Use of tigit gene locus as a car integration site for generation of car expressing immune cells

CRISPR/Cas9 systems are used to genetically modify NK cells by knocking out TIGIT and inserting CARs, addressing immune suppression and enhancing NK cell antitumor activity for effective cancer treatment.

WO2026085461A1PCT designated stage Publication Date: 2026-04-23RES INST AT NATIONWIDE CHILDRENS HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
RES INST AT NATIONWIDE CHILDRENS HOSPITAL
Filing Date
2025-10-17
Publication Date
2026-04-23

AI Technical Summary

Technical Problem

Human peripheral blood natural killer (NK) cells exhibit immune suppression and genetic modification is challenging due to high expression of innate sensing mechanisms for viral nucleic acids, limiting their effectiveness in clinical applications.

Method used

The use of CRISPR/Cas9 systems for genetically engineering NK cells by knocking out the T cell immunoreceptor with Ig and ITIM domains (TIGIT) and simultaneously knocking in a chimeric antigen receptor (CAR) through plasmids and AAV vectors, facilitated by electroporation and homology arms for precise genome editing.

Benefits of technology

Enhances the antitumor activity of NK cells by reducing immune suppression and enabling targeted cancer treatment, including leukemias, lymphomas, and solid tumors, with improved cytotoxicity and specificity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000034_0001
    Figure IMGF000034_0001
  • Figure 00000055_0000
    Figure 00000055_0000
  • Figure 00000056_0000
    Figure 00000056_0000
Patent Text Reader

Abstract

Disclosed are plasmid and methods for genetically engineering NK cells using a CRISPR / CAS9 system to knock out TIGIT while simultaneously knocking in a chimeric antigen receptor (CAR). In some aspects, disclosed herein are method of using such engineering NK cells for treating cancers.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Docket No. 10935-036W01

[0002] USE OF TIGIT GENE LOCUS AS A CAR INTEGRATION SITE FOR GENERATION OF CAR EXPRESSING IMMUNE CELLS

[0003] RELATED APPLICATION

[0004] This PCT application claims priority to, and the benefit of, U.S. Provisional Patent Application No. 63 / 708,746, filed October 17, 2024, entitled “USE OF THE TIGIT GENE LOCUS AS A CAR INTEGRATION SITE FOR GENERATION OF CAR EXPRESSING IMMUNE CELLS,” which is incorporated by reference herein in its entirety.

[0005] REFERENCE TO SEQUENCE LISTING

[0006] The sequence listing submitted on October 17, 2025, as an .XML file entitled “10935- 036WOl_ST26” created on October 17, 2025, and having a file size of 48,696 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5).

[0007] FIELD

[0008] The present disclosure relates compositions and methods for genetically engineering NK cells using a CRISPR / Cas9 system to knock out T cell immunoreceptor with Ig and ITIM domains (TIGIT) while simultaneously knocking in a chimeric antigen receptor (CAR).

[0009] BACKGROUND

[0010] Human peripheral blood natural killer (NK) cells have intense antitumor activity and have been used successfully in several clinical trials. However, NK cells can be subject to immune suppression and genetic modification of NK cells has been challenging due to the high expression of innate sensing mechanisms for viral nucleic acids. What are needed are new methods and vectors for engineering NK cells.

[0011] SUMMARY

[0012] Disclosed are methods and compositions related to electroporation of NK cells for delivery of a CRISPR / CAS9 gene editing system to a cell (e.g., NK cell).

[0013] In one aspect, disclosed herein are plasmids for use with clustered regularly interspaced short palindromic repeat (CRISPR) / CRISPR-associatcd 9 (Cas9) integration systems wherein the plasmid comprises in order a left homology arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide (such as, for example, a Docket No. 10935-036W01

[0014] CAR comprising a scFv targeted to a receptor on a target cell (e.g., CD33), a transmembrane domain (e.g.. an NKG2D transmembrane domain, a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, and / or a CD3g transmembrane domain), a costimulatory domain (e.g., a 2B4 domain, a CD28 co-stimulatory domain, a 4-1 BB co-stimulatory domain, or any combination of a 2B4 domain, a CD28 co-stimulatory domain, and / or a 4-1 BB co-stimulatory domain), and a CD3g signaling domain), and a right homology arm; wherein the left and right homology arms are each lOOObp in length or less (for example, 30 bp in length, 300 bp in length, 600 bp in length).

[0015] Also disclosed herein are plasmids for use with CRISPR / Cas9 integration systems of any preceding aspect, wherein the left homology arm and right homology arm are the same length or different lengths. In some aspects , the homology arms specifically hybridize to the T Cell Immunoreceptor with Ig And ITIM Domains (TIGIT) gene of humans.

[0016] In some embodiments, disclosed herein are plasmids for use with CRISPR / Cas9 integration systems of any preceding aspect, wherein the plasmid further comprises a murine leukemia virus-derived (MND) promoter.

[0017] Also disclosed herein are Adeno-associated viral (AAV) vectors (such as, for example, an AAV vector comprising the AAV6 serotype) comprising the plasmid of any preceding aspect. In some aspects, AAV plasmids further comprise a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide. In some embodiments, the vector further comprises a plasmid encoding a crRNA, a tracer RNA (trcrRNA), and a Cas endonuclease. The AAV vector can be a single stranded AAV (ssAAV) or a self- complimentary AAV (scAAV).

[0018] In one aspect, disclosed herein are modified cells (such as, for example NK cells and NK T cells) comprising the plasmid or the AAV vector of any preceding aspect.

[0019] Also disclosed herein are methods of treating, decreasing, reducing, inhibiting, ameliorating, and / or preventing a cancer and / or metastasis (such as, for example, leukemia, acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), hairy cell leukemia (HCL), or myelodysplastic syndromes (MDS), lymphoma, multiple myeloma, rhabdomyosarcoma, a brain tumor, neuroblastoma, breast cancer, or Ewing’s sarcoma family tumor) in a subject comprising administering to a subject with a cancer the modified cell of any preceding aspect.

[0020] In one aspect, disclosed herein are methods creating a chimeric antigen receptor (CAR) natural killer (NK) cell or CAR NK T cell comprising a) obtaining a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) Docket No. 10935-036W01 complexed with a corresponding CRISPR / Cas guide RNA and an AAV vector comprising a plasmid comprising a transgene (such as, for example, a chimeric antigen receptor for a tumor antigen); wherein the transgene is flanked by homology arms; and wherein the homology arms are lOOObp in length or less (such as, for example, 600bp in length); and wherein the homology arms of RNP complex specifically hybridize to the T Cell Immunoreceptor with Ig And ITIM Domains (TIGIT) gene within the genomic DNA of the NK or NK T cell; and b) introducing the transgene and the RNP complex into an NK cell or NK T cell; wherein the transgene (such as, for example, a chimeric antigen receptor for a tumor antigen including, but not limited to CD33, B cell maturation antigen (BCMA), G protein-coupled receptor class C group 5 member D (GPRC5D), CD 19, guanylate cyclase-C (GUCY2C), B7 homolog 3 protein (B7-H3), epidermal growth factor receptor (EGFR), disialoganglioside 2 (GD2), IL-13 Ra2, human epidermal growth factor receptor 2 (HER2), CD20, CD22, or mucin-1 (MUC1)) is introduced into the NK cell or NK T cell via infection with the Adeno-associated virus (AAV); wherein the RNP complex hybridizes to a target sequence within the genomic DNA of the NK cell or NK T cell and the DNA repair enzymes of the NK cell or NK T cell insert the transgene into the host genome (for example, by homologous repair) at the target sequence, thereby creating a CAR NK cell or CAR NK T cell. In some aspects, the RNP complex can be introduced into the cell via electroporation. In some aspects, the RNP complex can be introduced into the cell via viral delivery in the same or a different AAV (i.e., superinfection).

[0021] In one aspect, disclosed herein are methods of genetically modifying a cell (T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and / or muscle cells, including, but not limited to primary or expanded cells) comprising a) obtaining a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA and an AAV vector comprising a plasmid comprising a chimeric antigen receptor (CAR) polypeptide; wherein the polynucleotide sequence is flanked by homology arms; and wherein the homology arms are 1000 bp in length or less (such as, for example, 600bp in length); and wherein the homology arms of RNP complex specifically hybridize to the T Cell Immunoreceptor with Ig And ITIM Domains (TIGIT) gene within the genomic DNA of the NK or NK T cell; and b) introducing the polynucleotide sequence and the RNP complex into the cell; wherein the polynucleotide sequence is introduced into the cell via infection with the AAV into the cell; wherein the RNP complex hybridizes to a target sequence within the genomic DNA of the cell and the cell’s DNA repair enzymes insert the transgene (such as, Docket No. 10935-036W01 for example a CAR that targets CD33, B cell maturation antigen (BCMA), G protein-coupled receptor class C group 5 member D (GPRC5D). CD19, guanylate cyclase-C (GUCY2C), B7 homolog 3 protein (B7-H3), epidermal growth factor receptor (EGFR), disialoganglioside 2 (GD2), IL- 13 Ra2, human epidermal growth factor receptor 2 (HER2), CD20, CD22, or mucin-1 (MUC1)) into the host genome at the target sequence within the genomic DNA of the cell thereby creating a modified cell.

[0022] In some embodiments, disclosed herein are methods of genetically modifying a cell of any preceding aspect, wherein the cell (e.g., NK cell or NK T cell) is infected with about 5 to 500K multiplicity of infection (MOI) of the AAV disclosed herein.

[0023] Also disclosed herein are methods of genetically modifying a cell of any preceding aspect, wherein the primary cells are incubated for about 4 to 10 days in the presence of IL-2 and / or irradiated feeder, plasma membrane particles, or exosomes cells prior to infection and / or electroporation. In some embodiments, disclosed herein are methods of genetically modifying a cell of any preceding aspect further comprising expanding the primary cells for about 4 to 10 days in the presence of irradiated feeder cells, plasma membrane particles, or exosomes prior to infection, wherein the irradiated feeder cells, plasma membrane particles, or exosomes express membrane bound 4-1BBL, membrane -bound IL-21, or membranebound IL- 15, or any combination thereof. Also disclosed herein arc methods of genetically modifying a cell of any preceding aspect, further comprising expanding the modified cell with irradiated feeder cells, plasma membrane particles, or exosomes following infection, wherein the irradiated feeder cells, plasma membrane particles, or exosomes express membrane bound 4-1BBL, membrane-bound IL-21, or membrane -bound IL-15, or any combination thereof.

[0024] In some aspects, disclosed herein is a method of treating, decreasing, reducing, inhibiting, ameliorating, and / or preventing a cancer and / or metastasis (such as, for example, leukemia, acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), hairy cell leukemia (IICL), or myelodysplastic syndromes (MDS), lymphoma, multiple myeloma, rhabdomyosarcoma, a brain tumor, neuroblastoma, breast cancer, or Ewing’s sarcoma family tumor) in a subject comprising administering to the subject a therapeutically effective amount of a natural killer (NK) cell, wherein the NK cell comprises a plasmid for use with clustered regularly interspaced short palindromic repeat (CRISPR) / CRISPR- associated 9 (Cas9) integration systems wherein the plasmid comprises in order a left homology arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide (such as, for example a CD33 targeting CAR), and a right Docket No. 10935-036W01 homology arm; wherein the left and right homology arms are each lOOObp in length or less (for example, 600bp);and wherein the homology arms of RNP complex specifically hybridize to the T Cell Immunoreceptor with Ig And ITIM Domains (TIGIT) gene within the genomic DNA of the NK or NK T cell.

[0025] In some aspects, disclosed herein is a plasmid for use with clustered regularly interspaced short palindromic repeat (CRISPR) / CRISPR-associated 9 (Cas9) integration systems wherein the plasmid comprises a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide; wherein the polynucleotide sequence is adjacent to one protospacer adjacent motif (PAM) and one sequence encoding crispr RNA (crRNA) or flanked by two PAMs and sequences encoding crRNAs. It some aspects, the disclosed plasmid can be used in any of the methods of treating, decreasing, reducing, inhibiting, ameliorating, and / or preventing a cancer and / or metastasis of any preceding aspect; methods of creating a CAR NK cell and / or CAR NK T cell of any preceding aspect; and / or genetically modifying a cell of any preceding aspect.

[0026] BRIEF DESCRIPTION OF FIGURES

[0027] The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects described below.

[0028] Figure 1 shows TIGIT expression on freshly isolated peripheral blood (“Naive”) NK cells and expanded NK cells, demonstrating increased TIGIT expression on the expanded cells.

[0029] Figure 2 shows efficient TIGIT deletion in NK cells by electroporation of TIGIT- specific gRNA and Cas9. Shown is TIGIT expression for each gRNA tested, compared to control un-electroporated cells.

[0030] Figure 3 shows a MAP of the CD33 CAR with homology arms for insertion into the TIGIT locus, version 1.

[0031] Figure 4 shows a MAP of the TIGIT CAR with homology arms for insertion into the TIGIT locus, version 3.

[0032] Figures 5A and 5B show the MAPs of CD33-CAR (Figure 5A) and the TIGIT-CAR (Figure 5B) with homology arms for insertion into the TIGIT locus, version 3 codon optimized.

[0033] Figure 6 shows the MAP of CD33-CAR with homology arms for insertion into the TIGIT locus, version 4 codon optimized. Docket No. 10935-036W01

[0034] Figures 7A and 7B show the flow cytometry demonstrating successful TIGIT knockout in expanded NK cells, whether expanded with CSTX002 feeder cells or particles derived from CSTX002.

[0035] Figures 8A and 8B show that the TIGIT knock out does not alter the NK cell phenotype. Shown NK cells with the TIGIT knockout (red triangles) and WT control NK cells (black circles).

[0036] Figures 9A and 9B show the cytotoxicity of the TIGIT knockout in 4 cancer cell lines. Shown NK cells with the TIGIT knockout (red triangles) and WT control NK cells (black circles).

