Osteogenic growth peptides for use in cancer treatment
Engineered immune cells with a CAR specific to tumor antigens and OGP activate CB2 to inhibit colon cancer progression and multiple myeloma, enhancing CAR T-cell therapy efficacy by suppressing immunosuppressive cells and tumor growth.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- RAMOT AT TEL AVIV UNIVERSITY LTD
- Filing Date
- 2025-09-30
- Publication Date
- 2026-04-23
AI Technical Summary
There is a long-lasting need for novel and efficient drugs to treat cancer, particularly in addressing the immunosuppressive tumor microenvironment that impairs the effectiveness of CAR T-cell therapy and the development of osteolytic lesions in bone metastases, as well as the progression and initiation of colon cancer.
A pharmaceutical composition comprising immune cells engineered to express a chimeric antigen receptor (CAR) specific to a tumor antigen and an active Osteogenic Growth Peptide (OGP) with the amino acid sequence YGFGG, which activates cannabinoid receptor 2 (CB2) to inhibit tumor growth and suppress immunosuppressive myeloid-derived suppressor cells.
The combination of CAR-expressing immune cells and OGP achieves significant tumor elimination and attenuates adenoma growth by decreasing pro-tumor immune cells and their cytokines, providing a synergistic anticancer effect.
Smart Images

Figure IMGF000051_0001 
Figure IMGF000065_0001 
Figure 00000071_0000
Abstract
Description
OSTEOGENIC GROWTH PEPTIDES FOR USE IN CANCER TREATMENTFIELD OF THE INVENTION
[0001] The present invention relates to methods of treatment cancer using osteogenic growth peptides either alone or in combination with adoptive cell therapy.BACKGROUND OF THE INVENTION
[0002] Colon cancer is one of the most prevalent malignancies and remains a significant cause of cancer-related mortality. Chronic inflammation of the inner lining of the intestine is a major risk factor for colon carcinogenesis. An emerging therapeutic target is the endocannabinoid system, comprising endogenous lipids, enzymes, and receptors, including cannabinoid receptor 2 (CB2). CB2 has been shown to play a role in various biological processes, including immune response, pain modulation, and, notably, tumorigenesis. It was previously shown that lack of endogenous CB2 activation ameliorates colorectal cancer (CRC) and non-melanoma skin cancer.
[0003] Osteogenic Growth Peptide (OGP), an endogenous peptide with pleiotropic effects, including bone formation and anti-inflammatory action, has recently been identified as a CB2 selective agonist. OGP(1-14) is a 14-amino acid peptide that is present in the nano-micromolar range in human serum, and is a well-established bone anabolic agent. It is complexed to a2- macroglobulin, and after dissociation, is proteolytically cleaved into the pentapeptide OGP (10- 14), hereafter referred to as OGP. Pertinently, OGP has also been shown to regulate myelopoiesis in mouse models of myeloid suppression. WO 2023 / 026280 describes pharmaceutical compositions comprising OGP and methods for its use in accelerating bone repair and growth and attenuating inflammation-induced osteolysis.
[0004] US Patent No. 6,479,460 discloses compositions comprising synthetic pseudopeptide derivatives of osteogenic growth peptide (OGP) and OGP(10-14), and their use in stimulating the formation of osteoblastic or fibroblastic cells, enhancing bone formation in osteopenic pathological conditions, repairing fractures, healing wounds, grafting of intraosseous implants, reversing bone loss in osteoporosis and other conditions requiring enhanced bone cells formation.
[0005] Myeloid-derived suppressor cells (MDSCs) play a critical role in the immune microenvironment of CRC. These immature myeloid cells contribute to tumor immune evasion and progression by suppressing T cell responses. MDSC activity is known to be regulated by interleukin-4 (IL-4) and interleukin-6 (IL-6). IL-6 is pro-inflammatory cytokine involved invarious cellular processes, including immune responses and tumor progression. In colon cancer, IL-4 and IL-6 promote tumor growth and metastasis. They contribute to the expansion, survival, and suppressive function of MDSCs. There are evidences that CB2 activation downregulates IL-6 expression and suppresses MDSC activity in mouse models of CRC.
[0006] The ApcMin / +mouse model, a valuable genetic model for studying hereditary colon cancer as it presents in humans, have been widely used to study the tumorigenic effects of MDSCs. These mice carry a mutation in the tumor-suppressor gene, Adenomatous polyposis coli (APC), which predisposes them to spontaneous development of multiple intestinal adenomas. Furthermore, these mice develop severe macrocytic anemia accompanied by splenomegaly due to ineffective erythropoiesis, wherein the typical differentiation of erythroid precursors is blocked in early stages. In addition to hematologic disorders, this model is particularly useful for studying multiple phases of cancer development as juvenile ApcMin / +mice do not have adenomas: there is a five-week delay in adenoma development during which a sufficient amount of intestinal cells accumulate the mutation. The formation of adenomas from week five to eight is exponential, after which the adenomas continue to form, although at a much slower rate, with substantial growth in size from week eight to twelve.
[0007] Cannabinoid (CB) receptors (CB1 and CB2) are expressed on cancer cells and their expression influences carcinogenesis in various tumor entities. Cells of the tumor microenvironment (TME) also express CB receptors, however, their role in tumor development is still unclear and there are contradicting evidences for CB receptor on the development of cancer (Ladin, D. A., et al., Preclinical and Clinical Assessment of Cannabinoids as Anti-Cancer Agents. Front Pharmacol, 2016. 7: p. 361; 13. Schwarz, R., R. Ramer, and B. Hinz, Targeting the endocannabinoid system as a potential anticancer approach. Drug Metab Rev, 2018. 50(1): p. 26-53; Martinez-Martinez, E., et al., CB2 cannabinoid receptor activation promotes colon cancer progression via AKT / GSK3beta signaling pathway. Oncotarget, 2016. 7(42): p. 68781- 68791.)
[0008] Chimeric Antigen Receptor T-cell (CAR-T) therapy has already revolutionized the medical approach to blood cancers, with research underway to treat solid tumors. In 2019 there were only 2 FDA regulatory approvals for CAR-T cell therapies versus 21 expected in 2024 (https: / / www.statista.com / statistics). Multiple myeloma (MM) is a plasma cell malignancy affecting the bones, characterized by osteolytic lesions, bone loss and bone fractures resulting from skeletal weakening. CD38 is expressed at high levels on almost all MM cells and serves as a specific marker together with CD138. CAR T cells targeting multiple myeloma antigens, such as CD 19, CD38, CD 138, SLAMF7, and the dual CAR for CD138-CD38 are also beingexplored. Although some subsets of patients have sustained responses for more than 1 year, most patients eventually relapse, which might be related to an immunosuppressive tumor microenvironment (TME) that impairs the activity of T cells.
[0009] CAR-T therapy is also considered effective against breast cancer (BCa). Bone is a primary target for BCa metastases, and the local immunosuppressive microenvironment is also a major obstacle for anti-cancer therapies. BCa-related bone metastases and cancer treatments are also associated with osteolytic lesions, reduced bone mass and increased risk of fractures.
[0010] It was previously shown that CB2 knockout in mice resulted in the development of spontaneous pre-cancerous lesions (The Anti-Tumorigenic Role of Cannabinoid Receptor 2 in Non-Melanoma Skin Cancer. Int J Mol Sci. 2023 Apr 24;24(9):7773. doi: 10.3390 / ijms24097773. PMID: 37175480; Iden et al. The Anti-Tumorigenic Role of Cannabinoid Receptor 2 in Colon Cancer: A Study in Mice and Humans. Int J Mol Sci. 2023 Feb 17;24(4):4060. doi: 10.3390 / ijms24044060. PMID: 36835468). It was also found that an increased number of large tumors in the colon of azoxymethane (AOM) and dextran sulfate sodium (DSS)-treated CB2 / _mice (versus WT) and of APCimn / +CB2' / ' (versus APCmin / +CB2+ / +) (Iden et al. The Anti-Tumorigenic Role of Cannabinoid Receptor 2 in Colon Cancer: A Study in Mice and Humans. Int J Mol Sci. 2023 Feb (Iden et al. The Anti-Tumorigenic Role of Cannabinoid Receptor 2 in Colon Cancer: A Study in Mice and Humans. Int J Mol Sci. 2023 Feb 17;24(4):407;24(4):4060. doi: 10.3390 / ijms24044060. PMID: 36835468)0. doi: 10.3390 / ijms24044060. PMID: 36835468).
[0011] There is a long-lasting need for development of novel and efficient drugs for treatment of cancer. Efforts to improve the effectiveness of CAR T-cell therapy are needed.SUMMARY OF THE INVENTION
[0012] The present invention is based on the observation that ApcMin / +mice receiving OGP during the progression phase displayed significantly fewer tumors in the large intestine, and significantly smaller tumors in the small intestine. During the initiation phase, OGP significantly attenuated adenomagenesis in both the small and large intestine of ApcMin / +mice. Additionally, OGP -treated mice exhibited increased splenic anti-tumor CD8+ T cells, diminished populations of immunosuppressive and tumor-promoting myeloid-derived suppressor cells, and decreased serum levels of IL-6 and IL-4. Taken together, the results suggest that CB2 activation via OGP attenuates adenoma growth in the progression phase and suppresses tumorigenesis during the initiation phase by decreasing pro-tumor immune cells and their promoting cytokines. Further it was demonstrated that co administration of OGP with anti-CD138 CAR T cells provided a significant and even synergistic elimination of multiple myeloma tumor of treated mice.
[0013] According to one aspect, the present invention provides a population of immune cells engineered to express (i) a chimeric antigen receptor (CAR) binding specifically to a tumor associated antigen and (ii) an active Osteogenic Growth Peptide (OGP) comprising the amino acid sequence YGFGG set forth in SEQ ID NO: 1 and consisting of from 5 to 120 amino acids. In some examples, the immune cells comprise a nucleic acid construct comprising a nucleic acid sequence encoding the CAR and a nucleic acid construct comprising a nucleic acid sequence encoding the active OGP. In some examples, the nucleic acid molecule encoding the CAR is operably linked to a constitutive promoter and the nucleic acid molecule encoding the active OGP is operably linked to (i) an inducible promoter configured to initiate the expression of the active OGP upon activation of the CAR; or (ii) a constitutive promoter. In some examples, the OGP is operably linked to an inducible promoter that initiates the expression of said OGP upon activation of a T cell receptor. In some examples the immune cells express the active OGP peptide upon activation of the CAR. In some examples, the nucleic acid molecule encoding the active OGP is operably linked to a constitutive promoter and the immune cells express the CAR and the active OGP peptide constitutively. In some examples, the nucleic acid construct comprising a nucleic acid molecule comprising a nucleic acid sequence encoding the CAR and a nucleic acid sequence encoding the active OGP, wherein said nucleic acid molecule is operably linked to a constitutive promoter. In some examples, the nucleic acid construct comprises a nucleic acid sequence selected from SEQ ID NOs: 20, 21, 22 and 23.
[0014] According to another aspect, the present invention provides a pharmaceutical composition comprising the population of immune cells as described in any one of the examples and embodiments of the invention, and a pharmaceutically acceptable carrier.
[0015] According to another aspect, the present invention provides a pharmaceutical composition comprising (i) a population of immune cells engineered to express a chimeric antigen receptor (CAR) binding specifically to a tumor associated antigen, (ii) an active OGP peptide comprising the amino acid sequence YGFGG set forth as SEQ ID NO: 1 and consisting of from 5 to 120 amino acids, and (iii) a pharmaceutically acceptable carrier.
[0016] In some examples, the pharmaceutical composition of the above examples is for use in treating cancer.
[0017] According to another aspect, the present invention provides a therapeutic combination comprising (i) a population of engineered immune cells engineered to express a chimeric antigen receptor (CAR) that binds specifically to a tumor associated antigen and (ii) an activeOGP peptide comprising the amino acid sequence YGFGG set forth as SEQ ID NO: 1 and consisting of from 5 to 120 amino acids. In some examples, the therapeutic combination is for use in treating cancer. In some examples, the immune cells are characterized by a surface expression of the CAR. In some examples, the use comprises co-administering the engineered immune cells and the active OGP in a regimen selected from a sequential administering or a substantially simultaneous administering.
[0018] According to a further aspect, the present invention provides A kit comprising (i) a population of engineered immune cells engineered to express a chimeric antigen receptor (CAR) that binds specifically to a tumor associated antigen, (ii) an active OGP peptide comprising the amino acid sequence YGFGG set forth as SEQ ID NO: 1 and consisting of from 5 to 120 amino acids, and (iii) instruction for use of said kit. In some examples, the kit is for use in treating cancer. In some examples, the immune cells are characterized by a surface expression of the CAR. In some examples, the use comprises co-administering the engineered immune cells and the active OGP in a regimen selected from a sequential administering or a substantially simultaneous administering.
[0019] According to another aspect, the present invention provides pharmaceutical composition comprising an active Osteogenic Growth Peptide (OGP), for use in treating cancer, wherein the active OGP comprises the amino acid sequence YGFGG set forth as SEQ ID NO: 1 and consists of from 5 to 120 amino acids. In some examples, the use comprises coadministration of the pharmaceutical composition and an additional anti-cancer agent. In some examples, the additional anti-cancer agent comprises a population of T cells engineered to express a chimeric antigen receptor binding specifically to a tumor associated antigen (CAR T cells).
[0020] According to any one of the above examples, (i) the active OGP comprises or consists of an amino acid sequence selected from YGFGG (SEQ ID NO: 1) and ALKRQGRTL YGFGG (SEQ ID NO: 2), (ii) the active OGP consists of from 5 to 20 amino acids, and / or (iii) the cancer expresses cannabinoid receptor 2 (CB2).
[0021] According to any one of the above examples referring to use, the cancer is selected from a colon cancer, multiple myeloma, breast cancer, ovarian cancer, blood cancer, non-melanoma skin cancer, squamous cell carcinoma, and (SCC) and basal cell carcinoma (BCC). In some examples, the use comprises inhibition of the progression and / or prevention of the initiation of the cancer. In some examples, the cancer is a colon cancer. In some examples, use comprises inhibition of adenomas formation and growth. In some examples, the cancer is multiple myeloma. In some examples, the cancer is breast cancer multiple myeloma. In some examples,the use provides a long-term treatment. In some examples, the use provides a synergistic anticancer effect.
[0022] According to any one of the examples of the present invention, the CAR binds specifically to a tumor associated antigen selected from HER2 / Erbb2, CD 138, CD38, CD 19, CD276, EGFR, GCC19, GUCY2C or CD 166. In some examples, the (i) the CAR binds specifically to CD138 and comprises an amino acid sequence selected from SEQ ID NO: 61 and a combination of SEQ ID NOs: 62 and 63. In some examples, the or (ii) CAR binds specifically to HER2 and comprises an amino acid sequence selected from SEQ ID NO: 34, and a combination of SEQ ID NOs: 35 and 36.
[0023] According to another aspect, the present invention provides a nucleic acid construct comprising a nucleic acid molecule comprising a nucleic acid sequence encoding a CAR that binds specifically to a tumor associated antigen and a nucleic acid sequence encoding an active OGP peptide comprising the amino acid sequence YGFGG set forth as SEQ ID NO: 1 and consisting of from 5 to 120 amino acids, wherein each one of the nucleic acid sequences is operably linked to a promoter or both nucleic acid sequences are operably linked to one promoter. In some examples, both nucleic acid sequences are operably linked to one constitutive promoter. In some examples, the nucleic acid molecule comprises a cleavable nucleic acid sequence or a nucleic acid sequence encoding a self-cleaving peptide between the two nucleic acid sequences.
[0024] In some examples, the nucleic acid sequence encoding the CAR is operably linked to a constitutive promoter and the nucleic acid sequence encoding the active OGP is operably linked to (i) an inducible promoter, said promoter initiates the expression of OGP upon activation of the CAR; or (ii) a constitutive promoter. In some examples, (i) the CAR binds specifically to a tumor associated antigen selected from ErbB2, CD 19, CD38, CD 138, EGFR, CD276, CD24, GD2, EGF, BCMA, MUC-1, FAP, Mesothelin (MSLN), MUC16, GCC19, GUCY2C or CD 166. In some examples, the CAR binds specifically to CD138 and comprises the nucleic acid sequences selected from SEQ ID NO: 20, 21, SEQ ID NOs: 24 and 25, SEQ ID NO: 24, 26, 27, 59, 60 and 71. In some examples, the CAR binds specifically to HER2 and comprises the nucleic acid sequences selected from SEQ ID NO: 22, 23, 29, 30, and 49, 50, 51.
[0025] According to another aspect, the present invention provides a vector comprising the nucleic acid construct as defined in any one of the above examples.
[0026] According to another aspect, the present invention provides a cell comprising the construct as defined in any one of the above examples. In some examples, the cells is a T cell.
[0027] According to another aspect, the present invention provides a method of treating cancer in a subject in need thereof comprising co-administering to the subject a therapeutic combination of (i) engineered immune cells and (ii) an active OGP peptide comprising the amino acid sequence YGFGG set forth in SEQ ID NO: 1, optionally consisting of from 5 to 120 amino acids, wherein the immune cells are engineered to express a chimeric antigen receptor (CAR) that binds specifically to a tumor associated antigen.
[0028] According to another aspect, the present invention provides a method of treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of immune cells engineered to express (i) a chimeric antigen receptor (CAR) that binds specifically to a tumor associated antigen, and (ii) an active OGP peptide comprising the amino acid sequence YGFGG set forth in SEQ ID NO: 1 and consisting of from 5 to 120 amino acids.
[0029] According to another aspect, the present invention provides a method of treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount an active OGP peptide comprising the amino acid sequence YGFGG set forth in SEQ ID NO: 1 and consisting of from 5 to 120 amino acids.BRIEF DESCRIPTION OF DRAWINGS
[0030] Figs. 1A-1J shows the effect of one weekly OGP administration (IP) in naive WT mice on myelopoiesis and lymphopoiesis. Fig. 1A shows body weight expressed as percent (%) initial of weight recorded on day of first injection (day 0), two-way ANOVA, p=0.4889. Fig. IB shows spleen weight. Figs. 1C-1I Relative frequency of the spleen (SP, Figs. 1C-1F) and bone marrow (BM, Figs. 1G-1I) populations of CDl lb+and subpopulations of immature myeloid cells (CD1 lb+Ly6GhlLy6Cintand CD1 lb+Ly6G'Ly6Chl), macrophages (M , CD1 lb+F480+), dendritic cells (DC, CD1 lbhlCDl lchl), CD3+(referred to as ‘CD3’), CD3+CD4+(referred to as ‘CD4’), and CD3+CD8+(referred to as ‘CD8’) T cells (Figs. IE and II), and the CD4:CD8 ratio (Fig. IF and 1 J). Indicated values are expressed as percent of the parent population, as determined by flow cytometry analysis. VEH, n=8; OGP (700 ng / week), n=8. Student’ s t-test, * p < 0.05 and ** p < 0.01.
[0031] Fig. 2 shows the effect of OGP administration in naive WT mice. It can be seen that the administration does not affect IL-6 and IL-4 serum levels. Serum was analysed by ELISA. Vehicle control (VEH), n=8; OGP (700 ng / week), n=8. Student’s Ltest
[0032] Fig. 3A-3F shows that OGP attenuates adenoma formation and growth during the progression phase in ApcMin / +mice. Fig. 3A shows body weight expressed as percent (%) initial body weight on the day of the first injection, two-way ANOVA, p=0.8389. Fig. 3B showsspleen weight. Fig. 3C shows length of large intestine. Fig. 3D shows count and size distribution of adenomas in SI. Fig. 3E shows gross adenomas in the large intestine (LI), each measuring 2-4 mm. Fig. 3F shows the quantitative analysis of fecal occult blood one week before sacrifice. Vehicle control (VEH), n=6; OGP 700 ng / week, n=6, OGP 100 ng / day, n=7. One-way ANOVA or Kruskal-Wallis test vs VEH, * p < 0.05 and ** p < 0.01.
[0033] Fig. 4 shows the effect of OGP administration on IL-6 and IL-4 serum levels in ApcMin / +mice during the progression phase. IL-6 and IL-4 levels in the serum were determined by ELISA technique. Vehicle control (VEH), n=6; OGP 700 ng / week, n=6, OGP 100 ng / day, n=7. One-way ANOVA vs VEH.
[0034] Fig. 5 shows the effect of OGP on hemoglobin (Hb) in wildtype male and female mice. Starting at 12 weeks of age, mice were injected weekly with 700 ng OGP for one month or three months. Vehicle control (VEH), n= 10. OGP (700 ng / week), n=10. Student’s t test. * p<0.05 vs. VEH.
[0035] Figs. 6A-6F shows that OGP attenuates adenomagenesis during the initiation phase in ApcMin / +mice. Fig. 6A shows body weight expressed as percent (%) initial body weight on the day of the first injection, two-way ANOVA, p=0.067. Fig. 6B shows spleen weight. Fig. 6C shows Length of large intestine (LI). Fig. 6D shows gross adenomas in the small intestine (SI). Fig. 6E shows gross adenomas in the large intestine (LI) each measuring 2-4 mm. Fig. 6F shows a quantitative analysis of fecal occult blood on the day of sacrifice. Vehicle control (VEH), n=8; OGP 700 ng / week, n=12. Student’ s t-test or Mann Whitney U test, * p < 0.05.
