Oligonucleotide compositions for identifying and characterising drug-resistant

Abstract

The disclosure relates to an oligonucleotide composition for multiplex nucleic acid amplification reactions for the identification of Mycobacterium tuberculosis mutations associated with drug resistance.

Description

[0001] METHOD

[0002] Cross reference to related

[0003] This application claims priority from United Kingdom Patent Application No.

[0004] 2414276.2 filed on 27 September 2024, the entire contents of which are hereby incorporated by reference.

[0005] Field

[0006] The present disclosure relates to methods and compositions for characterising tuberculosis infections, in particular for identifying and characterising drug -resistant tuberculosis infections. The disclosure further relates to novel oligonucleotide primers, to compositions and kits comprising the oligonucleotides of the disclosure, and methods of using the oligonucleotides, compositions and kits of the disclosure.

[0007] Tuberculosis (TB) is an infectious disease caused primarily by Mycobacterium tuberculosis (MTB). Causing a high disease burden in low-income, middle-income and developing countries, TB has a global health importance. One third of the human population is estimated to harbour latent TB, and there are between 9 and 11 million TB cases annually according to the World Health Organization, with 1.5 to 2 million deaths attributed to TB annually. TB typically presents as a pulmonary disease, with extrapulmonary and disseminated disease presentations also known.

[0008] A significant threat to global TB care and prevention efforts is the presence of Drug-Resistant TB (DR-TB), where infection is resistant to treatment with one or more antimicrobial agents. Multidrug-resistant TB (MDR-TB) is defined as TB resistant to at least the agents rifampicin and isoniazid, while extensively drug-resistant TB (XDR-TB) is further resistant to at least one fluoroquinolone and at least one second-line injectable agent. Further resistant forms of TB have also been identified: extremely drug -resistant TB (XXDR-TB), resistant to all first- and second-line medications, and totally drugresistant TB (TDR-TB), resistant to all current TB medications.

[0009] There is a need for rapid and accurate detection of Mycobacterium tuberculosis mutations in patient samples. Improved rates and accuracy of detection will enable clinicians to diagnose patients promptly, and subsequently administer the most appropriate therapy for treating TB. This is particularly important when a patient is infected with drug- resistant TB. Effective treatment of drug-resistant TB requires careful selection of anti-TB therapy.

[0010] Drug-resistant TB is mainly conferred through point mutations in specific gene targets. Accordingly, amplification of MTB genomic material containing the loci of said point mutations using a method such as polymerase chain reaction (PCR) and subsequent rapid sequencing of the amplified material provides great promise for the future management and diagnosis of patients presenting TB infection.

[0011] Methods and compositions for drug-resistance screening are described in WO 2022 / 049365, which describes oligonucleotide primers and their use to detect the presence of drug resistance mutations in a sample from a subject with suspected or confirmed tuberculosis.

[0012] The present invention provides improved products and methods for more efficient analysis of samples obtained from subjects suspected of having a drug-resistant TB infection.

[0013] The present inventors have identified novel oligonucleotide pairs for use in methods of amplifying nucleic acids. Particularly, the oligonucleotide pairs may be used in methods to determine the presence of drug-resistant Mycobacterium tuberculosis and / or drug-resistant bacteria in the Mycobacterium tuberculosis complex and therefore diagnose individuals as having drug-resistant TB infections.

[0014] The present inventors have particularly identified novel oligonucleotides which may be used in large multiplex nucleic acid amplification reactions. This enables the identification of drug-resistant TB with greater efficiency and accuracy, thereby enabling the faster administration of a suitable drug to an individual following diagnosis with TB, and in particular drug-resistant TB.

[0015] In a first aspect, the invention provides a plurality of oligonucleotides comprising any pair of oligonucleotides, or pair of variants thereof, selected from: a. SEQ ID NO: 1 and SEQ ID NO: 2; b. SEQ ID NO: 3 and SEQ ID NO: 4; c. SEQ ID NO: 5 and SEQ ID NO: 6; d. SEQ ID NO: 7 and SEQ ID NO: 8; e. SEQ ID NO: 9 and SEQ ID NO: 10; f. SEQ ID NO: 11 and SEQ ID NO: 12; g. SEQ ID NO: 13 and SEQ ID NO: 14; h. SEQ ID NO: 15 and SEQ ID NO: 16; i. SEQ ID NO: 17 and SEQ ID NO: 18; j. SEQ ID NO: 19 and SEQ ID NO: 20; k. SEQ ID NO: 21 and SEQ ID NO: 22; l. SEQ ID NO: 23 and SEQ ID NO: 24; m. SEQ ID NO: 25 and SEQ ID NO: 26; n. SEQ ID NO: 27 and SEQ ID NO: 28; and o. SEQ ID NO: 29 and SEQ ID NO: 30.

[0016] The invention also provides a composition for PCR comprising a plurality of oligonucleotides according to the invention and a polymerase.

[0017] The invention also provides a kit comprising: i. a plurality of oligonucleotides according to the invention; and ii. instructions for using the kit.

[0018] The invention also provides a polymerase chain reaction (PCR) amplification method for amplifying a target nucleic acid sequence comprised in DNA to produce amplicons, the method comprising contacting the DNA with:

[0019] (i) a plurality of oligonucleotides according to the invention and a polymerase; or

[0020] (ii) a composition for PCR according to the invention.

[0021] The invention also provides a method for determining whether a tuberculosis strain in a sample is resistant to a drug for treating tuberculosis infection, the method comprising: i. amplifying DNA comprised in the sample using a plurality of oligonucleotides defined according to the invention to produce amplicons; and ii. determining in the amplicons the presence of mutations known to confer drug resistance in tuberculosis.

[0022] The invention also provides a method of characterising a polynucleotide, the method comprising: a. providing a polynucleotide, wherein the polynucleotide has been obtained by amplifying DNA using a plurality of oligonucleotides as defined herein; b. contacting the polynucleotide with a nanopore such that the polynucleotide moves with respect to the nanopore; and c. taking one or more measurements as the polynucleotide moves with respect to the nanopore, thereby characterising the polynucleotide. In another aspect, the invention provides a multiplex PCR reaction mixture comprising two or more pairs of oligonucleotides, wherein each pair comprises a Forward primer sequence and a Reverse primer sequence selected from: a. SEQ ID NO: 1 and SEQ ID NO: 2; b. SEQ ID NO: 3 and SEQ ID NO: 4; c. SEQ ID NO: 5 and SEQ ID NO: 6; d. SEQ ID NO: 7 and SEQ ID NO: 8; e. SEQ ID NO: 9 and SEQ ID NO: 10; f. SEQ ID NO: 11 and SEQ ID NO: 12; g. SEQ ID NO: 13 and SEQ ID NO: 14; h. SEQ ID NO: 15 and SEQ ID NO: 16; i. SEQ ID NO: 17 and SEQ ID NO: 18; j. SEQ ID NO: 19 and SEQ ID NO: 20; k. SEQ ID NO: 21 and SEQ ID NO: 22; l. SEQ ID NO: 23 and SEQ ID NO: 24; m. SEQ ID NO: 25 and SEQ ID NO: 26; n. SEQ ID NO: 27 and SEQ ID NO: 28; and o. SEQ ID NO: 29 and SEQ ID NO: 30.

[0023] In one embodiment, the multiplex PCR reaction mixture further comprises one or more oligonucleotide pairs comprising a Forward primer sequence and a Reverse primer sequence selected from: a. SEQ ID NO: 31 and SEQ ID NO: 32; b. SEQ ID NO: 33 and SEQ ID NO: 34; c. SEQ ID NO: 35 and SEQ ID NO: 36; d. SEQ ID NO: 37 and SEQ ID NO: 38; e. SEQ ID NO: 39 and SEQ ID NO: 40; f. SEQ ID NO: 41 and SEQ ID NO: 42; g. SEQ ID NO: 43 and SEQ ID NO: 44; h. SEQ ID NO: 45 and SEQ ID NO: 46; and i. SEQ ID NO: 47 and SEQ ID NO: 48.

[0024] In one embodiment, the multiplex PCR reaction mixture comprises a set of oligonucleotide pairs comprising the following Forward and Reverse primer sequences: a. SEQ ID NO: 1 and SEQ ID NO: 2; b. SEQ ID NO: 3 and SEQ ID NO: 4; c. SEQ ID NO: 5 and SEQ ID NO: 6; d. SEQ ID NO: 7 and SEQ ID NO: 8; e. SEQ ID NO: 9 and SEQ ID NO: 10; f. SEQ ID NO: 11 and SEQ ID NO: 12; g. SEQ ID NO: 13 and SEQ ID NO: 14; h. SEQ ID NO: 15 and SEQ ID NO: 16; i. SEQ ID NO: 17 and SEQ ID NO: 18; j. SEQ ID NO: 19 and SEQ ID NO: 20; k. SEQ ID NO: 21 and SEQ ID NO: 22; l. SEQ ID NO: 23 and SEQ ID NO: 24; m. SEQ ID NO: 25 and SEQ ID NO: 26; n. SEQ ID NO: 27 and SEQ ID NO: 28; and o. SEQ ID NO: 29 and SEQ ID NO: 30.

