Lipid nanoparticles for delivery to the CNS from systemic administration
Optimized LNP formulations conjugated to anti-transferrin receptor antibodies enhance BBB penetration and enable high-throughput screening for CNS delivery, addressing the challenge of drug delivery to the CNS.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-10-02
- Publication Date
- 2026-04-09
AI Technical Summary
The delivery of therapeutic agents to the central nervous system (CNS) is challenging due to the restrictive nature of the blood-brain barrier (BBB), and there is a need for lipid nanoparticles (LNPs) that can penetrate this barrier for effective drug delivery and high-throughput screening methods to track uptake in CNS cells.
LNP formulations are optimized for CNS uptake, conjugated to an antigen binding fragment of an anti-transferrin receptor antibody, and include a nucleotide barcode for high-throughput assessment, allowing multiple formulations to be tested simultaneously in vivo.
The optimized LNPs demonstrate enhanced penetration of the BBB, enabling efficient delivery to brain cells and facilitating high-throughput screening for brain-permeable LNPs, significantly speeding up the development process.
Smart Images

Figure US2025049243_09042026_PF_FP_ABST
Abstract
Description
Attorney Docket No: 01164-0038-00PCTLIPID NANOPARTICLES FOR DELIVERY TO THE CNS FROM SYSTEMIC ADMINISTRATIONCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Application No. 63 / 703,135, filed October 3, 2024, and U.S. Application No. 63 / 802,788, filed May 9, 2025, the entire contents of which are incorporated by reference herein for all purposes.REFERENCE TO ELECTRONIC SEQUENCE LISTING
[0002] This application contains a sequence listing, which has been submitted electronically in .XML format and is hereby incorporated by reference in its entirety. Said .XML file, created on September 26, 2025, is named “01164-0038-00PCT. xml” and is 26,357 bytes in size.FIELD
[0003] The present disclosure relates to LNP formulations useful for uptake in the CNS or brain, for example, in some cases wherein the LNP is conjugated to an antigen binding fragment of an anti-transferrin receptor antibody. The present disclosure also relates to methods of delivering lipid nanoparticles (LNPs) systemically, for uptake in vivo in the central nervous system (CNS), such as to brain cells, and methods for assessment of the extent of uptake in CNS cells, such as brain cells. In some cases, methods allow for high throughput screening of multiple different LNPs in parallel.BACKGROUND
[0004] The delivery of therapeutic agents to the central nervous system (CNS) remains a significant challenge due to the restrictive nature of the blood-brain barrier (BBB). A number of methods and systems have been proposed, with variable degrees of success. Lipid nanoparticles (LNPs) have emerged as a promising vehicle for drug delivery, including systemic drug delivery. But efficient targeting and uptake in difficult-to-reach organs such as the CNS and brain are key challenges for LNPs. Thus, there is a need for LNPs that can penetrate the BBB, in order to allow LNP drug cargos to reach the CNS and brain. There is also a need for high throughput screening methods to administer and track uptake of LNPs in the CNS and brain, such as in CNS or brain cells, for example, in order to select for brain-permeable LNPs.Attorney Docket No: 01164-0038-00PCTSUMMARY
[0005] The present application provides LNP formulations optimized for uptake into the CNS and brain and methods for systemic administration of such LNPs. In some embodiments, the LNPs comprise lipids conjugated to an antigen binding fragment of an antitransferrin receptor antibody, such as an anti -transferrin receptor Fab domain. The present application also encompasses methods of testing uptake of such LNPs in vivo, for instance, through high-throughput techniques that allow multiple LNP formulation designs to be tested simultaneously in a single animal administration. In some embodiments, the LNP formulations comprise lipids conjugated to an antigen binding fragment of an anti-transferrin receptor antibody, such as an anti-transferrin receptor antibody Fab domain, at various molar ratios, as well as different lipid components. In some cases, an LNP cargo may comprise a nucleotide barcode, which may be used to assess uptake of the LNP formulation in the CNS or brain. Barcodes, for instance, may allow for assessment of uptake of several different LNP formulations in one, single administration to an animal, potentially greatly speeding the process of developing optimized LNPs for uptake by the CNS or brain.
[0006] Exemplary embodiments herein include the following:
[0007] 1. A lipid nanoparticle (LNP) comprising at least one ionizable lipid, at least one conjugating lipid, and at least one further lipid optionally selected from DSPC, DOPE, DPPC, DOPC, and cholesterol, wherein the LNP is conjugated to an antigen binding fragment of an anti-transferrin receptor (anti-TfR) antibody by the conjugating lipid.
[0008] 2. The LNP of embodiment 1, wherein the LNP comprises (a) at least one ionizable lipid, (b) DPPC, DOPC, DSPC and / or DOPE, (c) cholesterol, and (d) one or both of DMG-PEG2000 and DSPE-PEG2000 as conjugating lipid, wherein the DMG-PEG2000 and / or DSPE-PEG2000 further comprises a functional group linking the DMG-PEG2000 and / or DSPE-PEG2000 to the antigen binding fragment of the anti-TfR antibody.
[0009] 3. The LNP of embodiment 1 or 2, wherein the antigen binding fragment of the anti-transferrin receptor antibody comprises a Fab domain.
[0010] 4. The LNP of embodiment 3, wherein the LNP comprises from 0.01 to 1 mol % Fab, from 0.1 to 1 mol % Fab, from 0.01 to 0.5 mol % Fab, from 0.05 to 0.5 mol % Fab, from 0.1 to 0.5 mol % Fab, from 0.2 to 0.5 mol % Fab, from 0.2 to 0.4 mol % Fab, or from 0.05 to 0.2 mol % Fab, wherein mol % is of the conjugating lipid.Attorney Docket No: 01164-0038-00PCT
[0011] 5. The LNP of any one of embodiments 1-4, wherein the LNP has a mean particle diameter of 50-200 nm, 50-150 nm, 75-150 nm, 100-150 nm, 75-100 nm, 75-125 nm, 80-120 nm, or 90-110 nm as measured by dynamic light scattering (DLS).
[0012] 6. The LNP of any one of embodiments 1-5, wherein the antigen binding fragment of the anti-TfR antibody has an affinity for transferrin receptor of 5 nM to 1 pM, 10 nM to 1 pM, 10-500 nM, 50-500 nM, 100-500 nM, 100-400 nM, 100-300 nM, 200-500 nM, 200-400 nM, or 200-300 nM as measured by surface plasmon resonance.
[0013] 7. The LNP of any one of embodiments 1-6, wherein the LNP has a poly dispersity of 15-40%, 15-30%, 15-25%, 20-30%, 15-20%, or 20-25% as measured by dynamic light scattering (DLS).
[0014] 8. The LNP of any one of embodiments 1-7, wherein the LNP comprises a mol % of ionizable lipid of 40-60%, 40-50%, 50-60%, or 45-55%, wherein mol % is of the total lipid content.
[0015] 9. The LNP of any one of embodiments 1-8, wherein the LNP comprises a mol % of DSPC and / or DOPE of 5-15%, 5-10%, 10-25%, or 7-13%, wherein mol % is of the total lipid content.
[0016] 10. The LNP of any one of embodiments 1-9, wherein the LNP comprises a mol % of cholesterol of 20-50%, 20-40%, 30-50%, 30-40%, 40-50%, 25-45%, 35-45%, or 35- 40%, wherein mol % is of the total lipid content.
[0017] 11. The LNP of any one of embodiments 1-10, wherein the LNP comprises a mol % of DMG-PEG2000 and / or DSPE-PEG2000 of 0.5-3%, 1-3%, 0.5-2.5%, 0.5-2%, 1-2.5%, 1-2%, 0.5-1.5%, or 2-3%, wherein mol % is of the total lipid content, and wherein the DMG- PEG2000 and / or DSPE-PEG2000 acts as conjugating lipid and further comprises a functional group linking the DMG-PEG2000 and / or DSPE-PEG2000 to the antigen binding fragment of the antibody.
[0018] 12. The LNP of any one of embodiments 1-11, wherein the LNP further comprises a polynucleotide cargo.
[0019] 13. The LNP of embodiment 12, wherein the polynucleotide is single stranded or double stranded and comprises a length of 10-200, 10-100, 10-50, 50-200, 50-100, or 100- 200 bases or base pairs.
[0020] 14. The LNP of any one of embodiments 1-13, wherein (a) the antigen binding fragment of the anti -transferrin receptor antibody comprises a Fab domain; (b) the LNP comprises from 0.1 to 1 mol % Fab, wherein mol % Fab is of the conjugating lipid; (c) theAttorney Docket No: 01164-0038-00PCTLNP has a mean particle diameter of from 75 to 125 nm, or from 90-110 nm as measured by DLS; and (d) the LNP has a poly dispersity of as measured by DLS.
[0021] 15. The LNP of embodiment 14, wherein the antigen binding fragment of the anti- TfR antibody has an affinity for transferrin receptor of 50-500 nM, 100-500 nM, 100-400 nM, 100-300 nM, 200-500 nM, 200-400 nM, or 200-300 nM, as measured by surface plasmon resonance.
[0022] 16. The LNP of embodiment 14 or 15, wherein the LNP comprises a polynucleotide cargo, optionally wherein the polynucleotide cargo shows a fold change from input of at least 2, at least 3, at least 4, of 2-5, of 2-4, of 3-5, of 2-3, or of 3-4, in the brain of an animal following administration, wherein fold change = [{(Percent Tissue Cargo) / (Percent Input Cargo)} - 1],
[0023] 17. A pharmaceutical composition comprising the LNP of any one of embodiments 1-16 and a pharmaceutical carrier or excipient.
[0024] 18. A method of making an LNP of any one of embodiments 1-16, the method comprising (a) dissolving a lipid mixture comprising at least one ionizable lipid, at least one conjugating lipid, and at least one further lipid optionally selected from DSPC, DOPE, DPPC, DOPC and cholesterol in a non-aqueous solvent such as ethanol, (b) dissolving at least one cargo molecule in an aqueous solvent, (c) mixing the non-aqueous solvent phase and the aqueous solvent phase together, optionally at a molar ratio of from 2: 1 to 4: 1 nonaqueous to aqueous solvent, (d) separating LNPs formed during the mixing from unincorporated lipids and cargo, optionally wherein the separating is by ultrafiltration or buffer exchange, and (e) incubating the LNPs with the antigen binding fragment of the anti- TfR antibody under conditions allowing conjugation of the antigen binding fragment, and optionally removing unconjugated antigen binding fragment. Further optionally, in part (e), the anti-TfR antigen binding fragment is conjugated to one or more lipids of the LNP via alkyne-azide chemistry.
[0025] 19. The method of embodiment 18, wherein the method further comprises determining the mean particle diameter and / or the poly dispersity of the LNPs by dynamic light scattering (DLS) or cryo electron microscopy (cryo EM).
[0026] 20. Use of the LNP of any one of embodiments 1-16 or the pharmaceutical composition of embodiment 17 for treating a disease or disorder in a subject, optionally wherein the disease or disorder is a neurological disease or disorder, wherein the LNP orAttorney Docket No: 01164-0038-00PCT pharmaceutical composition is to be administered systemically, optionally wherein the systemic administration comprises intravenous administration.
[0027] 21. A method of treating a neurological disease or disorder in a subject in need thereof, comprising systemically administering the LNP of any one of embodiments 1-16 or the pharmaceutical composition of embodiment 17 to the subject, optionally wherein the systemic administration comprises intravenous administration.
[0028] 22. A method of delivering a cargo molecule across the blood-brain barrier (BBB) in a subject, comprising systemically administering the LNP of any one of embodiments 1-16 or the pharmaceutical composition of embodiment 17 to the subject, optionally wherein the systemic administration comprises intravenous administration.
[0029] 23. The LNP of any one of embodiments 1-16, the pharmaceutical composition of embodiment 17, or the use or method of any one of embodiments 20-22, wherein the cargo shows a fold change from input of at least 2, at least 3, at least 4, of 2-5, of 2-4, of 3-5, of 2-3, or of 3-4, in the brain of the subject following administration, wherein fold change = [{(Percent Tissue Cargo) / (Percent Input Cargo)} - 1],
[0030] 24. A method of detecting uptake of a lipid nanoparticle (LNP) or a mixture of different LNPs in the brain of an animal following systemic administration of the LNP or mixture of different LNPs to the animal, wherein the LNP is conjugated to an antigen binding fragment of an antibody or wherein the mixture of different LNPs comprises at least one LNP conjugated to an antigen binding fragment of an antibody via a conjugating lipid, and wherein the LNP or mixture of LNPs comprises a label or barcode, the method comprising detecting presence of the label or barcode in the brain of the animal following the systemic administration.
[0031] 25. A method of detecting uptake of a lipid nanoparticle (LNP) or a mixture of different LNPs in the brain of an animal following systemic administration of the LNP or mixture of different LNPs to the animal, wherein the method comprises (a) systemically administering the LNP or mixture of different LNPs to the animal, wherein the LNP is conjugated to an antigen binding fragment of an antibody or wherein the mixture of different LNPs comprises at least one LNP conjugated to an antigen binding fragment of an antibody via a conjugating lipid, and wherein the LNP or mixture of different LNPs comprises a label or barcode, and (b) detecting presence of the label or barcode in the brain of the animal following the systemic administration.Attorney Docket No: 01164-0038-00PCT
[0032] 26. The method of embodiment 24 or 25, wherein the method comprises detecting presence of one or more labels or barcodes from a mixture of different LNPs in the brain of the animal.
[0033] 27. The method of embodiment 25, wherein the method comprises systemically administering a mixture of different LNPs to the animal in a single administration and detecting presence of one or more labels or barcodes from the mixture of different LNPs in the brain of the animal following the systemic administration.
[0034] 28. The method of embodiment 26 or 27, wherein each member of the mixture of different LNPs comprises a unique label or unique nucleic acid barcode.
[0035] 29. The method of embodiment 28, wherein each member of the mixture of different LNPs comprises a unique nucleic acid barcode, and wherein detection comprises quantitative PCR. Optionally, in some embodiments, detecting presence of one or more labels or barcodes in the brain of the animal further comprises determining a partition percentage of the one or more labels or barcodes to compare the level in the brain to the level in other tissues, such as the liver, optionally wherein the partition percentage is as follows, wherein “est. total BCbrain” and “est. total BCliver” is the normalized barcode abundance in brain or liver:Est. T otal. BCSrnin1p1p Brain x 100Est. Total BCBrain+ Est. Total BCLiver
[0036] 30. The method of any one of embodiments 24-29, wherein detecting presence of the label or barcode comprises in situ hybridization (ISH).
[0037] 31. The method of any one of embodiments 30, wherein the method further comprises immunofluorescence (IF) detection of cellular markers, and optionally comparison of distribution of cellular markers as detected by IF against distribution of the label or barcode as detected by ISH.
[0038] 32. The method of any one of embodiments 24-31, wherein the mixture of different LNPs comprises 2-100, 2-50, 4-100, 4-50, 10-100, 10-80, 20-80, 30-70, 20-60, 20- 50, 5-10, 10-50, 10-40, 10-30, 20-60, 20-50, 20-40, 30-60, or 30-50 different LNPs,Attorney Docket No: 01164-0038-00PCT optionally wherein each LNP of the mixture of LNPs comprises a unique nucleic acid barcode.
[0039] 33. The method of any one of embodiments 24-32, wherein the antibody is an anti-transferrin receptor (anti-TfR) antibody.
[0040] 34. The method of embodiment 33, wherein the antigen binding fragment of the anti-TfR antibody has an affinity for transferrin receptor of 10 nM to 1 pM, 10-500 nM, 50- 500 nM, 100-500 nM, 100-400 nM, 100-300 nM, 200-500 nM, 200-400 nM, or 200-300 nM as measured by surface plasmon resonance.
[0041] 35. The method of any one of embodiments 24-34, wherein the antigen binding fragment of the antibody comprises a Fab domain.
[0042] 36. The method of embodiment 35, wherein the LNP comprises from 0.01 to 1 mol % Fab, from 0.1 to 1 mol % Fab, from 0.01 to 0.05 mol % Fab, from 0.05 to 0.5 mol % Fab, from 0.1 to 0.5 mol % Fab, from 0.2 to 0.5 mol % Fab, from 0.2 to 0.4 mol % Fab, or from 0.05 to 0.2 mol % Fab, wherein mol % is of the conjugating lipid.
[0043] 37. The method of any one of embodiments 24-36, wherein the LNP has a mean particle diameter of 50-200 nm, 50-150 nm, 75-150 nm, 100-150 nm, 75-100 nm, 75-125 nm, 80-120 nm, or 90-110 nm as measured by dynamic light scattering (DLS); and / or wherein the LNP has a flexibility as measured by a Laudran GP of greater than -1 or less than 1, or of from greater than -0.5 to less than 0.5, or of from greater than -0.1 to less than 0.5, or of from greater than 0 to less than 0.5.
[0044] 38. The method of any one of embodiments 24-37, wherein the LNP has a poly dispersity of 15-40%, 15-30%, 15-25%, 20-30%, 15-20%, or 20-25% as measured by dynamic light scattering (DLS).
[0045] 39. The method of any one of embodiments 24-38, wherein the LNP or mixture of LNPs comprises an ionizable lipid, a conjugating lipid, one or both of DSPC and DOPE, and cholesterol.