[0037] Figures 10A and 10B show the CRISPR / Cas9 genome editing facilitates expression of CD33-CAR and TIGIT-CAR. Figure 10A shows the expression of CD33 CAR on primary human NK cells is similar when inserted into the TIGIT as when inserted into the CD38 locus. Figure 10B shows the expression of TIGIT CAR and CD33 CAR in primary human TIGITk0NK cells.

[0038] Figure 11 shows the expression of TIGIT ligands in human AML cell lines, demonstrating the role for TIGIT targeting in AML.

[0039] Figures 12A and 12B show the TIGIT-KO NK cell cytotoxicity against AML compared to wild-type NK cells.

[0040] Figure 13 shows the cytotoxicity of TIGIT knockout CAR NK cells against AML. Figure 14 shows the cytotoxicity of TIGIT knockout CAR NK cells against AML.

[0041] DETAILED DESCRIPTION

[0042] The following description of the disclosure is provided as an enabling teaching of the disclosure in its best, currently known embodiment(s). To this end, those skilled in the relevant art will recognize and appreciate that many changes can be made to the various embodiments of the invention described herein, while still obtaining the beneficial results of the present disclosure. It will also be apparent that some of the desired benefits of the present disclosure can be obtained by selecting some of the features of the present disclosure without utilizing other features. Accordingly, those who work in the art will recognize that many modifications and adaptations to the present disclosure are possible and can even be desirable in certain circumstances and are a part of the present disclosure. Thus, the following description is provided as illustrative of the principles of the present disclosure and not in limitation thereof. Docket No. 10935-036W01

[0043] Reference will now be made in detail to the embodiments of the invention, examples of which are illustrated in the drawings and the examples. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein.

[0044] Terminology

[0045] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non- limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of’ and “consisting of” can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed. As used in this disclosure and in the appended claims, the singular forms “a”, “an”, “the”, include plural referents unless the context clearly dictates otherwise.

[0046] The following definitions are provided for the full understanding of terms used in this specification.

[0047] Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that when a value is disclosed that “less than or equal to” the value, “greater than or equal to the value” and possible ranges between values are also disclosed, as appropriately understood by the skilled artisan. For example, if the value “10” is disclosed the “less than or equal to 10”as well as “greater than or equal to 10” is also disclosed. It is also understood that the throughout the application, data is provided in a number of different formats, and that this data, represents endpoints and starting points, and ranges for any combination of the data points. For example, if a particular data point “10” and a particular data point 15 are disclosed, it is understood that greater than, greater than or Docket No. 10935-036W01 equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

[0048] “Administration” to a subject includes any route of introducing or delivering to a subject an agent. Administration can be carried out by any suitable route, including oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted reservoir, parenteral (e.g., subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrastemal, intrathecal, intraperitoneal, intrahepatic, intralesional, and intracranial injections or infusion techniques), and the like. "Concurrent administration", "administration in combination", "simultaneous administration" or "administered simultaneously" as used herein, means that the compounds are administered at the same point in time or essentially immediately following one another. In the latter case, the two compounds are administered at times sufficiently close that the results observed are indistinguishable from those achieved when the compounds are administered at the same point in time. “Systemic administration” refers to the introducing or delivering to a subject an agent via a route which introduces or delivers the agent to extensive areas of the subject's body (e.g. greater than 50% of the body), for example through entrance into the circulatory or lymph systems. By contrast, “local administration” refers to the introducing or delivery to a subject an agent via a route which introduces or delivers the agent to the area or area immediately adjacent to the point of administration and does not introduce the agent systemically in a therapeutically significant amount. For example, locally administered agents are easily detectable in the local vicinity of the point of administration, but are undetectable or detectable at negligible amounts in distal parts of the subject’s body. Administration includes self-administration and the administration by another.

[0049] "Biocompatible" generally refers to a material and any metabolites or degradation products thereof that are generally non-toxic to the recipient and do not cause significant adverse effects to the subject.

[0050] A “control” is an alternative subject or sample used in an experiment for comparison purposes. A control can be "positive" or "negative."

[0051] “Complementary” or “substantially complementary” refers to the hybridization or base pairing or the formation of a duplex between nucleotides or nucleic acids, such as, for Docket No. 10935-036W01 instance, between the two strands of a double stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single stranded nucleic acid. Complementary nucleotides are, generally, A and T / U, or C and G. Two single-stranded RNA or DNA molecules are said to be substantially complementary when the nucleotides of one strand, optimally aligned and compared and with appropriate nucleotide insertions or deletions, pair with at least about 80% of the nucleotides of the other strand, usually at least about 90% to 95%, and more preferably from about 98 to 100%. Alternatively, substantial complementarity exists when an RNA or DNA strand will hybridize under selective hybridization conditions to its complement. Typically, selective hybridization will occur when there is at least about 65% complementary over a stretch of at least 14 to 25 nucleotides, at least about 75%, or at least about 90% complementary. See Kanehisa (1984) Nucl. Acids Res. 12:203.

[0052] The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of’ and “consisting of” can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed.

[0053] “Composition” refers to any agent that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition. The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, a vector, polynucleotide, cells, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the term “composition” is used, then, or when a particular composition is specifically identified, it is to be understood that the term includes the composition per se as well as pharmaceutically acceptable, pharmacologically active vector, polynucleotide, salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc.

[0054] A DNA sequence that "encodes" a particular RNA is a DNA nucleic acid sequence that is transcribed into RNA. A DNA polynucleotide may encode an RNA (mRNA) that is translated into protein (and therefore the DNA and the mRNA both encode the protein), or a DNA polynucleotide may encode an RNA that is not translated into protein (e.g. tRNA, rRNA, microRNA (miRNA), a "non-coding" RNA (ncRNA), a guide RNA, etc.). Docket No. 10935-036W01

[0055] "Expression vector" refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.)

[0056] The “fragments,” whether attached to other sequences or not, can include insertions, deletions, substitutions, or other selected modifications of particular regions or specific amino acids residues, provided the activity of the fragment is not significantly altered or impaired compared to the nonmodified peptide or protein. These modifications can provide for some additional property, such as to remove or add amino acids capable of disulfide bonding, to increase its bio-longevity, to alter its secretory characteristics, etc. In any case, the fragment must possess a bioactive property, such as regulating the transcription of the target gene.

[0057] The term "gene" or "gene sequence" refers to the coding sequence or control sequence, or fragments thereof. A gene may include any combination of coding sequence and control sequence, or fragments thereof. Thus, a "gene" as referred to herein may be all or part of a native gene. A polynucleotide sequence as referred to herein may be used interchangeably with the term "gene”, or may include any coding sequence, non-coding sequence or control sequence, fragments thereof, and combinations thereof. The term "gene" or "gene sequence" includes, for example, control sequences upstream of the coding sequence (for example, the ribosome binding site).

[0058] The term “genome” refers to the entire complement of genetic material (genes and non-coding sequences) that is present in each cell of an organism, or vims or organelle; and / or a complete set of chromosomes inherited as a (haploid) unit from one parent.

[0059] By “homology” is meant DNA sequences that are similar. For example, a “region of homology to a genomic region” that is found on the donor DNA is a region of DNA that has a similar sequence to a given “genomic region” in the cell or organism genome. A region of homology can be of any length that is sufficient to promote homologous recombination at the cleaved target site. For example, the region of homology can comprise at least 5-10, 5-15, 5- 20, 5-25, 5-30, 5-35, 5-40, 5-45, 5- 50, 5-55, 5-60, 5-65, 5- 70, 5-75, 5-80, 5-85, 5-90, 5-95, 5-100, 5-200, 5-300. 5-400, 5-500, 5-600. 5-700, 5-800, 5-900. 5-1000, 5-1100, 5-1200, 5- 1300, 5- 1400, 5-1500, 5-1600, 5-1700, 5-1800, 5-1900, 5-2000, 5-2100, 5-2200, 5-2300, 5- Docket No. 10935-036W01

[0060] 2400. 5-2500, 5-2600, 5-2700, 5-2800, 5-2900, 5-3000, 5-3100 or more bases in length such that the region of homology has sufficient homology to undergo homologous recombination with the corresponding genomic region. Thus, the homology arms of any aspect disclosed herein can comprise at least 5-10, 5-15, 5-20, 5-25, 5-30, 5-35, 5-40, 5-45, 5- 50, 5-55, 5-60, 5-65, 5- 70, 5-75, 5-80, 5-85, 5-90, 5-95, 5-100, 5-200, 5-300, 5-400, 5-500, 5-600, 5-700, 5- 800, 5-900, 5-1000, 5-1100, 5-1200. 5-1300, 5- 1400, 5-1500, 5-1600, 5-1700, 5-1800, 5- 1900, 5-2000, 5-2100, 5-2200, 5-2300, 5-2400, 5-2500, 5-2600, 5-2700, 5-2800, 5-2900, 5- 3000, 5-3100 or more bases in length that are homologous to its target sequence.

[0061] As used herein, “homologous recombination” (HR) includes the exchange of DNA fragments between two DNA molecules at the sites of homology. The frequency of homologous recombination is influenced by a number of factors. Different organisms vary with respect to the amount of homologous recombination and the relative proportion of homologous to non-homologous recombination. Generally, the length of the region of homology affects the frequency of homologous recombination events; the longer the region of homology, the greater the frequency. The length of the homology region needed to observe homologous recombination is also species- variable. In many cases, at least 5 kb of homology has been utilized, but homologous recombination has been observed with as little as 25-50 bp of homology. Sec, for example, Singer ct al. , (1982) Cell 31 :25-33; Shen and Huang, (1986) Genetics 112:441-57; Watt et al. , (1985) Proc. Natl. Acad. Sci. USA 82:4768-72, Sugawara and Haber, (1992 )Mol Cell Biol 12:563-75, Rubnitz and Subramani, (1984) o / Cell Biol 4:2253-8; Ayares et al. , (1986) Proc. Natl. Acad. Sci. USA 83:5199-203; Liskay et al. , (1987) Genetics 115: 161-7.

[0062] The terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site or the like). Such sequences are then said to be “substantially identical.” This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions Docket No. 10935-036W01 and / or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 10 amino acids or 20 nucleotides in length, or more preferably over a region that is 10-50 amino acids or 20-50 nucleotides in length. As used herein, percent (%) nucleotide sequence identity is defined as the percentage of amino acids in a candidate sequence that arc identical to the nucleotides in a reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared can be determined by known methods.

[0063] For sequence comparisons, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.

[0064] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977) Nuc. Acids Res. 25:3389-3402, and Altschul et al. (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ). This algorithm involves first identifying high scoring sequence pairs (IISPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive- valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al. (1990) J. Mol. Biol. 215:403-410). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for Docket No. 10935-036W01 mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negativescoring residue alignments; or the end of cither sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) or 10, M=5, N=-4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands.

[0065] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873- 5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, preferably less than about 0.01.

[0066] The terms “knock-in”, “gene knock-in, “gene insertion” and “genetic knock-in” are used interchangeably herein. A knock-in represents the replacement or insertion of a DNA sequence at a specific DNA sequence in cell by targeting with a Cas protein (for example by homologous recombination (HR), wherein a suitable donor DNA polynucleotide is also used) examples of knock-ins are a specific insertion of a heterologous amino acid coding sequence in a coding region of a gene, or a specific insertion of a transcriptional regulatory element in a genetic locus.

[0067] The term "naturally-occurring" or "unmodified" or "wild type" as used herein as applied to a nucleic acid, a polypeptide, a cell, or an organism, refers to a nucleic acid, polypeptide, cell, or organism that is found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by a human in the laboratory is wild type (and naturally occurring). Docket No. 10935-036W01

[0068] An "increase" can refer to any change that results in a greater amount of a symptom, disease, composition, condition or activity. An increase can be any individual, median, or average increase in a condition, symptom, activity, composition in a statistically significant amount. Thus, the increase can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% increase so long as the increase is statistically significant.

[0069] A "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant. The term "nucleic acid" as used herein means a polymer composed of nucleotides, e.g., deoxyribonucleotides (DNA) or ribonucleotides (RNA). The terms "ribonucleic acid" and "RNA" as used herein mean a polymer composed of ribonucleotides. The terms "deoxyribonucleic acid" and "DNA" as used herein mean a polymer composed of deoxyribonucleotides .

[0070] “Optional” or “optionally” means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

[0071] As used herein, "operatively linked" can indicate that the regulatory sequences useful for expression of the coding sequences of a nucleic acid are placed in the nucleic acid molecule in the appropriate positions relative to the coding sequence so as to effect expression of the coding sequence. This same definition is sometimes applied to the arrangement of coding sequences and / or transcription control elements (e.g. promoters, enhancers, and termination elements), and / or selectable markers in an expression vector. The term "operatively linked" can also refer to the arrangement of polypeptide segments within a single polypeptide chain, where the individual polypeptide segments can be, without limitation, a protein, fragments thereof, linking peptides, and / or signal peptides. The term operatively linked can refer to direct fusion of different individual polypeptides within the single polypeptides or fragments thereof where there are no intervening amino acids between Docket No. 10935-036W01 the different segments as well as when the individual polypeptides are connected to one another via one or more intervening amino acids.

[0072] “Primers” are a subset of probes which are capable of supporting some type of enzymatic manipulation and which can hybridize with a target nucleic acid such that the enzymatic manipulation can occur. A primer can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art which do not interfere with the enzymatic manipulation.

[0073] “Probes” are molecules capable of interacting with a target nucleic acid, typically in a sequence specific manner, for example through hybridization. The hybridization of nucleic acids is well understood in the art and discussed herein. Typically, a probe can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art.

