Compositions and methods for the treatment of delayed paternal mitochondrial elimination (PME)

Abstract

Methods and compositions for treating a disease or condition caused by the delay of paternal mitochondrial elimination (PME) resulting in biparental mitochondrial inheritance.

Description

[0001] COMPOSITIONS AND METHODS FOR THE TREATMENT OF DELAYED PATERNAL MITOCHONDRIAL ELIMINATION (PME)

[0002] GOVERNMENT INTEREST

[0003] This invention was made with government support under grant number R35 GM118188 awarded by National Institutes of Health (NIH). The government has certain rights in the invention.

[0004] CROSS-REFERENCE TO RELATED APPLICATIONS

[0005] This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 702,789, filed October 3, 2024. The entire specification and figures of the above-referenced application are hereby incorporated, in their entirety by reference.

[0006] TECHNICAL FIELD

[0007] The present invention includes novel systems, methods, and compositions for the treatment of one or more mitochondrial diseases, and specifically mitochondrial diseases caused by delayed paternal mitochondrial elimination (PME).

[0008] BACKGROUND

[0009] In eukaryotes, cells are powered by mitochondria, which produce adenosine triphosphate (ATP) to drive many essential cellular processes (7). Perturbation of mitochondrial ATP production could compromise a myriad of physiological functions (7), leading to numerous deficiencies, including neurological, muscular, and behavioral defects. Unlike other organelles in the cell, mitochondria have their own genomic DNA (mtDNA), which encodes 13 proteins, 22 transfer RNAs (tRNA), and 2 ribosomal RNAs (rRNA) (7). Proteins encoded by mtDNA are integral components of four different protein complexes in the electron transport chain (ETC) that produces ATP (2), while mtDNA-encoded RNAs are important for mitochondrial protein synthesis (3). Since the majority of proteins in ETC are encoded by the nuclear genome (nDNA) (7), efficient ATP synthesis relies on intricate interactions and cooperations of proteins encoded by both mtDNA and nDNA (2, -7). Mutations in either nDNA, mtDNA, or both could perturb or impair such elaborate interactions and cooperations, leading to reduced ATP synthesis and compromised physiological functions (4, 5). In the nematode C. elegans, mutations in mtDNA, including a homoplasmic mutation that alters an amino acid in the ctb-1 gene, which encodes cytochrome b, and two different heteroplasmic deletion mutations that remove one or multiple mtDNA-encoded genes, all lead to reduced ATP production and similar neurological and developmental defects, including loss or reduction of multiple sensory responses, locomotion, and cognition and increased embryonic lethality (6). Moreover, these mtDNA mutations act through a cellular signaling pathway involving adenosine monophosphate (AMP)-activated protein kinase (AMPK), AAK-2, and a forkhead box class O (FOXO) transcription factor, DAF-16, to cause these deficiencies (6), suggesting that mutations in different regions of mtDNA perturb ATP synthesis and cellular signaling through the same mechanism.

[0010] Interestingly, even the heteroplasmic presence of normal mitochondria with two different mtDNA sequences in mice, which differ by 91 nucleotides, can cause adverse physiological effects, including reduced activity and metabolism, impaired cognition, and altered behaviors, indicating that homoplasmic mitochondria are preferred in animals (7). The preference for homoplasmic mitochondria is widespread during animal development, as in most animals mtDNA is inherited maternally and paternal mitochondria are eliminated shortly after fertilization (8-17). Although the tight interactions and optimal matches among proteins encoded by maternal mtDNA and nuclear genome and incompatibility between paternal mtDNA and the maternal nuclear genome have been suggested to be an important contributing factor (7, 18, 19), the true reason behind strict maternal mitochondrial inheritance remains unknown. It is known, however, that the process of paternal mitochondrial elimination (PME) involves multiple different mechanisms, including degradation of paternal mitochondria by maternal degradation machineries, proteasomes and autophagosomes, and a self-destruction mechanism in paternal mitochondria triggered by fertilization and relocation of the mitochondrial endonuclease G into the mitochondrial matrix to degrade mtDNA (10-12, 14, 15, 17, 20, 21).

[0011] Electron microscopy and high-resolution fluorescent microscopy analyses of C. elegans fertilized eggs have revealed that paternal mitochondria are depolarized and damaged right after their entry into the oocyte (20, 22). Paternal mitochondrial damages include collapse of mitochondrial cristae and permeabilization of inner and outer mitochondrial membrane (20, 22), which cause the relocation of the mitochondrial endonuclease G from the intermembrane space of paternal mitochondria to the mitochondrial matrix to degrade mtDNA, thereby accelerating the PME process. In contrast, maternal mitochondria stay intact and unaffected (20, 22). The damaged paternal mitochondria are recognized and rapidly enclosed by autophagosomes, leading to their degradation very early during embryo development, mostly in 2- or 4-cell stage embryos (20, 22). Consequently, the potential negative impact of damaged paternal mitochondria on the fertilized egg is swiftly removed. However, if one of the PME mechanisms is compromised, causing delay in removal of paternal mitochondria 10-12, 14, 15, 17, 20-22), the damaged paternal mitochondria could emit harmful factors or dysfunctional or ill-matched mitochondrial signals to interfere with the normal cellular functions (7, 18, 19). Indeed, loss of the paternal cps-6 gene, which encodes the C. elegans mitochondrial endonuclease G, causes delayed removal of paternal mitochondria and increased lethality of cross-fertilized embryos {20), when paternal mitochondria carry mutant mtDNA or mtDNA with a slightly different sequence from another wild-type C. elegans strain. In humans, a rare clinical case of a patient carrying paternal mtDNA in his muscles that also had a 2 base pair mtDNA deletion in the ND2 gene was reported {23). The patient had severe exercise intolerance and mitochondrial myopathy. In another study, biparental inheritance of mtDNA in three unrelated families was reported and affected patients showed various symptoms, including fatigue, myopathy, neuropathy and developmental delay {24). Whether the clinical symptoms observed in these two reports are due to persistent paternal mtDNA remains to be determined {25-28). Moreover, several subsequent studies could not find additional evidence of paternal mitochondrial inheritance in humans {28-30), indicating that it could be an extremely rare event, if not impossible. These studies reflect the scarcity of experimental systems and the extreme difficulty in studying the physiological significance of maternal mitochondrial inheritance.

[0012] As described below, Applicants investigate the physiological consequences of delayed removal of paternal mitochondria and the underlying molecular and cellular mechanisms, especially in the setting of modest delay of PME, in which paternal mitochondria do not persist in larval and adult animals.

[0013] SUMMARY OF THE INVENTION

[0014] Rapid elimination of paternal mitochondria following fertilization is a conserved event in most animals, but its physiological significance remains unclear. Applicants find that modest delay of paternal mitochondrial elimination (PME) in C. elegans embryos surprisingly impairs mating and cognition of adult animals and alters their locomotion behaviors. Interestingly, delayed PME causes decreased adenosine triphosphate (ATP) levels in early embryos, which lead to impaired physiological functions of adult animals through an energy-sensing pathway mediated by an adenosine monophosphate (AMP)-activated protein kinase, AAK-2, and a forkhead box class O (FOXO) transcription factor, DAF-16. Treatment of PME-delayed animals with MK-4, a subtype of vitamin K2 that can improve mitochondrial ATP production, restores ATP levels in early embryos, and rescues physiological defects of adult animals. Applicants results suggest that moderate PME delay during embryo development adversely affects crucial physiological functions in adults, which could be evolutionarily disadvantageous. These observations provide mechanistic explanations for the need to swiftly remove paternal mitochondria early during embryo development.

[0015] In one aspect, a therapeutically effective amount of vitamin MK-4 can treat delayed PME by increasing mitochondrial ATP production within the mitochondria of a subject in need thereof. In another aspect, a therapeutically effective amount of vitamin MK-4 can treat one or more symptoms of delayed PME by increasing mitochondrial ATP production within the mitochondria of a subject in need thereof.

[0016] Additional aspects of the invention will be evident from the specification, figures, and claims provided herein.

[0017] BRIEF DESCRIPTION OF DRAWINGS

[0018] FIG. 1A-H. Impaired associative learning and memory in adults that experienced embryonic PME delay. (A) Schematic diagram of C. elegans mtDNA, the uaDf5 deletion, the ctb-l(tm4273) deletion, primers used in the nested PCR assays to detect the uaDf5 detection, and the sizes of PCR products expected from N2 and uab)f5 animals. (B to D) PCR and electrophoresis analyses to detect the presence of paternal mtDNA carrying uaDf5 (B), ctb- l(tm4273) (C), or from Bristol (BR) N2 animals (D) in cross-progeny 1.5-fold embryos, LI larva, or day 1 (DI) adults derived from the indicated crosses. All males carried smls42, an integrated sur-5p::sur-5::gfp transgene that drives GFP expression in most developmental stages and is used to track cross progeny. Ten cross-fertilized (GFP positive) embryos or animals were subjected to PCR analysis in each cross. Expected sizes of ctb-l(tm4273) / + and HA mtDNA PCR products are illustrated in fig. 5B and 5D. (E) A flow chart showing key steps of the 2-nonanone associative learning and memory assay. One portion of well-fed adult day 1 animals were tested to determine their naive response latency (Tnaive) to 1 :25 diluted 2-nonanone in DMSO. The others were subjected to the response latency (T) test after going through a 2-nonanone and food associative training process, including 1 hour each of starvation, conditioning, and holding on food without 2- nonanone. Learning index = (T - Tnaive) / Tnaive. (F to H) Learning indexes of animals in 2-nonanone associative learning and memory assays. Day 1 adult hermaphrodites alone or cross-fertilized adult hermaphrodites from the indicated crosses were tested. All males carried smls42. The number of animals examined is indicated inside or above the bar. Data are mean ± SEM; ** P < 0.01, *** P < 0.001 (unpaired Student t test); ns, not significant. BR cps-6(tm3222) and HA cps-6(sm493) alleles were used where indicated.

[0019] FIG. 2A-E. Embryonic PME delay impairs mating efficiency of adult males and alters activity patterns of adult animals. (A) A schematic diagram showing the assay for male mating efficiency using fog-2(q71) females. Feminized fog-2(q71) animals produce only eggs and no sperm and could not conceive if no male is present. In each mating plate, five fog-2(q71) females were placed with one day 2 adult male and allowed to mate for 1.5 hours. The number of conceived fog-2(q71) females with eggs in the uterus was then scored using a Nomarski microscope. The mating efficiency (%) of the tested male is determined by the number of conceived fog-2 females / 5xl00%. (B) Mating efficiencies of Fl males from the indicated crosses. The number of F 1 males tested in each cross is shown inside or above the bar. (C) Representative movement tracks of day 1 adult hermaphrodite animals or day 1 adult hermaphrodite cross progeny from the indicated crosses. In each experiment, 10 adult animals were allowed to freely move in a testing NGM plate that had been seeded with a thin layer of OP50 bacteria and tracked by the Wormlab Acquisition System. Each recording time was 1 minute. (D and E) Peristaltic speed (D) and peristaltic track length (E) of hermaphrodite animals or hermaphrodite cross progeny from the indicated crosses are shown. Each recording time was 1 minute. The number of animals analyzed in each experiment is shown inside the bar. In (B), (D) and (E), data are mean ± SEM; *P < 0.05, ** < 0.01, ** P < 0.001 (unpaired Student t test); ns, not significant. cps-6(tm3222) was used where cps-6 is indicated, while cps-6(sm493) was used where HA cps-6 is indicated.

[0020] FIG. 3A-F. Embryonic PME delay causes decreased ATP levels in early embryos, leading to deficiencies in cognition, mating, and activity patterns in adult animals. (A) Representative images showing the fluorescence intensity of ATP sensor, BioTracker ATP -Red, in cross-fertilized embryos (16 to 32 cell stage) from the indicated crosses without or with 2 mM MK-4 treatment. Scale bar, 10 pm. (B) The relative fluorescent intensity of BioTracker ATP -Red in cross-fertilized embryos from the indicated crosses without or with 2 mM MK-4 treatment. The number of embryos measured in each cross and condition is shown inside the bar. The relative fluorescent intensity value of cross-fertilized embryos from mating of N2 males and N2 hermaphrodites without MK-4 treatment was set at 1 and used to normalize the fluorescent intensity values of cross-fertilized embryos from other crosses. (C) Learning indexes of day 1 adult cross progeny from the indicated crosses without or with 2 mM MK-4 treatment in 2-nonanone associative learning and memory assays. The number of animals tested in each cross and condition is shown inside or above the bar. (D) Mating efficiencies of day 2 Fl males from the indicated crosses without or with 2 mM MK-4 treatment. The number of males tested in each cross and condition is shown inside the bar. (E and F) Peristaltic speed (E) and peristaltic track length (F) of day 1 adult hermaphrodite cross progeny from the indicated crosses without or with 2 mM MK-4 treatment. Each recording time was 1 minute. The number of animals analyzed in each cross and condition is shown inside the bar. In (B to F), data are mean ± SEM; * P < 0.05, ** P < 0.01, *** P < 0.001 (unpaired Student t test); ns, not significant. cps-6(tm3222) was used where cps-6 is indicated.

