Circularly structured guide rnas for crispr genome editing

Abstract

Provided herein are circularly structured guide RNAs with a circularization portion and a 3' to 3' linkage to the guide RNA.

Description

[0001] CIRCULARLY STRUCTURED GUIDE RNAs FOR

[0002] CRISPR GENOME EDITING CROSS REFERENCE TO RELATED APPLICATION

[0003] This application claims the benefit of U.S. Provisional Patent Application Serial No. 63 / 712,046, filed October 25, 2024. The entire content of the above-referenced patent application is incorporated by reference in its entirety herein.

[0004] BACKGROUND CRISPR gene editing makes use of a Cas enzyme with an RNA guide [Doudna et al., Science, 2014], The most commonly used Cas protein is called Cas9, and requires an RNA guide of about 100 nucleotides [Yin et al., Nat Biotechnol, 2017], A variation of CRISPR editing is called Prime editing (PE) [Anzalone et al., Nature, 2019], which uses a reverse transcriptase to incorporate a short edit in a site-specific manner without double-strand breaks, and this requires an even longer guide (typically 120 to 180 nucleotides). These guides are susceptible to nuclease cleavage, activation of the innate immune system, and endosomal entrapment, all of which reduce their editing efficacy inside cells.

[0005] The termini of RNA molecules are particularly susceptible to degradation by nucleases and recognition by many innate immune factors.

[0006] Accordingly, there exists a need in the art for optimized guide RNAs and prime editing RNAs (pegRNAs) that retain efficient genome editing activity in vivo and ex vivo when paired with a CRISPR nuclease, such as Cas9.

[0007] SUMMARY

[0008] The present disclosure provides circularly structured guide RNAs and prime editing RNAs (pegRNAs, including petRNAs) for CRISPR genome editing. The circularly structured RNAs (i.e., guide RNA or pegRNA) are capable of circularization through base pair complementarity between a circularization portion of the RNA and another portion of the RNA (such as a terminal 5’ or 3’ end of the RNA). The circularization portion is linked to the RNA via an inverted nucleotide linkage, such as a 3’ to 3’ linkage or a 5’ to 5’ linkage. Through circularization, the circularly structured guide RNAs and prime editing RNAs (pegRNAs) are resistant to degradation, such as though nuclease degradation (e.g., exonucleases). The circular structure also reduces the recognition by innate immune factors.

[0009] The present disclosure demonstrates that circularly structured guides show substantially enhanced editing efficacy relative to linear guides, both in cells (codelivered with Cas9 mRNA via electroporation) and in vivo (co-delivered with Cas9 mRNA via lipid nanoparticles).

[0010] In one aspect, the disclosure provides a circularly structured guide RNA comprising: (a) a crRNA portion comprising (i) a guide sequence capable of hybridizing to a target polynucleotide sequence, and (ii) a repeat sequence; (b) a tracrRNA portion comprising an anti-repeat nucleotide sequence that is complementary to the repeat sequence; and (c) a circularization portion comprising at least 4 inverted nucleotides with complementarity to the crRNA portion, wherein the circularization portion is linked to the tracrRNA portion via a 3’ to 3’ linkage.

[0011] In one aspect, the disclosure provides a circularly structured guide RNA comprising: (a) a crRNA portion comprising (i) a guide sequence capable of hybridizing to a target polynucleotide sequence, and (ii) a repeat sequence; (b) a tracrRNA portion comprising an anti-repeat nucleotide sequence that is complementary to the repeat sequence; and (c) a circularization portion comprising at least 4 inverted nucleotides with complementarity to the tracrRNA portion, wherein the circularization portion is linked to the crRNA portion via a 5’ to 5’ linkage.

[0012] In certain embodiments, the circularization portion comprises between 4 and 20 inverted nucleotides with complementarity to the guide sequence or the tracrRNA portion. In certain embodiments, the circularization portion comprises between 4 and 10 inverted nucleotides with complementarity to the guide sequence or the tracrRNA portion. In certain embodiments, the circularization portion comprises 4 inverted nucleotides with complementarity to the guide sequence or the tracrRNA portion. In certain embodiments, the circularization portion comprises 5 inverted nucleotides with complementarity to the guide sequence or the tracrRNA portion. In certain embodiments, the circularization portion comprises between 6 inverted nucleotides with complementarity to the guide sequence or the tracrRNA portion. In certain embodiments, the circularization portion comprises 7 inverted nucleotides with complementarity to the guide sequence or the tracrRNA portion. In certain embodiments, the circularization portion comprises 8 inverted nucleotides with complementarity to the guide sequence or the tracrRNA portion. In certain embodiments, the circularization portion comprises 9 inverted nucleotides with complementarity to the guide sequence or the tracrRNA portion. In certain embodiments, the circularization portion comprises 10 inverted nucleotides with complementarity to the guide sequence or the tracrRNA portion.

[0013] In certain embodiments, the circularization portion comprises sufficient complementarity to the guide sequence or the tracrRNA portion to permit circularization.

[0014] In certain embodiments, the circularization portion comprises 1-3 mismatches with the guide sequence or the tracrRNA portion. In certain embodiments, the circularization portion comprises 1 mismatch with the guide sequence or the tracrRNA portion. In certain embodiments, the circularization portion comprises 2 mismatches with the guide sequence or the tracrRNA portion. In certain embodiments, the circularization portion comprises 3 mismatches with the guide sequence or the tracrRNA portion.

[0015] In certain embodiments, the 3’ to 3’ linkage or the 5’ to 5’ linkage further comprises a non-nucleotide linker.

[0016] In certain embodiments, the non-nucleotide linker is selected from the group consisting of an ethylene glycol chain, an alkyl chain, a polypeptide, a polysaccharide, and a block copolymer.

[0017] In certain embodiments, the non-nucleotide linker comprises a C2-C16 alkyl linker.

[0018] In certain embodiments, the non-nucleotide linker comprises an ethylene glycol linker comprising 1 to 10 ethylene glycol units. In certain embodiments, the non-nucleotide linker comprises a tri ethylene glycol, a tetra ethylene glycol linker, or a hexa ethylene glycol linker.

[0019] In certain embodiments, the circularization portion comprises at least 4 inverted nucleotides with complementarity to the guide sequence of the crRNA portion.

[0020] In certain embodiments, the crRNA portion comprises, from 5’ to 3’, auniversal polynucleotide sequence, the guide sequence, and the repeat sequence.

[0021] In certain embodiments, the circularization portion comprises at least 4 inverted nucleotides with complementarity to the universal polynucleotide sequence of the crRNA portion.

[0022] In certain embodiments, the 3’ to 3’ linkage further comprises a cleavable linker.

[0023] In certain embodiments, the tracrRNA portion comprises, from 5’ to 3’, the antirepeat nucleotide sequence, one or more stem loop sequences, and a universal polynucleotide sequence.

[0024] In certain embodiments, the circularization portion comprises at least 4 inverted nucleotides with complementarity to the universal polynucleotide sequence of the tracrRNA portion.

[0025] In certain embodiments, the crRNA portion comprises a 5’ single strand sequence of at least one nucleotide.

[0026] In certain embodiments, the crRNA portion comprises a 5’ single strand sequence of between 1 to 10 nucleotides in length.

[0027] In certain embodiments, the circularization portion is not complementary to the 5’ single strand sequence of the crRNA portion.

[0028] In certain embodiments, the circularly structured guide RNA comprises at least one modified nucleotide.

[0029] In certain embodiments, the crRNA portion comprises at least one modified nucleotide. In certain embodiments, the tracrRNA portion comprises at least one modified nucleotide.

[0030] In certain embodiments, the circularization portion comprises at least one modified nucleotide.

[0031] In certain embodiments, the at least one modified nucleotide each independently comprise a modification of a ribose group, a phosphate group, a nucleobase, or a combination thereof.

[0032] In certain embodiments, each modification of the ribose group is independently selected from the group consisting of 2'-O-methyl, 2’-fluoro, 2’-deoxy, 2’ -O-(2-methoxy ethyl) (MOE), 2’-NH2 (2’ -amino), 4’ -thio, a bicyclic nucleotide, a locked nucleic acid (LNA), a 2’-(5)-constrained ethyl (S-cEt), a constrained MOE, and a 2'-O,4'-C-aminomethylene bridged nucleic acid (2',4'-BNANC).

[0033] In certain embodiments, at least 80% of the ribose groups are chemically modified. In certain embodiments, at least 90% of the ribose groups are chemically modified. In certain embodiments, 100% of the ribose groups are chemically modified.

[0034] In certain embodiments, each modification of the phosphate group is independently selected from the group consisting of a phosphorothioate, phosphonoacetate (PACE), thiophosphonoacetate (thioPACE), amide, triazole, phosphonate, and phosphotriester modification.

[0035] In certain embodiments, each modification of the nucleobase group is independently selected from the group consisting of 2-thiouridine, 4-thiouridine, N6-methyladenosine, pseudouridine, 2,6-diaminopurine, inosine, thymidine, 5-methylcytosine, 5-substituted pyrimidine, isoguanine, isocytosine, and halogenated aromatic groups.

[0036] In certain embodiments, circularly structured guide RNA comprises the sequence 5'(N)xGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUU AUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU< 33>( iN)y 5', wherein X corresponds to the guide sequence and an integer of between 17 and 20, each N corresponds to a nucleotide of A, U, G, or C, y corresponds to the circularization portion and an integer of between 4 and 20, < 33> corresponds to a 3’ to 3’ linkage, and each iN corresponds to a nucleotide of A, U, G, or C.

[0037] In certain embodiments, the circularly structured guide RNA further comprises a nucleotide or non-nucleotide loop or linker linking the 3’ end of the crRNA portion to the 5’ end of the tracrRNA portion.

[0038] In certain embodiments, the non-nucleotide linker comprises an ethylene glycol oligomer linker.

[0039] In certain embodiments, the nucleotide loop is chemically modified.

[0040] In certain embodiments, the nucleotide loop comprises the nucleotide sequence ofGAAA.

[0041] In certain embodiments, the guide RNA binds to a Cas9 nuclease selected from the group consisting of S. pyogenes Cas9 (SpCas9), S. aureus Cas9 (SaCas9), N meningitidis Cas9 (NmCas9), C. jejuni Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9).

[0042] In certain embodiments, the Cas9 is a variant Cas9 with altered activity.

[0043] In certain embodiments, the variant Cas9 is selected from the group consisting of a Cas9 nickase (nCas9), a catalytically dead Cas9 (dCas9), a hyper accurate Cas9 (HypaCas9), a high fidelity Cas9 (Cas9-HF), an enhanced specificity Cas9 (eCas9), and an expanded PAM Cas9 (xCas9).

[0044] In certain embodiments, the Cas9 or variant Cas9 is fused to a nucleotide base editor (NBE) domain.

[0045] In certain embodiments, the NBE domain is an adenine base editor (ABE) domain.

[0046] In certain embodiments, the ABE domain is a adenosine deaminase8e protein domain (ABE8e).

[0047] In certain embodiments, the NBE domain is a cytidine base editor (CBE) domain.

[0048] In certain embodiments, the CBE domain is evoFERNY or rAPOBECl. In one aspect, the disclosure provides a method of altering expression of a target gene in a cell, comprising administering to said cell a genome editing system comprising: the circularly structured guide RNA described herein; and an RNA-guided nuclease or a polynucleotide encoding an RNA-guided nuclease.

[0049] In certain embodiments, the target gene is in a cell in an organism.

[0050] In certain embodiments, the expression of the target gene reduced compared to a cell the is not administered the genome editing system.

[0051] In certain embodiments, the circularly structured guide RNA and the RNA-guided nuclease comprise a ribonucleoprotein (RNP) complex.

[0052] In certain embodiments, the RNA-guided nuclease is selected from the group consisting of S. pyogenes Cas9 (SpCas9), S. aureus Cas9 (SaCas9), N. meningitidis Cas9 (NmCas9), C. jejuni Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9).

[0053] In certain embodiments, the Cas9 is a variant Cas9 with altered activity.

[0054] In certain embodiments, the variant Cas9 is selected from the group consisting of a Cas9 nickase (nCas9), a catalytically dead Cas9 (dCas9), a hyper accurate Cas9 (HypaCas9), a high fidelity Cas9 (Cas9-HF), an enhanced specificity Cas9 (eCas9), and an expanded PAM Cas9 (xCas9).

[0055] In certain embodiments, the Cas9 or variant Cas9 is fused to a nucleotide base editor (NBE) domain.

[0056] In certain embodiments, the NBE domain is an adenine base editor (ABE) domain.

[0057] In certain embodiments, the ABE domain is a adenosine deaminase8e protein domain (ABE8e).

[0058] In certain embodiments, the NBE domain is a cytidine base editor (CBE) domain.

[0059] In certain embodiments, the CBE domain is evoFERNY or rAPOBECl.

[0060] In certain embodiments, the polynucleotide encoding an RNA-guided nuclease comprises a vector. In certain embodiments, the vector is a viral vector.

[0061] In certain embodiments, the viral vector is an adeno-associated virus (AAV) vector or a lentivirus (LV) vector.

[0062] In certain embodiments, the polynucleotide encoding an RNA-guided nuclease comprises a synthetic mRNA.

[0063] In certain embodiments, the expression of the target gene is reduced by at least about 20%.

[0064] In certain embodiments, the circularly structured guide RNA and / or the RNA-guided nuclease or the polynucleotide encoding the RNA-guided nuclease are encapsulated in a lipid nanoparticle (LNP).

[0065] In one aspect, the disclosure provides a CRISPR genome editing system comprising: the circularly structured guide RNA described herein; and an RNA-guided nuclease or a polynucleotide encoding an RNA-guided nuclease.

[0066] In certain embodiments, the RNA-guided nuclease is selected from the group consisting of S. pyogenes Cas9 (SpCas9), S. aureus Cas9 (SaCas9), N. meningitidis Cas9 (NmCas9), C. jejuni Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9).

[0067] In certain embodiments, the Cas9 is a variant Cas9 with altered activity.

[0068] In certain embodiments, the variant Cas9 is selected from the group consisting of a Cas9 nickase (nCas9), a catalytically dead Cas9 (dCas9), a hyper accurate Cas9 (HypaCas9), a high fidelity Cas9 (Cas9-HF), an enhanced specificity Cas9 (eCas9), and an expanded PAM Cas9 (xCas9).