[0074] A "protein coding sequence" or a sequence that encodes a particular protein or polypeptide, is a nucleic acid sequence that is transcribed into mRNA (in the case of DNA) and is translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' terminus (N-terminus) and a translation stop nonsense codon at the 3’ terminus (C -terminus). A coding sequence can include, but is not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and synthetic nucleic acids. A transcription termination sequence will usually be located 3’ to the coding sequence.

[0075] The term "polynucleotide" refers to a single or double stranded polymer composed of nucleotide monomers.

[0076] The term "polypeptide" refers to a compound made up of a single chain of D- or L- amino acids or a mixture of D- and L-amino acids joined by peptide bonds.

[0077] The term "promoter" as used herein is defined as a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence.

[0078] As used herein, the term "promoter / regulatory sequence" means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter / reglatory sequence. In some instances, this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product. The promoter / regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner. Docket No. 10935-036W01

[0079] "Pharmaceutically acceptable" component can refer to a component that is not biologically or otherwise undesirable, i.e., the component may be incorporated into a pharmaceutical formulation of the invention and administered to a subject as described herein without causing significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the formulation in which it is contained. When used in reference to administration to a human, the term generally implies the component has met the required standards of toxicological and manufacturing testing or that it is included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug Administration.

[0080] "Pharmaceutically acceptable carrier" (sometimes referred to as a “carrier”) means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic and includes a carrier that is acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents. As used herein, the term "carrier" encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further herein.

[0081] “Pharmacologically active” (or simply “active”), as in a “pharmacologically active” derivative or analog, can refer to a derivative or analog (e.g., a salt, ester, amide, conjugate, metabolite, isomer, fragment, etc.) having the same type of pharmacological activity as the parent compound and approximately equivalent in degree.

[0082] “Effective amount” of an agent refers to a sufficient amount of an agent to provide a desired effect. The amount of agent that is “effective” will vary from subject to subject, depending on many factors such as the age and general condition of the subject, the particular agent or agents, and the like. Thus, it is not always possible to specify a quantified “effective amount.” However, an appropriate “effective amount” in any subject case may be determined by one of ordinary skill in the art using routine experimentation. Also, as used herein, and unless specifically stated otherwise, an “effective amount” of an agent can also refer to an amount covering both therapeutically effective amounts and prophylactically effective amounts. An “effective amount” of an agent necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. Docket No. 10935-036W01

[0083] “Sufficient homology” indicates that two polynucleotide sequences have sufficient structural similarity to act as substrates for a homologous recombination reaction. The structural similarity includes overall length of each polynucleotide fragment, as well as the sequence similarity of the polynucleotides. Sequence similarity can be described by the percent sequence identity over the whole length of the sequences, and / or by conserved regions comprising localized similarities such as contiguous nucleotides having 100% sequence identity, and percent sequence identity over a portion of the length of the sequences.

[0084] “Therapeutic agent” refers to any composition that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition (e.g., a cancer). The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the terms “therapeutic agent” is used, then, or when a particular agent is specifically identified, it is to be understood that the term includes the agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc.

[0085] “Therapeutically effective amount” or “therapeutically effective dose” of a composition (e.g., a composition comprising an agent) refers to an amount that is effective to achieve a desired therapeutic result. In some embodiments, a desired therapeutic result is the control of cancer. In some embodiments, a desired therapeutic result is the control of metastasis. In some embodiments, a desired therapeutic result is the reduction of tumor size. In some embodiments, a desired therapeutic result is the prevention and / or treatment of relapse. Therapeutically effective amounts of a given therapeutic agent will typically vary with respect to factors such as the type and severity of the disorder or disease being treated and the age, gender, and weight of the subject. The term can also refer to an amount of a therapeutic agent, or a rate of delivery of a therapeutic agent (e.g., amount over time), effective to facilitate a desired therapeutic effect, such as pain relief. The precise desired therapeutic effect will vary according to the condition to be treated, the tolerance of the subject, the agent and / or agent formulation to be administered (e.g., the potency of the therapeutic agent, the concentration of agent in the formulation, and the like), and a variety of other factors that are appreciated by those of ordinary skill in the art. In some instances, a Docket No. 10935-036W01 desired biological or medical response is achieved following administration of multiple dosages of the composition to the subject over a period of days, weeks, or years.

[0086] As used herein, “transgene” refers to exogenous genetic material (e.g., one or more polynucleotides) that has been or can be artificially provided to a cell. The term can be used to refer to a “recombinant” polynucleotide encoding any of the herein disclosed polypeptides that are the subject of the present disclosure. The term “recombinant” refers to a sequence (e.g., polynucleotide or polypeptide sequence) which does not occur in the cell to be artificially provided with the sequence or is linked to another polynucleotide in an arrangement which does not occur in the cell to be artificially provided with the sequence. It is understood that “artificial” refers to non-natural occurrence in the host cell and includes manipulation by man, machine, exogenous factors (e.g., enzymes, viruses, etc.), other nonnatural manipulations, or combinations thereof. A transgene can comprise a gene operably linked to a promoter (e.g., an open reading frame), although is not limited thereto. Upon artificially providing a transgene to a cell, the transgene may integrate into the host cell chromosome, exist extrachromosomally, or exist in any combination thereof.

[0087] Throughout this application, various publications are referenced. The disclosures of these publications in their entireties arc hereby incorporated by reference into this application in order to more fully describe the state of the art to which this pertains. The references disclosed are also individually and specifically incorporated by reference herein for the material contained in them that is discussed in the sentence in which the reference is relied upon.

[0088] Compositions

[0089] Disclosed compositions related to electroporation of NK cells for delivery of a CRISPR / CAS9 gene editing system to a cell (e.g., NK cell). In some embodiments, said compositions comprise expression vector constructs including, but not limited to plasmids.

[0090] In one aspect, disclosed herein are plasmids for use with clustered regularly interspaced short palindromic repeat (CRISPR) / CRISPR-associated 9 (Cas9) integration systems wherein the plasmid comprises in order a left homology arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide (such as, for example, a CAR comprising a scFv targeted to a receptor on a target cell (e.g., CD33), a transmembrane domain (e.g., an NKG2D transmembrane domain, a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, and / or a CD3c transmembrane Docket No. 10935-036W01 domain), a costimulatory domain (e.g., a 2B4 domain, a CD28 co-stimulatory domain, a 4-1 BB co-stimulatory domain, or any combination of a 2B4 domain, a CD28 co-stimulatory domain, and / or a 4-1 BB co-stimulatory domain), and a CD3 signaling domain), and a right homology arm; wherein the left and right homology arms are each lOOObp in length or less. In some embodiments, the left homology arm comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,

[0091] 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69,

[0092] 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94,

[0093] 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114,

[0094] 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144. 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211. 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278. 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290. 291, 292, 293, 294, 295, 296, 297, 298, 299. 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311. 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378. 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445. 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512. 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524. 525, 526, 527, 528, 529, 530, 531, 532, 533. 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, Docket No. 10935-036W01

[0095] 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582,

[0096] 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600,

[0097] 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618,

[0098] 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636,

[0099] 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654,

[0100] 655, 656. 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672,

[0101] 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690,

[0102] 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708,

[0103] 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726,

[0104] 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744,

[0105] 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756. 757, 758, 759, 760, 761, 762,

[0106] 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780,

[0107] 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798,

[0108] 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816,

[0109] 817, 818, 819, 820, 821, 822, 823. 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834,

[0110] 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852,

[0111] 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867, 868, 869, 870,

[0112] 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 883, 884, 885, 886, 887, 888,

[0113] 889, 890. 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902. 903, 904, 905, 906,

[0114] 907, 908, 909, 910, 911. 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 923. 924,

[0115] 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942,

[0116] 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960,

[0117] 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971, 972, 973, 974, 975, 976, 977, 978,

[0118] 979, 980, 981, 982, 983, 984, 985, 986, 987, 988, 989, 990. 991, 992, 993, 994, 995, 996,

[0119] 997, 998, 999, 1000 bps. In some embodiments, the right homology arm comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,

[0120] 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61,

[0121] 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75. 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86,

[0122] 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108,

[0123] 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126,

[0124] 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144,

[0125] 145, 146. 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158. 159, 160, 161, 162,

[0126] 163, 164, 165, 166, 167. 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179. 180,

[0127] 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, Docket No. 10935-036W01

[0128] 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216,

[0129] 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234,

[0130] 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252,

[0131] 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270,

[0132] 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288,

[0133] 289, 290. 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306,

[0134] 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324,

[0135] 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342,

[0136] 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360,

[0137] 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378,

[0138] 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390. 391, 392, 393, 394, 395, 396,

[0139] 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414,

[0140] 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432,

[0141] 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450,

[0142] 451, 452, 453, 454, 455, 456, 457. 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468,

[0143] 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486,

[0144] 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504,

[0145] 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522,

[0146] 523, 524. 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536. 537, 538, 539, 540,

[0147] 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557. 558,

[0148] 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576,

[0149] 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594,

[0150] 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612,

[0151] 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624. 625, 626, 627, 628, 629, 630,

[0152] 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648,

[0153] 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666,

[0154] 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684,

[0155] 685, 686, 687, 688, 689, 690, 691. 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702,

[0156] 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720,

[0157] 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738,

[0158] 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756,

[0159] 757, 758. 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770. 771, 772, 773, 774,

[0160] 775, 776, 777, 778, 779. 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791. 792,

[0161] 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, Docket No. 10935-036W01

[0162] 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828,

[0163] 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846,

[0164] 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864,

[0165] 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882,

[0166] 883, 884, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900,

[0167] 901, 902. 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918,

[0168] 919, 920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936,

[0169] 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954,

[0170] 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971, 972,

[0171] 973, 974, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984, 985, 986, 987, 988, 989, 990,

[0172] 991, 992, 993, 994, 995, 996, 997, 998, 999, 1000 bps. A non-limiting example of the right homology arm is SEQ ID NO: 2. A non-limiting example of the left homology arm is SEQ ID NO: 3.

[0173] Also disclosed herein are plasmids for use with CRISPR / Cas9 integration systems of any preceding aspect, wherein the left homology arm and right homology arm are the same length or different lengths.

[0174] “CRISPR” (Clustered Regularly Interspaced Short Palindromic Repeats) loci refers to certain genetic loci encoding components of DNA cleavage systems, for example, used by bacterial and archaeal cells to destroy foreign DNA (Horvath and Barrangou, 2010, Science 327: 167-170; W02007025097, published 01 March 2007). A CRISPR locus can consist of a CRISPR array, comprising short direct repeats (CRISPR repeats) separated by short variable DNA sequences (called spacers), which can be flanked by diverse Cas (CRISPR-associated) genes.

[0175] The term “Cas protein” refers to a polypeptide encoded by a Cas (CRISPR- associated) gene. A Cas protein includes proteins encoded by a gene in a cas locus and includes adaptation molecules as well as interference molecules. An interference molecule of a bacterial adaptive immunity complex includes endonucleases. A Cas endonuclease described herein comprises one or more nuclease domains. Contemplated herein are any Cas molecules that comprise a Rec3 clamp, as described below. As used herein, the term "Cas9 protein" refers to, but is not limited to, Cas9 proteins, Cas9-type proteins encoded by Cas9 orthologs, and synthetic proteins of Cas9. The term "Cas9 protein" as used herein refers to a wild type Cas9 protein from CRISPR-Cas9 type II B systems, Cas9 protein modifications, Cas9 protein variants, Cas9 orthologs and combinations of the same. Various Cas9s and their relationship with each other can be found in Gasiunas, et al. (Gasiunas G., Young, J.K., Docket No. 10935-036W01

[0176] Karvelis, T. et al. A catalogue of biochemically diverse CRISPR-Cas9 orthologs. Nat Commun 11, 5512 2020, hereby incorporated by reference in its entirety for its discussion concerning Cas9 molecules).

[0177] In some aspects, the homology arms specifically hybridize to the T Cell Immunorcccptor with Ig And ITIM Domains (TIGIT) gene of humans. The TIGIT gene encodes an inhibitory immune checkpoint protein that functions in regulating immune responses and preventing excessive immune activation. TIGIT is generally expressed on immune cells, including but not limited to T cells and natural killer (NK) cells, and binds to ligands on tumor cells thus sending inhibitory signals that can suppress the immune response. In some embodiments, the polynucleotide encoding the CAR polypeptide is inserted into the TIGIT, as demonstrated by the polynucleotide sequence of SEQ ID NO: 9, which is a full codon optimized nucleotide sequence.

[0178] In some embodiments, disclosed herein are plasmids for use with CRISPR / Cas9 integration systems of any preceding aspect, wherein the plasmid further comprises a murine leukemia virus-derived (MND) promoter. In some embodiments, the MND promoter comprises SEQ ID NO: 20.

[0179] In some embodiments, the plasmid of any preceding aspect comprises at least 60% sequence identity to SEQ ID NO: 21. In some embodiments, the plasmid of any preceding aspect comprises 60%, 61%. 62%. 63%. 64%. 65%. 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 21. In some embodiments, the plasmid of any preceding aspect comprises at least 60% sequence identity to SEQ ID NO: 22. In some embodiments, the plasmid of any preceding aspect comprises 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 22.

[0180] Also disclosed herein are Adeno-associated viral (AAV) vectors (such as, for example, an AAV vector including but not limited to an AAV6 serotype) comprising the plasmid of any preceding aspect. In some aspects, AAV plasmids further comprise a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide. In some embodiments, the vector further comprises a plasmid encoding a crRNA, a tracer RNA (trcrRNA), and a Gas endonuclease. The AAV vector can be a single stranded AAV (ssAAV) or a self-complimentary AAV (sc AAV). Docket No. 10935-036W01

[0181] In one aspect, disclosed herein are modified cells (such as, for example NK cells and NK T cells) comprising the plasmid or the AAV vector of any preceding aspect. In some embodiments, the modified cell of any preceding aspect is an eukaryotic NK cell, including but not limited to human, murine, canine, feline, non-human primate, and other mammalian NK cells.