[0025] In one embodiment, the multiplex PCR reaction mixture comprises a set of oligonucleotide pairs comprising the following Forward and Reverse primer sequences: a. SEQ ID NO: 1 and SEQ ID NO: 2; b. SEQ ID NO: 3 and SEQ ID NO: 4; c. SEQ ID NO: 5 and SEQ ID NO: 6; d. SEQ ID NO: 7 and SEQ ID NO: 8; e. SEQ ID NO: 9 and SEQ ID NO: 10; f. SEQ ID NO: 11 and SEQ ID NO: 12; g. SEQ ID NO: 13 and SEQ ID NO: 14; h. SEQ ID NO: 15 and SEQ ID NO: 16; i. SEQ ID NO: 17 and SEQ ID NO: 18; j. SEQ ID NO: 19 and SEQ ID NO: 20; k. SEQ ID NO: 21 and SEQ ID NO: 22; l. SEQ ID NO: 23 and SEQ ID NO: 24; m. SEQ ID NO: 25 and SEQ ID NO: 26; n. SEQ ID NO: 27 and SEQ ID NO: 28; o. SEQ ID NO: 29 and SEQ ID NO: 30. p. SEQ ID NO: 31 and SEQ ID NO: 32; q. SEQ ID NO: 33 and SEQ ID NO: 34; r. SEQ ID NO: 35 and SEQ ID NO: 36; s. SEQ ID NO: 37 and SEQ ID NO: 38; t. SEQ ID NO: 39 and SEQ ID NO: 40; u. SEQ ID NO: 41 and SEQ ID NO: 42; v. SEQ ID NO: 43 and SEQ ID NO: 44; w. SEQ ID NO: 45 and SEQ ID NO: 46; and x. SEQ ID NO: 47 and SEQ ID NO: 48.

[0026] In one embodiment, the multiplex PCR reaction mixture further comprises one or more oligonucleotide pairs comprising a Forward primer sequence and a Reverse primer sequence selected from: a. SEQ ID NO: 49 and SEQ ID NO: 50; b. SEQ ID NO: 51 and SEQ ID NO: 52; and c. SEQ ID NO: 53 and SEQ ID NO: 54.

[0027] In another aspect, the invention provides a method for detecting the presence of one or more antibiotic-resistance mutations in DNA from Mycobacterium tuberculosis and / or bacteria in the Mycobacterium tuberculosis complex, the method comprising: providing a sample comprising DNA from Mycobacterium tuberculosis and / or bacteria in the Mycobacterium tuberculosis complex; isolating DNA from the sample; amplifying one or more target DNA regions in the isolated DNA by polymerase chain reaction using one or more oligonucleotide primer pairs to produce amplicons of the target DNA regions; subjecting the amplicons to DNA sequencing; and detecting the presence of one or more antibiotic-resistance mutations; wherein the one or more oligonucleotide primer pairs comprise Forward and Reverse primer sequences selected from: a. SEQ ID NO: 1 and SEQ ID NO: 2; b. SEQ ID NO: 3 and SEQ ID NO: 4; c. SEQ ID NO: 5 and SEQ ID NO: 6; d. SEQ ID NO: 7 and SEQ ID NO: 8; e. SEQ ID NO: 9 and SEQ ID NO: 10; f. SEQ ID NO: 11 and SEQ ID NO: 12; g. SEQ ID NO: 13 and SEQ ID NO: 14; h. SEQ ID NO: 15 and SEQ ID NO: 16; i. SEQ ID NO: 17 and SEQ ID NO: 18; j. SEQ ID NO: 19 and SEQ ID NO: 20; k. SEQ ID NO: 21 and SEQ ID NO: 22; l. SEQ ID NO: 23 and SEQ ID NO: 24; m. SEQ ID NO: 25 and SEQ ID NO: 26; n. SEQ ID NO: 27 and SEQ ID NO: 28; and o. SEQ ID NO: 29 and SEQ ID NO: 30.

[0028] In one embodiment, the oligonucleotide primer pairs further comprise Forward and Reverse primer sequences selected from: a. SEQ ID NO: 31 and SEQ ID NO: 32; b. SEQ ID NO: 33 and SEQ ID NO: 34; c. SEQ ID NO: 35 and SEQ ID NO: 36; d. SEQ ID NO: 37 and SEQ ID NO: 38; e. SEQ ID NO: 39 and SEQ ID NO: 40; f. SEQ ID NO: 41 and SEQ ID NO: 42; g. SEQ ID NO: 43 and SEQ ID NO: 44; h. SEQ ID NO: 45 and SEQ ID NO: 46; and i. SEQ ID NO: 47 and SEQ ID NO: 48.

[0029] In one embodiment, the oligonucleotide primer pairs comprise the following Forward and Reverse primer sequences: a. SEQ ID NO: 1 and SEQ ID NO: 2; b. SEQ ID NO: 3 and SEQ ID NO: 4; c. SEQ ID NO: 5 and SEQ ID NO: 6; d. SEQ ID NO: 7 and SEQ ID NO: 8; e. SEQ ID NO: 9 and SEQ ID NO: 10; f. SEQ ID NO: 11 and SEQ ID NO: 12; g. SEQ ID NO: 13 and SEQ ID NO: 14; h. SEQ ID NO: 15 and SEQ ID NO: 16; i. SEQ ID NO: 17 and SEQ ID NO: 18; j. SEQ ID NO: 19 and SEQ ID NO: 20; k. SEQ ID NO: 21 and SEQ ID NO: 22; l. SEQ ID NO: 23 and SEQ ID NO: 24; m. SEQ ID NO: 25 and SEQ ID NO: 26; n. SEQ ID NO: 27 and SEQ ID NO: 28; and o. SEQ ID NO: 29 and SEQ ID NO: 30.

[0030] In one embodiment, the oligonucleotide primer pairs comprise the following Forward and Reverse primer sequences: a. SEQ ID NO: 1 and SEQ ID NO: 2; b. SEQ ID NO: 3 and SEQ ID NO: 4; c. SEQ ID NO: 5 and SEQ ID NO: 6; d. SEQ ID NO: 7 and SEQ ID NO: 8; e. SEQ ID NO: 9 and SEQ ID NO: 10; f. SEQ ID NO: 11 and SEQ ID NO: 12; g. SEQ ID NO: 13 and SEQ ID NO: 14; h. SEQ ID NO: 15 and SEQ ID NO: 16; i. SEQ ID NO: 17 and SEQ ID NO: 18; j. SEQ ID NO: 19 and SEQ ID NO: 20; k. SEQ ID NO: 21 and SEQ ID NO: 22; l. SEQ ID NO: 23 and SEQ ID NO: 24; m. SEQ ID NO: 25 and SEQ ID NO: 26; n. SEQ ID NO: 27 and SEQ ID NO: 28; o. SEQ ID NO: 29 and SEQ ID NO: 30. p. SEQ ID NO: 31 and SEQ ID NO: 32; q. SEQ ID NO: 33 and SEQ ID NO: 34; r. SEQ ID NO: 35 and SEQ ID NO: 36; s. SEQ ID NO: 37 and SEQ ID NO: 38; t. SEQ ID NO: 39 and SEQ ID NO: 40; u. SEQ ID NO: 41 and SEQ ID NO: 42; v. SEQ ID NO: 43 and SEQ ID NO: 44; w. SEQ ID NO: 45 and SEQ ID NO: 46; and x. SEQ ID NO: 47 and SEQ ID NO: 48.

[0031] In one embodiment, the oligonucleotide primer pairs further comprise Forward and Reverse primer sequences selected from: a. SEQ ID NO: 49 and SEQ ID NO: 50; b. SEQ ID NO: 51 and SEQ ID NO: 52; and c. SEQ ID NO: 53 and SEQ ID NO: 54. In another aspect, the invention provides a method of determining whether a patient with tuberculosis will respond to treatment with an anti-tuberculosis drug, the method comprising: providing a sample obtained from a patient comprising DNA from Mycobacterium tuberculosis and / or bacteria in the Mycobacterium tuberculosis complex; isolating DNA from the sample; amplifying one or more target DNA regions in the isolated DNA by polymerase chain reaction using one or more oligonucleotide primer pairs to produce amplicons of the target DNA regions; subjecting the amplicons to DNA sequencing; detecting the presence of one or more antibiotic-resistance mutations; wherein the one or more oligonucleotide primer pairs comprise Forward and Reverse primer sequences selected from: a. SEQ ID NO: 1 and SEQ ID NO: 2; b. SEQ ID NO: 3 and SEQ ID NO: 4; c. SEQ ID NO: 5 and SEQ ID NO: 6; d. SEQ ID NO: 7 and SEQ ID NO: 8; e. SEQ ID NO: 9 and SEQ ID NO: 10; f. SEQ ID NO: 11 and SEQ ID NO: 12; g. SEQ ID NO: 13 and SEQ ID NO: 14; h. SEQ ID NO: 15 and SEQ ID NO: 16; i. SEQ ID NO: 17 and SEQ ID NO: 18; j. SEQ ID NO: 19 and SEQ ID NO: 20; k. SEQ ID NO: 21 and SEQ ID NO: 22; l. SEQ ID NO: 23 and SEQ ID NO: 24; m. SEQ ID NO: 25 and SEQ ID NO: 26; n. SEQ ID NO: 27 and SEQ ID NO: 28; and o. SEQ ID NO: 29 and SEQ ID NO: 30.

