 0–40 µM KL1 at 37 °C and 225 rpm for 24 h. The bacteria were washed in one volume of sterile 1% NaCl three times at 20,000 g for 5 min, followed by resuspending in one volume of 1% NaCl. The bacterial suspensions were 10-fold serially diluted and plated on tryptic soy agar (TSA) to enumerate the number of survivor S. aureus.Attorney Docket No.5470.986.WO The frequencies of tolerant bacteria were calculated by normalizing the number of surviving bacteria to the number of input bacteria.

[0115] To assess the intracellular S. aureus persister frequencies, RAW 264.7 macrophages or BMDMs were seeded in Costar 24-well tissue culture-treated plates (Corning) (500 µL of 4x105cells per well) in complete MEM at 37 °C and 5% CO2for 16 h. For THP-1-derived human macrophages, THP-1 cells were seeded in 24-well tissue culture-treated plates at 2x105cells per well in 500 µL of complete RPMI 1640 medium containing 100 nM phorbol 12-myristate 13- acetate (PMA) (Cayman) and differentiated for 3 days. Differentiated cells were then rested in complete RPMI 1640 medium without PMA for 16 h prior to infection. Macrophages were infected with S. aureus strains at a multiplicity of infection (MOI) of 10–20 by centrifugation at 1,000 g for 2 min, followed by incubation at 37 °C for 35 min. After removal of the spent medium, infected cells were incubated in 500 µL complete MEM containing antibiotics (10 µg / mL Rif, 50 µg / mL Mox or 20 µg / mL Van) in the presence or absence of 0–100 µM KL1 and its analogs (KL2–7), 20 µM butylated hydroxyanisole (BHA) (Sigma) or 0–10 µM BIX-01294 in the presence of 50– 100 µg / mL Gen at 37 °C and 5% CO2for 6–24 h. The cells were washed three times in 1 mL PBS and lysed with 200 µL 0.5% (vol / vol) Triton X-100 (Fisher Scientific) at 37 °C for 5 min, followed by the addition of 800 µL PBS. The released intracellular S. aureus were 10-fold serially diluted and plated on TSA for enumeration. For the persister frequencies, the number of surviving bacteria was normalized to the corresponding number of intracellular bacteria at the time of antibiotic addition. For comparison between different treatment groups, the intracellular S. aureus loads were normalized against the untreated controls at the endpoint (24-h post-treatment).

[0116] For Salmonella infections, immortalized BMDMs were seeded in 12-well tissue culture- treated plates (4x105cells per well) in RPMI 1640 supplemented with 2 mM L-glutamine and 10% (vol / vol) heat-inactivated FBS at 37 °C and 5% CO2for 24 h. The stationary-phase bacteria were opsonized with 8% (vol / vol) mouse serum in the RPMI 1640 medium for 20 min and applied to the immortalized BMDMs at an MOI of 15 as previously described26. The plates were centrifuged at 110 g for 5 min and incubated at 37 °C and 5% CO2for 30 min. Cells were washed once with PBS and incubated in RPMI 1640 medium containing 5 µg / mL ciprofloxacin hydrochloride (MP Biomedicals) in the presence of 10–80 µM KL1 or 0.2% DMSO at 37 °C and 5% CO2for 24 h. The cells were washed three times in 500 µL PBS and lysed with 0.2% (vol / vol) Triton X-100 at 37 °C for 10 min. The extracted intracellular S. Typhimurium were plated on LB agar to determineAttorney Docket No.5470.986.WO the number of survivor bacteria. The persister frequencies were calculated by normalizing the final CFUs (T24) to the input CFUs (T0).

[0117] For Mycobacterium tuberculosis, bacterial cells were washed twice with PBS, resuspended in complete DMEM, and passed through a 5-µm filter to remove clumps72. BMDMs were infected at an MOI of 1 for 4 h, followed by three washes with PBS and treatment with 200 µg / mL Gen at 37 °C and 5% CO2for 2 h to eliminate extracellular bacteria. Cells were incubated in medium containing 0.1% DMSO, 1 µg / mL Rif, 100 µM KL1, or a combination of Rif and KL1 in the presence of 20 µg / mL Gen in triplicate at 37 °C and 5% CO2for three days. Cells were washed three times with PBS, lysed with 200 µL of 0.1% Triton X-100 at 37 °C for 5 min. The extracted intracellular bacteria were plated on Middlebrook 7H10 agar plates (BD Difco). The number of viable bacteria was enumerated after 21 days of incubation at 37 °C and 5% CO2. Assessment of adjuvant activity in primary human neutrophils