[0021] FIG. 4A-F. The AMPK-FOXO pathway is involved in mediating functional deficiencies of adult animals caused by embryonic delay of PME. (A and B) Peristaltic speed (A) and peristaltic track length (B) of day 1 adult hermaphrodite cross progeny from the indicated crosses. Each recording time was 1 minute. The number of animals analyzed in each cross is indicated inside the bar. (C) Relative GFP fluorescence intensity in animals expressing AAK- 2::GFP or DAF-16::GFP and fed with control RNAi bacteria only, 1% aak-2 RNAi bacteria, or 1% daf-16 RNAi bacteria (the last two mixed with 99% control RNAi bacteria). The number of animals measured is indicated inside the bar. (D) Learning indexes of day 1 adult hermaphrodite cross progeny from the indicated crosses treated with control RNAi bacteria, 1% aak-2 RNAi bacteria, or 1% daf-16 RNAi bacteria, respectively, in 2-nonanone associative learning and memory assays. The number of animals tested in each cross and RNAi condition is indicated inside or above the bar. (E and F) Mating efficiencies of day 2 Fl males from the indicated crosses (E) or indicated crosses treated with control RNAi bacteria, 1% aak-2 RNAi bacteria, or 1% daf-16 RNAi bacteria (F). The number of F l males tested is shown inside the bar. In all panels, data are mean ± SEM; * P < 0.05, ** P < 0.01, *** P < 0.001 (unpaired Student / test); ns, not significant. cps-6(tm3222), aak-2(ok524) and daf-16(mu86) were used where they are indicated.

[0022] FIG. 5A-H. Detection of uaDf5, ctb-l(tm4273), and BR N2 mtDNA. (A, C, E) Specific DNA electrophoresis bands indicating the presence of uaDf5 (A), ctb-l(tm4273) (C), and BR N2 (E) mtDNA in cross-fertilized embryos or animals at the indicated developmental stage from the indicated crosses. For PCR controls, hermaphrodite animals of the indicated genotype were used as templates. (B) Schematic diagrams showing the C. elegans BR N2 mtDNA, the 782 bp ctb- l(tm4273) deletion, primers used in nested PCR assays to detect ctb-l(tm4273), the sites of two restriction enzymes present in N2 mtDNA but absent in ctb-l(tm4273) mtDNA, and the sizes of PCR products in two-rounds of PCR analysis combined with restriction enzyme digestion before the 2ndround PCR. The PCR products amplified from N2 animals but not those from ctb- l(tm4273) animals after the 1stround of PCR analysis were cut into pieces by two restriction enzymes (SSP I and Hind III) and resulted in no amplification from the N2 samples in the 2ndround of PCR analysis. (D) Sequence-specific primers were used in the 1stround of nested PCR analysis to selectively amplify from N2 mtDNA, but not from HA mtDNA. The 3' end of the primers are designed to have the maximal numbers of mismatched base pairs (shown in red) with HA mtDNA, which effectively prevents amplification from HA mtDNA, but allows amplification from N2 mtDNA. The size of the PCR product in each round of nested PCR analysis is shown. (F to H) Specific PCR products amplified from uaDf5 / \ (F), ctb-l(tm4273) / \ (G), and BR N2 (H) templates at a series of dilutions as indicated by nested PCR analysis. The original 10 pl DNA templates were made from 4 adult day-one hermaphrodites. 2 pl of DNA templates from each dilution were used in each PCR reaction. All males carried smls42. cps-6(tm3222) was used where cps-6 is indicated.

[0023] FIG. 6A-G. Embryonic PME delay doesn’t affect the sensory response of animals to multiple chemicals. (A) A schematic diagram of the “dry drop test”. A micro-droplet containing the repellent of interest is dropped onto the agar approximately 1 mm away from the head of a forward moving animal. The animal will move through the repellent-containing region (i) or turn back to avoid the repellent-containing region (ii). The avoidance index is calculated as navoid / ntest, where navoid is the number of animals turning back when they encounter the repellent containing region, and ntest is the total number of animals tested. (B-D) Avoidance response of adult day one animals of the indicated genotype or cross progeny from the indicated crosses to 50 mM glycerol (B), 100 pM CuCk (C) and 150 mMNaCl (D). The number of independent experiments conducted is indicated inside the bar. In each experiment, ten animals were tested. (E) A schematic diagram of the “2-nonanone response latency test”. A 20 pl pipette tip containing 5 pl repulsive odorant 2- nonanone (1 :10 diluted in DMSO) is placed in front of a forward moving animal. The response latency is recorded as the time from the odorant presentation to the initiation of a reversal by the animal. (F) Response latency of adult day one animals of the indicated genotype or cross progeny from the indicated crosses to 2-nonanone (1 : 10 diluted in DMSO). The number of animals tested in each experiment is indicated inside the bar. (G) Locomotion assay. The number of lateral swimming movements (thrashes) in the M9 buffer in one minute was scored in L4 larvae of the indicated genotype or L4 cross progeny from the indicated crosses. The number of animals tested in each genotype or cross is indicated in the bar. In (B), (C), (D), (F), and (G), data are mean ± SEM; ns, not significant. All males carried smls42. cps-6(tm3222) was used where cps-6 is indicated.

[0024] FIG. 7. Response latency of animals in 2-nonanone associative learning and memory assays. Response latency of day 1 adult hermaphrodites alone or hermaphrodite cross progeny from the indicated crosses to 2-nonanone (1 :25 diluted in DMSO) without or with 2-nonanone and food associative training. All males carried smls42. The number of animals tested in each experiment is indicated inside the bar. Data are mean ± SEM; ** P < 0.01, *** P < 0.001 (unpaired Student / test); ns, not significant. cps-6(tm3222) was used where cps-6 is indicated.

[0025] FIG. 8A-B. Paternal mitochondria do not fuse or mix with maternal mitochondria. (A) A representative image of an embryo stained by MitoTracker Red. Scale bars, 2 pm. (B) MTR- stained paternal mitochondria do not colocalize with TOMM-20::GFP-labeled maternal mitochondria in cross-fertilized embryos from the indicated cross. Representative images of embryos at three different embryonic stages are shown. Dashed rectangles highlight the areas enlarged. Scale bars, 2 pm. HA cps-6(sm493) and BR tomm-20(zjul04\tomm-20:: fp ) alleles were used.

[0026] FIG. 9. MK-4 treatment doesn’t affect PME. Specific uaDf5 PCR products amplified from cross-fertilized embryos or larvae from the indicated cross, cps-6(tm3222) smls42; uaDf5 '+ males with N2 hermaphrodites, and at the indicate developmental stage without (lanes 1-3) or with 2 mM MK-4 treatment (lanes 4-6) are shown.

[0027] FIG. 10A-H. Reduced AAK-2 or DAF-16 gene dosage or MK-4 treatment reverses changes of activity patterns in adult animals caused by embryonic delay of PME. (A-H) Representative movement tracks of day 1 adult hermaphrodite cross progeny from the indicated crosses and without or with 2 mM MK-4 treatment (C and D). Each box shows the tracks of 10 animals during one-minute tracking. All males carried smls42. cps-6(tm3222), aak-2(ok524) and daf-16(mu86) SNWCQ used where indicated. FIG. 11A-C. Reduced expression of aak-2 and daf-16 by limited RNAi can improve the cognitive function of PME-delayed adult animals. (A) Learning indexes of day 1 adult hermaphrodites of the indicated genotype or hermaphrodite cross progeny from the indicated crosses in 2-nonanone associative learning and memory assays. (B and C) Learning indexes of day 1 adult hermaphrodite cross progeny from the indicated cross, cps-6 smls42; uaDf5 / + males with N2 hermaphrodite, fed with OP50 bacteria (None), control RNAi bacteria (Ctrl), or different dilutions of aak-2 RNAi bacteria (B) and daf-16 RNAi bacteria (C) at the indicated percentages. In all panels, data are mean ± SEM; *P < 0.05, **P < 0.01, ***p < 0.001 (unpaired Student t test). The number of worms tested in each experiment is indicated inside or above the bar. cps- 6(tm3222), aak-2(ok524) and daf-16(mu86) were used where indicated.

[0028] FIG. 12A-B. MK-4 treatment and reduced gene dosage of components in the AMPK pathway prevent increased embryonic death caused by delay of PME. (A and B) The lethality rate of cross-fertilized embryos from the indicated crosses (B) or from the indicated crosses without or with 2 mM MK-4 treatment (A) was scored at 25°C. n > 1000 embryos in each cross and treatment condition. Data are mean ± SEM; *P < 0.05, **P < 0.01 (unpaired Student t test); ns, not significant. All males carried smls42. cps-6(tm3222), aak-2(ok524) and daf-16(mu86) were used where indicated.

[0029] DETAILED DESCRIPTION OF INVENTION

[0030] In one embodiment, the present invention includes methods and compositions for treating a disease or condition caused by the delay of paternal mitochondrial elimination (PME) resulting in biparental mitochondrial inheritance. In a preferred embodiment, the present invention includes a method of treating delayed PME in a subject in need thereof, comprising administering a therapeutically effective amount of Vitamin MK-4. In another preferred embodiment, the present invention includes a method of treating a delayed PME disease in a subject in need thereof, comprising administering a pharmaceutical composition including a therapeutically effective amount of Vitamin MK-4, and a pharmaceutically acceptable carrier.

[0031] In one preferred embodiment, the present invention includes a method of treating delayed PME in a subject in need thereof, comprising administering a therapeutically effective amount of Vitamin MK-4 according to Formula (I): or a pharmaceutically acceptable salt thereof.

[0032] In another preferred embodiment, the present invention includes a method of increasing mitochondrial ATP production in a subject in need thereof, comprising administering a therapeutically effective amount of Vitamin MK-4 according to Formula (I): or a pharmaceutically acceptable salt thereof.

[0033] In another preferred embodiment, the present invention includes a method of treating a delayed PME in a subject in need thereof, comprising administering a pharmaceutical composition including a therapeutically effective amount of the compound according to Formula (I), or a pharmaceutically acceptable salt thereof, and optionally a pharmaceutically acceptable carrier.

[0034] In another preferred embodiment, the present invention includes a method of increasing mitochondrial ATP levels resulting from delayed PME, and preferably a human cell, comprising contacting the cell with a therapeutically effective amount of a compound according to Formula (I). In another preferred embodiment, the present invention includes a method of increasing ATP levels in a cell resulting from delayed PME, and preferably a human cell, comprising contacting the cell with a pharmaceutical compositions having a therapeutically effective amount of compound according to Formula (I), and optionally a pharmaceutically acceptable carrier.

[0035] In another preferred embodiment, the present invention includes a method of increasing mitochondrial ATP levels, rescuing defects resulting from delayed PME, further resulting in the decreased activity of the cellular signaling pathway involving adenosine monophosphate (AMP)- activated protein kinase (AMPK), namely AAK-2, and a forkhead box class O (FOXO) transcription factor, namely DAF-16, in a subject in need thereof, the method comprising administering a pharmaceutical composition including a therapeutically effective amount of the compound according to Formula (I), or a pharmaceutically acceptable salt thereof, and optionally a pharmaceutically acceptable carrier.

[0036] In another preferred embodiment, the present invention includes a method of increasing mitochondrial ATP levels, correcting defects resulting from delayed PME, further resulting in the decreased activity of the cellular signaling pathway involving adenosine monophosphate (AMP)- activated protein kinase (AMPK), namely AAK-2, and a forkhead box class O (FOXO) transcription factor, namely DAF-16, in a cell, and preferably a human cell, the method comprising contacting the cell with a pharmaceutical compositions having a therapeutically effective amount of compound according to Formula (I), and optionally a pharmaceutically acceptable carrier.

