Method of estimating the chronological age based on DNA methylation levels in human dental tissue
The method addresses limitations of current DNA methylation-based age estimation by using methylation-sensitive restriction enzymes and qPCR to analyze short amplicons from dental cementum, enabling accurate age estimation in degraded samples with reduced costs and time, suitable for forensic and archaeological applications.
Patent Information
- Application Number
- PCT/IB2025/061072
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-31
- Filing Date
- 2025-10-30
- Publication Date
- 2026-05-07
AI Technical Summary
Current DNA methylation-based age estimation methods are limited by the use of sodium bisulfite, which degrades DNA, require expensive technologies, analyze long genomic regions, and examine multiple CpG sites, making them unsuitable for degraded samples and increasing costs and analysis time.
A method using methylation-sensitive restriction enzymes in combination with quantitative PCR (qPCR) to analyze amplicons not exceeding 200 bp, avoiding sodium bisulfite and relying on dental cementum as a DNA source, with a simplified analysis process accessible to more laboratories.
The method allows for accurate age estimation on degraded DNA samples, reducing costs and analysis time, and is applicable in forensic and archaeological contexts using widely available qPCR technology.
Smart Images

Figure IMGF000006_0001 
Figure IMGF000010_0001 
Figure IMGF000022_0001
Abstract
Description
[0001] Method of estimating the chronological age based on DNA methylation levels in human dental tissue
[0002] DESCRIPTION
[0003] Technical field of the Invention
[0004] The present invention relates to a method for the analysis of DNA methylation , a method for calculating methylation level and a method for estimating the chronological age of a human subject starting from the DNA methylation patterns, as well as the related kits or equipment. The methods are based on the use of methylation-sensitive restriction enzymes combined with quantitative PCR and are also applicable to degraded DNA samples and fragments. These methods are useful for the reconstruction of the biological profile of human remains, such as bone tissues, of unknown identity found in forensic or archaeological contexts.
[0005] State of the art
[0006] Reconstructing the biological profile of an individual of unknown identity is a key objective in forensic science and in various branches of anthropology, such as forensic anthropology, physical anthropology, paleo demography, and evolutionary anthropology. In particular, estimating age and age at death from fresh tissues and ancient remains, respectively, is currently one of the main challenges.
[0007] Over the years, several methods for age estimation have been developed, including both morphological [1 ,2, 3, 4, 5, 6] and molecular techniques [7,8,9,10,1 1 ,12,13,14,15,16,17,18]. Among molecular methods, DNA methylation analysis has emerged as one of the most promising biomarkers [19,20,21 ],
[0008] Epigenetics is the discipline that studies the mechanisms regulating gene expression, including DNA methylation. DNA methylation is a molecular process in which a methyl group is added to the cytosine of a CpG site, a position along the DNA sequence where a cytosine (C) is followed by a guanine (G).
[0009] Recently, the methylation of specific CpGs in the ELOVL2 and FHL2 genes has shown a strong correlation with chronological age, making these loci excellent candidates for DNA methylation-based age estimation. Analysis of the methylation status of selected CpG sites located on these genes has produced highly accurate age estimates in several human tissues [21 ,22,23,24,25,26,27], including dental tissue [24,28,29,30],
[0010] However, the methods proposed so far for measuring DNA methylation suffer from several technical limitations that limit their applicability. Most of the methods present in the literature, for example, rely on the use of sodium bisulfite, a chemical agent capable of converting unmethylated cytosines into uracils [30,31 ,32,33]. Treatment with this substance tends to degrade DNA molecules, therefore, it is not optimal if applied to samples that are already fragmented or damaged, such as those frequently encountered in forensic or archaeological contexts.
[0011] Following sodium bisulfite treatment, many studies quantify the DNA methylation level using expensive methodologies that require technologies available only in specialized molecular laboratories, such as MALDI-TOF mass spectrometry
[0030] and sequencing approaches [24,29]. This substantially limits the applicability of DNA methylation-based age estimation to a small number of laboratories.
[0012] Moreover, some previous studies targeted relatively long genomic regions (amplicons) (>300bp)
[0021] , thereby excluding degraded and fragmented DNA samples / fragments from the analysis.
[0013] Finally, numerous methods examine multiple CpG sites / genes, increasing analysis times and costs [26,30,33].
[0014] Aims of the invention
[0015] The main aim of the present invention is therefore to develop new technical solutions capable of overcoming the drawbacks of the currently used methodologies . Among the new technical solutions for estimating the chronological age based on DNA methylation levels, we propose a method that employs methylation-sensitive restriction enzymes in combination with quantitative PCR (qPCR) to amplify genomic regions, known as amplicons, not exceeding 200 bp in length.
[0016] The method described in the present invention includes a set of measures that make DNA methylation-based age estimation accessible to a greater number of laboratories and applicable also to samples from archaeological and forensic contexts, which are often characterized by highly degraded DNA.
[0017] Specifically, the method according to the present invention:
[0018] • avoids the use of sodium bisulfite, a chemical agent known to damage / degradeDNA;
[0019] • reduces the risk of false-positive signals;
[0020] • decreases amplicon length, a favorable condition for fragmented DNA;
[0021] • decreases the number of CpG sites analyzed, thus reducing analysis time and costs;
[0022] • relies on qPCR, a widely available technology in most molecular biology laboratories, making the analysis more accessible and reducing overall costs;
[0023] • proposes dental cementum, one of the human tissues least susceptible to environmental agents and postmortem degenerative processes, as a source of genomic DNA, extending the applicability of the method to individuals recovered in forensic and archaeologicalcontexts.
[0024] Summary of the Invention
[0025] The aspects of the invention described herein form an integral part of the technical content of the present patent specification. These aspects may be used to limit the claims and / or define additional claims during the duration of the patent property rights.
[0026] While pursuing the search in the field, the applicant has surprisingly and unexpectedly developed and realized, as an object of the present invention:
[0027] A) a method for analyzing the methylation status of human DNA extracted from bone tissue, preferably dental cementum, using qPCR, which comprises: i) subjecting identical DNA aliquots extracted from human biological sample to an enzymatic treatment, ensuring all variables remain equal, respectively:
[0028] • treating a first aliquot with a methylation-sensitive restriction enzyme targeting the CPGELOVL2, CpG (GRCh37 / hg19; chr6: 11 ,044,888) [as identified by the UCSC Human Genome Browser (GRCh37 / hg19)], within the promoter region of the ELOVL2 gene, to obtain the treated aliquot a1 );
[0029] • treating a second aliquot with water to obtain an “untreated” aliquot a2);
[0030] • treating a third aliquot with a methylation-sensitive restriction enzyme targeting the CPGFHL2, CpG (GRCh37 / hg19; chr2: 106,015,754) [as identified by the UCSC Human Genome Browser (GRCh37 / hg19)], within the promoter region of the FHL2 gene, to obtain the treated aliquot b1 );
[0031] • treating a fourth aliquot with a restriction enzyme which is insensitive to methylation of the CPGFHL2, CpG (GRCh37 / hg19; chr2: 106,015,754), within the promoter region of the FHL2 gene, to obtain the treated aliquot b2);
[0032] • treating a fifth aliquot with water to obtain the “untreated” aliquot b3); ii) amplifying all aliquots by qPCR, respectively with:
[0033] 1 . a pair of PELOVL2 primers, designed to amplify a genomic region (amplicon) having a length not greater than 200 bp and encompassing the position chr6: 11,044,888 (GRCh37 / hg19), are used to amplify the aliquots a1 ) and a2) under the same conditions; 2. a pair of PFHL2 primers, designed to amplify a genomic region having a length not greater than 200 bp and encompassing the position chr2: 106,015,754 (GRCh37 / hg19), are used to amplify the aliquots b1 ), b2) and b3) under the same conditions; and wherein the amplification result obtained by qPCR using the ELOVL2 primer pair is compared with the amplification result obtained separately by qPCR using the FHL2 primers pair.
[0034] A further object of the present invention is:
[0035] B) a method for calculating the relative amount of methylated human DNA or the level of human DNA methylation in a sample, i.e. the percentage of methylated DNA molecules relative to the total number of DNA molecules extracted from a human subject is determined, following method A) as described above: said method includes the analysis of the methylation of human DNA extracted from bone tissue, preferably dental cementum, and wherein the calculation of the relative amount of methylated human DNA or the level of DNA methylation comprises determining the methylation level of human DNA at the CPGELOVL2 site and at the CPGFHL2 site, located in the promoter region of the ELOVL2 and of the FHL2 genes respectively, using the formula:
[0036] (A) CpGELOVL2 DNAm = 2 ~ACt- HpyCH4IV=2 -(Ct mean HpyCH4IV - Ct mean NT)
[0037] (B) CpGFHL2 DNAm = 2 ~ Ct_Hpall . 2 -ACt_Mspl=2 -(Ct mean Hpall - Ct mean NT) . 2 -(Ct mean Mspl - Ct mean NT) where CPGELOVL2 DNAm stands for DNA methylation level at the CPGELOVL2 methylation site and CPGFHL2 DNAm stands for DNA methylation level at the CPGFHL2 methylation site, since DNAm stands for DNA methylation; ACt stands for the difference between the mean Ct value obtained from the enzyme-treated DNA and the mean Ct value obtained from the untreated DNA; Ct mean HpyCH4IV stands for the mean Ct value of the HpyCH4IV-treated DNA; Ct mean NT stands for the mean Ct value of the untreated DNA; Ct mean Hpall stands for the mean Ct value of the Hpall- treated DNA; Ct mean Mspl stands for the mean Ct value of the Mspl-treated DNA; Ct indicates the threshold cycle generated by the qPRC.
[0038] A further object of the present invention is:
[0039] C) a method for estimating the chronological age of a human subject by method A): a method of analyzing the methylation of DNA extracted from bone tissue, preferably dental cement, of said subject, as described above, followed by the application of subsequent method B): a method of calculating the relative amount of methylated human DNA or the level of human DNA methylation, as described above, said method of estimating the chronological age of a human subject further comprising calculating the age of said human subject by the formula:
[0040] (C) Age wherein
[0041] Age stands for the calculated age of the human subject,
[0042] Po = -6.70,
[0043] (3i = 95.65,
[0044] P2 = -75.33,
[0045] [33= 253.94,
[0046] [34 = -270.88,
[0047] CpG ELOVL2 stands for methylation level of the CpG site located within the promoter region of the ELOVL2 gene
[0048] CPGFHL2 stands for methylation level of the CpG site located within the promoter region of the FHL2 gene.
[0049] A further object of the present invention is a kit(s) / equipment for the analysis of human DNA methylation / for the calculation of the level of human DNA methylation / for the estimation of the chronological age of a human subject, said kit / equipment comprising:
[0050] - a pair of PELOVL2 primers, designed to amplify a genomic region not exceeding 200 bp, encompassing the CpG site at chr6: 11,044,888 (GRCh37 / hg19), located in the promoter region of ELOVL2 gene,
[0051] - a pair of PFHL2 primers, designed to amplify a genomic region not exceeding 200 bp, encompassing the CpG site at chr2: 106,015,754 (GRCh37 / hg19), located in the promoter region of FHL2 gene;
[0052] In a further preferred embodiment, the kit / assembly for the analysis of human DNA methylation / for the calculation of the level of human DNA methylation / for the estimation of the chronological age of a human subject, according to the present invention, further comprises:
[0053] - a methylation-sensitive restriction enzyme for the CpGELovL2(GRCh37 / hg19; chr6: 11 ,044,888), located in the promoter region of the ELOVL2 gene,
[0054] - a methylation-sensitive restriction enzyme for the CpGFHL2(GRCh37 / hg19; chr2: 106,015,754), located in the promoter region of the FHL2 gene,
[0055] - a methylation-unsensitive restriction enzyme for the CpGFHL2(GRCh37 / hg19; chr2: 106,015,754), located in the promoter region of the FHL2 gene.