[0118] Blood samples were collected from healthy donors and processed immediately according to a standard protocol73. Briefly, whole blood was mixed 1:1 with a 3% dextran T-500 (Pharmacosmos) / 0.9% NaCl solution and incubated at room temperature for 20 min to sediment erythrocytes. The leukocyte-rich supernatants were transferred to 50-mL tubes and centrifuged at 250 g for 10 min at 4 °C. The pellets were resuspended in 0.9% NaCl equal to the starting blood volume. Cytiva Ficoll-Paque Plus media (Fisher Scientific) was carefully underlaid (10 mL per tube) beneath the cell suspension, followed by centrifugation at 400 g for 40 min at 20 °C with no brake. The cell pellets were resuspended in 20 mL of cold 0.2% NaCl for 30 seconds, followed by the immediate addition of 20 mL of cold 1.6% NaCl to lyse the remaining erythrocytes. Neutrophils were pelleted at 250 g for 6 min and washed in RPMI 1640 supplemented with 2% FBS, 2 mM L-glutamine, and 10 mM HEPES, and centrifuged at 250 g for 4 min. Cells were resuspended in the same medium and rested at 37 °C for 0.5–1 h. Cell debris was removed by filtration through 100-μm cell strainers (VWR International) before dispending 1x105neutrophils into each well (500 µL / well) of 24-well ultra-low attachment plates (Corning). Cells were pretreated with 100 µM KL1 or 0.25% DMSO at 37 °C for 1–1.5 h in six replicates, incubated with S. aureus strain JE2-lux at an MOI of 10 at 37 °C for 1 h, followed by treatment with 50 µg / mL Mox or 10 µg / mL Rif and 25 µg / mL Gen for 4 h. Cell suspensions were then 10-fold serially diluted and plated on TSA supplemented with 0.4% activated charcoal (Sigma) toAttorney Docket No.5470.986.WO neutralize residual antibiotics, allowing enumeration of surviving bacteria. Neutrophils from at least four healthy donors were examined to ensure the reproducibility. Antibiotic survival assays in human PBMC-derived macrophages

[0119] Human peripheral blood mononuclear cells (PBMCs) were isolated from fresh blood samples using the same Ficoll-Paque density gradient centrifugation protocol employed for neutrophil isolation. After density gradient centrifugation, the interphase containing PBMCs was collected into five volumes of complete RPMI 1640 medium and centrifuged at 400 g for 10 min. Cells were then washed twice with 20 mL PBS at 300 g for 5 min and rested in complete medium at 37 °C for 30 min. Cell debris was removed by filtration through 100-μm cell strainers. For differentiation, 1–2x105PBMCs were seeded in 1 mL complete medium containing 1x Penicillin- Streptomycin and 20–50 ng / mL human GM-CSF (PeproTech) per well in 24-well tissue culture- treated plates for 4–6 days, with fresh medium changed every other day. On day 4 and 6, differentiated macrophages were polarized with and without 100 ng / mL LPS (Sigma) and 20–50 ng / mL human IFN-γ (PeproTech) for 1–2 days. For further stimulation, polarized macrophages were incubated with 500 nM PMA at 37 °C for 2–3 h, followed by three washes with RPMI 1640 medium to remove PMA and Penicillin-Streptomycin. Macrophages (polarized and non-polarized, stimulated and unstimulated) were pretreated with 40–100 µM KL1, 20 µM BHA or 0.1–0.25% DMSO in 500 µL complete medium at 37 °C for 1 h in triplicates. Macrophages were infected with S. aureus at an MOI of 10 by centrifugation at 1,000 g for 2 min, followed by incubation at 37 °C for 35 min. Cells were subsequently treated with 10 µg / mL Rif and 50–100 µg / mL Gen in the presence of KL1, BHA or DMSO, and incubated at 37 °C with 5% CO2for 6–18 h. The cells were washed three times in 1 mL PBS and lysed with 200 µL 0.5% Triton X-100 at 37 °C for 5 min, followed by the addition of 800 µL PBS. The released bacteria were serially diluted and plated on TSA for enumeration. S. aureus murine infection and isolation of kidney cells

[0120] To visualize viable intracellular S. aureus, C57BL / 6J mice (6- to 9-week-old) were systemically infected with the Tet-inducible GFP-expressing S. aureus strain HG003 (5x106CFU) via the tail vein intravenous route7. At 1 day post-infection (dpi), mice were administered with 10 mg / kg Rif in 2.5% DMSO, 12.5% polyethylene glycol (PEG300) (Sigma) and 85% sterile H2O via intraperitoneal injection. Infected mice received the vehicle (2.5% DMSO / 12.5% PEG300) were included as a control. At 2 dpi (24-h Rif treatment), dissected mouse kidneys wereAttorney Docket No.5470.986.WO homogenized in 5 mL cold PBS containing deoxyribonuclease I (50 U / mL, bovine pancreas) (ThermoFisher Scientific) using a Stomacher 80 Biomaster (Seward, USA) at fast speed for 2 min twice74. Tissue homogenates were filtered through 70-µm strainers and pelleted at 300 g for 5 min at 4 °C. After three washes in 4 mL cold PBS in 5-mL polypropylene round-bottom tubes (Corning) at 300 g for 5 min at 4 °C, cells were resuspended in cold PBS containing 1% FBS and 50 µg / mL Gen in the presence or absence of 2 µM aTc for 3 h. The cell suspensions were probed with LIVE / DEAD fixable violet dead cell stain (1 µL / 1 mL) (ThermoFisher Scientific) at 4 °C for 30 min before ImageStream analysis.