[0037] As used herein, “delayed paternal mitochondrial elimination (PME) refers to a disease, disorder, or condition in which the physiological functions of a subject or the functions of a subject’s mitochondria become impaired or dysfunctional due to the delay in the elimination of paternally mitochondria resulting in biparental mtDNA presence. Moreover, “delayed PME” also refers to a disease or condition that can be treated through the administration of a therapeutically effective amount of vitamin Mk-4. As further described herein, delayed PME can result in one or more of the following symptoms in a subject: fatigue, mitochondrial myopathy, neuropathy, developmental delay, neurological delays, neurological impairment, stunted growth, loss of muscle coordination, seizures, autism spectrum disorder, impaired vision, impaired hearing, learning disabilities, heart, liver, or kidney disease, respiratory difficulty / failure, stroke, and movement disorders.

[0038] The term “compound,” or “composition, “ or “compound of the invention” includes all solvates, complexes, polymorphs, radiolabeled derivatives, tautomers, stereoisomers, and optical isomers of the compound of the invention having a structure according to the structure of MK-4, and salts thereof, unless otherwise specified.

[0039] The term “treatment,” or “treating” as used herein in the context of treating a condition, pertains generally to treatment and therapy, whether of a human or an animal (e.g., in veterinary applications), in which some desired therapeutic effect is achieved, for example, the inhibition of the progress of the condition, and includes a reduction in the rate of progress, a halt in the rate of progress, amelioration of the condition, and cure of the condition. Treatment as a prophylactic measure (i.e., prophylaxis) is also included. As used herein, treatment is provided in the context of treating of delayed PME in a subject in need thereof. A “pharmaceutical composition” or “pharmaceutical composition of the invention” refers to a compound of the invention or a pharmaceutically acceptable salt, solvate, hydrate or prodrug thereof as an active ingredient, and at least one pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition comprises two or more pharmaceutically acceptable carriers and / or excipients. In other embodiments, the pharmaceutical composition further comprises at least one additional antibiotic, such as through a co-treatment. As used herein, a “pharmaceutically acceptable carrier” refers to a carrier or diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered composition of the invention. The pharmaceutical acceptable carrier may comprise any conventional pharmaceutical carrier or excipient. The choice of carrier and / or excipient will to a large extent depend on factors such as the particular mode of administration, the effect of the carrier or excipient on solubility and stability, and the nature of the dosage form.

[0040] The term “pharmaceutically acceptable carrier” as used herein further pertains to compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgement, suitable for use in contact with the tissues of a subject (e.g., human) without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. Each carrier, excipient, etc. must also be “acceptable” in the sense of being compatible with the other ingredients of the formulation. Suitable carriers, diluents, excipients, etc. can be found in standard pharmaceutical texts. See, for example, “Handbook of Pharmaceutical Additives,” 2nd Edition (eds. M. Ash and I. Ash), 2001 (Synapse Information Resources, Inc., Endicott, N.Y., USA), “Remington's Pharmaceutical Sciences”, 20th edition, pub. Lippincott, Williams & Wilkins, 2000; and “Handbook of Pharmaceutical Excipients”, 2nd edition, 1994.

[0041] Suitable pharmaceutically acceptable carriers include inert diluents or fillers, water, and various organic solvents (such as hydrates and solvates). The pharmaceutical compositions may, if desired, contain additional ingredients such as flavorings, binders, excipients, and the like. Thus, for oral administration, tablets containing various excipients, such as citric acid may be employed together with various disintegrants such as starch, alginic acid and certain complex silicates and with binding agents such as sucrose, gelatin, and acacia. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols. Additionally, lubricating agents such as magnesium stearate, sodium lauryl sulfate and talc are often useful for tableting purposes. Solid compositions of a similar type may also be employed in soft and hard filled gelatin capsules. Non-limiting examples of materials, therefore, include lactose or milk sugar and high molecular weight polyethylene glycols. When aqueous suspensions or elixirs are desired for oral administration the active compound therein may be combined with various sweetening or flavoring agents, coloring matters or dyes and, if desired, emulsifying agents or suspending agents, together with diluents such as water, ethanol, propylene glycol, glycerin, or combinations thereof.

[0042] The pharmaceutical composition of the invention may, for example, be in a form suitable for oral administration as a tablet, capsule, pill, powder, sustained release formulations, solution suspension, for parenteral injection as a sterile solution, suspension, or emulsion, for topical administration as an ointment or cream or for rectal administration as a suppository. The pharmaceutical composition may be in unit dosage forms suitable for single administration of precise dosages. Exemplary parenteral administration forms include solutions or suspensions of active compounds in sterile aqueous solutions, for example, aqueous propylene glycol or dextrose solutions. Such dosage forms may be suitably buffered, if desired.

[0043] A pharmaceutical composition of the invention may be administered as single or multiple agents, for example a pharmaceutical composition of the compound of the invention, or a pharmaceutical composition of the compound of the invention and a second therapeutic compound or agent. In some embodiments, the methods the pharmaceutical composition of the invention can be used to treat a delayed PME, or one or more of its symptoms. Pharmaceutical compositions suitable for the delivery of the compound of the invention as described herein, and methods for their preparation will be readily apparent to those skilled in the art. Such compositions and methods for their preparation can be found, for example, in 'Remington's Pharmaceutical Sciences', 19th Edition (Mack Publishing Company, 1995), the disclosure of which is incorporated herein by reference in its entirety.

[0044] The active compound MK-4 can be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it can be enclosed in hard or soft shell gelatin capsules, or it can be compressed into tablets, or it can be incorporated directly with the food of the diet. For oral therapeutic administration, the active compound may be incorporated with excipient and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparation can contain at least 0.1% of active compound. The percentage of the compositions and preparation can, of course, be varied and can conveniently be between about 1 to about 10% of the weight of the unit. The amount of active compound in such therapeutically useful compositions is such that a suitable dosage will be obtained. Typical compositions or preparations according to the invention are prepared such that an oral dosage unit form contains from about 1 to about 1000 mg of active compound.

[0045] Pharmaceutical compositions for use in the methods of the present invention may be prepared by any of the methods of pharmacy, but all methods include the step of bringing the active ingredient into association with the carrier which constitutes one or more necessary ingredients. In general, the compositions are prepared by uniformly and intimately admixing the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product into the desired presentation. For example, a tablet may be prepared by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active or dispersing agent. Molded tablets may be made by molding, in a suitable machine, a mixture of the powdered compound moistened with an inert liquid diluent.

[0046] The compound of the invention can also be administered parenterally. Solutions of the active compound as a free base or pharmacologically acceptable salt can be prepared in water suitably mixed with a surfactant such as hydroxypropylcellulose. Dispersion can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

[0047] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It can be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent of dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, e.g., sugars or sodium chloride. Prolonged absorption of the injectable compositions of agents delaying absorption, e g., aluminum monostearate and gelatin.

[0048] Sterile injectable solutions are prepared by incorporating the compound of the invention in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by fdtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile-filtered solution thereof.

[0049] The compound of the invention can be administered to a subject alone or in combination with pharmaceutically acceptable carriers, as noted above, the proportion of which is determined by the solubility and chemical nature of the compound, chosen route of administration and standard pharmaceutical practice. The physician can readily determine the dosage of the present therapeutic agents which will be most suitable for prophylaxis or treatment, and it will vary with the form of administration and the particular compound chosen, and also, it will vary with the particular patient under treatment. The physician will generally wish to initiate treatment with small dosages by small increments until the optimum effect under the circumstances is reached. The therapeutic dosage can generally be from about 0.1 to about 1000 mg / day, and preferably from about 10 to about 100 mg / day, or from about 0.1 to about 50 mg / Kg of body weight per day and preferably from about 0.1 to about 20 mg / Kg of body weight per day and can be administered in several different dosage units. Higher dosages, on the order of 2* to about 4x, may be required for oral administration.

[0050] A “therapeutically effective amount” means the amount of a compound that, when administered to a subject for treating delayed PME is sufficient to effect such treatment for the disease or one or more of its symptoms. The “therapeutically effective amount” will vary depending on the compound, the disease and its severity and the age, weight, etc., of the mammal to be treated. “Treating” or “treatment” of a delayed PME includes: (1) preventing the delayed PME, i.e., causing the clinical symptoms of delayed PME not to develop in a subject that may be exposed to or predisposed to the condition but does not yet experience or display symptoms of the same; (2) inhibiting delayed PME, i.e., arresting or reducing the development of the disease or its clinical symptoms; or (3) relieving delayed PME, i.e., causing regression of the disease or its clinical symptoms.

[0051] As noted above, the compound of the invention, or pharmaceutical composition comprising the compound of the invention, may be administered to a “subject,” and preferably a human or embryo at any stage of development from fertilization onward, by any convenient route of administration, whether systemically / peripherally or at the site of desired action, including but not limited to, oral (e.g. by ingestion); topical (including e.g. transdermal, intranasal, ocular, buccal, and sublingual); pulmonary (e.g. by inhalation or insufflation therapy using, e.g. an aerosol, e.g. through mouth or nose); rectal; vaginal; parenteral, for example, by injection, including subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subcuticular, intraarticular, subarachnoid, and intrasternal; by implant of a depot, for example, subcutaneously or intramuscularly. The subject may be a eukaryote, an animal, a vertebrate animal, a mammal, a rodent (e.g., a guinea pig, a hamster, a rat, a mouse), murine (e.g., a mouse), canine (e.g., a dog), feline (e.g., a cat), equine (e.g., a horse), a primate, simian (e.g., a monkey or ape), a monkey (e.g., marmoset, baboon), an ape (e.g., gorilla, chimpanzee, orangutang, gibbon), or a human.

[0052] It will be appreciated that appropriate dosages of the active compound, and compositions comprising the active compound, can vary from patient to patient. Determining the optimal dosage will generally involve the balancing of the level of therapeutic benefit against any risk or deleterious side effects of the treatments of the present invention. The selected dosage level will depend on a variety of factors including, but not limited to, the activity of the particular compound, the route of administration, the time of administration, the rate of excretion of the compound, the duration of the treatment, other drugs, compounds, and / or materials used in combination, and the age, sex, weight, condition, general health, and prior medical history of the patient. The amount of compound and route of administration will ultimately be at the discretion of the physician, although generally the dosage will be to achieve local concentrations at the site of action which achieve the desired effect without causing substantial harmful or deleterious side-effects. Administration in vivo can be effected in one dose, continuously or intermittently (e.g., in divided doses at appropriate intervals) throughout the course of treatment. Methods of determining the most effective means and dosage of administration are well known to those of skill in the art and will vary with the formulation used for therapy, the purpose of the therapy, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician.

[0053] The term “pharmaceutically acceptable salt” means a salt which is acceptable for administration to a patient, such as a mammal, such as human (salts with counterions having acceptable mammalian safety for a given dosage regime). Such salts can be derived from pharmaceutically acceptable inorganic or organic bases and from pharmaceutically acceptable inorganic or organic acids. “Pharmaceutically acceptable salt” refers to pharmaceutically acceptable salts of a compound, which salts are derived from a variety of organic and inorganic counter ions well known in the art and include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like; and when the molecule contains a basic functionality, salts of organic or inorganic acids, such as hydrochloride, hydrobromide, formate, tartrate, besylate, mesylate, acetate, maleate, oxalate, and the like.

[0054] The term “salt thereof’ means a compound formed when a proton of an acid is replaced by a cation, such as a metal cation or an organic cation and the like. Where applicable, the salt is a pharmaceutically acceptable salt, although this is not required for salts of intermediate compounds that are not intended for administration to a patient. By way of example, salts of the present compound include those wherein the compound is protonated by an inorganic or organic acid to form a cation, with the conjugate base of the inorganic or organic acid as the anionic component of the salt. For therapeutic use, salts of the compound are those wherein the counter-ion is pharmaceutically acceptable. However, salts of acids and bases which are non-pharmaceutically acceptable may also find use, for example, in the preparation or purification of a pharmaceutically acceptable compound.

[0055] Unless otherwise stated, structures depicted herein are also meant to include all isomeric (e.g., enantiomeric, diastereomeric, and geometric (or conformational)) forms of the structure; for example, the R and S configurations for each asymmetric center, Z and E double bond isomers, and Z and E conformational isomers. Therefore, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the present compound are within the scope of the invention. Unless otherwise stated, all tautomeric forms of the compound of the invention are within the scope of the invention. Additionally, unless otherwise stated, structures depicted herein are also meant to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures including the replacement of hydrogen by deuterium or tritium, or the replacement of a carbon by a 13C- or 14C-enriched carbon are within the scope of this invention. Such compounds are useful, for example, as analytical tools, as probes in biological assays, or as therapeutic agents in accordance with the present invention. The term “stereoisomer” refers to a molecule that is an enantiomer, diastereomer or geometric isomer of a molecule. Stereoisomers, unlike structural isomers, do not differ with respect to the number and types of atoms in the molecule's structure but with respect to the spatial arrangement of the molecule's atoms. Examples of stereoisomers include the (+) and (-) forms of optically active molecules.