[0032] In one embodiment, the oligonucleotide primer pairs further comprise Forward and Reverse primer sequences selected from: a. SEQ ID NO: 31 and SEQ ID NO: 32; b. SEQ ID NO: 33 and SEQ ID NO: 34; c. SEQ ID NO: 35 and SEQ ID NO: 36; d. SEQ ID NO: 37 and SEQ ID NO: 38; e. SEQ ID NO: 39 and SEQ ID NO: 40; f. SEQ ID NO: 41 and SEQ ID NO: 42; g. SEQ ID NO: 43 and SEQ ID NO: 44; h. SEQ ID NO: 45 and SEQ ID NO: 46; and i. SEQ ID NO: 47 and SEQ ID NO: 48.

[0033] In one embodiment, the oligonucleotide primer pairs comprise the following Forward and Reverse primer sequences: a. SEQ ID NO: 1 and SEQ ID NO: 2; b. SEQ ID NO: 3 and SEQ ID NO: 4; c. SEQ ID NO: 5 and SEQ ID NO: 6; d. SEQ ID NO: 7 and SEQ ID NO: 8; e. SEQ ID NO: 9 and SEQ ID NO: 10; f. SEQ ID NO: 11 and SEQ ID NO: 12; g. SEQ ID NO: 13 and SEQ ID NO: 14; h. SEQ ID NO: 15 and SEQ ID NO: 16; i. SEQ ID NO: 17 and SEQ ID NO: 18; j. SEQ ID NO: 19 and SEQ ID NO: 20; k. SEQ ID NO: 21 and SEQ ID NO: 22; l. SEQ ID NO: 23 and SEQ ID NO: 24; m. SEQ ID NO: 25 and SEQ ID NO: 26; n. SEQ ID NO: 27 and SEQ ID NO: 28; and o. SEQ ID NO: 29 and SEQ ID NO: 30.

[0034] In one embodiment, the oligonucleotide primer pairs comprise the following Forward and Reverse primer sequences: a. SEQ ID NO: 1 and SEQ ID NO: 2; b. SEQ ID NO: 3 and SEQ ID NO: 4; c. SEQ ID NO: 5 and SEQ ID NO: 6; d. SEQ ID NO: 7 and SEQ ID NO: 8; e. SEQ ID NO: 9 and SEQ ID NO: 10; f. SEQ ID NO: 11 and SEQ ID NO: 12; g. SEQ ID NO: 13 and SEQ ID NO: 14; h. SEQ ID NO: 15 and SEQ ID NO: 16; i. SEQ ID NO: 17 and SEQ ID NO: 18; j. SEQ ID NO: 19 and SEQ ID NO: 20; k. SEQ ID NO: 21 and SEQ ID NO: 22; l. SEQ ID NO: 23 and SEQ ID NO: 24; m. SEQ ID NO: 25 and SEQ ID NO: 26; n. SEQ ID NO: 27 and SEQ ID NO: 28; o. SEQ ID NO: 29 and SEQ ID NO: 30. p. SEQ ID NO: 31 and SEQ ID NO: 32; q. SEQ ID NO: 33 and SEQ ID NO: 34; r. SEQ ID NO: 35 and SEQ ID NO: 36; s. SEQ ID NO: 37 and SEQ ID NO: 38; t. SEQ ID NO: 39 and SEQ ID NO: 40; u. SEQ ID NO: 41 and SEQ ID NO: 42; v. SEQ ID NO: 43 and SEQ ID NO: 44; w. SEQ ID NO: 45 and SEQ ID NO: 46; and x. SEQ ID NO: 47 and SEQ ID NO: 48.

[0035] In one embodiment, the oligonucleotide primer pairs further comprise Forward and Reverse primer sequences selected from: a. SEQ ID NO: 49 and SEQ ID NO: 50; b. SEQ ID NO: 51 and SEQ ID NO: 52; and c. SEQ ID NO: 53 and SEQ ID NO: 54.

[0036] Brief Description of the Figures

[0037] Figure 1. Example drug resistance profile of sputum samples spiked with Mycobacterium tuberculosis variant bovis BCG using the developed method.

[0038] Figure 2. Summary of target coverage for Mycobacterium tuberculosis variant bovis BCG.

[0039] Figure 3. Example per-sample resistance summary.

[0040] Detailed

[0041] The present invention will be described with respect to particular embodiments and with reference to certain drawings but the disclosure is not limited thereto but only by the claims. Any reference signs in the claims shall not be construed as limiting the scope. Of course, it is to be understood that not necessarily all aspects or advantages may be achieved in accordance with any particular embodiment. Thus, for example those skilled in the art will recognize that the disclosed embodiments may be embodied or carried out in a manner that achieves or optimizes one advantage or group of advantages as taught herein without necessarily achieving other aspects or advantages as may be taught or suggested herein.

[0042] The disclosure, both as to organization and method of operation, together with features and advantages thereof, may best be understood by reference to the following detailed description when read in conjunction with the accompanying drawings. The aspects and advantages of the invention will be apparent from and elucidated with reference to the embodiment(s) described hereinafter. Reference throughout this specification to "one embodiment" or "an embodiment" means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one disclosed embodiment. Thus, appearances of the phrases "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Similarly, it should be appreciated that in the description of exemplary disclosed embodiments, various features are sometimes grouped together in a single embodiment, figure, or description thereof for the purpose of streamlining the disclosure and aiding in the understanding of one or more of the various inventive aspects. This method of disclosure, however, is not to be interpreted as reflecting an intention that the claimed invention requires more features than are expressly recited in each claim. Rather, as the following claims reflect, inventive aspects lie in less than all features of a single foregoing disclosed embodiment.

[0043] It should be appreciated that “embodiments” of the disclosure can be specifically combined together unless the context indicates otherwise. The specific combinations of all disclosed embodiments (unless implied otherwise by the context) are further disclosed embodiments of the claimed invention.

[0044] The term “wild-type” refers to a gene or gene product isolated from a naturally occurring source. A wild-type gene is that which is most frequently observed in a population and is thus arbitrarily designed the “normal” or “wild-type” form of the gene. In contrast, the term “modified”, “mutant” or “variant” refers to a gene or gene product that displays modifications in sequence (e.g., substitutions, truncations, or insertions), post- translational modifications and / or functional properties (e.g., altered characteristics) when compared to the wild-type gene or gene product.

[0045] “Polynucleotide”, “nucleotide sequence”, “DNA sequence”, or “nucleic acid molecule(s)” as used herein refers to a polymeric form of nucleotides of any length, which comprises ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, this term includes double- and single-stranded DNA, and RNA. The term “polynucleotide” as used herein, may be a single or double stranded covalently linked sequence of nucleotides in which the 3' and 5' ends on each nucleotide are joined by phosphodiester bonds. The polynucleotide may be made up of deoxyribonucleotide bases or ribonucleotide bases. Polynucleotides may be manufactured synthetically in vitro or isolated from natural sources. Polynucleotides may further include modified DNA or RNA, for example DNA or RNA that has been methylated, or RNA that has been subject to post-translational modification, for example 5 ’-capping with 7- methyl guanosine, 3 ’-processing such as cleavage and polyadenylation, and splicing. Polynucleotides may also include synthetic nucleic acids (XNA), such as hexitol nucleic acid (HNA), cyclohexene nucleic acid (CeNA), threose nucleic acid (TNA), glycerol nucleic acid (GNA), locked nucleic acid (LNA) and peptide nucleic acid (PNA).

[0046] The terms “patient” and “subject” are used interchangeably and typically refer to a mammal, preferably a human.

[0047] In addition as used in this specification and the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “a polynucleotide” includes two or more polynucleotides.

[0048] Unless otherwise indicated, nucleic acid sequences herein are written in the 5’-to-3’ direction from left to right.

[0049] All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.

[0050] Plurality of oligonucleotides

[0051] Provided herein are oligonucleotide primers suitable for use in amplification of genes associated with drug-resistance mutations in Mycobacterium tuberculosis (MTB) and / or bacteria in the Mycobacterium tuberculosis complex (MTBc). Also provided herein are oligonucleotide primers suitable for use in determining tuberculosis speciation, lineage identification and as an internal control in a multiplex PCR assay.

[0052] The oligonucleotide primers described herein comprise primers for amplifying portions of the following MTB gene targets known to be associated with drug-resistance: eis embB rrs r\'0678 fab(j 1 rpoB elhA rplC kalG gidB inhA rrl„ pncA rpsl. tlyA gyrA; gyrB embA,fgdr, Ddrr, atpE,fbiA,fbiB,fbiC. The portions of the amplified gene targets may comprise one or more mutations that confer antibiotic resistance to one or more of the following antibiotics used in the treatment of tuberculosis: ethambutol; isoniazid; pyrazinamide; rifampicin; streptomycin; amikacin; bedaquiline; capreomycin; clofazimine; delamanid; ethionamide; kanamycin; levofloxacin; linezolid; moxifloxacin; pretomanid.

[0053] Target genes for each oligonucleotide primer pair are set out in Table A as follows: Table A: DRa / b GGGGTTTTGGGTCTGACGAC CCGAGAGGGGACGGAAAC 54 hsp65 - for tuberculosis speciation; targets highly conserved region in Mycobacteria. Both Forward and Reverse primers comprise one degeneracy each (Y = C or T).

[0054] IC - internal control (unique DNA fragment).