[0069] In certain embodiments, the Cas9 or variant Cas9 is fused to a nucleotide base editor (NBE) domain.

[0070] In certain embodiments, the NBE domain is an adenine base editor (ABE) domain.

[0071] In certain embodiments, the ABE domain is a adenosine deaminase8e protein domain (ABE8e). In certain embodiments, the NBE domain is a cytidine base editor (CBE) domain.

[0072] In certain embodiments, the CBE domain is evoFERNY or rAPOBECl.

[0073] In one aspect, the disclosure provides a circularly structured prime editing guide RNA (pegRNA) comprising: (a) a crRNA portion comprising (i) a guide sequence capable of hybridizing to a target polynucleotide sequence, and (ii) a repeat sequence; (b) a tracrRNA portion comprising an anti-repeat nucleotide sequence that is complementary to the repeat sequence; (c) a nucleotide polymerase template (NPT) portion; (d) a primer binding site (PBS) portion, wherein: i) a circularization portion comprising at least 4 inverted nucleotides with complementarity to the crRNA portion is linked to the PBS portion via a 3’ to 3’ linkage; or ii) a circularization portion comprising at least 4 inverted nucleotides with complementarity to the PBS portion is linked to the crRNA portion via a 5’ to 5’ linkage.

[0074] In one aspect, the disclosure provides a circularly structured prime editor template RNA (petRNA) comprising a primer binding site (PBS) and a nucleotide polymerase template (NPT), wherein a circularization portion comprising at least 4 inverted nucleotides with complementarity to the PBS and / or NPT is linked to the PBS and / or NPT via a 3’ to 3’ linkage.

[0075] In certain embodiments, the circularization portion comprises between 4 and 20 inverted nucleotides with complementarity to the guide sequence or the PBS portion.

[0076] In certain embodiments, the 3’ to 3’ linkage or the 5’ to 5’ linkage further comprises a non-nucleotide linker.

[0077] In certain embodiments, the non-nucleotide linker is selected from the group consisting of an ethylene glycol chain, an alkyl chain, a polypeptide, a polysaccharide, and a block copolymer.

[0078] In certain embodiments, the non-nucleotide linker comprises a C2-C16 alkyl linker.

[0079] In certain embodiments, the non-nucleotide linker comprises an ethylene glycol linker comprising 1 to 10 ethylene glycol units. In certain embodiments, the non-nucleotide linker comprises a tri ethylene glycol, a tetra ethylene glycol linker, or a hexa ethylene glycol linker.

[0080] In certain embodiments, the circularization portion comprises at least 4 inverted nucleotides with complementarity to the guide sequence of the crRNA portion.

[0081] In certain embodiments, the crRNA portion comprises, from 5’ to 3’, auniversal polynucleotide sequence, the guide sequence, and the repeat sequence.

[0082] In certain embodiments, the circularization portion comprises at least 4 inverted nucleotides with complementarity to the universal polynucleotide sequence of the crRNA portion.

[0083] In certain embodiments, the 3’ to 3’ linkage further comprises a cleavable linker.

[0084] In certain embodiments, the PBS portion comprises a universal polynucleotide sequence at the 3’ end of the PBS portion.

[0085] In certain embodiments, the circularization portion comprises at least 4 inverted nucleotides with complementarity to the universal polynucleotide sequence of the PBS portion.

[0086] In certain embodiments, the circularly structured petRNA comprises at least one MS2 hairpin. In certain embodiments, the circularly structured petRNA comprises, from 5’ to 3’ at least one MS2 hairpin, the NPT portion, and the PBS portion.

[0087] In certain embodiments, the circularly structured pegRNA or petRNA comprises at least one modified nucleotide.

[0088] In certain embodiments, the crRNA portion comprises at least one modified nucleotide.

[0089] In certain embodiments, the tracrRNA portion comprises at least one modified nucleotide.

[0090] In certain embodiments, the circularization portion comprises at least one modified nucleotide. In certain embodiments, the at least one modified nucleotide each independently comprise a modification of a ribose group, a phosphate group, a nucleobase, or a combination thereof.

[0091] In certain embodiments, each modification of the ribose group is independently selected from the group consisting of 2'-(9-methyl, 2’-fluoro, 2’-deoxy, 2’ -O-(2-methoxy ethyl) (MOE), 2’-NH2 (2’ -amino), 4’ -thio, a bicyclic nucleotide, a locked nucleic acid (LNA), a 2’-(5)-constrained ethyl (S-cEt), a constrained MOE, and a 2'-(9,4'-C-aminomethylene bridged nucleic acid (2',4'-BNANC).

[0092] In certain embodiments, at least 80% of the ribose groups are chemically modified.

[0093] In certain embodiments, at least 90% of the ribose groups are chemically modified.

[0094] In certain embodiments, 100% of the ribose groups are chemically modified. In certain embodiments, each modification of the phosphate group is independently selected from the group consisting of a phosphorothioate, phosphonoacetate (PACE), thiophosphonoacetate (thioPACE), amide, triazole, phosphonate, and phosphotriester modification.

[0095] In certain embodiments, each modification of the nucleobase group is independently selected from the group consisting of 2-thiouridine, 4-thiouridine, N6-methyladenosine, pseudouridine, 2,6-diaminopurine, inosine, thymidine, 5-methylcytosine, 5-substituted pyrimidine, isoguanine, isocytosine, and halogenated aromatic groups.

[0096] In certain embodiments, the circularly structured pegRNA further comprises a nucleotide or non-nucleotide loop or linker linking the 3’ end of the crRNA portion to the 5’ end of the tracrRNA portion.

[0097] In certain embodiments, the non-nucleotide linker comprises an ethylene glycol oligomer linker.

[0098] In certain embodiments, the nucleotide loop is chemically modified. In certain embodiments, the nucleotide loop comprises the nucleotide sequence ofGAAA.

[0099] In one aspect, the disclosure provides a prime editing system comprising: the circularly structured pegRNA described herein; and a fusion protein comprising a Cas9 nickase protein linked to a nucleotide polymerase (NT) protein or a polynucleotide encoding the fusion protein.

[0100] In certain embodiments, the NT protein is a reverse transcriptase.

[0101] In certain embodiments, the reverse transcriptase is a retrovirus reverse transcriptase.

[0102] In certain embodiments, the reverse transcriptase is a Moloney murine leukemia virus (M-MLV) reverse transcriptase.

[0103] In certain embodiments, the fusion protein is linked to at least one MS2 binding protein.

[0104] BRIEF DESCRIPTION OF THE DRAWINGS

[0105] The foregoing and other features and advantages of the present disclosure will be more fully understood from the following detailed description of illustrative embodiments taken in conjunction with the accompanying drawings. The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0106] FIG. 1A - FIG. 1C depict schematics of exemplary circularly structured guide RNAs. FIG. 1A depicts a circularly structured guide RNA with a circularization domain (CD) of six reverse nucleotides (see bracketed region) joined to the 3 ’-end via a 3 ’-3’ linkage. All nucleotides may be natural or modified. FIG. IB depicts a circularly structured guide RNA where the circularization domain of inverted nucleotides (see bracketed region) is added at the 5’-end of the guide, via a 5’, 5’ linkage. In some embodiments, this may be designed to be complementary to an additional stretch of normal nucleotides (NN) added at the 3 ’-end past the third stem loop (see bracketed region). FIG. 1C depicts a circularly structured guide RNA where the circularization domain may be joined to the rest of the guide by a non-nucleotide linker (indicated by a line above at the 3 ’,3’ linkage). FIG. 2 depicts the percentage of GFP positive cells expressing the mTmG reporter after electroporation with circularly structured or chemical-modification-matched linear guide RNAs combined with Cas9-encoding mRNA. After 90 hours, the GFP-expressing cells were counted by flow cytometry.

[0107] FIG. 3 depicts GFP expression from brain slices from a mouse model expressing the mTmG reporter. Mice were injected intrastriatally with 1.25 pg of total RNA (ratio 3:1 Cas9-encoding mRNA to guide RNA) encapsulated in lipid nanoparticles (LNPs). Three mice per group were injected with a circularly structured or chemical -modification-matched linear guide. After 7 days, the mice were euthanized, brain sections were prepared, and GFP-expressing cells were visualized by immunohi stochemi stry .

[0108] FIG. 4 depicts the percentage of GFP positive cells expressing the mTmG reporter after electroporation with circularly structured or chemical-modification-matched linear guide RNAs combined with Cas9-encoding mRNA. After 72 hours, the GFP-expressing cells were counted by flow cytometry. Circularly structured guide RNAs with complementary domains of 4, 6, 8, and 10 bases were tested.

[0109] FIG. 5 depicts the percentage of GFP positive cells expressing the mTmG reporter after electroporation with circularly structured or chemical-modification-matched linear guide RNAs combined with Cas9-encoding mRNA. After 72 hours, the GFP-expressing cells were counted by flow cytometry. Circularly structured guide RNAs containing a circularization domain of 6 inverted bases complementary to the 5' end of the guide region or a control sequence containing 6 scrambled inverted bases were tested.

[0110] FIG. 6 depicts the percentage of GFP positive cells expressing the mTmG reporter after electroporation with circularly structured or chemical-modification-matched linear guide RNAs combined with Cas9-encoding mRNA. After 72 hours, the GFP-expressing cells were counted by flow cytometry. The circularization domain was placed on the 5'- or 3 '-terminus of the guide RNA, with and without a C9 alkyl spacer.

[0111] FIG. 7A depicts the percentage of GFP positive cells expressing the mTmG reporter after electroporation with circularly structured or chemical-modification- matched linear guide RNAs combined with Cas9-encoding mRNA. After 72 hours, the GFP-expressing cells were counted by flow cytometry. The circularization domains were complementary to the 5 '-terminus (“O-shaped” as shown in FIG. 1A, FIG. 1C) or with a “tail” of 4 or 8 nucleotides between the 5 '-terminus and the region of complementarity to the circularization domain (as depicted in FIG. 7B).

[0112] FIG. 7B depicts a schematic of an exemplary circularly structured guide RNA with a single stranded tail between the 5 '-terminus and the region of complementarity to the circularization domain.

[0113] FIG. 8A - FIG. 8B depict liver editing in the mTmG reporter in mice. Circularly structured and linear guide RNAs were formulated into LNPs at a 6:1 ratio of Cas9 mRNA to guide RNA (mass / mass). The LNPs containing circularly structured and linear guide RNAs had similar Z-average around 250 nm, and a similar encapsulation efficiency (80-90%). 3.0 mg / kg of total RNA was formulated into LNPs and injected intravenously into mTmG reporter-expressing mice (six mice per group) to deliver to the liver. After one week, the mice were euthanized. Liver sections from one liver lobe were prepared for immunohistochemistry staining (FIG.8A) to visualize GFP-expressing cells to show successful editing. Genomic DNA of liver tissue from the other liver lobes were extracted to quantify editing efficiency by amplicon deep sequencing and ddPCR (FIG. 8B).

[0114] FIG. 9 depicts the percentage of modified reads at an endogenous target in mouse, mPcsk9. Circularly structured or linear guide RNA and Cas9-expressing mRNA (6:1 ratio of Cas9 mRNA to guide RNA, mass / mass) were co-encapsulated in LNPs and injected intravenously into wild-type mice (five or six mice per group) at 0.2, 0.8, 3.0 mg / kg of total RNA. After one week, mice were euthanized to collect liver tissue for genomic DNA extraction. Editing efficiency of the gene mPcsk9 was measured by amplicon deep sequencing.

[0115] FIG. 10A - FIG. 10C depict adenine base editing in cultured MEFs expressing the GER10 reporter. The GER10 target is depicted in FIG. 10A, with the top strand as SEQ ID NO: 3 and the bottom strand depicted as SEQ ID NO: 4. Circularly structured ABE guide RNAs were tested in cultured cells expressing the GER10 reporter system. IxlO5cultured MEFs were electroporated with 1, 0.5, 0.25, 0.13, and 0.06 pmol of circularly structured or linear ABE guide RNA with 50 ng of adenine base editor mRNA. After 72 hours, the Venus-expressing cells were counted by flow cytometry (FIG. 10B). The same experiment was repeated, where amount of adenine base editing was measured by amplicon deep sequencing (FIG. IOC).

[0116] FIG. 11A - FIG. 11B depict adenine base editing of the GER10 reporter in mouse liver. Circularly structured and linear guides were formulated into LNPs. The LNPs containing circularly structured and linear guides had Z-average of 169 and 197 nm, respectively, and a similar encapsulation efficiency (83%). 0.2 or 0.8 mg / kg of total RNA (6:1 ratio of Cas9 mRNA to guide RNA, mass / mass) was formulated into LNPs and injected intravenously into GER10 reporter-expressing mice (six mice per group) to deliver to the liver. After 2 weeks, the mice were euthanized. Liver sections from one liver lobe were prepared for immunohistochemistry staining to visualize Venus-expressing cells (FIG. 11A). Genomic DNA of liver tissue from the other liver lobes were extracted to quantify adenine base editing efficiency by amplicon deep sequencing (FIG. 11B)

[0117] FIG. 12A - FIG. 12B depict adenine base editing of the GER10 reporter in mouse brain. 1.5 pg of total RNA (6: 1 ratio of Cas9 mRNA to guide RNA, mass / mass) was formulated into LNPs and stereotactically injected into the right striatum of GER10 reporter-expressing mice (seven mice per group). After 2 weeks, the mice were euthanized. Brain sections from three mice per group were prepared for immunohistochemistry staining to visualize Venus-expressing cells to show successful adenine base editing (FIG. 12A, each column represents one mouse). Genomic DNA of left and right (injected) striatum of four mice per group were extracted to quantify adenine base editing efficiency by amplicon deep sequencing (FIG. 12B).

[0118] FIG. 13 depicts split prime editing of FANCF 3-nucleotide substitution. 50,000 cultured HEK293T cells were electroporated with 250 ng of mRNA (nCas9 and RT), 25 pmol of nicking sgRNA, 25 pmol of linear or circularly structure sgRNA targeting FANCF gene, and 25 pmol of linear or circularly structured (6-base complement with a C9 linker) LPET After 96 hours, genomic DNA was extracted and prepared for amplicon deep sequencing for the correct edit of FANCF locus which is a 3-nucleotide substitution. DETAILED DESCRIPTION

[0119] Provided herewith are circularly structured guide RNAs (gRNAs) and pegRNAs.