[0182] Methods of Use

[0183] Also disclosed herein are methods of treating, decreasing, reducing, inhibiting, ameliorating, and / or preventing a cancer and / or metastasis (such as, for example, leukemia, acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), hairy cell leukemia (HCL), or myelodysplastic syndromes (MDS), lymphoma, multiple myeloma, rhabdomyosarcoma, a brain tumor, neuroblastoma, breast cancer, or Ewing’s sarcoma family tumor) in a subject comprising administering to a subject with a cancer the modified cell of any preceding aspect.

[0184] In some embodiments, the modified cell of any preceding aspect decreases, reduces, inhibits, ameliorates, and / or prevents the cancer and / or metastasis of any preceding aspect in the subject by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100%, or more relative to a control subject.

[0185] The modified cell of any preceding aspect may be administered in such amounts, time, and route deemed necessary in order to achieve the desired result. The exact amount of the modified cell of any preceding aspect will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the cancer and / or metastasis, the particular modified cell, its mode of administration, its mode of activity, and the like. The modified cell of any preceding aspect is preferably formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the modified cell will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the cancer and / or metastasis being treated and the severity of the cancer and / or metastasis symptoms, the activity of the modified cell employed; the specific modified cell employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific modified cell employed; the duration of the treatment; drugs used in combination or coincidental with the specific modified cell employed; and like factors well known in the medical arts. Docket No. 10935-036W01

[0186] The modified cell of any preceding aspect may be administered by any route. In some embodiments, the modified cell of any preceding aspect is administered via a variety of routes, including oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subcutaneous, intraventricular, transdermal, interdermal, rectal, intravaginal, intraperitoneal, mucosal, nasal, buccal, enteral, sublingual; by intratracheal instillation, and / or bronchial instillation. In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the modified cell (e.g., its stability in the environment of the gastrointestinal tract), the condition of the subject (e.g., whether the subject is able to tolerate oral administration), etc.

[0187] The exact amount of modified cell required to achieve a therapeutically effective amount will vary from subject to subject, depending on species, age, and general condition of a subject, severity of the side effects, identity of the particular compound(s), mode of administration, and the like. The amount to be administered to, for example, a child or an adolescent can be determined by a medical practitioner or person skilled in the art and can be lower or the same as that administered to an adult.

[0188] In one aspect, disclosed herein are methods creating a chimeric antigen receptor (CAR) natural killer (NK) cell or CAR NK T cell comprising a) obtaining a ribonuclcoprotcin (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA and an AAV vector comprising a plasmid comprising a transgene (such as, for example, a chimeric antigen receptor for a tumor antigen); wherein the transgene is flanked by homology arms; and wherein the homology arms are lOOObp in length or less (such as, for example, 600bp in length); and wherein the homology arms of RNP complex specifically hybridize to the T Cell Immunoreceptor with Ig And ITIM Domains (TIGIT) gene within the genomic DNA of the NK or NK T cell; and b) introducing the transgene and the RNP complex into an NK cell or NK T cell; wherein the transgene (such as, for example, a chimeric antigen receptor for a tumor antigen including, but not limited to CD33, B cell maturation antigen (BCMA), G protein-coupled receptor class C group 5 member D (GPRC5D), CD 19, guanylate cyclase-C (GUCY2C), B7 homolog 3 protein (B7-H3), epidermal growth factor receptor (EGFR), disialoganglioside 2 (GD2), IL-13 Ra2, human epidermal growth factor receptor 2 (HER2), CD20, CD22, or mucin-1 (MUC1)) is introduced into the NK cell or NK T cell via infection with the Adeno-associated virus (AAV); wherein the RNP complex hybridizes to a target sequence within the genomic DNA of the NK cell or NK T cell and the DNA repair enzymes of the NK cell or NK T cell insert the transgene into the host genome (for example, by Docket No. 10935-036W01 homologous repair) at the target sequence, thereby creating a CAR NK cell or CAR NK T cell. In some aspects, the RNP complex can be introduced into the cell via electroporation. In some aspects, the RNP complex can be introduced into the cell via viral delivery in the same or a different AAV (i.e., superinfection).

[0189] In one aspect, disclosed herein arc methods of genetically modifying a cell (T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and / or muscle cells, including, but not limited to primary or expanded cells), the method comprising a) obtaining a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA and an AAV vector comprising a plasmid comprising a chimeric antigen receptor (CAR) polypeptide; wherein the polynucleotide sequence is flanked by the homology arms of any preceding aspect; and wherein the homology arms are 1000 bp in length or less (such as, for example, 600bp in length); and wherein the homology arms of RNP complex specifically hybridize to the T Cell Immunoreceptor with Ig And ITIM Domains (TIGIT) gene within the genomic DNA of the NK or NK T cell of any preceding aspect; and b) introducing the polynucleotide sequence and the RNP complex into the cell; wherein the polynucleotide sequence is introduced into the cell via infection with the AAV into the cell; wherein the RNP complex hybridizes to a target sequence within the genomic DNA of the cell and the cell’s DNA repair enzymes insert the transgene (such as, for example a CAR that targets CD33, B cell maturation antigen (BCMA), G protein-coupled receptor class C group 5 member D (GPRC5D), CD19, guanylate cyclase-C (GUCY2C), B7 homolog 3 protein (B7- H3), epidermal growth factor receptor (EGFR), disialoganglioside 2 (GD2), IL-13 Ra2, human epidennal growth factor receptor 2 (HER2), CD20, CD22, or mucin- 1 (MUC1)) into the host genome at the target sequence within the genomic DNA of the cell thereby creating a modified cell.

[0190] In some embodiments, disclosed herein are methods of genetically modifying a cell of any preceding aspect, wherein the cell (e.g., NK cell or NK T cell) is infected with about 5 to 500K multiplicity of infection (MOI) of the AAV disclosed herein.

[0191] Also disclosed herein are methods of genetically modifying a cell of any preceding aspect, wherein the primary cells are incubated for about 4, 5, 6, 7, 8, 9, or 10 days in the presence of IL-2 and / or irradiated feeder, plasma membrane particles, or exosomes cells prior to infection and / or electroporation. In some embodiments, disclosed herein are methods of genetically modifying a cell of any preceding aspect further comprising expanding the primary cells for about 4, 5, 6, 7, 8, 9, or 10 days in the presence of irradiated feeder cells, Docket No. 10935-036W01 plasma membrane particles, or exosomes prior to infection, wherein the irradiated feeder cells, plasma membrane particles, or exosomes express membrane bound 4-1 BBL, membrane-bound IL-21, or membrane-bound IL- 15, or any combination thereof. Also disclosed herein are methods of genetically modifying a cell of any preceding aspect, further comprising expanding the modified cell with irradiated feeder cells, plasma membrane particles, or exosomes following infection, wherein the irradiated feeder cells, plasma membrane particles, or exosomes express membrane bound 4-1 BBL, membrane-bound 1L- 21, or membrane-bound IL- 15, or any combination thereof.

[0192] In some aspects, disclosed herein is a method of treating, decreasing, reducing, inhibiting, ameliorating, and / or preventing a cancer and / or metastasis (such as, for example, leukemia, acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), hairy cell leukemia (HCL), or myelodysplastic syndromes (MDS), lymphoma, multiple myeloma, rhabdomyosarcoma, a brain tumor, neuroblastoma, breast cancer, or Ewing’s sarcoma family tumor) in a subject comprising administering to the subject a therapeutically effective amount of a modified natural killer (NK) cell, wherein the modified NK cell comprises a plasmid for use with clustered regularly interspaced short palindromic repeat (CRISPR) / CRISPR-associated 9 (Cas9) integration systems wherein the plasmid comprises in order the left homology arm of any preceding aspect, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide (such as, for example a CD33 targeting CAR), and the right homology arm of any preceding aspect; wherein the left and right homology arms are each lOOObp in length or less (for example, 600bp);and wherein the homology arms of RNP complex specifically hybridize to the T Cell Immunoreceptor with Ig And ITIM Domains (TIGIT) gene within the genomic DNA of the NK or NK T cell.

[0193] In some embodiments, the modified NK cell of any preceding aspect decreases, reduces, inhibits, ameliorates, and / or prevents the cancer and / or metastasis of any preceding aspect in the subject by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100%, or more relative to a control subject.

[0194] In some aspects, disclosed herein is a plasmid for use with clustered regularly interspaced short palindromic repeat (CRISPR) / CRISPR-associated 9 (Cas9) integration systems wherein the plasmid comprises a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide; wherein the polynucleotide sequence is adjacent to one protospacer adjacent motif (PAM) and one sequence encoding crispr RNA (crRNA) or flanked by two PAMs and sequences encoding crRNAs. Docket No. 10935-036W01

[0195] A “protospacer adjacent motif’ (PAM) herein refers to a short nucleotide sequence adjacent to a target sequence (protospacer) that is recognized (targeted) by a guide polynucleotide / Cas endonuclease system described herein. The Cas endonuclease may not successfully recognize a target DNA sequence if the target DNA sequence is not followed by a PAM sequence. The sequence and length of a PAM herein can differ depending on the Cas protein or Cas protein complex used. The PAM sequence can be of any length but is typically 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides long.

[0196] In some aspects, the disclosed plasmid can be used in any of the methods of treating, decreasing, reducing, inhibiting, ameliorating, and / or preventing a cancer and / or metastasis of any preceding aspect; methods of creating a CAR NK cell and / or CAR NK T cell of any preceding aspect; and / or genetically modifying a cell of any preceding aspect.

[0197] A number of embodiments of the disclosure have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.

[0198] By way of non-limiting illustration, examples of certain embodiments of the present disclosure arc given below.

[0199] EXAMPLES

[0200] The following examples are set forth below to illustrate the compositions, devices, methods, and results according to the disclosed subject matter. These examples are not intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrate representative methods and results. These examples are not intended to exclude equivalents and variations of the present invention which are apparent to one skilled in the art.

[0201] Example 1: Highly efficient site-directed CAR insertion into the TIGIT gene in primary human natural killer cells using CRSPR / cas9 delivered by AAV6

[0202] Using the approaches described herein, highly efficient and stable transgene-modified human CAR-NK cells were generated which showed enhanced anti-AML activity via a simultaneous knockout of TIGIT and knockin of a CAR. Docket No. 10935-036W01

[0203] Methods

[0204] Human NK Cell Purification and Expansion.

[0205] NK cells were purified. Briefly, NK cells were isolated from PBMC collected from healthy individuals using RosetteSep™ Human NK Cell Enrichment Cocktail. Purified NK cells were phcnotypcd using flow cytometry as >90% CD3-ncgativc / CD56-positivc population. These cells were stimulated with irradiated K562 feeder cells expressing 4-1 BBL and membrane- bound IL-21 (FC21) at a ratio of 2:1 (feeder: NK) at the day of purification. The stimulated cells were cultured for 7 days in the serum-free AIM-V / ICSR expansion medium containing 50 lU / mL of IL-2.

[0206] Cas9 / RNP electroporation for targeting TIGIT in NK cells.

[0207] TIGIT was targeted using gRNA targeting exon 3 (guide 2) TIGIT GTTCACGGTCAGCGACTGGA (SEQ ID NO: 4), gRNA targeting exon 2 guide (3) of TIGIT GCCCCTGGGCCCAGATCAGG (SEQ ID NO: 5), or gRNA targeting exon 3 (guide 1) of TIGIT GCTGACCGTGAACGATACAG (SEQ ID NO: 6) via electroporation of Cas9 / RNP into day seven expanded NK cells as described before. Briefly, 3 x IO6expanded NK cells were harvested and washed twice with 13ml of PBS followed by centrifugation for 5 minutes at 400g and aspiration of PBS. The cell pellet was resuspended in 20ul of P3 Primary Cell 4D-Nuclcofcctor Solution. 5ul of prc-complcxcd Cas9 / RNP (ALT-R® CRISPR-Cas9 crRNA. ALT-R® CRISPR-Cas9 tracrRNA, and ALT-R® S.p. HiFi Cas9 Nuclease V3) (Integrated DNA Technologies, Inc., Coralville, Iowa), targeting TIGIT and lul of lOOuM electroporation enhancer (ALT-R® Cas9 Electroporation Enhancer) were added to the cell suspension. The total volume of 26ul of CRISPR reaction was transferred into 4D-Nucleofector™ 16-well Strip and electroporated using program EN-138 (FIG. 3B). After electroporation, the cells were transferred into 2ml of media containing 50IU of IL-2 in a 12 well plate and incubated at 37 degrees and 5% CO2 pressure. Two days post electroporation, cells were stimulated with 2 x 106feeder cells, and 8ml fresh media complemented with 50IU was added in cell suspension and kept in a T25 flask. AAV6 production.

[0208] The transgenes cloned into ssAAV or scAAV plasmids were packaged in AAV6 capsids as described before.

[0209] Combining Cas9 / RNP and AAV6 to generate CAR NK cells.

[0210] A media change and resuspension at 5 x 105cells per ml were performed on day 6 of NK cell expansion one day before experimental manipulation. The NK cells were then electroporated with Cas9 / RNP targeting TIGIT on day 7, as described above. Thirty minutes Docket No. 10935-036W01 after electroporation, 3 x 105live cells were collected and resuspended at 1 x 106cells per ml in media containing 50IU IL2 (Novartis) in a 24 well plate in a total volume of 300ul. For each transduction condition with ssAAV6 or scAAV6 to deliver HR or CRISPaint DNA encoding mCherry or CD33CARs, we transduced 3 x 105electroporated cells with 300K MOI (10-500K MOI if needed). Negative controls included as NK cells that were not electroporated were electroporated with Cas9 / RNP but not AAV transduced or were transduced with 300K MOI of AAV6 without electroporation of Cas9 / RNP. The day after electroporation and transduction, 300ul of fresh media containing 50IU of IL2 was added to each well without changing the old media. The cells were kept in culture for 48 hours after electroporation and were then restimulated with 2 x 106feeder cells and kept in a total volume of 2ml media containing 50IU in 12 well plate, without changing the old media. 48 hours later, 8ml fresh media supplemented with IL2 was added to cells, a total volume of 10ml was kept in a T25 flask. At day 7 post-transduction, cells were re-stimulated with feeder cells at a ratio of 1 : 1 and grown for one more week, every 2 days fresh media was added to the cells.