[0055] DRa / b - for lineage identification (direct repeat locus).

[0056] Note: two sections of the JbiC gene are targeted, numbered 1 and 2 above. gyrAB combines sections of gyrA and gyrB in one target.

[0057] Genes as listed are based on the H37Rv Mycobacterium tuberculosis reference genome, NCBI Reference Sequence: NC_000962.3.

[0058] The disclosure provides a plurality of oligonucleotides comprising any pair of oligonucleotides, or pair of variants thereof, selected from: a. SEQ ID NO: 1 and SEQ ID NO: 2; b. SEQ ID NO: 3 and SEQ ID NO: 4; c. SEQ ID NO: 5 and SEQ ID NO: 6; d. SEQ ID NO: 7 and SEQ ID NO: 8; e. SEQ ID NO: 9 and SEQ ID NO: 10; f. SEQ ID NO: 11 and SEQ ID NO: 12; g. SEQ ID NO: 13 and SEQ ID NO: 14; h. SEQ ID NO: 15 and SEQ ID NO: 16; i. SEQ ID NO: 17 and SEQ ID NO: 18; j. SEQ ID NO: 19 and SEQ ID NO: 20; k. SEQ ID NO: 21 and SEQ ID NO: 22; l. SEQ ID NO: 23 and SEQ ID NO: 24; m. SEQ ID NO: 25 and SEQ ID NO: 26; n. SEQ ID NO: 27 and SEQ ID NO: 28; and o. SEQ ID NO: 29 and SEQ ID NO: 30.

[0059] As used herein, a variant of a nucleotide sequence may have at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% sequence identity to the corresponding nucleotide sequence. A variant of a nucleotide sequence may have at least 90% sequence identity to the corresponding nucleotide sequence. A variant of a nucleotide sequence may have at least 95% sequence identity to the corresponding nucleotide sequence. A variant of a nucleotide sequence may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotide additions (e.g. to the 5’ or to the 3’ end), deletions (internally or from the 5’ end or from the 3’ end), or substitutions compared to the corresponding nucleotide sequence. A variant of a nucleotide sequence may comprise 1, 2 or 3 nucleotide additions (e.g. to the 5’ or to the 3’ end) compared to the corresponding nucleotide sequence. A variant of a nucleotide sequence may comprise 1, 2, 3, 4 or 5; or 1, 2 or 3; or 1 or 2; or 1 nucleotide substitution(s) compared to the corresponding nucleotide sequence.

[0060] The pair of variants thereof preferably have at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% sequence identity to the pair of oligonucleotides selected from (a)-(o). The pair of variants preferably remain capable of annealing to the complementary nucleic acid sequence of the oligonucleotide sequences defined according to (a)-(o) and thereby remain capable of mediating PCR amplification of a target sequence in a PCR amplification method.

[0061] The plurality of oligonucleotides of the invention preferably comprises, or consists of, at least two pairs, at least three pairs, at least four pairs, at least five pairs, at least six pairs, at least seven pairs, at least eight pairs, at least nine pairs, at least ten pairs, at least eleven pairs, at least twelve pairs, at least thirteen pairs, at least fourteen pairs or most preferably all fifteen pairs of oligonucleotides, or pairs of variants thereof, selected from (a)-(o).

[0062] The plurality may further comprise any pair of oligonucleotides, or pair of variants thereof, selected from: p. SEQ ID NO: 31 and SEQ ID NO: 32; q. SEQ ID NO: 33 and SEQ ID NO: 34; r. SEQ ID NO: 35 and SEQ ID NO: 36; s. SEQ ID NO: 37 and SEQ ID NO: 38; t. SEQ ID NO: 39 and SEQ ID NO: 40; u. SEQ ID NO: 41 and SEQ ID NO: 42; v. SEQ ID NO: 43 and SEQ ID NO: 44; w. SEQ ID NO: 45 and SEQ ID NO: 46; and x. SEQ ID NO: 47 and SEQ ID NO: 48.

[0063] The pair of variants of (p)-(x) preferably have at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% sequence identity to the pair of oligonucleotides selected from (p)-(x). The pair of variants preferably remain capable of annealing to the complementary nucleic acid sequence of the oligonucleotide sequences defined according to (p)-(x) and thereby remain capable of mediating PCR amplification of a target sequence in a PCR amplification method.

[0064] The plurality of oligonucleotides of the invention preferably further comprises, or additionally consists of, at least two pairs, at least three pairs, at least four pairs, at least five pairs, at least six pairs, at least seven pairs, at least eight pairs or all nine pairs of oligonucleotides, or pairs of variants thereof, selected from (p)-(x).

[0065] The plurality of oligonucleotides or variants thereof preferably comprises, or consists of, the oligonucleotides defined by SEQ ID NOs 1 to 14 and SEQ ID NOs 31 to 48.

[0066] The plurality of oligonucleotides or variants thereof preferably comprises, or consists of, the oligonucleotides defined by SEQ ID NOs 1 to 14 and SEQ ID NOs 13 to 30.

[0067] The plurality of oligonucleotides or variants thereof preferably comprises, or consists of, the oligonucleotides defined by SEQ ID NOs 1 to 48.

[0068] The plurality preferably further comprises one or more pairs of oligonucleotides suitable for tuberculosis speciation, TB lineage identification and / or an internal control PCR reaction.

[0069] An example pair of oligonucleotides suitable for tuberculosis speciation is defined according to SEQ ID NO: 49 and SEQ ID NO: 50. The plurality of oligonucleotides may further comprise, or additionally consist of, the pair of oligonucleotides defined by SEQ ID NO: 49 and SEQ ID NO: 50.

[0070] An example pair of oligonucleotides suitable for TB lineage identification is defined according to SEQ ID NO: 53 and SEQ ID NO: 54. The plurality of oligonucleotides may further comprise, or additionally consist of, the pair of oligonucleotides defined by SEQ ID NO: 53 and SEQ ID NO: 54.

[0071] An example pair of oligonucleotides suitable for use as an internal control PCR reaction is defined according to SEQ ID NO: 51 and SEQ ID NO: 52. The plurality of oligonucleotides may further comprise, or additionally consist of, the pair of oligonucleotides defined by SEQ ID NO: 51 and SEQ ID NO: 52.

[0072] The plurality of oligonucleotides or variants thereof preferably further comprises: y. SEQ ID NO: 49 and SEQ ID NO: 50; and / or z. SEQ ID NO: 51 and SEQ ID NO: 52; and / or aa. SEQ ID NO: 53 and SEQ ID NO: 54. The plurality of oligonucleotides or variants thereof preferably further comprises, or additionally consists of, SEQ ID NO: 49 and SEQ ID NO: 50, SEQ ID NO: 51 and SEQ ID NO: 52, and SEQ ID NO: 53 and SEQ ID NO: 54.

[0073] At the 5’ end of one or more of the oligonucleotides in the plurality there may be

[0074] 5 added a GGK triplet nucleotide sequence, where K represents G or T, i.e. GGT or GGG (also referred to as a GGK ‘tail’). Preferably there may be a GGK triplet nucleotide sequence at the 5’ end of all of the oligonucleotides in the plurality. The presence of a GGK triplet at the 5’ end of each primer sequence may advantageously provide improvements in a multiplex PCR assay, for example by providing a higher concentration 0 of PCR products following amplification.

[0075] The plurality of oligonucleotides preferably consists of the oligonucleotides defined by SEQ ID NOs 1 to 54, and wherein there is a GGK triplet nucleotide sequence at the 5’ end of each oligonucleotide defined by SEQ ID NOs 1 to 52.

[0076] The invention therefore also provides the following oligonucleotides, which 5 correspond to SEQ ID NOs 1 to 52 with a GGK triplet nucleotide sequence at the 5’ end of each oligonucleotide sequence:

[0077] Table B:

[0078] Any of the variant oligonucleotides described herein may preferably comprise the identical sequence to any one of SEQ ID NOs 1 to 54, but may comprise one or more, two or more, three or more, four or more, or five or more nucleotides immediately 5’ and / or 3’

[0079] 5 to the said identical sequence defined according to any one of SEQ ID NOs 1 to 54. Any of the variant oligonucleotides described herein may preferably comprise the identical sequence to any one of SEQ ID NOs 1 to 52 including a GGK triplet nucleotide sequence at the 5’ end of each oligonucleotide, but may comprise one or more, two or more, three or more, four or more, or five or more nucleotides immediately 5’ and / or 3’ to the said 0 identical sequence defined according to any one of SEQ ID NOs 1 to 52 additionally comprising the 5’ GGK triplet nucleotide sequence.

[0080] The disclosure provides a plurality of oligonucleotides comprising any pair of oligonucleotides selected from the pairs of oligonucleotides described herein. Accordingly, the plurality of oligonucleotides may comprise any number of distinct 5 oligonucleotides provided that the plurality comprises at least a pair of oligonucleotides selected from the oligonucleotide pairs described herein.

[0081] The oligonucleotide primer sequences described herein are suitable for use in a multiplex PCR reaction.