[0046] 40. The method of embodiment 39, wherein the LNP or mixture of LNPs comprises DMG-PEG2000 and / or DSPE-PEG2000 as conjugating lipid, wherein the DMG- PEG2000 and / or DSPE-PEG2000 comprises a functional group linking the DMG-PEG2000 and / or DSPE-PEG2000 to the antigen binding fragment of the antibody.
[0047] 41. The method of embodiment 39 or 40, wherein the LNP or mixture of LNPs comprises a mol % of 40-60%, 40-50%, 50-60%, or 45-55% of ionizable lipid, wherein mol % is of the total lipid content.Attorney Docket No: 01164-0038-00PCT
[0048] 42. The method of any one of embodiments 39-41, wherein the LNP or mixture of LNPs comprises a mol % of 5-15%, 5-10%, 10-25%, or 7-13% of DSPC and / or DOPE, wherein mol % is of the total lipid content.
[0049] 43. The method of any one of embodiments 32-42, wherein the LNP or mixture of LNPs comprises a mol % of 20-50%, 20-40%, 30-50%, 30-40%, 40-50%, 25-45%, 35-45%, or 35-40% cholesterol, wherein mol % is of the total lipid content.
[0050] 44. The method of any one of embodiments 41-43, wherein the LNP or mixture of LNPs comprises 0.5-3%, 1-3%, 0.5-2.5%, 0.5-2%, 1-2.5%, 1-2%, 0.5-1.5%, or 2-3% DMG- PEG2000 and / or DSPE-PEG2000 as conjugating lipid, wherein mol % is of the total lipid content, and wherein the DMG-PEG2000 and / or DSPE-PEG2000 comprises a functional group linking the DMG-PEG2000 and / or DSPE-PEG2000 to the antigen binding fragment of the antibody.
[0051] 45. The method of any one of embodiments 41-44, wherein the LNP or mixture of LNPs comprises DSPE-PEG2000 as conjugating lipid, wherein the DSPE-PEG2000 further comprises a functional group linking the DSPE-PEG2000 to the antigen binding fragment of the antibody, optionally wherein the functional group comprises an azide-alkyne cycloaddition reaction product.
[0052] 46. The method of any one of embodiments 24-45, wherein the animal is a mouse or rat.
[0053] 47. The method of any one of embodiments 24-46, wherein the systemic administration comprises intravenous administration.
[0054] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate certain embodiments and together with the description, serve to further explain certain principles described herein.
[0055] All references cited herein are incorporated by reference in their entirety.BRIEF DESCRIPTION OF THE DRAWINGS
[0056] Fig. 1 A-1C show schematics of methods herein of assessing CNS or brain uptake of a pool of uniquely barcoded LNP formulations after systemic administration to an animal. Fig. 1 A provides a schematic of LNP components, noting that each component can impact particle stability, biodistribution, and delivery efficiency. Fig. IB shows the polynucleotide sequence of barcodes used in studies described in the working examples herein (SEQ ID NO: 1). Fig.Attorney Docket No: 01164-0038-00PCT1C shows a schematic of the use of nucleic acid barcodes as cargo in LNPs, allowing the biodistribution and delivery efficiency of different LNP formulations to be specifically tracked in vivo.
[0057] Fig. 2 shows the experimental workflow of the screening methods described in the working examples herein.
[0058] Fig. 3 shows a further schematic of the screening methods described in Examples 1-2 herein. The figure shows the components of LNPs tested and their administration to mice. In particular, transgenic heterozygous mice expressing human transferrin receptor, recognized by anti-human transferrin receptor Fab domains on LNPs were used. A single IV bolus dose of a pool of different LNPs, each with a unique nucleic acid barcode as cargo was administered by IV to mice at a dose of 8 mL / kg by tail vein injection. Animals were taken down 24 hours post dosing and samples of liver and brain were collected for analysis. The figure also shows a schematic of characterization of the LNPs of the pool.
[0059] Fig. 4A-4F show information regarding the LNPs tested in the experiments described herein. Fig. 4 A shows the components of the tested LNPs and a schematic of LNPs with increasing amounts of conjugated Fab fragments. 48 different LNPs were prepared based on the choice of different ionizable lipid, helper lipid (DOPE or DSPC), cholesterol and other lipids, and the mol% of anti -transferrin receptor Fab based on the conjugating lipid (i.e., based on the amount of conjugating lipid used in preparation of the LNPs). The formulations shown have a ratio of 50: 10:38: 1 : 1 of ionizable lipid, helper lipid (DOPE or DSPC), cholesterol, DMG-PEG2000, and DSPE-PEG2000-N3. Fig. 4B shows the particle size of the different LNPs, measured as mean particle diameter in nm by dynamic light scattering (DLS). As can be seen, the choice of ionizable lipid had an impact on particle size, with lipid 1 producing LNPs of larger size (mean particle diameter 150-200 nm) than those of any of lipids 2-4 (mean particle diameter roughly 100 nm). Fig. 4C shows poly dispersity as a percentage, measured by DLS. As can be seen, in general, the poly dispersity was 20% or lower in most LNP formulations. Fig. 4D provides a graph showing the size (diameter) for each LNP and for the final dosing solution (pool). Fig. 4E provides cryo-EM images depicting the morphology of LNPs without conjugated Fab (LNP-1, LNP-7, LNP-13) (left column) and LNPs with Fab (LNP-3, LNP-9, LNP-15) (middle column), scale = 100 nm. The column on the farthest right shows a zoomed-in view of LNP-Fabs (LNP-3, LNP-9 and LNP- 15), scale = 20 nm. Fig. 4F shows the poly dispersity of the LNPs, as well as for the final pool (see bar at the right of the graph).Attorney Docket No: 01164-0038-00PCT
[0060] Fig. 5A-5B show downstream tissue processing and analysis of distribution of barcodes in the brain and liver. Fig. 5 A shows a schematic of brain tissue, showing that the right hemi-brain was analyzed by quantitative PCR (qPCR) and the left hemi -brain was analyzed by in situ hybridization (ISH) and immunofluorescence (IF). Fig. 5B shows pPCR results in liver and brain samples for animals administered with a control saline solution (saline) and a pool of 47 different barcoded LNP formulations (LNP-Fab). Each point represents one animal; there were four control animals and six LNP-Fab experimental animals. The results show a more than 10-fold increase in qPCR barcode in the brain compared to saline control.
[0061] Fig. 6 shows analysis of individual barcode data for LNP formulations in the LNP pool in brain and liver tissue samples. Each of the 8 plots shows the fold change in barcode signal compared to the input pool for LNP formulations with a particular ionizable lipid and helper lipid combination with 0, 0.075, or 0.375 mol% anti-transferrin receptor Fab based on conjugating lipid. Fold change = [{(percent tissue barcode) / (percent input barcode)} - 1], As shown, certain ionizable lipid and helper lipid combinations were significantly enriched in brain tissue as the concentration of Fab increased.
[0062] Fig. 7A-7D show graphs representing the fold change relative to the dosed pool (input) of barcode in brain (blue) and liver (green), analyzed by amplicon sequencing. Error bars are SEM. The dashed line at y-axis = 1 represents the threshold for enrichment relative to the dosed material. For each cationic / ionizable lipid and helper lipid (circle: DSPC, square: DOPE), Fab target density (mol%) is plotted on the x-axis and fold change relative to the input (dosed pool) on the y-axis. Statistics are represented per Table 2. Graphs are shown for each cationic / ionizable lipid with Fig. 7A = lipid 1, Fig. 7B = lipid 2, Fig. 7C = lipid 3, and Fig. 7D = lipid 4.
[0063] Fig. 8 provides a graph showing barcode (BC) abundance (red) in blood at 15 mins, 6 and 24 hours respectively. Saline control in blue at 15 min . Error bars are SEM.
[0064] Fig. 9A-9C shows ISH and IF data from the experiments described herein. Fig. 9A shows DAPI staining of a hemi-brain section in a sample from a saline control. Fig. 9B shows DAPI staining of a hemi-brain section in a sample from an animal administered the pooled Fab-LNP sample overlaid with staining of barcode DNA. Fig. 9C shows sections of thalamus (upper panels) and hippocampus (lower panels) with overlaying of staining of barcodes by ISH and of CD31 in endothelial cells and NeuN in neurons, as well as cell nuclei by DAPI. As shown in the figure, a substantial barcode positive signal was observed awayAttorney Docket No: 01164-0038-00PCT from endothelial cells (CD31) thereby confirming distribution in the parenchyma (indicated by stars in the far left panels). Sparse signal was observed colocalizing with neurons (NeuN).
[0065] Fig. 10A-10B show correlation plots demonstrate the relationship between relative abundance in brain (y-axis) and (Fig. 10A) diameter (x-axis) measured by DLS for all samples incorporated in the study and (Fig. 10B) Laudran GP (x-axis) for select formulations where Laudran GP was calculated. For both graphs, LNP-3 is in green, LNP-8 in purple and LNP-15 in orange. A linear fit analysis was performed to calculate R2in both cases.DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS1. Definitions
[0066] Unless otherwise defined, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those of ordinary skill in the art.
[0067] In this application, the use of “or” means “and / or” unless stated otherwise. In the context of a multiple dependent claim, the use of “or” refers back to more than one preceding independent or dependent claim in the alternative only. In this application, the article “a” or “the” preceding an item generally means “one or more” of such an item, unless context dictates that only one such item can be present. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit unless specifically stated otherwise.
[0068] As described herein, any concentration range, percentage range, ratio range or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated.
[0069] Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. The headings provided herein are not limitations of the various aspects of the disclosure, which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification in its entirety.
[0070] As utilized in accordance with the present disclosure, the following terms, unless otherwise indicated, shall be understood to have the following meanings:Attorney Docket No: 01164-0038-00PCT
[0071] “Affinity” refers to the strength of the sum total of noncovalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless indicated otherwise, as used herein, “binding affinity” refers to intrinsic binding affinity which reflects a 1 : 1 interaction between members of a binding pair (e.g., antibody and antigen). The affinity of a molecule X for its partner Y can generally be represented by the dissociation constant (KD). Affinity can be measured by common methods known in the art, including those described herein.
[0072] The “blood-brain barrier” or “BBB” refers to the physiological barrier between the peripheral circulation and the brain and spinal cord (i.e., the CNS) which is formed by tight junctions within the brain capillary endothelial plasma membranes, creating a tight barrier that restricts the transport of molecules into the brain, even very small molecules such as urea (60 Daltons). The blood-brain barrier within the brain, the blood-spinal cord barrier within the spinal cord, and the blood-retinal barrier within the retina are contiguous capillary barriers within the CNS, and are herein collectively referred to as the blood-brain barrier or BBB. The BBB also encompasses the blood-CSF barrier (choroid plexus) where the barrier is comprised of ependymal and brain micro endothelial cells (BMECs). The “central nervous system” or “CNS” refers to the complex of nerve tissues that control bodily function, and includes the brain and spinal cord.
[0073] The term “transferrin receptor” or “TfR”, as used herein, refers to any native TfR from any vertebrate source, including mammals such as primates (e.g., humans) and rodents (e.g., mice and rats), unless otherwise indicated. The term encompasses “full-length,” unprocessed TfR as well as any form of TfR that results from processing in the cell. The term also encompasses naturally occurring variants of TfR, e.g., splice variants or allelic variants. TfR is a transmembrane glycoprotein (with a molecular weight of about 180,000) composed of two disulphide-bonded sub-units (each of apparent molecular weight of about 90,000) involved in iron uptake in vertebrates. In some embodiments, the TfR herein is human TfR (“hTfR”) also termed human transferrin receptor protein 1 (hTfRl) comprising the amino acid sequence as set forth in Schneider et al. Nature 311 : 675 - 678 (1984) with UniProt Ref. No. P02786, for example (SEQ ID NO: 5). In another embodiment, the TfR herein is primate TfR (“pTfR”) comprising the amino acid sequence as set forth in Genbank reference AFD18260.1 (SEQ ID NO: 6). For comparison, the mouse TfR sequence may be found in Genbank reference AAH54522.1 (SEQ ID NO: 7).Attorney Docket No: 01164-0038-00PCT
[0074] A “lipid nanoparticle,” abbreviated “LNP,” refers to a particle that comprises a plurality of lipid molecules physically associated with each other by intermolecular forces. In some cases, an LNP may form a liposome. In some cases, the LNP may partially or fully encapsulate at least one type of “cargo” or “payload” molecule.
[0075] The term “plurality” herein refers to two or more. In some embodiments, a plurality may also comprise more than two, such as at least three, at least four, and so forth. In some cases, the items of a plurality may be mixed together, i.e., in a mixture. In some cases, each member of a plurality of items may be separate from the other members of the plurality.
[0076] The terms “polynucleotide” or “nucleic acid” are used interchangeably to refer to a double stranded or single stranded polymer of nucleotide residues, including DNA, RNA, PNA, LNA, and the like. In some cases, a polynucleotide or nucleic acid may include chemical modifications in the nucleotide backbone and / or nucleotide bases, while in other cases, the backbone and / or bases may be unmodified. In some cases, a polynucleotide or nucleic acid may also be conjugated to otherwise attached to a label for detection. A single stranded or double stranded polynucleotide that is relatively short in length, such as 100 nucleotides or less, may also be referred to as an “oligonucleotide.”
[0077] A “label” herein, refers to a detectable moiety or a chemical group or molecule that associates with a detectable moiety. A “label,” for example, can include a radiolabel, dye, fluorescent molecule, hapten, or metal ion, among others.
[0078] A “cargo” or “payload” in the context of an LNP refers to a molecule that is at least partially encapsulated within or otherwise physically associated with an LNP such that the LNP is capable of assisting with the transport of the cargo or payload from one location to another. For example, in some cases a cargo can include a polynucleotide (e.g., an oligonucleotide), polypeptide (e.g., a peptide), organic molecule, drug, or the like. In some cases, a cargo may include more than one different molecule, such as more than one polynucleotide or polypeptide species. In some cases, a cargo may comprise a “barcode” molecule, such as a nucleic acid barcode.
[0079] The terms “polypeptide” and “protein” are used interchangeably and refer to a polymer of amino acid residues. Such polymers of amino acid residues may contain natural and / or non-natural amino acid residues, and include, but are not limited to, peptides, dimers, trimers, and multimers of amino acid residues. The terms also include polymers of amino acids that have modifications such as, for example, glycosylation, sialylation, and the like, or that are complexed with other molecules. A polypeptide or protein herein may in some casesAttorney Docket No: 01164-0038-00PCT also be conjugated or otherwise attached to a label for detection. A relatively short polypeptide such as up to 50 amino acid residues in length may also be called a “peptide” or “oligopeptide” herein.
[0080] The term “antibody” herein refers to a type of polypeptide comprising at least complementarity-determining region (CDR) 1, CDR2, and CDR3 of a heavy chain (HC) and at least CDR1, CDR2, and CDR3 of a light chain (LC) or alternatively comprising at least CDR1, CDR2, and CDR3 of a camelid antibody heavy chain, wherein the molecule is capable of binding to antigen. An “antibody fragment” or “antigen binding fragment of an antibody” herein refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds the antigen to which the intact antibody binds. Examples of antibody fragments include but are not limited to Fab, Fv, Fab', Fab’-SH, F(ab')2; diabodies; linear antibodies; single-chain antibody molecules (e.g., scFv and scFab); and single domain antibodies (sdAbs, VHH, nanobodies). For a review of certain antibody fragments, see Holliger and Hudson, Nature Biotechnology 23 : 1126-1136 (2005). In some cases, an antigen binding fragment of an antibody comprises a light chain variable region (VL) and a heavy chain variable region (VH) of an antibody. The term “variable region” or “variable domain” interchangeably refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to antigen. The variable domains of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three complementary determining regions (CDRs). See, e.g., Kindt et al. Kuby Immunology, 6thed., W.H. Freeman and Co., page 91 (2007). A variable domain may comprise heavy chain (HC) CDR1-FR2- CDR2-FR3-CDR3 with or without all or a portion of FR1 and / or FR4; and light chain (LC) CDR1-FR2-CDR2-FR3-CDR3 with or without all or a portion of FR1 and / or FR4. That is, a variable domain may lack a portion of FR1 and / or FR4 so long as it retains antigen-binding activity.
[0081] The term “isolated” or “purified” polynucleotide, nucleic acid, polypeptide or protein means such a molecule that has been at least partially separated from one or more contaminants. In some embodiments, purification is to greater than 80%, 90%, 95%, or 99% purity as determined by, for example, electrophoretic (e.g., SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis) or chromatographic (e.g., ion exchange or reverse phase HPLC) methods. For a review of methods for assessment of protein and antibody purity, see, e.g., Flatman et al., J. Chromatogr. B 848:79-87 (2007).Attorney Docket No: 01164-0038-00PCT
[0082] A “barcode” herein refers to a molecule or group that distinguishes a particular entity, such as a particular LNP formulation herein, from other, similar entities such as other LNP formulations, that do not comprise a barcode, or that comprise a different barcode. In some cases, a specific “barcode” molecule may be a cargo in an LNP in order to distinguish that LNP from other, different LNPs in a mixture, which may incorporate different barcode molecules as cargo. In some embodiments, the “barcode” is a “nucleic acid barcode,” comprising for example a unique, distinguishable nucleic acid sequence, such that a particular LNP comprising that nucleic acid barcode may be distinguished from other LNPs in a mixture incorporating different nucleic acid barcodes. In some embodiments, barcodes may be utilized that allow for simultaneous detection of, for instance, 10, 50, or 100, or more different LNP formulations at a particular location.