[0036] Fig. 7A and 7B shows the effect of OGP on hemoglobin (Hb) and erythroblasts in ApcMin / +mice during the initiation phase. Mice were injected weekly with 700 ng OGP for eight weeks, starting at eight weeks of age: Fig. 7A - Hemoglobin (Hb) levels; Fig. 7B - relative frequency of erythroblasts (Terl l9+), Teri 19hlCD71hlFSChl(EryA), Teri 19hlCD71hlFSC10(EryB), and (Teri 19hlCD7110FSC10(EryC). Vehicle control (VEH), n>7; OGP 700 ng / week, n >7. Student’ s t-test.
[0037] Fig. 8A-8D show that OGP prevents splenic MDSC accumulation during the initiation phase in ApcMin / +mice. Fig. 8A- relative frequency of myeloid cells, polymorphonuclear and monocytic MDSCs (PMN- and M-MDSC), eosinophils (Eos), and dendritic cells (DC). Fig. 8B - relative frequency of T cells: CD3+, CD3+CD4+, and CD3+CD8+; Fig. 8C- CD4:CD8 ratio Fig. 8D IL-6 and IL-4 levels in the serum. Flow cytometry values are expressed as number of events / 50k cells or percent parent as indicated. Vehicle control (VEH), n=8; OGP 700 ng / week, n=9. Student’s / -test, * p < 0.05.
[0038] Fig 9A shows a Manhattan plot of p-values for rare variants in the exomic region of CNR2 (build GRCh38). The dotted black line represents significance threshold of p<0.05.
[0039] Fig 9B shows gene-based burden test of rare variants of CNR2, tumor suppressor genes linked to anal polyps (APC and MSH2 and CNR1 for putative loss of function mutations (pLOF) and putative loss of function deleterious missense mutations (DM) at the indicated allele frequencies.
[0040] Figs. 10A and 10B show association of common and rare variants of CNR2 with monocyte count. Fig. 10A shows a Manhattan plot of p values in the exomic region of CNR2 (build GRCh37) showing common variants (red, MAF>1%) and rare variants (blue, MAF < 1%). Q63R variants are indicated with a black arrow. Fig. 10A shows a gene-based burden test of rare variants of CNR2, genes associated with monocyte proliferation (CSF1R and FLT3), and CNR1 for putative loss of function mutations (pLOF) and putative loss of function deleterious missense mutations (DM) at the indicated allele frequencies.
[0041] Fig. 11A and 11B show the effect of OGP in mice colon cancer model - AOM / DSS- treated mice (chemical -induced colon cancer). Fig. 11A - body weight loss in OGP -treated mice, and Fig. 11B - number of polyps in the large intestine were significantly lower. *p < 0.05 vs VEH (2 -way ANOVA & t-test, respectively).
[0042] Fig. 12 shows images of six Balb / c mice aged ~8 weeks i.v. injected with 4*106CD138.MOPC.BM.Luc cells (multiple myeloma cancer cells), followed by the i.v. injection of 10* 106mouse T cells transduced with anti-CD138 CAR (‘treated’) or a non-relevant CAR (‘not-treated’). Mice were imaged at different time points as indicated on the right.
[0043] Fig. 13 shows a construct of T cells comprising a construct encoding for anti-CD138 CAR and a construct in which the sequence encoding OGP peptide is under inducible promoter allowing production of OGP upon activation of the CAR-T cells.
[0044] Fig. 14 shows images of Balb / c mice injected with 4*106CD138.MOPC.BM.Luc cells and treated with a co-administering of anti-CD138 CAR T cells and OGP compared to controls.
[0045] Fig. 15A and 15B show the average tumor volumes of each treated group of mice. Results are shown up to the day when the first mouse was sacrificed. (Fig. 15A) Dorsal imaging of mice. (Fig. 15B) Ventral imaging of mice. Shown are mean values ± SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. No treatment group, two-way ANOVA.
[0046] Fig. 16 shows median survival curves of in vivo experiment of multiple myeloma mouse model.DETAILED DESCRIPTION OF THE INVENTION
[0047] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. In case of conflict, the patent specification, including definitions, will control.
[0048] Compositions comprising OGP for treating cancer
[0049] The present invention is based in part on the unexpected observation that Osteogenic Growth Peptide (OGP) is capable of perverting and inhibiting the development of colon cancer. Without being limited to any particular theory it may be assumed that the beneficial therapeutic activity of the OGP is mediated, inter alia, is via a cannabinoid receptor 2 (CB2), more specifically via activation of CB2 receptor, optionally on the immune cells. According to one aspect, the present invention provides a pharmaceutical composition comprising an active Osteogenic Growth Peptide (OGP), for use in treating cancer, wherein the active OGP comprises the amino acid sequence YGFGG (SEQ ID NO: 1). According to some embodiments, the active OGP consists of from 5 to 120 amino acids. According to some embodiments, the active OGP consists of from 5 to 100 amino acids. According to some embodiments, the active OGP consists of from 5 to 80 amino acids. According to some embodiments, the active OGP consists of from 5 to 60 amino acids. According to some embodiments, the active OGP consists of from 5 to 40 amino acids. According to some embodiments, the active OGP consists of from 5 to 30 amino acids. According to some embodiments, the active OGP consists of from 5 to 20 amino acids. According to some embodiments, the cancerous tissue expresses cannabinoid receptor 2 (CB2). According to some embodiments, the present invention provides a pharmaceutical composition comprising an active OGP, for use in treating cancer, wherein the active OGP comprises the amino acid sequence YGFGG (SEQ ID NO: 1) and consists of from 5 to 120 amino acids and wherein the cancer expresses cannabinoid receptor 2 (CB2). According to some embodiments, the present invention provides a pharmaceutical composition comprising an active OGP, for use in treating cancer, wherein the active OGP comprises the amino acid sequence YGFGG and consists of from 5 to 40 amino acids, optionally wherein the cancer expresses cannabinoid receptor 2 (CB2). According to some embodiments, the present invention provides a pharmaceutical composition comprising an active OGP, for use in treating cancer, wherein the active OGP comprises the amino acid sequence YGFGG and consists of from 5 to 20 amino acids According to some embodiments, the present invention provides a pharmaceutical composition comprising an active OGP comprising the amino acid sequence YGFGG, for use in a method of treating cancer, wherein the active OGP peptide comprises the amino acid sequence YGFGG and consists of from 5 to 20 amino acids and wherein the cancer expressescannabinoid receptor 2 (CB2). According to some embodiments, the OGP comprises from 5 to 15 amino acids. According to some embodiments, the OGP comprises or consists of SEQ ID NO: 1 or 2.
[0050] In some embodiments, OGP may be modified by any known in the art method such as chemical modification, conjugated or cyclized. In some embodiments, NAP is acylated, acetylated, amidated, lapidated, stearylated, pegylated, biotinylated or modified by any other way. In some embodiments, some of the amino acid of OGP may be replaced by d-amino acids.
[0051] The term “pharmaceutical composition” as used herein refers to a composition comprising at least one active agent as disclosed herein, e.g. OGP, formulated together with one or more pharmaceutically acceptable carriers.
[0052] Formulation of the pharmaceutical composition may be adjusted according to applications. In particular, the pharmaceutical composition may be formulated using a method known in the art so as to provide rapid, continuous or delayed release of the active ingredient after administration to mammals. For example, the formulation may be any one selected from among plasters, granules, lotions, liniments, lemonades, aromatic waters, powders, syrups, ophthalmic ointments, liquids and solutions, aerosols, extracts, elixirs, ointments, fluidextracts, emulsions, suspensions, decoctions, infusions, ophthalmic solutions, tablets, suppositories, injections, spirits, capsules, creams, troches, tinctures, pastes, pills, and soft or hard gelatin capsules.
[0053] The composition for oral administration may be in a form of tablets, troches, lozenges, aqueous, or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs. Pharmaceutical compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and may further comprise one or more agents selected from sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active agent in admixture with non-toxic pharmaceutically acceptable excipients, which are suitable for the manufacture of tablets. These excipients may be, e.g., inert diluents such as calcium carbonate, sodium carbonate, lactose, calcium phosphate, or sodium phosphate; granulating and disintegrating agents, e.g., corn starch or alginic acid; binders; and lubricating agents. The tablets are preferably coated utilizing known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide an extended release of the drug over a longer period.
[0054] The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" as used herein refers to any and all solvents, dispersion media, preservatives,antioxidants, coatings, isotonic and absorption delaying agents, surfactants, fillers, disintegrants, binders, diluents, lubricants, glidants, pH adjusting agents, buffering agents, enhancers, wetting agents, solubilizing agents, surfactants, antioxidants the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The compositions may contain other active compounds providing supplemental, additional, or enhanced therapeutic functions, solid carriers or excipients such as, for example, lactose, starch or talcum or liquid carriers such as, for example, water, fatty oils or liquid paraffins.
[0055] Other carriers or excipients which may be used include, but are not limited to, materials derived from animal or vegetable proteins, such as the gelatins, dextrins and soy, wheat and psyllium seed proteins; gums such as acacia, guar, agar, and xanthan; polysaccharides; alginates; carboxymethylcelluloses; carrageenans; dextrans; pectins; synthetic polymers such as polyvinylpyrrolidone; polypeptide / protein or polysaccharide complexes such as gelatinacacia complexes; sugars such as mannitol, dextrose, galactose and trehalose; cyclic sugars such as cyclodextrin; inorganic salts such as sodium phosphate, sodium chloride and aluminium silicates; and amino acids having from 2 to 12 carbon atoms and derivatives thereof such as, but not limited to, glycine, L-alanine, L-aspartic acid, L-glutamic acid, L-hydroxyproline, L- isoleucine, L-leucine and L-phenylalanine. Each possibility represents a separate embodiment of the present invention.
[0056] Solutions or suspensions used for parenteral, intradermal, or subcutaneous application typically include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol (or other synthetic solvents), antibacterial agents (e.g., benzyl alcohol, methyl parabens), antioxidants (e.g., ascorbic acid, sodium bisulfite), chelating agents (e.g., ethylenediaminetetraacetic acid), buffers (e.g., acetates, citrates, phosphates), and agents that adjust tonicity (e.g., sodium chloride, dextrose). The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide, for example. The parenteral preparation can be enclosed in ampules, disposable syringes or multiple dose glass or plastic vials.
[0057] Pharmaceutical compositions adapted for parenteral administration include, but are not limited to, aqueous and non-aqueous sterile injectable solutions or suspensions, which can contain antioxidants, buffers, bacteriostats and solutes that render the compositions substantially isotonic with the blood of an intended recipient. Such compositions can also comprise water, alcohols, polyols, glycerine and vegetable oils, for example. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules and tablets.Such compositions preferably comprise a therapeutically effective amount of a compound of the invention and / or other therapeutic agent(s), together with a suitable amount of carrier so as to provide the form for proper administration to the subject.
[0058] The composition of the present invention may be administered by any known method. The term "administering” or “administration of’ a substance, a compound or an agent to a subject can be carried out using one of a variety of methods known to those skilled in the art. For example, a compound or an agent can be administered, intravenously, arterially, intradermally, intramuscularly, intraperitoneally, intravenously, subcutaneously, ocularly, sublingually, inhalation, orally (by ingestion), intranasally, intraspinally, intracerebrally, and transdermally (by absorption, e.g., through a skin duct). A compound or agent can also appropriately be introduced by rechargeable or biodegradable polymeric devices or other devices, e.g., patches and pumps, or formulations, which provide for the extended, slow or controlled release of the compound or agent. Administering can also be performed, for example, once, a plurality of times, and / or over one or more extended periods. According to some embodiments, the composition is administered 1, 2, 3, 4, 5 or 6 times a day. According to other embodiments, the composition is administered 1, 2, 3, 4, 5 or 6 times a month. In some embodiments, the administration includes both direct administration, including selfadministration, and indirect administration, including the act of prescribing a drug. For example, as used herein, a physician who instructs a patient to self-administer a drug, or to have the drug administered by another and / or who provides a patient with a prescription for a drug is administering the drug to the patient. According to some embodiments, the pharmaceutical composition comprising OGP is administered parenterally. According to some embodiments, the pharmaceutical composition comprising OGP is administered IV. According to some embodiments, the pharmaceutical composition comprising OGP is administered intranasally.
[0059] The terms "peptide" and “polypeptide” may be used herein interchangeably. The terms refer to a short chain of amino acid residues linked by peptide bonds, i.e., a covalent bond formed between the carboxyl group of one amino acid and an amino group of an adjacent amino acid. The term “peptide” refers to short sequences having up to 50 amino acids. A chain of amino acids monomers longer than 50 amino acid is referred as a “polypeptide”.
[0060] The terms "Osteogenic Growth Peptide", "OGP", "active OGP" and "OGP peptide" are used herein interchangeable and refer collectively to peptides comprising the amino acid sequence YGFGG (SEQ ID NO: 1) and consisting of up to 120 amino acids and having pleiotropic effects, including bone formation and anti-inflammatory action. OGP peptide is an active form of the peptide. According to some embodiments, the OGP peptide is a CB2 agonist.According to some embodiments, the OGP consists of up to 20 amino acids. According to some embodiments, the OGP consists of up to 100, up to 80, up to 60, up to 40 or up to 20 amino acids. According to some embodiments, the OGP consists of from 5 to 100, from 5 to 80, from 5 to 60, from 5 to 40 or from 5to 20 amino acids. According to some embodiments, the OGP consists of up to 15 amino acids. According to additional embodiments, the peptide is of 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 amino acid residues in length. According to some embodiments, the peptide is 5-11 amino acid residues in length. According to some embodiments, the active OGP is 5-10 amino acid residues in length. According to specific embodiment, the active OGP is a pentapeptide consisting of the amino acid sequence YGFGG (referred also as 5aa-OGP). According to other embodiments, the active OGP consists of the amino acid sequence ALKRQGRTL YGFGG (SEQ ID NO: 2), referred also as OGP(1-14). According to some embodiments, the peptide is a synthetic peptide as described in US Patent No. 6,479,460 which content is incorporated herein by reference.
[0061] According to some embodiments, the OGP comprises or consists of the amino acid sequence YGFGG. According to some embodiments, the OGP comprises or consists of the amino acid sequence ALKRQGRTL YGFGG. According to some embodiments, the OGP is encoded by a nucleic acid sequence SEQ ID NO: 6. According to some embodiments, the OGP is encoded by a nucleic acid sequence SEQ ID NO: 7. According to some embodiments, the OGP is encoded by a nucleic acid sequence SEQ ID NO: 8. According to some embodiments, the OGP is encoded by a nucleic acid sequence SEQ ID NO: 9. According to some embodiments, the sequences of SEQ ID NO: 8 or 9 may by further modified e.g. such that the translation of the peptide starts at start codon at position 85. In some embodiments, the OGP is encoded by a variant of a nucleic acid sequence SEQ ID NO: 8 or 9, such as a conservative variant encoding to the same amino acid as SEQ ID NO: 8 or 9.
[0062] The term “treating” a condition or patient refers to taking steps to obtain beneficial or desired results, including clinical results. Beneficial or desired clinical results include, but are not limited to, ameliorating, abrogating, substantially inhibiting, slowing, or reversing the progression of a disease, condition or disorder, substantially ameliorating or alleviating clinical or esthetical symptoms of a condition, substantially preventing the appearance of clinical or esthetical symptoms of a disease, condition, or disorder, and protecting from harmful or annoying symptoms. Treating further refers to accomplishing one or more of the following: (a) reducing the severity of the disorder; (b) limiting the development of symptoms characteristic of the disorder(s) being treated; (c) limiting worsening of symptoms characteristic of the disorder(s) being treated; (d) limiting recurrence of the disorder(s) in patients that havepreviously had the disorder(s); and / or (e) limiting recurrence of symptoms in patients that were previously asymptomatic for the disorder(s).
[0063] The term “treating cancer” as used herein should be understood to e.g. encompass treatment resulting in a decrease in tumor size; a decrease in the rate of tumor growth; stasis of tumor size; a decrease in the number of metastasis; a decrease in the number of additional metastasis; a decrease in the invasiveness of the cancer; a decrease in the rate of progression of the tumor from one stage to the next; inhibition of tumor growth in a tissue of a mammal having a malignant cancer; control of establishment of metastases; inhibition of tumor metastases formation; regression of established tumors as well as a decrease in the angiogenesis induced by the cancer, inhibition of growth and proliferation of cancer cells and so forth. The term “treating cancer” as used herein should also be understood to encompass prophylaxis such as prevention as cancer reoccurs after previous treatment (including surgical removal) and prevention of cancer in an individual prone (genetically, due to lifestyle, chronic inflammation and so forth) to develop cancer.
[0064] The term comprises preventing or inhibiting the development of metastasis or treating tumor metastasis comprises increasing the duration of survival or increasing the progression free survival or increasing the duration of response of a subject having cancer; or preventing tumor recurrence.
[0065] According to some embodiments, treating comprises inhibiting the progression of cancer. According to other embodiments, treating comprises preventing appearance of cancer or inhibiting the onset of the cancer.
[0066] The term “cancer” comprises cancerous diseases or a tumor being treated or prevented that is selected from the group comprising, but not limited to, mammary carcinomas, melanoma, skin neoplasms, lymphoma, leukemia, gastrointestinal tumors, including colon carcinomas, stomach carcinomas, pancreas carcinomas, colon cancer, small intestine cancer, ovarian carcinomas, cervical carcinomas, lung cancer, prostate cancer, kidney cell carcinomas and / or liver metastases.
[0067] According to some embodiments, cancer, i.e. cancer cells express cannabinoid receptor 2. According to some embodiments, cancer is a solid cancer. According to some embodiments, cancer is a liquid cancer, i.e. blood cancer. According to some embodiments, the cancer is selected from colon cancer, breast cancer, blood cancer, non-melanoma skin cancer, squamous cell carcinoma, (SCC) and basal cell carcinoma (BCC).
[0068] According to some embodiments, the cancer is a colon cancer. According to some embodiments, the treating comprises inhibiting the formation of adenomas. According to someembodiments, the treating comprises inhibiting the growth of adenomas. According to some embodiments, the cancer is not a metastasis phase of cancer into bones.
[0069] One of the well-known drawbacks of cancer treatment is a relapse of the cancer in certain cases, such as with treatment involved CAR T cells treatment. The treatment using OGP allows long term treatment without relapses. Therefore, according to some embodiments, the use of the present invention provides a long-term treatment.
[0070] According to some embodiments, the cancer is a HER2 -positive cancer, i.e. comprises cancer cells which have higher than normal levels of HER2.
[0071] According to any one of the above embodiments, the use comprises a long-term treatment.
[0072] Composition comprising OGP co-administered with CAR T cells for treating cancer
[0073] According to some embodiments, the use comprises co-administration of the pharmaceutical composition comprising the OGP and an additional anti-cancer agent.
[0074] The term “co-administration” encompasses administration of a first and second agent in an essentially simultaneous manner, such as in a single dosage form, e.g., a capsule, tablet or a solution for injection having a fixed ratio of first and second amounts, or in separate (multiple) dosage forms. The agents can be administered sequentially in either order. When coadministration involves the separate administration of each agent, the agents are administered sufficiently close in time to have the desired effect (e.g., complex formation).
[0075] The term “anti -cancer”, “anti -neoplastic” and “anti-tumor” when referred to a compound, an agent or a moiety are used herein interchangeably and refer to a compound, drug, antagonist, inhibitor, or modulator such as immunomodulatory having anticancer properties or the ability to inhibit or prevent the growth, function or proliferation of and / or causing destruction of cells,” and in particular tumor cells. Therapeutic agents suitable in an anti- neoplastic composition for treating cancer include, but not limited to, chemotherapeutic agents, radioactive isotopes, toxins, cytokines such as interferons, immunostimulating agents, immunomodulating agents and antagonistic agents targeting cytokines, cytokine receptors or antigens associated with tumor cells. In some embodiments, an anti-cancer agent is a chemotherapeutic. The term "chemotherapeutic agent" refers to a chemical compound useful in the treatment of cancer.
[0076] According to some embodiments, the additional anti-cancer agent is an adoptive cell therapy.
[0077] The term "adoptive cell therapy" is intended to refer to any therapy that involves the transfer / administration of cells into a subject, preferably a human. The cells may be autologousor allogeneic. The cells are commonly derived from the immune system with the goal of improving immune functionality. Adoptive cell therapy may include, but is not limited to, CAR-T cell therapy (chimeric antigen receptor T-cell), TIL therapy (tumor infiltrating lymphocytes) and iPSC-derived therapy (induced pluripotent stem cells).
[0078] According to some embodiments, the adoptive cell therapy comprises T cells comprising a chimeric antigen receptor binding specifically to a tumor associated antigen (CAR T-cells) treatment. Thus, according to some embodiments, the use comprises co-administering a pharmaceutical composition comprising the OGP and CAR T-cells. According to some embodiments, the OGP and CAR T cells may be administered in any way. According to some embodiments, the use comprises co-administering a pharmaceutical composition comprising CAR T cells and a pharmaceutical composition comprising the active OGP peptide.
[0079] The terms "chimeric antigen receptor" and "CAR" are used herein interchangeably and refer to engineered recombinant polypeptides or receptors which are grafted onto cells and comprising at least (1) an extracellular domain comprising an antigen-binding region, e.g., a single chain variable fragment of an antibody or a whole antibody, (2) a transmembrane domain to anchor the CAR into a cell, and (3) one or more cytoplasmic signaling domains (also referred to herein as “an intracellular signaling domains”). The extracellular domain comprises an antigen binding domain (ABD) and optionally a spacer or hinge region. The antigen binding domain of the CAR targets a specific antigen. The targeting regions may comprise full length heavy chain, Fab fragments, or single chain variable fragment (scFv). The antigen binding domain can be derived from the same species or a different species for or in which the CAR will be used in. In one embodiment, the antigen binding domain is scFv.