[0082] Single nucleotide polymorphisms associated with drug -resistance in tuberculosis 0 are located at multiple regions across the MTB genome. As such, multiple genomic regions must be targeted by PCR. The ability to carry out multiple amplifications simultaneously in a single PCR reaction - a multiplex PCR - provides a number of benefits, including higher throughput, reduced costs such as through decreased reagent requirements, and the production of increased data from limited amounts of starting 5 materials. Primer design for multiplexed PCR is complex with increased requirements compared to non-multiplex PCR methods. Primers must be designed to minimise unwanted interactions between primers in the multiplexed reaction, which could reduce amplification efficiency. Primers should also amplify similar sized PCR products to ensure a similar amplification efficiency between the multiple targets in the reaction. Each primer pair must be specific for its target, and each primer must have a similar annealing temperature.

[0083] Compositions and kits

[0084] Also provided is a composition for PCR comprising a plurality of oligonucleotides according to the invention and a polymerase.

[0085] Also provided is a kit comprising: i. a plurality of oligonucleotides according as described herein.

[0086] Also provided is a multiplex PCR reaction mixture comprising two or more pairs of oligonucleotides, wherein each pair comprises a Forward primer sequence and a Reverse primer sequence selected from the Forward and Reverse primer sequences described herein.

[0087] The composition, the kit, and the multiplex PCR reaction mixture, may each further comprise: a. a polymerase; and / or b. a buffer; and / or c. deoxynucleotide triphosphates; and / or d. a sequencing adapter.

[0088] The polymerase may be any polymerase suitable for amplifying a nucleic acid sequence when used in combination with a pair of oligonucleotides specifically designed for use in a method of amplifying said nucleic acid sequence. The polymerase may be a DNA polymerase.

[0089] One of skill in the art is familiar with buffers suitable for PCR amplification reactions, suitable deoxynucleotide triphosphates, and sequencing adapters, for example sequencing adapters for nanopore sequencing. Any suitable buffer, deoxynucleotide triphosphates, and sequencing adapters may be comprised in the kit and / or composition of the invention.

[0090] Methods The plurality of oligonucleotides according to the invention may be used for any suitable purpose. One of skill in the art would appreciate that whilst the methods described herein are preferred, the plurality of oligonucleotides may be used for any suitable purpose, particularly wherein the method comprises PCR amplification using the plurality of oligonucleotides comprising any pair of oligonucleotides as defined herein.

[0091] Method of PCR amplification

[0092] The disclosure provides a PCR amplification method for amplifying a target nucleic acid sequence comprised in DNA to produce amplicons, the method comprising contacting the DNA with:

[0093] (i) a plurality of oligonucleotides according to the invention and a polymerase; or

[0094] (ii) a composition for PCR according to the invention.

[0095] A multiplex PCR method comprises the simultaneous PCR amplification of more than one nucleic acid sequence in a reaction vessel. This is achieved by the contacting of a plurality of specifically designed oligonucleotide pairs for the targeting of distinct nucleic acids for amplification, and a polymerase, under conditions suitable for PCR amplification. When the plurality of oligonucleotides according to the invention comprises two or more distinct pairs of oligonucleotides as defined herein, and wherein the method of PCR amplification comprises contacting said plurality with DNA, the method of PCR is a ‘multiplex’ PCR amplification method.

[0096] The disclosure therefore provides a multiplex method of PCR amplification for amplifying a target nucleic acid sequence comprised in DNA to produce amplicons. A plurality of distinct target nucleic acid sequences comprised in the DNA are targeted for amplification by the plurality of oligonucleotides comprising two or more distinct oligonucleotide pairs as defined herein.

[0097] The DNA is preferably a population of DNA molecules. The DNA may be, or have been derived from, any sample as defined herein. Most preferably the DNA has been derived from sputum that has been obtained from a human or animal subject, preferably a human subject.

[0098] The contacting according to the PCR amplification method may comprise the contacting of the DNA with a plurality of oligonucleotides comprising all oligonucleotide pairs defined according to SEQ ID NOs 1 to 48 as described herein in a single reaction vessel. The contacting according to the PCR amplification method may comprise the contacting of the DNA with a plurality of oligonucleotides comprising all oligonucleotide pairs defined according to SEQ ID NOs 1 to 54 as described herein in a single reaction vessel. The contacting according to the PCR amplification method may comprise the contacting of the DNA with a plurality of oligonucleotides comprising all oligonucleotide pairs defined according to SEQ ID NOs 55 to 102 as described herein in a single reaction vessel. The contacting according to the PCR amplification method may comprise the contacting of the DNA with a plurality of oligonucleotides comprising all oligonucleotide pairs defined according to SEQ ID NOs 55 to 106 and 53 and 54 as described herein in a single reaction vessel.

[0099] The method may comprise the use of any suitable PCR conditions known to the skilled person. The method may also comprise the use of any suitable reagents and / or buffers known to the skilled person for the purposes of performing PCR.

[0100] Methods of determination, diagnosis and treatment

[0101] The disclosure provides a method for determining whether a tuberculosis strain in a sample is resistant to a drug for treating tuberculosis infection, the method comprising: i. amplifying DNA comprised in the sample using a plurality of oligonucleotides defined according to the invention to produce amplicons; and ii. determining in the amplicons the presence of mutations known to confer resistance to drugs for treating tuberculosis.

[0102] The amplification step (i) is preferably performed according to the PCR amplification method described herein.

[0103] The method may further comprise: i. obtaining the sample from a subject, preferably wherein the sample is sputum; and / or ii. isolating DNA from the sample prior to the step of amplifying; and / or iii. diagnosis of the subject with a drug-resistant tuberculosis infection, preferably wherein the subject is human.

[0104] The method may further comprise obtaining the sample from a subject, preferably wherein the subject is human, and preferably wherein the sample is sputum. Prior to, or during the step of amplification, the method may comprise fractionating the DNA in the sample, for example to isolate the DNA in the sample, and / or remove human DNA, and / or to isolate MTB DNA.

[0105] The step of determining the presence of mutations known to confer drug resistance may comprise a comparison of the amplicon sequences with genomic sequences of MTB which are known to confer drug resistance. The skilled person is aware that such genomic sequences, and mutations therein, are publicly accessible, thereby allowing said comparison. The World Health Organization publishes a catalogue of mutations and their association with phenotypic drug resistance: Catalogue of mutations in Mycobacterium tuberculosis complex and their association with drug resistance, 2nd ed, 2023, ISBN: 9789240082410.

[0106] Accordingly, where drug resistant MTB is identified in a sample, the method may preferably comprise diagnosis of the subject with a drug-resistant tuberculosis infection, preferably wherein the subject is human.

[0107] The step of determining may comprise a step of sequencing amplicons produced in step (i). The sequencing may be any suitable sequencing method, for example via the method of characterising an amplicon as described herein.

[0108] Also provided is a method for detecting the presence of one or more antibioticresistance mutations in DNA from Mycobacterium tuberculosis and / or bacteria in the Mycobacterium tuberculosis complex, the method comprising: providing a sample comprising DNA from Mycobacterium tuberculosis and / or bacteria in the Mycobacterium tuberculosis complex; isolating DNA from the sample; amplifying one or more target DNA regions in the isolated DNA by polymerase chain reaction using one or more oligonucleotide primer pairs to produce amplicons of the target DNA regions; subjecting the amplicons to DNA sequencing; and detecting the presence of one or more antibiotic-resistance mutations; wherein the one or more oligonucleotide primer pairs comprise Forward and Reverse primer sequences selected from the Forward and Reverse primer sequences described herein.

[0109] Also provided is a method of determining whether a patient with tuberculosis will respond to treatment with an anti-tuberculosis drug, the method comprising: providing a sample obtained from a patient comprising DNA from Mycobacterium tuberculosis and / or bacteria in the Mycobacterium tuberculosis complex; isolating DNA from the sample; amplifying one or more target DNA regions in the isolated DNA by polymerase chain reaction using one or more oligonucleotide primer pairs to produce amplicons of the target DNA regions; subjecting the amplicons to DNA sequencing; detecting the presence of one or more antibiotic-resistance mutations; wherein the one or more oligonucleotide primer pairs comprise Forward and Reverse primer sequences selected from the Forward and Reverse primer sequences described herein.

[0110] Described herein are methods of diagnosing a subject with a drug-resistant TB infection. These methods may further comprise the step of administering a therapeutic agent effective against the drug-resistant TB identified in the method. The therapeutic agent may be any suitable agent known to the skilled person. For example, the agent may be any one or more of isoniazid (INH), rifampicin (RIF), the fluoroquinolones (FQs), pyrazinamide (PZA) or any known second-line injectables (SLIs). The therapeutic agent may be any one or more of the drugs listed in Table C, particularly wherein the drug is selected when the individual has a TB infection but is not infected by MTB which has a mutation in a gene which confers resistance to said drug.

[0111] Table C:

[0112] Samples

[0113] The methods described herein may be carried out on a sample, such as a sample obtained from a subject. The sample may be obtained from, or may have been obtained from, any suitable organism as subject, preferably a human subject. The subject may be suspected or confirmed to have TB. Thus, the sample may be one that is known or suspected to comprise genetic material from Mycobacterium tuberculosis and / or bacteria from the M. tuberculosis complex. The sample may comprise one or more tissues and / or bodily fluids obtained from the subject. The sample may comprise a bodily fluid from the subject, typically a human subject. The sample may comprise sputum, urine, blood, plasma, mucus, serum, amniotic fluid, synovial fluid, cerebrospinal fluid, pleural fluid, pericardial fluid, interstitial fluid, ascitic fluid, sweat, saliva, mucus, tears, bronchoalveolar lavage, bronchial wash, gastric lavage, gastric wash, transtracheal or transbronchial fine needle aspiration, bone marrow, pleural tissue, lymph tissue, or tissue from a mediastinoscopy, thoracoscopy or transbronchial biopsy. The sample may comprise sputum.