[0083] As used herein, a method step that is performed “in parallel,” for example, on a plurality of samples means that the method step is performed on the plurality of samples at the same time. In some cases, for example, a series of samples is mixed together before use in the method step and then the individual samples from the mixture, in some embodiments, are detected using different barcodes or different labels, or the like.
[0084] A “pharmaceutical composition” means a composition that is intended to be used pharmaceutically. Such a composition typically comprises at least one active agent and at least one carrier or excipient. A “carrier” or “excipient” refers to a non-toxic solid, semisolid, or liquid filler, diluent, encapsulating material, formulation auxiliary, or carrier conventional in the art for use with an active agent that together comprise a “pharmaceutical composition” intended for administration to a subject. In general, a carrier or excipient used in a pharmaceutical composition is “pharmaceutically acceptable.” A “pharmaceutically acceptable” carrier is a carrier that is non-toxic to recipient subjects at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
[0085] Additional definitions may be found in the following sections.2. LNP Formulations, Manufacture, and Characterization
[0086] The present disclosure encompasses, for example, lipid nanoparticles (LNPs) optimized for improved transport across the blood-brain barrier (BBB), as well as methods of screening for such LNPs and methods of preparing and using such LNPs. For example, the present disclosure encompasses LNPs wherein the LNP is conjugated to an antigen binding fragment of an anti -transferrin receptor (anti-TfR) antibody, such as an anti-human transferrinAttorney Docket No: 01164-0038-00PCT receptor (anti-hTfR) antibody. In some cases, the transferrin receptor recognized by the antigen binding fragment of the antibody comprises the amino acid sequence of SEQ ID NO: 5 (human transferrin receptor 1). In other cases, the transferrin receptor recognized by the antigen binding fragment of the antibody is a primate or other mammalian transferrin receptor (such as, e.g., with SEQ ID NO: 6 or 7). In some embodiments, the lipid components of the LNPs comprise at least one ionizable lipid, at least one conjugating lipid, and at least one further lipid optionally selected from DSPC, DOPE, and cholesterol. In some cases, the LNP comprises (a) at least one ionizable lipid, (b) at least one further lipid such as DPPC, DOPC, DSPC and / or DOPE, (c) cholesterol, and (d) one or both of DMG-PEG2000, and DSPE-PEG2000, either of which may include suitable functional groups to act as a conjugating lipid. In some cases, the at least one additional lipid is DSPC and / or DOPE. An “ionizable lipid” refers to a lipid that is capable of existing as an ion under certain pH conditions. In some embodiments, an ionizable lipid is charged under some pH conditions but neutral under other pH conditions. For example, an ionizable lipid may be positively charged (i.e., cationic) under acidic pH but neutral at physiological pH (i.e. 7.0 to 7.4). Examples of ionizable lipids known in the literature include, for example, DOTMA, DODMA, DODAP, Dlin-DMA, Dlin-KC2-DMA, Dlin-MC3-DMA, among many others (see M. Schlich, Bioeng. Transl. Med., 2021;6:el0213 (available at doi.org / 10.1002 / btm2.10213); G. Settani, Macromolecular Rapid Comm. 43: 2100683, 2022 (available at doi.org / 10.1002 / marc.2100683); X. Han, Nature Comm. 12: 7233, 2021 (available at doi.org / 10.1038 / s41467-021-27493-0)). As used herein, in some cases an ionizable lipid may be a lipid that is positively charged under both acidic and physiological conditions (e.g., a cationic lipid). Certain ionizable lipids, for example, have been used for delivery of polynucleotide therapeutics. (See X. Han, for example.) In some cases, the “ionizable lipid” may be a mixture of two or more different ionizable lipids. In other cases, an LNP may comprise only one species of ionizable lipid. As used herein, a “conjugating lipid” refers to a lipid molecule that contains appropriate functional groups, such as, without limitation, an azide or mal eimide group, or similar, that allow for conjugation to another molecule such as an antigen binding fragment of an antibody, and thus, that is capable of being conjugated to an antigen binding fragment of an antibody. In some cases, at least some of the conjugating lipid is conjugated to an antibody and comprises, for example, the conjugation reaction product of an azide or maleimide.Attorney Docket No: 01164-0038-00PCT
[0087] In some cases, the DMG-PEG2000 and / or DSPE-PEG2000 is included in an LNP herein to act as conjugating lipid for conjugation to the antigen binding fragment of the antibody. Thus, in some cases, the DMG-PEG2000 and / or DSPE-PEG2000 comprises an azide functional group, maleimide functional group, or similar reactive functional group in order to facilitate conjugation of the lipid to the antigen binding fragment of the anti-TfR antibody. Thus, for example, in some cases, DMG-PEG2000 and / or DSPE-PEG2000 in the LNP is conjugated to the anti-TfR antibody via such a functional group, and thus the DMG- PEG2000 and / or DSPE-PEG2000 in the LNPs comprises a functional group linking the DMG-PEG2000 and / or DSPE-PEG2000 to the antigen binding fragment of the antibody. In some cases, the functional group is a conjugation reaction product of an azide group. In other cases, the functional group is a conjugation reaction product of a maleimide group.
[0088] In some cases, the antigen binding fragment of the anti-transferrin receptor antibody comprises a Fab domain. In other cases, the antigen binding fragment is an Fv, Fab’, Fab’- SH, F(ab')2, scFv, or other type of antigen binding fragment as described herein. In some cases, the transferrin receptor to which the antigen binding fragment binds is a human transferrin receptor (huTfR) such as human transferrin receptor protein 1 (huTfRl; SEQ ID NO: 1). In other cases, the transferrin receptor protein is another mammalian transferrin receptor (such as primate, mouse, etc.). In some cases, the LNP comprises from 0.01 to 1 mol % anti-TfR antigen binding fragment, from 0.01 to 0.5 mol % anti-TfR antigen binding fragment, from 0.05 to 0.5 mol % anti-TfR antigen binding fragment, from 0.1 to 0.5 mol % anti-TfR antigen binding fragment, from 0.2 to 0.5 mol % anti-TfR antigen binding fragment, from 0.2 to 0.4 mol % anti-TfR antigen binding fragment, or from 0.05 to 0.2 mol % anti-TfR antigen binding fragment, or 0.05 mol %, 0.075 mol %, 0.1 mol %, 0.15 mol %, 0.2 mol %, 0.25 mol %, 0.3 mol %, 0.35 mol %, 0.375 mol %, 0.4 mol %, 0.45 mol %, or 0.5 mol % anti-TfR antigen binding fragment, or any range between those numbers, wherein mol % is of the conjugating lipid. In some cases, the LNP comprises from 0.01 to 1 mol % Fab, from 0.01 to 0.5 mol % Fab, from 0.05 to 0.5 mol % Fab, from 0.1 to 0.5 mol % Fab, from 0.2 to 0.5 mol % Fab, from 0.2 to 0.4 mol % Fab, or from 0.05 to 0.2 mol % Fab, or 0.05 mol %, 0.075 mol %, 0.1 mol %, 0.15 mol %, 0.2 mol %, 0.25 mol %, 0.3 mol %, 0.35 mol %, 0.375 mol %, 0.4 mol %, 0.45 mol %, or 0.5 mol % Fab, or any range between those numbers, wherein mol % is of the conjugating lipid. A mol % based on conjugating lipid generally means that the mol % is determined based on the molar amount of conjugating lipid species,Attorney Docket No: 01164-0038-00PCT i.e., comprising an appropriate conjugation functional group, that was used to prepare the LNP.
[0089] In some cases, the antigen binding fragment of the anti-TfR antibody is derived from a “low affinity” anti-TfR antibody, as described, for example, in WO2016 / 081640 and / or WO 2016 / 081643, both of which are incorporated by reference herein. For example, a “low affinity” anti-TfR antibody may have an affinity for human or primate TfR from about 5nM, or from about 20 nM, or from about 100 nM, to about 50 pM, or to about 30 pM, or to about 10 pM, or to about 1 pM, or to about 500 nM. Thus, the affinity may be in the range from about 5 nM to about 50 pM, or in the range from about 20 nM to about 30 pM, or in the range from about 30 nM to about 30 pM, or in the range from about 50 nM to about 1 pM, or in the range from about 100 nM to about 500 nM, e.g. as measured by Scatchard analysis or surface plasmon resonance (e.g., BIACORE®). In some embodiments, the antibody has a dissociation half-life from TfR of less than 1 minute, less than 2 minutes, less than 3 minutes, less than four minutes, less than 5 minutes, or less than 10 minutes to about 20 minutes, or to about 30 minutes, as measured by competition binding analysis or surface plasmon resonance (e g., BIACORE®).
[0090] As described in WO2016 / 081640, for example, an exemplary BIACORE® analysis may be performed using a BIACORE®-2000 (BIAcore, Inc., Piscataway, NJ) at 25°C using anti-human Fc kit (BiAcore Inc., Piscataway, NJ). Briefly, carb oxy methylated dextran biosensor chips (CM5, BIACORE, Inc.) is activated with A-ethyl-A’- (3- dimethylaminopropyl)-carbodiimide hydrochloride (EDC) and A-hydroxysuccinimide (NHS) according to the supplier’s instructions. Anti-human Fc antibody is diluted with 10 mM sodium acetate, pH 4.0, to 50 pg / ml before injection at a flow rate of 5 pl / minute to achieve approximately 10000 response units (RU) of coupled protein. Following the injection of antibody, 1 M ethanolamine is injected to block unreacted groups. For kinetics measurements, antibody may be injected in HBS-P to reach about 220 RU, then two-fold serial dilutions of MuTfR-His (0.61 nM to 157 nM) are injected in HBS-P at 25°C at a flow rate of approximately 30 pl / min. Association rates (kon) and dissociation rates (koff) are calculated using a simple one-to-one Langmuir binding model (BIACORE® Evaluation Software version 3.2) by simultaneously fitting the association and dissociation sensorgrams. The equilibrium dissociation constant (Kd) is calculated as the ratio koff / kon. See, e.g., Chen et al., J. Mol. Biol. 293:865-881 (1999).Attomey Docket No: 01164-0038-00PCT
[0091] In some cases, the anti-TfR antibody has an affinity for transferrin receptor of 5 nM to 1 pM, 10 nM to 1 pM, 10-500 nM, 50-500 nM, 100-500 nM, 100-400 nM, 100-300 nM, 200- 500 nM, 200-400 nM, or 200-300 nM as measured by surface plasmon resonance. In some cases, the antigen binding fragment of the anti-TfR antibody has an affinity for transferrin receptor of 5 nM to 1 pM, 10 nM to 1 pM, 10-500 nM, 50-500 nM, 100-500 nM, 100-400 nM, 100-300 nM, 200-500 nM, 200-400 nM, or 200-300 nM as measured by surface plasmon resonance.
[0092] In some cases, an LNP herein has a mean particle diameter of 50-200 nm, 50-150 nm, 75-150 nm, 100-150 nm, 75-100 nm, 75-125 nm, 80-120 nm, or 90-110 nm as measured by dynamic light scattering (DLS). In some cases, an LNP herein has a mean particle diameter of 150 nm or less, such as 50-150 nm, 75-150 nm, 100-150 nm, 75-100 nm, 75-125 nm, 80- 120 nm, or 90-110 nm. In some cases, an LNP herein has a mean particle diameter of 125 nm or less, such as 75-125 nm, 75-100 nm, 80-125 nm, 100-125 nm, or 90-110 nm. In some cases, an LNP herein has a mean particle diameter of 110 nm or less, such as 75-100 nm or 90-110 nm. In some cases, an LNP herein has a mean particle diameter of about 100 nm, such as from 80-120 nm or from 90-110 nm.
[0093] In some cases, an LNP herein has a poly dispersity of 15-40%, 15-30%, 15-25%, 20- 30%, 15-20%, or 20-25% as measured by dynamic light scattering (DLS). In some cases, the poly dispersity is 40% or lower. In some cases, the poly dispersity is 30% or lower, such as 15-30%, 15-25%, 20-30%, 15-20%, or 20-25%. In some cases the poly dispersity is 25% or lower, such as 15-25%, 15-20%, or 20-25%. In some cases, the poly dispersity is about 20%, such as 15-25%, or 18-22%. In some cases, an LNP herein has both a particle size of 50-150 nm, 75-150 nm, 100-150 nm, 75-100 nm, 75-125 nm, 80-120 nm, or 90-110 nm and a poly dispersity of 15-40%, 15-30%, 15-25%, 20-30%, 15-20%, or 20-25%, as measured by dynamic light scattering (DLS). In some cases, an LNP herein has both a particle size of 75- 125 nm, 80-120 nm, or 90-110 nm and a poly dispersity of 15-25%, 15-20%, or 20-25%, as measured by dynamic light scattering (DLS). In some embodiments, the LNP has a flexibility as measured by a Laudran GP of greater than -1 or less than 1, or of from greater than -0.5 to less than 0.5, or of from greater than -0.1 to less than 0.5, or of from greater than 0 to less than 0.5.
[0094] In some cases, an LNP herein comprises a mol % of ionizable lipid of 40-60%, 40- 50%, 50-60%, or 45-55%, wherein mol % is of the total lipid content. In some cases, an LNP herein comprises a mol % of a further lipid such as DPPC, DOPC, DSPC and / or DOPE of 5-Attorney Docket No: 01164-0038-00PCT15%, 5-10%, 10-25%, or 7-13%, wherein mol % is of the total lipid content. In some cases, the further lipid is DSPC or DOPE. In some cases, an LNP herein comprises a mol % of DSPC and / or DOPE of 5-15%, 5-10%, 10-25%, or 7-13%, wherein mol % is of the total lipid content. In some cases, an LNP herein comprises a mol % of cholesterol of 20-50%, 20-40%, 30-50%, 30-40%, 40-50%, 25-45%, 35-45%, or 35-40%, wherein mol % is of the total lipid content. In some cases, an LNP herein further comprises a mol % of DMG-PEG2000 and / or DSPE-PEG2000, one or both of which serving as a conjugating lipid, for example, of 0.5-3%, 1-3%, 0.5-2.5%, 0.5-2%, 1-2.5%, 1-2%, 0.5-1.5%, or 2-3%, wherein mol % is of the total lipid content, and wherein the DMG-PEG2000 and / or DSPE-PEG2000 further comprises a functional group linking the DMG-PEG2000 and / or DSPE-PEG2000 to the antigen binding fragment of the antibody. In some cases, one or both of DMG-PEG2000 and / or DSPE- PEG2000 or a similar PEGylated lipid may act as a conjugating lipid. In some cases, the molar ratio of the lipids in the LNP may be 45-55 ionizable lipid : 7-15 further (helper) lipid : 35-45 cholesterol : 1-3 conjugating and / or PEGylated lipid such as DMG-PEG2000 and / or DSPE-PEG2000. In some cases, the molar ratio of the lipids in the LNP may be, for example, 50 ionizable lipid : 10 further (helper) lipid : 38 cholesterol : 2 PEGylated lipid DMG- PEG2000 and / or DSPE-PEG2000. In some cases, the PEGylated lipids may comprise 50% conjugating lipid and 50% non-conjugating lipid, such as 50% DMG-PEG2000 and 50% DSPE-PEG2000-N3, for example.
[0095] LNPs herein may comprise one or more than one cargo molecule. In some embodiments, an LNP herein comprises a polynucleotide cargo. Polynucleotide cargo molecules may comprise, for example double or single- stranded DNA or RNA, for example. A polynucleotide cargo in some cases comprises a length of 10-200, 10-100, 10-50, 50-200, 50-100, or 100-200 bases (if single-stranded) or base pairs (if double stranded). Such a cargo may, in some cases, comprise an oligonucleotide of, for example, 3-100, 3-50, 10-100, 10-50, or 50-100 bases or base pairs.
[0096] In some cases, for use in a pharmaceutical composition, the cargo may comprise, for example, an antisense oligonucleotide (ASO) such as an antisense RNA, a bivalent ASO, an siRNA, a bivalent siRNA, a guide RNA, a circular DNA or RNA, a viral vector, or the like, for example, intended for delivery to the CNS or brain. In some cases, a polynucleotide cargo may comprise one or a plurality of base or backbone modifications. In other embodiments, a cargo may comprise a polypeptide, organic molecule, drug, or the like. Pharmaceutical compositions comprising an LNP herein, may in some cases also comprise atAttorney Docket No: 01164-0038-00PCT least one pharmaceutically acceptable carrier or excipient to facilitate their administration to animals and to help retain the stability of the LNP, for example.
[0097] For uses in screening methods, for example, as described below, an LNP cargo may comprise a nucleic acid barcode or similar nucleic acid that allows for detection in situ based on its polynucleotide sequence, such as through PCR or in situ hybridization or similar methods. In some embodiments, a cargo may comprise a label, for example such as a dye, fluorophore, radiolabel, hapten, or a moiety recognized by a primary antibody in a detection assay. When an LNP formulation comprises a unique cargo such as a particular barcode or a particular label that is distinguishable from other barcodes or labels, then a pool of different LNPs can be created, each with its own unique barcode or label, allowing the localization of those LNPs following administration to an animal to be individually determined and distinguished from the localization of other LNPs in the pool.