[0080] The extracellular spacer or hinge region of a CAR is located between the antigen binding domain and a transmembrane domain. Extracellular spacer domains may include, but are not limited to, Fc fragments of antibodies or fragments or derivatives thereof, hinge regions of antibodies or fragments or derivatives thereof, constant domains such as CH2 region or CH3 region of antibodies, accessory proteins, artificial spacer sequences or combinations thereof.
[0081] The term "transmembrane domain" refers to the region of the CAR, which crosses or bridges the plasma membrane. The transmembrane domain of the CAR of the invention is the transmembrane region of a transmembrane protein, an artificial hydrophobic sequence or a combination thereof.
[0082] The term “intracellular domain” refers to the intracellular part of the CAR and may be an intracellular domain of T cell receptor or of any other receptor (e.g., TNFR superfamily member) or portion thereof, such as an intracellular activation domain (e.g., an immunoreceptortyrosine-based activation motif (ITAM)-containing T cell activating motif), an intracellular costimulatory domain, or both.
[0083] According to some embodiments, the CAR comprises a leading peptide. The term “leader peptide”, “leading peptide”, “lead peptide”, “signaling peptide” and “signal peptide” are used herein interchangeably and refer to a peptide that translocates or prompts translocation of the target protein to cellular membrane.
[0084] The term “antigen binding portion”, “antigen binding region” and ’’antigen binding domain” are used herein interchangeably and refer to one or more fragments of an antibody that retain the ability to specifically bind to an antigen. It has been shown that the antigen binding function of an antibody can be performed by fragments of a full-length antibody. Such antibody embodiments may also be bispecific, dual specific, or multi-specific formats; specifically binding to two or more different antigens. Examples of binding fragments encompassed within the term “antigen binding portion” of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb, which comprises a single variable domain; and (vi) an isolated complementarity determining region (CDR). Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules known as single chain Fv (scFv). Such single chain antibodies are also intended to be encompassed within the term “antigen binding portion” of an antibody. In certain embodiments of the invention, scFv molecules are incorporated into a fusion protein. Other forms of single chain antibodies, such as diabodies are also encompassed. Diabodies are bivalent, bispecific antibodies in which VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow for pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain and creating two antigen binding sites.
[0085] The term "variable region" as used herein refers to a region of an antibody heavy chain or light chain that is involved in the binding of an antibody to an antigen, "heavy chain variable region" being used interchangeably with "VH", "HCVR", and "light chain variable region" being used interchangeably with "VL", "LCVR". The variable domains (VH and VL, respectively) of the heavy and light chains of the native antibody generally have similarstructures, each domain comprising four conserved framework regions (FR) and three hypervariable regions (HVR). Each one of the VH and VL domains comprise 3 CDRs.
[0086] As used herein, the term “CDR” refers to the complementarity determining region within antibody variable sequences. There are three CDRs in each of the variable regions of the heavy chain (HC) and the light chain (LC), which are designated CDR1, CDR2 and CDR3 (or specifically HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3), for each of the variable regions. The term “CDR set” as used herein refers to a group of three CDRs that occur in a single variable region capable of binding the antigen. The exact boundaries of these CDRs have been defined differently according to different systems. The system described by Kabat (Kabat et al., Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987) and (1991)) not only provides an unambiguous residue numbering system applicable to any variable region of an antibody, but also provides precise residue boundaries defining the three CDRs. These CDRs may be referred to as Kabat CDRs. Chothia and coworkers (Chothia & Lesk, J. Mol. Biol. 196:901-917 (1987) and Chothia et al., Nature 342:877-883 (1989)) found that certain sub-portions within Kabat CDRs adopt nearly identical peptide backbone conformations, despite having great diversity at the level of amino acid sequence. These sub-portions were designated as LI, L2 and L3 or Hl, H2 and H3 where the “L” and the “H” designate the light chain and the heavy chains regions, respectively. These regions may be referred to as Chothia CDRs, which have boundaries that overlap with Kabat CDRs. Other boundaries defining CDRs overlapping with the Kabat CDRs have been described by Padlan (FASEB J. 9: 133-139 (1995)) and MacCallum (J Mol Biol 262(5):732-45 (1996)). Still other CDR boundary definitions may not strictly follow one of the above systems, but will nonetheless overlap with the Kabat CDRs, although they may be shortened or lengthened in light of prediction or experimental findings that particular residues or groups of residues or even entire CDRs do not significantly impact antigen binding. The methods used herein may utilize CDRs defined according to any of these systems, although preferred embodiments use Kabat or Chothia defined CDRs.
[0087] There are several methods known in the art for determining the CDR sequences of a given antibody molecule, but there is no standard unequivocal method. Determination of CDR sequences from antibody heavy and light chain variable regions can be made according to any method known in the art, including but not limited to the methods known as KABAT, Chothia and IMGT. A selected set of CDRs may include sequences identified by more than one method, namely, some CDR sequences may be determined using KABAT and some using IMGT, for example. According to some embodiments, the CDR sequences are determined using the IMGTmethod. According to some embodiments, the CDRs are as determined according to the Kabat (Wu T.T and Kabat E.A., J Exp Med, 1970; 132:211-50) and IMGT (Lefranc M-P, et al., Dev Comp Immunol, 2003, 27:55-77). According to some embodiments, the CDR sequences are determined using Chothia method.
[0088] The terms "binds specifically" or "specific for" with respect to an antigen-binding domain of an antibody, of a fragment thereof or of a CAR refers to an antigen-binding domain which recognizes and binds to a specific antigen, but does not substantially recognize or bind other molecules in a sample. The term encompasses that the antigen-binding domain binds to its antigen with high affinity and binds other antigens with low affinity. An antigen-binding domain that binds specifically to an antigen from one species may bind also to that antigen from another species. This cross-species reactivity is not contrary to the definition of that antigenbinding domain as specific. An antigen-binding domain that specifically binds to an antigen may bind also to different allelic forms of the antigen (allelic variants, splice variants, isoforms etc.). This cross reactivity is not contrary to the definition of that antigen-binding domain as specific.
[0089] The term "peptide linker" relates to any peptide capable of connecting two variable domains with its length depending on the kinds of variable domains to be connected.
[0090] In one embodiment of the invention, the CAR includes a transmembrane domain that comprises a transmembrane domain of a protein selected from the group consisting of the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 and CD154. In one embodiment of the invention, the CAR comprises a costimulatory domain, e.g., a costimulatory domain comprising a functional signaling domain of a protein selected from the group consisting of 0X40, CD2, CD27, CD28, CD5, ICAM-1, LFA-1 (CD1 la / CD18), ICOS (CD278), and 4-1BB (CD137). In certain embodiments of the invention, the CAR comprises an scFv comprising the CDR or variable regions described herein e.g., CDRs or variable regions from an antibody, a transmembrane domain, a costimulatory domain (e.g., a functional signaling domain from CD28 or 4-1BB), and a signaling domain comprising a functional signaling domain from CD3 (e.g., CD3-zeta).
[0091] The term “tumor antigen” as used herein includes both tumor associated antigens (TAAs) and tumor specific antigens (TSAs). A tumor-associated antigen means an antigen that is expressed on the surface of a tumor cell in higher amounts than is observed on normal cells or an antigen that is expressed on normal cells during fetal development. A “tumor specific antigen” is an antigen that is unique to tumor cells and is not expressed on normal cells.The term tumor antigen includes TAAs or TSAs that have been already identified and those that have yet to be identified, and includes fragments, epitopes and any and all modifications to the tumor antigens.
[0092] The term “tumor-associated antigen” as used herein refers to any antigen which is found in significantly higher concentrations in or on tumor cells than on normal cells
[0093] According to some embodiments, the tumor associated antigen is selected from AFP, ALK, B7H3, BAGE protein, BCMA, BIRC5, BIRC7, P-catenin, -8 brc-abl, BRCA1, BORIS, CA9, CA125, carbonic anhydrase IX, caspase 1, CALR, CCR5, CD19, CD20, CD22, CD24, CD30, CD33, CD38, CD40, CD123, CD133, CD138, CD276, CDK4, CEA, Claudin 18.2, cyclin -Bl, CYP1B1, EGFR, EGFRvIII, ErbB2 / Her2, ErbB3, ErbB4, ETV6-AML, EpCAM, EphA2, Fra-1, FOLR1, GAGE, GD2, GD3, GloboH, phosphatidylinositol proteoglycan -3, GM3, gplOO, Her2, HLA / B-raf-kinases, HLA / k-ras, HLA / MAGE-A3, hTERT, IL13R a2. LMP2 k -Light, LewisY, MAGE, MART-1, Mesothelin, ML-IAP, MOv-, y, Mucl, Muc2, Muc3, Muc4, Muc5, CA-125, MUM1, NA17, NKG2D, NY-BR1, NY-BR62, NY-BR85, NY- ESO1, 0X40, pl 5, p53, PAP, PAX3, PAX5, PCTA-1, PLAC1, PRLR, PRAME, PSMA, RAGE protein, Ras, RGS5, Rho, ROR1, SART-1, SART-3, STEAP1, STEAP2, TAG-72, TGF -P, TMPRSS2, soup-antigen, TRP-1, TRP-2, tyrosinase, urea soluble protein -3 and 5T4. According to some embodiments, the tumor associated antigen selected from HER2 / Erbb2, CD 138, CD38, CD 19, CD276, EGFR, GCC19, GUCY2C or CD 166 and the CAR binds specifically to said TAA.
[0094] The term “T cell” as used herein refers to as a thymus-derived lymphocyte that participates in a variety of cell-mediated immune reactions, as well known in art. The term “T cell” refers to a type of white blood cell that can be distinguished from other white blood cells by the presence of a T cell receptor on the cell surface. There are several subsets of T cells, including, but not limited to, T helper cells (a.k.a. Tx cells or CD4+T cells) and subtypes, including THI, TH2, TH3, TH17, TH9, and TFH cells, cytotoxic T cells (i.e., Tc cells, CD8+T cells, cytotoxic T lymphocytes, T-killer cells, killer T cells), memory T cells and subtypes, including central memory T cells (TCM cells), effector memory T cells (TEMand TEMRA cells), and resident memory T cells (TRM cells), regulatory T cells (a.k.a. Tregcells or suppressor T cells) and subtypes, including CD4+FOXP3+Tregcells, CD4+FOXP3“ Tregcells, Tri cells, Th3 cells, and Treg17 cells, natural killer T cells (a.k.a. NKT cells), mucosal associated invariant T cells (MAITs), and gamma delta T cells (y5 T cells), including Vy9 / V52 T cells. Any one or more of the aforementioned or unmentioned T cells may be the target cell type for a method ofuse of the invention. According to any one of the above embodiments, the T cell is selected from a CD4+ T-cell and a CD8+ T-cell.
[0095] According to some embodiments, the CAR binds specifically to a tumor associated antigen selected from HER2 / Erbb2, CD 138, CD38, CD 19, CD276, EGFR, GCC19, GUCY2C or CD 166. According to some embodiments, the CAR binds specifically to HER2. According to some embodiments, the CAR binds specifically to CD138. According to some embodiments, the CAR binds specifically to CD38. According to some embodiments, the CAR binds specifically to GCC19. According to some embodiments, the CAR binds specifically to GUCY2C. According to some embodiments, the CAR binds specifically to CD 166. The terms "HER2" and Erbb2" are used herein interchangeably.
[0096] According to some embodiments, the T cell comprises two or more different CARs, i.e. CARs that bind to different TAA. According to some embodiments, the T cell comprises two or more different CARs, wherein one of the CARs comprises an activation domain and is devoid of a costimulatory domain and the other CAR comprises a costimulatory domain and is devoid of an activation domain. According to some embodiments, the T cells comprising two or more cares are as described in WO 2019111249 which content is entirely incorporated herein by reference.
[0097] According to some embodiments, the CAR comprises elements such as VL domain, VL domain, CDRs, transmembrane domain, stimulatory domain, activation domain, leading peptide etc.
[0098] According to some embodiments, the present invention provides a pharmaceutical composition comprising an active Osteogenic Growth Peptide (OGP) as described in any one of the above embodiments, for use in treating breast cancer or ovarian cancer, wherein the use comprises co-administering the OGP with CAR T cells wherein the CAR bind specifically to HER2 (anti-HER2 CAR T cells). According to some embodiments, the OGP comprises or consists of an amino acid sequence selected from SEQ ID NO: 1 and 2. According to some embodiment, the anti-HER2 CAR has 6 CDRs as defined by IMGT method comprising the amino acid sequences as follows: VL-CDR1 having the amino acid sequence SEQ ID NO: 37, VL-CDR2 having the amino acid SAS, VL-CDR3 having the amino acid sequence SEQ ID NO: 39, VH-CDR1 having the amino acid sequence SEQ ID NO: 40, VH-CDR2 having the amino acid sequence SEQ ID NO: 41, and VH-CDR3 having the amino acid sequence SEQ ID NO: 42. According to some embodiments, the anti-HER2 CAR has 6 CDRs as defined by KABAT method as follows: VL-CDR1-3 having the amino acid sequences SEQ ID NO: 43- 45, respectively, and VH-CDR1-3 having the amino acid sequences SEQ ID NO: 46-48,respectively. According to some embodiment, the anti-HER2 CAR comprises an amino acid sequence selected from SEQ ID NO: 35 and SEQ ID NO: 36 or both SEQ ID NO: 35 and 36. According to some embodiment, the anti-HER2 CAR comprises an amino acid sequence selected from SEQ ID NO: 34. According to some embodiments, the present invention provides a pharmaceutical composition comprising an active OGP comprising or consisting of an amino acid sequence SEQ ID NO: 1 or 2, for use in treating breast cancer, ovarian cancer or adenoma, wherein the use comprises co-administering the OGP with anti-HER2 CAR T cells, wherein the CAR comprises an amino acid selected from SEQ ID NO: 34, and a combination of SEQ ID NO: 35 and 36. According to some embodiments, the CAR comprises an amino acid being an analog, such as conservative analog of the amino acid sequence selected from SEQ ID NO: 34, and a combination of SEQ ID NO: 35 and 36. According to some embodiments, the CAR is encoded by a nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NO: 29, 30, 49, and 50. According to some embodiments, the CAR is encoded by a variant, such as a conservative variant of the nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NO: 29, 30, 49, and 50.
[0099] As used here, the amino acid sequences encompass also analogues of these sequences. The terms "peptide", "polypeptide" and "protein" encompass also the analogs of these peptides, polypeptide and protein. The term "analog”, “analog” and “sequence analog” are used herein interchangeably and refer to an analog of a peptide, polypeptide or protein having at least 70% sequence identity with the original peptide, wherein the analog retains the activity of the original peptide. Thus, the terms “analog” and “active analog” may be used interchangeably. The term “analog” refers to a peptide, polypeptide or protein which contains substitutions, rearrangements, deletions, additions and / or chemical modifications in the amino acid sequence of the parent peptide. According to some embodiments, the peptide analog has at least 80%, at least 90% or at least 95% sequence identity to the original peptide. According to one embodiment, the analog has about 70% to about 95%, about 80% to about 90% or about 85% to about 95% sequence identity to the original peptide. According to some embodiments, the analog of the present invention comprises the sequence of the original peptide in which 1, 2, 3, 4, or 5 substitutions were made. The substitutions of the amino acids may be conservative or non-conservative substitution. The non-conservative substitution encompasses substitution of one amino acid by any other amino acid. In one particular embodiment, the amino acid is substituted by a non-natural amino acid.
[0100] The term “conservative substitution” as used herein denotes the replacement of an amino acid residue by another, without altering the overall conformation and biological activityof the peptide, including, but not limited to, replacement of an amino acid with one having similar properties (such as, for example, polarity, hydrogen bonding potential, acidic, basic, shape, hydrophobic, aromatic, and the like). Amino acids with similar properties are well known in the art. For example, according to one table known in the art, the following six groups each contain amino acids that are conservative substitutions for one another: (1) Alanine (A), Serine (S), Threonine (T); (2) Aspartic acid (D), Glutamic acid (E); (3) Asparagine (N), Glutamine (Q); (4) Arginine (R), Lysine (K); (5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and (6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).
[0101] When referring to CAR or to an antigen binding domain, no amendment or modification is made to the CDRs.
[0102] According to some embodiments, the present invention provides a pharmaceutical composition comprising an active Osteogenic Growth Peptide (OGP) as described in any one of the above embodiments, for use in treating multiple myeloma, wherein the use comprises coadministering CAR T cells wherein the CAR bind specifically to CD138 (anti-CD138 CAR). According to some embodiments, the OGP comprises or consists of an amino acid sequence selected from SEQ ID NO: 1 and 2. According to some embodiment, the anti-CD138 CAR has 6 CDRs as defined by KABAT method comprising the amino acid sequences as follows: VL- CDR1 having the amino acid sequence SEQ ID NO: 64, VL-CDR2 having the amino acid YTS, VL-CDR3 having the amino acid sequence SEQ ID NO: 66, VH-CDR1 having the amino acid sequence SEQ ID NO: 67, VH-CDR2 having the amino acid sequence SEQ ID NO: 68, and VH-CDR3 having the amino acid sequence SEQ ID NO: 69. According to some embodiment, the anti-CD138 CAR comprises an amino acid sequence selected from SEQ ID NO: 62, SEQ ID NO: 63 and a combination of SEQ ID NO: 62 and 63. According to some embodiment, the anti-CD138 CAR comprises an amino acid sequence SEQ ID NO: 61. According to some embodiments, the present invention provides a pharmaceutical composition comprising an active OGP comprising or consisting of an amino acid sequence SEQ ID NO: 1 or 2, for use in treating multiple myeloma, wherein the use comprises co-administering the OGP with anti- CD138 CAR T cells, wherein the CAR comprises an amino acid selected from SEQ ID NO: 61, and a combination of SEQ ID NO: 62 and 63. According to some embodiments, the CAR comprises an amino acid being an analog, such as conservative analog of the amino acid sequence selected from SEQ ID NO: 61, and a combination of SEQ ID NO: 62 and 63. According to some embodiments, the anti-CD138 CAR is encoded by a nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NO: 24, 25, 26, 27, 28, 58, 59, and 60. According to some embodiments, the CAR is encoded by a variant, such as a conservativevariant of the nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NO: 24, 25, 26, 27, 28, 58, 59, and 60. According to some embodiments, the present invention provides a pharmaceutical composition comprising an active Osteogenic Growth Peptide (OGP) as described in any one of the above embodiments, for use in treating multiple myeloma, wherein the use comprises co-administering CAR T cells wherein the CAR bind specifically to CD38 (anti-CD38 CAR). According to some embodiments, the OGP comprises or consists of an amino acid sequence selected from SEQ ID NO: 1 and 2. According to some embodiment, the anti-CD38 CAR has 6 CDRs as defined by KABAT method comprising the amino acid sequences as follows: VL-CDR1 having the amino acid sequence SEQ ID NO: 83, VL-CDR2 having the amino acid DAS, VL-CDR3 having the amino acid sequence SEQ ID NO: 85, VH- CDR1 having the amino acid sequence SEQ ID NO: 86, VH-CDR2 having the amino acid sequence SEQ ID NO: 87, and VH-CDR3 having the amino acid sequence SEQ ID NO: 88. According to some embodiment, the anti-CD138 CAR comprises an amino acid sequence selected from SEQ ID NO: 79 and SEQ ID NO: 80. According to some embodiment, the anti- CD38 CAR comprises an amino acid sequence selected from SEQ ID NO: 81. According to some embodiments, the present invention provides a pharmaceutical composition comprising an active OGP comprising or consisting of an amino acid sequence SEQ ID NO: 1 or 2, for use in treating multiple myeloma, wherein the use comprises co-administering the OGP with anti- CD38 CAR T cells, wherein the CAR comprises an amino acid selected from SEQ ID NO: 81, and a combination of SEQ ID NO: 79 and 80. According to some embodiments, the CAR comprises an amino acid being an analog, such as conservative analog of the amino acid sequence selected from SEQ ID NO: 81, and a combination of SEQ ID NO: 79 and 80. According to some embodiments, the anti-CD38 CAR is encoded by a nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NO: 89, 90, 91 and 92. According to some embodiments, the CAR is encoded by a variant, such as a conservative variant of the nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NO: 89, 90, 91 and 92.