[0114] DNA sequencing

[0115] The methods described herein may comprise a step of DNA sequencing. DNA sequencing may be carried out by any suitable method known in the art. DNA sequencing may be carried out using nanopore sequencing, for example using a MinlON, GridlON or PromethlON nanopore sequencing device from Oxford Nanopore Technologies. DNA sequencing may be carried out using a sequencing platform from Pacific Biosciences. DNA sequencing is preferably carried out using nanopore sequencing.

[0116] The methods described herein may comprise a step of detecting one or more mutations in sequenced DNA. The step of detecting one or more mutations may be carried out using any suitable method known in the art, such as suitable bioinformatics software, and by reference to mutations listed in publicly available databases. The software may comprise the EPI2ME software from Oxford Nanopore Technologies. Method of characterising an amplicon

[0117] The disclosure provides a method of characterising a target polynucleotide, the method comprising: a. providing a polynucleotide, wherein the polynucleotide has been obtained by amplification of DNA using a plurality of oligonucleotides as defined herein; b. contacting the polynucleotide with a nanopore such that the amplicon moves with respect to the nanopore; and c. taking one or more measurements as the polynucleotide moves with respect to the nanopore, thereby characterising the target polynucleotide.

[0118] The step of characterising the polynucleotide may comprise determining the presence, absence or one or more of the characteristics of a polynucleotide.

[0119] A polynucleotide (or ‘amplicon’) may be obtained by amplifying DNA using any plurality of oligonucleotides defined according to the invention. Any such polynucleotide, or any polynucleotide produced by any PCR amplification method or step forming part of the invention as described herein may be subject to a nanopore based method to determine the presence, absence or one or more characteristics of said products.

[0120] As described herein the method of characterising a polynucleotide may be used to sequence the polynucleotides generated by the method of confirming drug-resistance as described herein.

[0121] The methods of the disclosure may therefore further comprise determining the presence, absence or one or more characteristics of a polynucleotide as described above. For the purposes of the a nanopore-based method, an amplicon may be termed a “target polynucleotide”. The presence, absence or one or more characteristics of such a target polynucleotide be determined by:

[0122] (a) contacting the target polynucleotide with a nanopore such that the target polynucleotide moves with respect to the nanopore; and

[0123] (b) taking one or more measurements as the polynucleotide moves with respect to the nanopore, thereby determining the presence, absence or one or more characteristics of the polynucleotide. Nanopore-based methods of detecting and characterising target polynucleotides are known in the art. Examples of such methods are described in, for example, WO 2012 / 107778, WO 2013 / 014451, WO 2013 / 057495, WO 2014 / 013260, and WO 2016 / 034591. Accordingly, any suitable nanopore-based method of polynucleotide characterisation can be applied to the method of determining the presence, absence or one or more characteristics of the target polynucleotides (i.e. amplicons) as described herein. The preferred characteristics to be determined are the presence or absence of a mutation in an MTB genomic sequence known to confer resistance to one or more anti-tuberculosis drugs, as described herein.

[0124] Typically, the one or more measurements are electrical measurements, e.g. current measurements, and / or are one or more optical measurements. The characterisation methods may be carried out using the apparatus described in WO 2008 / 102120, WO 2010 / 122293 or WO 00 / 28312. The characterisation methods may comprise optical measurements, for example such as described in WO 2016 / 009180 and WO 2021 / 198695. The characterisation methods may involve measuring the ion current flow through the pore, typically by measurement of a current. Alternatively, the ion flow through the pore may be measured optically. Therefore the apparatus may also comprise an electrical circuit capable of applying a potential and measuring an electrical signal across the membrane and pore.

[0125] In the method of characterising a target polynucleotide described herein, the one or more measurements are indicative of one or more characteristics of the target polynucleotide selected from (i) the length of the polynucleotide, (ii) the identity of the polynucleotide, (iii) the sequence of the polynucleotide, (iv) the secondary structure of the polynucleotide and (v) whether or not the polynucleotide is modified. Preferably, the measurements are indicative of the sequence of the polynucleotide.

[0126] Step (a) comprises contacting the target polynucleotide with a nanopore such that the polynucleotide moves through the nanopore. The method is typically carried out with a potential applied across the nanopore. The applied potential may be a voltage potential.

[0127] The nanopore is typically a transmembrane protein pore, for example a transmembrane protein pore derived from MspA, or a transmembrane protein pore derived from CsgG, for example as described in WO 2012 / 107778 or as described in WO 2016 / 034591 respectively. It is to be understood that although particular embodiments, specific configurations as well as materials and / or molecules, have been discussed herein for methods according to the present disclosure, various changes or modifications in form and detail may be made without departing from the scope and spirit of this invention. The preceding embodiments and following examples are provided for illustration only, and should not be considered limiting the application. The application is limited only by the claims.

[0128] EXAMPLES

[0129] Example 1

[0130] Oligonucleotide primers suitable for use in detecting the presence of drug-resistance mutations in Mycobacterium tuberculosis in the genes eis, embB. rrs, r\'0678.fabG 1 , gyrA, rpoB. elhA. rplC, katG, gidB, inhA. rrl. pncA. rpsl.. and tlyA have been previously described in WO 2022 / 049365.

[0131] An objective of the present study was to provide an improved primer set suitable for use in detecting the presence of drug-resistance mutations in Mycobacterium tuberculosis and / or related bacteria in the M. tuberculosis complex.

[0132] New primers were developed for the gene targets rrs, ethA, rplC, gidB, and rrl. rrs-Y and / T.S-R. primers were designed to have improved specificity against NTMs. ethA-Y and ethA- R primers were designed to include an SNP and have increased target strength. rrl-F, rrs- , rplC- and irihAAk primers were designed to have increased length to increase melting temperature and increased target strength.

[0133] Additional coverage of fluoroquinolone resistance SNPs was achieved by including the gene gyrB. The gyrA target was replaced by a new combined gyrAB target to capture the end of the gyrB gene.

[0134] Primers for hsp65 were added to enable identification of Mycobacterial species. The primers target highly conserved regions in Mycobacteria to enable amplification of almost all non-tuberculous mycobacteria (NTMs). Both primers have one degeneracy each (Y = C or T). Further primers were designed to target additional Mycobacterium tuberculosis drugresistance genes fgdl, ddn. atpE, embA,fbiA,fbiB, and fbiC, and so enable the detection of resistance against additional anti-tuberculosis agents.

[0135] Also added were Direct Repeat primers to amplify CRISPR repeat region of MTBc for spoligotyping. DRa and DRb are from the literature. DRa was modified (lengthened at 5’ end) to increase melting temperature.

[0136] 5’-GGK tails were subsequently added to each primer sequence, with the exception of the spoligotyping primer set.

[0137] The final primer set results in a 27-plex PCR reaction which targets 24 specific resistance genes against 16 drugs as well as additional targets for speciation and lineage identification. An internal control target is also included to monitor for successful PCR amplification, library preparation and sequencing for each sample tested.

[0138] The final primer sequences (including additional 5’-GGK tails) were as follows:

[0139] The above final primer sequences correspond to SEQ ID NOs 1-54 as described herein above, with the addition of 5’-GGK tails with respect to SEQ ID NOs 1-52.

[0140] Primer locations with respect to the MTB reference genome NC 000962.3 are set out in the following table.

[0141]

[0142] Example 2

[0143] A study was conducted to evaluate the primers described in Example 1 using sputum spiked with Mycobacterium tuberculosis variant bovis BCG isolates at 1000 cfu / ml. Sputum samples were decontaminated, heat-killed and DNA was extracted using a Promega Maxwell instrument. Polymerase Chain Reaction (PCR) was carried out in a single multiplex reaction with all 27 primer pairs per sample following which samples were pooled, washed, barcoded and sequenced using nanopore sequencing on a GridlON device (Oxford Nanopore Technologies) in batches of 22 (plus two controls), following the protocols described below.

[0144] METHODS

[0145] Decontamination :

[0146] The following solutions were prepared in advance.

[0147] Preparation of working solutions

[0148] Sodium citrate solution

[0149] Prepare 2% NaOH and 1.45% sodium citrate solution by weighing out 20.0 g NaOH and 14.5 g sodium citrate dihydrate using a fine balance. Add 1 L distilled water and shake until dissolved.

[0150] NALC powder aliquots

[0151] Weigh out aliquots of 0.25 g NALC powder using a fine balance. This is enough for 50 mL final solution. Store aliquots in the fridge and prepare final solution immediately before use.

[0152] Phosphate buffer (0.067 M) Weigh out 4. 74 g disodium phosphate anhydrous and 4.54 g monopotassium phosphate using a fine balance. Add 1 L distilled water and shake until dissolved.

[0153] Method

[0154] 1. Just before starting, prepare a NALC-NaOH-Sodium Citrate solution by supplementing 50 mL of NaOH-Sodium citrate solution with the weighed aliquot of 0.25 g NALC powder and allow it to dissolve fully.