[0121] To evaluate the adjuvant activity of KL1 in vivo, C57BL / 6J mice were infected by intravenous injection with 2x107CFU of S. aureus strain HG003. At 6 hpi, mice were administered with 10 mg / kg Rif, either alone or in combination with 100 mg / kg KL1 in 7% DMSO, 40% PEG300 and 53% sterile H2O via intraperitoneal injection. Rif and KL1 were administered once a day (q.d.) and every 12 h (b.i.d.), respectively, for 2 days. After 48 h treatment, dissected mouse organs were homogenized either by repetitively rolling a serological pipette over the samples in sample bags (liver) or by bead beating using a Precellys 24 Touch (Bertin Technologies) at 5,000 rpm for 25 s twice with a 5 s interval (spleen and kidney). Tissue homogenates were 10-fold serially diluted in 1% NaCl and plated on TSA for the enumeration of survivor bacteria. The bacterial burden (CFU / g) was calculated by normalizing the number of CFU to the tissue weight. Two independent experiments using 6 to 8 mice from different litters were tested (a total of 14 mice each group).

[0122] For Kaplan-Meier survival analysis, C57BL / 6J mice were infected via intravenous injection with 2x108CFU of S. aureus strain JE2-lux. At 6 hpi, mice received an intraperitoneal injection of either 100 mg / kg KL1 or the vehicle control (7% DMSO, 40% PEG300 and 53% sterile H2O). At 12 hpi, a single dose of 1 mg / kg Rif, either alone or in combination with 100 mg / kg KL1, was administered. Mice were monitored at least twice daily for signs of disease and euthanized when they reached humane endpoints, defined as change in mobility, severe lethargy, dehydration and a loss of >20% body weight. Survival was recorded until natural death or humane euthanasia. Data from two independent experiments, each using mice from different litters, were pooled. Each group consisted of 12 to 13 mice. Statistical significance was determined using the Mantel-Cox test. Salmonella Typhimurium murine infectionAttorney Docket No.5470.986.WO

[0123] S. Typhimurium cultures were back-diluted to an OD600value of 0.1 in LB broth and grown to the exponential phase at 37 °C with shaking. Bacterial cells were washed three times with PBS prior to infection. C57BL / 6J female mice (10-week-old) were fasted for at least 4 hours and infected with 1x1010CFU in 200 µL PBS via oral gavage. At 2 dpi, mice were administered with 150 mg / kg cefotaxime (CTX), either alone or in combination with 100 mg / kg KL1 in 7% DMSO, 40% PEG300 and 53% sterile H2O via intraperitoneal injection. CTX and KL1 were administered every 12 h (b.i.d.) for 2 and 6 days. Dissected mouse organs were homogenized in PBS using a Mixer Mill MM400 (Retsch) with 3.2-mm stainless steel beads (BioSpec) at 30 Hz for 2 min. Tissue homogenates were serially diluted in PBS and plated on LB agar for the enumeration of survivor bacteria. Five mice were included in each group. Reactive species assays

[0124] The reactive oxygen and nitrogen species were measured using a luminescent probe L-012 (Wako Chemical Corporation) and a fluorescent dye fluorescein-boronate (Fl-B)63. For L-012 probing, RAW 264.7 macrophages were seeded in 100 µL complete MEM in Falcon 96-well tissue culture-treated white plates (Corning) (3.84x104cells / well) at 37 °C and 5% CO2for 16 h. Cells were infected with S. aureus strain JE2 at an MOI of 10 by centrifugation at 1,000 g for 2 min, followed by incubation at 37 °C for 40 min. Cells were treated with 40–100 µM KL1 or 1–10 µM BIX-01294 in the presence of 50 µg / mL Gen in five replicates at 37 °C and 5% CO2for 4–8 h. After three washes with 200 µL pre-warmed PBS, 100 µL of 300 µM pre-warmed Hanks’ balanced salt solution (Gibco) was added to each well. The luminescence signals were immediately measured with auto-gain at 37 °C using a Synergy H1 microplate reader. The signals of two consecutive reads were averaged to minimize the technical variability between reads.