[0120] Unless otherwise defined herein, nomenclature used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. The methods and techniques provided herein are usually performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications unless otherwise specified, as commonly accomplished in the art or as described herein. The nomenclature used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art, unless otherwise specified. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.

[0121] Unless otherwise defined herein, scientific and technical terms used herein have the meanings that are commonly understood by those of ordinary skill in the art. In the event of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. The use of “or” means “and / or” unless stated otherwise. The use of the term “including,” as well as other forms, such as “includes” and “included,” is not limiting.

[0122] So that the disclosure may be more readily understood, certain terms are first defined.

[0123] As used herein, the term “guide RNA” or “gRNA” refer to any nucleic acid that promotes the specific association (or “targeting”) of an RNA-guided nuclease such as a Cas9 to a target sequence (e.g., a genomic or episomal sequence) in a cell. As used herein, a “modular” or “dual RNA” guide comprises more than one, and typically two, separate RNA molecules, such as a CRISPR RNA (crRNA) and a trans-activating crRNA (tracrRNA), which are usually associated with one another, for example by duplexing. gRNAs and their component parts are described throughout the literature (see, e.g., Briner et al. Mol. Cell, 56(2), 333-339 (2014), which is incorporated by reference).

[0124] As used herein, a “unimolecular gRNA,” “chimeric gRNA,” or “single guide RNA (sgRNA)” comprises a single RNA molecule. The sgRNA may be a crRNA and tracrRNA linked together. For example, the 3 ’ end of the crRNA may be linked to the 5’ end of the tracrRNA. A crRNA and a tracrRNA may be joined into a single unimolecular or chimeric gRNA, for example, by means of a four nucleotide (e.g., GAAA) “tetraloop” or “linker” sequence bridging complementary regions of the crRNA (at its 3' end) and the tracrRNA (at its 5' end).

[0125] As used herein, a “repeat” sequence or region is a nucleotide sequence at or near the 3’ end of the crRNA which is complementary to an anti -repeat sequence of a tracrRNA.

[0126] As used herein, an “anti-repeat” sequence or region is a nucleotide sequence at or near the 5’ end of the tracrRNA which is complementary to the repeat sequence of a crRNA.

[0127] Additional details regarding guide RNA structure and function, including the gRNA / Cas9 complex for genome editing may be found in, at least, Mali et al. Science, 339(6121), 823-826 (2013); Jiang et al. Nat. Biotechnol. 31(3). 233-239 (2013); and Jinek et al. Science, 337(6096), 816-821 (2012); which are incorporated by reference herein.

[0128] As used herein, a “guide sequence” or “targeting sequence” refers to the nucleotide sequence of a gRNA, whether unimolecular or modular, that is fully or partially complementary to a target domain or target polynucleotide within a DNA sequence in the genome of a cell where editing is desired. Guide sequences are typically 10-30 nucleotides in length, preferably 16-24 nucleotides in length (for example, 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides in length), and are at or near the 5' terminus of a Cas9 gRNA.

[0129] As used herein, a “target domain” or “target polynucleotide sequence” is the DNA sequence in a genome of a cell that is complementary to the guide sequence of the gRNA.

[0130] In addition to the targeting domains, gRNAs typically include a plurality of domains that influence the formation or activity of gRNA / Cas9 complexes. For example, as mentioned above, the duplexed structure formed by first and secondary complementarity domains of a gRNA (also referred to as a repeat: anti-repeat duplex) interacts with the recognition (REC) lobe of Cas9 and may mediate the formation of Cas9 / gRNA complexes (Nishimasu et al. Cell 156: 935-949 (2014); Nishimasu et al. Cell 162(2), 1113-1126 (2015), both incorporated by reference herein).

[0131] Along with the first and second complementarity domains, Cas9 gRNAs typically include two or more additional duplexed regions that are necessary for nuclease activity in vivo but not necessarily in vitro (Nishimasu 2015, supra). A first stem-loop near the 3' portion of the second complementarity domain is referred to variously as the “proximal domain,” “stem loop 1” (Nishimasu 2014, supra, Nishimasu 2015, supra) and the “nexus” (Briner 2014, supra). One or more additional stem loop structures are generally present near the 3' end of the gRNA, with the number varying by species: S. pyogenes gRNAs typically include two 3' stem loops (for a total of four stem loop structures including the repeat: anti-repeat duplex), while S. aureus and other species have only one (for a total of three). A description of conserved stem loop structures (and gRNA structures more generally) organized by species is provided in Briner 2014, which is incorporated herein by reference. Additional details regarding guide RNAs generally may be found in WO2018026976A1, which is incorporated herein by reference.

[0132] The term “Cas9 nickase” or “nCas9”, as used herein refers to a mutated Cas9 which renders the nuclease able to cleave only one strand of deoxyribonucleic acid backbone. Depending on the position of the mutation within the Cas9 protein sequence either the target or non-target strand is cleaved. In the case of a prime editor the nontarget strand is selectively cleaved. The term “reverse transcriptase” as used herein, refers to a protein that converts RNA into DNA. One example of a reverse transcriptase is a Moloney murine leukemia virus reverse transcriptase (M- MLV RT).

[0133] The term “reverse transcriptase template” as used herein refers to a ribonucleic acid sequence that is utilized as a substrate for a reverse transcriptase protein that is part of the fusion protein complex as contemplated herein. Such templates provide the necessary information to edit a DNA sequence to support conversions including, but not limited to, base conversions, sequence insertions or sequence deletions.

[0134] The term "nucleotide polymerase template" or "NPT" as used herein refers to a deoxyribonucleic or a ribonucleic acid sequence and modifications thereof, that is utilized as a nucleic acid for a nucleotide polymerase protein (e.g., RNA polymerase or DNA polymerase) that is part of the chimeric prime editor complex as contemplated herein. Such templates provide the necessary information to edit a DNA sequence to support conversions including, but not limited to, base conversions, sequence insertions or sequence deletions.

[0135] The term “primer binding site” or “PBS” as used herein, refers to a specific nucleic acid sequence within the pegRNA that is complementary to the 3’ end of the nicked DNA strand. This allows annealing of the free 3’ end of the genomic DNA for extension by the nucleotide polymerase based on the template sequence encoded in the pegRNA.

[0136] The term, “prime editing guide RNA” or “pegRNA” as used herein, refers to a Cas9 guide RNA molecule that encodes the crRNA-tracrRNA fused to a primer binding site (PBS) and a nucleotide polymerase template (NPT) nucleic acid sequence. The primer binding site hybridizes to a desired genomic sequence released by the binding and cleavage of the Cas9 nickase. The 3’ end of the genomic sequence is extended by the nucleotide polymerase based on the nucleotide polymerase template sequence.

[0137] The term, “prime editor template RNA” or “petRNA” as used herein, refers to an RNA molecule that encodes a primer binding site (PB S) and a nucleotide polymerase template (NPT). The petRNA may also encode stem loops. The petRNA may also be linear or circularized. Unlike the pegRNA, the petRNA does not include the guide RNA component. A linear petRNA is referred to as an “LPET”. In some embodiments, the petRNA comprises at least one MS2 hairpin. The at least one MS2 hairpin facilitates the recruitment of the petRNA to the prime editor (i.e., a Cas9-nucleotide polymerase fusion protein) that is further linked to at least one MS2 binding protein.

[0138] The term “editing” or “gene editing” as used herein, refers to a genetic manipulation of a DNA sequence. Such a manipulation includes, but is not limited to, a base conversion, a sequence insertion and / or a sequence deletion. The term “prime editing” as used herein, is a genome editing technology by which the genome of living organisms may be modified. Prime editing manipulates the genetic information of a targeted DNA site to essentially “rewrite” the coded sequences.

[0139] The term “prime editor” or “PE” as used herein, is a fusion protein comprising a Cas9 nickase that can nick DNA and is fused to an nucleotide polymerase enzyme. The pegRNA is capable of programming the nCas9 to recognize a target site with the encoded crRNA-tracrRNA (as does a conventional single guide RNA). The resulting nicked genomic DNA can be extended by the nucleotide polymerase based on the pegRNA template sequence to contain a new sequence. Once one strand is recoded, cellular DNA repair pathways can cause conversion of the local DNA sequence to match the new sequence. Such manipulation includes, but is not limited to, insertions, deletions, and base-to-base conversions without the need for double strand breaks (DSBs) or donor DNA templates. For example, such prime editing may be performed by a Cas9 CRISPR platform programmed with a pegRNA, such as a catalytically impaired Cas9 nickase platform with an appropriate nucleotide polymerase.

[0140] Thus, in one aspect, the disclosure provides a prime editing system comprising: the circularly structured pegRNA or petRNA described herein; and a fusion protein comprising a Cas9 nickase protein linked to a nucleotide polymerase (NT) protein or a polynucleotide encoding the fusion protein.

[0141] In some embodiments, the NT protein is a reverse transcriptase. In some embodiments, the reverse transcriptase is a retrovirus reverse transcriptase. In some embodiments, the reverse transcriptase is a Moloney murine leukemia virus (M-MLV) reverse transcriptase. In some embodiments, the fusion protein is linked to at least one MS2 binding protein.

[0142] Prime editing systems and their components, including pegRNA and petRNA are described in further detail in WO2024249584, incorporated herein by reference.

[0143] Chemically Modified Circularly Structured Guide RNA

[0144] The circularly structured guide RNAs and pegRNAs and petRNAs of the disclosure may contain one or more modified nucleotides comprising a modification in a ribose group, a phosphate group, a nucleobase, or a combination thereof.

[0145] Chemical modifications to the ribose group may include, but are not limited to, 2'-O-methyl, 2’-fluoro, 2’-deoxy, 2’ -O-(2 -methoxy ethyl) (MOE), 2’-NH2 (2’-amino), 4’-thio, 2’-O-Allyl, 2’-O-Ethylamine, 2’-O-Cyanoethyl, 2 ’-O- Acetal ester, or a bicyclic nucleotide, such as locked nucleic acid (LNA), 2’-(5)-constrained ethyl (S-cEt), constrained MOE, or 2'-( ,4'-C-aminomethylene bridged nucleic acid (2',4'-BNANC).

[0146] The term “4’ -thio” as used herein corresponds to a ribose group modification where the sugar ring oxygen of the ribose is replaced with a sulfur.

[0147] Chemical modifications to the phosphate group may include, but are not limited to, a phosphorothioate, phosphonoacetate (PACE), thiophosphonoacetate (thioPACE), amide, triazole, phosphonate, or phosphotriester modification.

[0148] Chemical modifications to the nucleobase may include, but are not limited to, 2-thiouridine, 4-thiouridine, N6-methyladenosine, pseudouridine, 2,6-diaminopurine, inosine, thymidine, 5-methylcytosine, 5-substituted pyrimidine, isoguanine, isocytosine, or halogenated aromatic groups.

[0149] The circularly structured guide RNAs and pegRNAs may have one or more chemical modifications in the crRNA portion, the tracrRNA portion, and / or the circularization portion.

[0150] The circularly structured guide RNAs and pegRNAs may comprise at least about 50% to at least about 100% chemically modified nucleotides, at least about 60% to at least about 100% chemically modified nucleotides, at least about 70% to at least about 100% chemically modified nucleotides, at least about 80% to at least about 100% chemically modified nucleotides, at least about 90% to at least about 100% chemically modified nucleotides, and at least about 95% to at least about 100% chemically modified nucleotides.

[0151] The circularly structured guide RNAs and pegRNAs may comprise at least about 50% chemically modified nucleotides, at least about 60% chemically modified nucleotides, at least about 70% chemically modified nucleotides, at least about 80% chemically modified nucleotides, at least about 90% chemically modified nucleotides, at least about 95% chemically modified nucleotides, at least about 99% chemically modified, or 100% (fully) chemically modified nucleotides.

[0152] The circularly structured guide RNAs and pegRNAs may comprise at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% chemically modified nucleotides.

[0153] The activity of a circularly structured guide RNA or pegRNA can be readily determined by any means known in the art. In an embodiment, % activity is measured with the traffic light reporter (TLR) Multi-Cas Variant 1 system (TLR-MCV1). The TLR-MCV1 system will provide a % fluorescent cells which is a measure of % activity.

[0154] Another assay is the mTmG reporter system as described in Example 1.

[0155] It will be understood to those of skill in the art that the base sequence of the first 20 nucleotides of the crRNA portion described above are directed to a specific target. This 20-nucleotide base sequence may be changed based on the target nucleic acid. An exemplary unmodified crRNA sequence, from 5’ to 3’, is NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAUGCU (SEQ ID NO: 1), where “N” corresponds to any nucleotide (e.g., A, U, G, or C). An exemplary unmodified tracrRNA sequence, from 5’ to 3’, is AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU GGCACCGAGUCGGUGCUUU (SEQ ID NO: 2).

[0156] It will be further understood to those of skill in the art that the guide sequence may be 10-30 nucleotides in length, preferably 16-24 nucleotides in length (for example, 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides in length), and is at or near the 5' terminus of a Cas9 gRNA.

[0157] Guide RNA Conjugates

[0158] The circularly structured guide RNAs and pegRNAs of the disclosure may be modified with terminally conjugated moieties. As used herein, a “terminally conjugated moiety” or “moiety” refers to a compound which may be linked or attached to the 5’ and / or 3’ end of the crRNA and / or tracrRNA of a guide RNA. Terminally conjugated moieties can provide increased stability, increased ability to penetrate cell membranes, increase cellular uptake, increase circulation time in vivo, act as a cell-specific directing reagent, and / or provide a means to monitor cellular or tissue-specific uptake.

[0159] In certain embodiments, the terminally conjugated moiety is conjugated to the 5’ end of the crRNA portion of a guide RNA. In certain embodiments, the terminally conjugated moiety is conjugated to the 3’ end of the crRNA portion of a guide RNA. In certain embodiments, the terminally conjugated moiety is conjugated to the 5’ end of the tracrRNA portion of a guide RNA. In certain embodiments, the terminally conjugated moiety is conjugated to the 3’ end of the tracrRNA portion of a guide RNA.

