Polyethylene glycol composite, and preparation method therefor and use thereof

Abstract

The present invention belongs to the technical field of medicine. Provided are a polyethylene glycol composite, and a preparation method therefor and the use thereof. The polyethylene glycol composite of the present application comprises, by mass percentage: 1-2% of exosomes derived from mesenchymal stem cells modified with miRNA-138-5p, 1-2% of exosomes derived from mesenchymal stem cells modified with miRNA-21, 1-2% of exosomes derived from mesenchymal stem cells modified with lncGm36569, 1-2% of exosomes derived from mesenchymal stem cells modified with mRNA of a SNARE family protein, 1-2% of exosomes derived from mesenchymal stem cells modified with mRNA of syntaphilin, and the balance being polyethylene glycol. The polyethylene glycol composite of the present application can restore spinal cord continuity and improve the spinal cord injury microenvironment, thereby restoring neural function.

Description

A polyethylene glycol composite agent, its preparation method and application

[0001] Cross-references to related applications

[0002] This application claims priority to Chinese Patent Application No. 202411523744.1, filed on October 29, 2024, entitled "A Polyethylene Glycol Composite Agent and Its Preparation Method and Application", the entire contents of which are incorporated herein by reference. Technical Field

[0003] This application belongs to the field of pharmaceutical technology, specifically relating to a polyethylene glycol composite agent, its preparation method, and its application. Background Technology

[0004] Spinal cord injury (SCI) caused by various factors (such as traffic accidents, falls from heights, and violent trauma) is a catastrophic clinical condition. Complete SCI can lead to paraplegia (quadriplegia or lower limb paraplegia), meaning that paraplegic patients are confined to bed or wheelchairs for life, accompanied by serious and even fatal complications (such as central nervous system pain, bedsores, deep vein thrombosis in the lower limbs, hypostatic pneumonia, and urinary tract infections). Furthermore, paraplegia places a tremendous burden on families in terms of both living expenses and finances. Therefore, finding effective treatments and interventions for SCI is both necessary and urgent.

[0005] Currently, clinical treatments for spinal cord injury mainly include medication, surgery, and rehabilitation. Medication primarily includes corticosteroids, neurotrophic drugs, opioid receptor antagonists, and centrally acting skeletal muscle relaxants. However, these drugs mainly alleviate various complications arising from spinal cord injury and have minimal effect on spinal cord reconstruction and functional recovery. Surgical procedures vary depending on the injury and mainly include spinal reduction and fixation, spinal canal decompression, and bone grafting and fusion. These spinal reconstruction surgeries primarily target the vertebral fracture and dislocation itself, limiting their role in post-injury spinal cord reconstruction. Rehabilitation includes exercise therapy, hydrotherapy, extracorporeal shock wave therapy, neuromodulation techniques, and exoskeleton rehabilitation robots. These rehabilitation methods improve patients' quality of life by remobilizing limbs, promoting muscle and bone function recovery, and inducing neuroplasticity.

[0006] However, the above treatments have little effect on spinal cord reconstruction and functional recovery. Summary of the Invention

[0007] To address the aforementioned issues, this application provides a polyethylene glycol composite agent, its preparation method, and its application. The polyethylene glycol composite agent of this application can reconstruct spinal cord continuity, improve the microenvironment of spinal cord injury, and thereby restore nerve function.

[0008] Therefore, this application provides the following technical solution.

[0009] In a first aspect, this application provides a polyethylene glycol complex comprising, by weight percentage: 1-2% of mesenchymal stem cell-derived exosomes modified with miRNA-138-5p, 1-2% of mesenchymal stem cell-derived exosomes modified with miRNA-21, 1-2% of mesenchymal stem cell-derived exosomes modified with lncGm36569, 1-2% of mesenchymal stem cell-derived exosomes modified with SNARE family protein mRNA, 1-2% of mesenchymal stem cell-derived exosomes modified with syntaphilin mRNA, with the balance being polyethylene glycol.

[0010] In one possible implementation, the relative molecular mass of polyethylene glycol is 400 to 1500;

[0011] Optionally, the relative molecular mass of the polyethylene glycol is 400, 600, 1000 or 1500.

[0012] In one possible implementation, the SNARE family proteins include at least one of Syntaxin-7 and Snap47.

[0013] In one possible implementation, the mesenchymal stem cell-derived exosomes are exosomes secreted by the patient's own mesenchymal stem cells.

