Use of allicin e in controlling enterocytozoon hepatopenaei infection in shrimp

Abstract

The use of allicin E in controlling Enterocytozoon hepatopenaei, the use comprising adding a compound as shown in formula (I) to shrimp feed. The feed can ameliorate Enterocytozoon hepatopenaei infection in shrimp and reduce the mortality rate of shrimp.

Description

Uses of garlic E in the prevention and treatment of shrimp infected with Enterocytozoa. Technical Field

[0001] This invention relates to the field of prevention and control of shrimp hepatocystis infection, and proposes the use of garlic E to prevent and control shrimp infection with hepatocystis infection. Background Technology

[0002] Enterocytozoon hepatopenaei (EHP), belonging to the kingdom Fungi and phylum Microsporidia, is a typical obligate intracellular parasitic unicellular eukaryote that exclusively parasitizes the hepatobiliary tissue. EHP infects the hepatopancreas of Penaeus monodon and Pvannamei, causing slow growth and even death in shrimp. It is widely distributed in Brunei, China, India, Indonesia, Malaysia, the Philippines, Venezuela, and Vietnam. Since 2013, widespread outbreaks of EHP have been found in major shrimp farming areas along the coast of my country, including Guangdong, Zhejiang, Jiangsu, Hainan, Shandong, Tianjin, and Liaoning. EHP can cause extremely slow or stunted growth in shrimp, resulting in low farming success rates and significant economic losses, making it one of the most serious diseases affecting shrimp farming globally.

[0003] Shrimp infected with EHP show no obvious clinical symptoms, feed normally, and do not experience mass mortality. However, EHP can be observed at different growth stages in hepatopancreatic tissue sections, from early sporogenous material to mature spores. EHP infection leads to severe lesions in the hepatopancreatic tissue, with shrinkage or disappearance of the hepatopancreatic cavity and focal necrosis or sloughing of some hepatopancreatic epithelial cells. Biochemical parameters reflecting hepatopancreatic function in the hemolymph of EHP-infected shrimp are significantly higher than in healthy shrimp. Shrimp become emaciated, lose weight, exhibit uneven size and weight dispersion, directly impacting aquaculture yield.

[0004] From 2015 to 2017, a three-year survey was conducted on the prevalence of EHP in farmed shrimp in Tianjin. The results showed that the positive rates of EHP in 2015, 2016, and 2017 were 56.96%, 69.52%, and 29.28%, respectively. EHP could be detected in all stages of Litopenaeus vannamei farming, including larvae, juveniles, and adults, but the positive rates were higher in juveniles and adults. In 2015, the EHP carrier rate in Litopenaeus vannamei larvae in Zhejiang Province was 23.1%; in 2015, the EHP detection rate in diseased Litopenaeus vannamei samples from Liaoning Province was 34.6%; and in 2016, the EHF detection rate in shrimp samples from western Guangdong Province was 41.38%. Tissue distribution of shrimp infected with Enterocytozoa showed that the order of EHP infection from highest to lowest in different tissues was hepatopancreas > midgut > hemolymph > gills > muscle, with the hepatopancreas being the primary infected tissue.

[0005] Although those skilled in the art have been working to develop new anthelmintics for aquaculture, there are currently no publicly reported effective drugs against EHP.

[0006] Summary of the Invention

[0007] The purpose of this invention is to provide an effective drug for EHP.

[0008] Another object of the present invention is to provide a feed composition that can improve diseases caused by enterocytozoon infection in shrimp farming.

[0009] A first aspect of the present invention provides a use of garlic E, characterized in that it is used to prepare a feed composition for inhibiting enterocolitis hepatocellular carcinoma in shrimp; wherein the garlic E has a structure as shown in the following formula:

[0010] In another preferred embodiment, the feed composition is used to treat or improve diseases or symptoms caused by enterocytozoon infection in shrimp.

[0011] In another preferred embodiment, the feed composition is used to treat or improve the EHP content in shrimp tissues.

[0012] In another preferred embodiment, the feed composition is used to increase the body weight of shrimp during rearing.

[0013] In another preferred embodiment, the amount of garlic E in the feed composition is 50-2000 mg / kg of feed.

[0014] In another preferred embodiment, the amount of garlic E in the feed composition is 300-500 mg / kg of feed.

[0015] In another preferred embodiment, the feed composition is used to prevent and treat hepatopancreatic tissue lesions in shrimp.

[0016] In another preferred embodiment, the feed composition is used to improve necrosis of the hepatopancreatic tissue in shrimp.