[0056] As used herein the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a compound” includes a plurality of such compounds, and reference to “the method” includes reference to one or more methods, method steps, and equivalents thereof known to those skilled in the art, and so forth. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. Hence “comprising A or B” means including A, or B, or A and B. Furthermore, the use of the term “including,” as well as other related forms, such as “includes” and “included,” is not limiting.

[0057] The term “about” as used herein is a flexible word with a meaning similar to “approximately” or “nearly.” The term “about” indicates that exactitude is not claimed, but rather a contemplated variation. Thus, as used herein, the term “about” means within 1 or 2 standard deviations from the specifically recited value, or ± a range of up to 20%, up to 15%, up to 10%, up to 5%, or up to 4%, 3%, 2%, or 1 % compared to the specifically recited value.

[0058] The invention now being generally described will be more readily understood by reference to the following examples, which are included merely for the purposes of illustration of certain embodiments of the embodiments of the present invention. The examples are not intended to limit the invention, as one of skill in the art would recognize from the above teachings and the following examples that other techniques and methods can satisfy the claims and can be employed without departing from the scope of the claimed invention. Indeed, while this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.

[0059] EXAMPLES

[0060] Example 1 : Summary of Results.

[0061] PME is a highly conserved event that occurs in almost all animals (5-77), however, the reason for such a conserved developmental process remains poorly understood. To simulate biparental mitochondrial inheritance and to probe the consequence of defective PME, mice containing an admixture of two different sets of normal mtDNAs were generated by fusion of cytoplasts and embryonic stem cells containing different mtDNAs (7). These mice with heteroplasmic mtDNAs exhibit reduced activity and respiration, impaired cognition, altered behaviors, and other physiological abnormalities (7), suggesting that coexistence of two different mtDNAs in animals is deleterious and likely selected against during evolution. In C. elegans, moderate delay in clearance of paternal mitochondria with a mtDNA deletion or with a slightly different wild-type mtDNA sequence, but not those with the same mtDNA sequence, causes increased embryonic lethality (20), indicating that even mild delay of PME and brief coexistence of two slightly different mtDNAs could negatively impact embryo development. In humans, a rare case of paternal mitochondrial inheritance in muscles is associated with severe exercise intolerance and myopathy, but the interpretation is complicated by a 2-bp frameshift deletion in the ND2 gene in paternal mtDNA (23), which encodes a complex I component in the mitochondrial electron transport chain. In another report, biparental mitochondrial inheritance was suggested to occur in several patients with various neurological, muscular, and developmental deficiencies (27-27), but it is unclear if biparental mtDNA presence is the cause of these deficiencies. Moreover, several similar studies did not find evidence of paternal mitochondrial inheritance in humans (28-30). Therefore, the major questions of why maternal mitochondrial inheritance is nearly absolute and the physiological significance of PME remain unanswered.

[0062] In C. elegans, the maternal autophagy and proteasome degradation machineries and the paternal mitochondrial endonuclease CPS-6 are involved in removal of paternal mitochondria (10- 12, 20) and could potentially be manipulated to probe the significance of PME. Compared with mutants defective in autophagy or proteasomal functions but having various defects that would complicate the analysis (50, 51), the cps-6 mutant by itself is superficially wild-type, and can lead to brief coexistence of maternal and paternal mitochondria that interferes with embryo development (20), which presents a unique opportunity to analyze the impact of delayed PME on the functions and development of animals. Therefore, Applicants investigated whether the short paternal mitochondrial presence in embryos might affect other physiological functions of animals, especially those adult animals that no longer have paternal mitochondria. Applicants found that adult animals that had experienced embryonic PME delay showed no detectable defects in less complex activities, such as passive swimming and chemical sensations (fig. 6, A to G). However, for more complex and advanced physiological functions that involve multiple cells or neurons, cell-cell interactions, cellular processes and signaling, such as mating, learning and memory, and activity patterns, abnormal persistence of paternal mitochondria, even briefly during embryo development, has an enduring negative impact. Specifically, short embryonic delay in removal of paternal mitochondria from a different wild-type strain with a slightly different mtDNA sequence suppressed hybrid advantage in mating (Fig. 2, A and B), impaired associative learning and memory (Fig. 1, E to H), and altered activity patterns of hybrid adult animals (Fig. 2, C to E), in addition to causing increased death of affected embryos (fig. 12). These findings provide crucial and unexpected in vivo evidence that brief embryonic presence of paternal mitochondria can have adverse effects on important physiological functions of adults and proper development of embryos. When such adverse effects negatively affect reproduction, survival, development, and adaptation of animals to the environment, they could drive the evolution of the PME process and strict maternal mitochondrial inheritance.

[0063] It is interesting that the detrimental effects of delayed PME are observed only in cross progeny of parents from different strains with slightly different mtDNA sequences or parents from the same strain but one with a deletion in paternal mtDNA, and not in cross progeny of parents from the same strain with identical paternal and maternal mtDNA sequences. These findings suggest that brief coexistence of paternal and maternal mtDNAs with some sequence variations can trigger adverse outcomes in PME-delayed animals. The mechanisms underlying this interesting phenomenon are unclear, but could be fundamental to the understanding of why maternal mitochondrial inheritance is highly conserved in most animals and why PME needs to occur. The ability to precisely edit the mtDNA genome will be crucial to analyzing how many or which variants lead to incompatibility between paternal and maternal mitochondria. Importantly, given that variations in mtDNA sequences among individuals in the same species are widespread, including humans (52, 53), these findings that a brief period of biparental mitochondrial presence can have a lasting negative impact on important physiological functions will have profound implications in understanding the roles of PME on reproduction, development, and organismal fitness, as well as diagnosis and treatment of mitochondrial diseases.

[0064] How could a brief embryonic delay of PME have a lasting impact on the functions and activities of adult animals? Applicants discovered that delayed clearance of paternal mitochondria with mutant mtDNA or a slightly different wild-type mtDNA sequence led to decreased ATP levels in early embryos (Fig. 3, A and B). Treatment of PME-delayed animals with MK-4, a subtype of vitamin K2 that can improve the efficiency of the mitochondrial respiratory chain and ATP production (6, 42), not only restored their embryonic ATP levels, but also rescued functional defects in mating, learning and memory, and activity patterns observed in adult animals (Fig. 3, A to F), suggesting that embryonic ATP reduction is the cause of the functional deficiencies observed in adults that had experienced embryonic PME delay. Since reducing the expression levels of the energy-sensing kinase, AMPK / AAK-2, and its downstream FOXO transcription factor, DAF-16 (45-47), through limited RNAi or reduced gene dosages can rescue the functional deficits of PME- delayed adult animals (Fig. 4, A to F), our finding reveals a signaling pathway involving AMPK and a FOXO transcription factor as the crucial molecular link that connects the sequential events of delayed removal of paternal mitochondria, reduced ATP production in embryos, and impaired physiological functions in adults. These findings provide important insights into why paternal mitochondria need to be cleared early during embryo development, how delayed removal of paternal mitochondria adversely affects physiological functions and behaviors of animals, and what diagnosis and potential treatments for PME-related human diseases could be. In particular, vitamin MK-4 can become a promising treatment option not only for mitochondrial diseases caused by mtDNA mutations (6), but also for PME-related symptoms and diseases.

[0065] Example 2: Loss of paternal cps-6 causes persistence of paternal mitochondria in embryos but not in larvae or adults.

[0066] Applicants used the strong loss-of-function mutation in the cps-6 gene, tm3222, to assess the impact of loss of paternal cps-6 and delayed PME to animal development and functions (20). During C. elegans embryo development, paternal mitochondria and mtDNA are rapidly eliminated before 100-cell stage embryos (10-12, 20, 22). When males of the C. elegans Bristol (BR) strain carrying a 3054 bp mtDNA deletion, uaDf5, in heteroplasmic mixture with wild-type mtDNA were mated with BR wild-type hermaphrodites (N2), paternal uaDf5 mtDNA, which can be detected by a sensitive polymerase chain reaction (PCR) method as a 557 bp specific band (Fig. 1, A and B), was not seen in 100-cell, 1.5-fold, and 4-fold stage cross-fertilized embryos (Fig. IB, lane 1, and fig. 5 A, lanes 4 and 5), confirming that paternal mitochondria were eliminated early during embryo development. By contrast, when cps-6(tm3222); uaDf5 / + males were mated with N2 hermaphrodites, paternal uaDf5 mtDNA was observed in 100-cell, 1.5-fold and 4-fold stage crossfertilized embryos (Fig. IB, lane 2, and fig. 5A, lanes 1 and 2), but was not detected in larval stage 1 (LI), larval stage 4 (L4), and day 1 adult (DI) cross progeny (Fig. IB, lanes 4 and 5, and fig. 5 A, lane 3), indicating that PME is delayed but completed by the end of embryo development. In comparison, loss of maternal cps-6 in a similar cross did not delay PME (Fig. IB, lane 3). Applicants observed identical patterns of PME delay when cps-6 mutant males carrying a 782 bp mtDNA deletion (tm4273) removing most of the ctb-1 gene were used (Fig. 1C and fig. 5, B and C), or when cps-6 mutant males were mated with a different C. elegans wild-type variant, the Hawaii (HA) strain (Fig. ID and fig. 5, D and E). In these PCR-based analyses, the ctb-l(tm4273) paternal mtDNA can be detected and distinguished from wild-type maternal mtDNA through the combination of PCR and restriction enzyme digestion (fig. 5, B and G). For the BR and HA inbreeding, the BR paternal mtDNA can be detected and distinguished from maternal HA mtDNA by PCR using BR-specific primers based on single nucleotide polymorphisms (SNPs) found in their mtDNA sequences (fig. 5, D and H). Since the nested PCR protocols that Applicants used could detect as low as a few copies of uaDf5, clb-l(tm4273), and BR paternal mtDNA, respectively, based on PCR analyses of samples from serial dilutions of four adult uaDf5 / +, ctb- l(tm4273) / +, and N2 hermaphrodites (fig. 5, F to H), Applicants conclude that paternal mtDNA was completely eliminated in larval and adult cross progeny from these crosses. Applicants call these larval and adult cross progenies that went through embryonic delay of PME but were depleted of paternal mitochondria as PME-delayed animals.

[0067] Example 3: PME-delayed animals are not defective in simple sensory responses.

[0068] Applicants investigated how delayed clearance of paternal mitochondria might affect the functions of animals. Since neurological defects are prevalent in animals with compromised or mutant mitochondria (31, 32), Applicants examined sensory responses of PME-delayed animals to several different chemicals, which involve single sensory neurons. In avoidance behavioral assays to 50 mM glycerol and 100 pM CuCE (mediated by ASH neurons; fig. 6, A to C) (33), to 150 mM NaCl (mediated by ASE neurons; fig. 6, A and D) (34), or to 1 : 10 diluted 2-nonanone (mediated by AWB neurons; fig. 6, E and F) (35), PME-delayed cross progeny from mating of N2 hermaphrodites with cps-6(tm3222), cps-6(tm3222); ual)f5 , or cps-6(tm3222); ctb-l(tm4273) / + males were indistinguishable among themselves and when compared with PME-normal cross progeny from mating of N2 hermaphrodites with N2 males or the progeny from N2 and cps- 6(tm3222) hermaphrodites alone (fig. 6, B to D, F). These results indicate that delayed removal of wild-type or compromised paternal mitochondria from the same strain does not cause detectable defects in simple sensory responses.

[0069] It has been shown that delayed PME in cross progeny from inbreeding of two different C. elegans wild-type strains, the BR strain and the HA strain, causes increased embryonic lethality (20), probably because delayed removal of BR paternal mitochondria causes incompatibility with maternal HA mitochondria, which differ by 44 bp in their mtDNA sequences (table 1). However, PME-delayed cross progeny from mating of BR cps-6(tm3222) males with HA hermaphrodites did not exhibit defects in sensory responses to different chemicals, compared with PME-normal cross progeny from mating of BR males with HA hermaphrodites or progeny of HA hermaphrodites alone (fig. 6, B to F). Together, these results indicate that embryonic PME delay does not affect simple sensory responses of adult animals to multiple chemicals.

[0070] Example 4: PME-delayed animals show impaired learning and memory.