[0056] A further object of the present invention is selected from:
[0057] - pair of P ELOVL2 primers:
[0058] • forward-. 5’- ATTTGCAGGTCCAGCCGGC -3’
[0059] • reverse-. 5’- CGCCCTGCACGATACTGCTTC -3’ here also disclosed as SEQ. ID NO: 1 and SEQ. ID NO: 2, respectively, and wherein
[0060] SEQ. ID NO: 1 is:
[0061] Sequence Number (ID): 1
[0062] Length: 19
[0063] Molecule Type: DNA
[0064] Features Location / Qualifiers:
[0065] - source, 1 ..19
[0066] > mol_type, genomic DNA
[0067] > organism, Homo sapiens
[0068] Residues: atttgcaggt ccagccggc 19 and SEQ. ID NO: 2 is:
[0069] Sequence Number (ID): 2
[0070] Length: 21
[0071] Molecule Type: DNA
[0072] Features Location / Qualifiers:
[0073] - source, 1 ..21
[0074] > mol_type, genomic DNA
[0075] > organism, Homo sapiens
[0076] Residues: cgccctgcac gatactgctt c 21
[0077] - pair of di P FHL2 primers:
[0078] • forward-. 5’- GGTCTTGGGAGCACAGTAGTTAT -3’
[0079] • reverse: 5’- CCAGGCCTCGTCCGAAACT -3’ here also disclosed as SEQ. ID NO: 3 and SEQ. ID NO: 4, respectively, and wherein
[0080] SEQ. ID NO: 3 is:
[0081] Sequence Number (ID): 3
[0082] Length: 23
[0083] Molecule Type: DNA Features Location / Qualifiers:
[0084] - source, 1 ..23
[0085] > mol_type, genomic DNA
[0086] > organism, Homo sapiens
[0087] Residues: ggtcttggga gcacagtagt tat 23 and SEQ. ID NO: 4 is:
[0088] Sequence Number (ID): 4
[0089] Length: 19
[0090] Molecule Type: DNA
[0091] Features Location / Qualifiers:
[0092] - source, 1 ..19
[0093] > mol_type, genomic DNA
[0094] > organism, Homo sapiens
[0095] Residues: ccaggcctcg tccgaaact 19
[0096] - nucleotide sequence encompassing the CpG site (GRCh37 / hg19; chr6: 11 ,044,888):
[0097] ATTTGCAGGTCCAGCCGGCGCCGGTTTCGCGCGGCGGCTCAACGTCCA CGGAGCCCCAGGAATACCCACCCGCTGCCCAGATCGGCAGCCGCTGCTGCGG GGAGAAGCAGTATCGTGCAGGGCG, located in the promoter region of the ELOVL2 gene, here also disclosed as SEQ. ID NO: 5, i.e.:
[0098] Sequence Number (ID): 5
[0099] Length: 124
[0100] Molecule Type: DNA
[0101] Features Location / Qualifiers:
[0102] - source, 1 ..124
[0103] > mol_type, genomic DNA
[0104] > organism, Homo sapiens
[0105] Residues: atttgcaggt ccagccggcg ccggtttcgc gcggcggctc aacgtccacg gagccccagg 60 aatacccacc cgctgcccag atcggcagcc gctgctgcgg ggagaagcag tatcgtgcag 120 ggcg 124, wherein the CpG site of interest is the methylated CpG site at cytosine at position 43, and
[0106] - nucleotide sequence encompassing the CpG site (GRCh37 / hg19; chr2: 106,015,754):
[0107] GGTCTTGGGAGCACAGTAGTTATCGGGAGCGTCGCCTCCGGCGTGGGC TCTCGGGCGCGAGTTTCGGACGAGGCCTGG, located in the promoter region of gene FHL2, here also disclosed as SEQ. ID NO: 6, i.e.: Sequence Number (ID): 6 Length: 78 Molecule Type: DNA Features Location / Qualifiers:
[0108] - source, 1 ..78
[0109] > mol_type, genomic DNA
[0110] > organism, Homo sapiens Residues: ggtcttggga gcacagtagt tatcgggagc gtcgcctccg gcgtgggctc tcgggcgcga 60 gtttcggacg aggcctgg 78 wherein the CpG site of interest is the methylated CpG site at cytosine C at position 39.
[0111] Detailed description of the invention and embodiments thereof
[0112] It therefore constitutes an object of the present invention:
[0113] A) Method for analyzing the methylation of human DNA extracted from bone tissue, preferably dental cementum, by qPCR, which comprises: i) subjecting identical DNA aliquots extracted from human bone-like tissue to the same treatment conditions, ensuring all variables remain equal, respectively:
[0114] • treating a first aliquot with a methylation-sensitive restriction enzyme targeting the CPGELOVL2 (GRCh37 / hg19; chr6: 1 1 ,044,888), located within the promoter region of the ELOVL2 gene, to obtain the treated aliquot a1 );
[0115] • treating a second aliquot with water to obtain an “untreated” aliquot a2);
[0116] • treating a third aliquot with a methylation-sensitive restriction enzyme targeting the CPGFHL2 (GRCh37 / hg19; chr2: 106,015,754), located within the promoter region of the FHL2 gene, to obtain the treated aliquot b1 );
[0117] • treating a fourth aliquot with a restriction enzyme which is insensitive to methylation of the CPGFHL2 (GRCh37 / hg19; chr2: 106,015,754), located within the promoter region of the FHL2 gene, to obtain the treated aliquot b2);
[0118] • treating a fifth aliquot with water to obtain the “untreated” aliquot b3) ; ii) amplifying all aliquots by qPCR, respectively with:
[0119] 1 . a pair of PELOVL2 primers, designed to amplify a genomic region not greater than 200 bp, encompassing the chr6: 11,044,888 (GRCh37 / hg19), applied to the aliquots a1 ) and a2) under the same conditions;
[0120] 2. a pair of PFHL2 primers, designed to amplify a genomic region not greater than 200 bp, encompassing the chr2: 106,015,754 (GRCh37 / hg19), applied to the aliquots b1 ), b2) and b3) operating under the same conditions; and comparing the amplification results obtained by qPCR using the ELOVL2 primers pair with those obtained separately by qPCR using the FHL2 primers pair.
[0121] A further object of the present invention is:
[0122] B) a method in which the relative amount of methylated human DNA or the level of human DNA methylation is calculated, i.e. the percentage of methylated DNA molecules compared to the total number of DNA molecules extracted from a human subject is quantified, following method A): a method of analyzing the human DNA methylation extracted from bone tissue, preferably dental cementum, as described above, and included in said method wherein the relative amount of methylated human DNA or the level of methylation of human DNA is calculated, wherein said calculation consists of determining the level of methylation of human DNA at the CPGELOVL2 site and at the CPGFHL2 site in the promoter region of the ELOVL2 gene and in the promoter region of the FHL2 gene, respectively, by means of the formulas: where CPGELOVL2 DNAm stands for DNA methylation level at the CPGELOVL2 methylation site and CPGFHL2 DNAm stands for DNA methylation level at the CPGFHL2 methylation site, since DNAm stands for DNA methylation; ACt stands for the difference between the mean Ct value obtained from the treated DNA and the mean Ct value obtained from the untreated DNA; Ct mean HpyCH4IV stands for the mean Ct value of the HpyCH4IV-treated DNA; Ct mean NT stands for the mean Ct value of the untreated DNA; Ct mean Hpall stands for the mean Ct value of the Hpall-treated DNA; Ct mean Mspl stands for the mean Ct value of the Mspl-treated DNA; Ct indicating the threshold cycle generated by the qPRC. It is a further object of the present invention:
[0123] C) a method for estimating the chronological age of a human subject by method A): a method of analyzing the methylation of DNA extracted from bone tissue, preferably dental cement, of said subject, as described above, followed by the application of subsequent method B): a method of calculating the relative amount of methylated human DNA or the level of methylation of human DNA, as described above, said method of estimating the chronological age of a human subject further comprising calculating the age of said human subject by the formula:
[0124] (C) Age = |3o + |3i CPGELOVL2 + [32 (CPGELOVL2)2+ 3 CpGFHL2 + [34 (CpGFHL2)2wherein
[0125] Age stands for the calculated age of the human subject
[0126] Po = -6.70,
[0127] (3i = 95.65,
[0128] P2 = -75.33,
[0129] [33= 253.94,
[0130] [34 = -270.88 e
[0131] CpG ELOVL2 stands for the methylation level of the CpG site located on the promoter of the ELOVL2 gene
[0132] CPGFHL2 stands for the methylation level of the CpG site located on the promoter of the FHL2 gene.
[0133] As a further object of the present invention, as a further preferred embodiment thereof, is / are the method(s) for analyzing human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject, the following:
[0134] - method for analyzing human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject according to any of the related embodiments according to the present invention, wherein:
[0135] - the methylation-sensitive restriction enzyme that recognizes the CPGELOVL2 site is the HpyCH4lV enzyme, and / or
[0136] - the methylation-sensitive restriction enzyme that recognizes the CPGFHL2 site is the Hpall enzyme, and / or
[0137] - the methylation-insensitive restriction enzyme that recognizes the
[0138] CPGFHL2 site is the Mspl enzyme, and / or - the P ELOVL2 primers are:
[0139] • forward-. 5’- ATTTGCAGGTCCAGCCGGC -3’
[0140] • reverse-. 5’- CGCCCTGCACGATACTGCTTC -3’, here also disclosed as SEQ. ID NO: 1 and SEQ. ID NO: 2, respectively, and wherein SEQ. ID NO: 1 is:
[0141] Sequence Number (ID): 1
[0142] Length: 19
[0143] Molecule Type: DNA
[0144] Features Location / Qualifiers:
[0145] - source, 1 ..19
[0146] > mol_type, genomic DNA
[0147] > organism, Homo sapiens
[0148] Residues: atttgcaggt ccagccggc 19 and SEQ. ID NO: 2 is:
[0149] Sequence Number (ID): 2
[0150] Length: 21
[0151] Molecule Type: DNA
[0152] Features Location / Qualifiers:
[0153] - source, 1 ..21
[0154] > mol_type, genomic DNA
[0155] > organism, Homo sapiens
[0156] Residues: cgccctgcac gatactgctt c 21 and / or
[0157] - the P FHL2 primers are:
[0158] • forward-. 5’- GGTCTTGGGAGCACAGTAGTTAT -3’
[0159] • reverse: 5’- CCAGGCCTCGTCCGAAACT -3’, here also disclosed as SEQ. ID NO: 3 and SEQ. ID NO: 4, respectively, and wherein SEQ. ID NO: 3 is:
[0160] Sequence Number (ID): 3
[0161] Length: 23
[0162] Molecule Type: DNA
[0163] Features Location / Qualifiers: - source, 1 ..23
[0164] > mol_type, genomic DNA
[0165] > organism, Homo sapiens
[0166] Residues: ggtcttggga gcacagtagt tat 23 and SEQ. ID NO: 4 is:
[0167] Sequence Number (ID): 4
[0168] Length: 19
[0169] Molecule Type: DNA
[0170] Features Location / Qualifiers:
[0171] - source, 1 ..19
[0172] > mol_type, genomic DNA
[0173] > organism, Homo sapiens
[0174] Residues: ccaggcctcg tccgaaact 19 and / or
[0175] - genomic region (amplicon), not exceeding 200 bp, comprising said chr6: 11,044,888 (GRCh37 / hg19), located in the promoter of the ELOVL2 gene is the sequence:
[0176] >
[0177] ATTTGCAGGTCCAGCCGGCGCCGGTTTCGCGCGGCGGCTCAACGTCCA
[0178] CGGAGCCCCAGGAATACCCACCCGCTGCCCAGATCGGCAGCCGCTGCTGCGG
[0179] GGAGAAGCAGTATCGTGCAGGGCG, here disclosed as SEQ. ID NO: 5, i.e.:
[0180] Sequence Number (ID): 5
[0181] Length: 124
[0182] Molecule Type: DNA
[0183] Features Location / Qualifiers:
[0184] - source, 1 ..124
[0185] > mol_type, genomic DNA
[0186] > organism, Homo sapiens
[0187] Residues: atttgcaggt ccagccggcg ccggtttcgc gcggcggctc aacgtccacg gagccccagg 60 aatacccacc cgctgcccag atcggcagcc gctgctgcgg ggagaagcag tatcgtgcag 120 ggcg 124, wherein the CpG site of interest is the methylated CpG site at cytosine at position 43, and / or
[0188] - a genomic region (amplicon), not exceeding 200 bp, comprising said chr2: 106,015,754 (GRCh37 / hg19), located in the promoter of the FHL2 gene is the sequence:
[0189] GGTCTTGGGAGCACAGTAGTTATCGGGAGCGTCGCCTCCGGCGTGGGC TCTCGGGCGCGAGTTTCGGACGAGGCCTGG, here also disclosed as SEQ. ID NO: 6, i.e.:
[0190] Sequence Number (ID): 6
[0191] Length: 78
[0192] Molecule Type: DNA
[0193] Features Location / Qualifiers:
[0194] - source, 1 ..78
[0195] > mol_type, genomic DNA
[0196] > organism, Homo sapiens
[0197] Residues: ggtcttggga gcacagtagt tatcgggagc gtcgcctccg gcgtgggctc tcgggcgcga 60 gtttcggacg aggcctgg 78 wherein the CpG site of interest is the methylated CpG site at cytosine C at position 39, and / or
[0198] - bone tissue is preferably dental cementum.