[0014] In one possible implementation, the exosomes comprise, by weight percentage: 1.86% miRNA-138-5p-modified mesenchymal stem cell-derived exosomes, 1.71% miRNA-21-modified mesenchymal stem cell-derived exosomes, 1.49% lncGm36569-modified mesenchymal stem cell-derived exosomes, 1.99% SNARE family protein mRNA-modified mesenchymal stem cell-derived exosomes, 1.94% syntaphilin mRNA-modified mesenchymal stem cell-derived exosomes, and 91.02% polyethylene glycol.

[0015] In one possible implementation, the exosomes comprise, by weight percentage: 1.86% miRNA-138-5p-modified mesenchymal stem cell-derived exosomes, 2% miRNA-21-modified mesenchymal stem cell-derived exosomes, 1.99% lncGm36569-modified mesenchymal stem cell-derived exosomes, 1.07% SNARE family protein mRNA-modified mesenchymal stem cell-derived exosomes, 1.94% syntaphilin mRNA-modified mesenchymal stem cell-derived exosomes, and 91.14% polyethylene glycol.

[0016] In one possible implementation, the exosomes comprise, by weight percentage: 1.84% miRNA-138-5p-modified mesenchymal stem cell-derived exosomes, 1.69% miRNA-21-modified mesenchymal stem cell-derived exosomes, 1.97% lncGm36569-modified mesenchymal stem cell-derived exosomes, 1.31% SNARE family protein mRNA-modified mesenchymal stem cell-derived exosomes, 1.92% syntaphilin mRNA-modified mesenchymal stem cell-derived exosomes, and 91.27% polyethylene glycol;

[0017] In one possible implementation, the exosomes comprise, by weight percentage: 1.24% miRNA-138-5p-modified mesenchymal stem cell-derived exosomes, 1.14% miRNA-21-modified mesenchymal stem cell-derived exosomes, 1.00% lncGm36569-modified mesenchymal stem cell-derived exosomes, 1.99% SNARE family protein mRNA-modified mesenchymal stem cell-derived exosomes, 1.94% syntaphilin mRNA-modified mesenchymal stem cell-derived exosomes, and 92.69% polyethylene glycol.

[0018] Secondly, this application provides a method for preparing a polyethylene glycol composite agent, comprising the following steps:

[0019] The following components were mixed thoroughly according to their mass percentages: polyethylene glycol, mesenchymal stem cell-derived exosomes modified with miRNA-138-5p, mesenchymal stem cell-derived exosomes modified with miRNA-21, mesenchymal stem cell-derived exosomes modified with lncGm36569, mesenchymal stem cell-derived exosomes modified with SNARE family protein mRNA, and mesenchymal stem cell-derived exosomes modified with syntaphilin mRNA.

[0020] Thirdly, this application provides the use of a polyethylene glycol composite agent in a medicament for treating neurological disorders;

[0021] Optionally, the neurological injury can be one or more of spinal cord injury, brain injury, or peripheral nerve injury.

[0022] Fourthly, this application provides the use of a polyethylene glycol composite agent in a medicament for treating one or more of the following conditions caused by the spinal cord injury: rupture of spinal cord neurons or axon membranes, inflammatory response, oxidative stress, ischemia, apoptosis, ferroptosis, and glial scar formation.

[0023] Fifthly, this application provides a treatment method for neurological disorders, comprising administering the above-mentioned polyethylene glycol composite agent or a polyethylene glycol composite agent prepared according to the above preparation method to a subject in need.

[0024] Optionally, the neurological injury is one or more of spinal cord injury, brain injury, or peripheral nerve injury.

[0025] Optionally, the administration method is local infusion, and the dosage is determined according to the size of the spinal cord tissue.

[0026] Optionally, the dosage is 2ml-10ml.

[0027] Sixthly, this application provides a method for treating one or more of the following conditions, comprising applying the above-mentioned polyethylene glycol composite agent or a polyethylene glycol composite agent prepared according to the above preparation method to a subject in need, wherein the condition is selected from spinal cord neuron or nerve axon membrane rupture, inflammatory response, oxidative stress, ischemia, apoptosis, ferroptosis, and glial scar formation.