[0103] According to some embodiments, the present invention provides a pharmaceutical composition comprising an active Osteogenic Growth Peptide (OGP) as described in any one of the above embodiments, for use in treating hematologic malignancies like certain leukemias and lymphomas, wherein the use comprises co-administering CAR T cells wherein the CAR bind specifically to CD 19. According to some embodiments, the OGP comprises or consists of an amino acid sequence selected from SEQ ID NO: 1 and 2. According to some embodiment, the anti-CD19 CAR has 6 CDRs as defined by IMGT method comprising the amino acidsequences as follows: VL-CDR1 having the amino acid sequence SEQ ID NO: 93, VL-CDR2 having the amino acid sequence HTS, VL-CDR3 having the amino acid sequence SEQ ID NO: 95, VH-CDR1 having the amino acid sequence SEQ ID NO: 96, VH-CDR2 having the amino acid sequence SEQ ID NO: 97, and VH-CDR3 having the amino acid sequence SEQ ID NO: 98. According to some embodiment, the anti-CD19 CAR has 6 CDRs as defined by KABAT method comprising the amino acid sequences as follows: VL-CDR1 having the amino acid sequence SEQ ID NO: 99, VL-CDR2 having the amino acid sequence SEQ ID NO: 100, VL- CDR3 having the amino acid sequence SEQ ID NO: 101, VH-CDR1 having the amino acid sequence SEQ ID NO: 102, VH-CDR2 having the amino acid sequence SEQ ID NO: 103, and VH-CDR3 having the amino acid sequence SEQ ID NO: 104. According to some embodiment, the anti-CD19 CAR comprises an amino acid sequence selected from SEQ ID NO: 54 and SEQ ID NO: 55. According to some embodiment, the anti-CD19 CAR comprises an amino acid sequence selected from SEQ ID NO: 52, 53, and 56. According to some embodiments, the CAR comprises an amino acid being an analog, such as conservative analog of the amino acid sequence selected from SEQ ID NO: 34, and a combination of SEQ ID NO: 52, 53, and 56. According to some embodiments, the present invention provides a pharmaceutical composition comprising an active OGP comprising or consisting of an amino acid sequence SEQ ID NO: 1 or 2, for use in treating multiple myeloma, wherein the use comprises co-administering the OGP with anti-CD38 CAR T cells, wherein the CAR comprises an amino acid selected from SEQ ID NO: 52, 53, 56, and a combination of SEQ ID NO: 54 and 55. According to some embodiments, the CAR comprises an amino acid being an analog, such as conservative analog of the amino acid sequence selected from SEQ ID NO: 52, 53, 56, and a combination of SEQ ID NO: 54 and 55. According to some embodiments, the anti-CD38 CAR is encoded by a nucleic molecule comprising a nucleic acid sequence SEQ ID NO: 57. According to some embodiments, the CAR is encoded by a variant, such as a conservative variant of the nucleic molecule comprising a nucleic acid sequence SEQ ID NO: 57.
[0104] According to some embodiments, the present invention provides a pharmaceutical composition comprising an active Osteogenic Growth Peptide (OGP) as described in any one of the above embodiments, for use in treating solid tumors, such as in pancreatic cancer, esophageal cancer, and breast cancer, wherein the use comprises co-administering CAR T cells wherein the CAR bind specifically to CD276. According to some embodiments, the OGP comprises or consists of an amino acid sequence selected from SEQ ID NO: 1 and 2. According to some embodiment, the anti-CD276 CAR comprises an amino acid sequence selected from SEQ ID NO: 72 and 73. According to some embodiments, the present invention provides apharmaceutical composition comprising an active OGP comprising or consisting of an amino acid sequence SEQ ID NO: 1 or 2, for use in treating solid tumors, such as in pancreatic cancer, esophageal cancer, and breast cancer, wherein the use comprises co-administering the OGP with anti-CD276 CAR T cells, wherein the anti CD276 CAR comprises an amino acid selected from SEQ ID NO: 72 and 73. According to some embodiments, the CAR comprises an amino acid being an analog, such as conservative analog of the amino acid sequence selected from SEQ ID NO: 72 and 73. According to some embodiments, the anti-CD276 CAR is encoded by a nucleic molecule comprising a nucleic acid sequence SEQ ID NO: 74, 75 and 76. According to some embodiments, the CAR is encoded by a variant, such as a conservative variant of the nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NO: 74, 75 and 76.
[0105] According to some embodiments, the present invention provides a pharmaceutical composition comprising an active Osteogenic Growth Peptide (OGP) as described in any one of the above embodiments, for use in treating cancer associated with EGFR such as non-small cell lung, breast, endometrial, colorectal, head and neck, ovarian, cervical, and gastric cancer, wherein the use comprises co-administering CAR T cells wherein the CAR bind specifically to EGFR. According to some embodiments, the OGP comprises or consists of an amino acid sequence selected from SEQ ID NO: 1 and 2. According to some embodiment, the anti-EGFR CAR comprises an amino acid sequence SEQ ID NO: 77. According to some embodiments, the present invention provides a pharmaceutical composition comprising an active OGP comprising or consisting of an amino acid sequence SEQ ID NO: 1 or 2, for use in treating associated with EGFR such as non-small cell lung, breast, endometrial, colorectal, head and neck, ovarian, cervical, and gastric cancer, wherein the use comprises co-administering the OGP with anti-EGFR CAR T cells, wherein the anti-EGFR CAR comprises the amino acid sequence SEQ ID NO: 77. According to some embodiments, the CAR comprises an amino acid being an analog, such as conservative analog of the amino acid sequence SEQ ID NO: 77. According to some embodiments, the anti-CD38 CAR is encoded by a nucleic molecule comprising a nucleic acid sequence SEQ ID NO: 78. According to some embodiments, the CAR is encoded by a variant, such as a conservative variant of the nucleic molecule comprising a nucleic acid SEQ ID NO: 78.
[0106] According to some embodiments, OGP reduces the immunosuppressive effect of tumor microenvironment. According to some embodiments, OGP enhances the CAR T cells treatment outcome. According to some embodiments, the co-administration of comprises / results is an enhanced activity of CAR T cells and / or wherein the OGP reduces the immunosuppressivetumor microenvironment. According to some embodiment, the treatment provides a long-term treatment. According to some embodiment, the treatment prevents relapse of cancer.
[0107] According to some embodiments, co-admini strati on of CAR T cells and active OGP provides a synergistic anti-cancer effect.
[0108] According to another aspect, the present invention provides a method of treating cancer in a person in need thereof, the method comprising administering to said person a therapeutically effective amount of active OGP, wherein the active OGP comprises the amino acid sequence YGFGG. According to some embodiments, the active OGP consists of from 5 to 20, from 5 to 40, from 5 to 60, from 5 to 80, from 5 to 100 or from 5 to 120 amino acids. All terms, embodiments and definitions disclosed in any one of the above aspects apply and are encompassed herein as well. According to some embodiments, the cancerous tissue expresses cannabinoid receptor 2. According to some embodiments, the treatment comprises inhibiting the growth of adenomas. According to some embodiments, the method further comprises administering an additional anti-cancer agent. According to some embodiments, the additional anti-cancer agent is an adoptive cell therapy such as chimeric antigen receptor (CAR) T cells. Thus, according to some embodiments, the present invention provides a method of treating cancer in a subject in need thereof comprising co-admini stering to the subject a therapeutic combination of (i) engineered immune cells and (ii) an active OGP peptide comprising the amino acid sequence YGFGG and consisting of from 5 to 20 amino acids, wherein the immune cells are engineered to express a chimeric antigen receptor (CAR) that binds specifically to a tumor associated antigen.
[0109] The term “therapeutically effective amount” of a drug or agent is an amount of a drug or an agent that, when administered to a subject will have the intended therapeutic effect, e.g. treating or preventing cancer. The full therapeutic effect does not necessarily occur by administration of one dose and may occur only after administration of a series of doses. Thus, a therapeutically effective amount may be administered in one or more administrations. The precise effective amount needed for a subject will depend upon, for example, the subject's size, health and age, the nature and extent of the cognitive impairment, and the therapeutics or combination of therapeutics selected for administration, and the mode of administration. The skilled person can readily determine the effective amount for a given situation by routine experimentation.
[0110] Pharmaceutical composition comprising OGP and CAR T cells and uses thereof[OHl] As described above, the use comprises co-admini stering administering CAR T cells and the active OGP. In some embodiments, the CAR T cells and the active OGP are formulated ina single pharmaceutical composition. Therefore, according to another aspect, the present invention provides a pharmaceutical composition comprising both the CAR T cells and the active OGP as described in any one of the above aspects and embodiments, and a pharmaceutically acceptable carrier. All terms, embodiments and definitions disclosed in any one of the above aspects apply and are encompassed herein as well.
[0112] According to some embodiments, the present invention provides a pharmaceutical composition comprising (i) a population of immune cells engineered to express a chimeric antigen receptor (CAR) binding specifically to a tumor associated antigen, (ii) an active OGP peptide comprising the amino acid sequence YGFGG, and (iii) a pharmaceutically acceptable carrier. According to some embodiments, the active OGP consists of from 5 to 20, from 5 to 40, from 5 to 60, from 5 to 80, from 5 to 100 or from 5 to 120 amino acids. All terms, embodiments and definitions disclosed in any one of the above aspects apply and are encompassed herein as well. According to some embodiments, the CAR binds specifically to a tumor associated antigen selected from HER2 / Erbb2, CD 138, CD38, CD 19, CD276, EGFR, GCC19, GUCY2C or CD 166. According to some embodiments, the CAR binds specifically to HER2. According to some embodiments, the CAR binds specifically to CD138. According to some embodiments, the CAR binds specifically to CD38. According to some embodiments, the CAR binds specifically to GCC19. According to some embodiments, the CAR binds specifically to GUCY2C. According to some embodiments, the CAR binds specifically to CD 166 According to some embodiments, the OGP comprises or consists of the amino acid sequence YGFGG. According to some embodiments, the OGP comprises or consists of the amino acid sequence ALKRQGRTL YGFGG. According to any one of the embodiments of the present invention, the OGP and / or the CAR comprises the amino acid sequence as defined in any one of the embodiments of the present invention and in the Sequence listing. According to some embodiments, such pharmaceutical composition is for use in treating cancer. According to some embodiments, the cancerous tissue expresses cannabinoid receptor 2 (CB2). According to some embodiments, the cancer is selected from colon cancer, multiple myeloma, breast cancer, blood cancer, non-melanoma skin cancer, squamous cell carcinoma, and (SCC) and basal cell carcinoma (BCC). It would be obvious to a person of ordinary skills that the type of cancer treated relates to the CAR as described in the embodiments of the present invention.
[0113] According to some embodiments, the OGP comprises or consists of the amino acid sequence YGFGG. According to some embodiments, the OGP comprises or consists of the amino acid sequence ALKRQGRTL YGFGG. According to some embodiments, the OGP isencoded by a nucleic acid sequence SEQ ID NO: 6. According to some embodiments, the OGP is encoded by a nucleic acid sequence SEQ ID NO: 7.
[0114] According to some embodiments, the tumor associated antigen is selected from AFP, ALK, B7H3, BAGE protein, BCMA, BIRC5, BIRC7, P-catenin, -8 brc-abl, BRCA1, BORIS, CA9, CA125, carbonic anhydrase IX, caspase 1, CALR, CCR5, CD19, CD20, CD22, CD24, CD30, CD33, CD38, CD40, CD123, CD133, CD138, CD276, CDK4, CEA, Claudin 18.2, cyclin -Bl, CYP1B1, EGFR, EGFRvIII, ErbB2 / Her2, ErbB3, ErbB4, ETV6-AML, EpCAM, EphA2, Fra-1, FOLR1, GAGE, GD2, GD3, GloboH, phosphatidylinositol proteoglycan -3, GM3, gplOO, Her2, HLA / B-raf-kinases, HLA / k-ras, HLA / MAGE-A3, hTERT, IL13R a2. LMP2 k -Light, LewisY, MAGE, MART-1, Mesothelin, ML-IAP, MOv-, y, Mucl, Muc2, Muc3, Muc4, Muc5, CA-125, MUM1, NA17, NKG2D, NY-BR1, NY-BR62, NY-BR85, NY- ESO1, 0X40, pl 5, p53, PAP, PAX3, PAX5, PCTA-1, PLAC1, PRLR, PRAME, PSMA, RAGE protein, Ras, RGS5, Rho, ROR1, SART-1, SART-3, STEAP1, STEAP2, TAG-72, TGF -P, TMPRSS2, soup-antigen, TRP-1, TRP-2, tyrosinase, urea soluble protein -3 and 5T4. According to some embodiments, the OGP comprises or consists of the amino acid sequence YGFGG. According to some embodiments, the OGP comprises or consists of the amino acid sequence ALKRQGRTL YGFGG. According to some embodiments, the OGP is encoded by a nucleic acid sequence SEQ ID NO: 6. According to some embodiments, the OGP is encoded by a nucleic acid sequence SEQ ID NO: 7 and the tumor associated antigen selected from HER2 / Erbb2, CD 138, CD38, CD 19, CD276, EGFR, GCC19, GUCY2C or CD 166 and the CAR binds specifically to said TAA.
[0115] According to some embodiments, the present invention provides a pharmaceutical composition comprising an active OGP as described in any one of the above embodiments and anti-HER2 CAR T cells. According to some embodiments, the OGP comprises or consists of an amino acid sequence selected from SEQ ID NO: 1 and 2. According to some embodiment, the anti-HER2 CAR has 6 CDRs as defined by IMGT method comprising the amino acid sequences as follows: VL-CDR1 having the amino acid sequence SEQ ID NO: 37, VL-CDR2 having the amino acid SAS, VL-CDR3 having the amino acid sequence SEQ ID NO: 39, VH- CDR1 having the amino acid sequence SEQ ID NO: 40, VH-CDR2 having the amino acid sequence SEQ ID NO: 41, and VH-CDR3 having the amino acid sequence SEQ ID NO: 42. According to some embodiment, the anti-HER2 CAR has 6 CDRs as defined by KABAT method as follows: VL-CDR1-3 having the amino acid sequences SEQ ID NO: 43-45, respectively, and VH-CDR1-3 having the amino acid sequences SEQ ID NO: 46-48, respectively. According to some embodiment, the anti-HER2 CAR comprises an amino acidsequence selected from SEQ ID NO: 35 and SEQ ID NO: 36. According to some embodiment, the anti-HER2 CAR comprises an amino acid sequence selected from SEQ ID NO: 34. According to some embodiments, the present invention provides a pharmaceutical composition comprising an active OGP comprising or consisting of an amino acid sequence SEQ ID NO: 1 or 2, and anti-HER2 CAR T cells, wherein the CAR comprises an amino acid selected from SEQ ID NO: 34, and a combination of SEQ ID NO: 35 and 36. According to some embodiments, the anti-HER2 CAR is encoded by a nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NO: 49, 50, 29 and 30. According to some embodiments, the CAR is encoded by a variant, such as a conservative variant of the nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NO: 49, 50, 29 and 30. According to some embodiments, the pharmaceutical composition is for use in treating breast cancer or ovarian cancer. According to some embodiments, the pharmaceutical composition is parenterally administered, e.g. by IV.
[0116] According to some embodiments, the present invention provides a pharmaceutical composition comprising an OGP as described in any one of the above embodiments, and anti- CD138 CAR T cells. According to some embodiments, the OGP comprises or consists of an amino acid sequence selected from SEQ ID NO: 1 and 2. According to some embodiment, the anti-CD138 CAR has 6 CDRs as defined by KABAT method comprising the amino acid sequences as follows: VL-CDR1 having the amino acid sequence SEQ ID NO: 64, VL-CDR2 having the amino acid YTS, VL-CDR3 having the amino acid sequence SEQ ID NO: 66, VH- CDR1 having the amino acid sequence SEQ ID NO: 67, VH-CDR2 having the amino acid sequence SEQ ID NO: 68, and VH-CDR3 having the amino acid sequence SEQ ID NO: 69. According to some embodiment, the anti-CD138 CAR comprises an amino acid sequence selected from SEQ ID NO: 62 and SEQ ID NO: 63. According to some embodiment, the anti- CD138 CAR comprises an amino acid sequence SEQ ID NO: 61. According to some embodiments, the present invention provides a pharmaceutical composition comprising an active OGP comprising or consisting of an amino acid sequence SEQ ID NO: 1 or 2 and anti- CD138 CAR T cells, wherein the anti-CD138 CAR comprises an amino acid selected from SEQ ID NO: 61, and a combination of SEQ ID NO: 62 and 63. According to some embodiments, the anti-CD138 CAR is encoded by a nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NO: 58, 59, 60, 24, 25, 26, 27 and 28. According to some embodiments, the CAR is encoded by a variant, such as a conservative variant of the nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NO: SEQ ID NO: 58, 59, 60, 24, 25, 26, 27 and 28. According to some embodiments, the pharmaceutical composition isfor use in treating multiple myeloma. According to some embodiments, the pharmaceutical composition is parenterally administered, e.g. by IV.
[0117] According to some embodiments, the present invention provides a pharmaceutical composition comprising an OGP as described in any one of the above embodiments, and anti- CD38 CAR T cells. According to some embodiments, the OGP comprises or consists of an amino acid sequence selected from SEQ ID NO: 1 and 2. According to some embodiment, the anti-CD38 CAR has 6 CDRs as defined by KABAT method comprising the amino acid sequences as follows: VL-CDR1 having the amino acid sequence SEQ ID NO: 83, VL-CDR2 having the amino acid DAS, VL-CDR3 having the amino acid sequence SEQ ID NO: 85, VH- CDR1 having the amino acid sequence SEQ ID NO: 86, VH-CDR2 having the amino acid sequence SEQ ID NO: 87, and VH-CDR3 having the amino acid sequence SEQ ID NO: 88. According to some embodiment, the anti-CD38 CAR comprises an amino acid sequence selected from SEQ ID NO: 79 and SEQ ID NO: 80. According to some embodiment, the anti- CD38 CAR comprises an amino acid sequence selected from SEQ ID NO: 81. According to some embodiments, the present invention provides a pharmaceutical composition comprising an active OGP comprising or consisting of an amino acid sequence SEQ ID NO: 1 or 2, and anti-CD38 CAR T cells, wherein the CAR comprises an amino acid selected from SEQ ID NO: 81, and a combination of SEQ ID NO: 79 and 80. According to some embodiments, the anti- CD38 CAR is encoded by a nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NO: 89, 90, 91 and 92. According to some embodiments, the CAR is encoded by a variant, such as a conservative variant of the nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NOs: 89, 90, 91 and 92. According to some embodiments, the pharmaceutical composition is for use in treating multiple myeloma. According to some embodiments, the pharmaceutical composition is parenterally administered, e.g. by IV.
[0118] According to some embodiments, the present invention provides a pharmaceutical composition comprising an OGP as described in any one of the above embodiments, and anti- CD19 CAR T cells. According to some embodiments, the OGP comprises or consists of an amino acid sequence selected from SEQ ID NO: 1 and 2. According to some embodiment, the anti-CD19 CAR has 6 CDRs as defined by IMGT method comprising the amino acid sequences as follows: VL-CDR1 having the amino acid sequence SEQ ID NO: 93, VL-CDR2 having the amino acid HTS, VL-CDR3 having the amino acid sequence SEQ ID NO: 95, VH-CDR1 having the amino acid sequence SEQ ID NO: 96, VH-CDR2 having the amino acid sequence SEQ ID NO: 97, and VH-CDR3 having the amino acid sequence SEQ ID NO: 98. According to some embodiment, the anti-CD19 CAR has 6 CDRs as defined by KABAT methodcomprising the amino acid sequences as follows: VL-CDR1 having the amino acid sequence SEQ ID NO: 99, VL-CDR2 having the amino acid sequence SEQ ID NO: 100, VL-CDR3 having the amino acid sequence SEQ ID NO: 101, VH-CDR1 having the amino acid sequence SEQ ID NO: 102, VH-CDR2 having the amino acid sequence SEQ ID NO: 103, and VH-CDR3 having the amino acid sequence SEQ ID NO: 104. According to some embodiment, the anti- CD19 CAR comprises an amino acid sequence selected from SEQ ID NO: 54 and SEQ ID NO: 55. According to some embodiment, the anti-CD19 CAR comprises an amino acid sequence selected from SEQ ID NO: 52, 53, and 56. According to some embodiments, the present invention provides a pharmaceutical composition comprising an active OGP comprising or consisting of an amino acid sequence SEQ ID NO: 1 or 2, and anti-CD19 CAR T cells, wherein the CAR comprises an amino acid selected from SEQ ID NO: 52, 53, 56, and a combination of SEQ ID NO: 54 and 55. According to some embodiments, the anti-CD19 CAR is encoded by a nucleic molecule comprising a nucleic acid sequence SEQ ID NO: 57. According to some embodiments, the CAR is encoded by a variant, such as a conservative variant of the nucleic molecule comprising a nucleic acid sequence SEQ ID NO: 57. According to some embodiments, the pharmaceutical composition is for use in treating for use in treating hematologic malignancies like certain leukemias and lymphomas. According to some embodiments, the pharmaceutical composition is parenterally administered, e.g. by IV.
[0119] According to some embodiments, the present invention provides a pharmaceutical composition comprising an OGP as described in any one of the above embodiments, and anti- CD276 CAR T cells as described in any one of the above aspects and embodiments. According to some embodiments, the OGP comprises or consists of an amino acid sequence selected from SEQ ID NO: 1 and 2. According to some embodiment, the anti-CD276 CAR comprises an amino acid sequence selected from SEQ ID NO: 72 and 73. According to some embodiments, the pharmaceutical composition for use in treating solid tumors, such as in pancreatic cancer, esophageal cancer, and breast cancer. According to some embodiments, the pharmaceutical composition is parenterally administered, e.g. by IV.
[0120] According to some embodiments, the present invention provides a pharmaceutical composition comprising an OGP as described in any one of the above embodiments, and anti- EGFR CAR T cells. According to some embodiments, the OGP comprises or consists of an amino acid sequence selected from SEQ ID NO: 1 and 2. According to some embodiment, the anti-EGFR CAR comprises an amino acid sequence SEQ ID NO: 77. According to some embodiments, the pharmaceutical composition for use in treating cancer associated with EGFR such as non-small cell lung, breast, endometrial, colorectal, head and neck, ovarian, cervical,and gastric cancer. According to some embodiments, the pharmaceutical composition is parenterally administered, e.g. by IV.