[0160] In certain exemplary embodiments, a terminally conjugated moiety includes, but is not limited to, fatty acid, steroid, secosteroid, lipid, ganglioside analog, nucleoside analogs, endocannabinoid, vitamin, receptor ligand, peptide, aptamer, alkyl chain, fluorophore, antibody, nuclear localization signal, and the like.

[0161] In certain exemplary embodiments, a terminally conjugated moiety includes, but is not limited to, cholesterol, cholesterol-triethylene glycol (TEGChol), docosahexaenoic acid (DHA), docosanoic acid (DCA), lithocholic acid (LA), GalNAc, amphiphilic block copolymer (ABC), hydrophilic block copolymer (HBC), poloxamer, Cy5, Cy3, and the like.

[0162] The moieties may be attached to the terminal nucleotides of the guide RNA via a linker. Exemplary linkers include, but are not limited to, an ethylene glycol chain, an alkyl chain, a polypeptide, a polysaccharide, a block copolymer, and the like.

[0163] Circularly Structured Single Guide RNA

[0164] As described herein, the circularly structured guide RNAs of the disclosure may be constructed as single guide RNAs (sgRNAs) by linking the 3’ end of a crRNA to the 5’ end of a tracrRNA. The linker may be an oligonucleotide loop, including a chemically modified oligonucleotide loop. In certain embodiments, the oligonucleotide loop comprises a GAAA tetraloop. The linker may be a non-nucleotide chemical linker, including, but not limited to, ethylene glycol oligomers (see, e.g., Pils et al. Nucleic Acids Res. 28(9): 1859-1863 (2000)).

[0165] RNA-guided nucleases

[0166] RNA-guided nucleases according to the present disclosure include, without limitation, naturally-occurring Type II CRISPR nucleases such as Cas9, as well as other nucleases derived or obtained therefrom. Exemplary Cas9 nucleases that may be used in the present disclosure include, but are not limited to, S. pyogenes Cas9 (SpCas9), S. aureus Cas9 (SaCas9), N. meningitidis Cas9 (NmCas9), C. jejuni Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9). In functional terms, RNA-guided nucleases are defined as those nucleases that: (a) interact with (e.g., complex with) a gRNA; and (b) together with the gRNA, associate with, and optionally cleave or modify, a target region of a DNA that includes (i) a sequence complementary to the targeting domain of the gRNA and, optionally, (ii) an additional sequence referred to as a “protospacer adjacent motif,” or “PAM,” which is described in greater detail below. As the following examples will illustrate, RNA-guided nucleases can be defined, in broad terms, by their PAM specificity and cleavage activity, even though variations may exist between individual RNA-guided nucleases that share the same PAM specificity or cleavage activity. Skilled artisans will appreciate that some aspects of the present disclosure relate to systems, methods and compositions that can be implemented using any suitable RNA-guided nuclease having a certain PAM specificity and / or cleavage activity. For this reason, unless otherwise specified, the term RNA-guided nuclease should be understood as a generic term, and not limited to any particular type (e.g., Cas9 vs. Cpfl), species (e.g., S. pyogenes vs. S. aureus) or variation (e.g., full-length vs. truncated or split; naturally-occurring PAM specificity vs. engineered PAM specificity).

[0167] Various RNA-guided nucleases may require different sequential relationships between PAMs and protospacers. In general, Cas9s recognize PAM sequences that are 5' of the protospacer as visualized relative to the top or complementary strand.

[0168] In addition to recognizing specific sequential orientations of PAMs and protospacers, RNA-guided nucleases generally recognize specific PAM sequences. S. aureus Cas9, for example, recognizes a PAM sequence of NNGRRT, wherein the N sequences are immediately 3' of the region recognized by the gRNA targeting domain. S. pyogenes Cas9 recognizes NGG PAM sequences. It should also be noted that engineered RNA-guided nucleases can have PAM specificities that differ from the PAM specificities of similar nucleases (such as the naturally occurring variant from which an RNA-guided nuclease is derived, or the naturally occurring variant having the greatest amino acid sequence homology to an engineered RNA-guided nuclease). Modified Cas9s that recognize alternate PAM sequences are described below.

[0169] RNA-guided nucleases are also characterized by their DNA cleavage activity: naturally-occurring RNA-guided nucleases typically form DSBs in target nucleic acids, but engineered variants have been produced that generate only SSBs (discussed above; see also Ran 2013, incorporated by reference herein), or that do not cut at all.

[0170] The RNA-guided nuclease Cas9 may be a variant of Cas9 with altered activity. Exemplary variant Cas9 nucleases include, but are not limited to, a Cas9 nickase (nCas9), a catalytically dead Cas9 (dCas9), a hyper accurate Cas9 (HypaCas9) (Chen et al. Nature, 550(7676), 407-410 (2017)), a high fidelity Cas9 (Cas9-HF) (Kleinstiver et al. Nature 529(7587), 490-495 (2016)), an enhanced specificity Cas9 (eCas9) (Slaymaker et al. Science 351(6268), 84-88 (2016)), and an expanded PAM Cas9 (xCas9) (Hu et al. Nature doi: 10.1038 / nature26155 (2018)).

[0171] The RNA-guided nucleases may be combined with the chemically modified guide RNAs of the present disclosure to form a genome-editing system. The RNA- guided nucleases may be combined with the chemically modified guide RNAs to form an RNP complex that may be delivered to a cell where genome-editing is desired. The RNA-guided nucleases may be expressed in a cell where genome-editing is desired with the chemically modified guide RNAs delivered separately. For example, the RNA-guided nucleases may be expressed from a polynucleotide such as a vector or a synthetic mRNA. The vector may be a viral vector, including, be not limited to, an adeno-associated virus (AAV) vector or a lentivirus (LV) vector.

[0172] Circularization Portion

[0173] As used herein, a “circularization portion” refers to a contiguous stretch of at least 4 inverted nucleotides having an opposite polarity to the guide RNA or pegRNA to which the circularization portion is attached. The circularization portion comprises sufficient complementarity to another portion of the guide RNA or pegRNA to form the circularly structured guide RNA or pegRNA.

[0174] The circularization portion is linked to the remainder of the guide RNA or pegRNA via an inverted 3’ to 3’ linkage or a 5’ to 5’ linkage.

[0175] Thus, in certain aspects, the disclosure provides a circularly structured guide RNA comprising: (a) a crRNA portion comprising (i) a guide sequence capable of hybridizing to a target polynucleotide sequence, and (ii) a repeat sequence; (b) a tracrRNA portion comprising an anti-repeat nucleotide sequence that is complementary to the repeat sequence; and (c) a circularization portion comprising at least 4 inverted nucleotides with complementarity to the crRNA portion, wherein the circularization portion is linked to the tracrRNA portion via a 3’ to 3’ linkage.

[0176] In another aspect, the disclosure provides a circularly structured guide RNA comprising: (a) a crRNA portion comprising (i) a guide sequence capable of hybridizing to a target polynucleotide sequence, and (ii) a repeat sequence; (b) a tracrRNA portion comprising an anti-repeat nucleotide sequence that is complementary to the repeat sequence; and (c) a circularization portion comprising at least 4 inverted nucleotides with complementarity to the tracrRNA portion, wherein the circularization portion is linked to the crRNA portion via a 5’ to 5’ linkage. In certain embodiments, the circularization portion comprises between 4 and 20 inverted nucleotides (i.e., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 inverted nucleotides) with complementarity to the guide sequence or the tracrRNA portion.

[0177] In certain embodiments, the 3’ to 3’ linkage or the 5’ to 5’ linkage further comprises a non-nucleotide linker.

[0178] In certain embodiments, the non-nucleotide linker is selected from the group consisting of an ethylene glycol chain, an alkyl chain, a polypeptide, a polysaccharide, and a block copolymer.

[0179] In certain embodiments, the non-nucleotide linker comprises a C2-C16 alkyl linker.

[0180] In certain embodiments, the non-nucleotide linker comprises an ethylene glycol linker comprising 1 to 10 ethylene glycol units.

[0181] In certain embodiments, the non-nucleotide linker comprises a tri ethylene glycol, a tetra ethylene glycol linker, or a hexa ethylene glycol linker.

[0182] In certain embodiments, the non-nucleotide linker is a cleavable linker. In certain embodiments, the cleavable linker is a photolabile linker or a disulfide-containing linker.

[0183] In certain embodiments, the circularization portion comprises at least 4 inverted nucleotides (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 inverted nucleotides) with complementarity to the guide sequence of the crRNA portion.

[0184] In certain embodiments, the circularly structured guide RNA comprises the sequence 5'(N)xGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUU AUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU< 33>( iN)y 5', wherein X corresponds to the guide sequence and an integer of between 17 and 20, each N corresponds to a nucleotide of A, U, G, or C, y corresponds to the circularization portion and an integer of between 4 and 20, < 33> corresponds to a 3’ to 3’ linkage, and each iN corresponds to a nucleotide of A, U, G, or C. Universal Polynucleotide Sequence

[0185] In certain embodiments, a universal polynucleotide sequence is appended to the 5’ or 3’ end of the circular structured guide RNA or pegRNA. The circularization potion comprises complementarity to said universal polynucleotide sequence. The universal polynucleotide sequence comprises a sequence that is distinct from any one of the crRNA portion, the tracrRNA portion, or the PBS.

[0186] In certain embodiments, the crRNA portion comprises, from 5’ to 3’, auniversal polynucleotide sequence, the guide sequence, and the repeat sequence.

[0187] In certain embodiments, the circularization portion comprises at least 4 inverted nucleotides with complementarity to the universal polynucleotide sequence of the crRNA portion. In certain embodiments, the 3’ to 3’ linkage further comprises a cleavable linker.

[0188] In certain embodiments, the tracrRNA portion comprises, from 5’ to 3’, the anti-repeat nucleotide sequence, one or more stem loop sequences, and a universal polynucleotide sequence.

[0189] In certain embodiments, the circularization portion comprises at least 4 inverted nucleotides with complementarity to the universal polynucleotide sequence of the tracrRNA portion.

[0190] It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods described herein may be made using suitable equivalents without departing from the scope of the embodiments disclosed herein. Having now described certain embodiments in detail, the same will be more clearly understood by reference to the following examples, which are included for purposes of illustration only and are not intended to be limiting.

[0191] EXAMPLES

[0192] Example 1 - Circularly structured guide RNAs for CRISPR genome editing The termini of RNA molecules are particularly susceptible to degradation by nucleases and recognition by many innate immune factors. A guide RNA can be given a circular structure by including a stretch of reverse (i.e. inverted) nucleotides, joined by a 3 ’-3’ or 5 ’-5’ linkage to one end of the guide RNA, that are complementary to the opposite end. This circular structure reduces the recognition by innate immune factors and exonucleases.

[0193] Schematics of exemplary circularly structured guide RNAs are shown in FIGs.

[0194] 1A-1C

[0195] mTmG Reporter System

[0196] The mTmG reporter system is a double-fluorescent Cre reporter that expresses membrane-targeted tandem dimer Tomato (mT) prior to Cre-mediated excision and membrane-targeted green fluorescent protein (mG) after excision. As an alternative, the tdTomato gene may be excised by introducing two CRISPR-mediated cuts at flanking positions. The two cut sites are identical, and can therefore be cleaved with a single guide RNA-Cas9 RNP. The reporter system can be used in vivo in a transgenic mouse, or in vitro in a cell line. Here the reporter was used in mouse embryonic fibroblasts (MEFs) for in vitro experiments, and in the transgenic mouse for in vivo experiments. When the reporter is unedited (i.e., no CRISPR editing), tdTomato is expressed, leading to red fluorescence. If the tdTomato gene is successfully edited out, a GFP gene is expressed. Accordingly, in the mTmG reporter system, higher levels of GFP fluorescence indicate successful editing by CRISPR. The crRNA portions of the chemically modified guide RNAs described herein have the guide sequence CGAAGUUAUAUUAAGGGUUC. The reporter is described in greater detail in Muzumdar et al. (Genesis. 45(9): 593-605. 2007), incorporated herein by reference.

[0197] Results

[0198] Exemplary circularly structured guide RNAs were tested in vitro in the mTmG reporter system. IxlO5MEF cells expressing the mTmG reporter were electroporated with 50 pmol or 25 pmol of circularly structured or chemical-modification-matched linear guide RNA with 500 ng Cas9-encoding mRNA. After 90 hours, the GFP-expressing cells were counted by flow cytometry.

[0199] As shown in FIG.2, the circularly structured guide RNAs showed substantially enhanced editing efficacy relative to linear guides. The circularly structured guide RNAs also showed substantially enhanced editing efficacy relative to linear guides in vivo when co-delivered with Cas9-encoding mRNA via lipid nanoparticles. In this experiment, circularly structured or modification-matched linear guides were formulated into lipid nanoparticles. The LNPs containing linear and circularly structured guides had a similar Z-average (80-90 nm) and a similar encapsulation efficiency (94-96%).

[0200] 1.25 pg of total RNA was stereotactically injected into the striatum of mTmG reporter-expressing mice (three mice per group). After 7 days the mice were euthanized and brain sections were prepared for immunohistochemical visualization of GFP-expressing cells to show editing. The three mice injected with linear guide showed editing through part of the striatum and a subset of cells in the corpus callosum. The three mice injected with the circularly structured guide showed substantially higher editing that covered more cells of the striatum and more cells in the corpus callosum, in two of the three mice approaching saturating levels of editing along the whole ipsilateral corpus callosum (FIG. 3).