[0028] The technical solution of this application has the following advantages:

[0029] 1. A polyethylene glycol complex comprising, by weight percentage: 1-2% exosomes derived from mesenchymal stem cells modified with miRNA-138-5p, 1-2% exosomes derived from mesenchymal stem cells modified with miRNA-21, 1-2% exosomes derived from mesenchymal stem cells modified with lncGm36569, 1-2% exosomes derived from mesenchymal stem cells modified with mRNA corresponding to SNARE family proteins, 1-2% exosomes derived from mesenchymal stem cells modified with mRNA of syntaphilin, with the balance being polyethylene glycol.

[0030] When applied to the site of spinal cord injury, miRNA-138-5p-modified mesenchymal stem cell-derived exosomes exert their anti-inflammatory and anti-oxidative stress functions against secondary spinal cord injury through the NLRP3 / Caspase-1 inflammatory response pathway and the Nrf2 / keap1 oxidative stress pathway. Similarly, miRNA-21-modified mesenchymal stem cell-derived exosomes, when applied to the site of spinal cord injury, regulate astrocyte size and glial scar formation after spinal cord injury by interacting with bone morphogenetic protein (BMP) and the JAK-STAT signaling pathway. Furthermore, in damaged neural tissue, overexpression of miRNA-21 promotes the expression of angiogenesis-related molecules, including angiopoietin-1 (Ang-1), Tie-2 (Ang-1's receptor), and vascular endothelial growth factor (VEGF). miRNA-21 also promotes angiogenesis by increasing the expression of metalloproteinase-13 (MMP-13) and p-ERK1 / 2. Finally, miRNA-21 can also exert anti-apoptotic effects by downregulating the expression of PTEN, Spry2, and PDCD4. When mesenchymal stem cell-derived exosomes modified with lncGm36569 are applied locally at the site of spinal cord injury, lncGm3656 inhibits neuronal ferroptosis through the miRNA-5627-5p / FSP1 axis, thereby alleviating neuronal dysfunction. The mechanism of axonal membrane repair after spinal cord injury involves the production of vesicles via endocytosis within the axonal membrane. These vesicles migrate directionally to the axonal surface and tightly bind to seal the axonal ends. These tightly packed vesicles prevent harmful substances from entering the cytoplasm, and the vesicle membranes of contacting each other fuse to form an orderly cell membrane, achieving effective connection of the damaged axonal membrane. In this process, vesicle fusion depends on the SNARES complex formed by SNARE family proteins and the large amount of energy provided by mitochondria. When mesenchymal stem cell-derived exosomes modified with SNARE family protein mRNA are applied at the site of spinal cord injury, the number of SNARE family proteins at the axonal ends can be increased, thereby increasing the vesicle membrane fusion rate. When mesenchymal stem cell-derived exosomes modified with syntaphilin mRNA are applied to the site of spinal cord injury, they can increase the level of syntaphilin protein at the axonal stump, thereby attracting a large number of mitochondria to provide sufficient energy for the axonal stump vesicle membrane fusion process.

[0031] Polyethylene glycol (PEG) is inexpensive, stable, and non-toxic, possessing complete biocompatibility, water solubility, and in-situ sustained-release properties. In this application, PEG acts as an exosome sustained-release agent in the PEG composite, ensuring the continuous release of modified exosomes at the site of spinal cord injury to exert their corresponding functions. PEG dehydrates the cell membranes of neurons or axons, causing the protein and lipid structural elements to break down, thereby eliminating membrane rupture. Furthermore, PEG can promote membrane resealing by reducing the surface tension of neuronal or axon membranes and enhancing membrane fluidity, conditions favorable for resealing of neuronal or axon membranes. PEG immediately seals and gradually eliminates membrane damage, reducing calcium and calcium levels. 2+ Influx of polyethylene glycol (PEG) occurs through ruptures in the membrane into neurons or axons, where it interacts with mitochondria, inhibiting the formation of mitochondrial permeability transition pores and associated oxidative stress, thereby preventing interaction with O2. 2- The membrane permeability associated with the generation of H2O2 is further increased.

[0032] In summary, through the synergistic effects of the above components, the continuity of spinal cord nerve fibers is restored by inhibiting inflammation, anti-oxidation, angiogenesis, inhibiting apoptosis, inhibiting ferroptosis, inhibiting glial scar formation, and promoting the fusion and repair of vesicle membranes at axonal ends, thereby restoring nerve function below the level of spinal cord injury. Attached Figure Description

[0033] To more clearly illustrate the technical solutions in the specific embodiments of this application or the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0034] Figure 1 shows the magnetic resonance imaging (MRI) images of beagle dogs in treatment group 1 and control group 1 two months after surgery;

[0035] Figure 1 shows the T2-weighted MRI images of beagle dogs in treatment group 1 and the T2-weighted MRI images of beagle dogs in control group 1.