[0125] For Fl-B staining, macrophages were seeded in 96-well tissue culture-treated black clear- bottom plates (Corning) with the same culture condition. After treatment with 40–100 µM KL1, 100 µM KL2, 40–100 µM the inactive analog KL7, 1–10 µM BIX-01294 or 20 µM BHA, infected cells were washed twice with 200 µL pre-warmed PBS and incubated with 100 µL of 25–50 µM Fl-B in PBS at 37 °C for 30 min. Cells were washed three times with 200 µL PBS to remove unbound dyes and maintained in 100 µL PBS. The fluorescence signals were measured at 535 nm with excitation at 485 nm with a detector gain of 100 and an area scan mode using a Synergy H1 microplate reader. ATP measurementAttorney Docket No.5470.986.WO

[0126] S. aureus strains LAC, HG003 and JE2 were grown in TSB for 16–18 h and subcultured at 1:1,000 to 1:40,000 dilution in fresh TSB containing 40 µM KL1 or 0.1–0.5% DMSO in six replicates at 37 °C for 4 h. The bacterial cultures were then aliquoted into Falcon 96-well white plates (100 µL / well) and mixed with one volume of BacTiter-Glo reagent (Promega), followed by incubation in the dark on a rocker with gentle shaking at room temperature for 5–20 min. The luminescence signals were detected at a 1.25-mm depth with a detector gain of 250 using a Synergy H1 microplate reader and normalized to the corresponding CFUs to determine the relative ATP levels.

[0127] To assess the correlation between lux-based bioluminescence and bacterial metabolic activity, stationary-phase cultures of JE2 and JE2-lux were subcultured at 1:200 in MHB and incubated at 37 °C for 3 h with shaking. Cultures were then treated with 0–0.5 mM sodium arsenate (Sigma) for 30 min under the same conditions. In a parallel experiment, stationary-phase cultures diluted 1:6 in PBS were incubated at 37 °C with shaking for 3 h, followed by treatment with 1% glucose, 5 mM sodium pyruvate and 0.5% casamino acids, or vehicle control for 30 min. The bioluminescence signal (JE2-lux) and ATP levels (JE2) were measured immediately following treatment. Bacterial suspensions from each treatment group were plated for CFU enumeration. Seahorse analysis

[0128] This analysis measures real-time changes in cellular metabolism and has been applied to investigate bacterial respiration in S. aureus75. The stationary-phase bacterial cultures were diluted at 1:100 in fresh TSB in triplicate and incubated for 2–3 h until the OD600values reached 0.3. Each culture was then diluted at 1:500 to 1:1,000 in TSB or Seahorse XF DMEM (Agilent Technologies) supplemented with 100 mM glucose, 2 mM L-glutamine and 1 mM sodium pyruvate, and dispensed into a poly-D-lysine (PDL)-coated Seahorse XF HS miniplate (100 µL / well). PDL- coating was performed by adding 100 µg / mL PDL in sterile H2O to each well of the miniplate for 30 min. Excessive PDL was removed by two washes with H2O, and the miniplate was air-dried prior to the assays. Bacteria adherence was achieved by centrifugation at 1,400 g for 10 min. An additional 80 µL media was carefully added to each well (180 µL final volume), and the miniplate was loaded into a pre-calibrated Seahorse XF HS Mini Analyzer (Agilent Technologies). A final concentration of 40 µM of KL1 or 0.1–0.5% DMSO was injected into each well, and the oxygen consumption rates (OCRs) and extracellular acidification rates (ECARs) of the bacteria wereAttorney Docket No.5470.986.WO monitored at 37 °C for 4–6 h. The data was analyzed using Seahorse Analytics (Agilent Technologies) and plotted using GraphPad Prism. Transcriptomic analysis

[0129] RAW 264.7 macrophages were seeded in 4 mL complete MEM in 6-well tissue culture- treated plates (8x105cells / well) at 37 °C and 5% CO2for 16 h. Cells were infected with S. aureus strain JE2-Lux at an MOI of 20 at 37 °C for 35 min and incubated in fresh media containing 100 µg / mL Gen and 40 µM KL1 or 0.1% DMSO at 37 °C for 24 h. After a PBS wash, cells were dissociated with 10 mM EDTA in PBS (2 mL / well) at 37 °C for 5 min, followed by three washes in 10 mL PBS at 4 °C to remove EDTA. The number of viable host cells was enumerated to ensure consistent sample input (2.4–4.2x106total viable cells for both KL1- and DMSO-treated groups). The frozen cell pellets were delivered to Azenta Life Sciences for the standard RNA-sequencing (paired-end, 30 million reads per sample) and data analysis. The aligned sequencing data were mapped to mouse GRCm38 reference genome available on ENSEMBL using the STAR aligner v.2.5.2b. Databases

[0130] Biological test results of the identified compound KL1 (PubChem CID: 2881454) were retrieved from PubChem (pubchem.ncbi.nlm.nih.gov / )39,76. Gene expression profiles were examined using Expression Atlas (ebi.ac.uk / gxa / home)77. Biological functions and subcellular localization data were sourced from the UniProt Knowledgebase (uniprot.org / )36. Protein association networks among the differentially expressed genes were analyzed using STRING (hstring-db.org / )78. Chemical structures were generated using ChemDraw software 21.0.0 (PerkinElmer). Data Availability