[0017] In another preferred embodiment, the feed composition is used to reduce shrimp mortality due to Hepatocellular carcinoma infection.

[0018] In a second aspect, the present invention provides a shrimp feed composition, characterized in that the feed composition comprises garlic E.

[0019] In another preferred embodiment, the content of allicin E in the feed composition is 50-2000 mg / kg of feed.

[0020] In another preferred embodiment, the amount of garlic E in the feed composition is 300-500 mg / kg of feed.

[0021] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0022] Figure 1 is a schematic diagram of the life cycle of *Enterocera hepatica* in shrimp and its physiological mechanism after EHP infection.

[0023] Figure 2 shows the morphological observation of the purified shrimp hepatocellular carcinoma in Example 1.

[0024] Figure 3 shows the results of nested PCR detection of EHP in shrimp hepatopancreas samples.

[0025] Figure 4 shows the spectrum of the pMD18T-SSU recombinant plasmid.

[0026] Figure 5 shows the fluorescence quantitative detection spectrum of EHP.

[0027] Figure 6 shows the drug dissolution and mixing process.

[0028] Figure 7 shows the mixing of the drug spraying material.

[0029] Figure 8 shows the feed drying process.

[0030] Figure 9 shows the sample collection.

[0031] Figure 10 shows the quantitative analysis of EHP in the hepatopancreas of Litopenaeus vannamei after feeding with garlic E. * indicates a significant difference compared to day 0 (P<0.05).

[0032] Figure 11 shows the observation of EHP (HE staining) in shrimp hepatopancreas samples. Detailed Implementation

[0033] Through long-term and in-depth research, the inventors discovered that adding garlic E to feed can effectively improve the infection status of Enterocytozoa hepatisifera in shrimp, demonstrating good inhibitory activity against the parasite. Based on these findings, the inventors completed this invention.

[0034] EHP infection

[0035] Enterocytozoon hepatopenaei (EHP) can infect the hepatopancreas of Penaeus monodon and Litopenaeus vannamei, causing extremely slow or stunted growth, low success rates in shrimp farming, and significant economic losses. It is one of the most serious diseases affecting shrimp farming production worldwide. After infecting shrimp, EHP forms cytoplasm within the hepatopancreas cells. Once mature, it is excreted through the shrimp's digestive tract, forming sporophytes in the aquatic environment. These sporophytes disperse in the water and attach to algae, debris, feed surfaces, pond walls, and bottom sediment, posing a potential threat to healthy shrimp (Figure 1).

[0036] Garlic E

[0037] ALE (Allicin E) is a single compound synthesized biomimetically by modifying the structure outside the antibacterial active group of ordinary allicin. Its structure is shown in the following formula:

[0038] Garlic E has broad-spectrum bactericidal and green safety characteristics, and can effectively replace traditional antibiotics, supporting environmental disinfection, animal and plant protection, preservation, and upgrading of the biopharmaceutical industry.

[0039] Feed composition with added garlic E

[0040] This invention provides a feed composition; the feed composition is fortified with garlic E, the garlic E having the structure shown in the following formula:

[0041] Because garlic E has good bactericidal properties, the feed composition described above is used to reduce or improve the infection of shrimp with Enterocytozoa hepatica. The garlic E of this invention can be directly added to existing feed formulations without affecting the feed's effectiveness. In a preferred embodiment, the amount of garlic E in the feed composition is 50-2000 mg / kg feed, more preferably 300-500 mg / kg feed.

[0042] The feed composition of this invention can effectively treat or prevent diseases or symptoms caused by enterocolitis infection in shrimp during shrimp farming, such as hepatopancreatic tissue lesions and hepatopancreatic tissue necrosis. The feed composition of this invention can also effectively improve the mortality rate of farmed shrimp and increase their body weight.

[0043] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

[0044] Example 1: Extraction and purification of EHP from diseased shrimp

[0045] Diseased Litopenaeus vannamei were collected, and the presence of Enterocytozoa hepatis was detected by PCR. Positive diseased shrimp samples were collected, and hepatopancreatic tissue from EHP-positive shrimp was collected. Phosphate buffer was added, and the mixture was thoroughly homogenized using a tissue homogenizer. The homogenate was filtered, and the filtrate was collected and mixed with double-distilled water. The filtrate was aliquoted into 1.5 mL centrifuge tubes, centrifuged at 10000 rpm for 10 min, the supernatant was discarded, and the precipitate was resuspended in 200 μL of double-distilled water, repeated twice. The precipitate was then centrifuged at 2000 rpm for 2 min, and the supernatant was collected. Finally, the precipitate was resuspended in phosphate buffer to obtain a crude extract of Enterocytozoa hepatis spores, which was then sterilized with penicillin / streptomycin solution at 4°C. The crude extract was subjected to density gradient centrifugation using Percol, and solutions from different layers were collected and resuspended in phosphate buffer to prepare a high-purity Enterocytozoa hepatis solution.