[0036] Figure 2 shows diffusion tensor imaging (DTI) images of beagle dogs in treatment group 1 and control group 1 two months after surgery;

[0037] Figure 2 shows the DTI images of beagle dogs in treatment group 1 and the DTI images of beagle dogs in control group 1.

[0038] Figure 3 shows electrophysiological images of beagle dogs in control group 2 and treatment group 2 before and after spinal cord injury.

[0039] Figure 3 shows the electrophysiological images of beagle dogs in treatment group 2 before injury, the electrophysiological images of beagle dogs in treatment group 2 two months after spinal cord injury and surgery, the electrophysiological images of beagle dogs in control group 2 before injury, and the electrophysiological images of beagle dogs in control group 2 two months after spinal cord injury and surgery.

[0040] Figure 4 is a transmission electron microscope image of exosomes;

[0041] Figure 5 shows the results of Western blot analysis of exosomes. Detailed Implementation

[0042] The following embodiments are provided to better understand this application and are not limited to the preferred embodiments described herein. They do not constitute a limitation on the content and scope of protection of this application. Any product that is the same as or similar to this application, derived by anyone under the guidance of this application or by combining features of this application with other prior art, falls within the scope of protection of this application.

[0043] For experiments not specifically described in the examples, the procedures or conditions should be followed according to the conventional experimental procedures described in the literature in this field. Reagents or instruments whose manufacturers are not specified are all commercially available conventional reagent products.

[0044] In the following examples, polyethylene glycol 600 is a sterile liquid stock solution provided by Sigma-Aldrich; the mesenchymal stem cell-derived exosomes are exosomes secreted by autologous umbilical cord mesenchymal stem cells; miRNA-138-5p (upstream primer Seq_1AGCTGGTGTTGTGAATCAGGCCG, downstream primer Seq_2TGGTGTCGTGGAGTCG), miRNA-21 (upstream primer Seq_3ATGGCTGTACCACCTTGTCGGATA, downstream primer Seq_4AGCATGCCTGCTATTGTCTTCCCA), lncGm36569 (upstream primer Seq_5TCATTTCTCTGCCGCTTCCA, downstream primer Seq_6AAAGAGCTCCTGTTTTCTGTACC), SN The mRNAs corresponding to ARE family proteins Syntaxin-7 (upstream primer Seq_7CGGAATTCCCATGTCTTACACTCCA, downstream primer Seq_8AATGCGGCCGCTCAGTGGTTCAATC), SNAP47 (upstream primer Seq_9AAGCTTATGAGTTCTGATATGCGTGTCC, downstream primer Seq_10CTCGAGCTACATCAGCTTTCTCATACGC), and syntaphilin (upstream primer Seq_11GCCCTCCACCTCTCCCTC, downstream primer Seq_12GCGAAGGCTTCCATGGTTTG) were all commercially available products (purchased from AnornorBiotechnology).

[0045] The method for obtaining exosomes derived from mesenchymal stem cells (MSCs) involves collecting exosomes secreted by umbilical cord MSCs from the culture medium via ultracentrifugation. In simple terms, the complete culture medium is centrifuged at 800g for 10 minutes, 3000g for 30 minutes, and then further centrifuged at 10000g for 1 hour at 4°C. The supernatant is then filtered through a 0.22μm filter to remove cells and debris. The supernatant is then ultracentrifuged twice at 120000g, 2 hours each time. The MSC exosome pellet is resuspended in 200μL phosphate-buffered saline to obtain an exosome suspension. Transmission electron microscopy (TEM) and Western blot analysis were used to verify exosome formation. Figure 4 shows the TEM image, and Figure 5 shows the Western blot analysis identifying high expression of specific markers CD63 and CD81 on the exosome surface (Calnexin, recombinant human calcinin, was used as an internal control in the Western blot test). These results demonstrate that MSC-derived exosomes were successfully collected.