[0201] Sequences and modification patterns used in FIG. 2 and FIG. 3 are shown below:

[0202] Guide Sequence

[0203] RNA

[0204] W-5066 5'(mC)#(mG)#(mA)#(mA)(mG)(mU)(mU)(mA)(mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(f G)(fU)(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(mG)(mA)(mG)(mC)(mU)(mA)(mG)(m A)(mA)(mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU)(rU)(mA)(rA)(mA)(mA)(rU)(mA )(mA)(mG)(mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU)(rU)(mA)(mU)(mC)(mA)(mA ) (mC) (mU) (mU) (mG) (mA) (mA) (mA) (mA) (mA) (mG) (mU) (mG) (mG) (mC) (m A)(mC) ( mC)(mG)(mA)(mG)(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU)#(mU)#(mU)#(mU)3' W-5232 5'(mC)#(mG)(mA)(mA)(mG)(mU)(mU)(mA)(mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG )(fU)(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(mG)(mA)(mG)(mC)(mU)(mA)(mG)(mA )(mA)(mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU)(rU)(mA)(rA)(mA)(mA)(rU)(mA)( mA)(mG)(mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU)(rU)(mA)(mU)(mC)(mA)(mA)( mC) (mU) (mU) (mG) (mA) (mA) (mA) (mA) (mA) (mG) (mU) (mG) (mG) (mC) (mA) (mC) (m C)(mG)(mA)(mG)(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU)(mU)(mU)(mU)< 33 >( imG) (imC) ( imU) ( imU) ( imC)#(im A) 5 '

[0205] W-5233 5'(mC)#(mG)(mA)(mA)(mG)(mU)(mU)(mA)(mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG )(fU)(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(mG)(mA)(mG)(mC)(mU)(mA)(mG)(mA )(mA)(mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU)(rU)(mA)(rA)(mA)(mA)(rU)(mA)( mA)(mG)(mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU)(rU)(mA)(mU)(mC)(mA)(mA)( mC) (mU) (mU) (mG) (mA) (mA) (mA) (mA) (mA) (mG) (mU) (mG) (mG) (mC) (mA) (mC) (m C)(mG)(mA)(mG)(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU)(mU)(mU)(mU)(C9)< 33 >(imG) (imC) (imU) (imU) (imC)#(im A) 5 '

[0206] W-5234 5'(mC)#(mG)(mA)(mA)(mG)(mU)(mU)(mA)(mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG

[0207] )(fU)(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(mG)(mA)(mG)(mC)(mU)(mA)(mG)(mA

[0208]

[0209] )(mA)(mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU)(rU)(mA)(rA)(mA)(mA)(rU)(mA)( mA)(mG)(mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU)(rU)(mA)(mU)(mC)(mA)(mA)( mC) (mU) (mU) (mG) (mA) (mA) (mA) (mA) (mA) (mG) (mU) (mG) (mG) (mC) (mA) (mC) (m C)(mG)(mA)(mG)(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU)(mU)(mU)(mU)< 33>(idG)(id5C)(idT)(idT)(id5C)#(idA)5'

[0210] W-5235 5'(mC)#(mG)(mA)(mA)(mG)(mU)(mU)(mA)(mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG )(fU)(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(mG)(mA)(mG)(mC)(mU)(mA)(mG)(mA )(mA)(mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU)(rU)(mA)(rA)(mA)(mA)(rU)(mA)( mA)(mG)(mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU)(rU)(mA)(mU)(mC)(mA)(mA)( mC) (mU) (mU) (mG) (mA) (mA) (mA) (mA) (mA) (mG) (mU) (mG) (mG) (mC) (mA) (mC) (m C)(mG)(mA)(mG)(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU)(mU)(mU)(mU)(C9)<

[0211]

[0212] 33>(idG)(id5C)(idT)(idT)(id5C)#(idA)5'

[0213] where “mN” signifies a 2’-0-methyl nucleotide, “fN” signifies a 2’ -fluoro nucleotide, “rN” signifies a 2’-OH nucleotide, “dN” signifies a 2’-deoxy nucleotide, “i” before any nucleotide signifies that it is an inverted nucleotide, and <33> or <55> signifies a 3 ’,3’ or 5 ’,5’ linkage, respectively.

[0214] Example 2 - Variations on circularly structured guide RNAs for CRISPR genome editing

[0215] Variations on the circularly structured gRNAs described in Example 1 were tested.

[0216] Circularization domain

[0217] The base pair complementarity between the circularization portion of the gRNA and the crRNA portion of the gRNA was tested. The gRNAs of Example 1 used a circularization portion of 6 inverted bases with perfect complementarity to the crRNA portion. Here, a circularization portion of 4, 6, 8, and 10 inverted bases with complementarity to the crRNA portion was tested. Circularly structured guide RNAs with complementary domains of 4, 6, 8, and 10 bases were tested in cultured MEFs in the mTmG reporter system. IxlO5MEFs expressing the mTmG reporter were electroporated with 1.25 pmol of circularly structured or chemical-modification-matched linear guide RNA with 250 ng Cas9-encoding mRNA. After 72 hours, the GFP-expressing cells were counted by flow cytometry. As shown in FIG. 4, all the circularly structured guides in this size range show higher editing efficiency than the linear guide. Next, the degree of complementarity between the circularization portion of the gRNA and the crRNA portion of the gRNA was tested. Circularly structured guide RNAs containing a circularization domain of 6 inverted bases complementary to the 5' end of the guide region or a control sequence containing 6 scrambled inverted bases were tested in cultured MEFs in the mTmG reporter system. IxlO5MEF cells expressing the mTmG reporter were electroporated with 1.25 pmol of circularly structured or chemical-modification-matched linear guide RNA with 250 ng Cas9-encoding mRNA. After 72 hours, the GFP-expressing cells were counted by flow cytometry. As shown in FIG. 5, the guide with a scrambled circularization domain did not improve editing efficiency, while the guide with a complementary circularization domain improved editing efficiency relative to the linear control.

[0218] Next, the type of linkage of the circularization portion to the gRNA was tested (i.e., a 3’-3’ linkage or a 5’-5’ linkage), since the circularly structured gRNAs described in Example 1 were all 3’-3’ linkage-based. IxlO5MEF cells expressing the mTmG reporter were electroporated with 1.25 pmol of circularly structured or chemicalmodification-matched linear guide RNA with 250 ng Cas9-encoding mRNA. After 72 hours, the GFP-expressing cells were counted by flow cytometry. Circularly structured guide RNAs containing a circularization domain on the 3' end (as shown in FIG. 1A and FIG. 1C) improves editing efficiency compared to a linear control. In contrast, the circularly structured guide RNAs containing inverted bases on the 5' end (as shown in FIG. IB) failed to edit compared to linear control (see, FIG. 6). The presence of a C9 alkyl spacer between the circularization portion and the gRNA did not negatively impact editing efficiency as well.

[0219] “Q-shaped” Guides

[0220] The presence of a single stranded nucleotide tail in the circularly structured guide RNA was tested. A schematic of this Q-shaped guide RNA is shown in FIG. 7B, where a part of the 5’ end of the crRNA portion is single-stranded (i.e., not base paired with the circularization portion. A tail of 4 or 8 nucleotides was tested with a 6 inverted nucleotide circularization portion. IxlO5MEF cells expressing the mTmG reporter were electroporated with 1.25 pmol of linear, O-shaped (i.e., the structures of FIG. 1A-1C), or Q-shaped guide RNA with 250 ng Cas9-encoding mRNA. After 72 hours, the GFP-expressing cells were counted by flow cytometry. Both O- and Q-shaped circularly structured guide RNAs showed improved editing activity compared to a linear control (see, FIG. 7A).

[0221] Surprisingly, the presence of the free 5’ end of Q-shaped circularly structured guide RNA did not negatively impact editing activity, as one would expect that the exposed 5’ end would promote degradation of the guide RNA. Without being bound by theory, the presence of the 5’ single stranded portion of the circularly structured guide RNA may promote target gene specificity and reduce off-target effects.

[0222] In vivo Editing

[0223] Additional testing in mTmG reporter-expressing mice showed that circularly structured guides result in higher Cas9 nuclease editing efficiency compared to modification-matched linear guides. In this experiment, circularly structured and linear guides were formulated into LNPs at a 6:1 ratio of Cas9 mRNA to guide RNA (mass / mass). The LNPs containing circularly structured and linear guides had similar Z-average around 250 nm, and a similar encapsulation efficiency (80-90%).

[0224] 3.0 mg / kg of total RNA was formulated into LNPs and injected intravenously into mTmG reporter-expressing mice (six mice per group) to deliver to the liver. After one week, the mice were euthanized. Liver sections from one liver lobe were prepared for immunohistochemistry staining to visualize GFP-expressing cells to show successful editing. Compared to modification-matched linear guides, circular guides lead to higher number of GFP-expressing cells in two different guides modification patterns. Genomic DNA of liver tissue from the other liver lobes were extracted to quantify editing efficiency by amplicon deep sequencing and ddPCR (methods, next paragraphs). Mice injected with linear guide had lower editing levels compared to mice injected with circularly structured guides with statistical significance. Amplicon deep sequencing: The genomic region of interest was amplified from genomic DNA and unique sequencing barcodes were added to each amplicon by polymerase chain reactions (PCR). Pooled samples were further purified and using an Illumina NextSeq2000 System following manufacturer’s protocol.

[0225] ddPCR assay for editing of the mTmG reporter: Primers with fluorescent probes were placed throughout the mTmG reporter. Genomic DNA was amplified with these fluorescent probes by PCR in droplets generated by Bio-Rad droplet generating instrument and fluorescence detected was using Bio-Rad droplet reader. The loss of fluorescence from primers within TdTomato gene while gain of fluorescence from TdTomato flanking primer / probes is used as quantification of TdTomato deletion.

[0226] Editing of mTmG reporter is quantified by combining the percent of modified amplicons at two loci flanking the TdTomato gene (measured by amplicon deep sequencing) and the percent of TdTomato gene deletion (measured by ddPCR assay).

[0227] As shown in FIG. 8A - FIG. 8B, the circularly structured guide RNAs demonstrated superior liver editing in the mTmG reporter in mice.

[0228] Next, an endogenous locus in mice was targeted. In an experiment with wildtype mice, circularly structured guides led to higher editing efficiency at an endogenous target in mouse, mPcsk9 (homologous to PCSK9 in human) (see, FIG. 9). Circularly structured or linear guide and Cas9-expressing mRNA (6:1 ratio of Cas9 mRNA to guide RNA, mass / mass) were co-encapsulated in LNPs and injected intravenously into wild-type mice (five or six mice per group) at 0.2, 0.8, 3.0 mg / kg of total RNA. After one week, mice were euthanized to collect liver tissue for genomic DNA extraction. Editing efficiency of the gene mPcsk9 was measured by amplicon deep sequencing. At clinically relevant dose of 0.8 mg / kg, mice injected with linear guides had significantly lower editing levels compared to mice injected with circularly structured guides. In vivo Base Editing

[0229] GER10 Reporter System

[0230] The GER10 adenine base editing (ABE) reporter system is a positive-signal fluorescent reporter that contains a premature stop codon (TAG), preventing expression of Venus, a yellow fluorescent protein. Upon single-nucleotide editing by an adenine base editor guided by a sgRNA which enables conversion of an A-T base pair to a G-C base pair, the stop codon is converted from TAG (stop) to TGG (tryptophan), leading to expression of Venus protein (FIG.10A). The reporter system can be used in vivo in a transgenic mouse, or in vitro in a cell line. Here the reporter was used in mouse embryonic fibroblasts (MEFs) for in vitro experiments, and in the transgenic mouse for in vivo experiments. When the reporter is unedited (i.e., no ABE), there is no fluorescent protein expression. When the reporter is edited, conversion of adenine to guanine, there is Venus expression. Higher levels of Venus fluorescence indicate efficiency of A base editing. This is also shown by amplicon sequencing of the edited locus. The sgRNA for ABE is structurally similar to sgRNA for nuclease editing. The 20-base guide sequence is shown in FIG. 10A.

[0231] Circularly structured ABE guide RNAs were tested in cultured cells expressing the GER10 reporter system. 1x105 cultured MEFs were electroporated with 1, 0.5, 0.25, 0.13, and 0.06 pmol of circularly structured or linear ABE guide RNA with 50 ng of adenine base editor mRNA. After 72 hours, the Venus-expressing cells were counted by flow cytometry (FIG. 10B). The same experiment was repeated, where amount of adenine base editing was measured by amplicon deep sequencing (FIG. 10C). As shown in FIG. 10B and FIG. 10C, the circularly structured guide RNAs showed enhanced base editing efficacy relative to linear guides at all doses.

[0232] The circularly structured guide RNA also showed substantially enhanced adenine base editing efficacy relative to linear guide RNA in vivo (FIG. 11A-FIG.

[0233] 11B) when co-delivered with adenine base editor mRNA via lipid nanoparticles (LNPs). In this experiment, circularly structured and linear guides were formulated into LNPs. The LNPs containing circularly structured and linear guides had Z-average of 169 and 197 nm, respectively, and a similar encapsulation efficiency (83%). 0.2 or 0.8 mg / kg of total RNA (6:1 ratio of Cas9 mRNA to guide RNA, mass / mass) was formulated into LNPs and injected intravenously into GER10 reporterexpressing mice (six mice per group) to deliver to the liver. After 2 weeks, the mice were euthanized. Liver sections from one liver lobe were prepared for immunohistochemistry staining to visualize Venus-expressing cells to show successful adenine base editing. At 0.2 mg / kg dose, mice injected with linear guide showed fewer Venus-expressing cells compared to mice injected with circularly structured guides (FIG. 11B) Genomic DNA of liver tissue from the other liver lobes were extracted to quantify adenine base editing efficiency by amplicon deep sequencing. At both injection doses, 0.2 and 0.8 mg / kg, mice injected with linear guides had significantly lower adenine base editing levels compared to mice injected with circularly structured guides (FIG. 11C).

[0234] Central nervous system base editing

[0235] 1.5 pg of total RNA (6:1 ratio of Cas9 mRNA to guide RNA, mass / mass) was formulated into LNPs and stereotactically injected into the right striatum of GER10 reporter-expressing mice (seven mice per group). After 2 weeks, the mice were euthanized. Brain sections from three mice per group were prepared for immunohistochemistry staining to visualize Venus-expressing cells to show successful adenine base editing. Mice injected with linear guides showed fewer Venus-expressing cells in the striatum and corpus callosum compared to mice injected with circularly structured guides (FIG. 12A, each column represents one mouse). Genomic DNA of left and right (injected) striatum of four mice per group were extracted to quantify adenine base editing efficiency by amplicon deep sequencing. The average percent of editing in mice injected with linear guides is lower than that of mice injected with circularly structured guides (FIG. 12B).