[0098] An LNP herein may, for example, assist in helping a cargo molecule penetrate the BBB in an animal. For instance, in general, < 0.2 % of antibodies are able to cross the BBB following intravenous (IV) administration, while in general only about 2 % of small molecule drugs or peptides are able to cross following IV administration. An LNP herein can, in some cases, be used to deliver a drug cargo, such as a polynucleotide drug, past the BBB to the CNS or brain, such that the LNP enhances delivery of the cargo to CNS or brain. In some cases, the cargo may be distributed to, for example, neurons, microglia, astrocytes, pericytes, and / or brain endothelial cells, among other locations in the CNS.
[0099] Furthermore, in some embodiments, the cargo from an anti-TfR antigen binding fragment-conjugated LNP herein, such as a polynucleotide cargo, shows a fold change in brain tissue of from 2-5 fold, such as 2-4 fold, 3-4 fold, 3-5 fold, or 3-4 fold, in an LNP conjugated to an antigen binding fragment of an anti-TfR antibody. In contrast, in some cases an LNP that is otherwise identical but not conjugated to an antigen binding fragment of an antibody may have a fold change of about zero. For example, the fold change = [{(Percent Tissue Cargo) / (Percent Input Cargo)} - 1], (See, e.g., Fig. 6.) In some cases, the cargo from an anti-TfR antigen binding fragment-conjugated LNP herein may show a concentration in brain tissue at least 2 fold, at least 3 fold, at least 4 fold, from 2-6 fold, such as 2-5 fold, 2-4 fold, 3-4 fold, 3-6 fold, 3-5 fold, or 3-4 fold higher than that of an identical LNP that is not conjugated to any antigen binding fragment. (See also Fig. 6, comparing the 0 mol% Fab data to the 0.075 mol% and 0.375 mol% data in each panel.)Attorney Docket No: 01164-0038-00PCT
[0100] The disclosure herein further encompasses methods of making LNPs herein. In some cases, LNPs may be prepared by a method comprising (a) dissolving a lipid mixture comprising at least one ionizable lipid, at least one conjugating lipid, and at least one further lipid optionally selected from DSPC, DOPE, DPPC, DOPC and cholesterol in a non-aqueous solvent such as ethanol, (b) dissolving at least one cargo molecule in an aqueous solvent, (c) mixing the non-aqueous solvent phase and the aqueous solvent phase together, optionally at a molar ratio of from 2: 1 to 4: 1 non-aqueous to aqueous solvent, (d) separating LNPs formed during the mixing from unincorporated lipids and cargo, optionally wherein the separating is by ultrafiltration, and (e) incubating the LNPs with the antigen binding fragment of the anti- TfR antibody under conditions allowing conjugation of the antigen binding fragment, and optionally removing unconjugated antigen binding fragment. In some cases, the non-aqueous and aqueous solvents are mixed at a molar ratio of from 2: 1 to 3 : 1, or from 3 : 1 to 4: 1, or at 2: 1, 3 : 1, or 4: 1, for example. In some cases, the mixing may be performed by an instrument. In some cases, the antigen binding fragment of the antibody is conjugated to the LNPs via an azide or mal eimide conjugation reaction, for example, in which the at least one conjugating lipid comprises an azide or maleimide group that reacts with a functional group of the antigen binding fragment to form a covalent bond. In some cases, following the conjugation reaction, the LNPs may be subjected to further purification steps to remove unconjugated antigen binding fragments, and / or to change the buffer conditions, and / or to add a pharmaceutically acceptable excipient or carrier, and / or to concentrate the LNPs into a suitable concentration for later administration to an animal. In some cases, LNPs prepared are further tested to determine their mean particle diameter and / or poly dispersity, such as by dynamic light scattering (DLS). In some cases, where a mixture of different LNPs is to be administered to an animal, such different LNPs are mixed together following their preparation.3. Methods of Administration and Detection In Vivo
[0101] LNP formulations described herein may be administered to animals, in some embodiments. In some cases, administration is systemic administration. In some cases, administration is intravenous (IV) administration, such as via a bolus injection or via infusion to an animal subject. LNPs herein may be administered to a wide variety of mammalian subjects. In some cases, the conjugated antigen binding fragment may target the appropriate transferrin receptor for the animal. In some cases, the animal subject is a human. In some cases, the animal subject is a primate. In some cases, the animal subject is a laboratoryAttorney Docket No: 01164-0038-00PCT animal, such as a mouse, rat, guinea pig, or rabbit or the like, for example in some cases an animal model that expresses a transferrin receptor from a different animal such as from a human. In other cases, the animal subject is a domestic mammal, such as a dog or cat. In some cases, the animal subject is a livestock animal such as a cow, pig, horse, goat, sheep, or the like.
[0102] An LNP may, for example, assist in helping a cargo molecule penetrate the BBB in an animal. For instance, in general, only about 2 % of small molecule drugs or peptides that have been tested are able to cross the BBB following IV administration, while consensus on the percentage of LNPs that can cross the BBB following systemic administration is currently unknown. An LNP herein can, in some cases, be used to deliver a drug cargo, such as a polynucleotide drug, past the BBB to the CNS or brain. In certain embodiments, following systemic administration, such as IV administration, an LNP herein enhances distribution of its cargo in CNS or brain. In some cases, the cargo may be distributed to, for example, neurons, microglia, astrocytes, pericytes, and / or brain endothelial cells, among other locations in the CNS.
[0103] Furthermore, in some embodiments, the cargo from an anti-TfR antigen binding fragment-conjugated LNP herein, such as a polynucleotide cargo, shows a fold change in brain tissue of at least 2 fold, at least 3 fold, at least 4 fold, from 2-5 fold, such as 2-4 fold, 3-4 fold, 3-5 fold, or 3-4 fold, in an LNP conjugated to an antigen binding fragment of an anti-TfR antibody. In contrast, in some cases an LNP that is otherwise identical but not conjugated to an antigen binding fragment of an antibody may have a fold change of about zero. For example, the fold change = [{(Percent Tissue Cargo) / (Percent Input Cargo)} - 1], (See, e.g., Fig. 6.) In some cases, the cargo from an anti-TfR antigen binding fragment- conjugated LNP herein may show a concentration in brain tissue at least 2 fold, at least 3 fold, at least 4 fold, from 2-6 fold, such as 2-5 fold, 2-4 fold, 3-4 fold, 3-6 fold, 3-5 fold, or 3- 4 fold higher than that of an identical LNP that is not conjugated to any antigen binding fragment. (See also Fig. 6, comparing the 0 mol% Fab data to the 0.075 mol% and 0.375 mol% data in each panel.)
[0104] In some cases, an LNP cargo may be intended to treat a disease or disorder impacting the CNS or brain. For example, in some cases, an LNP cargo may be intended to treat a neurological disease or disorder in a subject in need thereof. A “neurological disease” or “neurological disorder” as used herein refers to a disease or disorder which affects the CNS and / or which has an etiology in the CNS. Exemplary CNS diseases or disorders include,Attorney Docket No: 01164-0038-00PCT but are not limited to, neuropathy, amyloidosis, cancer, an ocular disease or disorder, viral or microbial infection, inflammation, ischemia, neurodegenerative disease, seizure, behavioral disorders, and a lysosomal storage disease. For the purposes of this application, the CNS will be understood to include the eye, which is normally sequestered from the rest of the body by the blood-retina barrier. Specific examples of neurological disorders include, but are not limited to, neurodegenerative diseases (including, but not limited to, Lewy body disease, postpoliomyelitis syndrome, Shy-Draeger syndrome, olivopontocerebellar atrophy, Parkinson's disease, multiple system atrophy, striatonigral degeneration, tauopathies (including, but not limited to, Alzheimer disease and supranuclear palsy), prion diseases (including, but not limited to, bovine spongiform encephalopathy, scrapie, Creutzfeldt-Jakob syndrome, kuru, Gerstmann-Straussler-Scheinker disease, chronic wasting disease, and fatal familial insomnia), bulbar palsy, motor neuron disease, and nervous system heterodegenerative disorders (including, but not limited to, Canavan disease, Huntington's disease, neuronal ceroid-lipofuscinosis, Alexander's disease, Tourette's syndrome, Menkes kinky hair syndrome, Cockayne syndrome, Halervorden-Spatz syndrome, lafora disease, Rett syndrome, hepatolenticular degeneration, Lesch-Nyhan syndrome, and Unverricht-Lundborg syndrome), dementia (including, but not limited to, Pick's disease, and spinocerebellar ataxia), cancer (e.g. of the CNS, including brain metastases resulting from cancer elsewhere in the body).
[0105] In some cases, a drug cargo for treating a neurological disease or disorder may comprise, for instance, an antisense oligonucleotide (ASO) such as an antisense RNA, a bivalent ASO, or the like, intended for delivery to the CNS or brain. Other exemplary polynucleotide cargo molecules include an siRNA, a bivalent siRNA, a guide RNA, a circular DNA or RNA, a viral vector, or the like, for example, intended for delivery to the CNS or brain. In some cases, a polynucleotide cargo may comprise one or a plurality of base or backbone modifications. In other embodiments, a cargo may comprise a polypeptide, organic molecule, or other neurological drug.
[0106] The present disclosure also relates to methods of screening LNP formulations in animals to detect the extent to which cargo crosses the BBB and is found in CNS or brain tissue, such as in neurons or brain cells. In some embodiments, the methods may be performed in a high-throughput fashion, screening multiple different LNP formulations administered as a pool to an animal in one, single systemic administration. Such high- throughput screens allow for rapid design and optimization of LNP formulations that are ableAttorney Docket No: 01164-0038-00PCT to accumulate in particular CNS tissues or cells. For example, where each different LNP within a pool has a specific label or barcode, such as a unique nucleic acid barcode, one may detect each different LNP from a pool in a single tissue sample from an animal postadministration in order to determine which LNPs were most enriched in the intended target tissues or cells.
[0107] Hence, in some embodiments, the present disclosure relates to a method of detecting uptake of a lipid nanoparticle (LNP) in the brain of an animal following systemic administration of the LNP to the animal, wherein the LNP is conjugated to an antigen binding fragment of an antibody, and wherein the LNP comprises a label or barcode, the method comprising detecting presence of the label or barcode in the brain of the animal following the systemic administration. In some embodiments, the disclosure encompasses a method of detecting uptake of a lipid nanoparticle (LNP) in the brain of an animal following systemic administration of the LNP to the animal, wherein the method comprises (a) systemically administering the LNP to the animal, wherein the LNP is conjugated to an antigen binding fragment of an antibody, and wherein the LNP comprises a label or barcode, and (b) detecting presence of the label or barcode in the brain of the animal following the systemic administration. The disclosure also relates to a method of detecting uptake of a mixture of different LNPs in the brain of an animal following systemic administration of the LNP mixture to the animal, wherein the mixture comprises LNPs that are conjugated to an antigen binding fragment of an antibody, such as an anti-TfR antibody, and wherein the LNPs of the mixture comprise a label or barcode, such as a unique label or barcode for each different LNP species of the mixture, the method comprising detecting presence of the label or barcode in the brain of the animal following the systemic administration. In some embodiments, the disclosure encompasses a method of detecting uptake of a mixture of different LNPs in the brain of an animal following systemic administration of the LNP mixture to the animal, wherein the method comprises (a) systemically administering the LNP mixture to the animal, wherein the mixture comprises LNPs that are conjugated to an antigen binding fragment of an antibody, such as an anti-TfR antibody, and wherein the LNPs of the mixture comprise a label or barcode, such as a unique label or barcode for each different LNP species of the mixture, and (b) detecting presence of the label or barcode in the brain of the animal following the systemic administration. In some cases, each LNP species pooled into the mixture comprises a unique label or barcode, for instance, as cargo, so that each LNP species may be separately detected following administration to the animal. In some cases, each LNPAttorney Docket No: 01164-0038-00PCT species in the mixture is conjugated to an antigen binding fragment of an antibody, while in other cases some LNPs in the mixture are not conjugated to an antibody or antigen binding fragment. In some cases, LNPs in the mixture may comprise different lipid combinations, such as different lipid species, such as different ionizable lipids, different conjugating lipids, different further lipids, and the like, or different concentrations of the same lipids. In some cases, LNPs in the mixture may comprise different concentration of antigen binding fragment. In some cases, LNPs may comprise different amounts of cargo or different types of cargo. In some cases, LNPs may comprise different antigen binding fragments, such as antigen binding fragments that bind to the same target protein or epitope, but that have different CDR or different VH and / or VL sequences. In some cases, LNPs may comprise antigen binding fragments that bind to different target proteins. Thus, there are a variety of variables that can be tested with such pooled, mixtures of LNPs, all in a single administration to an animal.
[0108] In some cases, the method comprises obtaining tissue samples and / or bodily fluid samples from the animal after administration, such as 6, 12, 24, 18, or 48 hours after administration. In some cases, both liver samples and a CNS or brain sample is obtained and uptake of cargo examined by detecting the label or barcode in the LNP. Hence, in some cases, the method comprises detecting presence of one or more labels or barcodes from a mixture of different LNPs in the brain of the animal. In some cases, the method comprises systemically administering a mixture of different LNPs to the animal in a single administration and detecting presence of one or more labels or barcodes from the mixture of different LNPs in the brain of the animal following the systemic administration. In some cases, the mixture of different LNPs comprises unique nucleic acid barcodes, such as wherein each LNP species of the mixture has its own unique barcode cargo. In such a case, a barcode may be a nucleic acid barcode, and, for example, detection of the barcodes may be via PCR, such as quantitative PCR (qPCR). In some cases, presence of the label or barcode comprises in situ hybridization (ISH), or a combination of PCR and ISH (e.g., qPCR and ISH).
[0109] In some cases, further steps may be taken to determine the biodistribution of cargo molecules such as nucleic acid barcodes by the LNPs. For example, one may use ISH to label nucleic acid cargo molecules via hybridization and then use cell staining methods to determine where the cargo molecules are situated within a tissue, such as to determine which cell types harbor the cargo and where in a cell the cargo is located. For example, immunofluorescence (IF) or other staining protocols may be used to detect particular cellAttorney Docket No: 01164-0038-00PCT types using molecular markers for those cell types, such as NeuN for neurons and CD31 for brain endothelial cells. Dyes such as DAPI or others or additional immunofluorescence reagents may be used to localize cell nuclei, or cell membranes, or other organelles. In this way, images showing the location of an LNP cargo compared to different cell types and different cellular components may be obtained, for example.
[0110] In screening methods herein, a mixture of different LNPs may comprise any number that is compatible with the labeling or barcoding method chosen for use. For instance, in some embodiments, a mixture of LNPs may comprise 2-100, 2-50, 4-100, 4-50, 10-100, 10-80, 20-80, 30-70, 20-60, 20-50, 5-10, 10-50, 10-40, 10-30, 20-60, 20-50, 20-40, 30-60, or 30-50 different LNPs. In some such cases, each LNP of the mixture of LNPs comprises a unique nucleic acid barcode.
[0111] In some cases herein a screening method may be performed on a mouse or rat or other laboratory mammal. In some cases, the mouse or rat or other laboratory mammal is a model animal in which a native antibody receptor such as transferrin receptor is at least partially knocked out and replaced with the equivalent receptor from a human or primate. Such animal models, for example, may facilitate screening of LNPs intended for administration to humans or primates.
[0112] In screening methods herein, the LNPs may in some cases be as described in the preceding sections. In some cases, the LNPs may comprise an ionizable lipid, at least one further lipid, cholesterol, and at least one PEG-ylated lipid, wherein at least one lipid acts as a conjugating lipid and comprises a functional group linked to an antigen binding fragment of an antibody, such as an anti-TfR antibody. In some embodiments, the lipid components of the LNPs comprise at least one ionizable lipid, at least one conjugating lipid, and at least one further lipid optionally selected from DSPC, DOPE, and cholesterol. In some cases, the LNP comprises (a) at least one ionizable lipid, (b) at least one further lipid such as DPPC, DOPC, DSPC and / or DOPE, (c) cholesterol, and (d) one or both of DMG-PEG2000, and DSPE- PEG2000, either one or both of which being a conjugating lipid. In some cases, the at least one additional lipid is DSPC and / or DOPE. In some cases, DSPE-PEG2OOO-N3 is used as a conjugating lipid. For example, the LNPs may be conjugated to an antigen binding fragment of an anti-TfR antibody. In some cases, the transferrin receptor recognized by the antigen binding fragment of the antibody comprises the amino acid sequence of SEQ ID NO: 5 (human transferrin receptor 1). In other cases, the transferrin receptor recognized by the antigen binding fragment of the antibody is a primate or other mammalian transferrinAttorney Docket No: 01164-0038-00PCT receptor (such as, e.g., with SEQ ID NO: 6 or 7). In some embodiments, the lipid components of the LNPs comprise at least one ionizable lipid and at least one further lipid optionally selected from DSPC, DOPE, and cholesterol. In some cases, the LNP comprises (a) at least one ionizable lipid, (b) at least one further lipid such as DPPC, DOPC, DSPC and / or DOPE, (c) cholesterol, and (d) one or both of DMG-PEG2000 and DSPE-PEG2000, optionally where one or both of DMG-PEG2000 and DSPE-PEG2000 is a conjugating lipid. In some cases, the at least one additional lipid is DSPC and / or DOPE. In some cases, the LNP may comprise a mixture of two or more different ionizable lipids. In other cases, an LNP may comprise only one species of ionizable lipid.