[0046] Mesenchymal stem cell-derived exosomes with corresponding nucleic acid modifications were prepared using Exo-Fect gene transfection technology. In simple terms, the mRNAs of miRNA-138-5p, miRNA-21, lncGm36569, SNARE family proteins, and syntaphilin were mixed with a suspension of mesenchymal stem cell-derived exosomes (50–300 μg / 500 μL), Exo-Fect reagent (Biomars, Beijing), and PBS buffer at a ratio of 2:5:1:7 (v / v / v / v), and heated at 37°C for 10 minutes. Then, it was mixed with Exo-Quick reagent (Biomars, Beijing) at a ratio of 5:1 (v / v) on ice for 30 minutes, and finally centrifuged at 13000g for 5 minutes at 4°C. The supernatant and precipitate were separated, and the corresponding modified mesenchymal stem cell-derived exosomes were collected and resuspended in phosphate-buffered saline.

[0047] Example 1

[0048] This embodiment provides a polyethylene glycol composite agent with the following formulation:

[0049] Mesenchymal stem cell-derived exosomes modified with miRNA-138-5p (total number of vesicle granules 3 × 10⁻⁶) 9 1.86g of exosomes derived from mesenchymal stem cells modified with miRNA-21 (total number of vesicle granules: 3×10⁻⁶). 9 1.71g of exosomes derived from mesenchymal stem cells modified with lncGm36569 (total number of vesicle granules: 3×10⁻⁶). 9 1.49g of mesenchymal stem cell-derived exosomes (total number of vesicles 3×10⁻¹) modified with SNARE family protein mRNA (Syntaxin-7 mRNA and SNAP47 mRNA mass ratio 1:1). 9 1.99g of mesenchymal stem cell-derived exosomes (total number of vesicle granules: 3 × 10⁻⁶) containing syntaphilin mRNA-modified exosomes. 9 1.94g of each, and 91.11g of polyethylene glycol 600.

[0050] This embodiment also provides a method for preparing the above-mentioned polyethylene glycol composite agent, including: taking each raw material according to the above formula and mixing them evenly under sterile conditions.

[0051] Example 2

[0052] This embodiment provides a polyethylene glycol composite agent with the following formulation:

[0053] Mesenchymal stem cell-derived exosomes modified with miRNA-138-5p (total number of vesicle granules 3 × 10⁻⁶)9 1.86g of exosomes derived from mesenchymal stem cells modified with miRNA-21 (total number of vesicle granules: 3.5 × 10⁻⁶). 9 2g of mesenchymal stem cell-derived exosomes (total number of vesicle granules: 4 × 10⁻¹) modified with lncGm36569. 9 1.99g of mesenchymal stem cell-derived exosomes (total number of vesicle granules: 1.6 × 10⁻⁶) modified with SNARE family protein mRNA (Syntaxin-7 mRNA and SNAP47 mRNA mass ratio 1:1). 9 1.07g of mesenchymal stem cell-derived exosomes (total number of vesicle granules: 3 × 10⁻⁶) containing syntaphilin mRNA-modified exosomes. 9 1.94g of each, and 91.14g of polyethylene glycol 600.

[0054] This embodiment also provides a method for preparing the above-mentioned polyethylene glycol composite agent, including: taking each raw material according to the above formula and mixing them evenly under sterile conditions.

[0055] Example 3

[0056] This embodiment provides a polyethylene glycol composite agent with the following formulation:

[0057] Mesenchymal stem cell-derived exosomes modified with miRNA-138-5p (total number of vesicle granules 3 × 10⁻⁶) 9 1.86g of exosomes derived from mesenchymal stem cells modified with miRNA-21 (total number of vesicle granules: 3×10⁻⁶). 9 1.71g of exosomes derived from mesenchymal stem cells modified with lncGm36569 (total number of vesicle granules: 4 × 10⁻⁶) 9 1.99g of mesenchymal stem cell-derived exosomes (total number of vesicle granules: 2×10⁻¹) modified with SNARE family protein mRNA (Syntaxin-7 mRNA and SNAP47 mRNA mass ratio 1:1). 9 1.33g of syntaphilin mRNA-modified mesenchymal stem cell-derived exosomes (total number of vesicle granules: 3 × 10⁻⁶). 9 1.94g of each, and 92.36g of polyethylene glycol 600.

[0058] This embodiment also provides a method for preparing the above-mentioned polyethylene glycol composite agent, including: taking each raw material according to the above formula and mixing them evenly under sterile conditions.