[0211] Flow Cytometry for detection ofCAR-NK cells.

[0212] 1 days and 14 days following electroporation, 5 x 105NK cells were washed twice with staining buffer containing 2% FBS in PBS. Next, 2.5ug of recombinant human siglcc- 3 / CD33 Fc chimera protein, (CF; R&D systems #1137-SL-050) was added to cell suspension in a total volume of 80ul and incubated for 30 minutes at 4C. Cells were washed twice with staining buffer before staining with 2ul of Alexa Fluor® 647 affinipure goat anti-human IgG, Fey fragment specific, (Jackson ImmunoResearch #109-605-098) at 1: 100 ratio in 200ul of staining buffer and kept at 4C for 30 minutes. Once stained, cells were washed twice with staining buffer then acquired on MacsQuant flow cytometers. Flow cytometry data were analyzed using FlowJo software (FlowJo, LLC). Cytotoxicity assay.

[0213] Cytotoxicity assays were performed for 3-4 h using a calcein-acetoxymethyl-release assay. Cytotoxicity was assessed against Kasumi-1, HL60, or AM L10 cells at different ratios of target: effector as defined in FIG. 8.

[0214] Results

[0215] To target TIGIT for CAR insertion, a guide RNA (gRNA) that targeted TIGIT was designed. The TIGIT expression for gRNA targeting exon 3 (guide 2) TIGIT GTTCACGGTCAGCGACTGGA (SEQ ID NO: 4), gRNA targeting exon 2 guide (3) of TIGIT GCCCCTGGGCCCAGATCAGG (SEQ ID NO: 5), or gRNA targeting exon 3 (guide Docket No. 10935-036W01

[0216] 1) of TIGIT GCTGACCGTGAACGATACAG (SEQ ID NO: 6) were compared. All gRNA appropriately targeted TIGIT (Figure 2), but gRNA targeting exon 3 (guide 2) was selected for further development.

[0217] With the gRNA selected, plasmids were created that would target TIGIT and insert a CAR (c.g., an anti-CD33 scFv) as shown in Figures 3-6. Having generated the plasmids, successful knock-out (KO) of TIGIT expression on expanded NK cells was confirmed by flow cytometry (Figure 7). Then knocking out TIGIT was verified to not alter the NK cell phenotype (Figure 8), Every measurement WT and TIGT knockout NK cells showed the same level of expression. The effect of knocking out TIGIT had on the cytotoxicity of NK cells was then investigated (Figure 9). Four different in vitro cancer models were used and it was found that knocking out TIGIT enhanced the cytotoxicity of NK cells compared to controls.

[0218] To assess the effect of the knocking out TIGIT on CD33 CAR expression (the knockin) and TIGIT expression (the knockout), CD33 CAR expression was measured in WT NK cells, NK cells electroporated with a plasmid construct that targets CD38, NK cells transfected with a AAV that targets CD38 and inserts a CD33 CAR at the CD38 gene locus; and NK cells transfected with a AAV that targets TIGIT and inserts CD33 CAR at the TIGIT gene locus (Figure 10A). CD33 CAR expression was not present in cither WT or CD38 knockout, but in both the CD38 and TIGIT targeting vectors that comprises a CD33 CAR, CD33 CAR expression was observed. Likewise, TIGIT expression was measured in WT NK cells, NK cells in which TIGIT was knocked out, NK cells that a CD33 CAR knockin with TIGIT targeting gRNA (thereby creating a TIGIT knockout and CD33CAR knockin), and NK cells with a TIGIT CAR knockin with TIGIT targeting gRNA (thereby creating a TIGIT knockout and TIGITCAR knockin) (Figure 10B). TIGIT expression was significantly reduced in the TIGIT knockout relative to WT controls, unaffected when the CD33CAR was knocked in, but fully restored in NK cells with both a TIGIT knockout and a TIGIT CAR knockin.

[0219] To study the cytotoxic effect of primary human CD33CAR NK cells against CD33 expressing AML cells, TIGIT ligand expression was first examined in 3 different AML cell lines. In each case, robust TIGIT ligand expression (FLT3-ITD, M0LM13, and MV411) was observed (Figure 11). Looking just at the cytotoxicity against AML, TIGIT knockouts had increased cytotoxicity (Figure 12).

[0220] The cytotoxic ability of the NK cells comprising a TIGIT targeting CAR or CD33 targeting CAR was then tested. CD33 CAR in TIGIT NK cells were found to exert enhanced Docket No. 10935-036W01 cytotoxicity against patient AML cells compared to WT expanded NK cells (Figures 13 and 14).

[0221] It will be apparent to those skilled in the art that various modifications and variations can be made in the present disclosure without departing from the scope or spirit of the invention. Other embodiments of the disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the methods disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.

[0222] Docket No. 10935-036W01

[0223] TABLES

[0224] Table 1. Features of various constructs.

[0225] Docket No. 10935-036W01

[0226] SEQUENCES

[0227] 1. SEQ ID NO: 1 - TIGIT sequence

[0228] ATGCGCTGGTGTCTCCTCCTGATCTGGGCCCAGGGGCTGAGGCAGGCTCCCCTCG

[0229] CCTCAGGAATGATGACAGGCACAATAGAAACAACGGGGAACATTTCTGCAGAGA

[0230] AAGGTGGCTCTATCATCTTACAATGTCACCTCTCCTCCACCACGGCACAAGTGAC

[0231] CCAGGTCAACTGGGAGCAGCAGGACCAGCTTCTGGCCATTTGTAATGCTGACTTG

[0232] GGGTGGCACATCTCCCCATCCTTCAAGGATCGAGTGGCCCCAGGTCCCGGCCTGG

[0233] GCCTCACCCTCCAGTCGCTGACCGTGAACGATACAGGGGAGTACTTCTGCATCTA

[0234] TCACACCTACCCTGATGGGACGTACACTGGGAGAATCTTCCTGGAGGTCCTAGAA

[0235] AGCTCAGTGGCTGAGCACGGTGCCAGGTTCCAGATTCCATTGCTTGGAGCCATGG

[0236] CCGCGACGCTGGTGGTCATCTGCACAGCAGTCATCGTGGTGGTCGCGTTGACTAG

[0237] AAAGAAGAAAGCCCTCAGAATCCATTCTGTGGAAGGTGACCTCAGGAGAAAATC

[0238] AGCTGGACAGGAGGAATGGAGCCCCAGTGCTCCCTCACCCCCAGGAAGCTGTGT

[0239] CCAGGCAGAAGCTGCACCTGCTGGGCTCTGTGGAGAGCAGCGGGGAGAGGACTG

[0240] TGCCGAGCTGCATGACTACTTCAATGTCCTGAGTTACAGAAGCCTGGGTAACTGC

[0241] AGCTTCTTCACAGAGACTGGTTAG

[0242] 2. SEQ ID NO: 2 - 600bp 5’ homology arm

[0243] CAGCCTTGACAAGCCTCCCTGTGGGCGAGGTGTAAAGAGGGGCAGAAGTCAGCT

[0244] CTGGAAGCATAGGGCAGTGGGTGGGGAGGAGATGGGCTGGGCTGGGCTGGAGT

[0245] AGAGATGTGTGGAGAAGGGTGAGAAGACTGGAAAGACAACCTGAATGGGGGAC

[0246] TGGGAGCCTTGAATAACAGGCATGGAGAGGAGCGTCTCTTGAAATGGAAGAAAC

[0247] AGGAAATAATTACAGCCTCTATGGAGGAGCAACAGGATGGACTGGAGAAACTAT

[0248] CATTCCAAAATCCAGTTGGGGCCTCAAAGGCCCTTAGAATTTTTCTAGGAAGGTT

[0249] GAAGGCCAGCTGCTGACCCAGGACTCACATGTGCTTCGTCCTCTTCCCTAGGAAT

[0250] GATGACAGGCACAATAGAAACAACGGGGAACATTTCTGCAGAGAAAGGTGGCTC

[0251] TATCATCTTACAATGTCACCTCTCCTCCACCACGGCACAAGTGACCCAGGTCAAC

[0252] TGGGAGCAGCAGGACCAGCTTCTGGCCATTTGTAATGCTGACTTGGGGTGGCACA

[0253] TCTCCCCATCCTTCAAGGATCGAGTGGCCCCAGGTCCCGGCCTGGGCCTCACCCT CCA

[0254] 3. SEQ ID NO: 3 - 600bp 3’ homology ami

[0255] GTCGCTGACCGTGAACGATACAGGGGAGTACTTCTGCATCTATCACACCTACCCT

[0256] GATGCTCTACCITACACTCTCTCIAGAATCTTCCTGCTAGCTTCCTAGAAAGCTCAGGTATT Docket No. 10935-036W01

[0257] CCTGCTGGAGCAAGTTGGTGGATAAACCTCTCCCTCTAGCATAGAAAATGCAATC

[0258] CTGAAACACTGCACAGcagggcttctcaattcgggatcacatttgaatcacctgaggagattttaaatcatactgatgccg aggcctcacccagaccaattcaatcagaatccctaatagcagagctaaacaagggtaaggtctaaaagcatttccaggtgattctaatg ggcagccaatactgagaaccactgTTCTTATGTAAGAAGCACATCTTACCTATATTTCCTAGGA

[0259] AGACCAGTTGATGAGGTCATATGCAAAAGTTCCCATTTATTGGTTTAGTATAATT

[0260] GTGCAAATTAGAATTAACCCCTAAGTGTATAAAGAGTAGAGCTGGTTAAAAACA

[0261] TAGCCTGTGCTAAGTTTAATTGTACAGTAATttacatttgtgtggtacttccaagtttcccaaatgccctcata tttgttatccacctgtaca