[0199] As a further object of the present invention, and as a further preferred embodiment thereof, the method(s) for analyzing human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject, is the following:
[0200] - method for analyzing human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject according to any of the related embodiments according to the present invention wherein:
[0201] - the P ELOVL2 primers are:
[0202] • forward-. 5’- ATTTGCAGGTCCAGCCGGC -3’
[0203] • reverse-. 5’- CGCCCTGCACGATACTGCTTC -3’; here also disclosed as SEQ. ID NO: 1 and SEQ. ID NO: 2, respectively, and wherein SEQ. ID NO: 1 is: Sequence Number (ID): 1
[0204] Length: 19
[0205] Molecule Type: DNA
[0206] Features Location / Qualifiers:
[0207] - source, 1 ..19
[0208] > mol_type, genomic DNA
[0209] > organism, Homo sapiens
[0210] Residues: atttgcaggt ccagccggc 19 and SEQ. ID NO: 2 is:
[0211] Sequence Number (ID): 2
[0212] Length: 21
[0213] Molecule Type: DNA
[0214] Features Location / Qualifiers:
[0215] - source, 1 ..21
[0216] > mol_type, genomic DNA
[0217] > organism, Homo sapiens
[0218] Residues: cgccctgcac gatactgctt c 21
[0219] - the P FHL2 primers are:
[0220] • forward-. 5’- GGTCTTGGGAGCACAGTAGTTAT -3’;
[0221] • reverse: 5’- CCAGGCCTCGTCCGAAACT -3’; here also disclosed as SEQ. ID NO: 3 and SEQ. ID NO: 4, respectively, and wherein SEQ. ID NO: 3 is:
[0222] Sequence Number (ID): 3
[0223] Length: 23
[0224] Molecule Type: DNA
[0225] Features Location / Qualifiers:
[0226] - source, 1 ..23
[0227] > mol_type, genomic DNA
[0228] > organism, Homo sapiens
[0229] Residues: ggtcttggga gcacagtagt tat 23 and SEQ. ID NO: 4 is: Sequence Number (ID): 4
[0230] Length: 19
[0231] Molecule Type: DNA
[0232] Features Location / Qualifiers:
[0233] - source, 1 ..19
[0234] > mol_type, genomic DNA
[0235] > organism, Homo sapiens
[0236] Residues: ccaggcctcg tccgaaact 19
[0237] - the methylation-sensitive restriction enzyme recognizing CPGELOVL2 site is HpyCH V enzyme;
[0238] - the methylation-sensitive restriction enzyme recognizing CPGFHL2 site is Hpall enzyme;
[0239] - the methylation-unsensitive restriction enzyme recognizing CPGFHL2 site is Mspl enzyme.
[0240] HUMAN DNA METHYLATION ANALYSIS METHOD
[0241] As a further object of the present invention, and as the method A), a method for analyzing the methylation of human DNA extracted from bone tissue, preferably dental cementum, the following further preferred embodiments thereof are provided, such as:
[0242] 1 . Method for analyzing the methylation of human DNA extracted from bone tissue by qPCR, which comprises: i) subjecting identical DNA aliquots extracted from human bone-like tissue to the same treatment conditions, ensuring all variables remain equal, respectively:
[0243] • treating a first aliquot with a methylation-sensitive restriction enzyme targeting the CPGELOVL2 (GRCh37 / hg19; chr6: 1 1 ,044,888), within the promoter region of the ELOVL2 gene, to obtain the treated aliquot a1 );
[0244] • treating a second aliquot with water to obtain an “untreated” aliquot a2);
[0245] • treating a third aliquot with a methylation-sensitive restriction enzyme targeting the CPGFHL2 (GRCh37 / hg19; chr2: 106,015,754), within the promoter region of the FHL2 gene, to obtain the treated aliquot b1 );
[0246] • treating a fourth aliquot with a restriction enzyme which is insensitive to methylation of the CPGFHL2 (GRCh37 / hg19; chr2: 106,015,754), within the promoter region of the FHL2 gene, to obtain the treated aliquot b2);
[0247] • treating a fifth aliquot with water to obtain the “untreated” aliquot b3); ii) amplifying all aliquots by qPCR, respectively with:
[0248] 1 . a pair of PELOVL2 primers, designed to amplify a genomic region not greater than 200 bp, encompassing the chr6: 11,044,888 (GRCh37 / hg19), applied to the aliquots a1 ) and a2) under the same conditions;
[0249] 2. a pair of PFHL2 primers, designed to amplify a genomic region not greater than 200 bp, encompassing the chr2: 106,015,754 (GRCh37 / hg19), applied to the aliquots b1), b2) and b3) operating under the same conditions; and comparing the amplification results obtained by qPCR using the ELOVL2 primers pair with those obtained separately by qPCR using the FHL2 primers pair.
[0250] 2. Method for analyzing the methylation of human DNA extracted from bone tissue, according to the embodiment 1 wherein the methylation-sensitive restriction enzyme recognizing the CPGELOVL2 site is HpyCH4lV.
[0251] 3. Method for analyzing the methylation of human DNA extracted from bone tissue, according to any of the embodiments from 1 to 2 wherein the methylationsensitive restriction enzyme recognizing the CPGFHL2 site is Hpall.
[0252] 4. Method for analyzing the methylation of human DNA extracted from bone tissue, according to any of the embodiments from 1 to 3 wherein the methylation- unsensitive restriction enzyme recognizing the CPGFHL2 site is Mspl.
[0253] 5. Method for analyzing the methylation of human DNA extracted from bone tissue, according to any of the embodiments from 1 to 4 wherein the primers P ELOVL2 are:
[0254] • forward-. 5’- ATTTGCAGGTCCAGCCGGC -3’
[0255] • reverse-. 5’- CGCCCTGCACGATACTGCTTC -3’ here also disclosed as SEQ. ID NO: 1 and SEQ. ID NO: 2, respectively, and wherein SEQ. ID NO: 1 is:
[0256] Sequence Number (ID): 1
[0257] Length: 19
[0258] Molecule Type: DNA
[0259] Features Location / Qualifiers:
[0260] - source, 1 ..19
[0261] > mol_type, genomic DNA
[0262] > organism, Homo sapiens
[0263] Residues: atttgcaggt ccagccggc 19 and SEQ. ID NO: 2 is:
[0264] Sequence Number (ID): 2
[0265] Length: 21
[0266] Molecule Type: DNA
[0267] Features Location / Qualifiers:
[0268] - source, 1 ..21
[0269] > mol_type, genomic DNA
[0270] > organism, Homo sapiens
[0271] Residues: cgccctgcac gatactgctt c 21
[0272] 6. Method for analyzing the methylation of human DNA extracted from bone tissue, according to any of the embodiments from 1 to 5 therein the primers P FHL2 are:
[0273] • forward-. 5’- GGTCTTGGGAGCACAGTAGTTAT -3’
[0274] • reverse: 5’- CCAGGCCTCGTCCGAAACT -3’ here also disclosed as SEQ. ID NO: 3 and SEQ. ID NO: 4, respectively, and wherein SEQ. ID NO: 3 is:
[0275] Sequence Number (ID): 3
[0276] Length: 23
[0277] Molecule Type: DNA
[0278] Features Location / Qualifiers:
[0279] - source, 1 ..23
[0280] > mol_type, genomic DNA
[0281] > organism, Homo sapiens
[0282] Residues: ggtcttggga gcacagtagt tat 23 and SEQ. ID NO: 4 is:
[0283] Sequence Number (ID): 4
[0284] Length: 19
[0285] Molecule Type: DNA
[0286] Features Location / Qualifiers:
[0287] - source, 1 ..19
[0288] > mol_type, genomic DNA
[0289] > organism, Homo sapiens
[0290] Residues: ccaggcctcg tccgaaact 19.
[0291] 7. Method for analyzing the methylation of human DNA extracted from bone tissue, according to any of the embodiments from 1 to 6 wherein a genomic region (amplicon), not exceeding 200 bp, comprising chr6: 11,044,888 (GRCh37 / hg19), located in the promoter of the ELOVL2 gene is the nucleotide sequence:
[0292] ATTTGCAGGTCCAGCCGGCGCCGGTTTCGCGCGGCGGCTCAACGTCCA CGGAGCCCCAGGAATACCCACCCGCTGCCCAGATCGGCAGCCGCTGCTGCGG GGAGAAGCAGTATCGTGCAGGGCG here also disclosed as SEQ. ID NO: 5, i.e.:
[0293] Sequence Number (ID): 5
[0294] Length: 124
[0295] Molecule Type: DNA
[0296] Features Location / Qualifiers:
[0297] - source, 1 ..124
[0298] > mol_type, genomic DNA
[0299] > organism, Homo sapiens
[0300] Residues: atttgcaggt ccagccggcg ccggtttcgc gcggcggctc aacgtccacg gagccccagg 60 aatacccacc cgctgcccag atcggcagcc gctgctgcgg ggagaagcag tatcgtgcag 120 ggcg 124, wherein the CpG site of interest is the methylated CpG site at cytosine C at position 43.
[0301] 8. Method for analyzing the methylation of human DNA extracted from bone tissue, according to any of the embodiments from 1 to 7 wherein a genomic region (amplicon), not exceeding 200 bp, comprising chr2: 106,015,754 (GRCh37 / hg19), located in the promoter of the FHL2 gene is the nucleotide sequence:
[0302] GGTCTTGGGAGCACAGTAGTTATCGGGAGCGTCGCCTCCGGCGTGGGC TCTCGGGCGCGAGTTTCGGACGAGGCCTGG here also disclosed as SEQ. ID NO: 6, i.e.:
[0303] Sequence Number (ID): 6
[0304] Length: 78
[0305] Molecule Type: DNA
[0306] Features Location / Qualifiers:
[0307] - source, 1 ..78 > mol_type, genomic DNA
[0308] > organism, Homo sapiens
[0309] Residues: ggtcttggga gcacagtagt tatcgggagc gtcgcctccg gcgtgggctc tcgggcgcga 60 gtttcggacg aggcctgg 78 where the CpG site of interest is the methylated CpG site at cytosine C at position 39.
[0310] 9. Method for analyzing the methylation of human DNA extracted from bone tissue, according to any of the embodiments from 1 to 8 wherein the bone tissue is preferably dental cementum.
[0311] METHOD FOR CALCULATING THE LEVEL OF HUMAN DNA METHYLATION
[0312] As a further object, according to the present invention, of the method B): a method for calculating the methylation level of human DNA extracted from bone tissue, preferably dental cementum, comprising method A) of DNA methylation analysis by qPCR, are the further following preferred embodiments thereof, such as:
[0313] 1 . A method for calculating the methylation level of human DNA extracted from bone tissue, this method comprising: i) subjecting identical DNA aliquots extracted from human bone-like tissue to the same treatment conditions, ensuring all variables remain equal, respectively:
[0314] • treating a first aliquot with a methylation-sensitive restriction enzyme HpyCH V targeting the CPGELOVL2, CpG (GRCh37 / hg19; chr6: 1 1 ,044,888), within the promoter region of the ELOVL2 gene, to give the treated aliquot a1 );
[0315] • treating a second aliquot with water to obtain an “untreated” aliquot a2);
[0316] • treating a third aliquot with a methylation-sensitive restriction enzyme Hpall targeting CPGFHL2, CpG (GRCh37 / hg19; chr2: 106,015,754), within the promoter region of the FHL2 gene, to obtain the treated aliquot b1 );
[0317] • treating a fourth aliquot with a restriction enzyme Mspl which is insensitive to methylation of the CPGFHL2, CpG (GRCh37 / hg19; chr2: 106,015,754), within the promoter region of the FHL2 gene, to obtain the treated aliquot b2);
[0318] • treating a fifth aliquot with water to obtain the “untreated” aliquot b3); ii) amplifying all aliquots by qPCR, respectively with:
[0319] 1 . a pair of PELOVL2 primers, designed to amplify a genomic region (amplicon) not greater than 200 bp, encompassing the GRCh37 / hg19; chr6: 11,044,888, which are: forward: 5’- ATTTGCAGGTCCAGCCGGC -3’ reverse: 5’- CGCCCTGCACGATACTGCTTC -3’ herein also disclosed as SEQ. ID NO: 1 and SEQ. ID NO: 2, respectively, and wherein SEQ. ID NO: 1 is:
[0320] Sequence Number (ID): 1
[0321] Length: 19
[0322] Molecule Type: DNA
[0323] Features Location / Qualifiers:
[0324] - source, 1 ..19
[0325] > mol_type, genomic DNA
[0326] > organism, Homo sapiens
[0327] Residues: atttgcaggt ccagccggc 19 and SEQ. ID NO: 2 is:
[0328] Sequence Number (ID): 2
[0329] Length: 21
[0330] Molecule Type: DNA
[0331] Features Location / Qualifiers:
[0332] - source, 1 ..21
[0333] > mol_type, genomic DNA
[0334] > organism, Homo sapiens
[0335] Residues: cgccctgcac gatactgctt c 21 applied to the aliquots a1 ) and a2) under the same conditions;
[0336] 2. a pair of PFHL2 primers, designed to amplify a genomic region (amplicon) not greater than 200 bp, encompassing the GRCh37 / hg19; chr2: 106,015,754, which are: forward: 5’- GGTCTTGGGAGCACAGTAGTTAT -3’
[0337] • reverse: 5’- CCAGGCCTCGTCCGAAACT -3’ herein also disclosed as SEQ. ID NO: 3 and SEQ. ID NO: 4, respectively, and wherein SEQ. ID NO: 3 is:
[0338] Sequence Number (ID): 3 Length: 23
[0339] Molecule Type: DNA
[0340] Features Location / Qualifiers:
[0341] - source, 1 ..23
[0342] > mol_type, genomic DNA
[0343] > organism, Homo sapiens
[0344] Residues: ggtcttggga gcacagtagt tat 23 and SEQ. ID NO: 4 is:
[0345] Sequence Number (ID): 4
[0346] Length: 19
[0347] Molecule Type: DNA
[0348] Features Location / Qualifiers:
[0349] - source, 1 ..19
[0350] > mol_type, genomic DNA
[0351] > organism, Homo sapiens
[0352] Residues: ccaggcctcg tccgaaact 19 applied to the aliquots b1 ), b2) and b3) operating under the same conditions;
[0353] - comparing the amplification results obtained by qPCR using the ELOVL2 primers pair with those obtained separately by qPCR using the FHL2 primers pair;
[0354] - calculating the relative amount of methylated human DNA or the level of human DNA methylation, i.e., quantify the percentage of methylated DNA molecules with respect to the total number of DNA molecules extracted from the human subject, wherein said calculation consists in determining the level of DNA methylation at the CpG ELOVL2 site and at the CPGFHL2 site in the promoter region of the ELOVL2 gene and in the promoter region of the FHL2 gene, respectively, by means of the formulas: Mspl - Ct mean NT) where CPGELOVL2 DNAm stands for DNA methylation level at the CPGELOVL2 methylation site and CPGFHL2 DNAm stands for DNA methylation level at the CPGFHL2 methylation site since DNAm stands for DNA methylation; ACt stands for the difference between the mean Ct value obtained from the treated DNA and the mean Ct value obtained from the untreated DNA; Ct mean HpyCH4IV stands for the mean Ct value of the HpyCH4IV-treated DNA; Ct mean NT stands for the mean Ct value of the untreated DNA; Ct mean Hpall stands for the mean Ct value of the Hpall-treated DNA; Ct mean Mspl stands for the mean Ct value of the Mspl-treated DNA; Ct indicating the threshold cycle generated by the qPRC.