[0059] Example 4

[0060] This embodiment provides a polyethylene glycol composite agent with the following formulation:

[0061] Mesenchymal stem cell-derived exosomes modified with miRNA-138-5p (total number of vesicle granules 2 × 10⁻⁶) 9 1.24g of exosomes derived from mesenchymal stem cells modified with miRNA-21 (total number of vesicle granules: 2 × 10⁻⁶). 9 1.14g of exosomes derived from mesenchymal stem cells modified with lncGm36569 (total number of vesicle granules: 2×10⁻⁶). 9 1g of mesenchymal stem cell-derived exosomes (total number of vesicle granules: 3 × 10⁻⁶) modified with SNARE family protein mRNA (Syntaxin-7 mRNA and SNAP47 mRNA mass ratio 1:1). 9 1.99g of mesenchymal stem cell-derived exosomes (total number of vesicle granules: 3 × 10⁻⁶) containing syntaphilin mRNA-modified exosomes. 9 1.94g of each, and 92.69g of polyethylene glycol 600.

[0062] This embodiment also provides a method for preparing the above-mentioned polyethylene glycol composite agent, including: taking each raw material according to the above formula and mixing them evenly under sterile conditions.

[0063] Experimental Example 1

[0064] This experimental example investigated the effect of the polyethylene glycol composite agent of Example 1 of this application in the treatment of spinal cord injury in animals, including the following steps:

[0065] 1. Material preparation:

[0066] 1.1 Animal selection and grouping: Eight 6-month-old female beagles were randomly divided into treatment group 1 and control group 1, with four animals in each group. The treatment group 1 members were designated as P1, P2, P3, and P4, while the control group 1 members were designated as C1, C2, C3, and C4.

[0067] 1.2 Experimental drugs: Treatment group 1 drug: polyethylene glycol complex in Example 1, wherein the mesenchymal stem cell-derived exosomes are exosomes secreted by autologous mesenchymal stem cells; Control group 1 drug: physiological saline.

[0068] 2. Model construction: A complete spinal cord transection model at the 10th thoracic vertebra (T10) level was constructed in beagle dogs of control group 1 and treatment group 1.

[0069] 3. Treatment group 1 received local infusion of the polyethylene glycol compound (2ml) from Example 1 at the spinal cord stump, while control group 1 received 2ml of normal saline.

[0070] 4. Postoperative observation: cBBB scores were performed one day before the T10 level complete spinal cord transection model was constructed and on days 0, 4, 7, 14, 21, 28, 42, and 56 postoperatively (see “Adaptation of the Basso–Beattie–Bresnahanlocomotor rating scale for use in a clinical model of spinal cord injury in dogs”, Rachel B. Song, D. Michele Basso, Ronaldo C. da Costa, Lesley C. Fisher, Xiaokui Mo, Sarah A. Moore, Journal of Neuroscience Methods 268(2016)117–124).

[0071] The cBBB scoring results are shown in Table 1.

[0072] Two months post-surgery, magnetic resonance imaging (MRI) and diffusion tensor imaging (DTI) were performed to assess the continuity of spinal cord nerve fibers. The results are shown in Figure 1.

[0073] Table 1. cBBB scores of treatment group 1 and control group 1

[0074] In Table 1, day -1 refers to the day before the T10 level complete spinal cord transection model was constructed. As shown in Table 1, the motor function of the forelimbs was normal after spinal cord injury. Day 0 refers to the day the T10 level complete spinal cord transection model was completed, at which time the hindlimbs were completely paralyzed. Surgical treatment was performed on the day the spinal cord was completely transcribed.

[0075] Figure 1 shows the T2-weighted MRI images of beagle dogs in treatment group 1 and the T2-weighted MRI images of beagle dogs in control group 1. Figure 2 shows the DTI images of beagle dogs in treatment group 1 and the DTI images of beagle dogs in control group 1.

[0076] As shown in Figures 1A and 1B, the spinal cord continuity in control group 1 was not restored, while the spinal cord continuity in treatment group 1 was restored. As shown in Figures 2A and 2B, the spinal cord ends in control group 1 were not connected by fiber tracts, while in treatment group 1, fused fiber tracts were visible crossing the injury area after surgery.

[0077] As shown in Table 1, Figure 1 and Figure 2, the recovery of motor function in the treatment group 1 beagle was better than that in the control group 1, and the difference was statistically significant (P<0.05 at 56 days post-surgery).