[0121] According to another aspect, the present invention provides a method of treating cancer in a person in need thereof, the method comprising administering to said person a therapeutically effective amount of active OGP and CAR T cells, wherein the active OGP comprises the amino acid sequence YGFGG. According to some embodiments, the present invention provides a method of treating cancer in a person in need thereof, the method comprising administering to said person a pharmaceutical composition comprising an active OGP and CAR T cells.
[0122] Nucleic acid construct encoding CAR and OGP
[0123] According to yet another aspect, the present invention provides a nucleic acid molecule comprising a nucleic acid sequence encoding a CAR that binds specifically to a tumor associated antigen and a nucleic acid sequence encoding an active OGP comprising the amino acid sequence YGFGG. All terms, embodiments and definitions disclosed in any one of the above aspects apply and are encompassed herein as well. According to some embodiments, the CAR and the OGP as described in any one of the above aspects and embodiments. According to some embodiments, the present invention further provides a nucleic acid construct comprising a nucleic acid sequence encoding a CAR that binds specifically to a tumor associated antigen and a nucleic acid sequence encoding an active OGP comprising the amino acid sequence YGFGG. The present invention provides a nucleic acid construct in which each one of the nucleic acid molecules, i.e. a nucleic acid sequence encoding a CAR and a nucleic acid sequence encoding an active OGP, is operably linked to a promoter. According to other embodiments, both nucleic acid molecules, i.e. a nucleic acid sequence encoding a CAR and a nucleic acid sequence encoding an active OGP, are operably linked to one promoter.
[0124] The term “nucleic acid” refers to single stranded or double stranded sequence (polymer) of deoxyribonucleotides or ribonucleotides. In addition, the polynucleotide includes analogues of natural polynucleotides, unless specifically mentioned. According to an embodiment, the nucleic acid may be selected from the group consisting of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), and analogues thereof, but is not limited thereto. The term encompasses DNA, RNA, single stranded or double stranded and chemical modifications thereof.
[0125] The terms “operably linked”, “operatively linked”, “operably encodes”, and “operably associated” are used herein interchangeably and refer to the functional linkage between a promoter and nucleic acid sequence, wherein the promoter initiates transcription of RNAcorresponding to the DNA sequence. A heterologous DNA sequence is “operatively associated” with the promoter in a cell when RNA polymerase which binds the promoter sequence transcribes the coding sequence into mRNA which then in turn is translated into the protein encoded by the coding sequence.
[0126] The term "nucleic acid construct" as used herein refers to a nucleic acid molecule operably linked to a promoter.
[0127] The term “promoter” as used herein refers to a regulatory sequence that initiates transcription of a downstream nucleic acid. The term “promoter” refers to a DNA sequence within a larger DNA sequence defining a site to which RNA polymerase may bind and initiate transcription. A promoter may include optional distal enhancer or repressor elements. The promoter may be either homologous, i.e., occurring naturally to direct the expression of the desired nucleic acid, or heterologous, i.e., occurring naturally to direct the expression of a nucleic acid derived from a gene other than the desired nucleic acid. A promoter may also include distal enhancer or repressor elements, which can be located as many as several thousand base pairs from the start site of transcription. A promoter may be constitutive or inducible. A constitutive promoter is a promoter that is active under most environmental and developmental conditions. An inducible promoter is a promoter that is active under environmental or developmental regulation, e.g., upregulation in response to xylose availability. Promoters may be derived in their entirety from a native gene, may comprise a segment or fragment of a native gene, or may be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. It is further understood that the same promoter may be differentially expressed in different tissues and / or differentially expressed under different conditions.
[0128] According to any one of the embodiments of the present invention, the nucleic acid molecule or construct encoding the OGP and the CAR, comprises a nucleic acid sequence as defined in any one of the aspects and embodiments of the application and in the sequence listing. According to some embodiments, the CAR comprises elements such as VL domain, VH domain, CDRs, transmembrane domain, stimulatory domain, activation domain, leading peptide etc., which sequences are encoded by the nucleic acid sequence as defined in any one of the aspects and embodiments of the application and in the sequence listing.
[0129] According to some embodiments, the active OGP consists of from 5 to 20, from 5 to 40, from 5 to 60, from 5 to 80, from 5 to 100 or from 5 to 120 amino acids. According to someembodiments, the OGP comprises or consists of the amino acid sequence YGFGG. According to some embodiments, the OGP comprises or consists of the amino acid sequence ALKRQGRTL YGFGG. According to some embodiments, the OGP is encoded by a nucleic acid sequence SEQ ID NO: 6. According to some embodiments, the OGP is encoded by a nucleic acid sequence SEQ ID NO: 7.
[0130] According to some embodiments, the tumor associated antigen is selected from AFP, ALK, B7H3, BAGE protein, BCMA, BIRC5, BIRC7, P-catenin, -8 brc-abl, BRCA1, BORIS, CA9, CA125, carbonic anhydrase IX, caspase 1, CALR, CCR5, CD19, CD20, CD22, CD24, CD30, CD33, CD38, CD40, CD123, CD133, CD138, CD276, CDK4, CEA, Claudin 18.2, cyclin -Bl, CYP1B1, EGFR, EGFRvIII, ErbB2 / Her2, ErbB3, ErbB4, ETV6-AML, EpCAM, EphA2, Fra-1, FOLR1, GAGE, GD2, GD3, GloboH, phosphatidylinositol proteoglycan -3, GM3, gplOO, Her2, HLA / B-raf-kinases, HLA / k-ras, HLA / MAGE-A3, hTERT, IL13R a2. LMP2 k -Light, LewisY, MAGE, MART-1, Mesothelin, ML-IAP, MOv-, y, Mucl, Muc2, Muc3, Muc4, Muc5, CA-125, MUM1, NA17, NKG2D, NY-BR1, NY-BR62, NY-BR85, NY- ESO1, 0X40, pl 5, p53, PAP, PAX3, PAX5, PCTA-1, PLAC1, PRLR, PRAME, PSMA, RAGE protein, Ras, RGS5, Rho, ROR1, SART-1, SART-3, STEAP1, STEAP2, TAG-72, TGF -P, TMPRSS2, soup-antigen, TRP-1, TRP-2, tyrosinase, urea soluble protein -3 and 5T4. According to some embodiments, the OGP comprises or consists of the amino acid sequence YGFGG. According to some embodiments, the OGP comprises or consists of the amino acid sequence ALKRQGRTL YGFGG. According to some embodiments, the OGP is encoded by a nucleic acid sequence SEQ ID NO: 6. According to some embodiments, the OGP is encoded by a nucleic acid sequence SEQ ID NO: 7 and the tumor associated antigen selected from HER2 / Erbb2, CD 138, CD38, CD 19, CD276, EGFR, GCC19, GUCY2C or CD 166 and the CAR binds specifically to said TAA.
[0131] According to some embodiments, the nucleic acid construct comprises a plurality of nucleic acid sequences encoding OGP separated by a cleavable nucleic acid molecule or a nucleic acid sequence encoding a self-cleaving peptide. According to some embodiments, both nucleic acid molecules are operably linked to one constitutive promoter. According to some embodiments, both nucleic acid sequences are operably linked to one constitutive promoter and the nucleic acid sequence(s) encoding OGP and the nucleic acid sequence encoding the CAR are separated by a cleavable nucleic acid sequence or a nucleic acid sequence encoding a selfcleaving peptide. According to some embodiments, the self-cleaving peptide is selected from T2A, P2A, E2A and F2A. According to some embodiments, the T2A self-cleaving peptide has an amino acid sequence selected from SEQ ID NO: 11, 12 and 13. According to someembodiments, the T2A self-cleaving peptide has the amino acid sequence SEQ ID NO: 13. According to some embodiments, the T2A self-cleaving peptide is encoded by a nucleic acid sequence SEQ ID NO: 14. According to some embodiments, the P2A, E2A and F2A selfcleaving peptide has an amino acid sequences SEQ ID NO: 15-17, respectively. According to some embodiments, the self-cleaving peptide is T2A. According to some embodiment, nucleic acid construct comprises internal ribosome entry site (IRES) sequence between the sequences encoding the OGP and CAR. According to some embodiments, the IRES has a nucleic acid sequence selected from SEQ ID NO: 10 and 18. According to some embodiments, the IRES has a nucleic acid sequence SEQ ID NO: 10. According to some embodiments, the sequences encoding OGP may be further separated by any feasible spacer. According to some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding for (OGP- T2A)X, wherein x is a number of repetitions being in the range of 1 to 20.
[0132] The terms "nucleic acid sequence encoding" and "nucleic acid molecule encoding" may be used interchangeably. The term nucleic acid molecule sequence / molecule encompasses variants of these sequences. The terms “homolog” “variant”, “DNA variant”, “sequence variant” and “polynucleotide variant” are used herein interchangeably and refer to a DNA polynucleotide having at least 70% sequence identity to the parent polynucleotide. The variant may include mutations such as deletion, addition or substitution such that the mutations do not change the open reading frame and the polynucleotide encodes a peptide or a protein having substantially similar structure and function as a peptide or a protein encoded by the parent polynucleotide. According to some embodiments, the variants are conservative variants. The term “conservative variants" as used herein refers to variants in which a change of one or more nucleotides in a given codon position results in no alteration in the amino acid encoded at that position. Thus, the peptide or the protein encoded by the conservative variants has 100% sequence identity to the peptide or the protein encoded by the parent polynucleotide. According to some embodiments, the variant is a non-conservative variant encoding to a peptide or a protein being a conservative analog of the peptide of the protein encoded by the parent polynucleotide. According to some embodiments, the variant has at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to the parent polynucleotide.
[0133] According to some embodiment, the CAR is anti-CD138 CAR. According to some embodiments, the anti-CD138 has CDRs as described hereinabove. According to some embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding the OGP comprising or consisting of the amino acid sequence selected from YGFGG andALKRQGRTLYGFGG. According to some embodiments, the OGP is encoded by a nucleic acid sequence selected from gcgctcaagcgccaggggcgcaccctgtacggcttcggaggc (SEQ ID NO: 6) and tacggcttcggaggc (SEQ ID NO: 7). According to some embodiment, the nucleic acid molecule comprises a nucleic acid sequence encoding the anti-CD138 CAR comprising an amino acid sequence selected from SEQ ID NO: 62 and SEQ ID NO: 63. According to some embodiment, the nucleic acid molecule comprises a nucleic acid sequence encoding an anti- CD138 CAR comprising an amino acid sequence SEQ ID NO: 61. According to some embodiments, the present invention provides a nucleic acid molecule comprising a nucleic acid sequence encoding an active OGP comprising or consisting of an amino acid sequence SEQ ID NO: 1 or 2, and nucleic acid sequence encoding anti-CD138 CAR, wherein the CAR comprises an amino acid selected from SEQ ID NO: 61, and a combination of SEQ ID NO: 62 and 63. According to some embodiments, the anti-CD138 CAR is encoded by a nucleic acid sequence comprising a nucleic acid sequence selected from SEQ ID NO: 58, 59, 60, 24, 25, 26, 27 and 28 and the OGP is encoded by a nucleic acid sequence selected from SEQ ID NO: 6 and 7. According to some embodiments, the present invention provides a nucleic acid molecule comprises a nucleic acid sequence selected from SEQ ID NO: 6 and 7 and a nucleic acid sequence selected from SEQ ID NO: 24, 25, 26, 27, 28, and combinations thereof. According to some embodiments, the nucleic acid sequence encoding OGP and the nucleic acid sequence encoding the anti-CD138 CAR are separated by a nucleic acid sequence encoding a self-cleaving peptide T2A. According to some embodiments, the T2A peptide has the amino acid sequence SEQ ID NO: 13. According to some embodiments, the T2A self-cleaving peptide is encoded by a nucleic acid sequence SEQ ID NO: 14. Thus, in some embodiments, the nucleic acid molecule comprises a nucleic acid sequence SEQ ID NO: 14 between the nucleic acid sequence encoding OGP and the nucleic acid sequence encoding the anti-CD138 CAR. According to some embodiments, the nucleic acid sequence encoding OGP and the nucleic acid sequence encoding the anti-CD138 CAR are separated by IRES. According to some embodiments, the IRES has a nucleic acid sequence selected from SEQ ID NO: 10 and 18. According to some embodiments, the IRES has a nucleic acid sequence SEQ ID NO: 10. Therefore, according to some embodiments, the nucleic acid sequence encoding OGP and the nucleic acid sequence encoding the anti-CD138 CAR are separated by a nucleic acid sequence SEQ ID NO: 10. According to some embodiments, the nucleic acid molecule comprises a nucleic acid sequence SEQ ID NO: 20. According to some embodiments, the nucleic acid molecule comprises a nucleic acid sequence SEQ ID NO: 21. According to some embodiments, the nucleic acid is operably linked to a promoter. According to some embodiments, the promoter is a constitutive promoter.According to some embodiments, the promoter is an inducible promoter. Therefore, the present invention provides a nucleic acid construction comprising said nucleic acid molecule. According to some embodiments, the present invention provides a construct comprising a nucleic acid molecule comprising a nucleic acid sequence selected from SEQ ID NO: 20 and 21, said nucleic acid molecule is operably linked to a promoter, either constitutive of inducible. According to some embodiments, the present invention provides a construct comprising a variant such as a conservative variant of a nucleic acid molecule comprising a nucleic acid sequence selected from SEQ ID NO: 20 and 21, said nucleic acid molecule is operably linked to a promoter, either constitutive of inducible.
[0134] According to some embodiment, the CAR is anti-HER2 CAR. According to some embodiments, the anti-HER2 CAR has CDRs as described hereinabove. According to some embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding the OGP comprising or consisting of the amino acid sequence selected from YGFGG and ALKRQGRTLYGFGG. According to some embodiments, the OGP is encoded by a nucleic acid sequence selected from SEQ ID NO: 6 and SEQ ID NO: 7. According to some embodiment, the nucleic acid molecule comprises a nucleic acid sequence encoding the anti-HER2 CAR comprising an amino acid sequence selected from SEQ ID NO: 35 and SEQ ID NO: 36. According to some embodiment, the nucleic acid construct comprises a nucleic acid sequence encoding an anti-HER2 CAR comprising an amino acid sequence selected from SEQ ID NO: 34. According to some embodiments, the present invention provides a nucleic acid molecule a nucleic acid sequence encoding an active OGP comprising or consisting of an amino acid sequence SEQ ID NO: 1 or 2, and a nucleic acid sequence encoding anti-HER2 CAR T cells, wherein the CAR comprises an amino acid selected from SEQ ID NO: 34, and a combination of SEQ ID NO: 35 and 36. According to some embodiments, the anti-HER2 CAR is encoded by a nucleic sequence comprising a nucleic acid sequence selected from SEQ ID NO: 49, 50, 29 and 30 and the OGP is encoded by a nucleic acid sequence selected from SEQ ID NO: 6 and 7. According to some embodiments, the present invention provides a nucleic acid comprising a nucleic acid molecule having a nucleic acid sequence selected from SEQ ID NO: 6 and 7 and a nucleic acid sequence selected from SEQ ID NO: 29 and 30. According to some embodiments, the nucleic acid sequence encoding OGP and the nucleic acid sequence encoding the anti-HER2 CAR are separated by a nucleic acid encoding a self-cleaving peptide T2A. According to some embodiments, the T2A peptide has the amino acid sequence SEQ ID NO: 13. According to some embodiments, the T2A self-cleaving peptide is encoded by a nucleic acid sequence SEQ ID NO: 14. Thus, in some embodiments, the nucleic acid molecule comprises a nucleic acid sequenceSEQ ID NO: 14 between the nucleic acid sequence encoding OGP and the nucleic acid sequence encoding the anti-HER2 CAR. According to some embodiments, the nucleic acid sequence encoding OGP and the nucleic acid sequence encoding the anti- HER2 CAR are separated by IRES. According to some embodiments, the IRES has a nucleic acid sequence selected from SEQ ID NO: 10 and 18. According to some embodiments, the IRES has a nucleic acid sequence SEQ ID NO: 10. Therefore, according to some embodiments, the nucleic acid sequence encoding OGP and the nucleic acid sequence encoding the anti- HER2 CAR are separated by a nucleic acid sequence SEQ ID NO: 10. According to some embodiments, the nucleic acid molecule comprises a nucleic acid sequence SEQ ID NO: 22. According to some embodiments, the nucleic acid molecule comprises a nucleic acid sequence SEQ ID NO: 23. According to some embodiments, the nucleic acid is operably linked to a promoter. According to some embodiments, the promoter is a constitutive promoter. According to some embodiments, the promoter is an inducible promoter. Therefore, the present invention provides a nucleic acid construction comprising said nucleic acid molecule. According to some embodiments, the present invention provides a construct comprising a nucleic acid molecule comprising a nucleic acid sequence selected from SEQ ID NO: 22 and 23, said nucleic acid molecule is operably linked to a promoter, either constitutive of inducible. According to some embodiments, the present invention provides a construct comprising a variant such as a conservative variant of a nucleic acid molecule comprising a nucleic acid sequence selected from SEQ ID NO: 22 and 23, said nucleic acid molecule is operably linked to a promoter, either constitutive of inducible.
[0135] According to some embodiments, the CAR is anti-CD38 CAR. According to some embodiments, the anti-CD38 has CDRs as described hereinabove. According to some embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding the OGP comprising or consisting of the amino acid sequence selected from YGFGG and ALKRQGRTLYGFGG. According to some embodiments, the OGP is encoded by a nucleic acid sequence selected from SEQ ID NO: 6 and SEQ ID NO: 7. According to some embodiment, the nucleic acid molecule comprises a nucleic acid sequence encoding the anti- CD38 CAR comprising an amino acid sequence selected from SEQ ID NO: 79 and SEQ ID NO: 80. According to some embodiment, the nucleic acid molecule comprises a nucleic acid sequence encoding an anti-CD38 CAR comprising an amino acid sequence SEQ ID NO: 81. According to some embodiments, the present invention provides a nucleic acid molecule comprising a nucleic acid sequence encoding an active OGP comprising or consisting of an amino acid sequence SEQ ID NO: 1 or 2, and a nucleic acid sequence encoding anti-CD38 CAR, wherein the anti-CD38 comprises an amino acid selected from SEQ ID NO: 81, and acombination of SEQ ID NO: 79 and 20. According to some embodiments, the anti-CD38 CAR is encoded by a nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NO: 89, 90, 91 and 92 and the OGP is encoded by a nucleic acid sequence selected from SEQ ID NO: 6 and 7. According to some embodiments, the present invention provides a nucleic acid molecule comprising a nucleic acid sequence selected from SEQ ID NO: 6 and 7 and a nucleic acid sequence selected from SEQ ID NO: 89, 90, 91 and 92, and combinations thereof. According to some embodiments, the nucleic acid sequence encoding OGP and the nucleic acid sequence encoding the anti-CD38 CAR are separated by a nucleic acid sequence encoding a self-cleaving peptide T2A. According to some embodiments, the T2A peptide has the amino acid sequence SEQ ID NO: 13. According to some embodiments, the T2A self-cleaving peptide is encoded by a nucleic acid sequence SEQ ID NO: 14. Thus, in some embodiments, the nucleic acid comprises a nucleic acid sequence SEQ ID NO: 14 between the nucleic acid sequence encoding OGP and the nucleic acid sequence encoding the anti-CD38 CAR. According to some embodiments, the nucleic acid sequence encoding OGP and the nucleic acid sequence encoding the anti-CD38 CAR are separated by IRES. According to some embodiments, the IRES has a nucleic acid sequence selected from SEQ ID NO: 10 and 18. According to some embodiments, the IRES has a nucleic acid sequence SEQ ID NO: 10. Therefore, according to some embodiments, the nucleic acid sequence encoding OGP and the nucleic acid sequence encoding the anti-CD38 CAR are separated by a nucleic acid sequence SEQ ID NO: 10.
[0136] According to some embodiment, the CAR is anti -CD 19 CAR. According to some embodiments, the anti-CD19 has CDRs as described hereinabove. According to some embodiments, the nucleic acid molecule comprises a nucleic acid sequence encoding the OGP comprising or consisting of the amino acid sequence selected from YGFGG and ALKRQGRTLYGFGG. According to some embodiments, the OGP is encoded by a nucleic acid sequence selected from SEQ ID NO: 6 and SEQ ID NO: 7. According to some embodiment, the nucleic acid molecule comprises a nucleic acid sequence encoding the anti- CD19 CAR comprising an amino acid sequence selected from SEQ ID NO: 54 and SEQ ID NO: 55. According to some embodiment, the nucleic acid molecule comprises a nucleic acid sequence encoding an anti-CD19 CAR comprising an amino acid sequence selected from SEQ ID NO: 52, 53, and 56. According to some embodiments, the present invention provides a nucleic acid molecule comprising a nucleic acid sequence encoding an active OGP comprising or consisting of an amino acid sequence SEQ ID NO: 1 or 2, and a nucleic acid sequence encoding anti-CD19 CAR, wherein the CAR comprises an amino acid selected from selected from SEQ ID NO: 52, 53, and 56. According to some embodiments, the anti-CD19 CAR isencoded by a nucleic molecule comprising a nucleic acid sequence SEQ ID NO: 57 and the OGP is encoded by a nucleic acid sequence selected from SEQ ID NO: 6 and 7. According to some embodiments, the present invention provides a nucleic acid molecule comprising a nucleic acid sequence selected from SEQ ID NO: 6 and 7 and a nucleic acid sequence SEQ ID NO: 57. According to some embodiments, the nucleic acid sequence encoding OGP and the nucleic acid sequence encoding the anti-CD19 CAR are separated by a nucleic acid encoding a self-cleaving peptide T2A. According to some embodiments, the T2A peptide has the amino acid sequence SEQ ID NO: 13. According to some embodiments, the T2A self-cleaving peptide is encoded by a nucleic acid sequence SEQ ID NO: 14. Thus, in some embodiments, the nucleic acid molecule comprises a nucleic acid sequence SEQ ID NO: 14 between the nucleic acid sequence encoding OGP and the nucleic acid sequence encoding the anti-CD19 CAR. According to some embodiments, the nucleic acid sequence encoding OGP and the nucleic acid sequence encoding the anti-CD19 CAR are separated by IRES. According to some embodiments, the IRES has a nucleic acid sequence selected from SEQ ID NO: 10 and 18. According to some embodiments, the IRES has a nucleic acid sequence SEQ ID NO: 10.Therefore, according to some embodiments, the nucleic acid sequence encoding OGP and the nucleic acid sequence encoding the anti-CD19 CAR are separated by a nucleic acid sequence SEQ ID NO: 10.