[0113] In some cases, the DMG-PEG2000 and / or DSPE-PEG2000 or another PEGylated lipid is included in an LNP herein to act as a conjugating lipid for conjugation to the antigen binding fragment of an antibody. Thus, in some cases, the DMG-PEG2000 and / or DSPE-PEG2000 comprises an azide functional group, maleimide functional group, or similar reactive functional group in order to facilitate conjugation of the lipid to the antigen binding fragment. Thus, for example, in some cases, DMG-PEG2000 and / or DSPE- PEG2000 in the LNP is conjugated to an antigen binding fragment of an antibody via such a functional group, and thus the DMG-PEG2000 and / or DSPE-PEG2000 in the LNPs comprises a functional group linking the DMG-PEG2000 and / or DSPE-PEG2000 to the antigen binding fragment of the antibody. In some cases, the functional group is a conjugation reaction product of an azide group. In other cases, the functional group is a conjugation reaction product of a maleimide group.
[0114] In some cases, the antigen binding fragment of the anti -transferrin receptor antibody comprises a Fab domain. In other cases, the antigen binding fragment is an Fv, Fab’, Fab’-SH, F(ab')2, scFv, or other type of antigen binding fragment as described herein. In some cases, the antigen binding fragment is of an anti-TfR antibody. In some cases, the LNP comprises from 0.01 to 1 mol % anti-TfR antigen binding fragment, from 0.01 to 0.5 mol % anti-TfR antigen binding fragment, from 0.05 to 0.5 mol % anti-TfR antigen binding fragment, from 0.1 to 0.5 mol % anti-TfR antigen binding fragment, from 0.2 to 0.5 mol % anti-TfR antigen binding fragment, from 0.2 to 0.4 mol % anti-TfR antigen binding fragment, or from 0.05 to 0.2 mol % anti-TfR antigen binding fragment, or 0.05 mol %, 0.075 mol %, 0.1 mol %, 0.15 mol %, 0.2 mol %, 0.25 mol %, 0.3 mol %, 0.35 mol %, 0.375 mol %, 0.4 mol %, 0.45 mol %, or 0.5 mol % anti-TfR antigen binding fragment, or any range between those numbers, wherein mol % is of the conjugating lipid. In some cases, the LNP comprisesAttorney Docket No: 01164-0038-00PCT from 0.01 to 1 mol % Fab, from 0.01 to 0.5 mol % Fab, from 0.05 to 0.5 mol % Fab, from 0.1 to 0.5 mol % Fab, from 0.2 to 0.5 mol % Fab, from 0.2 to 0.4 mol % Fab, or from 0.05 to 0.2 mol % Fab, or 0.05 mol %, 0.075 mol %, 0.1 mol %, 0.15 mol %, 0.2 mol %, 0.25 mol %, 0.3 mol %, 0.35 mol %, 0.375 mol %, 0.4 mol %, 0.45 mol %, or 0.5 mol % Fab, or any range between those numbers, wherein mol % is of the conjugating lipid.
[0115] In some cases, the antigen binding fragment of the anti-TfR antibody is derived from a “low affinity” anti-TfR antibody. Examples of such antibodies are described, for example in W02016 / 081640 and WO2016 / 081643. For example, a “low affinity” anti- TfR antibody may have an affinity for human or primate TfR from about 5nM, or from about 20 nM, or from about 100 nM, to about 50 pM, or to about 30 pM, or to about 10 pM, or to about 1 pM, or to about 500 nM. Thus, the affinity may be in the range from about 5 nM to about 50 pM, or in the range from about 20 nM to about 30 pM, or in the range from about 30 nM to about 30 pM, or in the range from about 50 nM to about 1 pM, or in the range from about 100 nM to about 500 nM, e.g. as measured by Scatchard analysis or surface plasmon resonance (e g., BIACORE®).
[0116] In some cases, the anti-TfR antibody has an affinity for transferrin receptor of 5 nM to 1 pM, 10 nM to 1 pM, 10-500 nM, 50-500 nM, 100-500 nM, 100-400 nM, 100-300 nM, 200-500 nM, 200-400 nM, or 200-300 nM as measured by surface plasmon resonance. In some cases, the antigen binding fragment of the anti-TfR antibody has an affinity for transferrin receptor of 5 nM to 1 pM, 10 nM to 1 pM, 10-500 nM, 50-500 nM, 100-500 nM, 100-400 nM, 100-300 nM, 200-500 nM, 200-400 nM, or 200-300 nM as measured by surface plasmon resonance.
[0117] In some cases, an LNP herein has a mean particle diameter of 50-200 nm, 50- 150 nm, 75-150 nm, 100-150 nm, 75-100 nm, 75-125 nm, 80-120 nm, or 90-110 nm as measured by dynamic light scattering (DLS). In some cases, an LNP herein has a mean particle diameter of 150 nm or less, such as 50-150 nm, 75-150 nm, 100-150 nm, 75-100 nm, 75-125 nm, 80-120 nm, or 90-110 nm. In some cases, an LNP herein has a mean particle diameter of 125 nm or less, such as 75-125 nm, 75-100 nm, 80-125 nm, 100-125 nm, or 90- 110 nm. In some cases, an LNP herein has a mean particle diameter of 110 nm or less, such as 75-100 nm or 90-110 nm. In some cases, an LNP herein has a mean particle diameter of about 100 nm, such as from 80-120 nm or from 90-110 nm.
[0118] In some cases, an LNP herein has a poly dispersity of 15-40%, 15-30%, 15- 25%, 20-30%, 15-20%, or 20-25% as measured by dynamic light scattering (DLS). In someAttorney Docket No: 01164-0038-00PCT cases, the poly dispersity is 40% or lower. In some cases, the poly dispersity is 30% or lower, such as 15-30%, 15-25%, 20-30%, 15-20%, or 20-25%. In some cases the poly dispersity is 25% or lower, such as 15-25%, 15-20%, or 20-25%. In some cases, the poly dispersity is about 20%, such as 15-25%, or 18-22%. In some cases, an LNP herein has both a particle size of 50-150 nm, 75-150 nm, 100-150 nm, 75-100 nm, 75-125 nm, 80-120 nm, or 90-110 nm and a poly dispersity of 15-40%, 15-30%, 15-25%, 20-30%, 15-20%, or 20-25%, as measured by dynamic light scattering (DLS). In some cases, an LNP herein has both a particle size of 75-125 nm, 80-120 nm, or 90-110 nm and a poly dispersity of 15-25%, 15- 20%, or 20-25%, as measured by dynamic light scattering (DLS).
[0119] In some cases, an LNP herein comprises a mol % of ionizable lipid of 40-60%, 40-50%, 50-60%, or 45-55%, wherein mol % is of the total lipid content. In some cases, an LNP herein comprises a mol % of a further lipid such as DPPC, DOPC, DSPC and / or DOPE of 5-15%, 5-10%, 10-25%, or 7-13%, wherein mol % is of the total lipid content. In some cases, the further lipid is DSPC or DOPE. In some cases, an LNP herein comprises a mol % of DSPC and / or DOPE of 5-15%, 5-10%, 10-25%, or 7-13%, wherein mol % is of the total lipid content. In some cases, an LNP herein comprises a mol % of cholesterol of 20-50%, 20- 40%, 30-50%, 30-40%, 40-50%, 25-45%, 35-45%, or 35-40%, wherein mol % is of the total lipid content. In some cases, an LNP herein further comprises a mol % of DMG-PEG2000 and / or DSPE-PEG2000 of 0.5-3%, 1-3%, 0.5-2.5%, 0.5-2%, 1-2.5%, 1-2%, 0.5-1.5%, or 2- 3%, wherein mol % is of the total lipid content, and wherein the DMG-PEG2000 and / or DSPE-PEG2000 is a conjugating lipid and comprises a functional group linking the DMG- PEG2000 and / or DSPE-PEG2000 to the antigen binding fragment of the antibody. In some cases, the molar ratio of the lipids in the LNP may be 45-55 ionizable lipid : 7-15 further (helper) lipid : 35-45 cholesterol : 1-3 conjugating and / or PEGylated lipid such as DMG- PEG2000 and / or DSPE-PEG2000. In some cases, the molar ratio of the lipids in the LNP may be, for example, 50 ionizable lipid : 10 further (helper) lipid : 38 cholesterol : 2 PEGylated lipid DMG-PEG2000 and / or DSPE-PEG2000. In some cases, the PEGylated lipids may comprise 50% conjugating lipid and 50% non-conjugating lipid, such as 50% DMG-PEG2000 and 50% DSPE-PEG2000-N3, for example.
[0120] The disclosure herein also encompasses kits comprising reagents for performing methods herein, such as described above. Kits may comprise, for example, a mixture of LNPs as described herein, optionally comprising different barcodes as cargo, or may comprise the ingredients for preparing different LNPs, such as nucleic acid barcodes toAttorney Docket No: 01164-0038-00PCT be used as cargo, ionizable lipids, additional lipids such as DSPC, DOPE, DOPC and DPPC, cholesterol, and DMG-PEG2k, and DSPE-PEG2k-N3 for conjugation to an antigen binding fragment of an antibody, as well as an antigen binding fragment of an antibody, such as an anti-TfR antibody. Kits may further comprise directions for use.EXAMPLES
[0121] The study described in Examples 1 and 2 implements a high-throughput screening (HTS) approach to detect Fab-conjugated LNP formulations that enable brain parenchyma delivery. LNPs were prepared and conjugated with targeting ligands (Fab) at varying densities. The LNPs were loaded with DNA barcodes (BCs) as cargo and administered intravenously to transgenic mice expressing a human shuttling receptor. Tissue analysis was performed 24 hours post-injection to assess the distribution and uptake of LNPs in the brain and liver. The formulations were characterized by differential light scattering (DLS) prior to dosing. Quantitative PCR (qPCR), amplicon sequencing, in situ hybridization (ISH), and immunofluorescence (IF) were employed to evaluate the biodistribution in vivo. The study highlights several key findings: Fab targeting moieties significantly enhanced uptake of selective LNPs in the brain compared to matched non-targeted LNPs; a relative increase in brain uptake with Fab-conjugated LNPs when compared to liver. This study demonstrates the successful in vivo targeting and delivery of LNPs to the CNS from systemic circulation using Fab conjugation. The findings provide a foundation for further development of LNP -based therapeutics for CNS disorders and highlight the potential of targeted LNPs in overcoming the challenges posed by the blood brain barrier (BBB).Example 1: Preparation and Characterization of DNA Barcoded LNP Formulations
[0122] A lipid mixture was made by dissolving an individual ionizable lipid (Lipid 1, 2, 3, or 4), DSPC or DOPE, cholesterol, DMG-PEG2k, and DSPE-PEG2k-N3 at a molar ratio of 50: 10:38: 1 : 1 in ethanol. Barcode DNAs with the same sequence length of 92 nucleotides were separately dissolved in a citrate buffer (25 mM, pH 4). A robotic liquid handler was used to rapidly mix the lipid and barcode phases at a volume ratio of 3 : 1 (aqueous : ethanol) to formulate LNPs with a N / P ratio of 2, total lipid concentration of 3 mM, and total barcode concentration of 233 ug / mL. The LNPs were processed through ultrafiltration with DPBS (Dulbecco’s phosphate buffered saline) or buffer exchange into PBS to remove ethanol and the unloaded barcode, followed by overnight incubation without or with different amounts ofAttorney Docket No: 01164-0038-00PCT a bicyclononyne-modified anti-human transferrin receptor 1 (hTFRl) Fab ligand, which was conjugated with DSPE-PEG2k-N3 via the azide-alkyne cycloaddition reaction. The resulting LNPs were either not modified (Fab at 0 mol%), or supposedly modified with the Fab at 0.075 mol% or 0.375 mol% of the DSPE-PEG2k-N3 content used for preparing the LNPs. Site-specific conjugation was performed to covalently link a BCN-PEG2-amine linker to the Fab containing a reactive glutamine residue at the C-terminus of the heavy chain in the presence of microbial transglutaminase. Anti-TfR Fab was then conjugated to the surface of each LNP using strain promoted alkyne-azide chemistry (SPAAC), targeting different molar ratios (mol%) relative to total lipid concentration. Specifically, the anti-TfR Fab (comprising SEQ ID Nos: 8 and 9) with reactive glutamine embedded into a peptide sequence (YLQSP) at the C-terminus of the heavy chain was conjugated to BCN-PEG2-amine (Millipore Sigma) in the presence of microbial transglutaminase (0.39 mol% Fab) using the following stoichiometry: 1 : 15 glutamine:amine. Following removal of amine linker using affinity purification and barcode encapsulation, each LNP formulation was buffer exchanged using 10K MWCO spin concentrators (Millipore Sigma) to remove residual ethanol and unencapsulated barcode. SPAAC was then used to covalently link the Fab with c-terminal BCN conjugation to DSPE-PEG2K-N3 incorporated within the LNP, using a molar ratio of either 0, 0.075, 0.375% of total lipid content. Conjugation reactions were allowed to sit overnight at room temperature, then LNPs were buffer exchanged 2X using 100 MWCO spin concentrators (Millipore) to remove unreacted Fab.
[0123] LNPs were further purified and concentrated to the dosing concentration of barcode, and pooled with an equal volume to obtain the dosing formulation. Individual and pooled LNP formulations were diluted into DPBS for analysis of particle size distribution (mean particle diameter, percent poly dispersity) using dynamic light scattering (DLS). The unloaded and total barcode concentrations, as well as the percent loading efficiency of barcode were measured by using the OliGreen™ reagent. As shown in Fig. 4A, 48 different LNP formulations were prepared. The Fab ligands were derived from an anti-hTfRl antibody with complete heavy and light chain sequences as provided in SEQ ID NOs: 8-9.
[0124] A total of 47 different formulations from those described in Fig. 4 A were ultimately pooled and injected into animals as described in Example 2. One formulation was excluded due to aggregation.
[0125] Prior to pooling and administration, the particle size and poly dispersity of the LNP formulations was determined by dynamic light scattering (DLS), as shown in Figs. 4BAttorney Docket No: 01164-0038-00PCT and 4C. For the majority of LNPs, particle size (reported as mean particle diameter) was roughly 100 nm, although LNPs made with ionizable lipid 1 were larger, at about 150-200 nm mean particle diameter. Poly dispersity was roughly 20% or lower, as shown in Fig. 4C. The percent encapsulation (%EE) of barcodes in the pooled formulations was 72.8%.
[0126] In addition, prior to in vivo dosing, morphology of select LNPs were compared by cryo-EM. Images of individual particles for LNP-1 (Lipid-1, DSPC, no Fab), LNP-3 (Lipid- 1 , DSPC, 0.375 mol% Fab), LNP-7 (Lipid-2, DSPC, no Fab), LNP-9 (Lipid-2, DSPC, 0.375 mol% Fab), LNP-13 (Lipid-3, DSPC, no Fab) and LNP-15 (Lipid-3, DSPC, 0.375 mol% Fab) are shown in Fig. 4E. As evidenced by these images, hexagonal internal structures, as well as bleb structures were observed in all formulations. Furthermore, a distinct laminar layer was observed for LNP-13 and LNP-15, but not LNP-1, LNP-3, LNP-7 or LNP-9. Finally, addition of Fab did not appear to have a significant impact on morphology for any of the lipid compositions that were examined.
[0127] Particle membrane fluidity was measured by Laudran GP values using the following equation:
[0128] As shown in Fig. 4D bar labelled “pool,” the final dosing solution had a size in-line with the average size of the pooled formulations, and a poly dispersity of 38.8% (Fig. 4F). Moreover, a total barcode concentration of 130 ug / mL and encapsulation efficiency of 70% were achieved for the final pool.Example 2: Administration of Pooled LNP Formulations to Mice and Detection of Polynucleotide Barcodes In Vivo
[0129] A schematic of the overall experiment described in this Example is provided in Fig. 2, and a schematic of the animal dosing with a pool of Fab -conjugated LNPs with different barcodes is provided in Fig. 3. A single bolus IV injection was administered, and brain and liver were harvested for downstream processing 24 hours later (Fig. 3 A). Blood samples were collected at 15 min, 6 hours and 24 hours post injection retro-orbitally under restraint. Analysis of blood samples by qPCR confirmed that barcode was cleared from systemic circulation by 24 hours (Fig. 8).
[0130] Mouse model and administration: A total of 47 different LNP formulations from those described in Fig. 4A-C were pooled and administered intravenously to mice, andAttorney Docket No: 01164-0038-00PCT compared to control mice administered a saline control solution. Specifically, human TFR1 (hTFRl) heterozygous mice (expressing human TFR1) were used for the study. Six mice were in the Fab-LNP group and four mice were in the control, saline group. A bolus IV administration was performed via tail vein injection at a dose of 8 mL / kg of either the pooled LNP formulations or the saline solution. Tissue analysis was conducted 24 hours postinjection.
[0131] Tissue analysis: Animals were perfused with saline under anesthesia and then tissues were collected. Samples were collected from the liver and brain for further analysis. The right caudal lobe of the liver was dissected and processed for downstream analysis. The brain was dissected sagittally in the hemi-brain. The right hemi-brain was used for downstream quantitative PCR (qPCR) an amplicon sequencing, while the left hemi-brain was frozen and later sectioned for in situ hybridization (ISH) and immunofluorescence (IF) immunostaining. See Fig. 5A.