[0078] The above research results indicate that the polyethylene glycol composite agent of this application can rapidly reconnect severed spinal nerve fibers and restore motor and sensory functions below the level of spinal cord injury in a short period of time.

[0079] Experiment Example 2

[0080] This experimental example examines the comparative effects of the polyethylene glycol composite agent of Example 2 of this application and the positive control drug pure polyethylene glycol in the treatment of spinal cord injury in animals, including the following steps:

[0081] 1. Material preparation:

[0082] 1.1 Animal selection and grouping: Eight 6-month-old female beagles were randomly divided into treatment group 2 and control group 2, with 4 animals in each group. The treatment group 2 consisted of P1', P2', P3', and P4', while the control group 2 consisted of C1', C2', C3', and C4'.

[0083] 1.2 Experimental drugs: Treatment group 2 drug: polyethylene glycol complex in Example 2, wherein the mesenchymal stem cell-derived exosomes are exosomes secreted by autologous mesenchymal stem cells; Control group 2 drug: PEG-600.

[0084] 2. Model construction: A complete spinal cord transection model at the 10th thoracic vertebra (T10) level was constructed in beagle dogs of control group 2 and treatment group 2.

[0085] 3. Treatment group 2 received local infusion of the polyethylene glycol compound (2ml) from Example 2 at the spinal cord stump, while control group 2 received 2ml of PEG-600.

[0086] 4. Postoperative observation: cBBB scores were performed 1 day before surgery and on days 0, 4, 7, 14, 21, 28, 42, and 56 after surgery (see “Adaptation of the Basso–Beattie–Bresnahanlocomotor rating scale for use in a clinical model of spinal cord injury in dogs”, Rachel B. Song, D. Michele Basso, Ronaldo C. da Costa, Lesley C. Fisher, Xiaokui Mo, Sarah A. Moore, Journal of Neuroscience Methods 268(2016)117–124).

[0087] The cBBB score results are shown in Table 2.

[0088] Table 2. cBBB scores of treatment group 2 and control group 2

[0089] 5. Electrophysiological examinations (MEP, motor evoked potentials) were performed on beagle dogs before spinal cord injury and two months after spinal cord injury and surgery. The results are shown in Figure 2.

[0090] Figure 3 shows the electrophysiological images of the beagle dogs in treatment group 2 before injury, the electrophysiological images of the beagle dogs in treatment group 2 two months after injury and surgery, the electrophysiological images of the beagle dogs in control group 2 before injury, and the electrophysiological images of the beagle dogs in control group 2 two months after injury and surgery.

[0091] As shown in Figure 3, the electrophysiological amplitudes of control group 2 and treatment group 2 before injury were similar and were both normal amplitudes. Two months after injury and surgery, the spinal cord electrical signal conduction of both control group 2 and treatment group 2 recovered to some extent, but the MEP waveform amplitude of treatment group 2 was significantly higher than that of control group 2.

[0092] As shown in Table 2 and Figure 3, the motor function of the beagle dogs in the control group 2 was partially restored, and the spinal cord electrical signal transmission was partially restored. However, the recovery of motor function and electrical signal transmission in the beagle dogs in the treatment group 2 was better than that in the control group 2, and the difference was statistically significant (P<0.05 at 56 days postoperatively).

[0093] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A polyethylene glycol composite agent, characterized in that, The product comprises, by weight percentage: 1–2% exosomes derived from mesenchymal stem cells modified with miRNA-138-5p, 1–2% exosomes derived from mesenchymal stem cells modified with miRNA-21, 1–2% exosomes derived from mesenchymal stem cells modified with lncGm36569, 1–2% exosomes derived from mesenchymal stem cells modified with SNARE family protein mRNA, 1–2% exosomes derived from mesenchymal stem cells modified with syntaphilin mRNA, with the remainder being polyethylene glycol.

2. The polyethylene glycol composite agent according to claim 1, characterized in that, The relative molecular mass of polyethylene glycol is 400–1500; Optionally, the relative molecular mass of the polyethylene glycol is 400, 600, 1000 or 1500.

3. The polyethylene glycol composite agent according to claim 1, characterized in that, The SNARE family of proteins includes at least one of Syntaxin-7 and Snap47.

4. The polyethylene glycol composite agent according to any one of claims 1-3, characterized in that, Mesenchymal stem cell-derived exosomes are exosomes secreted by the patient's own mesenchymal stem cells.