[0355] 2. Method for calculating the methylation level of human DNA extracted from bone tissue, according to the embodiment 1 wherein the genomic region (amplicon), not exceeding 200 bp, comprising GRCh37 / hg19; chr6: 11,044,888, located in the promoter of the ELOVL2 gene is the nucleotide sequence:
[0356] ATTTGCAGGTCCAGCCGGCGCCGGTTTCGCGCGGCGGCTCAACGTCCA CGGAGCCCCAGGAATACCCACCCGCTGCCCAGATCGGCAGCCGCTGCTGCGG GGAGAAGCAGTATCGTGCAGGGCG herein also indicated as SEQ. ID NO: 5, i.e.:
[0357] Sequence Number (ID): 5
[0358] Length: 124
[0359] Molecule Type: DNA
[0360] Features Location / Qualifiers:
[0361] - source, 1 ..124
[0362] > mol_type, genomic DNA
[0363] > organism, Homo sapiens
[0364] Residues: atttgcaggt ccagccggcg ccggtttcgc gcggcggctc aacgtccacg gagccccagg 60 aatacccacc cgctgcccag atcggcagcc gctgctgcgg ggagaagcag tatcgtgcag 120 ggcg 124, where the CpG site of interest is the methylated CpG site at cytosine C at position 43.
[0365] 3. Method for calculating the methylation level of human DNA extracted from bone tissue, according to any of the embodiment from 1 to 2 wherein the genomic region (amplicon), not exceeding 200 bp, comprising GRCh37 / hg19; chr2: 106,015,754, located in the promoter of the FHL2 gene is the nucleotide sequence:
[0366] GGTCTTGGGAGCACAGTAGTTATCGGGAGCGTCGCCTCCGGCGTGGGC TCTCGGGCGCGAGTTTCGGACGAGGCCTGG also referred to here as SEQ. ID NO: 6, i.e.:
[0367] Sequence Number (ID): 6 Length: 78
[0368] Molecule Type: DNA
[0369] Features Location / Qualifiers:
[0370] - source, 1 ..78
[0371] > mol_type, genomic DNA
[0372] > organism, Homo sapiens
[0373] Residues: ggtcttggga gcacagtagt tatcgggagc gtcgcctccg gcgtgggctc tcgggcgcga 60 gtttcggacg aggcctgg 78 wherein the CpG site of interest is the methylated CpG site at cytosine C at position 39.
[0374] 4. Method for calculating the methylation level of human DNA extracted from bone tissue, according to any of the embodiment from 1 to 3 wherein the bone tissue is preferably dental cementum.
[0375] METHOD FOR ESTIMATION OF THE CHRONOLOGICAL AGE OF A HUMAN SUBJECT BY ANALYSIS OF THE DNA METHYLATION OF THE SUBJECT
[0376] As a further object, according to the present invention, of the method C): Method of estimating the chronologic age of a human the analysis of the methylation of DNA extracted from bone tissue, preferably dental cementum, of said subject, including method A) of DNA methylation analysis by qPCR, and the subsequent calculation of the relative amount of methylated human DNA or the level of human DNA methylation, are the further following preferred embodiments thereof, such as:
[0377] 1 . Method for estimating the chronological age of a human subject, by analyzing the methylation of DNA extracted from bone tissue of said subject, and the consequent calculation of the relative quantity of methylated human DNA or the level of methylation of human DNA, said method for estimating the chronological age of a human subject comprising: i) subjecting identical DNA aliquots extracted from human bone-like tissue to the same treatment conditions, ensuring all variables remain equal, respectively:
[0378] • treating a first aliquot with a methylation-sensitive restriction enzyme HpyCH V targeting the CPGELOVL2 (GRCh37 / hg19; chr6: 1 1 ,044,888), within the promoter region of the ELOVL2 gene, to obtain the treated aliquot a1 );
[0379] • treating a second aliquot with water to obtain an “untreated” aliquot a2);
[0380] • treating a third aliquot with a methylation-sensitive restriction enzyme Hpall targeting the CPGFHL2 (GRCh37 / hg19; chr2: 106,015,754), within the promoter region of the FHL2 gene, to obtain the treated aliquot b1 );
[0381] • treating a fourth aliquot with a restriction enzyme Mspl which is insensitive to methylation of the CPGFHL2 (GRCh37 / hg19; chr2: 106,015,754), within the promoter region of the FHL2 gene, to obtain the treated aliquot b2);
[0382] • treating a fifth aliquot with water to obtain the “untreated” aliquot b3); ii) amplifying all aliquots by qPCR, respectively with:
[0383] 1 . a pair of primers PELOVL2, designed to amplify a genomic region (amplicon) not greater than 200 bp, encompassing the GRCh37 / hg19; chr6: 11,044,888, which are forward: 5’- ATTTGCAGGTCCAGCCGGC -3’ reverse: 5’- CGCCCTGCACGATACTGCTTC -3’ also referred to here as SEQ. ID NO: 1 and SEQ. ID NO: 2, respectively, and wherein SEQ. ID NO: 1 is:
[0384] Sequence Number (ID): 1
[0385] Length: 19
[0386] Molecule Type: DNA
[0387] Features Location / Qualifiers:
[0388] - source [sorgente], 1 ..19
[0389] > mol_type, genomic DNA
[0390] > organism, Homo sapiens
[0391] Residues: atttgcaggt ccagccggc 19 and SEQ. ID NO: 2 is:
[0392] Sequence Number (ID): 2
[0393] Length: 21
[0394] Molecule Type: DNA
[0395] Features Location / Qualifiers:
[0396] - source, 1 ..21
[0397] > mol_type, genomic DNA
[0398] > organism, Homo sapiens
[0399] Residues: cgccctgcac gatactgctt c 21 applied to the aliquots a1 ) and a2) under the same conditions; 2. a pairs of primers PFHL2, designed to amplify a genomic region (amplicon) not greater than 200 bp, encompassing the GRCh37 / hg19; chr2: 106,015,754, which are: forward: 5’- GGTCTTGGGAGCACAGTAGTTAT -3’
[0400] • reverse: 5’- CCAGGCCTCGTCCGAAACT -3’ also referred to here as SEQ. ID NO: 3 and SEQ. ID NO: 4, respectively, and wherein SEQ. ID NO: 3 is:
[0401] Sequence Number (ID): 3
[0402] Length: 23
[0403] Molecule Type: DNA
[0404] Features Location / Qualifiers:
[0405] - source, 1 ..23
[0406] > mol_type, genomic DNA
[0407] > organism, Homo sapiens
[0408] Residues: ggtcttggga gcacagtagt tat 23 and SEQ. ID NO: 4 is:
[0409] Sequence Number (ID): 4
[0410] Length: 19
[0411] Molecule Type: DNA
[0412] Features Location / Qualifiers:
[0413] - source, 1 ..19
[0414] > mol_type, genomic DNA
[0415] > organism, Homo sapiens
[0416] Residues: ccaggcctcg tccgaaact 19 applied to the aliquots b1 ), b2) and b3) operating under the same conditions;
[0417] - compare the results of qPCR amplification in the presence of the ELOVL2 primers pair and, separately, those of qPCR in the presence of the FHL2 primers pair;
[0418] - calculate the relative amount of methylated human DNA or the level of human DNA methylation, i.e., quantify the percentage of methylated DNA molecules compared to the total number of DNA molecules extracted from the human subject, wherein said calculation consists in determining the level of DNA methylation at the CpG ELOVL2 site and at the CPGFHL2 site in the promoter region of the ELOVL2 gene and in the promoter region of the FHL2 gene, respectively, by means of the formulas:
[0419] (A) CpGELOVL2 DNAm = 2 ~ACt- HpyCH4IV= 2-(ct mean HpyCH4IV - Ct mean NT) wherein CPGELOVL2 DNAm stands for DNA methylation level at the CPGELOVL2 methylation site and CPGFHL2 DNAm stands for DNA methylation level at the CPGFHL2 methylation site since DNAm stands for DNA methylation; ACt stands for the difference between the mean Ct value obtained from the treated DNA and the mean Ct value obtained from the untreated DNA; Ct mean HpyCH4IV stands for the mean Ct value of the HpyCH4IV-treated DNA; Ct mean NT stands for the mean Ct value of the untreated DNA; Ct mean Hpall stands for the mean Ct value of the Hpall-treated DNA; Ct mean Mspl stands for the mean Ct value of the Mspl-treated DNA; Ct indicating the threshold cycle generated by the qPRC;
[0420] - calculating the age of said human subject by the formula:
[0421] (C) Age
[0422] Wherein
[0423] Age stands for the calculated age of the human subject;
[0424] Po = -6.70,
[0425] (3i = 95.65,
[0426] P2 = -75.33,
[0427] [33= 253.94,
[0428] [34 = -270.88;
[0429] CpG ELOVL2 stands for methylation level of the CpG site located within the promoter region of the ELOVL2 gene; CPGFHL2 stands for methylation level of the CpG site located within the promoter region of the FHL2 gene.
[0430] 2. Method for estimating the chronological age of a human subject, according to the embodiment 1 wherein a genomic region (amplicon) not exceeding 200 bp, encompassing the chr6: 11,044,888 (GRCh37 / hg19), located in the promoter region of ELOVL2 gene is the nucleotide sequence:
[0431] ATTTGCAGGTCCAGCCGGCGCCGGTTTCGCGCGGCGGCTCAACGTCCA CGGAGCCCCAGGAATACCCACCCGCTGCCCAGATCGGCAGCCGCTGCTGCGG GGAGAAGCAGTATCGTGCAGGGCG also referred to here as SEQ. ID NO: 5, i.e.:
[0432] Sequence Number (ID): 5 Length: 124
[0433] Molecule Type: DNA
[0434] Features Location / Qualifiers:
[0435] - source, 1 ..124
[0436] > mol_type, genomic DNA
[0437] > organism, Homo sapiens
[0438] Residues: atttgcaggt ccagccggcg ccggtttcgc gcggcggctc aacgtccacg gagccccagg 60 aatacccacc cgctgcccag atcggcagcc gctgctgcgg ggagaagcag tatcgtgcag 120 ggcg 124, wherein the CpG site of interest is the methylated CpG site at cytosine C at position 43.