[0236] Sequences used for the figures of Example 2 are shown below:

[0237] (mC)#(mG)#(mA)#(mA)(mG)(mU)(mU)(mA )(mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(f U)(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)( FIG mG)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(m

[0238]

[0239] 3. linear Mtmg c20t41 A)(mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)( rU)(rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(m G)(mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)( rU)(rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)( mU)(mG)(mA)(mA)(mA)(mA)(mA)(mG)(m U)(mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)( mG)(mU)(mC)(mG)(mG)(mU)(mG)(mC)(m U)#(mU)#(mU)#(mU) (mC)#(mG)(mA)(mA)(mG)(mU)(mU)(mA)( mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(fU )(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(m G)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(mA)( mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU) (rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(mG)( mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU) (rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)(mU )(mG)(mA)(mA)(mA)(mA)(mA)(mG)(mU)( mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)(mG )(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU) Mtmg_Rev_3' (mU) (mU)

[0240] csg 3'dna comp6 (mU)(idG)(id5C)(idT)(idT)(id5C)#(idA) (mC)#(mG)#(mA)#(mA)(mG)(mU)(mU)(mA )(mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(f U)(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)( mG)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(m A)(mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)( rU)(rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(m G)(mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)( rU)(rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)( mU)(mG)(mA)(mA)(mA)(mA)(mA)(mG)(m U)(mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)( FIG.4 mG)(mU)(mC)(mG)(mG)(mU)(mG)(mC)(m linear Mtmg c20t41 U)#(mU)#(mU)#(mU)

[0241] (mC)#(mG)(mA)(mA)(mG)(mU)(mU)(mA)( mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(fU )(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(m G)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(mA)( mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU) (rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(mG)( mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU) (rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)(mU )(mG)(mA)(mA)(mA)(mA)(mA)(mG)(mU)( mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)(mG Mtmg_Rev_3' )(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU)(m csg 3'dna comp4 U)(mU)(mU)(idG)(id5C)(idT)#(idT)

[0242] (mC)#(mG)(mA)(mA)(mG)(mU)(mU)(mA)( Mtmg_Rev_3' mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(fU

[0243]

[0244] csg 3'dna comp6 )(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(m G)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(mA)( mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU) (rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(mG)( mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU) (rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)(mU )(mG)(mA)(mA)(mA)(mA)(mA)(mG)(mU)( mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)(mG )(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU) (mU) (mU) (mU)(idG)(id5C)(idT)(idT)(id5C)#(idA) (mC)#(mG)(mA)(mA)(mG)(mU)(mU)(mA)( mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(fU )(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(m G)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(mA)( mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU) (rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(mG)( mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU) (rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)(mU )(mG)(mA)(mA)(mA)(mA)(mA)(mG)(mU)( mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)(mG )(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU)(m Mtmg_Rev_3' U)(mU)(mU)(idG)(id5C)(idT)(idT)(id5C)(id csg 3'dna comp8 A)(idA)#(idT)

[0245] (mC)#(mG)(mA)(mA)(mG)(mU)(mU)(mA)( mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(fU )(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(m G)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(mA)( mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU) (rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(mG)( mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU) (rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)(mU )(mG)(mA)(mA)(mA)(mA)(mA)(mG)(mU)( mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)(mG )(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU)(m Mtmg_Rev_3' U)(mU)(mU)(idG)(id5C)(idT)(idT)(id5C)(id csg 3'dna comp 10 A)(idA)(idT)(idA)#(idT)

[0246] (mC)#(mG)#(mA)#(mA)(mG)(mU)(mU)(mA )(mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(f U)(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)( mG)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(m A)(mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)( rU)(rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(m G)(mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)( rU)(rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)( FIG mU)(mG)(mA)(mA)(mA)(mA)(mA)(mG)(m

[0247]

[0248] 5. linear Mtmg c20t41 U)(mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)( mG)(mU)(mC)(mG)(mG)(mU)(mG)(mC)(m U)#(mU)#(mU)#(mU) (mC)#(mG)(mA)(mA)(mG)(mU)(mU)(mA)( mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(fU )(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(m G)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(mA)( mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU) (rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(mG)( mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU) (rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)(mU )(mG)(mA)(mA)(mA)(mA)(mA)(mG)(mU)( mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)(mG )(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU) Mtmg_Rev_3' (mU) (mU)

[0249] csg 3'dna comp6 (mU)(idG)(id5C)(idT)(idT)(id5C)#(idA) (mC)#(mG)(mA)(mA)(mG)(mU)(mU)(mA)( mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(fU )(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(m G)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(mA)( mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU) (rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(mG)( mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU) (rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)(mU )(mG)(mA)(mA)(mA)(mA)(mA)(mG)(mU)( mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)(mG Srcrambl Srcramble )(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU) e C20T41mtmg (mU) (mU) (mU)(iT)(iC)(iG)(iT)(iA)#(iC) (mC)#(mG)#(mA)#(mA)(mG)(mU)(mU)(mA )(mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(f U)(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)( mG)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(m A)(mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)( rU)(rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(m G)(mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)( rU)(rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)( mU)(mG)(mA)(mA)(mA)(mA)(mA)(mG)(m U)(mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)( FIG mG)(mU)(mC)(mG)(mG)(mU)(mG)(mC)(m 6. linear Mtmg c20t41 U)#(mU)#(mU)#(mU)

[0250] (mC)#(mG)(mA)(mA)(mG)(mU)(mU)(mA)( mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(fU )(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(m G)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(mA)( mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU) (rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(mG)( csg_no Mtmg_Rev_3' mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU)

[0251]

[0252] c9 spacer 3'dna comp6 (rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)(mU )(mG)(mA)(mA)(mA)(mA)(mA)(mG)(mU)( mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)(mG )(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU) (mU) (mU) (mU)(idG)(id5C)(idT)(idT)(id5C)#(idA) (mC)#(mG)(mA)(mA)(mG)(mU)(mU)(mA)( mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(fU )(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(m G)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(mA)( mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU) (rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(mG)( mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU) (rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)(mU )(mG)(mA)(mA)(mA)(mA)(mA)(mG)(mU)( mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)(mG Mtmg_Rev_3' )(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU) 3'dna_comp6_ (mU) (mU)

[0253] csg c9spacer (mU)(C9)(idG)(id5C)(idT)(idT)(id5C)#(idA)

[0254] (iT)#(iG)(iC)(iA)(iG)(iG)(mC)(mG)(mA)(mA )(mG)(mU)(mU)(mA)(mU)(mA)(fU)(fU)(fA) (fA)(rG)#(rG)#(fG)(fU)(rU)#(mC)(mG)(rU)#( rU)#(rU)#(fU)(fA)(mG)(mA)(mG)(mC)(mU)( mA)(mG)(mA)(mA)(mA)(mU)(mA)(mG)(m C)(mA)(mA)(mG)(rU)(rU)(mA)(rA)(mA)(m A)(rU)(mA)(mA)(mG)(mG)(rC)(rU)(mA)(rG )(rU)#(rC)(mC)(rG)(rU)(rU)(mA)(mU)(mC)( mA)(mA)(mC)(mU)(mU)(mG)(mA)(mA)(m A)(mA)(mA)(mG)(mU)(mG)(mG)(mC)(mA)( mC)(mC)(mG)(mA)(mG)(mU)(mC)(mG)(mG csg_no Mtmg_Rev_5' )(mU)(mG)(mC)(mU)(mU)(mU)(mU)(mA)( c9 spacer 5'dna comp6 mC)(mG)(mU)(mC)#(mC)

[0255] (iT)#(iG)(iC)(iA)(iG)(iG)(C9)(mC)(mG)(mA) (mA)(mG)(mU)(mU)(mA)(mU)(mA)(fU)(fU) (fA)(fA)(rG)#(rG)#(fG)(fU)(rU)#(mC)(mG)(r U)#(rU)#(rU)#(fU)(fA)(mG)(mA)(mG)(mC)( mU)(mA)(mG)(mA)(mA)(mA)(mU)(mA)(m G)(mC)(mA)(mA)(mG)(rU)(rU)(mA)(rA)(m A)(mA)(rU)(mA)(mA)(mG)(mG)(rC)(rU)(m A)(rG)(rU)#(rC)(mC)(rG)(rU)(rU)(mA)(mU)( mC)(mA)(mA)(mC)(mU)(mU)(mG)(mA)(m A)(mA)(mA)(mA)(mG)(mU)(mG)(mG)(mC)( Mtmg_Rev_5' mA)(mC)(mC)(mG)(mA)(mG)(mU)(mC)(mG 5'dna_comp6_ )(mG)(mU)(mG)(mC)(mU)(mU)(mU)(mU)( csg c9spacer mA)(mC)(mG)(mU)(mC)#(mC)

[0256] (mC)#(mG)#(mA)#(mA)(mG)(mU)(mU)(mA )(mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(f

[0257]

[0258] FIG.7 linear Mtmg c20t41 U)(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)( mG)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(m A)(mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)( rU)(rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(m G)(mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)( rU)(rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)( mU)(mG)(mA)(mA)(mA)(mA)(mA)(mG)(m U)(mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)( mG)(mU)(mC)(mG)(mG)(mU)(mG)(mC)(m U)#(mU)#(mU)#(mU) (mC)#(mG)(mA)(mA)(mG)(mU)(mU)(mA)( mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(fU )(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(m G)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(mA)( mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU) (rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(mG)( mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU) (rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)(mU )(mG)(mA)(mA)(mA)(mA)(mA)(mG)(mU)( mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)(mG )(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU) Q- Mtmg_Rev_3' (mU) (mU)

[0259] Shaped 3'dna comp6 (mU)(idG)(id5C)(idT)(idT)(id5C)#(idA) (mC)#(mG)(mA)(mA)(mG)(mU)(mU)(mA)( mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(fU )(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(m G)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(mA)( mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU) (rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(mG)( mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU) (rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)(mU )(mG)(mA)(mA)(mA)(mA)(mA)(mG)(mU)( mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)(mG Mtmg_Rev_3' )(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU)(m Q- 3'dna_comp6_ U)(mU)(mU)(id5C)(idA)(idA)(idT)(idA)#(id Shaped 4gap T)

[0260] (mC)#(mG)(mA)(mA)(mG)(mU)(mU)(mA)( mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(fU )(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(m G)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(mA)( mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU) (rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(mG)( mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU) (rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)(mU )(mG)(mA)(mA)(mA)(mA)(mA)(mG)(mU)( Mtmg_Rev_3' mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)(mG Q- 3'dna_comp6_ )(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU)(m

[0261]

[0262] Shaped 8gap U)(mU)(mU)(idA)(idT)(idA)(idA)(idT)#(idT) (mC)#(mG)#(mA)#(mA)(mG)(mU)(mU)(mA )(mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(f U)(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)( mG)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(m A)(mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)( rU)(rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(m G)(mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)( rU)(rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)( mU)(mG)(mA)(mA)(mA)(mA)(mA)(mG)(m linear U)(mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)( heavily mG)(mU)(mC)(mG)(mG)(mU)(mG)(mC)(m FIG.8 modified Mtmg c20t41 U)#(mU)#(mU)#(mU)

[0263] (mC)#(mG)(mA)(mA)(mG)(mU)(mU)(mA)(mU)(mA)(fU)(fU)(fA)(fA)(rG)#(rG)#(fG)(fU )(rU)#(mC)(mG)(rU)#(rU)#(rU)#(fU)(fA)(m G)(mA)(mG)(mC)(mU)(mA)(mG)(mA)(mA)( mA)(mU)(mA)(mG)(mC)(mA)(mA)(mG)(rU) (rU)(mA)(rA)(mA)(mA)(rU)(mA)(mA)(mG)( mG)(rC)(rU)(mA)(rG)(rU)#(rC)(mC)(rG)(rU) (rU)(mA)(mU)(mC)(mA)(mA)(mC)(mU)(mU )(mG)(mA)(mA)(mA)(mA)(mA)(mG)(mU)( mG)(mG)(mC)(mA)(mC)(mC)(mG)(mA)(mG csg Mtmg_Rev_3' )(mU)(mC)(mG)(mG)(mU)(mG)(mC)(mU) heavily 3'dna_comp6_ (mU) (mU)

[0264] modified c20t41 (mU)(idG)(id5C)(idT)(idT)(id5C)#(idA) (mC)#(mG)#(mA)#(rA)(rG)(rU)(rU)(rA)(rU)( rA)(rU)(rU)(rA)(rA)(rG)(rG)(rG)(rU)(rU)(rC) (rG)(rU)(rU)(rU)(rU)(rA)(rG)(rA)(rG)(rC)(rU )(rA)(rG)(rA)(rA)(rA)(rU)(rA)(rG)(rC)(rA)(r A)(rG)(rU)(rU)(rA)(rA)(rA)(rA)(rU)(rA)(rA)( rG)(rG)(rC)(rU)(rA)(rG)(rU)(rC)(rC)(rG)(rU) (rU)(rA)(rU)(rC)(rA)(rA)(rC)(rU)(rU)(rG)(rA linear )(rA)(rA)(rA)(rA)(rG)(rU)(rG)(rG)(rC)(rA)(r End C)(rC)(rG)(rA)(rG)(rU)(rC)(rG)(rG)(rU)(rG)( modified Mtmg cOtO rC)(rU)#(mU)#(mU)#(mU)

[0265] (mC)#(mG)(mA)(rA)(rG)(rU)(rU)(rA)(rU)(rA )(rU)(rU)(rA)(rA)(rG)(rG)(rG)(rU)(rU)(rC)(r G)(rU)(rU)(rU)(rU)(rA)(rG)(rA)(rG)(rC)(rU)(rA)(rG)(rA)(rA)(rA)(rU)(rA)(rG)(rC)(rA)(rA) (rG)(rU)(rU)(rA)(rA)(rA)(rA)(rU)(rA)(rA)(rG )(rG)(rC)(rU)(rA)(rG)(rU)(rC)(rC)(rG)(rU)(r U)(rA)(rU)(rC)(rA)(rA)(rC)(rU)(rU)(rG)(rA)(rA)(rA)(rA)(rA)(rG)(rU)(rG)(rG)(rC)(rA)(rC) Mtmg_Rev_3' (rC)(rG)(rA)(rG)(rU)(rC)(rG)(rG)(rU)(rG)(rC csg End 3'dna_comp6_ )(rU)(mU)(mU)(mU)(dG)(d5C)(dT)(dT)(d5C)

[0266]