5. The polyethylene glycol composite agent according to any one of claims 1-3, characterized in that, The composition by weight percentage includes: 1.86% exosomes derived from mesenchymal stem cells modified with miRNA-138-5p, 1.71% exosomes derived from mesenchymal stem cells modified with miRNA-21, 1.49% exosomes derived from mesenchymal stem cells modified with lncGm36569, 1.99% exosomes derived from mesenchymal stem cells modified with SNARE family protein mRNA, 1.94% exosomes derived from mesenchymal stem cells modified with syntaphilin mRNA, and 91.02% polyethylene glycol.

6. The polyethylene glycol composite agent according to any one of claims 1-3, characterized in that, The composition by weight percentage includes: 1.86% exosomes derived from mesenchymal stem cells modified with miRNA-138-5p, 2% exosomes derived from mesenchymal stem cells modified with miRNA-21, 1.99% exosomes derived from mesenchymal stem cells modified with lncGm36569, 1.07% exosomes derived from mesenchymal stem cells modified with SNARE family protein mRNA, 1.94% exosomes derived from mesenchymal stem cells modified with syntaphilin mRNA, and 91.14% polyethylene glycol.

7. The polyethylene glycol composite agent according to any one of claims 1-3, characterized in that, The composition by weight percentage includes: 1.84% exosomes derived from mesenchymal stem cells modified with miRNA-138-5p, 1.69% exosomes derived from mesenchymal stem cells modified with miRNA-21, 1.97% exosomes derived from mesenchymal stem cells modified with lncGm36569, 1.31% exosomes derived from mesenchymal stem cells modified with SNARE family protein mRNA, 1.92% exosomes derived from mesenchymal stem cells modified with syntaphilin mRNA, and 91.27% polyethylene glycol. or The composition by weight percentage includes: 1.24% exosomes derived from mesenchymal stem cells modified with miRNA-138-5p, 1.14% exosomes derived from mesenchymal stem cells modified with miRNA-21, 1.00% exosomes derived from mesenchymal stem cells modified with lncGm36569, 1.99% exosomes derived from mesenchymal stem cells modified with SNARE family protein mRNA, 1.94% exosomes derived from mesenchymal stem cells modified with syntaphilin mRNA, and 92.69% polyethylene glycol.

8. A method for preparing the polyethylene glycol composite agent according to any one of claims 1-7, characterized in that, Includes the following steps: The following components were mixed thoroughly according to their mass percentages: polyethylene glycol, mesenchymal stem cell-derived exosomes modified with miRNA-138-5p, mesenchymal stem cell-derived exosomes modified with miRNA-21, mesenchymal stem cell-derived exosomes modified with lncGm36569, mesenchymal stem cell-derived exosomes modified with SNARE family protein mRNA, and mesenchymal stem cell-derived exosomes modified with syntaphilin mRNA.

9. The use of the polyethylene glycol composite agent according to any one of claims 1-7 or the polyethylene glycol composite agent prepared according to the preparation method according to claim 8 in a medicament for treating diseases of nervous system injury; Optionally, the neurological injury can be one or more of spinal cord injury, brain injury, or peripheral nerve injury.

10. The use of the polyethylene glycol composite agent according to any one of claims 1-7 or the polyethylene glycol composite agent prepared according to the preparation method according to claim 8 in a medicament for treating one or more of the following conditions caused by spinal cord injury: rupture of spinal cord neurons or nerve axon membranes, inflammatory response, oxidative stress, ischemia, apoptosis, ferroptosis, and glial scar formation.

11. A treatment regimen for a neurological disorder comprising administering to a subject in need the polyethylene glycol composite of any one of claims 1-7 or the polyethylene glycol composite prepared according to the method of claim 8.

12. The method according to claim 11, wherein the neurological injury is one or more of spinal cord injury, brain injury, or peripheral nerve injury.

13. The method of claim 11, wherein the administration is by local infusion and the dosage is determined according to the size of the spinal cord tissue.

14. The method according to claim 11, wherein the dosage is 2 ml to 10 ml.

15. A method of treating one or more of the following conditions, comprising administering to a subject in need the polyethylene glycol composite of any one of claims 1-7 or the polyethylene glycol composite prepared according to the method of claim 8, wherein the condition is selected from spinal cord neuron or nerve axon membrane rupture, inflammatory response, oxidative stress, ischemia, apoptosis, ferroptosis, and glial scar formation.

Images