[0046] Collected samples of *Enterocera hepatis* were stained with 2% fluorescent pink B solution, and the spore morphology was observed under a microscope. The results are shown in Figure 2: the spores of *Enterocera hepatis* were stained red, and their morphology and size were consistent with those reported in the literature. After counting, the spore concentration in the EHP extract was approximately 7.02 x 10⁻⁶. 6 per mL.

[0047] Example 2: The inhibitory or killing effect of allicin on EHP spore germination

[0048] Garlic E-ingredient: Provided by Shanghai Laishen Biotechnology Co., Ltd., it is a high-concentration drug. Fish Insect Cleanser, whose main ingredient is eucalyptus oil, was purchased from a fish medicine store in Zhongshan City.

[0049] The isolated and purified spores were placed in sterile 2.0 ml centrifuge tubes. Allicin E at final concentrations of 100, 200, 400, 800, and 1600 mg / L was added to the treatment groups, while the control group received an equal volume of sterile physiological saline. The tubes were incubated at 25°C for 60 min, centrifuged to remove the drug, and stained with DAPI for 5 min. 100 mL of deionized water was added, and the dye was removed by centrifugation. The tubes were then resuspended in 50 mL of deionized water, and the staining effect was observed under a fluorescence microscope. The number of dead spores was counted, and the spore mortality rates for the treatment and control groups were calculated. The results showed that the average spore mortality rates for the treatment groups (100, 200, 400, 800, and 1600 mg / L) were 8.02%, 15.35%, 21.06%, 34.65%, and 78.42%, respectively, indicating a clear dose-dependent spore mortality rate. In addition, the positive control drug, Yuchongqing (mainly composed of eucalyptus oil), purchased by our laboratory, was diluted to concentrations of 100, 200, 400, 800, and 1600 mg / L. The killing effect of this drug on EHP spores was evaluated according to the above experimental method. The results showed that the killing rates of Yuchongqing on EHP spores at concentrations of 100, 200, 400, 800, and 1600 mg / L were 3.07%, 9.28%, 17.02%, 28.96%, and 65.31%, respectively. This indicates that, compared with Yuchongqing, allicin E significantly enhances the killing effect on EHP spores.

[0050] Example 3: Establishment of EHP fluorescence quantitative detection method

[0051] Referring to the industry standard "Diagnostic Procedures for Shrimp Hepatocystitis" (SC / T 7232-2020), the real-time PCR primers 157-F and 157-R, as well as the TaqMan probe (Table 1), were synthesized. The target gene for detection was SSU rRNA. The real-time PCR method was performed in accordance with the "Diagnostic Procedures for Shrimp Hepatocystitis" (SC / T 7232-2020).

[0052] SSU rRNA of EHP in positive samples was amplified by PCR. The positive PCR product was recovered, ligated into the pMD18T vector (TAKARA), and transformed into E. coli DH5α competent cells. Positive clones were selected using M13F / R universal primers and sent to Guangzhou Aiji Biotechnology Co., Ltd. for sequencing verification. The sequencing results showed that the SSU rRNA sequence of EHP is as follows: 5'-AGTAAACTATGCCGACAATGCTGGGTGTTGCGAGAGCGATGCTTGGTGTGGGAGAAATCTTAGTTTTCGGGCTCTGGGGATAGTACGCTCGCAAGGGTGAAACTTAAAGCGAAATTGACGGAAGGACACTACCAGGAGTGGATTGTGCTGCTTAATT-3'. The vector map of the positive clone is shown in Figure 4, i.e., the pMD18T-SSU plasmid. Using the pMD18T-SSU plasmid as the positive sample, a quantitative real-time detection method for EHP was established (Figure 5).

[0053] Example 4: Feeding trial of garlic E

[0054] (1) Shrimp samples: Diseased shrimp from a shrimp farm in Nansha District, Guangzhou City, were collected. The diseased shrimp that tested positive for EHP by PCR and were negative for acute hepatopancreatic necrosis, decapod iridovirus disease and infectious hypodermal and hematopoietic tissue necrosis were used as the samples for this feeding experiment.

[0055] (2) Sample grouping: A drug feeding experiment was conducted at the aquaculture farm. Diseased shrimp were divided into a drug group and a control group. Each group was divided into 3 rearing tanks as biological replicates. 60 shrimp of relatively uniform size were randomly stocked in each tank. Each group of shrimp was fed twice a day, once in the morning and once in the evening.