[0439] 3. Method for estimating the chronological age of a human subject, according to any of the embodiments from 1 to 2 wherein the genomic region (amplicon), not exceeding 200 bp, comprising GRCh37 / hg19; chr2: 106,015,754, located in the promoter region of FHL2 gene is the nucleotide sequence:
[0440] GGTCTTGGGAGCACAGTAGTTATCGGGAGCGTCGCCTCCGGCGTGGGC TCTCGGGCGCGAGTTTCGGACGAGGCCTGG also referred to here as SEQ. ID NO: 6, i.e.:
[0441] Sequence Number (ID): 6
[0442] Length: 78
[0443] Molecule Type: DNA
[0444] Features Location / Qualifiers:
[0445] - source, 1 ..78
[0446] > mol_type, genomic DNA
[0447] > organism, Homo sapiens
[0448] Residues: ggtcttggga gcacagtagt tatcgggagc gtcgcctccg gcgtgggctc tcgggcgcga 60 gtttcggacg aggcctgg 78 wherein the CpG site of interest is the methylated CpG site at cytosine C at position 39.
[0449] 4. Method for estimating the chronological age of a human subject, according to the any of the embodiments from 1 to 3 wherein the bone tissue is preferably dental cementum. KIT / EQUIPMENT
[0450] It is a further object of the present invention to provide a kit / assembly for analyzing human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject, said kit / assembly comprising:
[0451] - a pair of PELOVL2 primers, design to amplify a genomic region not exceeding 200 bp, encompassing the CpG site at chr6: 11,044,888 (GRCh37 / hg19), located in the promoter region of ELOVL2 gene,
[0452] - a pair of PFHL2 primers, design to amplify a genomic region not exceeding 200 bp, encompassing the CpG site at chr2: 106,015,754 (GRCh37 / hg19), located in the promoter region of FHL2 gene.
[0453] In a further preferred embodiment of the kit / assembly for analyzing human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject, according to the present invention, said kit / assembly further comprises:
[0454] - a methylation-sensitive restriction enzyme for the CpGELovL2(GRCh37 / hg19; chr6: 11 ,044,888), located in the promoter region of the ELOVL2 gene,
[0455] - a methylation-sensitive restriction enzyme for the CpGFHL2(GRCh37 / hg19; chr2: 106,015,754), located in the promoter region of the FHL2 gene,
[0456] - a methylation-unsensitive restriction enzyme for the CpGFHL2(GRCh37 / hg19; chr2: 106,015,754), located in the promoter region of the FHL2 gene.
[0457] As a further object of the present invention, and as a preferred embodiments thereof, the kit / assembly for analyzing the human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human being, are the following:
[0458] - kit / assembly for analyzing human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject according to any of the preferred embodiments according to the present invention, wherein the P ELOVL2 primers are:
[0459] • forward-. 5’- ATTTGCAGGTCCAGCCGGC -3’
[0460] • reverse-. 5’- CGCCCTGCACGATACTGCTTC -3’; also referred to here as SEQ. ID NO: 1 and SEQ. ID NO: 2, respectively, and wherein SEQ. ID NO: 1 is:
[0461] Sequence Number (ID): 1
[0462] Length: 19 Molecule Type: DNA Features Location / Qualifiers:
[0463] - source, 1 ..19
[0464] > mol_type, genomic DNA
[0465] > organism, Homo sapiens Residues: atttgcaggt ccagccggc 19 and SEQ. ID NO: 2 is: Sequence Number (ID): 2 Length: 21 Molecule Type: DNA Features Location / Qualifiers:
[0466] - source, 1 ..21
[0467] > mol_type, genomic DNA
[0468] > organism, Homo sapiens Residues: cgccctgcac gatactgctt c 21
[0469] - kit / assembly for analyzing human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject according to any of the preferred embodiments according to the present invention, wherein the P FHL2 primers are:
[0470] • forward-. 5’- GGTCTTGGGAGCACAGTAGTTAT -3’
[0471] • reverse: 5’- CCAGGCCTCGTCCGAAACT -3’; also referred to here as SEQ. ID NO: 3 and SEQ. ID NO: 4, respectively, and wherein SEQ. ID NO: 3 is: Sequence Number (ID): 3 Length: 23
[0472] Molecule Type: DNA Features Location / Qualifiers:
[0473] - source, 1 ..23
[0474] > mol_type, genomic DNA
[0475] > organism, Homo sapiens
[0476] Residues: ggtcttggga gcacagtagt tat 23 and SEQ. ID NO: 4 is:
[0477] Sequence Number (ID): 4
[0478] Length: 19
[0479] Molecule Type: DNA
[0480] Features Location / Qualifiers:
[0481] - source, 1 ..19
[0482] > mol_type, genomic DNA
[0483] > organism, Homo sapiens Residues: ccaggcctcg tccgaaact 19
[0484] - kit / assembly for analyzing human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject according to any of the preferred embodiments according to the present invention, wherein the methylation-sensitive restriction enzyme recognizing the CPGELOVL2 site is HpyCH V;
[0485] - kit / assembly for analyzing the human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject according to any of the preferred embodiments according to the present invention, wherein the methylation-sensitive restriction enzyme recognizing the CPGFHL2 site is Hpall;
[0486] - kit / assembly for analyzing human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject according to any of the corresponding preferred embodiments according to the present invention, wherein the methylation-unsensitive restriction enzyme recognizing CPGFHL2 site is Mspl.
[0487] As a further object, according to the present invention, as a further preferred embodiment thereof, of the kit / assembly for analyzing human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject, is the following:
[0488] - kit / assembly for analyzing human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject according to any of the corresponding preferred embodiments according to the present invention, wherein:
[0489] - the primers P ELOVL2 are: • forward-. 5’- ATTTGCAGGTCCAGCCGGC -3’
[0490] • reverse-. 5’- CGCCCTGCACGATACTGCTTC -3’;
[0491] - the primers P FHL2 are:
[0492] • forward-. 5’- GGTCTTGGGAGCACAGTAGTTAT -3’;
[0493] • reverse: 5’- CCAGGCCTCGTCCGAAACT -3’;
[0494] - the methylation-sensitive restriction enzyme that recognizes the CPGELOVL2 site is HpyCH4IV;
[0495] - the methylation-sensitive restriction enzyme that recognizes the CPGFHL2 site is Hpall;
[0496] - the methylation-insensitive restriction enzyme that recognizes the CPGFHL2 site is Mspl.
[0497] A further object of the present invention is a kit / equipment for the analysis of human DNA methylation, according to any of its embodiments described above, said kit / equipment also comprising the instructions for implementing the method for the analysis of human DNA methylation according to the present invention.
[0498] A further object of the present invention is a kit / equipment for calculating the level of methylation of human DNA, according to any of its embodiments described above, said kit / equipment also comprising instructions for implementing the method for calculating the level of methylation of human DNA according to the present invention.
[0499] A further object of the present invention is a kit / equipment for estimating the chronological age of a human subject, according to any of its embodiments described above, said kit / equipment also comprising instructions for implementing the method for estimating the chronological age of a human subject according to the present invention.
[0500] For the purposes of this invention, the methylation levels of human DNA of two CpG sites located within the promoters of the ELOVL2 and FHL2 genes were analyzed and measured in 61 samples of dental cementum collected from as many subjects, with age ranging from 17 to 94 years. Dental cementum is one of the human tissues most resistant to environmental stress and post-mortem transformation phenomena, and for the purposes of analysis and measurement of methylation levels, a technique based on methylation-sensitive restriction enzymes and quantitative PCR (qPCR) was used, selectively amplifying amplicons not exceeding 200 bp, preferably not exceeding 150 bp, more preferably not exceeding 130 bp, for example around approximately 100 bp. Subsequently, a mathematical model, implemented as a multiple quadratic regression formula, was developed to predict chronological age, i.e., to estimate the age of an individual based on the methylation levels of the CPGELOVL2 and CPGFHL2 sites simultaneously.
[0501] The computational model reported an error (median of the absolute value of the model residuals) of 4.65 years between the chronological age and the predicted age. Furthermore, the predictive performance of the model was consistent across all age groups, allowing it to be applied to individuals belonging to different age groups.
[0502] In order to evaluate DNA methylation level , two genomic regions were identified and amplified: one located in the promoter of the ELOVL2 gene (GRCh37 / hg19; chr6:1 1 ,044,846 - 1 1 ,044,969) 124bp long and one located in the promoter of the FHL2 gene (GRCh37 / hg19; chr2:106,015,716 - 106,015,793) 78bp long.
[0503] Specifically, the amplicon:
[0504] • Sequence ELOVL2 (GRCh37 / hg19; chr6:1 1 ,044,846 - 1 1 ,044,969) - 124bp
[0505] ATTTGCAGGTCCAGCCGGCGCCGGTTTCGCGCGGCGGCTCAACGTCCA CGGAGCCCCAGGAATACCCACCCGCTGCCCAGATCGGCAGCCGCTGCTGCGG GGAGAAGCAGTATCGTGCAGGGCG, also referred to here as SEQ. ID NO: 5, i.e.: Sequence Number (ID): 5 Length: 124
[0506] Molecule Type: DNA
[0507] Features Location / Qualifiers:
[0508] - source, 1 ..124
[0509] > mol_type, genomic DNA
[0510] > organism, Homo sapiens
[0511] Residues: atttgcaggt ccagccggcg ccggtttcgc gcggcggctc aacgtccacg gagccccagg 60 aatacccacc cgctgcccag atcggcagcc gctgctgcgg ggagaagcag tatcgtgcag 120 ggcg 124, wherein the CpG site of interest is the methylated CpG site at cytosine C at position 43, and
[0512] • Sequence FHL2 (GRCh37 / hg19; chr2:106,015,716 - 106,015,793) - 78bp
[0513] GGTCTTGGGAGCACAGTAGTTATCGGGAGCGTCGCCTCCGGCGTGGGC TCTCGGGCGCGAGTTTCGGACGAGGCCTGG, also referred to here as SEQ. ID NO: 6, i.e.:
[0514] Sequence Number (ID): 6
[0515] Length: 78
[0516] Molecule Type: DNA
[0517] Features Location / Qualifiers:
[0518] - source, 1 ..78
[0519] > mol_type, genomic DNA
[0520] > organism, Homo sapiens
[0521] Residues: ggtcttggga gcacagtagt tatcgggagc gtcgcctccg gcgtgggctc tcgggcgcga 60 gtttcggacg aggcctgg 78 wherein the CpG site of interest is the methylated CpG site at cytosine C at position 39.
[0522] These regions were chosen to include the CPGELOVL2 (GRCh37 / hg19; chr6: 11 ,044,888) and CPGFHL2 (GRCh37 / hg19; chr2: 106,015,754) sites, which were the CpG sites that best correlated with age in dental cementum in a previous study
[0030] .
[0523] To determine the level of DNA methylation at the two CpG sites, a method based on Methylation-Sensitive Restriction Enzymes (MSREs) in combination with quantitative PCR (qPCR) was used. Briefly, when the CpG sites were unmethylated, the enzymes recognized and dived the DNA, preventing amplification during qPCR. Conversely, if the CpG sites were methylated, the enzymes were unable to cleave the DNA, and consequently, the sequence was amplified in its entirety.
[0524] For the purposes of this invention, 61 human teeth from living individuals, aged between 17 and 94 years, were analyzed.
[0525] Initially, the teeth were cut under a chemical fume hood to separate the three dental tissues (cementum, dentin, and pulp). Specifically, the cementum was scraped from the tooth root using a scalpel.
[0526] DNA was extracted from the cementum using the QIAamp DNA Mini kit (Qiagen), as follows:
[0527] • Incubate the sample in 1 mL of EDTA for 48 hours in a rotor at 37°C
[0528] • Centrifuge for 3 minutes at 14,000 rpm and discard the supernatant
[0529] • Perform wash steps: add 1 mL of water to the sample, centrifuge for 3 minutes at 14,000 rpm and discard the supernatant (repeat 5 times)
[0530] • Add 360 pL of ATL and 20 pL of Proteinase K to perform cell lysis and protein digestion, respectively
[0531] • Incubate at 56°C for 24 hours
[0532] • Add 300 pL of AL, mix for 10 seconds and incubate at 70°C for 10 minutes
[0533] • Add 200 pL of 100% ethanol, shake for 15 seconds and Centrifuge for 4 seconds at 8000 rpm to precipitate the DNA.
[0534] • Transfer the mixture to the column provided with the kit and centrifuge for 1 minute at 8000 g.
[0535] • Replace the collection tube, add 500 pL of AW1 , and centrifuge for 1 minute at 8000 g.
[0536] • Replace the collection tube again, add 500 pL of AW2, and centrifuge for 3 minutes at 14000 g.