[0132] Quantitative PCR (qPCR) analysis: The total genomic DNA present in each animal tissue collected was first measured using gene loci primers. Next, common adaptor primers that are universal to all barcodes were used to amplify the total barcodes present in the tissue. Abundance of barcodes in each tissue type was then determined by normalizing the qPCR Ct values of the barcodes to the total genomic DNA in the tissue. This normalization allows comparison of the relative abundance of barcodes across the different tissues. Results from the qPCR analysis are shown in Fig. 5B. Each data point in the graph represents an individual animal subjected to the study, and those in each group are denoted “saline” or “LNP -Fab” for control or experimental animals. The total abundance of barcodes was significantly higher in the liver compared to the brain, which was expected since the liver is a primary site for drug metabolism and absorption. A more than 10-fold increase in the abundance of barcodes in the brain in the LNP -Fab animals compared to the saline groups was observed, as shown on the left side of Fig. 5B. This high level of barcode signal in the brain was unexpected, as the expectation would have been to see very little to no barcode signal in the brain.
[0133] Amplicon sequencing: A 10X Genomics GEX assay in TotalSeq™-B format was used to sequence 90 nucleotide barcode amplicons. Genomic DNA was extracted from the hemi-brain or liver tissue. 50 pl of blood was diluted in 500 pl of QuickExtraDNA buffer and then 1 :50 dilution was subjected to qPCR. DNA from the liver (10: 1 volume to weight) and brain (5: 1 volume to weight) was extracted using QuickExtract DNA solution (LucigenAttorney Docket No: 01164-0038-00PCTQE0950). QPCR was used to measure total genomic DNA and barcode in samples. DNA lysate was combined with Taqman PowerUP Sybr green master mix (Thermo fisher, A25741) and either ETV primers or barcode primers, then run using StepONePlus, ViiA 7 system. Primers incorporating the TotalSeq™-B format were used to prepare amplicons. Common adaptor primers were used for the barcodes and primers against ETV were used to obtain the total genomic cDNA. 40 samples were sequenced in total, specifically 8 samples from the saline group (4 brain and 4 liver), with 2 technical replicates, and 12 samples from the experimental Fab-LNP group (6 brain and 6 liver), with 2 technical replicates. For library preparation, sequencing adapters (Illumina) were ligated to pooled PCR products and a limited number of PCR cycles were run to amplify the adapter-ligated library.
[0134] Quantitative PCR and barcode abundance analysis: The library was quantified by Qubit assays and the size distribution of the library was analyzed. The prepared library was loaded onto the 10X Genomics 3’ single-cell GEX assay platform and sequencing was run. Sequencing data was then de-multiplexed based on the unique barcodes for each LNP formulation, assigning reads to the respective LNPs. Low-quality reads were filtered out and adapter sequences were trimmed. Next, the filtered reads were aligned to the target sequence in the input pool. The abundance of each barcode was quantified in the samples based on the read counts.
[0135] Counting of barcodes from reads involved quality filtering, deduplicating based on UMIs, and mapping barcodes to an LNP. Fold change from the input pool was calculated using the following equation: Percent Tissue Barcode / Percent Input Barcode. Statistical analysis for fold change by input was obtained by performing a paired t-test to determine if the difference in fold change from Fab molar ratios was greater in the brain than in the liver. The results were adjusted for multiple comparisons using the Holm method to control the Family-Wise Error Rate (FWER). The A fold change metric (i.e. ABrain & ALiver) is the difference within a tissue between the Fab molar ratios (i.e. 0.075% - 0%) and was used for testing. The AA metric (ABrain - ALiver) is a comparison of the difference in mean enrichment between tissues. The TfR molar ratio of an LNP was determined to pass the test for brain enrichment based on AA > 0.5 & padjusted < 0.05.
[0136] To calculate abundance of barcodes (BC), the following equations were used:AACt ~ ACt - ACtSaUneAttorney Docket No: 01164-0038-00PCTNormalized BC abundance (Norm. BC~) ~ 2lPercent partitioning in the brain (PPBrain) was calculated using the following equation:
[0137] The experiment consisted of 19 samples, saline (7 samples: 3 brain + 4 liver) and LNP-Fab (12 samples: 6 brain + 6 liver), with 2 technical replicates.
[0138] Quantitative PCR primers were as follows: ETV Enhl F: TGTTCCACGCCATAGAACTG; ETV Enhl R: TGTCAGCGGCTCATTCATAG; Barcode F: GTGACTGGAGTTCAGACG; Barcode R: TTGCTAGGACCGGCCTTAAAGC (SEQ ID Nos: 16-19, respectively).
[0139] Sequencing results: All LNPs from the same pool were detected, and DNA barcodes were quantifiable and reproducible across different animals. Mean read quality (Phred Score) was assessed before filtering and deduplication was assessed. A cut-off of Q > 30 was used, indicating 99.9% accuracy (1 in 1000 chance of an incorrect call). The foldchange values from the input pool for several different LNP formulations in the pool are shown in Fig. 6. Fold change = [{(Percent Tissue Barcode) / (Percent Input Barcode)} - 1], Each plot shows results for a given lipid mixture with 0 mol%, 0.075 mol%, or 0.375 mol% Fab (in most cases three different LNP formulations with the exception of “lipid 2 DSPC” with two LNP formulations), with fold change values in liver and brain. As can be seen, brain and liver samples showed different enrichment profiles. In general, conjugation of Fab did not change enrichment in liver tissue of a particular LNP. LNPs with lipid 2 showed significant enrichment in brain with increasing Fab moiety concentration, using both DOPE and DSPC helper lipids (panels 3 and 4 of Fig. 6). Lipid 3 also showed moderate brain enrichment with the DSPC helper lipid with increasing Fab moiety concentration (panel 6 of Fig. 6). The saline group served as an ideal matched control, confirming the experiment’s success.Attorney Docket No: 01164-0038-00PCT
[0140] From the brain and liver tissue analysis, it was found that a majority of the signal was located in liver. This cross-tissue comparison enabled the determination that 1.44% of the combined barcodes detected between liver and brain tissues partitioned to the brain (Table 1). Of note, one brain saline sample was contaminated during tissue processing and therefore was not included in the analysis.
[0141] Given the observation of barcode signal in both the brain and liver by qPCR, tissue samples were further sequenced to assess abundance of each individual LNP formulation relative to the dosing material (input). The addition of Fab substantially influenced brain distribution (AA > 0.5, p adjusted < 0.05) for LNPs prepared with Lipid-2, Lipid-3, and Lipid-4 but not Lipid- 1 (Fig. 7A-7D, Table 2). For LNPs using Lipid-2, -3 and - 4, the increase in relative abundance in the brain was associated with the Fab molar ratio for both helper lipids. Although Lipid-2, -3 and -4 all showed increased abundance in the brain, the enrichment profiles differed between ionizable lipids, demonstrating that both the ionizable lipid and Fab density had an impact. Lipid-2 and -4 led to the greatest difference in enrichment between brain and liver when comparing the 0.075% and 0% Fab molar ratios, while Lipid-3 showed the greatest difference between 0.375% and 0.075% (Table 2).
[0142] Understanding the state of lipid packing in each LNP formulation provides insight into their state in systemic circulation and may help explain their aptitude for transcytosis.39,40 Therefore polarity (Laudran GP) was measured for LNP-3, LNP-8, and LNP-15 and LNPs were rank ordered, where a higher value indicates a more ordered / less fluid membrane (Table 3). The measurements revealed that LNP-8 had the highest value, suggesting it had the most ordered lipid membrane, LNP-3 had the lowest value, suggesting it was the most elastic and LNP-15 had a value in between the two. These values aligned well with the brain partitioning data (Fig. 7A-7D).Table 1. Partitioning between liver and brain from qPCRAttorney Docket No: 01164-0038-00PCTTable 2. LNP-seq summary metrics and statistical testing resultsAttorney Docket No: 01164-0038-00PCTTable 3. Lipid membrane fluidity measured for selected LNPs
[0143] ISH protocol :
[0144] Combining ISH with IF allowed for simultaneous detection of nucleic acids and proteins within the same tissue section, and was helpful in determining where barcodes were localized in brain tissue. The protocol for ISH was as follows. 10 micron frozen tissue sections were sectioned and embedded on glass slides. Tissues were fixed for 30 minutes in 4% PFA and permeabilized in 70% ethanol at -20 °C overnight. For hybridization, sections were incubated in pre-hybridization buffer at 150 nM each (a 1 / 333 dilution) in 10% hybridization buffer. For ligation of the probes, tissue sections were incubated with labeled ISH probe at 30 °C for 4.5 hours, washed twice, and placed in a phi29 buffer for 2 hours to overnight at 4 °C. Sections were then washed in saline-sodium citrate (SSC) wash buffer toAttorney Docket No: 01164-0038-00PCT remove unbound probe and further stringent washes were performed to reduce background. To detect ISH signal, samples were stained with a readout oligonucleotide in 10% wash buffer for 10 minutes to 1 hour, washed in 10% wash buffer, and then 3 times with PBS buffer including Tween® 20, DAPI was added and samples were imaged. FISH probe and primer sequences are provided as SEQ ID NOs: 2-4. ISH probes intended to detect all barcodes were used. IF protocol: Tissue samples with ISH signal were washed with a PBS wash buffer. Nonspecific binding sites were blocked by incubating the sections with a 5% donkey serum blocking buffer for 1 hour at room temperature. Tissue sections were then incubated with a primary antibody specific to target protein overnight at 4 °C. Anti-C31 antibody was used as a primary antibody to detect brain endothelial cells (goat anti-CD31 antibody, Bio-Techne ab3628; 1 :500 dilution). Anti-NeuN antibody was used to detect neurons (chicken anti-NeuN antibody, GeneTex GTX00837, 1 :5000 dilution). Sections were then washed in PBS and incubated with a fluorophore-conjugated secondary antibody for 1 hour at room temperature. Sections were mounted with a mounting medium containing DAPI to detect the cell nucleus, and examined by microscopy, to detect both the ISH signal from the DNA barcodes and the IF signal from the primary antibodies. Probes and primers were as follows:LNP Constant 1 ( / 5Phos / GCCTTAAAGCCTTGGGTCTCGT CGTGCCTTGTTTGCCGTCCTGCTT GCTATGGACCG) and LNP Constant 2( / 5Phos / GTCTGAACTCCAGTCACCTTGGGTCTCGT CGTGCCTTGTTTGCCGTCCTGCTT AGATCGGAAGAGCACAC) (wherein “ / 5Phos / ” represents a 5’ end modification). Primer 169 AAGCAGGACG*G*C (169 SPLINTR V3 Pi2; “*G” and “*C” represent phosphorothioate modifications). Readout oligo sequence:CGTGCCTTGTTT / 3 ATTO647NN / (wherein ‘73 ATTO647NN / ” represents a dye conjugate that is conjugated to the oligo sequence). Sequences are SEQ ID Nos: 20-23, respectively.
[0145] Results are shown in Figs. 9A-9C. As the figures show, a substantial barcode positive signal was observed away from endothelial cells in the hippocampus and thalamus sections, thereby confirming distribution of barcodes in the parenchyma (see stars in Fig. 9C, left panels). Sparse signal was observed colocalizing with neurons, as shown by comparing ISH signal with anti-NeuN signal.Attomey Docket No: 01164-0038-00PCT
[0146] Cryo-EM Imaging: Cryo-EM samples were prepared on Quantifoil® QF- Cu300 Rl.2 / 1.3 + 2 nm carbon grids (Ted Pella, Redding, CA, USA). The grids were glow discharged for 7s on GloQube® (Quorum Technologies, East Sussex, UK) at 20 mA. An aliquot of 3 pL of LNP sample was added to each grid. Grids were then plunge-frozen using a Vitrobot® Mark IV (ThermoFisher Scientific, Waltham, MA, USA) at 4 °C / 95% humidity at original sample concentration with a blot force of -12, wait time of 45 seconds, and drain time of 0.5 seconds. Cryo-EM data collection was performed using a Talos Arctica 200 keV TEM (ThermoFisher Scientific, Waltham, MA, USA) equipped with a Gatan K3 camera and BioQuantum® energy filter (20 eV) using SerialEM® software. Images of LNPs were collected at a defocus range of -2 to -3 pm with a total 60 e“ / A2electron dose. Cryo-EM images were processed by 3dmod.
[0147] Overall, this study demonstrates the ability of specific Fab -conjugated LNPs to deliver oligonucleotides in the CNS parenchyma. It also demonstrates an efficient pooling strategy to assess brain enrichment of multiple Fab-conjugated and non-conjugated LNPs in one single administration to an animal.
[0148] The workflow herein may be used to identify formulations capable of BBB transcytosis and accumulation in the brain. This disclosure also describes a strategy to quantitate partitioning between different tissue types (liver and brain) by normalizing to a genomic DNA locus. The strategy developed here enabled the determination that the brain compartment accounted for 1.44% of the totality of barcodes detected in liver and brain tissues combined (Fig. 5B). This study also demonstrated that in addition to Fab density and among other LNP composition factors, ionizable lipid species showed the strongest impact on brain accumulation. An association between mol% and transcytosis was revealed for LNPs formulated with ionizable lipids but not with a cationic lipid (Fig. 7A-7B, Table 2). Since highly positively charged particles can aggregate in biological fluids,13it is possible that the LNPs made with a lipid carrying a positive charge in circulation were not amenable to the receptor engagement necessary for crossing the BBB. It is also possible that the difference in charge relative to the other formulations endowed a distinct protein corona that altered LNP biodistribution.46Differences in lipid composition of LNPs can have an impact on biodistribution and cellular delivery,13'47 49which can in part be attributed to lipid membrane fluidity, where LNPs with less fluid and more rigid membranes have shown preferential uptake relative to more elastic ones.50,51In this study, the observed trend in LNP transcytosis and brain accumulation showed better uptake with more rigid membranes. For those LNP-Attorney Docket No: 01164-0038-00PCTFabs measured, Laurdan GP correlated well with relative abundance in the brain, where the LNP with the highest relative abundance in the brain (LNP-8), also displayed the most ordered lipid phase (Table 3, Fig. 10A). Since endothelial cell-uptake is part of the mechanism of transcytosis, it is conceivable that LNP fluidity and bilayer packing driven by lipid composition may help explain the differences in brain accumulation. Furthermore, bilayer rigidity may also affect Fab display, which in turn may have an impact on brain accumulation and merits further investigations. Of note, the correlation plot between particle size and abundance in the brain relative to the dosing solution was not observed within the size range of the LNPs used in this study, further supporting the idea that LNP size is generally not predictive of in vivo outcome (Fig. 1 OB).53,54Finally, imaging results demonstrated the penetration of barcodes across the BBB and into the parenchyma. A significant amount of barcode was also observed in the endothelial cells, but here they were delivered systemically, suggesting brain-targeted delivery. In addition, barcodes were also detected in the CNS parenchyma that were not colocalized with endothelial cells, in addition to a small subset colocalized with neurons. These findings suggest transcytosis into the CNS and cell uptake within the brain parenchyma (Fig. 9A-9C).
