Oligonucleotide compositions and methods thereof

Abstract

Among other things, the present disclosure provides oligonucleotide compositions and methods thereof. In some embodiments, the present disclosure provides oligonucleotide compositions that can edit an adenosine in a LDLR transcript. In some embodiments, the present disclosure provides methods for upregulatmg LDLR expression. In some embodiments, the present disclosure provides methods for preventing or treating conditions, disorders or diseases, e.g., those that can benefit from editing of an adenosine in a LDLR transcript or higher LDLR expression.

Description

OLIGONUCLEOTIDE COMPOSITIONS AND METHODS THEREOFCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to United States Provisional Application Nos. 63 / 714.128, filed October 30, 2024, 63 / 752,459. filed January 31, 2025. and 63 / 770,934, filed March 12. 2025, the entirety of each of which is incorporated herein by reference.BACKGROUND

[0002] Oligonucleotides are useful in various applications, e.g., therapeutic, diagnostic, and / or research applications. For example, oligonucleotides targeting various genes can be useful for treatment of conditions, disorders or diseases related to such target genes.SUMMARY

[0003] Among other things, tire present disclosure provides designed oligonucleotides and compositions thereof which oligonucleotides comprise modifications (e.g., modifications to nucleobases sugars, and / or intemucleotidic linkages, and patterns thereof) as described herein. In some embodiments, technologies (compounds (e g., oligonucleotides), compositions, methods, etc.) of the present disclosure (e.g., oligonucleotides, oligonucleotide compositions, methods, etc.) are particularly useful for editing nucleic acids, e.g., site-directed editing in nucleic acids (e.g., editing of target adenosine). In some embodiments, as demonstrated herein, provided technologies can significantly improve efficiency of nucleic acid editing, e.g., modification of one or more A residues, such as conversion of A to I. In some embodiments, the present disclosure provides technologies for editing (e.g., for modifying an A residue, e.g., converting an A to 1) in an RNA. In some embodiments, the present disclosure provides technologies for editing (e.g.. for modifying an A residue, e.g., converting an A to an I) in a transcript, e.g., mRNA. Among other things, provided technologies provide the benefits of utilization of endogenous proteins such as ADAR (Adenosine Deaminases Acting on RNA) proteins (e.g., ADAR1 and / or ADAR2). for editing nucleic acids, e.g., for modify ing an A (e.g., as a result of G to A mutation). Those skilled in the art will appreciates that such utilization of endogenous proteins can avoid a number of challenges and / or provide various benefits compared to those technologies that require the delivery’ of exogenous components (e.g., proteins (e.g.. those engineered to bind to oligonucleotides (and / or duplexes thereof with target nucleic acids) to provide desired activities), nucleic acids encoding proteins, viruses, etc.).

[0004] Particularly, in some embodiments, oligonucleotides of provided technologies comprise useful sugar modifications and / or patterns thereof (e.g.. presence and / or absence of certain modifications), nucleobase modifications and / or patterns thereof (e.g., presence and / or absence of certain modifications), intemucleotidic linkages modifications and / or stereochemistry' and / or patterns thereof [e.g., types, modifications, and / or configuration (Rp or Sp) of chiral linkage phosphorus, etc.], etc., which, when combined with one or moreother structural elements described herein (e.g., additional chemical moieties) can provide high activities and / or various desired properties, e.g., high efficiency of nucleic acid editing, high selectivity, high stability, high cellular uptake, low immune stimulation, low toxicity, improved distribution, improved affinity, etc In some embodiments, provided oligonucleotides provide high stability, e.g.. when compared to oligonucleotides having a high percentage of natural RNA sugars utilized for adenosine editing. In some embodiments, provided oligonucleotides provide high activities, e.g., adenosine editing activity. In some embodiments, provided oligonucleotides provide high selectivity, for example, in some embodiments, provided oligonucleotides provide selective modification of a target adenosine in a target nucleic acid over other adenosine in the same target nucleic acid (e.g., 2, 3, 4, 5, 6. 7, 8, 9. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 fold or more modification at the target adenosine than another adenosine, or all other adenosine, in a target nucleic acid).