[0056] (3) Drug dilution: Garlic E drug dilution: High concentration garlic E is dissolved in a small amount of DMSO to form a working solution. For example, take 5 mL of the drug stock solution, add 1 mL of DMSO and then add sterile water, slowly dissolve, and make up to 50 mL. The drug concentration of the working solution is 100 mg / mL (Figure 6).

[0057] (4) Feed preparation (Figures 7 and 8):

[0058] E200 feed (200mg / kg): 10mg drug (0.10mL working solution + 3.90mL sterile water) + 50g feed, air dry for 30min, and store at 4 degrees Celsius after preparation;

[0059] E400 (400mg / kg), 20mg drug (0.20mL working solution + 3.8mL sterile water) + 50g feed, air dry for 30min, and store at 4 degrees Celsius after preparation;

[0060] E800 (800mg / kg), 40mg drug (0.4mL working solution + 3.6mL sterile water) + 50g feed, air dry for 30min, and store at 4 degrees Celsius after preparation;

[0061] E1600 (1600mg / kg), 80mg drug (0.8mL working solution + 3.2mL sterile water) + 50g feed, air dry for 30min, and store at 4 degrees Celsius after preparation;

[0062] Control group: Take 50g of shrimp feed, spray with about 4ml of sterile water, air dry for 30min, and store at 4 degrees.

[0063] (5) Sample collection: The cephalothorax was removed and longitudinally cut open from side to side with a scalpel blade. One half was fixed in a 4% paraformaldehyde solution (Figure 9), and the other half was frozen at -80℃. Samples of shrimp (9 shrimp / group) were collected from each group on days 0, 5, 10, and 15 after feeding. On day 16 after feeding, 30 shrimp from each group were taken, their body weight was measured, and the average body weight of the shrimp was calculated.

[0064] Example 5: Quantitative Analysis of EHP in Samples

[0065] Total DNA was extracted from the hepatopancreatic tissue of shrimp samples using an animal tissue total DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd.). The concentration of genomic DNA in the extracted samples was measured and then diluted to 100 ng / μL for quantitative PCR analysis.

[0066] Referring to the quantitative PCR method in the industry standard "Diagnostic Procedures for Shrimp Hepatocystis Disease" (SC / T 7232-2020), the TaqMam real-time PCR reaction system consisted of: 12.5 μL of 2x premixed buffer (2x), 1 L each of 157-F and 157-R primers, 0.5 μL of TaqMan probe, 1 μL of genomic DNA template, and ddH2O to a final volume of 25 μL. The TaqMan real-time PCR reaction conditions were: 95℃ for 30 s; 95℃ for 5 s, 60℃ for 30 s, for 40 cycles.

[0067] Quantitative analysis results show:

[0068] Before the experiment, the average EHP content of shrimp samples in the control group was 1010 copies / mg, and the average content on days 5, 10 and 15 was 2417, 5241 and 7022 copies / mg, respectively.

[0069] The average EHP content in shrimp samples from group E200 on days 0, 5, 10, and 15 was 832, 1372, 1050, and 495 copies / mg, respectively.

[0070] The average EHP content in shrimp samples from group E400 on days 0, 5, 10, and 15 was 804, 615, 211, and 80 copies / mg, respectively.

[0071] The average EHP content in shrimp samples from group E800 on days 0, 5, 10, and 15 was 888, 811, 546, and 319 copies / mg, respectively.

[0072] The average EHP content in shrimp samples from group E1600 on days 0, 5, 10, and 15 was 1097, 892, 1739, and 2679 copies / mg, respectively.

[0073] Based on the above statistical data, a graph was plotted. As shown in Figure 10, the EHP content in shrimp samples from groups E200, E400, and E800 was significantly lower than that in the control group. Specifically, in group E400, the EHP content in the hepatopancreas tissue of shrimp continued to decrease after drug administration. On days 10 and 15 of feeding, the EHP content in the hepatopancreas tissue was significantly lower than before feeding, and on day 15, the EHP content in the hepatopancreas tissue was the lowest among all groups. In group E800, the EHP content in the hepatopancreas tissue of shrimp also decreased significantly on days 10 and 15 after feeding. In group E1600, EHP decreased on day 5 after feeding (without significant difference), but increased on days 10 and 15. We hypothesize that the E1600 group was a high-dose drug group. The elevated EHP levels in the shrimp hepatopancreatic tissue were primarily due to the high drug concentration. Garlic E has a strong odor, which affected shrimp feeding. Feeding trials also revealed that shrimp in the E1600 group fed slowly, often leaving uneaten feed, resulting in insufficient drug dosage to effectively inhibit *Enterocera hepatopancreas*. Furthermore, during prolonged feeding, the slow feeding speed caused some of the drug to dissolve in the water due to the water solubility of garlic E, further reducing the ingested drug dosage. Therefore, the EHP content in the E1600 drug group tended to increase in the later stages.