[0149] In summary, LNP formulations capable of delivering DNA barcodes to the brain upon IV injection were identified. The influence of both lipid composition and ligand density on BBB transcytosis and parenchymal penetration was also assessed. Although DNA barcodes were used as the cargo in this study, it is reasonable to expect these results to extend to NABMs.References1. Reichmuth, A.M., Oberli, M.A., Jeklenec, A., Langer, R., and Blankschtein, D. (2076). mRNA vaccine delivery using lipid nanoparticles. Ther Deliv 7, 379-334. https: / / doi.org / 70.4755 / tde-2016-0006.2. Yonezawa, S., Koide, H., and Asai, T. (2020). Recent advances in siRNA delivery mediated by lipid-based nanoparticles. Adv Drug Deliver Rev 754, 64-75. https: / / doi.Org / 10.1016 / j.addr.2020.07.022.3. Kim, H., Zenhausem, R., Gentry, K., Lian, L., Huayamares, S.G., Radmand, A., Loughrey, D., Podilapu, A.R., Hatit, M.Z.C., Ni, H., et al. (2024). Lipid nanoparticle-mediated mRNA delivery to CD34+ cells in rhesus monkeys. Nat. Biotechnol., 1-8. https: / / doi.org / 10.1038 / s41587-024-02470-2.4. Hatit, M.Z.C., Lokugamage, M.P., Dobrowolski, C.N., Paunovska, K., Ni, H., Zhao, K., Vanover, D., Beyersdorf, J., Peck, H.E., Loughrey, D., et al. (2022). Species-dependent inAttorney Docket No: 01164-0038-00PCT vivo mRNA delivery and cellular responses to nanoparticles. Nat Nanotechnol, 1-9. https: / / doi.org / 10.1038 / s41565-021-01030-y.5. Hou, X., Zaks, T., Langer, R., and Dong, Y. (2021). Lipid nanoparticles for mRNA delivery. Nat Rev Mater 6, 1078-1094. https: / / doi.org / 10.1038 / s41578-021-00358-0.6. Yang, L., Ma, F., Liu, F., Chen, J., Zhao, X., and Xu, Q. (2020). Efficient Delivery of Antisense Oligonucleotides Using Bioreducible Lipid Nanoparticles In Vitro and In Vivo. Mol Ther Nucleic Acids 19, 1357-1367. https: / / doi.Org / 10.1016 / j.omtn.2020.01.07S.7. Akinc, A., Maier, M.A., Manoharan, M., Fitzgerald, K., Jayaraman, M., Barros, S., Ansell, S., Du, X., Hope, M.J., Madden, T.D., et al. (2019). The Onpattro story and the clinical translation of nanomedicines containing nucleic acid-based drugs. Nat Nanotechnol 74, 1084-1087. https: / / doi.org / 10.1038 / s41565-019-0597-y.8. Clinical Review Report: Patisiran (Onpattro): (Alnylam Netherlands B.V.): Indication: Treatment of polyneuropathy in adult patients with hereditary transthyretin-mediated amyloidosis [Internet] (2019). (Ottawa (ON): Canadian Agency for Drugs and Technologies in Health).9. Dobrowolski, C., Paunovska, K., Hatit, M.Z.C., Lokugamage, M.P., and Dahlman, J.E. (2021). Therapeutic RNA Delivery for COVID and Other Diseases. Adv Healthc Mater 10, 2002022. https: / / doi.org / 10.1002 / adhm.202002022.10. Jackson, L.A., Anderson, E.J., Rouphael, N.G., Roberts, P.C., Makhene, M., Coler, R.N., McCullough, M.P., Chappell, J.D., Denison, M.R., Stevens, L.J., et al. (2020). An mRNA Vaccine against SARS-CoV-2 — Preliminary Report. N. Engl. J. Med. 383, 1920-1931. https: / / doi.org / 10.1056 / nejmoa2022483.77. Schoenmaker, L., Witzigmann, D., Kulkami, J. A., Verbeke, R., Kersten, G., Jiskoot, W., and Crommelin, D.J.A. (2021). mRNA-lipid nanoparticle COVID-19 vaccines: Structure and stability. Int. J. Pharm. 601, 720586. https: / / doi.Org / 10.1016 / j.ijpharm.2021.120586.12. Levien, T.L., and Baker, D.E. (2024). Respiratory Syncytial Virus Vaccine (mRNA). Hosp. Pharm., 00185787241295740. https: / / doi.org / 10.1177 / 00185787241298140.13. Albertsen, C.H., Kulkami, J. A., Witzigmann, D., Lind, M., Petersson, K., and Simonsen, J.B. (2022). The role of lipid components in lipid nanoparticles for vaccines and gene therapy. Adv. Drug Deliv. Rev. 755, 774416. https: / / doi.Org / 10.1016 / j.addr.2022.114416.14. Akinc, A., Querbes, W., De, S., Qin, J., Frank-Kamenetsky, M., Jayaprakash, K.N., Jayaraman, M., Rajeev, K.G., Cantley, W.L., Dorkin, J.R., et al. (2010). Targeted Delivery of RNAi Therapeutics With Endogenous and Exogenous Ligand-Based Mechanisms. Mol Ther 18, 1357-1364. https: / / doi.org / 10.1038 / mt.2010.85.15. Cheng, Q., Wei, T., Farbiak, L., Johnson, L.T., Dilliard, S.A., and Siegwart, D.J. (2020). Selective ORgan Targeting (SORT) nanoparticles for tissue specific mRNA delivery and CRISPR / Cas gene editing. Nat Nanotechnol 15, 313-320. https: / / doi.org / 10.1038 / s41565- 020-0669-6.16. Dilliard, S.A., Cheng, Q., and Siegwart, D.J. (2021). On the mechanism of tissue-specific mRNA delivery by selective organ targeting nanoparticles. Proc National Acad Sci 775, e2109256118. https: / / doi.org / 10.1073 / pnas.2109256118.17. Zhang, R., El-Mayta, R., Murdoch, T.J., Warzecha, C.C., Billingsley, M.M., Shepherd, S.J., Gong, N., Wang, L., Wilson, J.M., Lee, D., et al. (2020). Helper lipid structureAttorney Docket No: 01164-0038-00PCT influences protein adsorption and delivery of lipid nanoparticles to spleen and liver.Biomater. Sci. 9, 1449-1463. https: / / doi.org / 10.1039 / d0bm01609h.18. Kauffman, K.J., Dorkin, J.R., Yang, J.H., Heartlein, M.W., DeRosa, F., Mir, F.F., Fenton, O.S., and Anderson, D.G. (2015). Optimization of Lipid Nanoparticle Formulations for mRNA Delivery in Vivo with Fractional Factorial and Definitive Screening Designs. Nano Lett. 15, 7300-7306. https: / / doi.org / 10.1021 / acs.nanolett.5b02497.19. Hashiba, K., Taguchi, M., Sakamoto, S., Otsu, A., Maeda, Y., Suzuki, Y., Ebe, H., Okazaki, A., Harashima, H., and Sato, Y. (2024). Impact of Lipid Tail Length on the Organ Selectivity of mRNA-Lipid Nanoparticles. Nano Lett. 24, 72758-12767. https: / / doi.org / 10.1021 / acs.nanolett.4c02566.20. Mui, B.L., Tam, Y.K., Jayaraman, M., Ansell, S.M., Du, X., Tam, Y.Y.C., Lin, P.J., Chen, S., Narayanannair, J.K., Rajeev, K.G., et al. (2013). Influence of Polyethylene Glycol Lipid Desorption Rates on Pharmacokinetics and Pharmacodynamics of siRNA Lipid Nanoparticles. Mol. Ther. - Nucleic Acids 2, el39. https: / / doi.org / 10.1038 / mtna.2013.66.21. Simonsen, J.B. (2024). Lipid nanoparticle-based strategies for extrahepatic delivery of nucleic acid therapies - challenges and opportunities. J. Control. Release 370, 763-772. http s : / / doi . org / 10.1016 / j .j conrel .2024.04.022.22. Pardridge, W.M. (2023). Brain gene therapy with Trojan horse lipid nanoparticles. Trends Mol. Med. 29, 343-353. https: / / doi.Org / 10.1016 / j.molmed.2023.02.004.23. Akhtar, A., Andleeb, A., Waris, T.S., Bazzar, M., Moradi, A.-R., Awan, N.R., and Yar, M. (2021). Neurodegenerative diseases and effective drug delivery: A review of challenges and novel therapeutics. J. Control. Release 330, 1152-1167. http s : / / doi . org / 10.1016 / j .j conrel .2020.11.021.24. Nance, E., Pun, S.H., Saigal, R., and Sellers, D.L. (2022). Drug delivery to the central nervous system. Nat. Rev. Mater. 7, 314-331. https: / / doi.org / 10.1038 / s41578-021-00394-w.25. Poduslo, J.F., Curran, G.L., and Berg, C.T. (1994). Macromolecular permeability across the blood-nerve and blood-brain barriers. Proc. Natl. Acad. Sci. 91, 5705-5709. https: / / doi.org / 10.1073 / pnas.91.12.5705.26. Niewoehner, J., Bohrmann, B., Collin, L., Urich, E., Sade, H., Maier, P., Rueger, P., Stracke, J.O., Lau, W., Tissot, A.C., et al. (2014). Increased Brain Penetration and Potency of a Therapeutic Antibody Using a Monovalent Molecular Shuttle. Neuron 81, 49-60. https: / / doi.Org / 10.1016 / j.neuron.2013.10.061.27. Yu, Y.J., and Watts, R.J. (2013). Developing Therapeutic Antibodies for Neurodegenerative Disease. Neurotherapeutics 10, 459-472. https: / / doi.org / 10.1007 / sl3311- 013-0187-4.28. Gao, J., Gunasekar, S., Xia, Z. (Judy), Shalin, K., Jiang, C., Chen, H., Lee, D., Lee, S., Pisal, N.D., Luo, J.N., et al. (2024). Gene therapy for CNS disorders: modalities, delivery and translational challenges. Nat. Rev. Neurosci. 25, 553-572. https: / / doi.org / 10.1038 / s41583- 024-00829-7.29. Kulkami, J. A., Witzigmann, D., Thomson, S.B., Chen, S., Leavitt, B.R., Cullis, P.R., and Meel, R. van der (2021). The current landscape of nucleic acid therapeutics. Nat.Nanotechnol. 16, 630-643. https: / / doi.org / 10.1038 / s41565-021-00898-0.30. Wu, D., Chen, Q., Chen, X., Han, F., Chen, Z., and Wang, Y. (2023). The blood-brainAttorney Docket No: 01164-0038-00PCT barrier: structure, regulation, and drug delivery. Signal Transduct. Target. Ther. 8, 217. https : / / doi . org / 10.1038 / s41392-023 -01481 -w.31. Dong, X. (2018). Current Strategies for Brain Drug Delivery. Theranostics 8, 1481-1493. https: / / doi.org / 10.7150 / thno.21254.32. Kariolis, M.S., Wells, R.C., Getz, J. A., Kwan, W., Mahon, C.S., Tong, R., Kim, D.J., Srivastava, A., Bedard, C., Henne, K.R., et al. (2020). Brain delivery of therapeutic proteins using an Fc fragment blood-brain barrier transport vehicle in mice and monkeys. Sci Transl Med 12. https: / / doi.org / 10.1126 / scitranslmed.aayl359.33. Barker, S.J., Thayer, M.B., Kim, C., Tatarakis, D., Simon, M.J., Dial, R., Nilewski, L., Wells, R.C., Zhou, Y., Afetian, M., et al. (2024). Targeting the transferrin receptor to transport antisense oligonucleotides across the mammalian blood-brain barrier. Sci. Transl. Med. 16, eadi2245. https: / / doi.org / 10.1126 / scitranslmed.adi2245.34. Johnsen, K.B., Burkhart, A., Thomsen, L.B., Andresen, T.L., and Moos, T. (2019). Targeting the transferrin receptor for brain drug delivery. Prog Neurobiol 181, 101665. https: / / doi.Org / 10.1016 / j.pneurobio.2019.101665.35. Faresjo, R., Lindberg, H., Stahl, S., Lofblom, J., Syvanen, S., and Sehlin, D. (2022). Transferrin Receptor Binding BBB-Shuttle Facilitates Brain Delivery of Anti-AP-Affibodies. Pharmaceut Res 39, 1509-1521. https: / / doi.org / 10.1007 / sl l095-022-03282-2.36. Yang, X., Koh, C.G., Liu, S., Pan, X., Santhanam, R., Yu, B., Peng, Y., Pang, J., Golan, S., Talmon, Y., et al. (2009). Transferrin Receptor-Targeted Lipid Nanoparticles for Delivery of an Antisense Oligodeoxyribonucleotide against Bcl-2. Mol. Pharm. 6, 221-230. https: / / doi.org / 10.1021 / mp800149s.37. Cepparulo, P., Cuomo, O., Campani, V., Vinciguerra, A., Sisalli, M.J., Nele, V., Anzilotti, S., Valsecchi, V., Casamassa, A., Brancaccio, P., et al. (2024). Anti- miRNA103 / 107 encapsulated in transferrin-conjugated lipid nanoparticles crosses bloodbrain barrier and reduces brain ischemic damage. Mol. Ther. - Nucleic Acids 35, 102131. https: / / doi.Org / 10.1016 / j.omtn.2024.102131.38. Dahlman, J.E., Kauffman, K.J., Xing, Y., Shaw, T.E., Mir, F.F., Dlott, C.C., Langer, R., Anderson, D.G., and Wang, E.T. (2017). Barcoded nanoparticles for high throughput in vivo discovery of targeted therapeutics. Proc National Acad Sci 114, 2060-2065. https: / / doi.org / 10.1073 / pnas.1620874114.39. Orlikowska-Rzeznik, H., Krok, E., Chattopadhyay, M., Lester, A., and Piatkowski, L. (2023). Laurdan Discerns Lipid Membrane Hydration and Cholesterol Content. J. Phys. Chem. B 127, 3382-3391. https: / / doi.org / 10.1021 / acs.jpcb.3c00654.40. Wong, A.M., and Budin, I. (2024). Organelle-Targeted Laurdans Measure Heterogeneity in Subcellular Membranes and Their Responses to Saturated Lipid Stress. ACS Chem. Biol. 19, 1773-1785. https: / / doi.org / 10.1021 / acschembio.4c00249.41. Qiu, M., Tang, Y., Chen, J., Muriph, R., Ye, Z., Huang, C., Evans, J., Henske, E.P., and Xu, Q. (2022). Lung-selective mRNA delivery of synthetic lipid nanoparticles for the treatment of pulmonary lymphangioleiomyomatosis. P Natl Acad Sci Usa 119, e2116271119. https: / / doi.org / 10.1073 / pnas.2116271119.42. Radmand, A., Lokugamage, M.P., Kim, H., Dobrowolski, C., Zenhausem, R., Loughrey, D., Huayamares, S.G., Hatit, M.Z.C., Ni, H., Cid, A.D., et al. (2023). The TranscriptionalAttorney Docket No: 01164-0038-00PCTResponse to Lung-Targeting Lipid Nanoparticles in Vivo. Nano Lett. 23, 993-1002. https: / / doi.org / 10.1021 / acs.nanolett.2c04479.43. Sago, C.D., Lokugamage, M.P., Loughrey, D., Lindsay, K.E., Hincapie, R., Krupczak, B.R., Kalathoor, S., Sato, M., Echeverri, E.S., Fitzgerald, J.P., et al. (2022). Augmented lipid- nanoparticle-mediated in vivo genome editing in the lungs and spleen by disrupting Cas9 activity in the liver. Nat Biomed Eng 6, 157-167. https: / / doi.org / 10.1038 / s41551-022-00847- 9.44. Guimaraes, P.P.G., Zhang, R., Spektor, R., Tan, M., Chung, A., Billingsley, M.M., El- Mayta, R., Riley, R.S., Wang, L., Wilson, J.M., et al. (2019). Ionizable lipid nanoparticles encapsulating barcoded mRNA for accelerated in vivo delivery screening. J Control Release 316, 404-417. https: / / doi.Org / 10.1016 / j.jconrel.2019.10.028.45. Han, E.L., Tang, S., Kim, D., Murray, A.M., Swingle, K.L., Hamilton, A.G., Mrksich, K., Padilla, M.S., Palanki, R., Li, J. J., et al. (2024). Peptide-Functionalized Lipid Nanoparticles for Targeted Systemic mRNA Delivery to the Brain. Nano Lett. https: / / doi.org / 10.1021 / acs.nanolett.4c05186.46. Monopoli, M.P., Aberg, C., Salvati, A., and Dawson, K.A. (2012). Biomolecular coronas provide the biological identity of nanosized materials. Nat. Nanotechnol. 7, 779-786. https: / / doi.org / 10.1038 / nnano.2012.207.47. Chen, D., Ganesh, S., Wang, W ., and Amiji, M. (2019). The role of surface chemistry in serum protein corona-mediated cellular delivery and gene silencing with lipid nanoparticles. Nanoscale 11, 8760-8775. https: / / doi.org / 10.1039 / c8nr09855g.48. Zheng, L., Bandara, S.R., Tan, Z., and Leal, C. (2023). Lipid nanoparticle topology regulates endosomal escape and delivery of RNA to the cytoplasm. Proc. Natl. Acad. Sci. 120, e2307067120. https: / / doi.org / 10.1073 / pnas.2301067120.49. Abumanhal-Masarweh, H., Silva, D. da, Poley, M., Zinger, A., Goldman, E., Krinsky, N., Kleiner, R., Shenbach, G., Schroeder, J.E., Shklover, J., et al. (2019). Tailoring the lipid composition of nanoparticles modulates their cellular uptake and affects the viability of triple negative breast cancer cells. J. Control. Release 307, 331-341. https: / / doi.org / 10.1016 / jjconrel.2019.06.025.50. Anselmo, A.C., Zhang, M., Kumar, S., Vogus, D.R., Menegatti, S., Helgeson, M.E., and Mitragotri, S. (2015). Elasticity of Nanoparticles Influences Their Blood Circulation, Phagocytosis, Endocytosis, and Targeting. ACS Nano 9, 3169-3177. https: / / doi.org / 10.1021 / acsnano.5b00147.51. Brown, T.D., Habibi, N., Wu, D., Lahann, J., and Mitragotri, S. (2020). Effect of Nanoparticle Composition, Size, Shape, and Stiffness on Penetration Across the Blood-Brain Barrier. Acs Biomater Sci Eng 6, 4916-4928. https: / / doi.org / 10.1021 / acsbiomaterials.0c00743.52. Goldman, R.L., Murthy, N.T.V., Northen, T.P., Balakrishnan, A., Chivukula, S., Danz, H., Tibbitts, T., Dias, A., Vargas, J., Cooper, D., et al. (2023). Understanding structure activity relationships of Good HEPES lipids for lipid nanoparticle mRNA vaccine applications. Biomaterials 301, 122243. https: / / doi.Org / 10.1016 / j.biomaterials.2023.122243.53. Paunovska, K., Sago, C.D., Monaco, C.M., Hudson, W.H., Castro, M.G., Rudoltz, T.G., Kalathoor, S., Vanover, D.A., Santangelo, P.J., Ahmed, R., et al. (2018). A DirectAttorney Docket No: 01164-0038-00PCTComparison of in Vitro and in Vivo Nucleic Acid Delivery Mediated by Hundreds of Nanoparticles Reveals a Weak Correlation. Nano Lett. 18, 2148-2157. https: / / doi.org / 10.1021 / acs.nanolett.8b00432.54. Hajj, K.A., Ball, R.L., Deluty, S.B., Singh, S.R., Strelkova, D., Knapp, C.M., and Whitehead, K.A. (2019). Branched-Tail Lipid Nanoparticles Potently Deliver mRNA In Vivo due to Enhanced Ionization at Endosomal pH. Small 15, 1805097. https: / / doi.org / 10.1002 / smll.201805097.55. Byrnes, A.E., Dominguez, S.L., Yen, C.-W., Laufer, B.I., Foreman, O., Reichelt, M., Lin, H., Sagolla, M., Hbtzel, K., Ngu, H., et al. (2023). Lipid nanoparticle delivery limits antisense oligonucleotide activity and cellular distribution in the brain after intracerebroventricular injection. Mol. Ther. - Nucleic Acids 32, 773-793. https: / / doi.Org / 10.1016 / j.omtn.2023.05.005.56. Daniels, T.R., Bemabeu, E., Rodriguez, J.A., Patel, S., Kozman, M., Chiappetta, D.A., Holler, E., Ljubimova, J.Y., Helguera, G., and Penichet, M.L. (2012). The transferrin receptor and the targeted delivery of therapeutic agents against cancer. Biochim. Biophys. Acta (BBA) - Gen. Subj. 1820, 291-317. https: / / doi.Org / 10.1016 / j.bbagen.2011.07.016.57. Desjardins, C.A., Yao, M., Hall, J., O’Donnell, E., Venkatesan, R., Spring, S., Wen, A., Hsia, N., Shen, P., Russo, R., et al. (2022). Enhanced exon skipping and prolonged dystrophin restoration achieved by TfRl -targeted delivery of antisense oligonucleotide using FORCE conjugation in mdx mice. Nucleic Acids Res. https: / / doi.org / 10.1093 / nar / gkac641.58. Fan, Y., Yen, C.-W., Lin, H.-C., Hou, W ., Estevez, A., Sarode, A., Goyon, A., Bian, J., Lin, J., Koenig, S.G., et al. (2021). Automated high-throughput preparation and characterization of oligonucleotide-loaded lipid nanoparticles. Int J Pharmaceut 599, 120392. https: / / doi.Org / 10.1016 / j.ijpharm.2021.120392.59. Yu, Y.J., Atwal, J.K., Zhang, Y., Tong, R.K., Wildsmith, K.R., Tan, C., Bien-Ly, N., Hersom, M., Maloney, J. A., Meilandt, W.J., et al. (2014). Therapeutic bispecific antibodies cross the blood-brain barrier in nonhuman primates. Sci. Transl. Med. 6, 261ral54. https: / / doi.org / 10.1126 / scitranslmed.3009835.60. Sountoulidis, A., Liontos, A., Nguyen, H.P., Firsova, A.B., Fysikopoulos, A., Qian, X., Seeger, W., Sundstrom, E., Nilsson, M., and Samakovlis, C. (2020). SCRINSHOT enables spatial mapping of cell states in tissue sections with single-cell resolution. PLoS Biol. 18, e3000675. https: / / doi.org / 10.1371 / journal.pbio.3000675.