[0262] 4. SEQ ID NO: 4 - gRNA targeting exon 3 (guide 2) TIGIT

[0263] GTTCACGGTCAGCGACTGGA

[0264] 5. SEQ ID NO: 5 - gRNA targeting exon 2 guide (3) of TIGIT

[0265] GCCCCTGGGCCCAGATCAGG

[0266] 6. SEQ ID NO: 6 - gRNA targeting exon 3 (guide 1) of TIGIT

[0267] GCTGACCGTGAACGATACAG

[0268] 7. SEQ ID NO: 7 - PAM sequence

[0269] GGG

[0270] 8. SEQ ID NO: 8 - PAM sequence

[0271] AGG

[0272] 9. SEQ ID NO: 9 - CD33 CAR in TIGIT, Full Codon Optimized Sequence

[0273] CAGCCTTGACAAGCCTCCCTGTGGGCGAGGTGTAAAGAGGGGCAGAAGTCAGCT

[0274] CTGGAAGCATAGGGCAGTGGGTGGGGAGGAGATGGGCTGGGCTGGGCTGGAGT

[0275] AGAGATGTGTGGAGAAGGGTGAGAAGACTGGAAAGACAACCTGAATGGGGGAC

[0276] TGGGAGCCTTGAATAACAGGCATGGAGAGGAGCGTCTCTTGAAATGGAAGAAAC

[0277] AGGAAATAATTACAGCCTCTATCTCTAGGAGCAACACTCTATGGACTGGAGAAACTAT

[0278] CATTCCAAAATCCAGTTGGGGCCTCAAAGGCCCTTAGAATTTTTCTAGGAAGGTT

[0279] GAAGGCCAGCTGCTGACCCAGGACTCACATGTGCTTCGTCCTCTTCCCTAGGAAT

[0280] GATGACAGGCACAATAGAAACAACGGGGAACATTTCTGCAGAGAAAGGTGGCTC

[0281] TATCATCTTACAATGTCACCTCTCCTCCACCACGGCACAAGTGACCCAGGTCAAC Docket No. 10935-036W01

[0282] TGGGAGCAGCAGGACCAGCTTCTGGCCATTTGTAATGCTGACTTGGGGTGGCACA

[0283] TCTCCCCATCCTTCAAGGATCGAGTGGCCCCAGGTCCCGGCCTGGGCCTCACCCT

[0284] CCACCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTG

[0285] CCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGG

[0286] AAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCATCGATCACGAGACTA

[0287] GCCTCGAGAAGCTTGATATCGAATTCCACGGGGTTGGACGCGTCTTAATTAAGGA

[0288] TCCAAGG TC AGGAACAGAGAAACAGGAGAA TATGGGCCAAACAGGA TA TC TGTG

[0289] GTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGTTGGAACAGCAGAATAT

[0290] GGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGA

[0291] ACAGATGGTCCCCAGATGCGGTCCCGCCCTCAGCAGTTTCTAGAGAACCATCAGA

[0292] TGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAAC

[0293] CAATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCTATATA

[0294] AGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTT

[0295] TTGACCTCCATAGAAGACACCGACTCTAGAGGATCGATCCCCCGGGCTGCAGGA

[0296] ATTCAAGCGAGAAGACAAGGGCAGAAAGCACCGCCACCATGCTGCTGCTGGTGA

[0297] CCTCTCTGCTGCTGTGCGAGCTGCCACACCCAGCCTTCCTGCTGATCCCAGACAT

[0298] CCAGATGACACAGAGCCCCAGCTCCCTGAGCGCCTCCGTGGGCGACAGAGTGAC

[0299] CATCACATGTAGGGCCTCTGAGAGCGTGGATAACTATGGCATCAGCTTCATGAAT

[0300] TGGTTTCAGCAGAAGCCTGGCGGCGCCCCAAAGCTGCTGATCTACGCAGCCAGC

[0301] ATGCAGGGCTCCGGCGTGCCCTCTCGGTTCTCCGGCTCTGGCAGCGGCACCGACT

[0302] TCACCCTGACAATCTCTAGCCTGCAGCCAGACGATTTCGCCACATACTATTGCCA

[0303] GCAGAGCAAGGAGGTGCCCTGGACCTTTGGCCAGGGCACAAAGGTGGAGATCAA

[0304] GGGCTCCACCTCTGGCAGCGGCAAGCCTGGCAGCGGAGAGGGCTCCACAAAGGG

[0305] ACAGGTGCAGCTGGTGCAGTCCGGAGCCGAGGTGAAGAAGCCAGGCTCCTCTGT

[0306] GAAGGTGTCTTGTAAGGCCAGCGGCTATACCTTCACAGACTACAACATGCACTGG

[0307] GTGCGCCAGGCACCAGGACAGGGCCTGGAGTGGATCGGCTACATCTATCCTTAC

[0308] AACGGCGGCACCGGCTATAATCAGAAGTTTAAGTCCAAGGCCACCATCACAGCC

[0309] GATGAGTCTACCAATACAGCCTACATGGAGCTGAGCAGCCTGCGGTCCGAGGAC

[0310] ACAGCCGTGTACTATTGCGCCCGGGGCAGACCCGCTATGGACTATTGGGGCCAG

[0311] GGCACCCTGGTGACAGTGTCTAGCACAACAACTCCAGCACCCCGCCCACCTACTC

[0312] CCGCTCCTACAATCGCCTCTCAGCCCCTGTCCCTGCGCCCAGAAGCCTGTCGCCC

[0313] CGCAGCAGGAGGAGCAGTGCACACCAGGGGCCTGGACTTCGCCTGCGATATCTA

[0314] CATCTGGGCTCCTCTGGCTGGAACTTGTGGCGTGCTGCTGCTGTCACTGGTCATTA

[0315] CCCTGTATTGTAAGCGGGGCAGAAAGAAGCTGCTGTACATCTTCAAGCAGCCCTT Docket No. 10935-036W01

[0316] TATGAGGCCTGTGCAGACCACACAGGAGGAGGACGGCTGCAGCTGTCGGTTCCC

[0317] CGAGGAGGAGGAGGGCGGCTGCGAGCTGCGGGTGAAGTTTAGCAGATCCGCCGA

[0318] TGCACCAGCATATCAGCAGGGACAGAATCAGCTGTACAACGAGCTGAATCTGGG

[0319] CAGGCGCGAGGAGTACGACGTGCTGGATAAGAGGCGGGGCCGGGACCCCGAGA

[0320] TGGGAGGCAAGCCCAGGCGCAAGAACCCTCAGGAGGGCCTGTATAATGAGCTGC

[0321] AGAAGGACAAGATGGCCGAGGCCTACAGCGAGATCGGCATGAAGGGAGAGCGG

[0322] AGAAGGGGCAAGGGACACGA TGGCC TG TA TCAGGGCC TG TCCACCGCCAC AAAG

[0323] GACACCTACGATGCACTGCACATGCAGGCCCTGCCACCTCGGTGAAAGTAACGC

[0324] CCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCT

[0325] TCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAA

[0326] TTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCGTCGCTGACCGTGAACGAT

[0327] ACAGGGGAGTACTTCTGCATCTATCACACCTACCCTGATGGGACGTACACTGGGA

[0328] GAATCTTCCTGGAGGTCCTAGAAAGCTCAGGTATTCCTGCTGGAGCAAGTTGGTG

[0329] GATAAACCTCTCCCTCTAGCATAGAAAATGCAATCCTGAAACACTGCACAGcaggg cttctcaattcgggatcacatttgaatcacctgaggagattttaaatcatactgatgccgaggcctcacccagaccaattcaatcagaatc cctaatagcagagctaaacaagggtaaggtctaaaagcatttccaggtgattctaatgggcagccaatactgagaaccactgTTCT

[0330] TATGTAAGAAGCACATCTTACCTATATTTCCTAGGAAGACCAGTTGATGAGGTCA

[0331] TATGCAAAAGTTCCCATTTATTGGTTTAGTATAATTGTGCAAATTAGAATTAACC

[0332] CCTAAGTGTATAAAGAGTAGAGCTGGTTAAAAACATAGCCTGTGCTAAGTTTAAT

[0333] TGTACAGTAATttacatttgtgtggtacttccaagtttcccaaatgccctcatatttgttatccacctgtaca

[0334] 10. SEQ ID NO: 10 - scFv atgctgctgctggtgacctctctgctgctgtgcgagctgccacacccagcctcctgctgatcccagacatccagatgacacagagccc cagctccctgagcgcctccgtgggcgacagagtgaccatcacatgtagggcctctgagagcgtggataactatggcatcagcttcatg aattggtttcagcagaagcctggcggcgccccaaagctgctgatctacgcagccagcatgcagggctccggcgtgccctctcggttct ccggctctggcagcggcaccgactcaccctgacaatctctagcctgcagccagacgatttcgccacatactatgccagcagagcaa ggaggtgccctggacctttggccagggcacaaaggtggagatcaagggctccacctctggcagcggcaagcctggcagcggaga gggctccacaaagggacaggtgcagctggtgcagtccggagccgaggtgaagaagccaggctcctctgtgaaggtgtcttgtaagg ccagcggctataccttcacagactacaacatgcactgggtgcgccaggcaccaggacagggcctggagtggatcggctacatctatc cttacaacggcggcaccggctataatcagaagtttaagtccaaggccaccatcacagccgatgagtctaccaatacagcctacatgga gctgagcagcctgcggtccgaggacacagccgtgtactattgcgcccggggcagacccgctatggactattggggccagggcacc ctggtgacagtgtctag

[0335] 11. SEQ ID NO: 11 - IgG4-Hinge Docket No. 10935-036W01 gagagcaagtacggaccaccttgcccaccatgtcctgcaccagagtcctgggaggaccttccgtgttcctgtttcctccaaagccaaa ggacaccctgatgatcagccggaccccagaggtgacatgcgtggtggtggacgtgagccaggaggaccccgaggtgcagttcaac tggtacgtggatggcgtggaggtgcacaatgccaagaccaagccaagagaggagcagtttaactccacctatagggtggtgtctgtg ctgacagtgctgcaccaggactggctgaacggcaaggagtacaagtgcaaggtgtccaataagggcctgcctcctctatcgagaag accatctctaaggcaaagggacagccaagggagccacaggtgtatacactgccccctagccaggaggagatgaccaagaaccagg tgtccctgacatgtctggtgaagggcttttacccttctgacatcgccgtggagtgggagagcaatggccagccagagaacaattataag accacaccacccgtgctggactctgatggcagcttctttctgtacagccgcctgaccgtggataagtcccggtggcaggagggcaac gtgttctcctgctctgtgatgcacgaggccctgcacaatcactacacacagaagagcctgtccctgtctctgggcaag

[0336] 12. SEQ ID NO: 12 - CD28

[0337] Atgttttgggtgctggtggtggtgggaggcgtgctggcctgttattccctgctggtgaccgtggccttcatcatcttttgggtgcgctcca agcggagccggggcggacactctgactacatgaacatgaccccacggagacccggacctacaaggaagcactatcagccctacgc ccctccacgggacttcgcagcatatcgcagc

[0338] 13. SEQ ID NO: 13 - CD3z

[0339] Cgggtgaagtttagcagatccgccgatgcaccagcatatcagcagggacagaatcagctgtacaacgagctgaatctgggcaggcg cgaggagtacgacgtgctggataagaggcggggccgggaccccgagatgggaggcaagcccaggcgcaagaaccctcaggag ggcctgtataatgagctgcagaaggacaagatggccgaggcctacagcgagatcggcatgaagggagagcggagaaggggcaa gggacacgatggcctgtatcagggcctgtccaccgccacaaaggacacctacgatgcactgcacatgcaggccctgccacctcggt ga

[0340] 14. SEQ ID NO: 14 - NKG2D Transmembrane domain

[0341] Agcaacctgttcgtggcctcctggatcgccgtgatgatcatctttcgcatcggcatggccgtggccatcttctgctgttcttttcccatcc

[0342] 15. SEQ ID NO: 1 - Linker

[0343] Ggaggctctggaggaggctccggc

[0344] 16. SEQ ID NO: 16 - 2B4

[0345] Tggcggagaaagcggaaggagaagcagagcgagacctcccctaaggagtttctgacaatctatgaggacgtgaaggatctgaaga ccaggcgcaatcacgagcaggagcagacctcccaggaggaggctctacaatctacagcatgatccagtcccagagcagcgcccc aaccagccaggagccagcctatacactgtactctctgatccagcctagccggaagtctggcagccgcaagcggaaccactccccatc tttcaattctaccatctatgaagtgatcggcaagagccagcctaaggcccagaacccagccagactgtccaggaaggagctggagaa ttttgacgtgtactct Docket No. 10935-036W01

[0346] 17. SEQ ID NO: 17 - Linker

[0347] Ggaggcagcggaggaggctctggc

[0348] 18. SEQ ID NO: 18 - CD3z

[0349] Cgcgtgaagttcagccggtccgccgatgccccagcctataagcagggccagaaccagctgtacaacgagctgaatctgggccgga gagaggagtacgacgtgctggataagaggcggggccgggaccccgagatgggaggcaagccccggagaaagaaccctcagga gggcctgtataatgagctgcagaaggacaagatggccgaggcctactccgagatcggcatgaagggagagaggcgccggggcaa gggacacgatggcctgtatcagggcctgagcaccgccacaaaggacacctacgatgccctgcacatgcaggccctgcctccacggt gatga

[0350] 19. SEQ ID NO: 19 - anti-CD33 ScFv atgctgctgctggtgacctccctgctgctgtgcgagctgccacaccctgcctttctgctgatcccagacatccagatgacacagagccc cagctccctgtctgccagcgtgggcgacagagtgaccatcacatgtagggcctccgagtctgtggataactatggcatcagctttatga attggttccagcagaagccaggaggcgcccctaagctgctgatctacgcagcctccatgcagggctctggcgtgcccagccgcttta gcggctccggctctggcaccgatttcaccctgacaatctctagcctgcagccagacgattttgccacatactattgccagcagtccaag gaggtgccctggaccttcggccagggcacaaaggtggagatcaagggcagcacctccggctctggcaagcctggctccggagag ggctctacaaagggacaggtgcagctggtgcagagcggagccgaggtgaagaagccaggctcctctgtgaaggtgagctgtaagg cctccggctatacctttacagactacaacatgcactgggtgagacaggcaccaggacagggcctggagtggatcggctacatctatcc ttacaacggcggcaccggctataatcagaagttcaagagcaaggccaccatcacagccgatgagtccaccaatacagcctacatgga gctgagcagcctgaggagcgaggacacagccgtgtactattgcgccagaggcaggcctgctatggactattggggccagggcacc ctggtgacagtgtctagc

[0351] 20. SEQ ID NO: 20 - MND promoter

[0352] Atcgatcacgagactagcctcgagaagcttgatatcgaattccacggggttggacgcgtcttaattaaggatccaaggtcaggaacag agaaacaggagaatatgggccaaacaggatatctgtggtaagcagttcctgccccggctcagggccaagaacagttggaacagcag aatatgggccaaacaggatatctgtggtaagcagttcctgccccggctcagggccaagaacagatggtccccagatgcggtcccgcc ctcagcagtttctagagaaccatcagatgtttccagggtgccccaaggacctgaaatgaccctgtgccttatttgaactaaccaatcagtt cgcttctcgcttctgttcgcgcgcttctgctccccgagctctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgcc atccacgctgttttgacctccatagaagacaccgactctagaggatcgatcccccgggctgcaggaattcaagcgagaagacaaggg cagaaagcacc