[0071] Applicants next investigated whether delayed clearance of paternal mitochondria might affect more complex neuronal processes, such as learning and memory, which could be susceptible to subtle changes in neuronal conditions. Applicants performed the 2-nonanone associative learning and memory assay (6), in which animals would show less aversion to the repulsive odor, 2-nonanone, after food association training, and exhibit short-term associative memory (Fig. IE). The latency time (T) from the odor presentation to the initiation of an avoidance reversal by the animal was used to determine the learning index (Fig. IE and fig. 6E) (36). Both BR N2 animals and HA animals showed significantly prolonged response latencies to 2-nonanone (1 :25 diluted in DMSO) one hour after food-associated training and therefore had positive learning indexes (Fig. IF and fig. 7). The cross progeny between BRN2 males and HA hermaphrodites showed a learning index comparable to those of BR N2 animals and HA animals (Fig. IF), indicating that breeding between two different wild-type strains does not compromise learning and memory of their progeny. Interestingly, cross progeny between BR cps-6(tm3222) males and HA hermaphrodites lost associative learning and memory (Fig. IF), whereas cross progeny from a comparable cross between BR cps-6(tm3222) males and BR N2 hermaphrodites did not (Fig. IF), suggesting that delayed removal of paternal mitochondria impairs the cognitive function of the inbred offspring, but not that of the purebred offspring. Since cross progeny between BR N2 males and HA cps- 6(sm493) hermaphrodites, in which the entire coding region of the HA cps-6 gene was deleted, had normal learning index and almost identical genotype to that of the cross progeny between BR cps-6(tm3222) males and HA hermaphrodite (Fig. IF), these results indicate that delayed removal of BR paternal mitochondria with a slightly different mtDNA sequence in HA embryos causes impaired learning of inbred adult progeny.

[0072] Although delayed PME due to loss of paternal cps-6 did not affect the cognitive functions of the wild-type purebred offspring, the presence of uaDf5 or ctb-l(tm4273) mutant mitochondria in cps-6(tm3222) males caused significant reduction in learning indexes of their cross progeny with N2 hermaphrodites (Fig. 1, G and H), indicating that delayed removal of paternal mitochondria with mutated mtDNA can impair learning and memory even in the same breed. Taken together, these results suggest that delayed removal of paternal mitochondria carrying mtDNA with mutations or a slightly different DNA sequence could have a major negative impact on animals’ cognitive functions.

[0073] Example 5: Delayed PME in embryos negates hybrid advantage in mating.

[0074] Mating between C. elegans males and hermaphrodite is a complex behavior that involves multiple steps. Males start the mating process by actively seeking, contacting, and moving around hermaphrodites, locating the hermaphrodite vulva and inserting spicule, and conclude with ejaculation (37). These steps are controlled by a rather complex neuronal network composed of more than twenty neurons, including CEM, HO A, HOB, SPC, PCA, PCB, PCC, RnA and RnB (n = 1 - 9) neurons (37). Interference of the functions of each of these neurons and neuronal interactions could cause defects in mating. Applicants determined the mating efficiency of a male by placing it with five fog-2(q71) female partners, which are feminized mutant animals lacking sperm production and thus do not self-fertilize (Fig. 2A) (3S). Applicants then scored the percentage of conceived fog-2(q71) animals after 1.5 hours of mating. When first generation (Fl) male cross progeny derived from mating of N2 hermaphrodites with cps-6(tm3222); uaDf5 / + males or cps-6(tm3222); ctb-l(tm4273) / + males were placed with fog-2(q71) females, Applicants didn’t observe any difference in mating efficiency (Fig. 2B), compared with Fl male cross progeny from mating of N2 hermaphrodites with N2 males or cps-6(tm3222) males, indicating that delayed removal of wild-type or mutant paternal mitochondria in the same breed does not affect the mating efficiency of male progeny.

[0075] Although wild-type HA males showed a higher mating efficiency than wild-type BR males, the Fl hybrid males from mating of HA hermaphrodites with BR N2 males or from mating of BR N2 hermaphrodites with HA males, exhibited a significantly higher mating efficiency than both HA and BR N2 males (Fig. 2B), demonstrating a hybrid advantage in mating. Interestingly, delayed removal of BR paternal mitochondria in HA embryos due to loss of paternal cps-6 abolished this hybrid advantage in mating (Fig. 2B), as Fl hybrid males from mating of HA hermaphrodites with BR cps-6(tm3222) males showed a reduced mating efficiency comparable to that of HA males. Similarly, delayed removal of HA paternal mitochondria in BR N2 embryos due to loss of paternal cps-6 erased this hybrid advantage in mating (Fig. 2B). Since Fl hybrid males derived from mating of HA cps-6(sm493) hermaphrodites with BR N2 males or BR cps-6(tm3222) hermaphrodites with HA males still maintained high mating efficiency of hybrid males (Fig. 2B), these results suggest that delayed removal of paternal mitochondria in hybrid inbred males is responsible for negating the hybrid advantage in mating.

[0076] Example 6: PME-delayed animals show altered movement and activity patterns.

[0077] BR N2 and HA are wild-type C. elegans strains isolated from two different continents that are far apart (7200 miles). It is not surprising that they display drastically different locomotion and activity patterns, probably due to tens of millions of years of evolution in very different environments. HA animals were much more active in movement than N2 animals, displaying significantly higher peristaltic speeds and longer peristaltic track lengths at the adult day 1 stage, when they were allowed to move freely on nematode growth medium (NGM) plates seeded with a thin layer of OP50 bacteria (Fig. 2, C to E). It is worth noting that in liquid N2 animals and HA animals exhibited comparable moving ability (fig. 6G), which was assessed by a thrashing assay that scores the number of “head thrashes” in 1 min when animals swim in liquid (39). In PME- delayed cross progeny from mating of N2 hermaphrodites with cps-6(tm3222) males, cps- 6(tm3222); uaDf5 / + males, or cps-6(tm3222); ctb-l(tm4273) + males, no noticeable difference was observed in their locomotion and activity patterns, including peristaltic speeds and peristaltic track lengths, compared with those seen in N2 animals (Fig. 2, D and E), indicating that delayed removal of wild-type or mutant paternal mitochondria in the same breed does not obviously affect the activity patterns of their progeny. Interestingly, Fl hybrid progeny from mating of BR N2 males with HA hermaphrodites displayed less active movement patterns similar to those of N2 animals (Fig. 2, C to E), suggesting that the hybrid progeny adopt the paternal N2 activity patterns. However, Fl hybrid progeny from mating of BR cps-6(tm3222) males with HA hermaphrodites were significantly more active, showing increased peristaltic speeds and peristaltic track lengths and a movement pattern closer to that of HA animals (Fig. 2, C to E), which were not seen in Fl hybrid progeny between N2 males and HA cps-6(sm493) hermaphrodites with a virtually identical genotype. These results suggest that loss of paternal cps-6 and delayed removal of BR paternal mitochondria in HA embryos partially reverse the paternal influence on the activity patterns of their hybrid progeny and provide further supporting evidence that delayed removal of paternal mitochondria in embryos can have significant impact on the lifestyle and behaviors of adult animals.

[0078] Example 7: PME-delayed embryos with mutant or slightly different wild-type paternal mitochondria have reduced ATP levels.

[0079] Because paternal mitochondria in PME-delayed animals persisted longer than they normally did, Applicants asked whether these damaged paternal mitochondria might fuse or mix with maternal mitochondria to perturb their functions. Applicants stained HA cps-6(sm493) males with MitoTracker Red (MTR), a mitochondria-specific dye, and mated them with BR N2 hermaphrodites carrying the tomm-20: :gfp knockin (40), which expresses TOMM-20::GFP, a worm orthologue of the mitochondrial protein TOM20, that labels maternal mitochondria (fig. 8, A and B). Applicants found that MTR-stained paternal mitochondria did not colocalize with TOMM-20: :GFP-labeled maternal mitochondria in cross-fertilized embryos at different embryonic stages (fig. 8B), suggesting that paternal mitochondria not removed in time do not fuse or mix with maternal mitochondria.

[0080] Applicants next examined whether the prolonged presence of damaged paternal mitochondria might interfere with the ATP production by maternal mitochondria, the most important mitochondrial function. Using a fluorescent mitochondrial ATP sensor, BioTracker ATP-Red (6, 41 , Applicants measured the ATP levels in embryos with normal and delayed PME, respectively. Applicants observed significantly lower ATP levels in cross-fertilized embryos from mating between N2 hermaphrodites and cps-6(tm3222); uaDf5, + or cps-6(tm3222); ctb- l(tm4273) / + males (Fig. 3, A and B), compared with cross-fertilized embryos from mating between N2 hermaphrodites and N2 males or cps-6(tm3222) males. These results suggest that delayed removal of mutant paternal mitochondria, but not the wild-type paternal mitochondria, impaired maternal mitochondrial ATP production. In the inbred situation, cross-fertilized embryos from mating between HA hermaphrodites and BR cps-6(tm3222) males showed significantly lower mitochondrial ATP levels than those from mating between HA hermaphrodites and BR N2 males (Fig. 3, A and B), indicating that delayed removal of wild-type paternal mitochondria from a different variant compromises normal ATP production. Given the important role of ATP in driving many important cellular processes, these results suggest that reduced cellular ATP production in early embryos may initiate cellular changes leading to impaired physiological functions observed in adult animals.

[0081] Example 8: Defects in PME-delayed adult animals are rescued by treatment with vitamin MK-4,

[0082] Vitamin K2 has been shown to act as a mitochondrial electron carrier to improve the efficiency of ATP production (6, 42). To investigate if reduced ATP levels in PME-delayed embryos is responsible for the defects observed in the adult animals, Applicants conducted the mating experiments in the presence or absence of 2 mM MK-4, a subtype of vitamin K2, and measured the ATP levels in cross-fertilized embryos. MK-4 treatment did not affect the ATP levels of cross-fertilized embryos from mating of N2 hermaphrodites with BR cps-6(tm3222) males or HA hermaphrodites with BRN2 males and slightly increased ATP levels in embryos from mating of N2 hermaphrodites with N2 males or HA hermaphrodites with HA males (Fig. 3, A and B). Importantly, MK-4 treatment significantly increased the ATP levels in cross-fertilized embryos from mating of N2 hermaphrodites with cps-6(tm3222); ual)f5 or cps-6(tm3222); ctb- l(tm4273) / + males or mating between HA hermaphrodites and BR cps-6(tm3222) males (Fig. 3, A and B). To examine if MK-4 treatment affects clearance of paternal mitochondria, Applicants performed PCR analysis to track the presence of paternal uaDf5 mtDNA at different stages of cross progeny from mating between cps-6(tm3222); uaDf5 / + males and BRN2 hermaphrodites without or with 2 mM MK-4 treatment and found that MK-4 treatment did not accelerate or delay clearance of paternal mitochondria (fig. 9), compared with untreated cross progeny. Together, these results indicate that MK-4 treatment can restore reduced ATP levels in embryos caused by delayed removal of mutant paternal mitochondria or paternal mitochondria from a different wild-type variant.

[0083] Applicants then examined whether MK-4 treatment could rescue the defects of adult animals caused by delayed PME in embryos. In 2-nonanone associative learning and memory assays, MK-4 treatment significantly improved the learning and memory performance of three different kinds of PME-delayed animals, compared with corresponding animals without MK-4 treatment (Fig. 3C). In the male mating efficiency assays, MK-4 treatment restored the mating efficiencies of Fl hybrid males from mating of BR cps-6(tm3222) males with HA hermaphrodites, back to the level seen in Fl hybrid males from mating of BR N2 males with HA hermaphrodites with hybrid advantage (Fig. 3D). In the movement tracking experiments, MK-4 treatment returned the PME-delayed Fl hybrid animals from mating of BR cps-6(tm3222) males with HA hermaphrodites to the activity patterns seen in Fl hybrid animals from mating of BR N2 males with HA hermaphrodites (Fig. 3, E and F and fig. 10, A to D). These results indicate that restoring embryonic ATP levels through vitamin MK-4 treatment remedies the behavioral and functional defects caused by delayed PME.

[0084] Example 9: The AMPK-FOXO signaling pathway mediates defects in PME-delayed animals.