[0137] According to some embodiments, the nucleic acid sequence encoding the CAR is operably linked to one constitutive promoter and the nucleic acid sequence encoding the OGP peptide is operably linked to an inducible promoter. According to some embodiments, the nucleic acid construct comprises a cleavable nucleic acid molecule or a nucleic acid sequence encoding a self-cleaving peptide between the two nucleic acid molecules. According to some embodiments, the nucleic acid sequence encoding the CAR is operably linked to a constitutive promoter and the nucleic acid sequence encoding the active OGP peptide is operably linked to an inducible promoter that initiates the expression of OGP upon activation of the CAR. According to some embodiments, the nucleic acid sequence encoding the CAR is operably linked to a constitutive promoter and the nucleic acid sequence encoding the active OGP peptide is operably linked to a constitutive promoter. The sequences of the nucleic acid molecules are as described above and encompassed herein as well.
[0138] According to some embodiments, the present invention provides a nucleic acid construct comprising the nucleic acid molecule according to any one of the above embodiments, operably linked to a promoter.
[0139] According to another aspect, the present invention provides a vector comprising the nucleic acid molecule or construct as described in any one of the aspects and embodiments of the present invention. All terms, embodiments and definitions disclosed in any one of the above aspects apply and are encompassed herein as well. The terms “vector” and “expression vector” are used herein interchangeably and refer to any viral or non-viral vector such as plasmid, virus, retrovirus, bacteriophage, cosmid, artificial chromosome (bacterial or yeast), phage, binary vector in double or single stranded linear or circular form, or nucleic acid, sequence which is able to transform host cells and optionally capable of replicating in a host cell. The vector may be integrated into the cellular genome or may exist extrachromosomally (e.g., autonomous replicating plasmid with an origin of replication). The vector may contain an optional marker suitable for use in the identification of transformed cells, e.g., tetracycline resistance or ampicillin resistance. A cloning vector may or may not possess the features necessary for it to operate as an expression vector. According to other embodiments, the vector is a virus, i.e. a viral vector, e.g. a modified or engineered virus. The modification of a vector may include mutations, such as deletion or insertion mutation, gene deletion or gene inclusion. In particular, a mutation may be done in one or more regions of the viral genome. Such mutations may be introduced in a region related to internal structural proteins, replication, or reverse transcription function. Other examples of vector modification are deletion of certain genes constituting the native infectious vector such as genes related to the virus' pathogenicity and / or to its ability to replicate. Any virus can be attenuated by the methods disclosed herein. The virus can be a dsDNA virus (e.g. Adenoviruses, Herpesviruses, Poxviruses), a single stranded “plus” sense DNA virus (e.g., Parvoviruses) a double stranded RNA virus (e.g., Reoviruses), a single stranded+sense RNA virus (e.g. Picornaviruses, Togaviruses), a single stranded “minus” sense RNA virus (e.g. Orthomyxoviruses, Rhabdoviruses), a single stranded+sense RNA virus with a DNA intermediate (e.g. Retroviruses), or a double stranded reverse transcribing virus (e.g. Hepadnaviruses). In certain non-limiting embodiments of the present invention, the virus is poliovirus (PV), rhinovirus, influenza virus including avian flu (e.g. H5N1 subtype of influenza A virus), severe acute respiratory syndrome (SARS) coronavirus, Human Immunodeficiency Virus (HIV), Hepatitis B Virus (HBV), Hepatitis C Virus (HCV), infectious bronchitis virus, ebolavirus, Marburg virus, dengue fever virus (Flavivirus serotypes), West Nile disease virus, Epstein-Barr virus (EBV), yellow fever virus, Ebola (ebolavirus), chickenpox (varicella-zoster virus), measles (a paramyxovirus), mumps (a paramyxovirus), rabies (Lyssavirus), human papillomavirus, Kaposi's sarcoma-associated herpesvirus, Herpes Simplex Virus (HSV Type 1), or genital herpes (HSV Type 2). Accordingto some embodiments, the vector is a virus selected from lentivirus, adenovirus, modified adenovirus and retrovirus. In one particular embodiment, the vector is lentivirus.
[0140] Population ofT cells encoding CAR and OGP
[0141] According to another aspect, the present invention provides a cell comprising the nucleic acid molecule, construct or the vector as described in any one of the above embodiments, and aspect. According to some embodiments, the cell is an immune cell. According to some embodiments, the cells are T cells.
[0142] According to any one of the above aspects and embodiments, the CAR binds specifically to a tumor associated antigen selected from ErbB2 (HER2), CD 19, CD38, CD 138, EGFR, CD276, CD24, GD2, EGF, BCMA, MUC-1, FAP, Mesothelin (MSLN), MUC16, GCC19, GUCY2C or CD 166; and / or (ii) the immune cells are selected from T cells, natural killer cells and tumor infiltrating lymphocytes (TIL).
[0143] According to some embodiments, the present invention provides a population of immune cells engineered to express (i) a chimeric antigen receptor (CAR) binding specifically to a tumor associated antigen and (ii) an active Osteogenic Growth Peptide (OGP) comprising the amino acid sequence YGFGG. According to some embodiments, the active OGP consists of from 5 to 20, from 5 to 40, from 5 to 60, from 5 to 80, from 5 to 100 or from 5 to 120 amino acids. All terms, embodiments and definitions disclosed in any one of the above aspects apply and are encompassed herein as well.
[0144] According to some embodiments, the immune cells are T cells as defined hereinabove. According to some embodiments, the active OGP comprises or consists of the amino acid sequence selected from YGFGG and ALKRQGRTL YGFGG. According to some embodiments, the CAR binds specifically to a tumor associated antigen selected from HER2 / Erbb2, CD 138, CD38, CD 19, CD276, EGFR, GCC19, GUCY2C or CD 166. According to some embodiments, the population of immune cells comprising a nucleic acid molecule or construct comprising a nucleic acid sequence encoding the CAR and a nucleic acid sequence encoding the active OGP peptide. According to some embodiments, the population of immune cells comprising a nucleic acid construct comprising a nucleic acid sequence encoding the CAR and a nucleic acid construct comprising a nucleic acid sequence encoding the active OGP peptide. According to some embodiments the nucleic acid sequence encoding the CAR is operably linked to a constitutive promoter and the nucleic acid sequence encoding the active OGP is operably linked to (i) an inducible promoter, said promoter initiates (i.e. configured to initiate) the expression of the active OGP peptide upon activation of the CAR. According to some embodiments the nucleic acid sequence encoding the CAR is operably linked to aconstitutive promoter and the nucleic acid sequence encoding the active OGP is operably linked to a constitutive promoter. According to some embodiments, the immune cells, e.g. T cells, express the CAR constitutively.
[0145] According to some embodiment, the nucleic acid molecule is operably linked to an inducible promoter, and wherein the promoter initiates the expression of said OGP upon activation of a T cell receptor. Therefore, according to some embodiments, the immune cells express the active OGP peptide upon activation of the CAR.
[0146] According to some embodiments, the immune cells express the CAR and the active OGP peptide constitutively.
[0147] According to some embodiments, the population of immune cells comprising a nucleic acid construct comprising a nucleic acid sequence encoding the CAR and a nucleic acid sequence encoding the active OGP peptide.
[0148] According to some embodiments, the present inventing provides a population of T cells expressing (i) OGP comprising or consisting of the amino acid sequence selected from YGFGG and ALKRQGRTL YGFGG and (ii) anti-CD138 CAR. According to some embodiment, the anti-CD138 CAR comprising an amino acid sequence selected from SEQ ID NO: 62 and SEQ ID NO: 63. According to some embodiment, the anti-CD138 CAR comprising an amino acid sequence SEQ ID NO: 61. According to some embodiments, the anti-CD138 CAR is encoded by a nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NO: 58, 59, 60, 24, 25, 26, 27 and 28 and the OGP is encoded by a nucleic acid sequence selected from SEQ ID NO: 6 and 7. According to some embodiments, the anti-CD138 CAR is encoded by a nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NO: 58, 59, 60, 24, 25, 26, 27 and 28 and the OGP is encoded by a nucleic acid sequence selected from SEQ ID NO: 6 and 7. According to some embodiments, population of T cells comprising a nucleic acid comprising a nucleic acid molecule having a nucleic acid sequence selected from SEQ ID NO: 6 and 7 and a nucleic acid sequence selected from SEQ ID NO: 24, 25, 26, 27 and 28, and combinations thereof. According to some embodiments, the population of T cells comprises a nucleic acid molecule comprising a nucleic acid sequence SEQ ID NO: 20. According to some embodiments, the population of T cells comprises a nucleic acid molecule comprising a nucleic acid sequence SEQ ID NO: 21.
[0149] According to some embodiments, the present inventing provides a population of T cells expressing (i) OGP comprising or consisting of the amino acid sequence selected from YGFGG and ALKRQGRTL YGFGG and (ii) anti-HER2 CAR. According to some embodiment, the anti- HER2 CAR comprising an amino acid sequence selected from SEQ ID NO: 35 and SEQ IDNO: 36. According to some embodiment, the anti-HER2 CAR comprising an amino acid sequence SEQ ID NO: 34. According to some embodiments, the anti-HER2 CAR is encoded by a nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NO: 49, 50, 29 and 30 and the OGP is encoded by a nucleic acid sequence selected from SEQ ID NO: 6 and 7. According to some embodiments, the anti-HER2 CAR is encoded by a nucleic molecule comprising a nucleic acid sequence selected from SEQ ID NO: 29 and 30 and the OGP is encoded by a nucleic acid sequence selected from SEQ ID NO: 6 and 7. According to some embodiments, population of T cells comprising a nucleic acid molecule comprising a nucleic acid sequence selected from SEQ ID NO: 6 and 7 and a nucleic acid sequence selected from SEQ ID NO: 29 and 30, and combinations thereof. According to some embodiments, the population of T cells comprises a nucleic acid molecule comprising a nucleic acid sequence SEQ ID NO: 22. According to some embodiments, the population of T cells comprises a nucleic acid molecule comprising a nucleic acid sequence SEQ ID NO: 23.
[0150] According to any one of the above embodiments, the T cell is selected are from CD4+ T-cell, CD8+ T-cell and a combination of CD4+ and CD8+ T-cell.
[0151] Pharmaceutical composition comprising a population of T cells encoding CAR and OGP
[0152] According to another aspect, the present invention provides a pharmaceutical composition comprising the population of immune cells as described in any one of the above aspects and embodiments, and a pharmaceutically acceptable carrier. All terms, embodiments and definitions disclosed in any one of the above aspects apply and are encompassed herein as well. According to some embodiments, the CAR binds specifically to a tumor associated antigen selected from HER2 / Erbb2, CD 138, CD38, CD 19, CD276, EGFR, GCC19, GUCY2C or CD 166. According to some embodiments, the CAR binds specifically to HER2. According to some embodiments, the CAR binds specifically to CD138. According to some embodiments, the CAR binds specifically to CD38. According to some embodiments, the CAR binds specifically to GCC19. According to some embodiments, the CAR binds specifically to GUCY2C. According to some embodiments, the CAR binds specifically to CD166. According to some embodiments, the OGP comprises or consists of the amino acid sequence YGFGG. According to some embodiments, the OGP comprises or consists of the amino acid sequence ALKRQGRTL YGFGG. According to any one of the embodiments of the present invention, the OGP and / or the CAR comprises the amino acid sequence as defined in any one of the aspects and embodiments of the application and in the sequence listing.
[0153] Pharmaceutical composition comprising a population of T cells encoding CAR and OGP for treating cancer
[0154] According to some embodiments, the pharmaceutical composition comprising the population of immune cells as described above, i.e. immune cells engineered to express (i) a chimeric antigen receptor (CAR) binding specifically to a tumor associated antigen and (ii) an active Osteogenic Growth Peptide (OGP) comprising the amino acid sequence YGFGG and consisting of from 5 to 120 amino acids, is for use in treating cancer. According to some embodiments, the cancerous tissue expresses cannabinoid receptor 2 (CB2). According to some embodiments, the cancer is selected from colon cancer, multiple myeloma, breast cancer, blood cancer, non-melanoma skin cancer, squamous cell carcinoma, and (SCC) and basal cell carcinoma (BCC). It would be obvious to a person of ordinary skills that the type of cancer treated relates to the CAR. The types of cancer and corresponding types of cancer treated by the combination of CAR and OGP is as described in any one of the above aspects and embodiments.
[0155] According to some embodiments, the present invention provides a pharmaceutical composition comprising a population of immune cells engineered to express (i) a chimeric antigen receptor (CAR) binding specifically to a tumor associated antigen and (ii) an active OGP, for use in treating breast cancer or ovarian cancer, wherein the active OGP comprises the amino acid sequence YGFGG and consists of from 5 to 20 amino acids and wherein the CAR bind specifically to HER2.
[0156] According to some embodiments, the present invention provides a pharmaceutical composition comprising a population of immune cells engineered to express (i) a chimeric antigen receptor (CAR) binding specifically to a tumor associated antigen and (ii) an active OGP, for use in treating colon cancer, wherein the active OGP comprises the amino acid sequence YGFGG and consists of from 5 to 20 amino acids and wherein the CAR bind specifically to a TAA selected from HER2, GCC19, GUCY2C or CD 166. According to some embodiments, the treatment comprises inhibiting the formation of adenomas. According to some embodiments, the treatment comprises inhibiting the growth of adenomas.
[0157] According to some embodiments, the present invention provides a pharmaceutical composition comprising a population of immune cells engineered to express (i) a chimeric antigen receptor (CAR) binding specifically to a tumor associated antigen and (ii) an active OGP, for use in treating multiple myeloma, wherein the active OGP comprises the amino acid sequence YGFGG and consists of from 5 to 20 amino acids and wherein the CAR bind specifically to CD38 or CD 138.
[0158] According to some embodiments, OGP reduces the immunosuppressive effect of tumor microenvironment. According to some embodiments, OGP enhances the CAR T cells treatment outcome. According to some embodiments, the co-administration of comprises / results in an enhanced activity of CAR T cells and / or wherein the OGP reduces the immunosuppressive tumor microenvironment. According to some embodiment, the treatment provides a long-term treatment. According to some embodiment, the treatment prevents relapse of cancer.
[0159] According to any one of the above embodiments, the combination of OGP and the CAR provides a synergistic anticancer effect.
[0160] According to some embodiments, the present invention provides a method of treating cancer in a subject in need thereof comprising administering to the subject engineered immune cells, wherein the immune cells are engineered to express a chimeric antigen receptor (CAR) that binds specifically to a tumor associated antigen and an active OGP peptide comprising the amino acid sequence YGFGG and consisting of from 5 to 20 amino acids.
[0161] Pharmaceutical combination and kit of CAR T cells and OGP for treating cancer
[0162] According to a further aspect, the present invention provides a therapeutic combination comprising (i) a population of immune cells engineered to express a chimeric antigen receptor (CAR) that binds specifically to a tumor associated antigen and (ii) an active OGP comprising the amino acid sequence YGFGG. According to some embodiments, the present invention provides a kit comprising (i) a population of immune cells engineered to express a chimeric antigen receptor (CAR) that binds specifically to a tumor associated antigen, (ii) an active OGP peptide comprising the amino acid sequence YGFGG and (iii) instructions for use of (i) and (ii). The population of the immune cells and / or the OGP may be in any known form of administration, e.g. a pharmaceutical composition such as pharmaceutical composition for parenteral administration, e.g. IV administration. All terms, embodiments and definitions disclosed in any one of the above aspects apply and are encompassed herein as well.
[0163] According to some embodiments, the therapeutic combination or the kit are for use in treating cancer. It would be obvious to a person of ordinary skills that the type of cancer treated relates to the CAR. The types of cancer and corresponding types of cancer treated by the combination of CAR and OGP is as described in any one of the above aspects and embodiments.
[0164] According to some embodiments, the active OGP consists of from 5 to 20, from 5 to 40, from 5 to 60, from 5 to 80, from 5 to 100 or from 5 to 120 amino acids. According to some embodiments, immune cells are characterized by a surface expression of the CAR upon administration. According to some embodiments, the CAR binds specifically to a tumor associated antigen selected from HER2 / Erbb2, CD 138, CD38, CD 19, CD276, EGFR, GCC19,GUCY2C or CD 166. According to some embodiments, the CAR binds specifically to HER2. According to some embodiments, the CAR binds specifically to CD 138. According to some embodiments, the CAR binds specifically to CD38. According to some embodiments, the CAR binds specifically to GCC19. According to some embodiments, the CAR binds specifically to GUCY2C. According to some embodiments, the CAR binds specifically to CD166. According to some embodiments, the OGP comprises or consists of the amino acid sequence YGFGG. According to some embodiments, the OGP comprises or consists of the amino acid sequence ALKRQGRTL YGFGG. According to any one of the embodiments of the present invention, the OGP and / or the CAR comprises the amino acid sequence as defined in any one of the aspects and embodiments of the application and in the sequence listing.
[0165] According to some embodiments, the cancerous tissue expresses cannabinoid receptor 2 (CB2). According to some embodiments, the cancer is selected from colon cancer, multiple myeloma, breast cancer, blood cancer, non-melanoma skin cancer, squamous cell carcinoma, and (SCC) and basal cell carcinoma (BCC).
[0166] The terms "pharmaceutical combination" and "therapeutic combination" used herein interchangeably and refer to a product that results from the mixing or combining of more than one active ingredient and includes both fixed and non-fixed combinations of the active ingredients. All terms, embodiments and definitions disclosed in any one of the above aspects apply and are encompassed herein as well. The term "fixed combination" means that the active ingredients, e.g. a compound disclosed herein, or a pharmaceutically acceptable salt thereof, and a co-agent, are both administered to a patient simultaneously in the form of a single entity or dosage. The term "non-fixed combination" means that the active ingredients, e.g. a compound disclosed herein, or a pharmaceutically acceptable salt thereof, and a co-agent, are administered to a patient as separate entities either simultaneously, concurrently or sequentially with no specific intervening time limits, wherein such administration provides effective levels of the two compounds in the body of the patient. The latter also applies to cocktail therapy, e.g. the administration of three or more active ingredients. According to some embodiments, the use comprises co-administering the engineered immune cells and the active OGP peptide in a regimen selected from a sequential administering or a substantially simultaneous administering.
[0167] According to some embodiments, OGP reduces the immunosuppressive effect of tumor microenvironment. According to some embodiments, OGP enhances the CAR T cells treatment outcome. According to some embodiments, the co-administration of comprises / results is an enhanced activity of CAR T cells and / or wherein the OGP reduces the immunosuppressivetumor microenvironment. According to some embodiment, the treatment provides a long-term treatment. According to some embodiment, the treatment prevents relapse of cancer.
[0168] According to any one of the aspects and embodiments of the present invention, administration of the OGP may be performed once a week. According to any one of the aspects and embodiments of the present invention, administration of the OGP may be performed 2 times a week. According to any one of the aspects and embodiments of the present invention, administration of the OGP may be performed 3 times a week.
[0169] According to any one of the aspects and embodiments of the present invention the combined therapy of the CAR T cells and OGP provides a synergistic effect. According to any one of the aspects and embodiments of the present invention OGP potentiates and / or enhance and / or prolong the CAR T cells therapy and / or prevents a relapse of cancer.
[0170] Reference Table of some of the sequences
[0171] The terms “a,” “an,” and “the” are used herein interchangeably and mean one or more.
[0172] The term “and / or” is used to indicate one or both stated cases may occur, for example A and / or B includes, (A and B) and (A or B).
[0173] The term “or,” as used herein, denotes alternatives that may, where appropriate, be combined; that is, the term “or” includes each listed alternative separately as well as their combination if the combination is not mutually exclusive.
[0174] The terms “comprising”, "comprise(s)", "include(s)", "having", "has" and "contain(s)," are used herein interchangeably and have the meaning of “consisting at least in part of’. When interpreting each statement in this specification that includes the term “comprising”, features other than that or those prefaced by the term may also be present. Related terms such as “comprise” and “comprises” are to be interpreted in the same manner. The terms “have”, “has”, having” and “comprising” may also encompass the meaning of “consisting of’ and “consisting essentially of’, and may be substituted by these terms. The term “consisting of’ excludes any component, step or procedure not specifically delineated or listed. The term “consisting essentially of’ means that the composition or component may include additional ingredients, but only if the additional ingredients do not materially alter the basic and novel characteristics of the claimed compositions or methods.
[0175] As used herein, the term “about”, when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of + / -10%, or + / - 5%, + / -1%, or even + / -0.1% from the specified value.