[0267] modifed cOtO #(dA) (mC)#(mC)#(mC)#(rA)(rU)(rA)(rC)(rC)(rU)(rU)(rG)(rG)(rA)(rG)(rC)(rA)(rA)(rC)(rG)(rG) (rG)(rU)(rU)(rU)(rU)(rA)(rG)(rA)(rG)(rC)(rU )(rA)(rG)(rA)(rA)(rA)(rU)(rA)(rG)(rC)(rA)(r A)(rG)(rU)(rU)(rA)(rA)(rA)(rA)(rU)(rA)(rA)( rG)(rG)(rC)(rU)(rA)(rG)(rU)(rC)(rC)(rG)(rU) (rU)(rA)(rU)(rC)(rA)(rA)(rC)(rU)(rU)(rG)(rA )(rA)(rA)(rA)(rA)(rG)(rU)(rG)(rG)(rC)(rA)(r C)(rC)(rG)(rA)(rG)(rU)(rC)(rG)(rG)(rU)(rG)( FIG.9 linear PCSK9 COTO rC)(rU)#(mU)#(mU)#(mU)

[0268] (mC)#(mC)(mC)(rA)(rU)(rA)(rC)(rC)(rU)(rU )(rG)(rG)(rA)(rG)(rC)(rA)(rA)(rC)(rG)(rG)(r G)(rU)(rU)(rU)(rU)(rA)(rG)(rA)(rG)(rC)(rU)(rA)(rG)(rA)(rA)(rA)(rU)(rA)(rG)(rC)(rA)(rA) (rG)(rU)(rU)(rA)(rA)(rA)(rA)(rU)(rA)(rA)(rG )(rG)(rC)(rU)(rA)(rG)(rU)(rC)(rC)(rG)(rU)(r U)(rA)(rU)(rC)(rA)(rA)(rC)(rU)(rU)(rG)(rA)(rA)(rA)(rA)(rA)(rG)(rU)(rG)(rG)(rC)(rA)(rC) (rC)(rG)(rA)(rG)(rU)(rC)(rG)(rG)(rU)(rG)(rC PCSK9 C0T0 )(rU)(mU)(mU)(mU)(dG)(dG)(dG)(dT)(dA)# csg rev dna (dT)

[0269] (mC)#(mG)#(mU)#(rG)(rC)(rU)(rA)(rC)(rU)( rU)(rC)(rA)(rU)(rG)(rU)(rG)(rG)(rU)(rC)(rG) (rG)(rU)(rU)(rU)(rU)(rA)(rG)(rA)(rG)(rC)(rU )(rA)(rG)(rA)(rA)(rA)(rU)(rA)(rG)(rC)(rA)(r A)(rG)(rU)(rU)(rA)(rA)(rA)(rA)(rU)(rA)(rA)( rG)(rG)(rC)(rU)(rA)(rG)(rU)(rC)(rC)(rG)(rU) (rU)(rA)(rU)(rC)(rA)(rA)(rC)(rU)(rU)(rG)(rA FIG. )(rA)(rA)(rA)(rA)(rG)(rU)(rG)(rG)(rC)(rA)(r 10,11 C)(rC)(rG)(rA)(rG)(rU)(rC)(rG)(rG)(rU)(rG)( ,12 linear GER10 COTO rC)(rU)#(mU)#(mU)#(mU)

[0270] (mC)#(mG)(mU)(rG)(rC)(rU)(rA)(rC)(rU)(rU )(rC)(rA)(rU)(rG)(rU)(rG)(rG)(rU)(rC)(rG)(r G)(rU)(rU)(rU)(rU)(rA)(rG)(rA)(rG)(rC)(rU)(rA)(rG)(rA)(rA)(rA)(rU)(rA)(rG)(rC)(rA)(rA) (rG)(rU)(rU)(rA)(rA)(rA)(rA)(rU)(rA)(rA)(rG )(rG)(rC)(rU)(rA)(rG)(rU)(rC)(rC)(rG)(rU)(r U)(rA)(rU)(rC)(rA)(rA)(rC)(rU)(rU)(rG)(rA)(rA)(rA)(rA)(rA)(rG)(rU)(rG)(rG)(rC)(rA)(rC) (rC)(rG)(rA)(rG)(rU)(rC)(rG)(rG)(rU)(rG)(rC eye )(rU)(mU)(mU)(mU)(iG)(iC)(iA)(iC)(iG)#(iA

[0271]

[0272] csg GER10 COTO ) _ where “mN” signifies a 2’-0-methyl nucleotide, “fN” signifies a 2’ -fluoro nucleotide, “rN” signifies a 2’-OH nucleotide, “dN” signifies a 2’-deoxy nucleotide, “i” before any nucleotide signifies that it is an inverted nucleotide, and <33> signifies a 3 ’,3’ linkage.

[0273] Example 3 - Circularly structured guide RNAs for Prime editing

[0274] The circularly structured guide RNAs described herein were used in a prime editing system.

[0275] The original prime editing system consists of a nicking Cas9 (nCas9) protein fused with a reverse transcriptase (RT), delivered with a prime editing guide RNA (pegRNA). There are many evolved versions of prime editing to achieve higher editing efficiency.

[0276] In the split prime editing system [Liu et al., Nat Biotechnol, 2022], nCas9 untethered to the RT is guided by the sgRNA and nicking sgRNA localizes to target locus and introduces a single stranded break on the non-targeting strand. A Linear Primer Editing Template (LPET), containing a primer binding site (PBS), reverse transcriptase template (RTT) and a recruiting moiety such as MS2 stemloop, recruits the MCP fused RT to the edit site and produce the correct edit. It has been previously shown that using a fully modified editing template, i.e., PBS and RTT 2’0Me modified, with engineered and evolved modification tolerant polymerases like MCP-TF1RT (PE6C), significantly improved editing efficiency of non-circularized pegRNA (PCT / US2025 / 044896). It was hypothesized that circularization of fully modified editing template and sgRNA would further improve editing.

[0277] The components in this system include nCas9 mRNA, an evolved MCP-TF1RT (PE6C) mRNA, nicking gRNA, sgRNA, and fully modified LPET (PBS+RTT 2’0Me). The 3'3' 6-base complementary circular design was applied to the sgRNA and fully modified editing template.

[0278] As shown in FIG. 13, circularly structured guides led to an increase in correct editing in the split prime editing system. The work exemplified in Examples 1-3 demonstrates the broad applicability of the circularly structured guide RNA with a circularization domain comprising 3 ’-3’ linkage.

[0279] Sequences used for the figure of Example 3 are shown below:

[0280] Linear 5'(mG)#(mG)#(mA)#(rA)(rU)(rC)(rC)(rC)(rU)(rU)(rC)(rU)(rG)(rC)(rA)(rG)(rC)(r FANCF A)(rC)(rC)(rG)(rU)(rU)(rU)(rU)(rA)(rG)(rA)(rG)(rC)(rU)(rA)(rG)(rA)(rA)(rA)(rU sgRNA )(rA)(rG)(rC)(rA)(rA)(rG)(rU)(rU)(rA)(rA)(rA)(rA)(rU)(rA)(rA)(rG)(rG)(rC)(rU)( rA)(rG)(rU)(rC)(rC)(rG)(rU)(rU)(rA)(rU)(rC)(rA)(rA)(rC)(rU)(rU)(rG)(rA)(rA)(r A)(rA)(rA)(rG)(rU)(rG)(rG)(rC)(rA)(rC)(rC)(rG)(rA)(rG)(rU)(rC)(rG)(rG)(rU)(rG )(rC)(rU)#(mU)#(mU)#(mU)3 '

[0281] Circular 5'(mG)#(mG)(mA)(rA)(rU)(rC)(rC)(rC)(rU)(rU)(rC)(rU)(rG)(rC)(rA)(rG)(rC)(rA) FANCF (rC)(rC)(rG)(rU)(rU)(rU)(rU)(rA)(rG)(rA)(rG)(rC)(rU)(rA)(rG)(rA)(rA)(rA)(rU)(r sgRNA A)(rG)(rC)(rA)(rA)(rG)(rU)(rU)(rA)(rA)(rA)(rA)(rU)(rA)(rA)(rG)(rG)(rC)(rU)(rA )(rG)(rU)(rC)(rC)(rG)(rU)(rU)(rA)(rU)(rC)(rA)(rA)(rC)(rU)(rU)(rG)(rA)(rA)(rA)( rA)(rA)(rG)(rU)(rG)(rG)(rC)(rA)(rC)(rC)(rG)(rA)(rG)(rU)(rC)(rG)(rG)(rU)(rG)(r C)(rU)(mU)(mU)(mU)(C9)<33>(iC)(iC)(iT)(iT)(iA)#(iG)5'

[0282] Linear 5'(mG)#(mC)#(mA)#(rC)(rA)(rU)(rG)(rA)(rG)(rG)(rA)(rU)(rC)(rA)(rC)(rC)(rC)(r FANCF A)(rU)(rG)(mU)(mG)(mC)(C9)(mG)(mG)(mA)(mA)(mA)(mA)(mG)(mC)(mG)(m petRNA A)(mU)(mC)(mG)(mU)(mG)(mA)(mU)(mG)(mC)(mU)(mG)(mC)(mA)(mG)(mA)

[0283] (m A)(mG)(mG)#(mG)#(m A)#(mU)31

[0284] Circular 5'(mU)#(mG)(mC)(mA)(mU)(mG)(mG)(mC)(mA)(rC)(rA)(rU)(rG)(rA)(rG)(rG)(r FANCF A)(rU)(rC)(rA)(rC)(rC)(rC)(rA)(rU)(rG)(mU)(mG)(mC)(C9)(mG)(mG)(mA)(mA) petRNA (mA)(mA)(mG)(mC)(mG)(mA)(mU)(mC)(mG)(mU)(mG)(mA)(mU)(mG)(mC)( mU)(mG)(mC)(mA)(mG)(mA)(mA)(mG)(mG)(mG)(mA)(mU)(C9)<33>(iA)(iC)(

[0285]

[0286] iG)(iT)(iA)#(iC)5'

[0287] where “mN” signifies a 2’-O-methyl nucleotide, “fN” signifies a 2’ -fluoro nucleotide, “rN” signifies a 2’-OH nucleotide, “dN” signifies a 2’-deoxy nucleotide, “i” before any nucleotide signifies that it is an inverted nucleotide, and <33> signifies a 3 ’,3’ linkage.

Claims

ClaimsWhat is claimed:

1. A circularly structured guide RNA comprising:(a) a crRNA portion comprising (i) a guide sequence capable of hybridizing to a target polynucleotide sequence, and (ii) a repeat sequence;(b) a tracrRNA portion comprising an anti-repeat nucleotide sequence that is complementary to the repeat sequence; and(c) a circularization portion comprising at least 4 inverted nucleotides with complementarity to the crRNA portion,wherein the circularization portion is linked to the tracrRNA portion via a 3’ to 3’ linkage.

2. The circularly structured guide RNA of claim 1, wherein the circularization portion comprises between 4 and 20 inverted nucleotides with complementarity to the guide sequence or the tracrRNA portion.

3. The circularly structured guide RNA of claim 1 or 2, wherein the circularization portion comprises between 4 and 10 inverted nucleotides with complementarity to the guide sequence or the tracrRNA portion.

4. The circularly structured guide RNA of any one of claims 1-3, wherein the circularization portion comprises sufficient complementarity to the guide sequence or the tracrRNA portion to permit circularization.

5. The circularly structured guide RNA of any one of claims 1-4, wherein the circularization portion comprises 1-3 mismatches with the guide sequence or the tracrRNA portion.

6. The circularly structured guide RNA of any one of claims 1-5, wherein the 3’ to 3’ linkage further comprises a non-nucleotide linker.

7. The circularly structured guide RNA of claim 6, wherein the non-nucleotide linker is selected from the group consisting of an ethylene glycol chain, an alkyl chain, a polypeptide, a polysaccharide, and a block copolymer.

8. The circularly structured guide RNA of claim 6 or 7, wherein the non-nucleotide linker comprises a C2-C16 alkyl linker.

9. The circularly structured guide RNA of claim 6 or 7, wherein the non-nucleotide linker comprises an ethylene glycol linker comprising 1 to 10 ethylene glycol units.

10. The circularly structured guide RNA of claim 6 or 7, wherein the non-nucleotide linker comprises a tri ethylene glycol, a tetra ethylene glycol linker, or a hexa ethylene glycol linker.

11. The circularly structured guide RNA of any one of claims 1-10, wherein the circularization portion comprises at least 4 inverted nucleotides with complementarity to the guide sequence of the crRNA portion.

12. The circularly structured guide RNA of any one of claims 1-11, wherein the circularization portion comprises between 4 and 20 inverted nucleotides with complementarity to the guide sequence of the crRNA portion.

13. The circularly structured guide RNA of any one of claims 1-12, wherein the crRNA portion comprises a 5’ single strand sequence of at least one nucleotide.

14. The circularly structured guide RNA of any one of claims 1-13, wherein the crRNA portion comprises a 5’ single strand sequence of between 1 to 10 nucleotides in length.

15. The circularly structured guide RNA of claims 13 or 14, wherein the circularization portion is not complementary to the 5’ single strand sequence of the crRNA portion.

16. The circularly structured guide RNA of any one of claims 1-15, wherein the crRNA portion comprises, from 5’ to 3’, a universal polynucleotide sequence, the guide sequence, and the repeat sequence.

17. The circularly structured guide RNA of claim 16, wherein the circularization portion comprises at least 4 inverted nucleotides with complementarity to the universal polynucleotide sequence of the crRNA portion.

18. The circularly structured guide RNA of claim 17, wherein the 3’ to 3’ linkage further comprises a cleavable linker.

19. The circularly structured guide RNA of any one of claims 1-18, wherein the tracrRNA portion comprises, from 5’ to 3’, the anti -repeat nucleotide sequence, one or more stem loop sequences, and a universal polynucleotide sequence.

20. The circularly structured guide RNA of claim 19, wherein the circularization portion comprises at least 4 inverted nucleotides with complementarity to the universal polynucleotide sequence of the tracrRNA portion.

21. The circularly structured guide RNA of any one of claims 1-20, comprising at least one modified nucleotide.

22. The circularly structured guide RNA of claim 21, wherein the crRNA portion comprises at least one modified nucleotide.