[0537] • Replace the collection tube and, leaving the cap open, centrifuge for 1 minute at 14000 g.
[0538] • Incubate for 10 minutes at room temperature.
[0539] • Elute the DNA twice in 50 pL of water. Incubate at room temperature for 5 minutes and centrifuge for 1 minute at 8000 rpm.
[0540] Following extraction, DNA was quantified using the Qubit fluorimeter (dsDNA HS Assay Kit). Subsequently, the DNA samples were diluted in H2O and normalized to a concentration of 20ng of total DNA in a final volume of 5pL.
[0541] By acting on identical DNA aliquots, and operating under equal conditions, the enzyme HpyCH4IV (10U / pL) was selected to measure the methylation level of CpG ELOVL2, which recognizes the 5'-A / CGT-3' cutting site (ELOVL2) and works optimally at 37°C in the rCutSmart Buffer (10X.
[0542] Specifically, the enzymatic treatment was performed in triplicate as follows: for each sample, 5pL of DNA (4ng / pL) were treated with 3.3pL of a solution composed of 2.5pL of HpyCH4IV (0.8U / pL) and 0.8pL of rCutSmart (10X). Similarly, the DNA was also treated with H2O, in order to obtain untreated samples. Subsequently, the samples were incubated in a thermocycler according to the following thermal cycle: 37°C for 12h, 65°C for 20 min, 4°C for an indefinite time.
[0543] Similarly, to measure the methylation level of CPGFHL2, the enzymes Hpall (10U / pL) and Mspl (10U / pL) were selected.
[0544] Mspl is a methylation-insensitive isoschizomer of Hpall and is therefore used as a control for enzymatic digestion. Hpall and Mspl recognize the 5'-C / CGG-3' cleavage site (FHL2) and function optimally at 37°C in Tango Buffer (10X). The enzymatic treatment was performed in triplicate as follows: for each sample, 5pL of DNA (4ng / pL) were treated with 3.3pL of a solution composed of 2.5pL of Hpall and Mspl (0.8U / pL), respectively, and 0.8pL of Tango (10X).
[0545] Similarly, DNA was also treated with H2O. Subsequently, the samples were incubated according to the following thermal cycle: 37°C for 12 hours, 65°C (Hpall) / 80°C (Mspl) for 20 min, 4°C indefinitely.
[0546] Subsequently, qPCR was used to quantify the level of DNA methylation. Specifically, qPCR was performed in triplicate in a final volume of 25 pL, using 12.5 pL of Power SYBR Green PCR Master Mix, 0.5 pL of forward primer (10 pM), 0.5 pL of reverse primer (10 pM), 7.5 pL of H2O, and 4 pL of DNA, with the following thermal cycling: 95°C for 10 min, 95°C for 30 s, and 67°C for 1 min (40 cycles).
[0547] At the end of the run, the instrument returned a threshold cycle (Ct) for each replicate, proportional to the amount of input DNA. Subsequently, data quality controls were performed by evaluating the standard deviation (SD) of the Ct values obtained from the triplicates for each sample. For samples with SD <0.5, the mean of the three Ct values was considered. Samples with SD >0.5 were removed from the analysis, except in the case where the difference between two of the three Ct values was <0.5, in which case the mean of the pair of values was considered and the sample was retained. To verify complete digestion by Mspl, the difference between the mean Ct of the Mspl-treated DNA and the mean Ct of the untreated DNA was calculated. If the difference was >4.5, then the digestion was considered successfull.
[0548] From the quantification of the amplified DNA fragments, it was possible to calculate the relative methylation level, that is an estimate of the percentage of methylated DNA molecules relative to the total DNA molecules, by applying the following formulas:
[0549] (A) CpGELOVL2 DNAm = 2 ~Ct-HPYCH4IV=2 -(Ct mean HpyCH4IV - Ct mean NT)
[0550] (B) CpGFHL2 DNAm = 2 ~ Ct_Hpall . 2 -ACt_Mspl > 2 -(Ct mean Hpall - Ct mean NT) . 2 -(Ct mean Mspl - Ct mean NT) wherein CPGELOVL2 DNAm stands for DNA methylation level at the CPGELOVL2 methylation site and CPGFHL2 DNAm stands for DNA methylation level at the CPGFHL2 methylation site since DNAm stands for DNA methylation; ACt stands for the difference between the mean Ct value obtained from the treated DNA and the mean Ct value obtained from the untreated DNA; Ct mean HpyCH4IV stands for the mean Ct value of the HpyCH4IV-treated DNA; Ct mean NT stands for the mean Ct value of the untreated DNA; Ct mean Hpall stands for the mean Ct value of the Hpall-treated DNA; Ct mean Mspl stands for the mean Ct value of the Mspl-treated DNA; Ct indicating the threshold cycle generated by the qPRC.
[0551] Table 1 reports, for illustrative purposes, some quality controls and calculation of the CpGFHL2 methylation level for the d85a sample.
[0552] Table 1. Example of quality controls and calculation of CPGFHL2 methylation level for sample d85a.
[0553] Once the methylation levels of CPGELOVL2 and CPGFHL2 were obtained for each individual, the correlation between chronological age and the methylation values at the two sites was evaluated. The analysis showed that both CpG sites were strongly correlated with age.
[0554] Subsequently, a predictive model for chronological age was constructed using quadratic regression, which provided a better fit to the experimental data compared to linear and logarithmic regression models. Specifically, a combined CPGELOVL2 + CPGFHL2 model (multiple R2= 0.83) was calculated as follows: Chronological age prediction formula:
[0555] Wherein
[0556] Age stands for the calculated age of the human subject(30= -6,70,
[0557] (3i = 95.65, p2= -75.33, p3= 253.94,
[0558] (34 = -270.88 and
[0559] CpG ELOVL2 stands for the methylation level of the CpG site located in the promoter of the ELOVL2 gene
[0560] CPGFHL2 stands for the methylation level of the CpG site located in the promoter of the FHL2 gene.
[0561] [3 values resulting from the combined age-predictive model are reported in Table 2. Table 2. (3 values resulting from the combined age-predictive model.
[0562] By substituting the measured methylation values of the CpG sites and the [3 values of the coefficients obtained from the predictive model, into the above formula, it was possible to predict the chronological age of each individual.
[0563] Then, the median absolute value of the model residuals was calculated to investigate the accuracy of the age prediction. The combined model reported a prediction error of 4.65 years between the chronological age and the estimated age.
[0564] Next, to investigate whether the model error was constant across ages, the association between chronological age and the difference between observed and predicted age was tested. The analysis reported that the model error did not vary with chronological age (p-value < 0.01 ).
[0565] Finally, the mean absolute error (MAE) of the model was calculated by dividing the samples into three age groups: young (< 35 years), adults (36-65 years) and elderly (> 66 years). The combined model reported a MAE of 6.37 years for young people (N=1 1 ), 6.30 years for adults (N=1 1 ) and 7.83 years for older people (N=13). An ANOVA test showed that there were no statistically significant differences (p- value<0.01 ) between the errors in the three age groups.
[0566] The chronological age prediction formula was developed based on experimental tests and verifications conducted on this group of individuals with known chronological ages. Analyses performed on these individuals allowed the derivation of the age prediction formula, including the determination of the corresponding [3 coefficient values.
[0567] The [3 coefficient values are calculated from the methylation levels of CPGELOVL2 and CPGFHL2 in individuals of known chronological ages, on which the predictive model is built.
[0568] These [3 coefficients remain fixed within the age-prediction equation and can be used to estimate the chronological age of any individual. In the case of an individual of unknown age, the methylation levels of the two CpG sites (CPGELOVL2 and CPGFHL2), obtained from the analysis of the DNA aliquots extracted from that subject, are inserted into the chronological age prediction formula together with the values of the [3 coefficients, from [30 to [34 (table 2), providing an estimate of the chronological age of the subject.
[0569] Since the age-predicting method or formula and the corresponding [3 coefficients values are linked to the measurement of the methylation level at the CpG sites CpG ELOVL2 and CPGFHL2 in human bone tissue, preferably dental cementum, the values of the [3 coefficients, from (30 to [34 (table 2), do not change even when primers and / or restriction enzymes other than the specific ones described are employed for the purpose of measuring the methylation level, provided that such other primers are selected among those such as to amplify a genomic region not exceeding 200 bp, including said GRCh37 / hg19; chr6: 1 1 ,044,888, in the promoter region of the ELOVL2 gene and amplify a genomic region not exceeding 200 bp including said GRCh37 / hg19; chr2: 106,015,754, in the promoter region of the FHL2 gene, and such other restriction enzymes sensitive and insensitive to the methylation of the sites they recognize as: one sensitive to the methylation of the CPGFHL2 site, CpG (GRCh37 / hg19; chr2: 106,015,754), present in the promoter region of the FHL2 gene, one sensitive to the methylation of the CPGELOVL2 site, CpG (GRCh37 / hg19; chr6: 11 ,044,888), present in the promoter region of the ELOVL2 gene and another being insensitive to the methylation of the CPGFHL2 site, CpG (GRCh37 / hg19; chr2: 106,015,754), present in the promoter region of the FHL2 gene.
[0570] ADVANTAGES
[0571] The method, according to any of its embodiments as described herein, solves several technical problems inherent in the methods described in the state of the art, such as:
[0572] - Most currently available techniques for measuring DNA methylation rely on an initial treatment with sodium bisulfite, a chemical agent capable of converting unmethylated cytosines into uracils, making the methylated ones identifiable. The methylation status of these cytosines can be assessed using technologies, such as mass spectrometry (MALDI-TOF) or sequencing. To avoid false-positive results, these methods require complete denaturation of the double-stranded DNA and complete conversion of the unmethylated cytosines. Moreover, treatment with sodium bisulfite damages the DNA, converting it into a single-stranded form, which requires high- quality DNA as starting material to obtain reliable results. This makes these methods unsuitable for potentially degraded samples, such as those of anthropological, and forensic origin.
[0573] - Previous studies have considered rather long amplicons (>300 bp), limiting the application of such methodologies to samples containing intact DNA and making these methods unsuitable for degraded or fragmented DNA, such as that obtained from historical, archaeological, or forensic remains.
[0574] - Previous work has also measured the methylation level of a large number of CpG sites, with a slight effect on chronological age.
[0575] - Methods proposed to date for measuring DNA methylation level, such as MALDI-TOF mass spectrometry or genome sequencing, use expensive technologies available only in specialized molecular biology centers, further limiting the widespread use of DNA methylation as a tool for estimating chronological age.
[0576] - Finally, many studies rely on DNA methylation analysis from tissues such as blood, which is only available when undeteriorated human tissue is found, thereby limiting the applicability of the method to degraded or post-mortem samples.
[0577] The main advantages achieved with the method according to any of its embodiments as described herein in accordance with the present invention can be listed as follows: a) the possibility of using bone tissue, and in particular dental cementum, as a biological sample from which to extract highly fragmented methylated DNA. Bone tissue is one of the most resistant human tissues to environmental agents and postmortem transformations, making it an excellent source of DNA, especially for individuals found in forensic or archaeological contexts; b) the use of Methylation-Sensitive Restriction Enzymes (MSREs), which avoid the use of sodium bisulfite, a chemical agent that tends to degrade DNA, making the method more suitable for DNA samples / fragments of poor integrity; c) the possibility of using a tool available in most molecular laboratories, such as qPCR, thus making the method according to the present invention accessible to a greater number of laboratories; d) The DNA sequences of interest containing the measured CpG sites were selected to be approximately 100 bp (base pairs) in length, shorter than those found in age estimation methods described in the state of the art, making the experimental protocol more suitable for degraded and fragmented DNA samples / fragments; e) The use of only two CpG sites to estimate age helps reduce analysis time and costs.
[0578] The method, in any of its embodiments as described here, is therefore suitable for reconstructing the biological profile of unknown individuals, found in both archaeological and forensic contexts. Furthermore, since it requires moderate time and cost, it is advantageous as an initial screening for large cohorts of individuals, such as in the case of numerous burials or mass disasters.
[0579] The methods according to the present invention, based on methylation-sensitive restriction enzymes and qPCR, avoid the use of sodium bisulfite and are therefore more suitable for a wider variety of contexts, as well as limiting the risk of erroneous conclusions.
[0580] The methods according to the present invention utilize the methylation status of only two CpG sites, CpGELOVL2 and CpGFHL2, which have been demonstrated to be strongly correlated with chronological age. These sites were selected according to previous studies, allowing the identification of the most predictive CpG sites for accurate age estimation.
[0581] The method according to any of its embodiments as described herein and in accordance with the present invention offers the following additional advantages:
[0582] • relatively low cost per sample
[0583] • high accuracy in age estimation compared to traditional morphological methods
[0584] • relatively short experimental times
[0585] • inexpensive instrumentation (qPCR).