[0131] Bulk RNA-sequencing data generated in this work have been deposited into the NCBI’s Gene Expression Omnibus database (GEO accession number: GSE280093). Additional information that support the findings of this study are available from the corresponding author upon request. Chemical synthesis of KL1 and KL7Attorney Docket No.5470.986.WO N N N O OO SO O N CN SH of 3-oxo-N-phenylbutanamide (3.54 g, 20 mmol), isonicotinaldehyde (2.14 g, 20 mmol) and 2- cyanoethanethioamide (2.00 g, 20 mmol) in 150 mL ethanol. The reaction mixture was stirred at room temperature for 12 h under air atmosphere. Afterwards, volatiles were removed, yielding a viscous oil, which was redissolved in 20 mL dichloromethane (DCM). Then, 150 mL of hexane was added to the solution. The mixture was stirred for an additional 10 min at room temperature, resulting in a slurry. The slurry was filtered, and the solid residue was washed with a mixture of DCM / hexane (1:15, v / v). The product was dried under high vacuum to give 5-cyano-6-mercapto- 2-methyl-N-phenyl- 1,4-dihydro-[4,4'-bipyridine]-3-carboxamide with >90% purity (4.02 g, 10.40 mmol).

[0132] MS (ESI): m / z calculated for C19H17N4OS: 349.11 [M + H]+; found 349.10.

[0133] 100 mg of the crude product was further purified by normal-phase ISCO chromatography. The isolated impurity was isolated and characterized as the oxidized analog 5-cyano-6-mercapto- 2-methyl-N-phenyl-[4,4'-bipyridine]-3-carboxamide, as the major byproduct.

[0134] MS (ESI): m / z calculated for C19H15N4OS: 347.10 [M + H]+; found 347.10.1H NMR (400 MHz, DMSO-d6) δ 14.52 (s, 1H), 10.33 (s, 1H), 8.71–8.65 (m, 2H), 7.48–7.42 (m, 2H), 7.34–7.20 (m, 4H), 7.10–7.01 (m, 1H), 2.49 (s, 3H). For methylation, 538 µL methyl iodide (MeI, 8.61 mmol) dissolved in 3 mL dimethylformamide (DMF) was added dropwise to a solution of the crude 5-cyano-6-mercapto-2-methyl-N-phenyl- 1,4-dihydro-[4,4'-bipyridine]-3-carboxamide (3.33 g, 8.61 mmol) in 50 mL DMF. The mixture was stirred at room temperature for 5 h under nitrogen atmosphere. Water was then added, and the mixture was extracted three times with ethyl acetate (EA). The organic phases were combined, washed with brine, dried over sodium sulfate and filtered. Volatiles were removed, and the residueAttorney Docket No.5470.986.WO was purified by normal-phase ISCO chromatography. The crude product was further slurried with a mixture of DCM / hexane (1:15, v / v), affording 5-cyano-2-methyl-6-(methylthio)-N- phenyl-1,4- dihydro-[4,4'-bipyridine]-3-carboxamide (1.98 g, 5.46 mmol) (KL1) with >99% purity.

[0135] MS (ESI): m / z calculated for C20H19N4OS: 363.13 [M + H]+; found 363.20.

[0136] 1H NMR (400 MHz, DMSO-d6) δ 9.73 (s, 1H), 9.18 (s, 1H), 8.56–8.50 (m, 2H), 7.56–7.48 (m, 2H), 7.29–7.22 (m, 2H), 7.22–7.18 (m, 2H), 7.01 (tt, J = 7.2, 1.2 Hz, 1H), 4.75 (s, 1H), 2.52 (s, 3H), 2.13–2.08 (m, 3H).

[0137] 13C NMR (100 MHz, DMSO-d6) δ 165.95, 152.22, 150.05, 147.04, 138.94, 137.19, 128.56, 123.33, 122.19, 119.64, 119.35, 106.12, 83.12, 42.30, 17.07, 15.63.

[0138] Fractions containing the oxidized impurity were also collected (KL7). Volatiles were removed to yield 5-cyano-2-methyl-6-(methylthio)-N-phenyl-[4,4'-bipyridine]- 3-carboxamide as a white solid in 98% purity.

[0139] MS (ESI): m / z calculated for C20H17N4OS: 361.11 [M + H]+; found 361.10.

[0140] 1H NMR (400 MHz, DMSO-d6) δ 10.45 (s, 1H), 8.74–8.65 (m, 2H), 7.51–7.45 (m, 2H), 7.40–7.32 (m, 2H), 7.32–7.22 (m, 2H), 7.12–7.03 (m, 1H), 2.70 (s, 3H), 2.64 (s, 3H).