[0085] In animals, decreased cellular ATP level is sensed by and activates the AMP-activated protein kinase (AMPK), which then promotes the nuclear translocation of a downstream FOXO transcription factor that regulates many physiological functions (43, 44). In C. elegans, mtDNA mutations have been shown to decrease cellular ATP levels, activate AAK-2, a worm homologue of AMPK (45), and promote the nuclear translocation of DAF-16, a FOXO transcription factor (46-48), leading to multiple neurological, behavioral, and developmental defects (6). Applicants thus tested whether aak-2 and daf-16 similarly mediate defects caused by delayed PME. In the movement tracking experiments, loss of paternal aak-2 or daf-16 in BR males did not change the activity patterns of Fl hybrid animals from mating of BR males with HA hermaphrodites, but blocked the movement-enhancing effect of loss of paternal cps-6 on Fl hybrid animals (Fig. 4, A and B and fig. 10, A and B, E to H), suggesting that paternal aak-2 and daf-16 activities are required to mediate the more active moving patterns of the Fl hybrid animals induced by delayed PME.

[0086] Applicants then tested whether aak-2 and daf-16 are involved in cognitive decline caused by delayed PME. Because loss of aak-2 or daf-16 or loss of paternal aak-2 or daf-16 all severely impaired learning and memory in 2-nonanone association assays (fig. 11 A), Applicants looked for conditions that reduce the expression of aak-2 and daf-16, but do not affect the cognitive functions of animals through diluted RNA interference (RNAi) experiments. By diluting bacteria expressing double-stranded RNA targeting aak-2 or daf-16 with different amounts of bacteria containing only the empty vector (6, 49), Applicants identified 1% aak-2 RNAi bacteria and 1% daf-16 RNAi bacteria (each with 99% control bacteria) as the ideal condition to partially inhibit the expression of the targeted gene. When animals expressing AAK-2::GFP or DAF-16::GFP from an integrated transgene were fed with 1% aak-2 RNAi bacteria or 1% daf-16 RNAi bacteria, the expression levels of AAK-2::GFP and DAF-16::GFP were reduced by 12.8% and 21.3%, respectively (Fig. 4C), indicating partial inhibition of target gene expression. These limited RNAi treatments did not affect learning and memory of Fl cross progeny from mating of N2 males with N2 or HA hermaphrodites or BR cps-6(tm3222) males with N2 hermaphrodites (Fig. 4D), but significantly enhanced the learning indexes of Fl cross progeny from mating of N2 hermaphrodites with cps- 6(tm3222); uaDf5 / + males or cps-6(tm3222); ctb-l(4273) / + males or mating ofBRcps-6(tm3222) males with HA hermaphrodite (Fig. 4D and fig. 11, B and C), all of which showed severely impaired cognitive functions due to delayed clearance of uaDf5 or ctb-l(tm4273) mutant paternal mitochondria or wild-type paternal mitochondria with a slightly different mtDNA sequence. These results indicate that aak-2 and daf-16 mediate the learning and memory defect caused by delayed PME.

[0087] Similarly, in male mating efficiency assays, loss of paternal BR aak-2 or daf-16 or treatment of mating animals with 1% aak-2 RNAi bacteria or 1% daf-16 RNAi bacteria, fully rescued the decreased mating efficiencies of Fl hybrid males from mating of BR cps-6(tm3222) males with HA hermaphrodites due to delayed PME, but did not affect mating efficiencies of Fl hybrid males from mating of HA hermaphrodites with N2 males or HA males (Fig. 4, E and F). These results indicate that aak-2 and daf-16 also underlies the reduced mating efficiency of adult Fl males caused by delayed PME in embryos. Taken together, these data indicate that aak-2 and daf-16, two central components of the AMPK-FOXO signaling pathway, are important in mediating loss or reduction of associative learning and memory and male mating efficiency of adult progeny as well as alterations of their activity patterns caused by delayed PME at their embryonic stages.

[0088] Example 10: The AMPK-FOXO signaling pathway mediates embryonic death caused by delayed PME,

[0089] Because delayed removal of either uaDf5 / + or ctb-l(tm4273) T mutant paternal mitochondria in BR embryos or delayed removal of BR paternal mitochondria in HA embryos causes decreased cellular ATP levels (Fig. 3, A and B) and increased embryonic lethality (fig. 12A) (20), Applicants asked whether reduced cellular ATP levels were the cause of increased embryonic lethality, given the important role of ATP in driving many cellular processes. Applicants found that 2 mM MK-4 treatment, which restored ATP levels in these three types of embryos (Fig. 3, A and B), strongly suppressed increased lethality of these PME-delayed embryos (fig. 12A), suggesting that reduced cellular ATP level is the cause of increased embryonic death. Applicants then tested if the AMPK-FOXO signaling pathway is involved in mediating increased embryonic lethality in these embryos and found that loss of paternal aak-2 or daf-16 was sufficient to suppress the increased lethality rates in these three types of embryos (fig. 12B). Taken together, these results indicate that increased embryonic death caused by delayed PME is due to reduced embryonic ATP production and mediated by the AMPK-FOXO pathway.

[0090] Example 11 :Materials and Methods.

[0091] Nematode strains and culture conditions: C. elegans strains were maintained on the nematode growth medium (NGM) plates at 20°C using standard methods (54). The N2 Bristol (BR) strain and the CB4856 Hawaii (HA) strain were used as two different C. elegans wild-type strains. Most of the alleles or transgenes used in this study are in Bristol background, unless otherwise noted: LGI, cps-6(tm3222), cps-6(sm493) HA, daf-16(mu86), smls42 [sur-5p: :sur- 5::gfp\, LGIV, him-8(e!489),' LGV , fog-2(q71) , zls356 \daf-16p::daf-16::gfp + rol-6(su!006)~, tomm-20(zju!04\tomm-20: :gfp ),' LGX, aak-2(ok524),' mtDNA, uaDf5, ctb-l(tm4273) . cps- 6(sm493) is a deletion that removes the cps-6 coding region in the HA strain. zju!04 is a gfp knockin at the tomm-20 locus (40). uthls248 \aak-2p::aak-2(aal-321)::gfp + myo-2p: :tdTomato\ is an integrated transgene with unknown chromosomal location. smls42 is an integrated transgene generated by UV irradiation of animals carrying an extrachromosomal array containing snr- 5p::sur-5::gfp. It was backcrossed six times with N2 animals before being used in this study. All C. elegans strains used in this study were listed in table 2. In this study, cross progeny refers to cross-fertilized progeny derived from mating of males with hermaphrodites.

[0092] Evaluation of male mating efficiency: A feminized fog-2(q71) mutant, defective in producing sperm, was used as females in this mating efficiency assay. Before the assay, 25 pl of OP50 bacteria were seeded on each of the NGM plates, which were used as mating plates after 12 hours. Five adult day 1 fog-2(q71) females were initially placed on the mating plate for a 1-hour acclimatization period before a single adult day 2 male was added to the mating plate for copulation. After 1.5 hours of mating, the male was removed from the mating plate. Two hours \aler,fog-2(q71) females from each mating plate were examined for the presence of embryos using a ZEISS Axioplan 2 Nomarski microscope with a 40 x objective lens. Only females that were successfully fertilized had embryos. The male mating efficiency is defined as the percentage of conceived females per plate: number of conceived fog-2 females / 5 x 100%.

[0093] Quantification of the daf-16 and aak-2 expression levels through GFP reporters: The zls356 V \daf-16p::daf-16::gfp + rol-6(sul006 \ transgene and the uthls248 [aak-2p::aak-2(aal- 321)::gfp + myo-2p: :tdTomato\ transgene were used to assess the expression levels of daf-16 and aak-2, respectively. Adult day 1 transgenic animals were subjected to a 5-minute anesthesia with 10 mM levamisole. Subsequently, DAF-16: :GFP and AAK-2: :GFP fluorescent images of the animals were captured using a ZEISS Axioplan 2 Nomarski microscope with a 20x objective lens and an exposure time of 100 ms. The GFP fluorescence intensity of each image was quantified using the Fiji Image J software.

[0094] RNA interference (RNAi) experiments: RNAi bacterial clones used in this study were from an RNAi library constructed by the Ahringer laboratory (55). The RNAi experiments were conducted using a previously established bacterial feeding protocol (49). Briefly, each RNAi bacterial clone was grown overnight in LB medium containing 50 ng / pl ampicillin, which were then seeded onto fresh NGM plates supplemented with 1 mM IPTG and allowed to grow on NGM plates for approximately 24 hours before use. To make NGM plates with varying concentrations of aak-2 RNAi and daf-16 RNAi bacteria, the RNAi control bacteria were utilized to dilute the aak-2 RNAi and daf-16 RNAi bacteria to the desired concentrations. For 2-nonanone associative learning and memory assays, animals were treated with RNAi bacteria for two consecutive generations before their progenies were subjected to testing.

[0095] Measurement of ATP levels in early embryos: Applicants used an ATP-sensitive imaging probe, "BioTracker ATP -Red Live Cell Dye" (Sigma-Aldrich, Cat. # SCT045), and a previously established protocol to assess ATP levels in early C. elegans embryos (6, 41). BioTracker ATP-Red dye was added to the warm liquid NGM (at a final concentration of 8 pM) prior to plate pouring. Animals were grown on NGM plates containing ATP-Red dye for two consecutive generations before mating and their progenies were subjected to the measurement of embryonic ATP levels. Fluorescent images of embryos were captured using the Zeiss LSM 800 laser scanning confocal system with a ZEN imaging software. The fluorescent intensity of each embryo was quantified using Fiji Image J software.

[0096] Preparation of MK-4 plates and MK-4 treatment: The concentration of MK-4 (Sigma- Aldrich, Cat# 809918) used in this study was set at 2 mM. To make MK-4-containig NGM plates, MK-4 was diluted with an E. coli OP50 suspension to a final concentration of 2 mM and then seeded on NGM plates (25 pl OP50 suspension per plate). The seeded plates were placed at room temperature in dark for 24 hours before they were used to treat animals. MK-4 plates were stored at 4°C and used within two-weeks to ensure the stability and efficacy of the compound. For MK- 4 treatment, animals were grown in MK-4-containing NGM plates for two consecutive generations before mating and their early embryos and adult progenies maintained on MK-4 plates were used in embryonic ATP measurement and behavioral and functional tests, respectively.

[0097] PCR analysis: The cross-fertilized embryos were collected from mated hermaphrodites through dissection, while larvae and adults were collected from the mating plates. PCR primers used to detect the uaDf5 deletion are:

[0098] Fl : GATTAGCACAAGCTTTATTGGATGG (SEQ ID NO. 1)

[0099] Rl : AAGATCTTAACATTCCGGCTGAGGC (SEQ ID NO. 2)

[0100] F2: TGGTATAATTGGGGCCATCCGTGC (SEQ ID NO. 3)

[0101] R2: AGGGTCTTCTACAGTGCATTGACC (SEQ ID NO. 4)

[0102] PCR primers used to detect the ctb-l(tm4273) deletion are:

[0103] Fl : ATTTGTTCTAGGTTAAATCC (SEQ ID NO. 5)

[0104] Rl : AAGATCTTAACATTCCGGCTGAGGC (SEQ ID NO. 6)

[0105] F2: GGTTAATAGCATTTTCAACAGT (SEQ ID NO. 7)

[0106] R2: AGGGTCTTCTACAGTGCATTGACC (SEQ ID NO. 8)

[0107] PCR primers used to detect the BR N2 mtDNA are:

[0108] Fl : TCTACTATTTTAAGATGAGTA (SEQ ID NO. 9)

[0109] Rl : AGAACAAACCACCACACATG (SEQ ID NO. 10)

[0110] F2: GGTCAATGCACTGTAGAAGAC (SEQ ID NO. 11)

[0111] R2: AGCAATATCCTTACCTCAAGC (SEQ ID NO. 12)

[0112] Dry drop test: The dry drop test was conducted following an established protocol (6, 33). Briefly, 10 animals as a group were placed on an NGM plate and allowed to acclimatize for 5 minutes. A micro-drop of solution containing glycerol, NaCl or CuCh at the desired concentration was dispensed on the agar in a few millimeters’ diameter ahead of a forward-moving animal via a 10 pm diameter glass capillary. The micro-drop liquid was rapidly absorbed by the agar, creating a region containing the repellent. The direction of the animal’s movement was observed and recorded when the animal encountered the repellent containing region. The repellent caused a subset of the animals to reverse their movement direction. Each animal was tested once. The avoidance index was calculated as nreversai / ntotai, where nreversai is the number of animals that reversed their movement direction upon encountering the repellent-containing region, and ntotai is the total number of animals tested. Generally, ntotai = 10 in each independent experiment in these tests. Day one adult animals maintained in 20°C were used in these testes. Chemicals were dissolved in the M9 minimal media (5.8 g Na2HPC>4, 3.0 g KH2PO4, 0.5 g NaCl and 1.0 g NH4CI in 1.0-liter ddELO).