[0176] Having now generally described the invention, the same will be more readily understood through reference to the following examples, which are provided by way of illustration and are not intended to be limiting of the present invention.EXAMPLES
[0177] Materials and Methods
[0178] Mice
[0179] Mice on a C57B1 / 6J genetic background were bred in the specific pathogen-free (SPF) animal facility in Tel Aviv University. All mice were housed as per IACUC guidelines in temperature-controlled rooms with a 12-hour light cycle and were given water and pelleted chow ad libitum. For steady-state analyses, six-week-old female WT mice were injected intraperitoneally with either 700 ng OGP (synthesized at Tel Aviv University) or vehicle control (saline) on day 0, 7 and 14, and sacrificed on day 15. ApcMin / +mice were obtained from the Jackson Laboratory and subsequently bred in-house using heterozygous males on a C57BL / 6J background. For progression phase studies, eight-week-old male and female ApcMin / +mice were injected with 100 ng OGP daily, 700 ng OGP weekly, or a vehicle control for eight weeks. Forinitiation phase studies, five-week-old male and female ApcMin / +mice were injected once weekly with 700 ng OGP for four weeks.
[0180] Genotyping
[0181] Genomic DNA was extracted from 2 mm tail clippings using Extracta DNA Prep for PCR (Quantabio, Beverly, MA). PCR was performed with DreamTaq Green PCR master mix (Thermo Scientific, Waltham, MA, USA). The following primers were used: ApcMin / +wild-type forward, 5'-GCCATCCCTTCACGTTAG-3', ApcMin / +forward, 5'- TTCTGAGAAAGACAGAAGTTA-3', and ApcMin / +common antisense, 5'- TTCCACTTTGGCATAAGGC-3' for ApcMin / +.
[0182] Flow cytometry
[0183] Single-cell suspensions were obtained by manually homogenizing harvested spleens in a petri dish or flushing the marrow contents from tibia with a 27G syringe. Red blood cells were lysed using ACK Lysis buffer (Life Technologies, Carlsbad, CA USA), except in cases of erythroid precursor analysis. Cells were washed with PBS supplemented with 2 mM EDTA and 2% FBS, filtered through a 70 pm cell strainer (Falcon, Corning Incorporated), and then resuspended. T cells were stained with anti-CD3-FITC, anti-CD4-PE and anti-CD8-APC for 30 min on ice, while myeloid cells were stained with anti-CD45-Pacific Blue, anti-CDl Ib-PE- Cy7, anti-CDl Ic-PE, anti-Ly6G-FITC, anti-Ly6C-PerCP-Cy5.5, and anti-Siglec-F-APC or anti-F4 / 80-APC for 45 minutes on ice. For erythroid cells, bone marrow cells were stained with anti-CD71-PE and anti-Terl 19-APC for 20 minutes on ice. All antibodies were purchased from BioLegend (San Diego, CA, USA). After staining, cells were washed twice with PBS and the fluorescence was assessed with a CytoFlex5L (Beckman Coulter, Brea, CA, USA). Dendritic cells were classified as CD45+CDl lb+CDl lc+, macrophages as CD45+CDl lb+F4 / 80+, eosinophils as CD45+CDl lb+Siglec-F+, PMN-MDSCs as CD45+CD1 Ib+CDl lclo / negLy6GhiLy6Cint, and M-MDSCs asCD45+CD1 Ib+CDl lclo / negLy6G‘Ly6Chl. Erythroblasts were classified as previously described (Pegka, F., et al., Cells, 2023. 12(13): p. 1704). Briefly, erythroblasts (Teri 19+) were identified and subdivided based on CD71 expression level and size. In order of increasing maturity, EryA were classified as Terl l9hlCD71hlFSChl, EryB as Teri 19hiCD71hlF SC10, and the most mature EryC as Teri 19hlCD7110FSC10. Analysis was performed using CytExpert® (Beckman Coulter, Brea, CA, USA).
[0184] Serum analysis
[0185] IL-6 and IL-4 levels in mouse serum were measured using the murine IL-6 and IL-4 pre-coated ELISA kit (Peprotech, Rehovot, IL) according to the manufacturer's instructions.
[0186] Hemoglobin measurement
[0187] At the time of sacrifice, mice were bled from the facial vein. The second drop (10 pL) of blood was collected in a capillary tube and subjected to hemoglobin measurement using a hemoglobinometer (Mission® Inc, San Diego, CA, USA).
[0188] Fecal occult blood detection
[0189] Feces were collected, weighed, and dissolved in 0.03 MNaOH at 1 mg / mL. In a 96 well plate, 5 pg of feces were placed in 50 pL of luminol working solution (10-2 M luminol, 0.03 M NaOH), followed by the addition of 50 pL 0.03% H2O2. The plate was read immediately on a luminometer at 425 nm (SpectraMax 13 X, San Jose, California, USA). A standard curve was generated by adding mouse blood with a known concentration of hemoglobin (measured on a hemoglobinometer) to negative control feces from the same naive WT mouse.
[0190] Statistical Analysis
[0191] All analyses for mouse experiments were conducted using GraphPad Prism v9.0. Data were analyzed by Student’ s t-test, One-Way ANOVA, Mann-Whitney U test, or Kruskal-Wallis test for continuous variables. Differences in weight loss were analyzed by two-way ANOVA for repeated measures over time. All results are expressed as mean values ±SD unless otherwise indicated, p < 0.05 was considered statistically significant.
[0192] Exome-wide association study and gene-based burden test
[0193] Exome-wide association study summary statistics and gene-based burden tests, wherein variants are tested in aggregate, for anal polyps and monocyte count generated by Backman et al and Barton et al were accessed via the GWAS Catalog [62, 63], The summary statistics for anal polyps include male and female UKBiobank participants of European ancestry, with 1480 cases and 386450 controls. The monocyte study included 443529 (exome study) or 418449 (gene-based burden test) UKBiobank participants of European ancestry. CNR2 and its containing haploblock were previously identified. A gene-enrichment analysis of CNR2 was performed and SNPs strictly in the exomic region with p<0.05 were identified via the Functional Mapping and Annotation (FUMA) platform. The LD matrix for significant and common CNR2 SNPs was generated using LDlink. Exomic data was validated via the Cohort Browser function on the UKB Research Assistant Platform DNAnexus(ukbiobank.dnanexus.com).
[0194] Example 1. OGP has a minimal effect on myelopoiesis and lymphopoiesis in wildtype mice at steady-state
[0195] From previous studies, we observed that OGP is not acutely or chronically toxic in ovariectomy and ear edema models. However, the effect of OGP administration on myelopoiesis and lymphopoiesis at steady-state was never assessed. In this study the effect of OGP (peptide having the amino acid sequences YGFGG (SEQ ID NO: 1) on immature myeloid cells and T cells in the spleen and bone marrow of naive wild-type (WT) mice was determined. Female mice were injected every seven days with 700 ng of OGP or vehicle control, and sacrificed one day after the third injection. Naive healthy mice receiving OGP displayed significantly smaller spleens compared to the vehicle control group, although body weight showed no differences (Figs. 1A-1B). Flow cytometry analysis revealed a significant decrease in T cells (CD3+, Fig. IE) and macrophages (Fig. 1C) in the spleen of OGP -treated mice. However, the CD4:CD8 T cell ratio in the spleen remained unchanged (Fig. IF). In the bone marrow, all these cell populations were not affected by OGP (Fig. 1G, II, 1 J). Furthermore, two subsets of CDl lb+ immature myeloid cells showed inverse trends as the Ly6G+Ly6Cint(granulocytic) decreased, while the Ly6G-Ly6C+ (monocytic) cells increased in both the spleen and bone marrow of OGP -treated mice (Fig. ID and 1H). It is important to note that all values were within the normal range for mice of this age. The observed changes in myeloid cell subpopulations did not lead to significant alterations, as the concomitant fluctuations led to an overall neutral effect, corroborated by comparable IL-6 and IL-4 serum levels between groups (Fig- 2).
[0196] Example 2. OGP attenuates adenoma formation and growth during the progression phase in ApcM,n / +mice
[0197] To assess the effect of OGP administration on the progression phase of colon cancer, eight-week-old ApcMin / +mice were injected either once weekly with 700 ng OGP, daily with 100 ng OGP, or a vehicle control for eight weeks and sacrificed two days after the last injection. Mice receiving either dose of OGP showed the same pattern in all parameters and are hereafter described together. Both male and female mice were used, as previous studies showed no sexdisparities in cancer development. The body weight and spleen weight showed no difference between groups (Fig. 3A-3B). Compared to the vehicle control, OGP -treated mice had significantly milder colonic shortening (Fig. 3C), a sign of severe inflammation and a marker of cancer progression. In other words, OGP -treated mice showed lower levels of inflammation and much reduced cancer progression than the control group. Although the gross number ofadenomas in the small intestine (SI) was not significantly different between groups, OGP- treated mice displayed significantly fewer large adenomas with a diameter greater than 2 mm (Fig. 3D). In the large intestine (LI), there was no difference in size of these adenomas (2-4 mm in all groups) but OGP -treated mice had significantly fewer adenomas than control mice (Fig. 3E). A common CRC screen in humans is the fecal occult blood test to quantify the blood in the stool, as polyps typically bleed intermittently. Using a method adapted and validated from Park et al (Biotechniques, 2018. 65(4): p. 227-230, it was demonstrated that ApcMin / +mice receiving OGP have significantly lower concentrations of blood in the feces compared to the vehicle control group (Fig. 3F). IL-6 and IL-4 serum levels showed no differences between groups (Fig. 4).
[0198] Further, we found that administration of OGP for one month to twelve-week-old naive WT mice significantly increased hemoglobin in males, but not in females; however, the effect on hemoglobin is no longer present in either sex after three months of injections (Fig. 5). In ApcMin / +mice (progression phase), we assessed the relative frequency of erythroblast populations and hemoglobin levels. Flow cytometry analysis of the bone marrow revealed that the subpopulations of erythroid precursors were the same in all groups, corroborated by similar hemoglobin levels (data not shown). In other words, it shows that OGP did not interfere with the production of red blood cells.
[0199] Example 3. OGP attenuates adenomagenesis during the initiation phase in ApcM,n / +mice
[0200] To determine the effect of OGP on adenoma formation during the initiation phase, ApcMin / +mice were injected with 700 ng OGP once per week for four weeks, starting at five weeks of age, and sacrificed two days after the last injection. Splenomegaly is a distinct characteristic of ApcMin / +mice and positively correlates with tumor development in these mice. In this experiment, no difference in body weight was observed. Nevertheless, OGP -treated mice displayed significantly smaller spleens compared to the vehicle control group (Fig. 6A-6B). The OGP -treated mice experienced reduced adenomas in both the SI and the LI, while colon length was the same between groups (Fig. 6C-6E). Fecal occult blood levels were significantly lower in OGP -treated mice, and fewer adenomas were observed in the LI (Fig. 6F).
[0201] Example 4. OGP reduces MDSC accumulation during the initiation phase in ApcM,n / +mice
[0202] As in the progression phase experiment, hemoglobin levels were similar between groups and no significant differences were observed in erythroblast populations of the bone marrow (Fig. 7A and 7B). OGP treatment in ApcMin / +mice during the initiation phase significantly decreased polymorphonuclear (PMN)- and monocytic (M)-MDSC populations in the spleen (Fig. 8A). Dendritic cells (DCs) were also significantly increased, while eosinophils (Eos) showed no difference compared to the vehicle control (Fig. 8A). Furthermore, OGP treatment altered the balance between CD4 and CD8 T cells in the spleen, with significantly higher CD8+ T cells and significantly lower CD4+ T cells in OGP -treated mice (Fig. 8B-8C). This shift in the CD4:CD8 T cell ratio favors a more cytotoxic immune response, likely contributing to the anti-tumorigenic effects of OGP in intestinal tumorigenesis. In contrast to the previous experiment started at 8 weeks of age to study tumor progression, the alterations in myeloid and T cell populations were accompanied by a significant decrease in IL-6 and IL-4 serum levels in OGP -treated mice (Fig. 8D).
[0203] Example 5. Rare genetic variants of CNR2 increase the risk of anal polyps in humans
[0204] ApcMin / +mice develop hundreds of adenomas over the course of their lifetime. The mouse model reflects familial adenomatous polyposis (FAP) in humans, which is also the result of mutations in the Ape gene. The role of rare CNR2 variants in anal polyps was assessed using data generated by Backman et al (Nature, 2021. 599(7886): p. 628-634). The exome-wide summary statistics showed two missense variants, and one frameshift variant as significantly associated with anal polyp occurrences (p<0.05, Fig. 9A). However, upon investigation in the UKBiobank data for these specific variants, each of these three variants only occur in one patient each. These singleton variants were most likely found to be significant because the number of controls is quite small, and the minor allele frequency (MAF) of the SNPs are quite low (MAF <0.01%). Seeing that rare variants could contribute to anal polyp development, we then assessed the gene-based burden test, which tests these variants on aggregate based on stratified MAF, to assess the role of rare CNR2 variants (MAF <1%) for this phenotype. The gene-based burden test showed that rare CNR2 variants that cause putative loss of function (MAF <0.001% and <0.01%) are associated with an increased risk of anal polyps (Fig. 9B). Rare CNR2 variants (MAF <0.001%) that cause a deleterious missense mutation (e.g. mutations leading to a change in protein stability, and disrupted interactions, etc.) were also significantlyassociated with the occurrence of anal polyps. In addition to mutations in the Ape gene, we found that mutations in MutS Homolog 2 (MSH2) also increase the risk of pre-cancerous polyps in the colon. CNR2 shows a notable effect level, especially compared to CNR1, albeit more modest than the aforementioned tumor suppressor genes (Fig. 9B).
[0205] Example 6. Association of common and rare CNR2 variants and peripheral blood monocyte count in humans
[0206] Further, an additional analysis of the association of peripheral blood monocyte count and CNR2 variants in UKBiobank participants was performed, using previously generated exomic association study summary statistics (Barton, A.R., et al., Nature genetics, 2021. 53(8): p. 1260-1269). In the present analysis, we found that many common variants as well as the two SNPs contributing to the functional variant Q63R (rs2502992 and rs2501432) are significantly associated with a lower monocyte count (p<0.05, Fig. 10A). These polymorphisms are in strong linkage disequilibrium (LD, r2=l) with the other common variants with an allele frequency >10% (data not shown). An assessment of the gene-based burden test generated by Backman et al showed that rare CNR2 variants (MAF <1% and <0.1%) that cause a deleterious missense mutation were also significantly associated with monocyte count (Fig. 10B). The effect of the rare variants is far more moderate than the effect of genes directly involved in monocyte survival and proliferation — colony stimulating factor 1 receptor (CSF1R), and fms-like tyrosine kinase 3 (FLT3) — although still notably significant compared to CNR1.
[0207] Example 7
[0208] Mice on a C57B1 / 6J genetic background were bred in the specific pathogen-free (SPF) animal facility in Tel Aviv University. All mice were housed as per IACUC guidelines in temperature-controlled rooms with a 12-hour light cycle and were given water and pelleted chow ad libitum. All experiments were conducted in accordance with the guidelines and with the approval of the Tel Aviv University Animal Care and Use Committee (Protocols 01-18-059 and 01-21-010). In this chemically-induced cancer model, 6-week-old female mice, ten per group, were given a single intraperitoneal injection of AOM (12 mg / kg body weight). Three days after the AOM injection, the mice were given 2.5% DSS in their drinking water for 7 days in weeks 1, 4, and 7. Mice were injected with 700 ng OGP / mouse or vehicle control weekly. Cancer progression in all mice was monitored through body weight, fecal occult blood, and colonoscopy. After 11 weeks, the mice were anesthetized with ketamine (80 mg / kg) andxylazine (12 mg / kg) followed by cervical dislocation and organ harvest. Large and small intestines were measured and polyps were counted.
[0209] The results are presented in Figs 11A and 11B. It can be seen that as in previous examples, OGP significantly reduced the number of polyps in AOM-DSS treated mice and prevented loss in weight. Our data therefore demonstrate that OGP attenuates cancer initiation and progression in 2 models of colon cancer (chemically-induced or genetically-induced) in immunocompetent mice, likely via actions directed on cells of the immune system.
[0210] Example 8. Use of OGP and CAR
[0211] Our data demonstrating that 5 amino acid peptide OGP blocks the initiation and progression of colon cancer via the alleviation of the immunosuppressive TME strongly support the notion that CB2 activation attenuates tumorigenesis across different cancer types via activation of CB2 on immune cells. In this example, we test the role of OGP in potentiating the host immune response against tumor development combined with targeted CAR-T therapy against multiple myeloma (MM) and breast cancer (BCa) in immunocompetent mice.
[0212] In the MM model, MOPC.BM.Luc mouse MM cells (cell line kindly provided by A. Beilhack, Wurzburg University Hospital), infected to overexpress a human CD138 as a targeting moiety to mimic CD138 levels in human MM, are used. The resulting CD138. MOPC.BM.Luc cells are engrafted in the syngeneic Balb / c mice. Tumor progression is assessed using bioluminescence imaging, and by following tumor-bearing mice for signs of paraplegia. Splenocytes are generated from Balb / c mice, activated and genetically manipulated to express the anti-CD138 CAR using a retroviral expression system. Functional activity of the CAR-T-cells is confirmed in vitro based on IFN-y secretion and killing assays. Treatment of the mice with CAR-T cells initiated 26 days after tumor injection resulted in inhibition of tumor growth, reduction in paraprotein level and delayed onset of paraplegia. However, around day 48, tumors relapsed (Fig. 12), supposedly due to the immunosuppressive TME. Without being limited to any particular theory it is assessed that combining such CAR T treatment with local secretion of OGP overcomes this known obstacle or TME and enhances tumor elimination.
[0213] In an additional experiment the concept of co-administering CAR T cells treatment together with OGP treatment in a BCa model, as another proof of concept for a malignancy that involves immunosuppressive TME. For BCa, an anti-ErbB2 CAR T cells are used and in vivo spontaneous murine breast cancer model expressing human ErbB2 (Her2NG,), recently calibrated and used in Dr Globerson-Levin’s lab with anti-ErbB2 (4D5) CAR-T therapy, is exploited as described in Globerson-Levin A, Waks T, Eshhar Z. Elimination of progressivemammary cancer by repeated administrations of chimeric antigen receptor-modified T cells. Mol Ther. 2014 May ;22(5): 1029-38. doi: 10.1038 / mt.2014.28. Epub 2014 Feb 27. PMID: 24572294.
[0214] It is already known that repeated administrations of CAR-modified T cells are required to eliminate these spontaneously occurring breast cancer (Globerson-Levin A, Waks T, Eshhar Z. Elimination of progressive mammary cancer by repeated administrations of chimeric antigen receptor-modified T cells. Mol Ther. 2014 May ;22(5): 1029-38. doi: 10.1038 / mt.2014.28. Epub 2014 Feb 27. PMID: 24572294). Following systemic or intratumoral administration, the CAR- modified T cells accumulated at tumor sites and eventually eliminated the malignant cells. However, despite the seemingly complete rejection of the primary lesion, most tumors relapsed.
[0215] Our invention includes the design and evaluation of the efficiency of different CAR T cells, e.g. T cells comprising anti-CD138 or anti-ErbB2 (HER2) CARs and an inducible promoter for targeted release of OGP in the respective MM and BCa TME (see the design in Fig. 12). The treatment is compared to CAR-T cells that do not secrete OGP peptide and with and without systemically administered OGP.
[0216] Specific examples:
[0217] 2.1 Design the anti-CD138 and anti-ErbB2 CAR constructs encoding inducible OGP (CD138-iCAR and ErbB2-iCAR, respectively, Fig. 13).
[0218] 2.2.1 In vitro testing of the CD138 / ErbB2-iCAR-T cells to specifically secret OGP upon CAR stimulation / recognition. The designed CD138-iCAR-T and ErbB2-iCAR-T cells are cultured with MM and BCa cells, respectively. Recognition and activation of the engineered iCAR-T cells is evaluated using the killing assay and OGP secretion in the supernatant is tested by ELISA.
[0219] 2.2.2 In an alternative example, anti-CD138 or anti-ErbB2 CAR T cells are administered simultaneously with a composition comprising OGP.
[0220] 2.3 Asses the in vivo effect of local and systemic OGP treatments vs. iCAR in MM and BCa immunocompetent mouse models.
[0221] The CD138.MOPC.BM.Luc cells are engrafted into the syngeneic Balb / c mice to induce MM. As a model of BCa, we use a variant of the HER2NG (spontaneously occurring BCa), in which the original tumor is transplanted into immunocompetent FVB mice to facilitate and enlarge the number of BCA-carrying mice per experiment. Notably, the mice are immunocompetent, and tumors develop within 2-3 weeks with an immunosuppressive TME including dendritic cells, Tregs, TAMs and MDSCs. For both models, CAR T cells are designedwith fluorescent signals to determine their bio distribution and activation state (IVIS in vivo, FACS and histology, e.g. as shown in Figs. 12 and 13).
[0222] For each one of the models, mice are divided into the following treatment groups: saline, iCAR T cells, CAR T+ OGP, and OGP. The treatment is administered IM or IP.