[0141] 13C NMR (100 MHz, DMSO-d6) δ 163.26, 162.54, 158.59, 149.81, 148.48, 141.85, 137.87, 128.84, 128.03, 124.35, 122.98, 119.62, 114.48, 103.13, 23.04, 13.00. Table 1. Minimum inhibitory concentrations (MICs) of antibiotics in the S. aureus strains used in this study. Strains Rif (ng / mL) Mox (µg / mL) Van (µg / mL)Attorney Docket No.5470.986.WO SA03803 (MSSA) 12.5 SA03809 (MRSA) 625 ducted, and the most frequently observed MIC value (i.e.,.Attorney Docket No.5470.986.WO Table 2. Potential targets of KL1 based on published functional screens. BioAssa Location, Target Assay Activity y ID†expression d d dAttorney Docket No.5470.986.WO Table 3. Primers for molecular cloning. Primer Sequence CAAATAGGTACCTATGTCAGAACTTATCAAGGAAAATATG†TT Ceque c g p e o co e e y o e ge e.§The sequence in lowercase represent inserted nucleotides for incorporating an upstream ribosomal binding site. References 1. M. Huemer et al., Molecular reprogramming and phenotype switching in Staphylococcus aureus lead to high antibiotic persistence and affect therapy success. Proc Natl Acad Sci U S A 118 (2021). 2. N. D. Hicks et al., Clinically prevalent mutations in Mycobacterium tuberculosis alter propionate metabolism and mediate multidrug tolerance. Nat Microbiol 3, 1032-1042 (2018). 3. R. A. Fisher, B. Gollan, S. Helaine, Persistent bacterial infections and persister cells. Nat Rev Microbiol 15, 453-464 (2017). 4. L. F. Westblade, J. Errington, T. Dorr, Antibiotic tolerance. PLoS Pathog 16, e1008892 (2020). 5. N. Q. Balaban et al., Definitions and guidelines for research on antibiotic persistence. Nat Rev Microbiol 17, 441-448 (2019). 6. K. Y. Lu et al., Antibiotic Tolerance and Treatment Outcomes in Cystic Fibrosis Methicillin-Resistant Staphylococcus aureus Infections. Microbiol Spectr 11, e0406122Attorney Docket No.5470.986.WO (2023). 7. R. Kuehl, L. Morata, S. Meylan, J. Mensa, A. Soriano, When antibiotics fail: a clinical and microbiological perspective on antibiotic tolerance and persistence of Staphylococcus aureus. J Antimicrob Chemother 75, 1071-1086 (2020). 8. I. Levin-Reisman et al., Antibiotic tolerance facilitates the evolution of resistance. Science 355, 826-830 (2017). 9. I. Santi, P. Manfredi, E. Maffei, A. Egli, U. Jenal, Evolution of Antibiotic Tolerance Shapes Resistance Development in Chronic Pseudomonas aeruginosa Infections. mBio 12 (2021). 10. P. Nandhini et al., Recent Developments in Methicillin-Resistant Staphylococcus aureus (MRSA) Treatment: A Review. Antibiotics (Basel) 11 (2022). 11. B. G. Surewaard et al., Identification and treatment of the Staphylococcus aureus reservoir in vivo. J Exp Med 213, 1141-1151 (2016). 12. P. Sendi, R. A. Proctor, Staphylococcus aureus as an intracellular pathogen: the role of small colony variants. Trends Microbiol 17, 54-58 (2009). 13. S. Clement et al., Evidence of an intracellular reservoir in the nasal mucosa of patients with recurrent Staphylococcus aureus rhinosinusitis. J Infect Dis 192, 1023-1028 (2005). 14. R. S. Flannagan, B. Heit, D. E. Heinrichs, Intracellular replication of Staphylococcus aureus in mature phagolysosomes in macrophages precedes host cell death, and bacterial escape and dissemination. Cell Microbiol 18, 514-535 (2016). 15. C. Garzoni, W. L. Kelley, Staphylococcus aureus: new evidence for intracellular persistence. Trends Microbiol 17, 59-65 (2009). 16. S. E. Rowe et al., Reactive oxygen species induce antibiotic tolerance during systemic Staphylococcus aureus infection. Nat Microbiol 5, 282-290 (2020). 17. J. E. Beam et al., Macrophage-Produced Peroxynitrite Induces Antibiotic Tolerance and Supersedes Intrinsic Mechanisms of Persister Formation. Infect Immun 89, e0028621 (2021). 18. F. Peyrusson et al., Intracellular Staphylococcus aureus persisters upon antibiotic exposure. Nat Commun 11, 2200 (2020). 19. B. P. Conlon et al., Persister formation in Staphylococcus aureus is associated with ATP depletion. Nat Microbiol 1 (2016). 20. M. L. Pinel-Marie et al., RNA antitoxin SprF1 binds ribosomes to attenuate translation andAttorney Docket No.5470.986.WO promote persister cell formation in Staphylococcus aureus. Nat Microbiol 6, 209-220 (2021). 21. J. A. Freiberg et al., Restriction of arginine induces antibiotic tolerance in Staphylococcus aureus. Nat Commun 15, 6734 (2024). 22. S. Helaine et al., Internalization of Salmonella by macrophages induces formation of nonreplicating persisters. Science 343, 204-208 (2014). 23. Y. Liu et al., Immune activation of the host cell induces drug tolerance in Mycobacterium tuberculosis both in vitro and in vivo. J Exp Med 213, 809-825 (2016). 24. J. E. Beam et al., Inflammasome-mediated glucose limitation induces antibiotic tolerance in Staphylococcus aureus. iScience 26, 107942 (2023). 25. E. Blasi et al., Selective immortalization of murine macrophages from fresh bone marrow by a raf / myc recombinant murine retrovirus. Nature 318, 667-670 (1985). 26. H. Liu et al., Staphylococcus aureus Epicutaneous Exposure Drives Skin Inflammation via IL-36-Mediated T Cell Responses. Cell Host Microbe 22, 653-666 e655 (2017). 27. L. R. Thurlow, A. C. Stephens, K. E. Hurley, A. R. Richardson, Lack of nutritional immunity in diabetic skin infections promotes Staphylococcus aureus virulence. Sci Adv 6 (2020). 28. B. T. Bateman, N. P. Donegan, T. M. Jarry, M. Palma, A. L. Cheung, Evaluation of a tetracycline-inducible promoter in Staphylococcus aureus in vitro and in vivo and its application in demonstrating the role of sigB in microcolony formation. Infect Immun 69, 7851-7857 (2001). 29. M. R. Grosser, A. R. Richardson, Method for Preparation and Electroporation of S. aureus and S. epidermidis. Methods Mol Biol 1373, 51-57 (2016). 30. N. W. de Jong, T. van der Horst, J. A. van Strijp, R. Nijland, Fluorescent reporters for markerless genomic integration in Staphylococcus aureus. Sci Rep 7, 43889 (2017). 31. R. M. Corrigan, T. J. Foster, An improved tetracycline-inducible expression vector for Staphylococcus aureus. Plasmid 61, 126-129 (2009). 32. S. Ronneau, C. Michaux, R. T. Giorgio, S. Helaine, Intoxication of antibiotic persisters by host RNS inactivates their efflux machinery during infection. PLoS Pathog 20, e1012033 (2024). 33. J. Schindelin et al., Fiji: an open-source platform for biological-image analysis. NatAttorney Docket No.5470.986.WO Methods 9, 676-682 (2012). 34. R. Nistala, A. Meuth, C. Smith, A. Annayya, Reliable and High Efficiency Extraction of Kidney Immune Cells. J Vis Exp 10.3791 / 54368 (2016). 35. S. Kim et al., PubChem 2023 update. Nucleic Acids Res 51, D1373-D1380 (2023). 36. I. Papatheodorou et al., Expression Atlas: gene and protein expression across multiple studies and organisms. Nucleic Acids Res 46, D246-D251 (2018). 37. C. UniProt, UniProt: the Universal Protein Knowledgebase in 2023. Nucleic Acids Res 51, D523-D531 (2023). 38. P. Santucci et al., Intracellular localisation of Mycobacterium tuberculosis affects efficacy of the antibiotic pyrazinamide. Nat Commun 12, 3816 (2021). 39. P. Hovhannisyan et al., Infection of human organoids supports an intestinal niche for Chlamydia trachomatis. PLoS Pathog 20, e1012144 (2024). 40. M. A. Lobritz et al., Antibiotic efficacy is linked to bacterial cellular respiration. Proc Natl Acad Sci U S A 112, 8173-8180 (2015). 41. Y. Li, G. Li, L. Zhang, Y. Li, Z. Zhao, G9a promotes inflammation in Streptococcus pneumoniae induced pneumonia mice by stimulating M1 macrophage polarization and H3K9me2 methylation in FOXP1 promoter region. Ann Transl Med 10, 583 (2022). 42. A. Muneer et al., Non-canonical function of histone methyltransferase G9a in the translational regulation of chronic inflammation. Cell Chem Biol 30, 1525-1541 e1527 (2023). 43. X. Wang et al., Histone methyltransferases G9a mediated lipid-induced M1 macrophage polarization through negatively regulating CD36. Metabolism 114, 154404 (2021).