[0113] 2-Nonanone response latency test: The response latency test of a single worm to 2- nonanone was conducted following a previously established protocol (36, 56). A day one adult animal was positioned at the center of an NGM plate and allowed a 5-minute acclimation period. Subsequently, a microcapillary pipette tip containing 5 pl of 2-nonanone (diluted at 1 : 10 in DMSO) was put in front of the nose of a forward-moving animal. Response latency was quantified as the duration (in seconds) between the presentation of the odorant to the commencement of a reversal by the animal.

[0114] 2-Nonanone and food associative learning and memory assay: The 2-nonanone associative learning and memory assay was performed as described previously (6). Initially, a subset of day-one adults underwent the 2-nonanone response latency test (2-nonanone diluted at 1 :25 in DMSO). The results were recorded as "naive" responding times and their average value was used as Tnaive. Concurrently, other day-one adults were transferred to an NGM plate devoid of OP50 bacteria and subjected to a 1-hour starvation at room temperature. Following starvation, animals were moved to an NGM plate seeded with OP50 bacteria, which also had 2 pl of 2- nonanone (1 :25 diluted in DMSO) smeared on the inside of its lid. After 1-hour incubation at room temperature and food associative training, animals were moved back to a fresh NGM plate seeded with OP50 bacteria, but without 2-nonanone on the lid, and incubated for one additional hour at room temperature. Subsequently, the animals underwent the 2-nonanone response latency test (2- nonanone 1 :25 diluted in DMSO), with the resulting response times recorded as T. The learning index (LI) was determined as (T - Tnaive) / Tnaive. A positive value for the learning index indicates that animals, as a result of food association training, exhibit reduced aversion to 2-nonanone and acquire short-term associative memory.

[0115] Thrashing assay: The thrashing assay of C. elegans animals was conducted following a previously established protocol (6, 39). 100 pl ofM9 buffer were spotted on the agar surface of an NGM plate. L4 stage animals were placed into the M9 buffer. Following one minute acclimation in the M9 buffer, the number of thrashes by animals in one minute was scored under a dissecting microscope. A thrash is a change in the direction of bending at the midbody of the animal. Each animal was counted only once.

[0116] Measurement of peristaltic speed and track length: The peristaltic speed and track length of C. elegans movement were measured by the Wormlab Acquisition System (MBF Bioscience), equipped with a high-resolution camera with a zoom lens and corresponding software. For this activity assay, a group of ten day-one adults were placed in an NGM plate seeded with a thin layer of OP50 bacteria. Following a 30-minute acclimation on the plate, the plate with the animals was placed under the camera and the activity patterns of each animal, including its movement track, peristaltic speed, and track length, were systematically recorded and analyzed by the Wormlab Acquisition System. Each recording was 1 minute.

[0117] Embryonic lethality: The embryonic lethality assay was conducted at 25°C as described previously (20). For cross-fertilized animals, young adult males carrying the smls42 [sur-5p::sur- 5::GFP] transgene were paired with late L4 hermaphrodites for a 12-hour mating. Subsequently, the hermaphrodites were transferred to fresh plates to lay eggs for 6 hours before they were removed from the plate. The total number of GFP -positive embryos on the plate was then quantified. After 24 hours, unhatched GFP-positive embryos were scored as dead embryos. The lethality rate of cross-fertilized embryos was calculated by dividing the number of GFP-positive dead embryos by the total number of GFP-positive embryos. For self-fertilized animals, late L4 hermaphrodites were transferred to fresh plates and allowed to age for 12 hours. They were then transferred to new plates to lay eggs for 6 hours before being removed from the plates. The total number of embryos on the plates was counted. After 24 hours, unhatched embryos were scored as dead embryos. The lethality rate of embryos was calculated by dividing the number of dead embryos by the total number of embryos.

[0118] MitoTracker Red staining: MitoTracker Red staining of C. elegans animals was conducted as described previously (20). Briefly, the E. coli OP50 bacterial suspension containing 10 pM MTR was seeded onto the NGM plate and left dry overnight at room temperature before use. Young adult males were placed on MTR plates for 12 hours and then cleaned up twice in fresh NGM plates with OP50 bacterial lawn to remove residual MTR from their exteriors. After that, MTR-stained males were mated with young adult hermaphrodites for 8 hours, before the mated hermaphrodites were dissected to obtain MTR-stained cross-fertilized embryos.

[0119] Quantification and statistical analysis: GraphPad Prism 6 software was used for all statistical analysis. Sample sizes were determined based on the reproducibility of the experiments and sample sizes commonly used in the field. Each experiment was repeated three or more times. Data were presented as mean ± SEM. Unpaired, two-tailed Student’s t test was used to compare two data sets. P < 0.05 is considered to be statistically significant.

[0120] REFERENCES

[0121] 1. S. E. Calvo, V. K. Mootha, The mitochondrial proteome and human disease. Annu. Rev. Genomics Hum. Genet. 11, 25-44 (2010).

[0122] 2. D. J. Pagliarini, S. E. Calvo, B. Chang, S. A. Sheth, S. B. Vafai, S. E. Ong, G. A. Walford, C. Sugiana, A. Boneh, W. K. Chen, D. E. Hill, M. Vidal, J. G. Evans, D. R. Thorburn, S. A. Carr, V. K. Mootha, A mitochondrial protein compendium elucidates complex I disease biology. Cell 134, 112-123 (2008).

[0123] 3. A. Barchiesi, C. Vascotto, Transcription, Processing, and Decay of Mitochondrial RNA in Health and Disease. Ini. J. Mol. Sci. 20, 2221 (2019).

[0124] 4. C. L. Alston, M. C. Rocha, N. Z. Lax, D. M. Turnbull, R. W. Taylor, The genetics and pathology of mitochondrial disease. J. Pathol. 241, 236-250 (2017).

[0125] 5. L. Craven, C. L. Alston, R. W. Taylor, D. M. Turnbull, Recent Advances in Mitochondrial Disease. Anna. Rev. Genomics Hum. Genet. 18, 257-275 (2017).

[0126] 6. H. Zhang, Y. Zhu, Y. Suehiro, S. Mitani, D. Xue, AMPK-FOXO-IP3R signaling pathway mediates neurological and developmental defects caused by mitochondrial DNA mutations. Proc. Natl. Acad. Sci. U.S.A. 120, e2302490120 (2023).

[0127] 7. M. S. Sharpley, C. Marciniak, K. Eckel-Mahan, M. McManus, M. Crimi, K. Waymire, C. S. Lin, S. Masubuchi, N. Friend, M. Koike, D. Chalkia, G. MacGregor, P. Sassone- Corsi, D. C. Wallace, Heteroplasmy of mouse mtDNA is genetically unstable and results in altered behavior and cognition. Cell 151, 333-343 (2012).

[0128] 8. C. W. Birky Jr., Uniparental inheritance of mitochondrial and chloroplast genes: mechanisms and evolution. Proc. Natl. Acad. Sci. U.S.A. 92, 1 1331-11338 (1995).

[0129] 9. J. M. Cummins, Fertilization and elimination of the paternal mitochondrial genome. Hum. Reprod. 15, 92-101 (2000).

[0130] 10. S. Al Rawi, S. Louvet-Vallee, A. Djeddi, M. Sachse, E. Culetto, C. Hajjar, L. Boyd, R. Legouis, V. Galy, Postfertilization autophagy of sperm organelles prevents paternal mitochondrial DNA transmission. Science 334, 1144-1147 (2011).

[0131] 11. Q. Zhou, H. Li, D. Xue, Elimination of paternal mitochondria through the lysosomal degradation pathway in C. elegans. Cell Res. 21, 1662-1669 (2011). 12. M Sato, K. Sato, Degradation of paternal mitochondria by fertilization-triggered autophagy in C. elegans embryos. Science 334, 1141-1144 (2011).

[0132] 13. R. E. Giles, H. Blanc, H. M. Cann, D. C. Wallace, Maternal inheritance of human mitochondrial DNA. Proc. Natl. Acad. Sci. U.S.A. 77, 6715-6719 (1980).

[0133] 14. S. Z. DeLuca, P. H. O’Farrell, Barriers to male transmission of mitochondrial DNA in sperm development. Dev. Cell 22, 660-668 (2012).

[0134] 15. Y. Politi, L. Gal, Y. Kalifa, L. Ravid, Z. Elazar, E. Arama, Paternal mitochondrial destruction after fertilization is mediated by a common endocytic and autophagic pathway in Drosophila. Dev. Cell 29, 305-320 (2014).

[0135] 16. S. M. Luo, Z. J. Ge, Z. W. Wang, Z. Z. Jiang, Z. B. Wang, Y. C. Ouyang, Y. Hou, H. Schatten, Q. Y. Sun, Unique insights into maternal mitochondrial inheritance in mice. Proc. Natl. Acad. Sci. U.S.A. 110, 13038-13043 (2013).

[0136] 17. R. Rojansky, M. Y. Cha, D. C. Chan, Elimination of paternal mitochondria in mouse embryos occurs through autophagic degradation dependent on PARKIN and MULL Elife 5, el7896 (2016).

[0137] 18. N. Lane, Mitonuclear match: optimizing fitness and fertility over generations drives ageing within generations. Bioessays 33, 860-869 (2011).

[0138] 19. A. Latorre-Pellicer, R. Moreno-Loshuertos, A. V. Lechuga- Vieco, F. Sanchez-Cabo, C. Torroja, R. Acin-Perez, E. Calvo, E. Aix, A. Gonzalez-Guerra, A. Logan, M. L. Bernad-Miana, E. Romanos, R. Cruz, S. Cogliati, B. Sobrino, A. Carracedo, A. Perez-Martos, P. Fernandez-Silva, J. Ruiz-Cabello, M. P. Murphy, I. Flores, J. Vazquez, J. A. Enriquez, Mitochondrial and nuclear DNA matching shapes metabolism and healthy ageing. Nature 535, 561-565 (2016).

[0139] 20. Q. H. Zhou, H. M. Li, H. Z. Li, A. Nakagawa, J. L. J. Lin, E. S. Lee, B. L. Harry, R. R. Skeen-Gaar, Y. Suehiro, D. William, S. Mitani, H. S. Yuan, B. H. Kang, D. Xue, Mitochondrial endonuclease G mediates breakdown of paternal mitochondria upon fertilization. Science 353, 394-399 (2016).

[0140] 21. P. Sutovsky, R. D. Moreno, J. Ramalho- Santos, T. Dominko, C. Simerly, G. Schatten, Ubiquitinated Sperm Mitochondria, Selective Proteolysis, and the Regulation of Mitochondrial Inheritance in Mammalian Embryos. Biol. Reprod. 63, 582-590 (2000).

[0141] 22. Y. Wang, Y. Zhang, L. W. Chen, Q. Liang, X. Yin, L. Miao, B. H. Kang, D. Xue, Kinetics and specificity of paternal mitochondrial elimination in Caenorhabditis elegans. Nat. Commun. 7, 12569 (2016).

[0142] 23. M. Schwartz, J. Vissing, Paternal Inheritance of Mitochondrial DNA. N. Engl. J. Med. 347, 576-580 (2002).

[0143] 24. S. Luo, C. A. Valencia, J. Zhang, N. C. Lee, J. Slone, B. Gui, X. Wang, Z. Li, S. Dell, J. Brown, S. M. Chen, Y. H. Chien, W. L. Hwu, P. C. Fan, L. J. Wong, P. S. Atwal, T. Huang, Biparental Inheritance of Mitochondrial DNA in Humans. Proc. Natl. Acad. Sci. U.S.A. 115, 13039-13044 (2018).

[0144] 25. S. Lutz-Bonengel, W. Parson, No further evidence for paternal leakage of mitochondrial DNA in humans yet. Proc. Natl. Acad. Sci. U.S.A. 116, 1821-1822 (2019). 26. S. Luo, C. A. Valencia, J. Zhang, N. C. Lee, J. Slone, B. Gui, X. Wang, Z. Li, S. Dell, J. Brown, S. M. Chen, Y. H. Chien, W. L. Hwu, P. C Fan, L. J. Wong, P. S. Atwal, T. Huang, Reply to Lutz-Bonengel et al.: Biparental mtDNA transmission is unlikely to be the result of nuclear mitochondrial DNA segments. Proc. Natl. Acad. Set. U.S.A. 116, 1823-1824 (2019).

[0145] 27. S. Annis, Z. Fleischmann, M. Khrapko, M. Franco, K. Wasko, D. Woods, W. S. Kunz, P. Ellis, K. Khrapko, Quasi-Mendelian paternal inheritance of mitochondrial DNA: A notorious artifact, or anticipated behavior? Proc. Natl. Acad. Set. U.S.A. 116, 14797-14798 (2019).