[0586] References
[0587] 1. Brooks S., Suchey J.M. 1990. Skeletal age determination based on the os pubis: a comparison of the Acsadi-Nemeskeri and Suchey-Brooks methods. Hum Evol 5: 227-38.
[0588] 2. Lovejoy C.O., Meindl R.S., Pryzbeck T.R., Mensforth R.P. 1985. Chronological metamorphosis of the auricular surface of the ilium: a new method for the determination of adult skeletal age at death. Am J Phys Anthropol 68: 15-28.
[0589] 3. Schmeling A, Grundmann C, Fuhrmann A, Kaatsch HJ, Knell B, Ramsthaler F, Reisinger W, Riepert T, Ritz-Timme S, Rosing FW, Rotzscher K, Geserick G. Criteria for age estimation in living individuals. Int J Legal Med. 2008 Nov;122(6):457-60. doi: 10.1007 / s00414-008-0254-2. Epub 2008 Jun 12. PMID: 18548266.
[0590] 4. Lottering N, MacGregor DM, Alston CL, Gregory LS. Ontogeny of the sphenooccipital synchondrosis in a modern Queensland, Australian population using computed tomography. Am J Phys Anthropol. 2015 May;157(1 ):42-57. doi: 10.1002 / ajpa.22687. Epub 2014 Dec 29. PMID: 25546173.
[0591] 5. Hillewig E, De Tobel J, Cuche O, Vandemaele P, Piette M, Verstraete K. Magnetic resonance imaging of the medial extremity of the clavicle in forensic bone age determination: a new four-minute approach. Eur Radiol. 201 1 Apr;21 (4):757-67. doi: 10.1007 / s00330-010-1978-1 . Epub 2010 Oct 3. PMID: 20890759.
[0592] 6. Ekizoglu O, Hocaoglu E, Inci E, Can IO, Aksoy S, Kazimoglu C. Forensic age estimation via 3-T magnetic resonance imaging of ossification of the proximal tibial and distal femoral epiphyses: Use of a T2-weighted fast spin-echo technique. Forensic Sci Int. 2016 Mar; 260:102.e1 -102. e7. doi: 10.1016 / j.forsciint.2015.12.006. Epub 2015 Dec 15. PMID: 26797254.
[0593] 7. Zheng Y, Luo X, Zhu J, Zhang X, Zhu Y, Cheng H, Xia Z, Su N, Zhang N, Zhou J. Mitochondrial DNA 4977 bp deletion is a common phenomenon in hair and increases with age. Bosn J Basic Med Sci. 2012 Aug;12(3):187-92. doi: 10.17305 / bjbms.2012.2480. PMID: 22938547; PMCID: PMC4362429.
[0594] 8. Herbst A, Lee CC, Vandiver AR, Aiken JM, McKenzie D, Hoang A, Allison D, Liu N, Wanagat J. Mitochondrial DNA deletion mutations increase exponentially with age in human skeletal muscle. Aging Clin Exp Res. 2021 Jul;33(7):181 1 - 1820. doi: 10.1007 / s40520-020-01698-7. Epub 2020 Sep 23. PMID: 32965609; PMCID: PMC7985047. Lujan SA, Longley MJ, Humble MH, Lavender CA, Burkholder A, Blakely EL, Alston CL, Gorman GS, Turnbull DM, McFarland R, Taylor RW, Kunkel TA, Copeland WC. Ultrasensitive deletion detection links mitochondrial DNA replication, disease, and aging. Genome Biol. 2020 Sep 17;21 (1 ):248. doi: 10.1186 / sl 3059-020-02138-5. PMID: 32943091 ; PMCID: PMC7500033. Pavicic WH, Richard SM. Correlation analysis between mtDNA 4977-bp deletion and ageing. Mutat Res. 2009 Nov 2;670(1 -2):99-102. doi: 10.1016 / j.mrfmmm.2009.07.009. Epub 2009 Jul 29. PMID: 19646455. Karlsson AO, Svensson A, Marklund A, Holmlund G. Estimating human age in forensic samples by analysis of telomere repeats. Forensic Sci. Int. Genet. Suppl. Ser. 1 (1 ) (2008) 569-571. Murillo-Ortiz B, Albarran-Tamayo F, Lopez-Briones S, Martinez-Garza S, Bemtez-Bribiesca L, Arenas-Aranda D. Increased telomere length and proliferative potential in peripheral blood mononuclear cells of adults of different ages stimulated with concanavalin A. BMC Geriatr. 2013 Sep 24; 13:99. doi: 10.1 186 / 1471 -2318-13-99. PMID: 24063536; PMCID: PMC3849925. Simm A, Wagner J, Gursinsky T, Nass N, Friedrich I, Schinzel R, Czeslik E, Silber RE, Scheubel RJ. Advanced glycation endproducts: a biomarker for age as an outcome predictor after cardiac surgery? Exp Gerontol. 2007 Jul;42(7):668-75. doi: 10.1016 / j.exger.2007.03.006. Epub 2007 Mar 27. PMID: 17482402. Sato Y, Kondo T, Ohshima T. Estimation of age of human cadavers by immunohistochemical assessment of advanced glycation end products in the hippocampus. Histopathology. 2001 Mar;38(3):217-20. doi: 10.1046 / j.1365- 2559.2001.01059.x. PMID: 1 1260301. C Zapico S, Ubelaker DH. Application of Aspartic Acid Racemization for Age Estimation in a Spanish Sample. Biology (Basel). 2022 Jun 3;1 1 (6):856. doi: 10.3390 / biologyl 1060856. PMID: 35741377; PMCID: PMC9220174. Hassan Q, Rakha A, Bashir MZ. Aspartic Acid Racemization with Correlation to Age: A Forensic Perspective. J Coll Physicians Surg Pak. 2017 May;27(5):283- 287. PMID: 28599689. Sawafuji R, Cappellini E, Nagaoka T, Fotakis AK, Jersie-Christensen RR, Olsen JV, Hirata K, Ueda S. Proteomic profiling of archaeological human bone. R Soc Open Sci. 2017 Jun 7;4(6):161004. doi: 10.1098 / rsos.161004. PMID: 28680659; PMCID: PMC5493901. Takemon Y, Chick JM, Gerdes Gyuricza I, Skelly DA, Devuyst O, Gygi SP, Churchill GA, Korstanje R. Proteomic and transcriptomic profiling reveal different aspects of aging in the kidney. Elife. 2021 Mar 9; 10:e62585. doi: 10.7554 / eLife.62585. PMID: 33687326; PMCID: PMC8096428. Hannum G, Guinney J, Zhao L, Zhang L, Hughes G, Sadda S, Klotzle B, Bibikova M, Fan JB, Gao Y, Deconde R, Chen M, Rajapakse I, Friend S, Ideker T, Zhang K. Genome-wide methylation profiles reveal quantitative views of human aging rates. Mol Cell. 2013 Jan 24;49(2):359-367. doi: 10.1016 / j.molceL2012.10.016. Epub 2012 Nov 21. PMID: 23177740; PMCID: PMC378061 1. Koch CM, Wagner W. Epigenetic-aging-signature to determine age in different tissues. Aging (Albany NY). 201 1 Oct;3(10):1018-27. doi:
[0595] 10.18632 / aging.100395. PMID: 22067257; PMCID: PMC3229965. Garagnani P, Bacalini MG, Pirazzini C, Gori D, Giuliani C, Mari D, Di Blasio AM, Gentilini D, Vitale G, Collino S, Rezzi S, Castellani G, Capri M, Salvioli S, Franceschi C. 2012. Methylation of ELOVL2 gene as a new epigenetic marker of age. Aging Cell 1 1 :1132-1 134. Zbiec-Piekarska R, Spolnicka M, Kupiec T, Parys-Proszek A, Makowska Z, Paleczka A, Kucharczyk K, Ploski R, Branicki W. Development of a forensically useful age prediction method based on DNA methylation analysis. Forensic Sci Int Genet. 2015 Jul; 17:173-179. doi: 10.1016 / j.fsigen.2015.05.001 . Epub 2015 May 5. PMID: 26026729. Park JL, Kim JH, Seo E, Bae DH, Kim SY, Lee HC, Woo KM, Kim YS. Identification and evaluation of age-correlated DNA methylation markers for forensic use. Forensic Sci Int Genet. 2016 Jul; 23:64-70. doi: 10.1016 / j.fsigen.2O16.03.005. Epub 2016 Mar 17. PMID: 270171 10. Bekaert B, Kamalandua A, Zapico SC, Van de Voorde W, Decode R. Improved age determination of blood and teeth samples using a selected set of DNA methylation markers. Epigenetics. 2015;10(10):922-30. doi: 10.1080 / 15592294.2015.1080413. Epub 2015 Aug 17. PMID: 26280308; PMCID: PMC4844214. Freire-Aradas A, Phillips C, Mosquera-Miguel A, Giron-Santamana L, Gomez- Tato A, Casares de Cal M, Alvarez-Dios J, Ansede-Bermejo J, Torres-Espanol M, Schneider PM, Pospiech E, Branicki W, Carracedo A, Lareu MV. Development of a methylation marker set for forensic age estimation using analysis of public methylation data and the Agena Bioscience EpiTYPER system. Forensic Sci Int Genet. 2016 Sep; 24:65-74. doi: 10.1016 / j.fsigen.2O16.06.005. Epub 2016 Jun 8. PMID: 27337627. Jung SE, Lim SM, Hong SR, Lee EH, Shin KJ, Lee HY. DNA methylation of the ELOVL2, FHL2, KLF14, C1orf132 / MIR29B2C, and TRIM59 genes for age prediction from blood, saliva, and buccal swab samples. Forensic Sci Int Genet.
[0596] 2019 Jan; 38:1 -8. doi: 10.1016 / j.fsigen .2018.09.010. Epub 2018 Sep 29. PMID: 30300865. Guan X, Ohuchi T, Hashiyada M, Funayama M. Age-related DNA methylation analysis for forensic age estimation using post-mortem blood samples from Japanese individuals. Leg Med (Tokyo). 2021 Nov; 53:101917. doi: 10.1016 / j.legalmed.2021.101917. Epub 2021 Jun 5. PMID: 34126371 . Kondo M, Aboshi H, Yoshikawa M, Ogata A, Murayama R, Takei M, Aizawa S. A newly developed age estimation method based on CpG methylation of teeth- derived DNA using real-time methylation-specific PCR. J Oral Sci. 2020 Dec 23;63(1 ):54-58. doi: 10.2334 / josnusd.20-0138. Epub 2020 Dec 7. PMID: 33281 149. Marquez-Ruiz AB, Gonzalez-Herrera L, Luna JD, Valenzuela A. DNA methylation levels and telomere length in human teeth: usefulness for age estimation. Int J Legal Med. 2020 Mar;134(2):451 -459. doi: 10.1007 / s00414- 019-02242-7. Epub 2020 Jan 2. PMID: 31897670. Giuliani C, Cilli E, Bacalini MG, Pirazzini C, Sazzini M, Gruppioni G, Franceschi C, Garagnani P, Luiselli D. Inferring chronological age from DNA methylation patterns of human teeth. Am J Phys Anthropol. 2016 Apr;159(4):585-95. doi: 10.1002 / ajpa.22921 . Epub 2015 Dec 15. PMID: 26667772. Correia Dias H, Cunha E, Corte Real F, Manco L. Age prediction in living: Forensic epigenetic age estimation based on blood samples. Leg Med (Tokyo).
[0597] 2020 Nov; 47:101763. doi: 10.1016 / j.legalmed.2020.101763. Epub 2020 Jul 21 . PMID: 32721866. Sukawutthiya P, Sathirapatya T, Vongpaisarnsin K. A minimal number CpGs of ELOVL2 gene for a chronological age estimation using pyrosequencing. Forensic Sci Int. 2021 Jan; 318:110631. doi: 10.1016 / j.forsciint.2020.110631 . Epub 2020 Nov 28. PMID: 33279766. C Zapico S, Gauthier Q, Antevska A, McCord BR. Identifying Methylation Patterns in Dental Pulp Aging: Application to Age-at-Death Estimation in Forensic Anthropology. Int J Mol Sci. 2021 Apr 2;22(7):3717. doi:
[0598] 10.3390 / ijms22073717. PMID: 33918302; PMCID: PMC8038189.