[0150] Sequences disclosed in this application include the following:Sequence TableAttorney Docket No: 01164-0038-00PCTAttorney Docket No: 01164-0038-00PCTAttorney Docket No: 01164-0038-00PCTAttorney Docket No: 01164-0038-00PCT
Claims
Attorney Docket No: 01164-0038-00PCTWhat is Claimed is:
1. A lipid nanoparticle (LNP) comprising at least one ionizable lipid, at least one conjugating lipid, and at least one further lipid optionally selected from DSPC, DOPE, DPPC, DOPC, and cholesterol, wherein the LNP is conjugated to an antigen binding fragment of an anti -transferrin receptor (anti-TfR) antibody by the conjugating lipid.
2. The LNP of claim 1, wherein the LNP comprises (a) at least one ionizable lipid, (b) DPPC, DOPC, DSPC and / or DOPE, (c) cholesterol, and (d) one or both of DMG-PEG2000 and DSPE-PEG2000 as conjugating lipid, wherein the DMG-PEG2000 and / or DSPE- PEG2000 further comprises a functional group linking the DMG-PEG2000 and / or DSPE- PEG2000 to the antigen binding fragment of the anti-TfR antibody.
3. The LNP of claim 1 or 2, wherein the antigen binding fragment of the anti -transferrin receptor antibody comprises a Fab domain.
4. The LNP of claim 3, wherein the LNP comprises from 0.01 to 1 mol % Fab, from 0.1 to 1 mol % Fab, from 0.01 to 0.5 mol % Fab, from 0.05 to 0.5 mol % Fab, from 0.1 to 0.5 mol % Fab, from 0.2 to 0.5 mol % Fab, from 0.2 to 0.4 mol % Fab, or from 0.05 to 0.2 mol % Fab, wherein mol % is of the conjugating lipid.
5. The LNP of any one of claims 1-4, wherein the LNP has a mean particle diameter of 50-200 nm, 50-150 nm, 75-150 nm, 100-150 nm, 75-100 nm, 75-125 nm, 80-120 nm, or 90- 110 nm as measured by dynamic light scattering (DLS).
6. The LNP of any one of claims 1-5, wherein the antigen binding fragment of the anti- TfR antibody has an affinity for transferrin receptor of 5 nM to 1 pM, 10 nM to 1 pM, 10- 500 nM, 50-500 nM, 100-500 nM, 100-400 nM, 100-300 nM, 200-500 nM, 200-400 nM, or 200-300 nM as measured by surface plasmon resonance.
7. The LNP of any one of claims 1-6, wherein the LNP has a poly dispersity of 15-40%, 15-30%, 15-25%, 20-30%, 15-20%, or 20-25% as measured by dynamic light scattering (DLS).
8. The LNP of any one of claims 1-7, wherein the LNP comprises a mol % of ionizable lipid of 40-60%, 40-50%, 50-60%, or 45-55%, wherein mol % is of the total lipid content.
9. The LNP of any one of claims 1-8, wherein the LNP comprises a mol % of DSPC and / or DOPE of 5-15%, 5-10%, 10-25%, or 7-13%, wherein mol % is of the total lipid content.Attorney Docket No: 01164-0038-00PCT10. The LNP of any one of claims 1-9, wherein the LNP comprises a mol % of cholesterol of 20-50%, 20-40%, 30-50%, 30-40%, 40-50%, 25-45%, 35-45%, or 35-40%, wherein mol % is of the total lipid content.
11. The LNP of any one of claims 1-10, wherein the LNP comprises a mol % of DMG- PEG2000 and / or DSPE-PEG2000 of 0.5-3%, 1-3%, 0.5-2.5%, 0.5-2%, 1-2.5%, 1-2%, 0.5- 1.5%, or 2-3%, wherein mol % is of the total lipid content, and wherein the DMG-PEG2000 and / or DSPE-PEG2000 acts as conjugating lipid and further comprises a functional group linking the DMG-PEG2000 and / or DSPE-PEG2000 to the antigen binding fragment of the antibody.
12. The LNP of any one of claims 1-11, wherein the LNP further comprises a polynucleotide cargo.
13. The LNP of claim 12, wherein the polynucleotide is single stranded or double stranded and comprises a length of 10-200, 10-100, 10-50, 50-200, 50-100, or 100-200 bases or base pairs.
14. The LNP of any one of claims 1-13, wherein (a) the antigen binding fragment of the anti-transferrin receptor antibody comprises a Fab domain; (b) the LNP comprises from 0.1 to 1 mol % Fab, wherein mol % Fab is of the conjugating lipid; (c) the LNP has a mean particle diameter of from 75 to 125 nm, or from 90-110 nm as measured by DLS; and (d) the LNP has a poly dispersity of as measured by DLS or cryo EM.
15. The LNP of claim 14, wherein the antigen binding fragment of the anti-TfR antibody has an affinity for transferrin receptor of 50-500 nM, 100-500 nM, 100-400 nM, 100-300 nM, 200-500 nM, 200-400 nM, or 200-300 nM, as measured by surface plasmon resonance.
16. The LNP of claim 14 or 15, wherein the LNP comprises a polynucleotide cargo, optionally wherein the polynucleotide cargo shows a fold change from input of at least 2, at least 3, at least 4, of 2-5, of 2-4, of 3-5, of 2-3, or of 3-4, in the brain of an animal following administration, wherein fold change = [{(Percent Tissue Cargo) / (Percent Input Cargo)} - 1],17. A pharmaceutical composition comprising the LNP of any one of claims 1-16 and a pharmaceutical carrier or excipient.
18. A method of making an LNP of any one of claims 1-16, the method comprising (a) dissolving a lipid mixture comprising at least one ionizable lipid, at least one conjugating lipid, and at least one further lipid optionally selected from DSPC, DOPE, DPPC, DOPC and cholesterol in a non-aqueous solvent such as ethanol, (b) dissolving at least one cargo molecule in an aqueous solvent, (c) mixing the non-aqueous solvent phase and the aqueousAttorney Docket No: 01164-0038-00PCT solvent phase together, optionally at a molar ratio of from 2: 1 to 4: 1 non-aqueous to aqueous solvent, (d) separating LNPs formed during the mixing from unincorporated lipids and cargo, optionally wherein the separating is by ultrafiltration, and (e) incubating the LNPs with the antigen binding fragment of the anti-TfR antibody under conditions allowing conjugation of the antigen binding fragment, and optionally removing unconjugated antigen binding fragment.
19. The method of claim 18, wherein the method further comprises determining the mean particle diameter and / or the poly dispersity of the LNPs by dynamic light scattering (DLS).
20. Use of the LNP of any one of claims 1-16 or the pharmaceutical composition of claim 17 for treating a disease or disorder in a subject, optionally wherein the disease or disorder is a neurological disease or disorder, wherein the LNP or pharmaceutical composition is to be administered systemically, optionally wherein the systemic administration comprises intravenous administration.
21. A method of treating a neurological disease or disorder in a subject in need thereof, comprising systemically administering the LNP of any one of claims 1-16 or the pharmaceutical composition of claim 17 to the subject, optionally wherein the systemic administration comprises intravenous administration.
22. A method of delivering a cargo molecule across the blood-brain barrier (BBB) in a subject, comprising systemically administering the LNP of any one of claims 1-16 or the pharmaceutical composition of claim 17 to the subject, optionally wherein the systemic administration comprises intravenous administration.
23. The LNP of any one of claims 1-16, the pharmaceutical composition of claim 17, or the use or method of any one of claims 20-22, wherein the cargo shows a fold change from input of at least 2, at least 3, at least 4, of 2-5, of 2-4, of 3-5, of 2-3, or of 3-4, in the brain of the subject following administration, wherein fold change = [{(Percent Tissue Cargo) / (Percent Input Cargo)} - 1],24. A method of detecting uptake of a lipid nanoparticle (LNP) or a mixture of different LNPs in the brain of an animal following systemic administration of the LNP or mixture of different LNPs to the animal, wherein the LNP is conjugated to an antigen binding fragment of an antibody or wherein the mixture of different LNPs comprises at least one LNP conjugated to an antigen binding fragment of an antibody via a conjugating lipid, and wherein the LNP or mixture of LNPs comprises a label or barcode, the method comprisingAttorney Docket No: 01164-0038-00PCT detecting presence of the label or barcode in the brain of the animal following the systemic administration.
25. A method of detecting uptake of a lipid nanoparticle (LNP) or a mixture of different LNPs in the brain of an animal following systemic administration of the LNP or mixture of different LNPs to the animal, wherein the method comprises (a) systemically administering the LNP or mixture of different LNPs to the animal, wherein the LNP is conjugated to an antigen binding fragment of an antibody or wherein the mixture of different LNPs comprises at least one LNP conjugated to an antigen binding fragment of an antibody via a conjugating lipid, and wherein the LNP or mixture of different LNPs comprises a label or barcode, and (b) detecting presence of the label or barcode in the brain of the animal following the systemic administration.
26. The method of claim 24 or 25, wherein the method comprises detecting presence of one or more labels or barcodes from a mixture of different LNPs in the brain of the animal.
27. The method of claim 25, wherein the method comprises systemically administering a mixture of different LNPs to the animal in a single administration and detecting presence of one or more labels or barcodes from the mixture of different LNPs in the brain of the animal following the systemic administration.
28. The method of claim 26 or 27, wherein each member of the mixture of different LNPs comprises a unique label or unique nucleic acid barcode.
29. The method of claim 28, wherein each member of the mixture of different LNPs comprises a unique nucleic acid barcode, and wherein detection comprises quantitative PCR.
30. The method of any one of claims 24-29, wherein detecting presence of the label or barcode comprises in situ hybridization (ISH).
31. The method of any one of claims 30, wherein the method further comprises immunofluorescence (IF) detection of cellular markers, and optionally comparison of distribution of cellular markers as detected by IF against distribution of the label or barcode as detected by ISH.
32. The method of any one of claims 24-31, wherein the mixture of different LNPs comprises 2-100, 2-50, 4-100, 4-50, 10-100, 10-80, 20-80, 30-70, 20-60, 20-50, 5-10, 10-50, 10-40, 10-30, 20-60, 20-50, 20-40, 30-60, or 30-50 different LNPs, optionally wherein each LNP of the mixture of LNPs comprises a unique nucleic acid barcode.
33. The method of any one of claims 24-32, wherein the antibody is an anti -transferrin receptor (anti-TfR) antibody.Attorney Docket No: 01164-0038-00PCT34. The method of claim 33, wherein the antigen binding fragment of the anti-TfR antibody has an affinity for transferrin receptor of 10 nM to 1 pM, 10-500 nM, 50-500 nM, 100-500 nM, 100-400 nM, 100-300 nM, 200-500 nM, 200-400 nM, or 200-300 nM as measured by surface plasmon resonance.
35. The method of any one of claims 24-34, wherein the antigen binding fragment of the antibody comprises a Fab domain.
36. The method of claim 35, wherein the LNP comprises from 0.01 to 1 mol % Fab, from 0.1 to 1 mol % Fab, from 0.01 to 0.05 mol % Fab, from 0.05 to 0.5 mol % Fab, from 0.1 to 0.5 mol % Fab, from 0.2 to 0.5 mol % Fab, from 0.2 to 0.4 mol % Fab, or from 0.05 to 0.2 mol % Fab, wherein mol % is of the conjugating lipid.
37. The method of any one of claims 24-36, wherein the LNP has a mean particle diameter of 50-200 nm, 50-150 nm, 75-150 nm, 100-150 nm, 75-100 nm, 75-125 nm, 80-120 nm, or 90-110 nm as measured by dynamic light scattering (DLS).
38. The method of any one of claims 24-37, wherein the LNP has a poly dispersity of 15- 40%, 15-30%, 15-25%, 20-30%, 15-20%, or 20-25% as measured by dynamic light scattering (DLS).
39. The method of any one of claims 24-38, wherein the LNP or mixture of LNPs comprises an ionizable lipid, a conjugating lipid, one or both of DSPC and DOPE, and cholesterol.
40. The method of claim 39, wherein the LNP or mixture of LNPs comprises DMG- PEG2000 and / or DSPE-PEG2000 as conjugating lipid, wherein the DMG-PEG2000 and / or DSPE-PEG2000 comprises a functional group linking the DMG-PEG2000 and / or DSPE- PEG2000 to the antigen binding fragment of the antibody.
41. The method of claim 39 or 40, wherein the LNP or mixture of LNPs comprises a mol % of 40-60%, 40-50%, 50-60%, or 45-55% of ionizable lipid, wherein mol % is of the total lipid content.
42. The method of any one of claims 39-41, wherein the LNP or mixture of LNPs comprises a mol % of 5-15%, 5-10%, 10-25%, or 7-13% of DSPC and / or DOPE, wherein mol % is of the total lipid content.
43. The method of any one of claims 32-42, wherein the LNP or mixture of LNPs comprises a mol % of 20-50%, 20-40%, 30-50%, 30-40%, 40-50%, 25-45%, 35-45%, or 35- 40% cholesterol, wherein mol % is of the total lipid content.Attorney Docket No: 01164-0038-00PCT44. The method of any one of claims 41-43, wherein the LNP or mixture of LNPs comprises 0.5-3%, 1-3%, 0.5-2.5%, 0.5-2%, 1-2.5%, 1-2%, 0.5-1.5%, or 2-3% DMG- PEG2000 and / or DSPE-PEG2000 as conjugating lipid, wherein mol % is of the total lipid content, and wherein the DMG-PEG2000 and / or DSPE-PEG2000 comprises a functional group linking the DMG-PEG2000 and / or DSPE-PEG2000 to the antigen binding fragment of the antibody.
45. The method of any one of claims 41-44, wherein the LNP or mixture of LNPs comprises DSPE-PEG2000 as conjugating lipid, wherein the DSPE-PEG2000 further comprises a functional group linking the DSPE-PEG2000 to the antigen binding fragment of the antibody, optionally wherein the functional group comprises an azide-alkyne cycloaddition reaction product.
46. The method of any one of claims 24-45, wherein the animal is a mouse or rat.
47. The method of any one of claims 24-46, wherein the systemic administration comprises intravenous administration.
Citation Information
Patent Citations
Anti-transferrin receptor / Anti-BACE1 multispecific antibodies and methods of use
WO2016081640A1
Anti-transferrin receptor antibodies and methods of use
WO2016081643A1
Anti-transferrin receptor antibodies and uses thereof
US11827702B2
Lipid nanoparticle methods and compositions for producing engineered erythroid cells
US20190062788A1
Targeted Therapeutic Lipid Nanoparticles and Methods of Use
US20240189445A1