[0155] 2. Add 700 pL of NALC-NaOH-Sodium Citrate solution to each 700 pL sample (including NTC and extraction PC).

[0156] 3. Vortex the tubes and incubate them at room temperature for 10 minutes.

[0157] 4. After the incubation, centrifuge at 15,000 xg for 3 minutes. Carefully discard the supernatant, leaving the pellet intact.

[0158] 5. Resuspend the pellet ini mL of Phosphate buffer.

[0159] 6. Centrifuge at 15,000 * g for 3 minutes. Carefully discard the supernatant, leaving the pellet intact.

[0160] 7. Proceed to automated extraction with heat kill.

[0161] Automated extraction (with heat-kill)

[0162] To be performed after decontamination.

[0163] Method

[0164] 1. Resuspend each decontaminated pellet in 750 pL PBS and proceed to heat kill including extraction PC and NTC samples.

[0165] 2. Heat kill step: incubate the samples at 95 °C for 15 minutes.

[0166] 3. Transfer 750 pL to an MPBio Matrix E tube (for automated bead beating).

[0167] 4. Bead beat at 6.0 m / s for 2 cycles of 45 seconds (90 seconds total).

[0168] 5. Centrifuge the Matrix E tubes at 20,000 xg for 1 minute.

[0169] 6. Transfer the liquid in 3 steps of 200 pL to a 1.5 mL Eppendorf tube, add 20 pL of Proteinase K to each tube and mix by quick vortex.

[0170] 7. Incubate tubes at 65 °C for 5 minutes on a shaking incubator at 1000 RPM.

[0171] 8. Progress to automated extraction on the Promega Maxwell. Follow the Maxwell Purefood Pathogen kit as per the protocol: o Place cartridges in the Maxwell RSC and remove seals. o Add 300 pL of Lysis Buffer (green lid - NOT Lysis Buffer A) to Well 1. o Add the Proteinase K-treated sample to Well 1 (from step 8). o Insert a plunger into Well 8. o Place new elution tubes into tube slot with lid open. o Add 50 pL of Elution buffer to each elution tube. o Start extraction. o The 50 pL eluate in the tube is ready to be used for PCR (N.B. if resin is present in the eluate centrifuge at 12,000 RPM prior to downstream processing). o If not used on the same day, the eluate can be stored at 4°C for short term (1 week), or -20°C for longer term storage.

[0172] Multiplex PCR set-up

[0173] After extraction, process the required extracts / replicates as detailed in relevant verification protocol.

[0174] 1. Prepare a PCR mastermix following the order in the table below, desirably in a pre-PCR no-template area:

[0175] 2. Thoroughly mix by vortexing.

[0176] N.B. Steps 3-9 of the protocol will be performed in a separate template addition area to minimise risk of contamination.

[0177] 3. Transfer the mastermix to a template addition area.

[0178] 4. To the mastermix, add 26 pL of the Internal Control (TBIC).

[0179] 5. Mix the mastermix+TBIC by vortexing and briefly spin down. 6. Aliquot 41 pL of the mastermix+TBIC into each PCR well for each sample plus the positive (TBPC) and no-template controls (NTC).

[0180] 7. Add 9 pL of sample extracted DNA to each sample tube / well (Add 9 pL of the positive extraction control as a sample).

[0181] 8. Add 5 pL of the positive control (TBPC) to the positive control well plus 4 pL nuclease-free water

[0182] 9. Add 9 pL of the no template control (NTC) extract to the no template control well.

[0183] 10. Seal the plate, vortex and briefly spin down.

[0184] 11. Incubate the plate in a thermocycler with a heated lid set to 105°C using the following programme. If available, use a ramp rate of 4 °C / sec.

[0185] Control quantification by Qubit

[0186] After completion of the amplification programme, quantify the Positive control(s) and No Template Control (NTC) using the Qubit lx dsDNA BR assay.

[0187] Quantify 2 pL of each control sample using the Qubit lx dsDNA BR assay

[0188] 1. Set up four Qubit Assay tubes for two samples and two standards.

[0189] 2. Add 198 pL Working solution in each sample tube and 190 pL in each Standard tube.

[0190] 3. Add 10 pL of Standard #1 to a tube and repeat for Standard #2 for the second tube.

[0191] 4. Add 2 pL of sample to the sample tube(s). 5. Mix the tubes by briefly vortexing, be careful not to create bubbles.

[0192] 6. Incubate the tubes for 2 min at room temperature.

[0193] 7. Quantify the standards and samples using the Qubit 4 Fluorometer: Select dsDNA on the home screen and choose the dsDNA: lx Broad range assay. Press Read standards to calibrate assay. Insert Standard #1 into the sample chamber, close the lid and press Read standard. Repeat the previous step for Standard #2. Once both standards are read, and calibration was successful, press Run samples. Insert the sample volume of 2 pL and units for the output of ng / pL. Insert the sample tube into the sample chamber, close the lid and press Read tube. Once complete, the results will be displayed.

[0194] Library Preparation

[0195] Rapid Barcode Attachment

[0196] 1. Thaw the Rapid Barcoding Plate 96 (RBO 1 -96) at room temperature (18-25 °C), spin down and place on ice until use.

[0197] 2. Quickly vortex and spin down the PCR plate.

[0198] 3. In a clean 96-well PCR plate, add the following to separate wells per sample or control, in the order listed below:

[0199] 4. Pipette mix the barcoding attachment plate 10 times using multichannel pipette set at 7.5 pL setting.

[0200] 5. Seal the barcode attachment plate and spin it down briefly. 6. Incubate the plate in a thermal cycler at 30 °C for 2 minutes and then at 80 °C for 2 minutes. Set hold to 10 °C to avoid condensation in the thermal cycler.

[0201] AMPure XP Bead Wash

[0202] Equilibrate the AMPure XP beads at room temperature for 30 minutes.

[0203] 1. Remove barcode attachment plate from thermocycler and spin down.

[0204] 2. Pool all barcoded samples into a fresh 1.5 mL Eppendorf DNA LoBind tube. Mix by pipetting and briefly spin down.

[0205] 3. Resuspend the AMPure XP Beads (AXP) by vortexing.

[0206] 4. Add an equal volume (1 : 1 ratio) of AMPure XP Beads (AXP) to your barcoded samples, mix by pipetting 10 times.

[0207] 5. Incubate at room temperature (18-25 °C) for 5 minutes with gentle mixing by flicking.

[0208] 6. In the meantime, prepare freshly 2.5 mL of 80 % Ethanol in nuclease- free water.

[0209] 7. Briefly spin down the sample and place the tube on a magnet until the supernatant is clear and colourless (ca. 2 minutes).

[0210] 8. Keeping the tube on the magnet, carefully remove and discard the supernatant without disturbing the pellet.

[0211] 9. With the tube on the magnet, wash the beads by adding 1 mL of the freshly prepared 80% Ethanol to the tube without disturbing the beads. Incubate for up to 30 sec. Remove and discard the Ethanol.

[0212] 10. Repeat the previous step for a second wash.

[0213] 11. Spin down the sample tube and place back onto magnet (for 30 seconds). 12. Remove any residual Ethanol and air-dry the pellet for 30 seconds (leaving the pellet for an extended period can result in reduced library recovery).

[0214] 13. With the tube off the magnet, resuspend the pellet in 15 pL of Elution Buffer (EB) and mix well by pipetting.

[0215] N.B. Ensure that the beads are resuspended well-enough that the solution is uniform.

[0216] 14. Spin down the tube briefly, avoiding pelleting the beads.

[0217] 15. Incubate for 10 minutes at room temperature (18-25°C) with occasional gentle flicking (make sure the tube is well closed).

[0218] 16. Place the tube on a magnet to pellet the beads until the eluate is clear and colourless (for a minimum of 2 minutes).

[0219] 17. Remove and collect to a new tube 14 pL of the eluate, taking care not to transfer any beads.

[0220] Quantification by Qubit

[0221] Quantify 1 pL of your final eluate using the Qubit IX ds DNA BR Assay:

[0222] 1. Set up four Qubit Assay tubes for two samples and two standards.

[0223] 2. Add 199 pL Working solution in each sample tube and 190 pL in each Standard tube.

[0224] 3. Add 10 pL of Standard #1 to a tube and repeat for Standard #2 for the second tube.

[0225] 4. Addl pL of sample to the sample tube(s).

[0226] 5. Mix the tubes by briefly vortexing, be careful not to create bubbles.

[0227] 6. Incubate the tubes for 2 min at room temperature.

[0228] 7. Quantify the standards and samples using the Qubit 4 Fluorometer: Select dsDNA on the home screen and choose the dsDNA: lx Broad range assay. Press Read standards to calibrate your assay. Insert Standard #1 into the sample chamber, close the lid and press Read standard. Repeat the previous step for Standard #2. Once both standards are read, and calibration was successful, press Run samples. Insert the sample volume of 1 pL and units for the output of ng / pL. Insert the sample tube into the sample chamber, close the lid and press Read tube. Once complete, the results will be displayed.

[0229] Library Loadins Preparation

[0230] Preparation

[0231] Thaw the reagents listed below at room temperature and store on ice. Before using the reagents, briefly spin down and pipette mix three times, unless stated otherwise.

[0232] 1. Briefly spin down the Rapid Adapter F (RAP F) and mix by pipetting.