[0223] Cancer-related experimental outcomes include survival, tumor number, mean size, and evaluation of the immunosuppressive environment (FACS, nitric oxide concentration to evaluate the immunosuppressive TME as in (Iden et al. The Anti-Tumorigenic Role of Cannabinoid Receptor 2 in Colon Cancer: A Study in Mice and Humans. Int J Mol Sci. 2023 Feb 17;24(4):4060. doi: 10.3390 / ijms24044060. PMID: 36835468). In the TME, in addition to CAR T cell infiltration, T cells (CD4+ / CD8+ / Treg), MDSCs populations (including polymorphonuclear cells, dendritic cells, macrophages, and monocytic MDSCs), and eosinophils are examined. A synergistic effect of CAR T cells and OGP is observed and a longterm treatment is obtained.
[0224] Cancer-related experimental outcomes include survival, tumor number and mean size (fluorescent and luminescent live imaging, histology of the CAR T cells), and evaluation of the immunosuppressive environment (FACS, nitric oxide concentration). In the MM model we also analyze bone related outcomes using microCT to assess osteolytic lesions, bone density and microarchitecture. As a secondary outcome, we also measure hematocrit, especially in the MM model as this disease is often associated with severe anemia.
[0225] Conclusions
[0226] The intricate pathophysiology of colon cancer encompasses a complex interplay of genetic predispositions and dynamic interactions among various immune cell populations, contributing to the onset and progression of the disease. The results of the present invention demonstrate the immunomodulatory and anti-tumorigenic role of CB2 activation via its endogenous selective agonist OGP in both the initiation and progression phases of colon cancer. Our findings highlight the context-dependent nature of OGP, as evidenced by its distinct behavior under cancer-associated inflammation and steady-state conditions.
[0227] In naive mice, we observed OGP treatment had a minimal overall effect on myelopoiesis, indicating this CB2 agonist has no immunosuppressive actions in healthy animals. Although the subpopulations of immature myeloid cells we tested (Fig. 1A-1J) are similar to MDSCs and have the same surface markers, MDSCs are not present at steady-state. The accumulation of MDSCs is a multifaceted phenomenon and hinges on two signal types: the first signal prompts the proliferation of immature myeloid cells while inhibiting their final maturation, and the second signal drives the pathological activation of these cells, transformingthem into MDSCs. While the effect of OGP was physiologically negligible in naive mice, the ability of this peptide to significantly impact the proliferation of immature myeloid cells, i.e. the first signal, was still observed, indicating that these cells are a principal target of OGP. By comparing naive WT mice to ApcMin / +mice, we showed this effect of OGP is biologically significant in cancer (i.e. OGP effect on MDSCs results in suppressed adenoma growth and formation), but insignificant in the absence of inflammation.
[0228] We assessed two low doses of OGP, 700 ng once weekly and 100 ng daily, to determine if one weekly injection is sufficient in mitigating adenomagenesis. Indeed, we found that during the progression phase, wherein adenoma growth is the predominant feature, both OGP doses exhibited the same anti-tumorigenic effect with significantly smaller adenomas in the SI, and decreased incidence in the LI. In the initiation phase of CRC, wherein adenomagenesis is rampant, OGP treatment evidently reduced adenoma formation. This effect was corroborated by a prominent depletion in the splenic populations of PMN-MDSCs, M-MDSCs, and CD4+ T cells, along with decreased serum levels of IL-6 and IL-4, cytokines known to promote proliferation of MDSCs and tumor growth. Without being limited to a particular theory, this prevailing evidence supports the notion that OGP mediates MDSC proliferation and / or IL-6 secretion, thus inhibiting adenomagenesis. Differences in IL-6 and IL-4 were not seen in the progression phase. Whereas this finding might be attributed to extensive inflammation evident in later stages of cancer in which the effect of OGP is more moderate on cytokine secretion or immune cell proliferation, it prompts a consideration of CB2 activation on intestinal epithelial cells, as their expression of CB2 in more advanced phases of cancer is increased.
[0229] ApcMin / +mice lose weight gradually after 14 weeks of age, perhaps explaining why no differences in weight loss were observed in either phase, although a decrease in spleen weight was noted in mice receiving OGP treatment during the initiation phase. We found significant differences in fecal occult blood in both phases of cancer. We did not observe, however, significant differences in hemoglobin levels or erythroid precursors between groups, with all mice showing the recognized marked shift towards immature erythropoiesis. We found that male WT mice treated with OGP for one month did not experience age-related hemoglobin reduction, although this effect is not present in males or females after three months of OGP administration. While we observed myelopoiesis to be significantly altered in OGP -treated mice in the colon cancer model, differences in erythropoiesis were not seen. Without being limited to any particular theory, this observation may be explained by an age-dependent mechanism or biased signaling and functional selectivity of CB2 activation, alluding to the context-dependent nature of OGP.
[0230] We found that rare CNR2 variants potentially increase the risk of anal polyps in humans, although moderately compared to known tumor-suppressor genes. While the exomic variant data does not elucidate specific alterations in the function of CNR2 or agonist binding, it sheds light on a potential link between CNR2 and colon cancer risk. Additionally, we showed a likely connection between monocyte count in peripheral blood and rare and common CNR2 variants. For the common variants, the mutation increases the likelihood of a lower monocyte count. This aligns with the effect of OGP in naive mice on monocytic immature myeloid cells in the spleen and bone marrow. Without being limited to any particular theory, it is stipulated that upon activation of CB2 by OGP, this population of cells significantly increased, whereas variants, particularly those contributing to Q63R leading to a less functional CB2 conceivably, decrease monocyte count in the peripheral blood. Without being bound to any particular theory we assess that CNR2 functionality could affect specific monocyte subtypes more than others, affecting the balance between pro- and anti-inflammatory monocytes.
[0231] Overall, the results in the present invention portray OGP as a potent anti-tumorigenic peptide, particularly in the initial stages of colon cancer, with significant immunomodulatory functions. Our findings provide therefore valuable insights into the multifaceted role of OGP, and establishing a foundation for use of OGP in treating cancer, and specifically CRC.
[0232] The above-described results provide a proof of concept. We have evidence suggesting that the anti-cancer actions of OGP are not restricted to colon cancer just as growth peptides (GP) are not restricted to colon cancer. Our previous studies showed that CB2 knockout in mice resulted in the development of spontaneous tumors in different organs in aged mice such as non-melanoma skin cancer It was previously demonstrated that the APCMin / +CB2' / ' mice show enhanced splenic population of dendritic cells as well as immunosuppressive and tumorpromoting cells called granulocytic-myeloid derived suppressor cells (MDSC, versus APCMm / +CB2+ / +mice) (Iden et al. The Anti-Tumorigenic Role of Cannabinoid Receptor 2 in Colon Cancer: A Study in Mice and Humans. Int J Mol Sci. 2023 Feb 17;24(4):4060. doi: 10.3390 / ijms24044060. PMID: 36835468). Importantly, we found according to the teaching of the present invention that exogenous administration of OGP resulted in an outcome opposite to the one observed in CB2 / _mice (Iden et al. The Anti-Tumorigenic Role of Cannabinoid Receptor 2 in Colon Cancer: A Study in Mice and Humans. Int J Mol Sci. 2023 Feb 17;24(4):4060. doi: 10.3390 / ijms24044060. PMID: 36835468), i.e. OGP reduced the number of tumors and overall cancer severity via an increase in T cells and decrease in the number of MDSCs. These observations support the notion that OGP attenuates tumorigenesis across different cancer types via activation its effect on immune cells. Notably, this aspect has beenmostly overlooked as most studies pertaining to CB2 were conducted using established cancer cell lines that were already selected for their ability to evade immune surveillance or xenografts implanted in immunodeficient mice.
[0233] Example 9
[0234] In this experiment, the effect of co-therapy of CAR T cells and OGP was tested. The experiment was performed as described in Example 8.
[0235] The CD138.MOPC.BM.Luc cells were engrafted into the syngeneic Balb / c mice to induce MM. Notably, the mice were immunocompetent, and tumors developed within 2-3 weeks with an immunosuppressive TME including dendritic cells, Tregs, TAMs and MDSCs. The anti-CD138 CAR T cells were designed with fluorescent signals to determine their biodistribution and activation state.
[0236] Mice were divided into the following treatment groups: saline, OGP administered IP (OGP I.P.), anti-CD138 CAR T cells administered IV (CAR IV), CAR T cells overexpressing OGP administered IV (CAR.OGP.I.V) and a last group where CAR T cells were administered IV together with OGP administered IP (CAR I. V.+OGP I P).
[0237] On day -1 and -2 the mice were irradiated with 90 Rad. On day 1 the mice were injected with 2* 106MOPC.hCD138.luc cells per mouse. On day 34 mice were irradiated with 200 Rad. On days 35 and 37 mice were injected with CAR-T cells (CD138.CAR (SEQ ID NO:60) or CD138. IRES. OGP. HA.CAR (SEQ ID NO: 20) according to the group). Each week the mice were injected with 50 pl of luciferase 10 minutes before imaging. The groups marked with OGP IP (OGP only IP and CD138 IV + OGP IP) were injected with 700 ng of short OGP once a week. If a mouse reduced more than 10% weight from the previous weighing or 15% from the initial weight, or if mouse dragged its legs, then the mouse was sacrificed. A - mice were photographed from the back, B - mice were photographed from the front.
[0238] Cancer-related experimental outcomes include survival, tumor number, mean size, and evaluation of the immunosuppressive environment (FACS, nitric oxide concentration to evaluate the immunosuppressive TME as in (Iden et al. The Anti-Tumorigenic Role of Cannabinoid Receptor 2 in Colon Cancer: A Study in Mice and Humans. Int J Mol Sci. 2023 Feb 17;24(4):4060. doi: 10.3390 / ijms24044060. PMID: 36835468). In the TME, in addition to CAR T cell infiltration, T cells (CD4+ / CD8+ / Treg), MDSCs populations (including polymorphonuclear cells, dendritic cells, macrophages, and monocytic MDSCs), and eosinophils are examined.
[0239] The results are present in Figs 14-16 and Table 1.
[0240] Table 1. Number of mice in different treatment group as a function of time
[0241] From the presented data it can be seen that there is a significant difference between mice treated with CAR T cells, either with or without OGP and group received only OGP. This is seen clearly on Figs. 15A and 15B showing that the size of the tumor in the OGP group does not differ from tumor of untreated group and in Fig 16 demonstrating the survival of OGP mice is similar to that of the untreated mice. It can be concluded that OGP by itself does not affect development of multiple myeloma. On the other hand, OGP did affect the treatment of MM with anti-CD138 CAR T cells (denoted on Figures as CD 138). It can be seen from Fig. 17 that the best survival was observed in the group when OGP was administered IP (in addition of IV administration of anti-CD138 CAR T cells) — 50% survival until the end of experiment. Considering that OGP per se does not provide any effect, these results clearly unexpected and demonstrate synergistic effect of OGP and CAR. A more moderate increase in survival was seen in the group treated with anti-CD138 CAR T cells expressing OGP (CD138.IRES.OGP.HA.IV) in comparison to mice treated anti-CD138 CAR T cells only. The better results indicate the effect that OGP had on anti-CD138 CAR T cells which is unexpected. Without being limited to any particular theory it is assumed that further modifications in construct and OGP expression and secretion for CAR T cells would lead to further improvement. To conclude, it can be seen from the examples, that a synergistic effect of CAR T cells and OGP was observed and a long-term treatment is obtained.
[0242] Example 10
[0243] The effect of anti-HER2 CAR T cells in combination with OGP were tested similarly to the experimental set up described in Example 9.
[0244] Shortly, tumors from FVB Her2 positive mice were inoculated and injected to negative mice on day 1.
[0245] Mice were divided into the following treatment groups: saline, OGP administered IP (OGP I P ), anti-HER2 CAR T cells administered IV (CAR IV - SEQ ID NO: 50) CAR T cells overexpressing OGP administered IV (CAR.OGP.I.V - SEQ ID NO: 22 or 23) and anti-HER2 CAR T cells administered IV and OGP administered IP (CAR I. V.+OGP I.P).
[0246] On day 12 OGP IP groups were injected with 700 ng / mouse of short OGP. On day 15 the CAR groups were injected with anti -HER CAR-T cells (either with or without OGP). Each week OGP IP groups were continuously injected with 700ng / mouse short OGP. All mice were measured for tumor growth once a week with caliper.
[0247] As in Experiment 8, much better survival is observed in mice treated with anti-HER CAR-T cells co-treated with OGP (either by IP injection or co-expressed) in comparison to the group treated with anti-HER CAR-T cells.
[0248] Although the present invention has been described herein above by way of preferred embodiments thereof, it can be modified, without departing from the spirit and nature of the subject invention as defined in the appended claims.
Claims
CLAIMS1. A population of immune cells engineered to express (i) a chimeric antigen receptor (CAR) binding specifically to a tumor associated antigen and (ii) an active Osteogenic Growth Peptide (OGP) comprising the amino acid sequence YGFGG set forth in SEQ ID NO: 1 and consisting of from 5 to 120 amino acids.
2. The population of immune cells according to claim 1, comprising a nucleic acid construct comprising a nucleic acid sequence encoding the CAR and a nucleic acid construct comprising a nucleic acid sequence encoding the active OGP.
3. The population of immune cells according to claim 2, wherein the nucleic acid molecule encoding the CAR is operably linked to a constitutive promoter and the nucleic acid molecule encoding the active OGP is operably linked to (i) an inducible promoter, said promoter initiates the expression of the active OGP upon activation of the CAR; or (ii) a constitutive promoter.
4. The population of immune cells according to claim 3, wherein the immune cells express the CAR constitutively.
5. The population of immune cells according to claim 3, wherein the nucleic acid molecule encoding the active OGP is operably linked to an inducible promoter, and wherein the promoter initiates the expression of said OGP upon activation of a T cell receptor.
6. The population of immune cells according to claim 5, wherein the immune cells express the active OGP peptide upon activation of the CAR.
7. The population of immune cells according to claim 3, wherein the nucleic acid molecule encoding the active OGP is operably linked to a constitutive promoter and the immune cells express the CAR and the active OGP peptide constitutively.
8. The population of immune cells according to claim 1, comprising a nucleic acid construct comprising a nucleic acid molecule comprising a nucleic acid sequence encoding the CAR and a nucleic acid sequence encoding the active OGP, wherein said nucleic acid molecule is operably linked to a constitutive promoter.
9. The population of immune cells according to claim 1 , wherein the nucleic acid construct comprises a nucleic acid sequence selected from SEQ ID NOs: 20, 21, 22 and 23.
10. A pharmaceutical composition comprising the population of immune cells according to any one of claims 1 to 9, and a pharmaceutically acceptable carrier.
11. A pharmaceutical composition comprising (i) a population of immune cells engineered to express a chimeric antigen receptor (CAR) binding specifically to a tumor associated antigen, (ii) an active OGP peptide comprising the amino acid sequence YGFGG set forth as SEQ ID NO: 1 and consisting of from 5 to 120 amino acids, and (iii) a pharmaceutically acceptable carrier.
12. The pharmaceutical composition according to claim 10 or 11, for use in treating cancer.
13. A therapeutic combination comprising (i) a population of engineered immune cells engineered to express a chimeric antigen receptor (CAR) that binds specifically to a tumor associated antigen and (ii) an active OGP peptide comprising the amino acid sequence YGFGG set forth as SEQ ID NO: 1 and consisting of from 5 to 120 amino acids.
14. A kit comprising (i) a population of engineered immune cells engineered to express a chimeric antigen receptor (CAR) that binds specifically to a tumor associated antigen, (ii) an active OGP peptide comprising the amino acid sequence YGFGG set forth as SEQ ID NO: 1 and consisting of from 5 to 120 amino acids, and (iii) instruction for use of said kit.
15. The therapeutic combination according to claim 13 or the kit of claim 14, for use in treating cancer.
16. The therapeutic combination or kit for use according to claim 15, wherein the immune cells are characterized by a surface expression of the CAR.
17. The therapeutic combination or kit for use according to claim 15 or 16, wherein the use comprises co-administering the engineered immune cells and the active OGP in a regimen selected from a sequential administering or a substantially simultaneous administering.
18. A pharmaceutical composition comprising an active Osteogenic Growth Peptide (OGP), for use in treating cancer, wherein the active OGP comprises the amino acid sequence YGFGG set forth as SEQ ID NO: 1 and consists of from 5 to 120 amino acids.
19. The pharmaceutical composition for use according claim 18, wherein the use comprises co-administration of the pharmaceutical composition and an additional anti-cancer agent.
20. The pharmaceutical composition for use according to claim 19, wherein the additional anti-cancer agent comprises a population of T cells engineered to express a chimeric antigen receptor binding specifically to a tumor associated antigen (CAR T cells).
21. The population of immune cells, pharmaceutical composition, pharmaceutical composition for use or therapeutic combination for use or the kit for use according to any one of claims 12 and 15 to 20, wherein (i) the active OGP comprises or consists of an amino acid sequence selected from YGFGG (SEQ ID NO: 1) and ALKRQGRTLYGFGG (SEQ ID NO: 2), (ii) the active OGP consists of from 5 to 20 amino acids, and / or (iii) the cancer expresses cannabinoid receptor 2 (CB2).
22. The subject matter according to any one of claims 12 and 15 to 21, wherein the cancer is selected from a colon cancer, multiple myeloma, breast cancer, ovarian cancer, blood cancer, non-melanoma skin cancer, squamous cell carcinoma, and (SCC) and basal cell carcinoma (BCC).
23. The subject matter according to any one of claims 12 and 15 to 22, wherein the use comprises inhibition the progression and / or prevention the initiation of the cancer.
24. The subject matter according to claims 22 or 23, wherein the cancer is a colon cancer.
25. The subject matter according to claim 24, wherein the use comprises inhibition of adenomas formation and growth.
26. The subject matter according to claim to claims 22 or 23, wherein the cancer is multiple myeloma.
27. The subject matter according to claim 22 or 23, wherein the cancer is breast cancer.
28. The subject matter according to any one of claims 12 and 15 to 27, wherein the use provides a long-term treatment.
29. The subject matter according to according to any one of claims 12 and 15 to 28, wherein the use provides a synergistic anti-cancer effect.
30. The subject matter of any one of claim 1 to 17 and 20 to 29, wherein the CAR binds specifically to a tumor associated antigen selected from HER2 / Erbb2, CD 138, CD38, CD 19, CD276, EGFR, GCC19, GUCY2C or CD166.
31. The subject matter of claim 30, wherein (i) the CAR binds specifically to CD138 and comprises an amino acid sequence selected from SEQ ID NO: 61 and a combination of SEQ ID NOs: 62 and 63, or (ii) CAR binds specifically to HER2 and comprises an amino acid sequence selected from SEQ ID NO: 34, and a combination of SEQ ID NOs: 35 and 36.
32. A nucleic acid construct comprising a nucleic acid molecule comprising a nucleic acid sequence encoding a CAR that binds specifically to a tumor associated antigen and a nucleic acid sequence encoding an active OGP peptide comprising the amino acid sequence YGFGG set forth as SEQ ID NO: 1 and consisting of from 5 to 120 amino acids, wherein each one of the nucleic acid sequences is operably linked to a promoter or both nucleic acid sequences are operably linked to one promoter.
33. The nucleic acid construct according to claim 32, wherein both nucleic acid sequences are operably linked to one constitutive promoter.
34. The nucleic acid construct according to claim 33, further comprising a cleavable nucleic acid molecule or a nucleic acid molecule encoding a self-cleaving peptide between the two nucleic acid sequences.
35. The nucleic acid construct according to claim 32, wherein the nucleic acid sequence encoding the CAR is operably linked to a constitutive promoter and the nucleic acid sequence encoding the active OGP is operably linked to (i) an inducible promoter, said promoter initiates the expression of OGP upon activation of the CAR; or (ii) a constitutive promoter.
36. The nucleic acid construct according to any one of claims 32 to 35, wherein (i) the CAR binds specifically to a tumor associated antigen selected from ErbB2, CD 19, CD38, CD 138, EGFR, CD276, CD24, GD2, EGF, BCMA, MUC-1, FAP, Mesothelin (MSLN), MUC16, GCC19, GUCY2C or CD 166.
37. The nucleic acid construct according to claim 36, wherein the CAR binds specifically to CD138 and comprises the nucleic acid sequences selected from SEQ ID NO: 20, 21, SEQ ID NOs: 24 and 25, SEQ ID NO: 24, 26, 27, 59, 60 and 71.
38. The nucleic acid construct according to claim 36, wherein the CAR binds specifically to HER2 and comprises the nucleic acid sequences selected from SEQ ID NO: 22, 23, 29, 30, and 49, 50, 51.
39. A vector comprising the nucleic acid construct according to any one of claims 32 to 38.
40. A cell comprising the construct according to any one of claims 32 to 38 or the vector according to claim 39.
41. The cell according to claim 40, wherein the cells is a T cell.
42. A method of treating cancer in a subject in need thereof comprising co-administering to the subject a therapeutic combination of (i) engineered immune cells and (ii) an active OGP peptide comprising the amino acid sequence YGFGG set forth in SEQ ID NO: 1, optionally consisting of from 5 to 120 amino acids, wherein the immune cells are engineered to express a chimeric antigen receptor (CAR) that binds specifically to a tumor associated antigen.
43. A method of treating cancer in a subj ect in need thereof comprising administering to the subject a therapeutically effective amount of immune cells engineered to express (i) a chimeric antigen receptor (CAR) that binds specifically to a tumor associated antigen, and (ii) an active OGP peptide comprising the amino acid sequence YGFGG set forth in SEQ ID NO: 1 and consisting of from 5 to 120 amino acids.
44. A method of treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount an active OGP peptide comprising the amino acid sequence YGFGG set forth in SEQ ID NO: 1 and consisting of from 5 to 120 amino acids.