[0142] The foregoing examples are illustrative of the present invention and are not to be construed as limiting thereof. Although the invention has been described in detail with reference to preferred embodiments, variation and modifications exist within the scope and spirit of the invention as described and defined in the following claims.

Claims

Attorney Docket No.5470.986.WO What is Claimed:

1. A compound according to formula I: O C(=O)-NR6R7, C1-C6alkoxy, C1-C6haloalkoxy, C3-C7R2is CH, NH, or C-CN; R3is N or NH; R4and R5are each independently unsubstituted or substituted aryl or heteroaryl; and R6and R7are independently H or C1-C8alkyl; O wherein the compound is .

2. The compound of claim 1, wherein R4and R5are each independently pyridine or phenyl, each of which may be substituted at one or more positions with a C1-C8alkyl, C1-C6haloalkyl, C1-C6alkoxy, C1-C6haloalkoxy, C3-C7cycloalkyl, C1- C8hydroxyalkyl, C3-C18aromatic, C3-C18heteroaromatic, C3-C8heterocyclic, or halide. H N 3. The compound of claim 1, wherein R1, C1-C6alkoxy, C1-C6haloalkoxy, C3-C7cycloalkyl, or a C1-C8alkyl,C1-C8alkyl.Attorney Docket No.5470.986.WO 4. The compound of claim 1, selected from the group consisting of .