[0233] 2. In a clean 1.5 mL Eppendorf DNA LoBind tube, add the following reagents:

[0234] 3. Mix by flicking tube and briefly spin down.

[0235] 4. Incubate the reaction for 5 minutes at room temperature (18-25 °C).

[0236] 5. Vortex the thawed SBII for 10 seconds and spin down.

[0237] 6. Vortex LB II immediately before use for 10 seconds, or until the beads are fully resuspended.

[0238] 7. Once the 5-minute incubation has finished, prepare the library as follows:

[0239] 8. Pipette mix the entire contents of the tube 10 times.

[0240] Flow Cell Loading

[0241] Flow Cell Preparation

[0242] 1. Prepare the Priming mix : 30 pL FLT + 1170 pL FB Mix thoroughly

[0243] 2. Open the priming port by sliding 90° clockwise, using a P1000 draw back a small volume (20-30 pL, until storage buffer is visible in the pipette tip) by turning the wheel of the pipette anticlockwise and discard.

[0244] 3. Using a Pl 000 pipette load 800 pL of the Priming mix into the flow cell via the Priming port, ensuring no air bubble is present in the tip before flushing.

[0245] 4. Wait 5 minutes before continuing.

[0246] 5. During this wait, prepare the relevant Library as described in loading library preparation.

[0247] 6. Lift the SpotON sample port to expose the sample loading port. Flush 200 pL of the previously prepared Priming mix into the priming port, ensuring no air bubble is present in the tip before flushing. Flushing should be done with enough pressure to form a meniscus on the sample loading port.

[0248] Library Loading

[0249] 1. Take 75 pL of the prepared loading Library, ensuring it is thoroughly mixed, and add to the SpotON sample port in a dropwise fashion, ensuring each drop flows into the port before adding the next.

[0250] 2. Seal the Flow cell for sequencing: Replace SpotON port ensuring sample port is covered, close priming port by rotating 90° anti clockwise.

[0251] RESULTS Sequencing results and analysis are presented in Figures 1 to 3. All targets were successfully amplified in the 27-plex PCR assay. This is demonstrated in Figure 2, which shows sequencing coverage of each target following nanopore sequencing; all target genes were covered at >20 x coverage, demonstrating successful amplification.

[0252] Resistance to first and second line drugs was identified using a custom analysis workflow. Wild-type and mutant nucleotides were reported for all drug resistance associated variants detected within the PCR product fastq sequences. Mycobacterium tuberculosis variant bovis BCG is inherently pyrazinamide resistant and this is shown across replicates. Identified drug-resistance genes are shown, with identification of resistance to pyrazinamide highlighted (Figure 1).

[0253] A more detailed analysis is shown in Figure 3. These results display the codon or nucleotide location within the annotated gene as well as the allele frequency.

Claims

CLAIMS1. A plurality of oligonucleotides comprising any pair of oligonucleotides, or pair of variants thereof, selected from: a. SEQ ID NO: 1 and SEQ ID NO: 2; b. SEQ ID NO: 3 and SEQ ID NO: 4; c. SEQ ID NO: 5 and SEQ ID NO: 6; d. SEQ ID NO: 7 and SEQ ID NO: 8; e. SEQ ID NO: 9 and SEQ ID NO: 10; f. SEQ ID NO: 11 and SEQ ID NO: 12; g. SEQ ID NO: 13 and SEQ ID NO: 14; h. SEQ ID NO: 15 and SEQ ID NO: 16; i. SEQ ID NO: 17 and SEQ ID NO: 18; j. SEQ ID NO: 19 and SEQ ID NO: 20; k. SEQ ID NO: 21 and SEQ ID NO: 22; l. SEQ ID NO: 23 and SEQ ID NO: 24; m. SEQ ID NO: 25 and SEQ ID NO: 26; n. SEQ ID NO: 27 and SEQ ID NO: 28; and o. SEQ ID NO: 29 and SEQ ID NO: 30.

2. The plurality of oligonucleotides according to claim 1, wherein the pair of variants thereof have at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% sequence identity to the pair of oligonucleotides selected from (a)-(o).

3. The plurality of oligonucleotides according to claim 1 or claim 2, wherein the plurality comprises at least two pairs, at least three pairs, at least four pairs, at least five pairs, at least six pairs, at least seven pairs, at least eight pairs, at least nine pairs, at least ten pairs, at least eleven pairs, at least twelve pairs, at least thirteen pairs, at least fourteen pairs or all fifteen pairs of oligonucleotides, or pairs of variants thereof, selected from (a)-(o).

4. The plurality of oligonucleotides according to any one of claims 1 to 3, wherein the plurality further comprises any pair of oligonucleotides, or pair of variants thereof, selected from: a. SEQ ID NO: 31 and SEQ ID NO: 32;44b. SEQ ID NO: 33 and SEQ ID NO: 34; c. SEQ ID NO: 35 and SEQ ID NO: 36; d. SEQ ID NO: 37 and SEQ ID NO: 38; e. SEQ ID NO: 39 and SEQ ID NO: 40; f. SEQ ID NO: 41 and SEQ ID NO: 42; g. SEQ ID NO: 43 and SEQ ID NO: 44; h. SEQ ID NO: 45 and SEQ ID NO: 46; and i. SEQ ID NO: 47 and SEQ ID NO: 48.

5. The plurality of oligonucleotides according to claim 4, wherein the pair of variants thereof have at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% sequence identity to the pair of oligonucleotides selected from (a)-(i).

6. The plurality of oligonucleotides according to claim 4 or claim 5, wherein the pair further comprised in the plurality comprises at least two pairs, at least three pairs, at least four pairs, at least five pairs, at least six pairs, at least seven pairs, at least eight pairs or all nine pairs of oligonucleotides, or pairs of variants thereof, selected from (a)-(i).

7. The plurality of oligonucleotides according to any one of claims 1 to 6, wherein the plurality comprises the oligonucleotides defined by SEQ ID NOs 1 to 14 and SEQ ID NOs 31 to 48.

8. The plurality of oligonucleotides according to any one of claims 1 to 7, wherein the plurality comprises the oligonucleotides defined by SEQ ID NOs 13 to 30.

9. The plurality of oligonucleotides according to any one of claims 1 to 8, wherein the plurality comprises the oligonucleotides defined by SEQ ID NOs 1 to 48.

10. The plurality of oligonucleotides according to any one of claims 1 to 9, wherein the plurality further comprises one or more oligonucleotide pairs for AT. tuberculosis speciation, M. tuberculosis lineage identification and / or an internal control PCR reaction.4511. The plurality of oligonucleotides according to claim 10, wherein the one or more oligonucleotide pairs for M. tuberculosis speciation, lineage identification and / or an internal control PCR reaction comprises: a. SEQ ID NO: 49 and SEQ ID NO: 50; b. SEQ ID NO: 51 and SEQ ID NO: 52; and c. SEQ ID NO: 53 and SEQ ID NO: 54.

12. The plurality of oligonucleotides according to any one of claims 1 to 11, wherein at the 5’ end of one or more of the oligonucleotides in the plurality there is a GGK triplet nucleotide sequence, preferably wherein there is a GGK triplet nucleotide sequence at the 5’ end of all of the oligonucleotides in the plurality.

13. The plurality of oligonucleotides according to any one of claims 1 to 12, wherein the plurality consists of the oligonucleotides defined by SEQ ID NOs 1 to 54, and wherein there is a GGK triplet nucleotide sequence at the 5’ end each oligonucleotide defined by SEQ ID NOs 1 to 52.

14. A composition for PCR comprising a plurality of oligonucleotides according to any one of claims 1 to 13 and a polymerase.

15. A kit comprising: i. a plurality of oligonucleotides according to any one of claims 1-13.

16. The kit according to claim 15, or composition according to claim 14, further comprising: a. a polymerase; and / or b. a buffer; and / or c. deoxynucleotide triphosphates; and / or d. a sequencing adapter.

17. A polymerase chain reaction (PCR) amplification method for amplifying a target nucleic acid sequence comprised in DNA to produce amplicons, the method comprising contacting the DNA with: i. a plurality of oligonucleotides according to the invention and a polymerase; or46ii. a composition for PCR according to the invention.

18. A method for determining whether a tuberculosis strain in a sample is resistant to a drug for treating tuberculosis infection, the method comprising: i. amplifying DNA comprised in the sample using a plurality of oligonucleotides defined according to any one of claims 1-13 to produce amplicons; and ii. determining in the amplicons the presence of mutations known to confer drug resistance in tuberculosis.

19. The method according to claim 18, wherein the method further comprises sequencing the amplicons.

20. The method according to claim 18 or claim 19, wherein the method further comprises: i. obtaining the sample from a subject, preferably wherein the sample is sputum; and / or ii. isolating DNA from the sample prior to the step of amplifying; and / or iii. diagnosis of the subject with a drug-resistant tuberculosis infection, preferably wherein the subject is human.

21. A method of characterising a target polynucleotide, the method comprising: a. providing a polynucleotide, wherein the polynucleotide has been obtained by amplification of DNA using a plurality of oligonucleotides as defined according to any one of claims 1 to 13; b. contacting the polynucleotide with a nanopore such that the polynucleotide moves with respect to the nanopore; and c. taking one or more measurements as the polynucleotide moves with respect to the nanopore, thereby characterising the target polynucleotide.

Images