[0353] 21. SEQ ID NO: 21 - CD33CAR in TIGU vl Docket No. 10935-036W01

[0354] CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGAC

[0355] CTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACT

[0356] CCATCACTAGGGGTTCCTGCGGCCGGCGCGCCCAGCCTTGACAAGCCTCCCTGTGG

[0357] GCGAGGTGTAAAGAGGGGCAGAAGTCAGCTCTGGAAGCATAGGGCAGTGGGTGGG

[0358] GAGGAGATGGGCTGGGCTGGGCTGGAGTAGAGATGTGTGGAGAAGGGTGAGAAGA

[0359] CTGGAAAGACAACCTGAATGGGGGACTGGGAGCCTTGAATAACAGGCATGGAGAG

[0360] GAGCGTCTC1TGAAATGGAAGAAACAGGAAATAA1TACAGCCTCTATGGAGGAGCA

[0361] ACAGGATGGACTGGAGAAACTATCATTCCAAAATCCAGTTGGGGCCTCAAAGGCCC

[0362] TTAGAATTTTTCTAGGAAGGTTGAAGGCCAGCTGCTGACCCAGGACTCACATGTGCT

[0363] TCGTCCTCTTCCCTAGGAATGATGACAGGCACAATAGAAACAACGGGGAACATTTC

[0364] TGCAGAGAAAGGTGGCTCTATCATCTTACAATGTCACCTCTCCTCCACCACGGCACA

[0365] AGTGACCCAGGTCAACTGGGAGCAGCAGGACCAGCTTCTGGCCATTTGTAATGCTG

[0366] ACTTGGGGTGGCACATCTCCCCATCCTTCAAGGATCGAGTGGCCCCAGGTCCCGGCC

[0367] TGGGCCTCACCCTCCACCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCC

[0368] CCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATA

[0369] AAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCATCGATCAC

[0370] GAGACTAGCCTCGAGAAGCTTGATATCGAATTCCACGGGGTTGGACGCGTCTTAA

[0371] TTAAGGATCCAAGGTCAGGAACAGAGAAACAGGAGAATATGGGCCAAACAGGATA

[0372] TCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGTTGGAACAGCAGA

[0373] ATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAA

[0374] GAACAGATGGTCCCCAGATGCGGTCCCGCCCTCAGCAGTTTCTAGAGAACCATCAG

[0375] ATGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACC

[0376] AATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCTATATAAGC

[0377] AGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGAC

[0378] CTCCATAGAAGACACCGACTCTAGAGGATCGATCCCCCGGGCTGCAGGAATTCAAG

[0379] CGAGAAGACAAGGGCAGAAAGCACCGCCACCATGCTGCTGCTGGTGACCTCTCTGC

[0380] TGCTGTGCGAGCTGCCACACCCAGCCTTCCTGCTGATCCCAGACATCCAGATGACAC

[0381] AGAGCCCCAGCTCCCTGAGCGCCTCCGTGGGCGACAGAGTGACCATCACATGTAGG

[0382] GCCTCTGAGAGCGTGGATAACTATGGCATCAGCTTCATGAATTGGTTTCAGCAGAA

[0383] GCCTGGCGGCGCCCCAAAGCTGCTGATCTACGCAGCCAGCATGCAGGGCTCCGGCG

[0384] TGCCCTCTCGGTTCTCCGGCTCTGGCAGCGGCACCGACTTCACCCTGACAATCTCTA

[0385] GCCTGCAGCCAGACGATTTCGCCACATACTATTGCCAGCAGAGCAAGGAGGTGCCC

[0386] TGGACCTTTGGCCAGGGCACAAAGGTGGAGATCAAGGGCTCCACCTCTGGCAGCGG

[0387] CAAGCCTGGCAGCGGAGAGGGCTCCACAAAGGGACAGGTGCAGCTGGTGCAGTCC Docket No. 10935-036W01

[0388] GGAGCCGAGGTGAAGAAGCCAGGCTCCTCTGTGAAGGTGTCTTGTAAGGCCAGCGG

[0389] CTATACCTTCACAGACTACAACATGCACTGGGTGCGCCAGGCACCAGGACAGGGCC

[0390] TGGAGTGGATCGGCTACATCTATCCTTACAACGGCGGCACCGGCTATAATCAGAAG

[0391] TTTAAGTCCAAGGCCACCATCACAGCCGATGAGTCTACCAATACAGCCTACATGGA

[0392] GCTGAGCAGCCTGCGGTCCGAGGACACAGCCGTGTACTATTGCGCCCGGGGCAGAC

[0393] CCGCTATGGACTATTGGGGCCAGGGCACCCTGGTGACAGTGTCTAGCACAACAACT

[0394] CCAGCACCCCGCCCACCTACTCCCGCTCCTACAATCGCCTCTCAGCCCCTGTCCCTG

[0395] CGCCCAGAAGCCTGTCGCCCCGCAGCAGGAGGAGCAGTGCACACCAGGGGCCTGG

[0396] ACTTCGCCTGCGATATCTACATCTGGGCTCCTCTGGCTGGAACTTGTGGCGTGCTGC

[0397] TGCTGTCACTGGTCATTACCCTGTATTGTAAGCGGGGCAGAAAGAAGCTGCTGTAC

[0398] ATCTTCAAGCAGCCCT TATGAGGCCTGTGCAGACCACACAGGAGGAGGACGGCTG

[0399] CAGCTGTCGGTTCCCCGAGGAGGAGGAGGGCGGCTGCGAGCTGCGGGTGAAGTTT

[0400] AGCAGATCCGCCGATGCACCAGCATATCAGCAGGGACAGAATCAGCTGTACAACG

[0401] AGCTGAATCTGGGCAGGCGCGAGGAGTACGACGTGCTGGATAAGAGGCGGGGCCG

[0402] GGACCCCGAGATGGGAGGCAAGCCCAGGCGCAAGAACCCTCAGGAGGGCCTGTAT

[0403] AATGAGCTGCAGAAGGACAAGATGGCCGAGGCCTACAGCGAGATCGGCATGAAGG

[0404] GAGAGCGGAGAAGGGGCAAGGGACACGATGGCCTGTATCAGGGCCTGTCCACCGC

[0405] CACAAAGGACACCTACGATGCACTGCACATGCAGGCCCTGCCACCTCGGTGAAAGT

[0406] AACGCCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTG

[0407] CCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAA

[0408] ATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCGTCGCTGACCGTGAACGATA

[0409] CAGGGGAGTACTTCTGCATCTATCACACCTACCCTGATGGGACGTACACTGGGAGA

[0410] ATCTTCCTGGAGGTCCTAGAAAGCTCAGGTATTCCTGCTGGAGCAAGTTGGTGGATA

[0411] AACCTCTCCCTCTAGCATAGAAAATGCAATCCTGAAACACTGCACAGCAGGGCTTC

[0412] TCAATTCGGGATCACATTTGAATCACCTGAGGAGATTTTAAATCATACTGATGCCGA

[0413] GGCCTCACCCAGACCAATTCAATCAGAATCCCTAATAGCAGAGCTAAACAAGGGTA

[0414] AGGTCTAAAAGCATTTCCAGGTGATTCTAATGGGCAGCCAATACTGAGAACCACTG

[0415] TTCTTATGTAAGAAGCACATCTTACCTATATTTCCTAGGAAGACCAGTTGATGAGGT

[0416] CATATGCAAAAGTTCCCATTTATTGGTTTAGTATAATTGTGCAAATTAGAATTAACC

[0417] CCTAAGTGTATAAAGAGTAGAGCTGGTTAAAAACATAGCCTGTGCTAAGTTTAATT

[0418] GTACAGTAATTTACATTTGTGTGGTACTTCCAAGTTTCCCAAATGCCCTCATATTTGT

[0419] TATCCACCTGTACAGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCT

[0420] CTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGG

[0421] CTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGGGCGCC Docket No. 10935-036W01

[0422] TGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACGTCAAA

[0423] GCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTA

[0424] CGCGCAGCGTGACCGCTACACTTGCCAGCGCCTTAGCGCCCGCTCCTTTCGCTTTCT

[0425] TCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCT

[0426] CCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTT

[0427] GGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGAC

[0428] GTTGGAGTCCACGTTCn AATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAA

[0429] CTCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGTCTATTGG

[0430] TTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAAC

[0431] GTTTACAATTTTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAG

[0432] CCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCC

[0433] GGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGT

[0434] TTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTT

[0435] TATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGG

[0436] GAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATC

[0437] CGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGT

[0438] ATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCT

[0439] ATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCG

[0440] GCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCT

[0441] GAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTC

[0442] CTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTG

[0443] GGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGT

[0444] ATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCC

[0445] ATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCG

[0446] GTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAA

[0447] CTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCA

[0448] TGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCAT

[0449] CGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCC

[0450] GTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACG

[0451] GTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTT

[0452] CTGACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTT

[0453] TAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCT

[0454] TAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATC

[0455] TTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACC Docket No. 10935-036W01

[0456] GCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGT

[0457] AACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTT

[0458] AGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCT

[0459] GTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAG

[0460] ACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACAC

[0461] AGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTA

[0462] TGAGAAAGCGCCACGC 1TCCCGAAGGGAGAAAGGCGGACAGG A TCCGGTAAGCG

[0463] GCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTA

[0464] TCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGC

[0465] TCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTT

[0466] CCTGGCCTTTTGCTGGCCTTTTGCTCACATGT

[0467] 22. SEQ ID NO: 22 - CD33 CAR in TIGIT v3

[0468] CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGAC

[0469] CTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACT

[0470] CCATCACTAGGGGTTCCTGCGGCCGGCGCGCCCAGCCTTGACAAGCCTCCCTGTGG

[0471] GCGAGGTGTAAAGAGGGGCAGAAGTCAGCTCTGGAAGCATAGGGCAGTGGGTGGG

[0472] GAGGAGATGGGCTGGGCTGGGCTGGAGTAGAGATGTGTGGAGAAGGGTGAGAAGA

[0473] CTGGAAAGACAACCTGAATGGGGGACTGGGAGCCTTGAATAACAGGCATGGAGAG

[0474] GAGCGTCTCTTGAAATGGAAGAAACAGGAAATAATTACAGCCTCTATGGAGGAGCA

[0475] ACAGGATGGACTGGAGAAACTATCATTCCAAAATCCAGTTGGGGCCTCAAAGGCCC

[0476] TTAGAATTTTTCTAGGAAGGTTGAAGGCCAGCTGCTGACCCAGGACTCACATGTGCT

[0477] TCGTCCTCTTCCCTAGGAATGATGACAGGCACAATAGAAACAACGGGGAACATTTC

[0478] TGCAGAGAAAGGTGGCTCTATCATCTTACAATGTCACCTCTCCTCCACCACGGCACA

[0479] AGTGACCCAGGTCAACTGGGAGCAGCAGGACCAGCTTCTGGCCATTTGTAATGCTG

[0480] ACTTGGGGTGGCACATCTCCCCATCCTTCAAGGATCGAGTGGCCCCAGGTCCCGGCC

[0481] TGGGCCTCACCCTCCACCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCC

[0482] CCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTrCCTAATA

[0483] AAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCATCGATCAC

[0484] GAGACTAGCCTCGAGAAGCTTGATATCGAATTCCACGGGGTTGGACGCGTCTTAA

[0485] TTAAGGATCCAAGGTCAGGAACAGAGAAACAGGAGAATATGGGCCAAACAGGATA

[0486] TCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGTTGGAACAGCAGA

[0487] ATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAA

[0488] GAACAGATGGTCCCCAGATGCGGTCCCGCCCTCAGCAGTTTCTAGAGAACCATCAG Docket No. 10935-036W01

[0489] ATGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACC

[0490] AATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCTATATAAGC

[0491] AGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGAC

[0492] CTCCATAGAAGACACCGACTCTAGAGGATCGATCCCCCGGGCTGCAGGAATTCAAG

[0493] CGAGAAGACAAGGGCAGAAAGCACCGCCACCATGCTGCTGCTGGTGACCTCTCTGC

[0494] TGCTGTGCGAGCTGCCACACCCAGCCTTCCTGCTGATCCCAATGATGACAGGCACA

[0495] ATAGAAACAACGGGGAACAT1TCTGCAGAGAAAGGTGGCTCTATCATC1TACAATG

[0496] TCACCTCTCCTCCACCACGGCACAAGTGACCCAGGTCAACTGGGAGCAGCAGGACC

[0497] AGCTTCTGGCCATTTGTAATGCTGACTTGGGGTGGCACATCTCCCCATCCTTCAAGG

[0498] ATCGAGTGGCCCCAGGTCCCGGCCTGGGCCTCACCCTCCAGTCGCTGACCGTGAAC

[0499] GATACAGGGGAGTACTTCTGCATCTATCACACCTACCCTGATGGGACGTACACTGG

[0500] GAGAATCTTCCTGGAGGTCCTAGAAAGCTCAGTGGCTGAGCACGGTGCCAGGTTCC

[0501] AGATTCCAACAACAACTCCAGCACCCCGCCCACCTACTCCCGCTCCTACAATCGCCT

[0502] CTCAGCCCCTGTCCCTGCGCCCAGAAGCCTGTCGCCCCGCAGCAGGAGGAGCAGTG

[0503] CACACCAGGGGCCTGGACTTCGCCTGCGATATCTACATCTGGGCTCCTCTGGCTGGA

[0504] ACTTGTGGCGTGCTGCTGCTGTCACTGGTCATTACCCTGTATTGTAAGCGGGGCAGA

[0505] AAGAAGCTGCTGTACATCTTCAAGCAGCCCTTTATGAGGCCTGTGCAGACCACACA

[0506] GGAGGAGGACGGCTGCAGCTGTCGGTTCCCCGAGGAGGAGGAGGGCGGCTGCGAG

[0507] CTGCGGGTGAAGTTTAGCAGATCCGCCGATGCACCAGCATATCAGCAGGGACAGAA

[0508] TCAGCTGTACAACGAGCTGAATCTGGGCAGGCGCGAGGAGTACGACGTGCTGGATA

[0509] AGAGGCGGGGCCGGGACCCCGAGATGGGAGGCAAGCCCAGGCGCAAGAACCCTCA

[0510] GGAGGGCCTGTATAATGAGCTGCAGAAGGACAAGATGGCCGAGGCCTACAGCGAG

[0511] ATCGGCATGAAGGGAGAGCGGAGAAGGGGCAAGGGACACGATGGCCTGTATCAGG

[0512] GCCTGTCCACCGCCACAAAGGACACCTACGATGCACTGCACATGCAGGCCCTGCCA

[0513] CCTCGGTGAAAGTAACGCCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTT

[0514] GCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTA

[0515] ATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCGTCGCTG

[0516] ACCGTGAACGATACAGGGGAGTACTTCTGCATCTATCACACCTACCCTGATGGGAC

[0517] GTACACTGGGAGAATCTTCCTGGAGGTCCTAGAAAGCTCAGGTATTCCTGCTGGAG

[0518] CAAGTTGGTGGATAAACCTCTCCCTCTAGCATAGAAAATGCAATCCTGAAACACTG

[0519] CACAGCAGGGCTTCTCAATTCGGGATCACATTTGAATCACCTGAGGAGATTTTAAAT

[0520] CATACTGATGCCGAGGCCTCACCCAGACCAATTCAATCAGAATCCCTAATAGCAGA

[0521] GCTAAACAAGGGTAAGGTCTAAAAGCATTTCCAGGTGATTCTAATGGGCAGCCAAT

[0522] ACTGAGAACCACTGTTCTTATGTAAGAAGCACATCTTACCTATATTTCCTAGGAAGA Docket No. 10935-036W01

[0523] CCAGTTGATGAGGTCATATGCAAAAGTTCCCATTTATTGGTTTAGTATAATTGTGCA

[0524] AATTAGAATTAACCCCTAAGTGTATAAAGAGTAGAGCTGGTTAAAAACATAGCCTG

[0525] TGCTAAGTTTAATTGTACAGTAATTTACATTTGTGTGGTACTTCCAAGTTTCCCAAAT

[0526] GCCCTCATATTTGTTATCCACCTGTACAGCGGCCGCAGGAACCCCTAGTGATGGAGT

[0527] TGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCG

[0528] CCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGC

[0529] CTGCAGGGGCGCCTGATGCGGTArn CTCCTrACGCATCTGTGCGGTATITCACAC

[0530] CGCATACGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCG

[0531] GGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCTTAGCGCCCGCT

[0532] CCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCT

[0533] AAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAA

[0534] AAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTT

[0535] TCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGG

[0536] AACAACACTCAACTCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATT

[0537] TCGGTCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAAC

[0538] AAAATATTAACGTTTACAATTTTATGGTGCACTCTCAGTACAATCTGCTCTGATGCC

[0539] GCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGC

[0540] TTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCAT

[0541] GTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGA

[0542] TACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTG

[0543] GCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTC

[0544] AAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAA

[0545] AAAGGAAGAGTATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGG

[0546] GTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGC

[0547] CGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCT

[0548] GTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCA

[0549] CGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGA

[0550] CTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTC

[0551] CTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGAT

[0552] CCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTAC

[0553] TCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGC

[0554] TCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGAT

[0555] CTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCG

[0556] CTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACAT Docket No. 10935-036W01

[0557] AGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCT

[0558] TCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCT

[0559] TCTTGACGAGTTCTTCTGACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGAT

[0560] TTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCA

[0561] TGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

[0562] AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAA

[0563] C AAAAAAACC ACCGCTACCAGCGGTGG1T1 G TTTGCCGGATCAAGAGCTACCAACT

[0564] CTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTA

[0565] GTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTC

[0566] GCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACC

[0567] GGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGG

[0568] GGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATAC

[0569] CTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACA

[0570] GGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGG

[0571] GGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCG

[0572] TCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACG

[0573] CGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGT

Claims

Docket No. 10935-036W01CLAIMSWhat is claimed is:

1. A plasmid for use with clustered regularly interspaced short palindromic repeat (CRTSPR) / CRISPR-associated 9 (Cas9) integration systems wherein the plasmid comprises in order a left homology arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide, and a right homology arm; wherein the homology arms specifically hybridize to the T Cell Immunoreceptor with Ig And ITIM Domains (TIGIT) gene.

2. The plasmid of claim 1, wherein the CAR polypeptide comprises a transmembrane domain, a co-stimulatory domain, a CD3q signaling domain, and a single-chain variable fragment (scFV) that specifically binds to a receptor on a target cell.

3. The plasmid of claim 2, wherein the receptor on the target cell comprises CD33, B cell maturation antigen (BCMA), G protein-coupled receptor class C group 5 member D (GPRC5D), CD19, guanylate cyclase-C (GUCY2C), B7 homolog 3 protein (B7-H3), epidermal growth factor receptor (EGFR), disialoganglioside 2 (GD2), IL- 13 Ra2, human epidermal growth factor receptor 2 (HER2), CD20, CD22, or mucin-1 (MUC1).

4. The plasmid of claim 3, wherein scFV specifically binds to CD33 and comprises a sequence at least 90% identical to SEQ ID NO: 19 or a fragment thereof.

5. The plasmid of any one of claims 1-4, wherein the transmembrane domain of the CAR polypeptide comprises a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3C transmembrane domain, or an NKG2D transmembrane domain.

6. The plasmid of any one of claims 1-5, wherein the co-stimulatory domain of the CAR polypeptide comprises a 2B4 domain, a CD28 co-stimulatory domain, a 4-1 BB co- stimulatory domain, or any combination thereof.

7. The plasmid of any one of claims 1-6, further comprising a polyadenylation signal between the transgene and the right homology arm.Docket No. 10935-036W018. The plasmid of any one of claims 1-7, wherein the left homology arm and right homology arm are the same length.

9. The plasmid of claim 8, wherein the homology arms arc each 30bp in length.

10. The plasmid of claim 8, wherein the homology arms are each 300bp in length.

11. The plasmid of claim 8, wherein the homology arms are each 600bp in length.

12. The plasmid of claim 8, wherein the homology arms are each lOOObp in length.

13. The plasmid of any one of claims 1-7, wherein the left homology arm and right homology arm are different lengths.

14. An Adeno-associated viral (AAV) vector comprising the plasmid of any one of claims 1-13.

15. The AAV vector of claim 14, wherein the serotype of the AAV comprises AAV6.

16. The AAV vector of claim 14 or 15, wherein the vector further comprises a plasmid encoding a crRNA, tracer RNA (trcrRNA), and a CAS endonuclease.

17. The AAV vector of any of claims 14-16, wherein the vector is a single stranded AAV (ssAAV).

18. The AAV vector of any of claims 14-17, wherein the vector is a self-complimentary AAV (scAAV).1 . A modified cell comprising the plasmid of any one of claims 1-13 or the AAV vector of any one of claims 14-18.

20. The modified cell of claim 19, wherein the modified cell is a natural killer (NK) cell or NK T cell.Docket No. 10935-036W0121. A method of treating a cancer in a subject comprising administering to a subject with a cancer the modified cell of any one of claims 19 or 20.

22. The method of claim 21, wherein the cancer comprises leukemia, acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), hairy cell leukemia (HCL), or myelodysplastic syndromes (MDS), lymphoma, multiple myeloma, rhabdomyosarcoma, a brain tumor, neuroblastoma, breast cancer, or Ewing’s sarcoma family tumor.

23. A method of engineering a chimeric antigen receptor (CAR) natural killer (NK) cell or NK T cell comprising a) obtaining a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA and an AAV vector comprising a plasmid comprising a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide; wherein the polynucleotide sequence is flanked by homology arms; and wherein the homology arms are 800 bp in length or less; and b) introducing the polynucleotide sequence encoding the CAR polypeptide and the RNP complex into the NK or NK T cell; wherein the polynucleotide sequence encoding the CAR polypeptide is introduced into the NK or NK T cell via infection with the AAV into the NK or NK T cell; wherein the homology arms of RNP complex specifically hybridize to the T Cell Immunoreceptor with Ig And ITIM Domains (TIGIT) gene within the genomic DNA of the NK or NK T cell and the NK or NK T cell’s DNA repair enzymes insert the polynucleotide sequence encoding the CAR polypeptide into the host genome at the target sequence within the genomic DNA of the NK or NK T cell thereby creating a modified cell.

24. The method of claim 23, wherein the NK or NK T cell is a primary cell or an expanded NK or NK T cell.

25. The method of claim 24, wherein the primary NK or NK T cell is incubated for about 4 to 10 days in the presence of IL-2 prior to infection.Docket No. 10935-036W0126. The method of claim 23 or 24, wherein the primary NK or NK T cell is expanded for about 4 to 10 days in the presence of irradiated feeder cells, plasma membrane particles, or exosomes prior to infection.

27. The method of claim 26, wherein the irradiated feeder cells, plasma membrane particles, or exosomes express membrane bound 4-1BBL, membrane-bound IL-21, or membrane-bound IL- 15, or any combination thereof.

28. The method of any one of claims 23-27, further comprising expanding the modified NK or NK T cell with irradiated feeder cells, plasma membrane particles, or exosomes following infection, wherein the irradiated feeder cells, plasma membrane particles, or exosomes express membrane bound 4-1 BBL, membrane-bound IL-21, or membrane -bound IL- 15, or any combination thereof.

29. The method of any one of claims 23-28, further comprising expanding the modified NK or NK T cell with IL-2 following infection.

30. The method of any one of claims 23-29, wherein the NK or NK T cell is infected with about 5 to 500,000 multiplicity of infection (MOI) of the AAV.

31. The method of any one of claims 23-30, wherein the RNP complex is introduced into the NK or NK T cell via electroporation.

32. The method of any one of claims 23-31, wherein the RNP complex is introduced into the cell via transfection; and wherein the RNP complex is encoded on the same or a different AAV.

33. The method of any one of claims 23-32, wherein the CAR polypeptide comprises a transmembrane domain, a co-stimulatory domain, a CD3 > signaling domain, and a singlechain variable fragment (scFV) that specifically binds to a receptor on a target NK or NK T cell.Docket No. 10935-036W0134. The method of claim 33, wherein the receptor comprises CD33, B cell maturation antigen (BCMA), G protein-coupled receptor class C group 5 member D (GPRC5D), CD19, guanylate cyclase-C (GUCY2C), B7 homolog 3 protein (B7-H3), epidermal growth factor receptor (EGFR), disialoganglioside 2 (GD2), IL- 13 Ra2, human epidermal growth factor receptor 2 (HER2), CD20, CD22, or mucin-1 (MUC1).

35. The method of 34, wherein scE’V specifically binds to CD33 and said scEv comprises a sequence at least 90% identical to SEQ ID NO: 19 or a fragment thereof.

36. The method of any one of claims 23-35, wherein the transmembrane domain of the CAR polypeptide comprises a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3C transmembrane domain, or an NKG2D transmembrane domain.

37. The method of any one of claims 23-36, wherein the co-stimulatory domain of the CAR polypeptide comprises a 2B4 domain, a CD28 co-stimulatory domain, a 4-1 BB costimulatory domain, or any combination thereof.

38. The method of any one of claims 23-37, wherein the left homology arm and right homology arm are the same length.

39. The method of claim 38, wherein the homology arms are each 600bp in length.

40. The method of any one of claims 23-37, wherein the left homology arm and right homology arm are different lengths.

41. The method of any one of claims 23-40, wherein the plasmid further comprises a murine leukemia virus-derived (MND) promoter.

42. The method of any one of claims 23-41, wherein the serotype of the AAV comprises AAV6.

43. The method of any one of claims 23-42, wherein the vector is a single stranded AAV (ssAAV) or a self-complimentary AAV (scAAV).Docket No. 10935-036W0144. The method of any of claims 23-43, wherein the vector comprises a sequence at least 90% identical to SEQ ID NO: 22 or SEQ ID NO: 23 or a fragment thereof.

45. A method of treating a cancer in a subject comprising administering to the subject a therapeutically effective amount of a natural killer (NK) cell or NK T cell, wherein the NK cell or NK T cell comprises a plasmid for use with clustered regularly interspaced short palindromic repeat (CRISPR) / CRISPR-associated 9 (Cas9) integration systems wherein the plasmid comprises in order a left homology arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide, and a right homology arm; wherein the left and right homology arms are each lOOObp in length or less; and wherein the left and right homology arms specifically hybridize to a T Cell Immunoreceptor with Ig And ITIM Domains (TIGIT) gene in NK cell or NK T cell.

46. The method of claim 45, wherein the CAR polypeptide comprises a transmembrane domain, a co-stimulatory domain, a CD3 signaling domain, and a single-chain variable fragment (scFV) that specifically binds to a receptor on a target cell.

47. The method of claim 46, wherein the receptor comprises CD33, B cell maturation antigen (BCMA), G protein-coupled receptor class C group 5 member D (GPRC5D), CD19, guanylate cyclase-C (GUCY2C), B7 homolog 3 protein (B7-H3), epidermal growth factor receptor (EGFR), disialoganglioside 2 (GD2), IL- 13 Ra2, human epidermal growth factor receptor 2 (HER2), CD20, CD22, or mucin-1 (MUC1).

48. The method of claim 47, wherein scFV specifically binds to CD33, said scFv comprising a sequence at least 90% identical to SEQ ID NO: 19 or a fragment thereof.

49. The method of any one of claims 45-48, wherein the transmembrane domain of the CAR polypeptide comprises a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3 transmembrane domain, or an NKG2D transmembrane domain.Docket No. 10935-036W0150. The method of any one of claims 45-49, wherein the co-stimulatory domain of the CAR polypeptide comprises a 2B4 domain, a CD28 co-stimulatory domain, a 4-1 BB costimulatory domain, or any combination thereof.

51. The method of any one of claims 45-50, further comprising a polyadcnylation signal between the transgene and the right homology arm.

52. The method of any one of claims 45-51, wherein the left homology arm and right homology arm are the same length.

53. The method of claim 52, wherein the homology arms are each 30bp in length.

54. The method of claim 52, wherein the homology arms are each 300bp in length.

55. The method of claim 52, wherein the homology arms are each 600bp in length.

56. The method of claim 52, wherein the homology arms are each lOOObp in length.

57. The method of any one of claims 45-50, wherein the left homology arm and right homology arm are different lengths.

58. The method of any one of claims 45-57, further comprising a murine leukemia virus- derived (MND) promoter.

59. The method of any one of claims 45-58, wherein the plasmid is transduced into the NK by an Adeno-associated viral (AAV) vector.

60. The method of claim 59, wherein the serotype of the AAV comprises AAV6.

61. The method of claim 59 or 60, wherein the vector further comprises a plasmid encoding a crRNA, tracer RNA (trcrRNA), and a CAS endonuclease.

62. The method of any one of claims 59-61, wherein the vector is a single stranded AAV (ssAAV).Docket No. 10935-036W0163. The method of any one of claims 59-62, wherein the vector is a self-complimentary AAV (scAAV).

64. The method of any one of claims 59-63, wherein the vector comprises a sequence at least 90% identical to SEQ ID NO: 22 or SEQ ID NO: 23 or a fragment thereof.

65. The method of any one of claims 45-64, wherein the cancer comprises leukemia, acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), hairy cell leukemia (HCL), or myelodysplastic syndromes (MDS), lymphoma, multiple myeloma, rhabdomyosarcoma, a brain tumor, neuroblastoma, breast cancer, or Ewing’s sarcoma family tumor.