[0146] 28. W. Wei, A. T. Pagnamenta, N. Gleadall, A. Sanchis-Juan, J. Stephens, J. Broxholme, S. Tuna, C. A. Odhams, C. Fratter, E. Turro, M J. Caulfield, J. C. Taylor, S. Rahman, P. F. Chinnery, Nuclear-mitochondrial DNA segments resemble paternally inherited mitochondrial DNA in humans. Nat. Commim. 11, 1740 (2020).

[0147] 29. M. Filosto, M. Mancuso, C. Vives-Bauza, M. R. Vila, S. Shanske, M. Hirano, A. L. Andreu, S. DiMauro. Lack of paternal inheritance of muscle mitochondrial DNA in sporadic mitochondrial myopathies. Ann. Neurol. 54, 524-526 (2003).

[0148] 30. R. W. Taylor, M. T. McDonnell, E. L. Blakely, P. F. Chinnery, G. A. Taylor, N. Howell, M. Zeviani, E. Briem, F. Carrara, D. M. Turnbull, Genotypes from patients indicate no paternal mitochondrial DNA contribution. Ann. Neurol. 54, 521-524 (2003).

[0149] 31. R. W. Taylor, D. M. Turnbull, Mitochondrial DNA mutations in human disease. Nat. Rev. Genet. 6, 389-402 (2005).

[0150] 32. G. S. Gorman, P. F. Chinnery, S. DiMauro, M. Hirano, Y. Koga, R. McFarland, A. Suomalainen, D. R. Thorburn, M. Zeviani, D. M. Turnbull, Mitochondrial diseases. Nat. Rev. Primer 2, 16080 (2016).

[0151] 33. M. A. Hilliard, C. I. Bargmann, P. Bazzicalupo, C. elegans Responds to Chemical Repellents by Integrating Sensory Inputs from the Head and the Tail. Curr. Biol. 12, 730-734 (2002).

[0152] 34. C. I. Bargmann, H. R. Horvitz, Chemosensory neurons with overlapping functions direct chemotaxis to multiple chemicals in C. elegans. Neuron 7, 729-742 (1991).

[0153] 35. E. R. Troemel, B. E. Kimmel, C. I. Bargmann, Reprogramming Chemotaxis Responses: Sensory Neurons Define Olfactory Preferences in C. elegans. Cell 91, 161-169 (1997).

[0154] 36. D. Duan, H. Zhang, X. Yue, Y. Fan, Y. Xue, J. Shao, G. Ding, D. Chen, S. Li, H. Cheng, X. Zhang, W. Zou, J. Liu, J. Zhao, L. Wang, B. Zhao, Z. Wang, S. Xu, Q. Wen, J. Liu, S. Duan, L. Kang, Sensory Glia Detect Repulsive Odorants and Drive Olfactory Adaptation. Neuron 108, 707-721 e8 (2020).

[0155] 37. M. M. Barr, L. R. Garcia, Male mating behavior, in WormBook: The Online Review of C. elegans Biology, (WormBook, 2006) pp. 1-11.

[0156] 38. R. Clifford, M. H. Lee, S. Nayak, M. Ohmachi, F. Giorgini, T. Schedl, FOG-2, a novel F-box containing protein, associates with the GLD-1 RNA binding protein and directs male sex determination in the C. elegans hermaphrodite germline. Development 127, 5265-5276 (2000).

[0157] 39. K. G. Miller, A. Alfonso, M. Nguyen, J. A. Crowell, C. D. Johnson, J. B. Rand, A genetic selection for Caenorhabditis elegans synaptic transmission mutants. Proc. Natl. Acad. Sci. U.S.A. 93, 12593-12598 (1996). 40. P. Wang, L. Chen, N. Wang, L. Miao, Y. Zhao, Mitochondrial defects triggered by amg-1 mutation elicit UPRmt and phagocytic clearance during spermatogenesis in C. elegans. Development 151, dev202165 (2024).

[0158] 41. M. Samaddar, J. Goudeau, M. Sanchez, D. H. Hall, K. A. Bohnert, M. Ingaramo, C. Kenyon, A genetic screen identifies new steps in oocyte maturation that enhance proteostasis in the immortal germ lineage. Elife 10, e62653 (2021).

[0159] 42. M. Vos, G. Esposito, J. N. Edirisinghe, S. Vilain, D. M. Haddad, J. R. Slabbaert, S. Van Meensel, O. Schaap, B. De Strooper, R. Meganathan, V. A. Morais, P. Verstreken, Vitamin K2 is a mitochondrial electron carrier that rescues pinkl deficiency. Science 336, 1306-1310 (2012).

[0160] 43. D. G. Hardie, AMP-activated protein kinase: an energy sensor that regulates all aspects of cell function. Genes Dev. 25, 1895-1908 (2011).

[0161] 44. D. Garcia, R. J. Shaw, AMPK: Mechanisms of Cellular Energy Sensing and Restoration of Metabolic Balance. Mol. Cell 66, 789-800 (2017).

[0162] 45. E. L. Greer, D. Dowlatshahi, M. R. Banko, J. Villen, K. Hoang, D. Blanchard, S. P. Gygi, A. Brunet, An AMPK-FOXO pathway mediates longevity induced by a novel method of dietary restriction in C. elegans. Curr. Biol. 17, 1646-1656 (2007).

[0163] 46. S. Ogg, S. Paradis, S. Gottlieb, G. I. Patterson, L. Lee, H. A. Tissenbaum, G. Ruvkun, The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature 389, 994-999 (1997).

[0164] 47. K. Lin, J. B. Dorman, A. Rodan, C. Kenyon, daf-16: An HNF-3 / forkhead family member that can function to double the life-span of Caenorhabditis elegans. Science 278, 1319— 1322 (1997).

[0165] 48. C. T. Murphy, P. J. Hu, Insulin / insulin-like growth factor signaling in C. elegans, in WormBook: The Online Review ofC. elegans Biology, (WormBook, 2013) pp. 1-43.

[0166] 49. L. Timmons, D. L. Court, A. Fire, Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene 263, 103-112 (2001).

[0167] 50. A. Melendez, B. Levine, Autophagy in C. elegans, in WormBook: The Online Review ofC. elegans Biology, (WormBook, 2009) pp. 1-26.

[0168] 51. N. Papaevgeniou, N. Chondrogianni, The ubiquitin proteasome system in Caenorhabditis elegans and its regulation. Redox Biol. 2, 333-347 (2014).

[0169] 52. W. Wei, S. Tuna, M. J. Keogh, K. R. Smith, T. J. Aitman, P. L. Beales, D. L. Bennett, D. P. Gale, M. A. K. Bitner-Glindzicz, G. C. Black, P. Brennan, P. Elliott, F. A. Flinter, R. A. Floto, H. Houlden, M. Irving, A. Koziell, E. R. Maher, H. S. Markus, N. W. Morrell, W. G. Newman, I. Roberts, J. A. Sayer, K. G. C. Smith, J. C. Taylor, H. Watkins, A. R. Webster, A. O. M. Wilkie, C. Williamson, N. B.-R. Diseases, G. P.-R. D. Pilot, S. Ashford, C. J. Penkett, K. E. Stirrups, A. Rendon, W. H. Ouwehand, J. R. Bradley, F. L. Raymond, M. Caulfield, E. Turro, P. F. Chinnery, Germline selection shapes human mitochondrial DNA diversity. Science 364, eaau6520 (2019). 53. J. B. Stewart, P. F. Chinnery, Extreme heterogeneity of human mitochondrial DNA from organelles to populations. Nat. Rev. Genet. 22, 106-118 (2021).

[0170] 54. S. Brenner, The genetics of Caenorhabditis elegans. Genetics 77, 71-94 (1974).

[0171] 55. A. G. Fraser, R. S. Kamath, P. Zipperlen, M. Martinez-Campos, M. Sohrmann, J. Ahringer, Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408, 325-330. (2000).

[0172] 56. E. R. Troemel, J. H. Chou, N. D. Dwyer, H. A. Colbert, C. I. Bargmann, Divergent seven transmembrane receptors are candidate chemosensory receptors in C. elegans. Cell 83, 207- 218 (1995).

[0173] TABLES

[0174] Table 1. Sequence differences between BR N2 mtDNA and HA mtDNA Table 2. C elegans strains

Claims

CLAIMWhat is claimed is1. A method of treating delayed paternal mitochondrial elimination (PME) in a subject in need thereof, comprising administering a therapeutically effective amount of Vitamin MK-4.

2. A method of treating PME in a subject in need thereof, comprising administering a pharmaceutical composition including a therapeutically effective amount of Vitamin MK-4, and a pharmaceutically acceptable carrier.

3. A method of treating PME in a subject in need thereof, comprising administering a therapeutically effective amount of a compound according to Formula (I):or a pharmaceutically acceptable salt thereof.

4. A method of treating PME in a subject in need thereof, comprising administering a pharmaceutical composition including a therapeutically effective amount of a compound according to Formula (I):and a pharmaceutically acceptable carrier.

5. The method of any of claims 1-4, wherein said subject is a human.

6. The method of any of claims 1-5, wherein the method prevents or ameliorates one or more symptoms associated with PME selected from: fatigue, mitochondrial myopathy, neuropathy,developmental delay, neurological delays, neurological impairment, stunted growth, loss of muscle coordination, seizures, autism spectrum disorder, impaired vision, impaired hearing, learning disabilities, impaired memory, heart, liver, or kidney disease, respiratory difficulty / failure, stroke, and movement disorders.

7. A method of increasing ATP production in a cell exhibiting one or more symptoms of PME, the method comprising contacting the cell a therapeutically effective amount of Vitamin MK-4.

8. A method of increasing ATP production in a cell exhibiting one or more symptoms of PME, the method comprising contacting the cell with a pharmaceutical composition including a therapeutically effective amount of Vitamin MK-4, and a pharmaceutically acceptable carrier.

9. A method of increasing ATP production in a cell exhibiting one or more symptoms of PME, the method comprising contacting the cell with a therapeutically effective amount of a compound according to Formula (I):or a pharmaceutically acceptable salt thereof.

10. A method of increasing ATP production in a cell exhibiting one or more symptoms of PME, the method comprising contacting the cell with a therapeutically effective amount of a compound according to Formula (I):and a pharmaceutically acceptable carrier.11 . The method of any of claims 6-10, wherein said cell is a human cell.

12. The method of any of claims 6-11, wherein the step of contacting comprises contacting the cell in vitro , or in vivo.

13. The method of any claims 1-12, wherein the PME results in biparental mtDNA inheritance.

14. A compound of for use in the treatment of progressive myoclonic epilepsy (PME), wherein the compound comprises Vitamin MK-4.

15. A compound of for use in the treatment of progressive myoclonic epilepsy (PME), wherein the compound comprises Vitamin MK-4 and a pharmaceutically acceptable carrier.

16. A compound of Formula (I) for use in the treatment of progressive myoclonic epilepsy (PME):or a pharmaceutically acceptable salt thereof.

17. The compound of any of claims 14-16, wherein the compound prevents or ameliorates one or more symptoms associated with PME selected from: fatigue, mitochondrial myopathy, neuropathy, developmental delay, neurological delays, neurological impairment, stunted growth, loss of muscle coordination, seizures, autism spectrum disorder, impaired vision, impaired hearing, learning disabilities, impaired memory, heart, liver, or kidney disease, respiratory difficulty / failure, stroke, and movement disorders.

18. A compound of for use in increasing ATP production in a cell exhibiting one or more symptoms of PME, wherein the compound comprises Vitamin MK-4.

19. A compound of for use in increasing ATP production in a cell exhibiting one or more symptoms of PME, wherein the compound comprises Vitamin MK-4. and a pharmaceutically acceptable carrier.

20. A compound of Formula (I) for use in increasing ATP production in a cell exhibiting one or more symptoms of PME:or a pharmaceutically acceptable salt thereof.

21. The compound of any of claims 18-20, wherein the compound prevents or ameliorates one or more symptoms associated with PME selected from: fatigue, mitochondrial myopathy, neuropathy, developmental delay, neurological delays, neurological impairment, stunted growth, loss of muscle coordination, seizures, autism spectrum disorder, impaired vision, impaired hearing, learning disabilities, impaired memory, heart, liver, or kidney disease, respiratory difficulty / failure, stroke, and movement disorders.

22. The compound of any claims 14-21, wherein the PME results in biparental mtDNA inheritance.

Images