[0599] SEQUENCE LISTING
[0600] Sequence Listing Information:
[0601] DTD Version: V1_3
[0602] File Name: Giuliani. xml
[0603] Software Name: WIPO Sequence
[0604] Software Version: 2.3.0
[0605] Production Date: 2024-10-26
[0606] General Information:
[0607] Current application I Applicant file reference: P71381 IT00
[0608] Applicant name: ALMA MATER STUDIORUM - UNIVERSITA’ DI BOLOGNA
[0609] Applicant name I Language: IT
[0610] Invention title: METHOD OF ESTIMATING THE CHRONOLOGICAL AGE BASED ON
[0611] DNA METHYLATION LEVEL IN HUMAN DENTAL TISSUE
[0612] Sequence Total Quantity: 6
[0613] Sequences:
[0614] Sequence Number (ID): 1
[0615] Length: 19
[0616] Molecule Type: DNA
[0617] Features Location / Qualifiers:
[0618] - source, 1 ..19
[0619] > mol_type, genomic DNA
[0620] > organism, Homo sapiens
[0621] Residues: atttgcaggt ccagccggc 19
[0622] Sequence Number (ID): 2
[0623] Length: 21
[0624] Molecule Type: DNA
[0625] Features Location / Qualifiers:
[0626] - source, 1 ..21
[0627] > mol_type, genomic DNA
[0628] > organism, Homo sapiens
[0629] Residues: cgccctgcac gatactgctt c 21
[0630] Sequence Number (ID): 3
[0631] Length: 23
[0632] Molecule Type: DNA
[0633] Features Location / Qualifiers:
[0634] - source, 1 ..23
[0635] > mol_type, genomic DNA
[0636] > organism, Homo sapiens
[0637] Residues: ggtcttggga gcacagtagt tat 23
[0638] Sequence Number (ID): 4
[0639] Length: 19
[0640] Molecule Type: DNA
[0641] Features Location / Qualifiers:
[0642] - source, 1 ..19
[0643] > mol_type, genomic DNA
[0644] > organism, Homo sapiens
[0645] Residues: ccaggcctcg tccgaaact 19
[0646] Sequence Number (ID): 5
[0647] Length: 124
[0648] Molecule Type: DNA
[0649] Features Location / Qualifiers:
[0650] - source, 1 ..124
[0651] > mol_type, genomic DNA
[0652] > organism, Homo sapiens
[0653] Residues: atttgcaggt ccagccggcg ccggtttcgc gcggcggctc aacgtccacg gagccccagg 60 aatacccacc cgctgcccag atcggcagcc gctgctgcgg ggagaagcag tatcgtgcag 120 ggcg 124 Sequence Number (ID): 6
[0654] Length: 78
[0655] Molecule Type: DNA
[0656] Features Location / Qualifiers: - source, 1 ..78
[0657] > mol_type, genomic DNA
[0658] > organism, Homo sapiens
[0659] Residues: ggtcttggga gcacagtagt tatcgggagc gtcgcctccg gcgtgggctc tcgggcgcga 60 gtttcggacg aggcctgg 78
[0660] END
Claims
1. Claims1. Method for analyzing the methylation status of human DNA extracted from bone tissue by qPCR, which comprises: i) subjecting identical DNA aliquots extracted from human bone-like tissue to the same treatment conditions, ensuring all variables remain equal, respectively:• treating a first aliquot with a methylation-sensitive restriction enzyme targeting the CPGELOVL2 (GRCh37 / hg19; chr6: 11 ,044,888), within the promoter region of the ELOVL2 gene, to obtain the treated aliquot a1 );• treating a second aliquot with water to obtain an “untreated” aliquot a2);• treating a third aliquot with a methylation-sensitive restriction enzyme targeting the CPGFHL2 (GRCh37 / hg19; chr2: 106,015,754), within the promoter region of the FHL2 gene, to obtain the treated aliquot b1 );• treating a fourth aliquot with a restriction enzyme which is insensitive to methylation of the CPGFHL2 (GRCh37 / hg19; chr2: 106,015,754), within the promoter region of the FHL2 gene, to obtain the treated aliquot b2);• treating a fifth aliquot with water to obtain the “untreated” aliquot b3); ii) amplifying all aliquots by qPCR, respectively with:1 . a pair of PELOVL2 primers, designed to amplify a genomic region not greater than 200 bp, encompassing the chr6: 11,044,888 (GRCh37 / hg19), applied to the aliquots a1 ) and a2) under the same conditions;2. a pair of PFHL2 primers, designed to amplify a genomic region not greater than 200 bp, encompassing the chr2: 106,015,754 (GRCh37 / hg19), applied to the aliquots b1 ), b2) and b3) operating under the same conditions; and comparing the amplification result obtained by qPCR using the ELOVL2 primers pair with those obtained separately by qPCR using the FHL2 primers pair.
2. Method according to claim 1 , wherein the methylation-sensitive restriction enzyme recognizing the CPGELOVL2 site is HpyCH V.
3. Method according to anyone of the claims from 1 to 2, wherein the methylationsensitive restriction enzyme recognizing the CPGFHL2 site is Hpall.
4. Method according to anyone of the claims from 1 to 3, wherein the methylationinsensitive restriction enzyme recognizing the CPGFHL2 site is Mspl.
5. Method according to anyone of the claims from 1 to 4, wherein the primers P ELOVL2 are: forward-. 5’- ATTTGCAGGTCCAGCCGGC -3’• reverse-. 5’- CGCCCTGCACGATACTGCTTC -3’ or SEQ. ID NO: 1 and SEQ. ID NO: 2, respectively.
6. Method according to anyone of the claims from 1 to 5, wherein the P FHL2 primers are:• forward-. 5’- GGTCTTGGGAGCACAGTAGTTAT -3’• reverse: 5’- CCAGGCCTCGTCCGAAACT -3’ or SEQ. ID NO: 3 and SEQ. ID NO: 4, respectively.
7. Method according to anyone of the claims from 1 to 6, wherein the genomic region, not exceeding 200 bp, comprising chr6: 11,044,888 (GRCh37 / hg19), located in the promoter region of the ELOVL2 gene is the sequence:ATTTGCAGGTCCAGCCGGCGCCGGTTTCGCGCGGCGGCTCAACGTCCACGGA GCCCCAGGAATACCCACCCGCTGCCCAGATCGGCAGCCGCTGCTGCGGGGAG AAGCAGTATCGTGCAGGGCG, or SEQ. ID NO: 5.
8. Method according to anyone of the claims from 1 to 7 wherein the genomic region, not exceeding 200 bp, comprising chr2: 106,015,754 (GRCh37 / hg19), located in the promoter region of the FHL2 gene is the sequence:GGTCTTGGGAGCACAGTAGTTATCGGGAGCGTCGCCTCCGGCGTGGGCTCTCG GGCGCGAGTTTCGGACGAGGCCTGG, or SEQ. ID NO: 6.
9. Method according to anyone of the claims from 1 to 8 wherein:- the P ELOVL2 primers are:• forward: 5’- ATTTGCAGGTCCAGCCGGC -3’• reverse: 5’- CGCCCTGCACGATACTGCTTC -3’; or SEQ. ID NO: 1 and SEQ. ID NO: 2, respectively;- the P FHL2 primers are:• forward: 5’- GGTCTTGGGAGCACAGTAGTTAT -3’;• reverse: 5'- CCAGGCCTCGTCCGAAACT -3' or SEQ. ID NO: 3 and SEQ. ID NO: 4, respectively;- the methylation-sensitive restriction enzyme recognizing the CPGELOVL2 site is HpyCH V;- the methylation-sensitive restriction enzyme recognizing the CPGFHL2 site is Hpall;- the methylation-unsensitive restriction enzyme recognizing the CPGFHL2 site is Mspl.
10. Method according to the claims from 1 to 9, wherein the DNA methylation levels at the CPGELOVL2 site in the ELOVL2 gene promoter region and at the CpGFHL2 S e in theFHL2 gene promoter region are calculated respectively using the following formulas:(A) CpGELOVL2 DNAm = 2 ~A Ct- HpyCH4IV=2 -(Ct mean HpyCH4IV - Ct mean NT)11 . Method of estimating the chronologic age of a human being comprising the method for analyzing the DNA methylation status according to the claims from 1 to 10, wherein the chronologic age is estimated by the formula:(C) AgewhereinAge is the calculated age of an individualPo = -6.70,(3i = 95.65,P2 = -75.33,[33= 253.94,[34 = -270.88, andCpG ELOVL2 refers to the methylation level of the CpG site located in the promoter region of the ELOVL2 geneCPGFHL2 refers to the methylation level of the CpG site located in the promoter region of FHL2 gene.
12. Method according to any of the claims from 1 to 1 1 , wherein the bone tissue is preferably dental cementum.
13. Kit / assembly for analyzing the human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject, said kit / assembly comprising:- a pair of PELOVL2 primers, design to amplify a genomic region not exceeding 200 bp, encompassing the CpG site at chr6: 11,044,888 (GRCh37 / hg19), located in the promoter region of ELOVL2 gene,- a pair of PFHL2 primers, design to amplify a genomic region not exceeding 200 bp, encompassing the CpG site at chr2: 106,015,754 (GRCh37 / hg19), located in the promoter region of FHL2 gene.
14. Kit / assembly for analyzing the human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject, according to claim 13, wherein said kit / assembly further comprises:- a methylation-sensitive restriction enzyme for the CpGELovL2(GRCh37 / hg19; chr6:1 1 ,044,888), located in the promoter region of the ELOVL2 gene,- a methylation-sensitive restriction enzyme for the CpGFHL2(GRCh37 / hg19; chr2: 106,015,754), located in the promoter region of the FHL2 gene,- a methylation-unsensitive restriction enzyme for the CpGFHL2(GRCh37 / hg19; chr2: 106,015,754), located in the promoter region of the FHL2 gene.
15. Kit / assembly for analyzing the human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject, according to any of the claims from 13 to 14, wherein the PELOVL2 primers are:• forward-. 5’- ATTTGCAGGTCCAGCCGGC -3’• reverse-. 5’- CGCCCTGCACGATACTGCTTC -3’ or SEQ. ID NO: 1 and SEQ. ID NO: 2, respectively.
16. Kit / assembly for analyzing the human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject, according to any of the claims from 13 to 15, wherein the PFHL2 primers are:• forward-. 5’- GGTCTTGGGAGCACAGTAGTTAT -3’• reverse: 5’- CCAGGCCTCGTCCGAAACT -3’ or SEQ. ID NO: 3 and SEQ. ID NO: 4, respectively.
17. Kit / assembly for analyzing the human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject, according to any of the claims from 13 to 16, wherein the methylation-sensitive restriction enzyme recognizing the CPGELOVL2 site is HpyCF IV.
18. Kit / assembly for analyzing the human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject, according to any of the claims from 13 to 17, wherein the methylation-sensitive restriction enzyme recognizing CPGFHL2 site is Hpall.
19. Kit / assembly for analyzing the human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject, according to any of the claims 13 to 18, wherein the methylation-unsensitive restriction enzyme recognizing CPGFHL2 site is Mspl.
20. Kit / assembly for analysing the human DNA methylation / for calculating the level of human DNA methylation / for estimating the chronological age of a human subject, according to any of the claims from 13 to 20, wherein:- the PELOVL2 primers are:• forward-. 5’- ATTTGCAGGTCCAGCCGGC -3’• reverse-. 5’- CGCCCTGCACGATACTGCTTC -3’ or SEQ. ID NO: 1 and SEQ. ID NO: 2, respectively;-the PFHL2 primers are:• forward-. 5’- GGTCTTGGGAGCACAGTAGTTAT -3’;• reverse: 5’- CCAGGCCTCGTCCGAAACT -3’ or SEQ. ID NO: 3 and SEQ. ID NO: 4, respectively;- the methylation-sensitive restriction enzyme recognizing CPGELOVL2 site is HpyCH4lV;- the methylation-sensitive restriction enzyme recognizing CPGFHL2 site is Hpall;- the methylation-unsensitive restriction enzyme recognizing CPGFHL2 site is Mspl.
21. Kit or assembly according to any of the claims from 13 to 20, further comprising instructions to execute the method of analyzing human DNA methylation according to any of the claims from 1 to 9 or 12, or for executing the method of calculating the level of human DNA methylation according to claim 10 or 12, or for executing the method of estimating the chronological age of a human being according to claim 11 or 12.
22. Pair of PELOVL2 primers:• forward: 5’- ATTTGCAGGTCCAGCCGGC -3’• reverse: 5’- CGCCCTGCACGATACTGCTTC -3’ or SEQ. ID NO: 1 and SEQ. ID NO: 2, respectively.
23. Pair of PFHL2 primers:• forward: 5’- GGTCTTGGGAGCACAGTAGTTAT -3’• reverse: 5’- CCAGGCCTCGTCCGAAACT -3’ or SEQ. ID NO: 3 and SEQ. ID NO: 4, respectively.
Citation Information
Patent Citations
Method and system for acquiring individual age of Chinese population and amplification detection system
CN110257494A
Movable fender apparatus
KR1020260037502A
Materials and methods for age-at-death estimation
US11312989B1
Method for detecting colorectal cancer DNA methylation and reagent
US20240271219A1
Method for the determination of biological age in human beings
WO2014146793A1