[0074] In summary, the addition of garlic E to feed at doses of 200, 400, and 800 mg / kg effectively inhibited the content of EHP in the hepatopancreas of shrimp. A comprehensive comparison revealed that the effect was best at a dose of 400 mg / kg. Therefore, a garlic E addition dose of 400 mg / kg is recommended for shrimp feed, as it has a good preventive and control effect on early EHP infection in Litopenaeus vannamei.

[0075] Histopathological observation of EHP in samples in Example 6

[0076] Shrimp samples were randomly selected from each group. The cephalothorax was collected, longitudinally cut from both sides with a scalpel, and fixed in 4% paraformaldehyde solution. The samples were sent to Wuhan Saiwei Biotechnology Co., Ltd. for tissue sectioning and HE staining. The EHP content in each group of samples was observed under a microscope. HE staining revealed a large amount of EHP in the hepatopancreas of the control group, while the EHP in the drug-treated group (E400 group) was significantly less (Figure 11).

[0077] Analysis of shrimp weight gain rate in each experimental group

[0078] The initial average weight per tail was 0.594g, and the average weight per tail at the end of the experiment was:

[0079] In the control group, the average weight of a single shrimp was 0.803g; in the E200 group, the average weight of a single shrimp was 0.862g; in the E400 group, the average weight of a single shrimp was 1.142g; in the E800 group, the average weight of a single shrimp was 1.101g; and in the E1600 group, the average weight of a single shrimp was 0.839g.

[0080] The above results indicate that after feeding shrimp with garlic E, the shrimp in the E400 group showed the most significant weight gain, with a weight gain rate of 92.26%, which was much higher than the 35.12% of the blank control group.

[0081] discuss

[0082] The results of in vitro experiments on the inhibition of EHP spore germination by allicin showed that allicin inhibited EHP spore germination in a dose-dependent manner, and had a better inhibitory effect than eugenol (anthoxylum bungeanum oil).

[0083] In vivo feeding trials of garlic E showed that when the feed dosage was 400 mg / kg, feeding Litopenaeus vannamei significantly inhibited the content of EHP in the hepatopancreatic tissue of shrimp, and the weight gain rate of shrimp in this dosage group was significantly higher than that of the blank control group.

[0084] Example 7: Application Effect of Garlic E

[0085] Preliminary tests revealed that garlic E-in was effective in preventing *Enterocera hepatica* in shrimp. Therefore, the company recommended the use of this drug to the shrimp farming base of Taijiang County Shengsheng Fishery Technology Co., Ltd., and donated some of the drug for experimental testing. The company used the donated drug in its shrimp farming operations in the second half of 2023, and the farming process went very smoothly. No *Enterocera hepatica* was detected in the shrimp during the farming process, indicating that garlic E-in of this invention has a very good preventive effect against *Enterocera hepatica* in shrimp.

[0086] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A use of garlic E, characterized in that, Feed composition for preparing in shrimp to inhibit hepatopanosus of shrimp; wherein, the garlic E element has the structure shown in the following formula:

2. Use according to claim 1, characterized in that, The feed composition is used to treat or improve diseases or symptoms caused by enterocytozoon infection in shrimp.

3. Use according to claim 1, characterized in that, In the feed composition, the amount of garlic E is 50-2000 mg / kg of feed.

4. The use according to claim 1, characterized in that, In the feed composition, the amount of garlic E is 300-500 mg / kg of feed.

5. The use according to claim 1, characterized in that, The feed composition described herein is used to prevent and treat hepatopancreatic tissue lesions in shrimp.

6. The use according to claim 1, characterized in that, The feed composition described herein is used to improve necrosis of the hepatopancreatic tissue in shrimp.

7. The use according to claim 1, characterized in that, The feed composition described herein is used to reduce shrimp mortality due to enterocytozoon infection.

8. A shrimp feed composition, characterized by, The feed composition includes garlic E.

9. The composition of claim 8, wherein, The feed composition contains 50-2000 mg / kg of allicin.

10. The composition of claim 8, wherein In the feed composition, the amount of garlic E is 300-500 mg / kg of feed.

Images