23. The circularly structured guide RNA of claim 21 or 22, wherein the tracrRNA portion comprises at least one modified nucleotide.

24. The circularly structured guide RNA of any one of claims 21-23, wherein the circularization portion comprises at least one modified nucleotide.

25. The circularly structured guide RNA of any one of claims 21-24, wherein the at least one modified nucleotide each independently comprise a modification of a ribose group, a phosphate group, a nucleobase, or a combination thereof.

26. The circularly structured guide RNA of claim 25, wherein each modification of the ribose group is independently selected from the group consisting of 2'-(9-methyl, 2’-fluoro, 2’-deoxy, 2’-O-(2-methoxyethyl) (MOE), 2’-NH2 (2’-amino), 4’-thio, a bicyclic nucleotide, a locked nucleic acid (LNA), a 2’-(5 -constrained ethyl (S-cEt), a constrained MOE, and a 2'-(9,4'-C-aminomethylene bridged nucleic acid (2', 4'-BNANC).

27. The circularly structured guide RNA of claim 25 or 26, wherein at least 80% of the ribose groups are chemically modified.

28. The circularly structured guide RNA of claim 25 or 26, wherein at least 90% of the ribose groups are chemically modified.

29. The circularly structured guide RNA of claim 25 or 26, wherein 100% of the ribose groups are chemically modified.

30. The circularly structured guide RNA of claim 25, wherein each modification of the phosphate group is independently selected from the group consisting of a phosphorothioate, phosphonoacetate (PACE), thiophosphonoacetate (thioPACE), amide, triazole, phosphonate, and phosphotriester modification.

31. The circularly structured guide RNA of claim 25, wherein each modification of the nucleobase group is independently selected from the group consisting of 2-thiouridine, 4-thiouridine, N6-methyladenosine, pseudouridine, 2,6-diaminopurine, inosine, thymidine, 5-methylcytosine, 5-substituted pyrimidine, isoguanine, isocytosine, and halogenated aromatic groups.

32. The circularly structured guide RNA of any one of claims 1-31, wherein circularly structured guide RNA comprises the sequence 5'(N)xGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUU AUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU< 33>( iN)y 5', wherein X corresponds to the guide sequence and an integer of between 17 and 20, each N corresponds to a nucleotide of A, U, G, or C, y corresponds to the circularization portion and an integer of between 4 and 20, < 33> corresponds to a 3’ to 3’ linkage, and each iN corresponds to a nucleotide of A, U, G, or C.

33. The circularly structured guide RNA of any one of claims 1-32, further comprising a nucleotide or non-nucleotide loop or linker linking the 3’ end of the crRNA portion to the 5’ end of the tracrRNA portion.

34. The circularly structured guide RNA of claim 33, wherein the non-nucleotide linker comprises an ethylene glycol oligomer linker.

35. The circularly structured guide RNA of claim 33, wherein the nucleotide loop is chemically modified.

36. The circularly structured guide RNA of claim 33, wherein the nucleotide loop comprises the nucleotide sequence of GAAA.

37. The circularly structured guide RNA of any one of claims 1-36, wherein the guide RNA binds to a Cas9 nuclease selected from the group consisting of S. pyogenes Cas9 (SpCas9), S. aureus Cas9 (SaCas9), N. meningitidis Cas9 (NmCas9), C. jejuni Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9).

38. The circularly structured guide RNA of claim 37, wherein the Cas9 is a variant Cas9 with altered activity.

39. A method of altering expression of a target gene in a cell, comprising administering to said cell a genome editing system comprising:the circularly structured guide RNA of any one of the preceding claims; and an RNA-guided nuclease or a polynucleotide encoding an RNA-guided nuclease.

40. The method of claim 39, wherein the target gene is in a cell in an organism.

41. The method of claim 39, wherein expression of the target gene reduced compared to a cell the is not administered the genome editing system.

42. The method of claim 39, wherein the circularly structured guide RNA and the RNA-guided nuclease comprise a ribonucleoprotein (RNP) complex.

43. The method of claim 39, wherein the RNA-guided nuclease is selected from the group consisting of S. pyogenes Cas9 (SpCas9), S. aureus Cas9 (SaCas9), N. meningitidis Cas9 (NmCas9), C. jejuni Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9).

44. The method of claim 39, wherein the Cas9 is a variant Cas9 with altered activity.

45. The method of claim 44, wherein the variant Cas9 is selected from the group consisting of a Cas9 nickase (nCas9), a catalytically dead Cas9 (dCas9), a hyper accurate Cas9 (HypaCas9), a high fidelity Cas9 (Cas9-HF), an enhanced specificity Cas9 (eCas9), and an expanded PAM Cas9 (xCas9).

46. The method of any one of claims 43-45, wherein the Cas9 or variant Cas9 is fused to a nucleotide base editor (NBE) domain.

47. The method of claim 46, wherein the NBE domain is an adenine base editor (ABE) domain.

48. The method of claim 47, wherein the ABE domain is a adenosine deaminase8e protein domain (ABE8e).

49. The method of claim 46, wherein the NBE domain is a cytidine base editor (CBE) domain.

50. The method of claim 49, wherein the CBE domain is evoFERNY or rAPOBECl.

51. The method of any one of claims 39-50, wherein the polynucleotide encoding an RNA-guided nuclease comprises a vector.

52. The method of claim 51, wherein the vector is a viral vector.

53. The method of claim 52, wherein the viral vector is an adeno-associated virus (AAV) vector or a lentivirus (LV) vector.

54. The method of any one of claims 39-50, wherein the polynucleotide encoding an RNA-guided nuclease comprises a synthetic mRNA.

55. The method of any one of claims 39-54, wherein the circularly structured guide RNA and / or the RNA-guided nuclease or the polynucleotide encoding the RNA-guided nuclease are encapsulated in a lipid nanoparticle (LNP).

56. A CRISPR genome editing system comprising:the circularly structured guide RNA of any of the preceding claims; andan RNA-guided nuclease or a polynucleotide encoding an RNA-guided nuclease.

57. The CRISPR genome editing system of claim 56, wherein the RNA-guided nuclease is selected from the group consisting of S. pyogenes Cas9 (SpCas9), S. aureus Cas9 (SaCas9), N. meningitidis Cas9 (NmCas9), C. jejuni Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9).

58. The CRISPR genome editing system of claim 57, wherein the Cas9 is a variant Cas9 with altered activity.

59. The CRISPR genome editing system of claim 58, wherein the variant Cas9 is selected from the group consisting of a Cas9 nickase (nCas9), a catalytically dead Cas9 (dCas9), a hyper accurate Cas9 (HypaCas9), a high fidelity Cas9 (Cas9-HF), an enhanced specificity Cas9 (eCas9), and an expanded PAM Cas9 (xCas9).

60. The CRISPR genome editing system of any one of claims 57-59, wherein the Cas9 or variant Cas9 is fused to a nucleotide base editor (NBE) domain.

61. The CRISPR genome editing system of claim 60, wherein the NBE domain is an adenine base editor (ABE) domain.

62. The CRISPR genome editing system of claim 61, wherein the ABE domain is a adenosine deaminase8e protein domain (ABE8e).

63. The CRISPR genome editing system of claim 60, wherein the NBE domain is a cytidine base editor (CBE) domain.

64. The CRISPR genome editing system of claim 63, wherein the CBE domain is evoFERNY or rAPOBEC 1.

65. A circularly structured prime editing guide RNA (pegRNA) comprising:(a) a crRNA portion comprising (i) a guide sequence capable of hybridizing to a target polynucleotide sequence, and (ii) a repeat sequence;(b) a tracrRNA portion comprising an anti-repeat nucleotide sequence that is complementary to the repeat sequence;(c) a nucleotide polymerase template (NPT) portion;(d) a primer binding site (PBS) portion,wherein a circularization portion comprising at least 4 inverted nucleotides with complementarity to the crRNA portion is linked to the PBS portion via a 3’ to 3’ linkage.

66. A circularly structured prime editor template RNA (petRNA) comprising a primer binding site (PBS) and a nucleotide polymerase template (NPT), wherein a circularization portion comprising at least 4 inverted nucleotides with complementarity to the PBS and / or NPT is linked to the PBS and / or NPT via a 3’ to 3’ linkage.

67. The circularly structured pegRNA or petRNA of claim 65 or 66, wherein the circularization portion comprises between 4 and 20 inverted nucleotides with complementarity to the guide sequence or the PBS portion.

68. The circularly structured pegRNA or petRNA of any one of claims 65-67, wherein the 3’ to 3’ linkage further comprises a non-nucleotide linker.

69. The circularly structured pegRNA or petRNA of claim 68, wherein the non-nucleotide linker is selected from the group consisting of an ethylene glycol chain, an alkyl chain, a polypeptide, a polysaccharide, and a block copolymer.

70. The circularly structured pegRNA or petRNA of claim 68 or 69, wherein the non-nucleotide linker comprises a C2-C16 alkyl linker.

71. The circularly structured pegRNA or petRNA of claim 68 or 69, wherein the non-nucleotide linker comprises an ethylene glycol linker comprising 1 to 10 ethylene glycol units.

72. The circularly structured pegRNA or petRNA of claim 68 or 69, wherein the non-nucleotide linker comprises a tri ethylene glycol, a tetra ethylene glycol linker, or a hexa ethylene glycol linker.

73. The circularly structured pegRNA of any one of claims 65 and 67-72, wherein the circularization portion comprises at least 4 inverted nucleotides with complementarity to the guide sequence of the crRNA portion.

74. The circularly structured petRNA of any one of claims 66-72, wherein the circularization portion comprises at least 4 inverted nucleotides with complementarity to the PBS and / or NPT.

75. The circularly structured pegRNA of any one of claims 65 and 67-73, wherein the crRNA portion comprises, from 5’ to 3’, a universal polynucleotide sequence, the guide sequence, and the repeat sequence.

76. The circularly structured pegRNA or petRNA of claim 75, wherein the circularization portion comprises at least 4 inverted nucleotides with complementarity to the universal polynucleotide sequence.

77. The circularly structured pegRNA or petRNA of any one of claims 65-76, wherein the 3’ to 3’ linkage further comprises a cleavable linker.

78. The circularly structured pegRNA or petRNA of any one of claims 65-72, wherein the PBS portion comprises a universal polynucleotide sequence at the 3’ end of the PBS portion.

79. The circularly structured pegRNA or petRNA of claim 78, wherein the circularization portion comprises at least 4 inverted nucleotides with complementarity to the universal polynucleotide sequence of the PBS portion.

80. The circularly structured petRNA of any one of claims 66-79, wherein the circularly structured petRNA comprises at least one MS2 hairpin.

81. The circularly structured petRNA of any one of claims 66-80, comprising, from 5’ to 3’ at least one MS2 hairpin, the NPT portion, and the PBS portion.

82. The circularly structured pegRNA or petRNA of any one of claims 65-81, comprising at least one modified nucleotide.

83. The circularly structured pegRNA or petRNA of claim 82, wherein the crRNA portion comprises at least one modified nucleotide.

84. The circularly structured pegRNA or petRNA of claim 82 or 83, wherein the tracrRNA portion comprises at least one modified nucleotide.

85. The circularly structured pegRNA or petRNA of any one of claims 82-84, wherein the circularization portion comprises at least one modified nucleotide.

86. The circularly structured pegRNA or petRNA of any one of claims 82-85, wherein the at least one modified nucleotide each independently comprise a modification of a ribose group, a phosphate group, a nucleobase, or a combination thereof.

87. The circularly structured pegRNA or petRNA of claim 86, wherein each modification of the ribose group is independently selected from the group consisting of 2'-O-methyl, 2’-fluoro, 2’-deoxy, 2’ -O-(2 -meth oxy ethyl) (MOE), 2’-NH2 (2’-amino), 4’-thio, a bicyclic nucleotide, a locked nucleic acid (LNA), a 2’-(5)-constrained ethyl (S-cEt), a constrained MOE, and a 2'-O,4'-C-aminomethylene bridged nucleic acid (2',4'-BNANC).

88. The circularly structured pegRNA or petRNA of claim 86 or 87, wherein at least 80% of the ribose groups are chemically modified.

89. The circularly structured pegRNA or petRNA of claim 86 or 87, wherein at least 90% of the ribose groups are chemically modified.

90. The circularly structured pegRNA or petRNA of claim 86 or 87, wherein 100% of the ribose groups are chemically modified.

91. The circularly structured pegRNA or petRNA of claim 86, wherein each modification of the phosphate group is independently selected from the group consisting of a phosphorothioate, phosphonoacetate (PACE), thiophosphonoacetate (thioPACE), amide, triazole, phosphonate, and phosphotriester modification.

92. The circularly structured pegRNA or petRNA of claim 86, wherein each modification of the nucleobase group is independently selected from the group consisting of 2-thiouridine, 4-thiouridine, N6-methyladenosine, pseudouridine, 2,6-diaminopurine, inosine, thymidine, 5-methylcytosine, 5-substituted pyrimidine, isoguanine, isocytosine, and halogenated aromatic groups.

93. The circularly structured pegRNA of any one of claims 65 and 67-92, further comprising a nucleotide or non-nucleotide loop or linker linking the 3’ end of the crRNA portion to the 5’ end of the tracrRNA portion.

94. The circularly structured pegRNA of claim 93, wherein the non-nucleotide linker comprises an ethylene glycol oligomer linker.

95. The circularly structured pegRNA of claim 93, wherein the nucleotide loop is chemically modified.

96. The circularly structured pegRNA of claim 93, wherein the nucleotide loop comprises the nucleotide sequence of GAAA.

97. A prime editing system comprising:the circularly structured pegRNA or petRNA of any of the preceding claims; and a fusion protein comprising a Cas9 nickase protein linked to a nucleotide polymerase (NT) protein or a polynucleotide encoding the fusion protein.

98. The prime editing system of claim 97, wherein the NT protein is a reverse transcriptase.

99. The prime editing system of claim 98, wherein the reverse transcriptase is a retrovirus reverse transcriptase.

100. The prime editing system of claim 98 or 99, wherein the reverse transcriptase is a Moloney murine leukemia virus (M-MLV) reverse transcriptase.

101. The prime editing system of any one of claims 97-100, wherein the fusion protein is linked to at least one MS2 binding protein.

Images