5. A method of sensitizing an antibiotic tolerant pathogen in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a O R5compound according to (I) wherein R1is a C1-C8alkyl, CC1-C6haloalkoxy, C3-C7cycloalkyl or amino; R2is CH, NH, or C-CN; R3 is N or NH; and R4and R5are each independently a heteroaryl or unsubstituted or substituted aryl; and R6and R7are independently H or C1-C8alkyl; or pharmaceutically acceptable salt thereof, wherein the pathogen is sensitized to an antibiotic.Attorney Docket No.5470.986.WO 6. A method of treating a pathogen infection in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound O R R3N5C6alkoxy, C1-C6haloalkoxy, C3-C7R2is CH, NH, or C-CN; R3is N or NH; and R4and R5are each independently a heteroaryl or unsubstituted or substituted aryl; and R6and R7are independently H or C1-C8alkyl; or a pharmaceutically acceptable salt thereof, and an antibiotic, wherein the growth of the pathogen is reduced.

7. A method of reducing antibiotic-tolerant persister cells in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a O R (I)C1-C6haloalkoxy, C3-C7cycloalkyl or amino; R2is CH, NH, or C-CN; R3is N or NH; and R4and R5are each independently a heteroaryl or unsubstituted or substituted aryl; and R6and R7are independently H or C1-C8alkyl; or a pharmaceutically acceptable salt thereof, and an antibiotic, wherein the amount of antibiotic-tolerant persister cells is reduced.Attorney Docket No.5470.986.WO 8. A method of reducing the production of reactive oxygen and nitrogen species in a subject in need thereof, comprising administering to the subject a therapeutically O R R3N5effective amount of a compound according to (I) wherein R1is a C1-C8alkyl, C(=O)-NR6R7, C1-C6C7cycloalkyl or amino; R2is CH, NH, or C-CN; R3is N or NH; and R4and R5are each independently a heteroaryl or unsubstituted or substituted aryl; and R6and R7are independently H or C1-C8alkyl; or a pharmaceutically acceptable salt thereof, and an antibiotic, wherein the production of reactive oxygen and nitrogen species in the subject is reduced.

9. A method of preventing antibiotic tolerance in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound O R according to wherein R1is a C1-C6alkoxy, C1-C6haloalkoxy, C3-C7cycloalkyl or amino; R2is CH, NH, or C-CN; R3is N or NH; and R4and R5are each independently a heteroaryl or unsubstituted or substituted aryl; and R6and R7are independently H or C1-C8alkyl; or pharmaceutically acceptable salt thereof, wherein the antibiotic tolerance in the subject is prevented.Attorney Docket No.5470.986.WO 10. A method of slowing the progression of antibiotic tolerance in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a O R R3N5(I) C1-C6haloalkoxy, C3-C7R2is CH, NH, or C-CN; R3is N or NH; and R4and R5are each independently a heteroaryl or unsubstituted or substituted aryl; and R6and R7are independently H or C1-C8alkyl; or a pharmaceutically acceptable salt thereof, wherein the progression of antibiotic tolerance in the subject is decreased.

11. A method of increasing antibiotic sensitivity in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound O RC6alkoxy, C1-C6haloalkoxy, C3-C7cycloalkyl or amino; R2is CH, NH, or C-CN; R3is N or NH; and R4and R5are each independently a heteroaryl or unsubstituted or substituted aryl; and R6and R7are independently H or C1-C8alkyl; or a pharmaceutically acceptable salt thereof, wherein the antibiotic sensitivity in the subject is increased.Attorney Docket No.5470.986.WO 12. The method of claim 5, wherein the antibiotic-tolerant pathogen has low metabolic activity relative to antibiotic-sensitive pathogen.

13. The method of claim 6, wherein the pathogen is an antibiotic-tolerant bacteria.

14. The method of any one of claims 5 or 12, wherein the antibiotic-tolerant pathogen is selected from species of Salmonella, Mycobacterium, Staphylococcus, Klebsiella, Pseudomonas, Escherichia, Brucella, Borrelia, or Chlamydia.

15. The method of claim 14, wherein the antibiotic-tolerant pathogen is Salmonella typhimurium, Mycobacterium tuberculosis, or Staphylococcus aureus.

16. The method of anyone of claims 6-8, wherein the compound and the antibiotic are co- administered, wherein the antibiotic is administered before the compound, or wherein the compound is administered before the antibiotic.

17. The method of any one of claims 6-8 or 16, wherein two or more antibiotics are administered to the subject.

18. The method of anyone of claims 5-17, wherein the therapeutically effective amount of the compound is a dose of about 0.1 mg / kg to about 100 mg / kg once per day or twice per day.

19. The method of any one of claims 5-18, wherein administering the compound and / or the antibiotic comprises oral administration, intravenous administration, intrathecal administration, intraperitoneal administration, intra-articular administration, epidural administration, or any combination thereof.

Images