[0005] Among other things, the present disclosure provides designed oligonucleotides and compositions of improved properties and / or activities compared to reference oligonucleotides and compositions (e.g., those described herein or reported in the art). For example, in some embodiments, as demonstrated herein provided oligonucleotide and compositions can provide improved stability, pharmacokinetic properties, pharmacodynamic properties and / or improved activities (e.g.. for A-to-I editing) Various designed oligonucleotides and compositions are described herein. For example, in some embodiments, the present disclosure provides oligonucleotides and compositions thereof, including chirally controlled oligonucleotide compositions thereof, wherein the oligonucleotides comprise several (e.g., 1, 2, 3, 4, or 5 or more; in some embodiments, 3 or more) nucleosides independently comprising sugar modifications (e.g,, 2’-OR modifications wherein R is optionally substituted C; alkyl (e.g., 2’-OMe, 2 -MOE, etc.,), bicyclic sugars (e.g.. LNA sugars, cEt sugars, etc.)) at their 5'- and 3’-ends. In some embodiments, the first several (e.g.. 1, 2, 3, 4, or 5 ormore; in some embodiments, 3 ormore) nucleosides and / orthe last several (e.g.. 1, 2, 3, 4, or 5 ormore; in some embodiments, 3 or more) nucleosides independently comprise sugar modifications. In some embodiments, the first 3 or more and the last 3 or more nucleosides independently comprise sugar modifications. In some embodiments, one or more intemucleotidic linkages bonded to such nucleosides are non-negatively charged intemucleotidic linkage such as phosphoryl guanidine intemucleotidic linkages like nOOl. In some embodiments, both the first and the last intemucleotidic linkages are independently non-negatively charged intemucleotidic linkages. In some embodiments, both the first and the last intemucleotidic linkages are independently phosphory l guanidine intemucleotidic linkages. In some embodiments, both the first and the last intemucleotidic linkages arc independently nOO 1. In some embodiments, they arc both chirally controlled and are Rp. In some embodiments, an oligonucleotide comprises a nucleoside No which comprises a natural DNA sugar (two 2’-H), a natural RNA sugar or a 2’-F modified sugar. In some embodiments, No is a nucleoside opposite to a target adenosine when an oligonucleotide is utilized for adenosine editing. In some embodiments, sugar of No is a natural DNA sugar. In some embodiments, sugar of N i f‘+” or nothing before a number indicates counting toward the 5’-direction (5... NiNoN i... 3")) is a 2’-Fmodified sugar, a naturalDNA sugar, or a natural RNA sugar. In some embodiments, sugar of Ni is a DNA sugar. In some embodiments, sugar of N.i (“-” indicates counting toward the 3 ’-direction (5’... N1N0N.1... 3')) is a 2’-F modified sugar, a natural DNA sugar, or a natural RNA sugar. In some embodiments, sugar of N.i is a DNA sugar. In some embodiments, sugar of N.3 is a 2’-F modified sugar. In some embodiments, between N2 and their 5’-ends oligonucleotides comprise multiple 2’-F modified sugars and multiple 2’-modified sugars (e.g., 2 ’-OR modified sugars wherein Ris optionally substituted C1-6 alkyl, bicyclic sugars such as LN A sugars, cEt sugars, etc.). In some embodiments, oligonucleotides comprise one or more (e.g., 1-20, 1-15, 1-10, 2-15, 2- 10, or 1, 2, 3, 4, 5, 6, 7, 8. 9, 10, 11, 12, 13, 14. 15, 16, 17, 18, 19, 20 or more) 2’-F blocks and one or more (e.g., 1-20, 1-15, 1-10, 2-15. 2-10. or 1, 2, 3. 4, 5, 6, 7. 8, 9, 10, 11, 12, 13, 14, 15. 16. 17, 18, 19, 20 or more) separating blocks from 2 to their 5’-ends (e.g., first domains and first subdomains of second domains combined when first subdomains end with and include N-), wherein each nucleoside in a 2’-F block independently comprises a 2’-F modification, each nucleoside in a separating block independently comprises no 2’-F modification, and each block independently comprises one or more (e.g., 1-20, 1-15, 1-10, 2-15, 2-10, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14. 15, 16, 17, 18, 19, 20 or more) nucleosides. In some embodiments, there are two or more such 2 -F blocks and two or more such separating blocks. In some embodiments, one or more or all such separating blocks are independently bonded to two 2’-F blocks. In some embodiments, each nucleoside in one or more or all separating blocks independently comprise a 2’-OR modification wherein R is optionally substituted CLe alkyl or is a bicyclic sugar such as a LNA sugar, a cEt sugar, etc. In some embodiments, each nucleoside in one or more or all separating blocks independently comprise a 2 ’-OR modification wherein R is optionally substituted Ci-s alkyl. In some embodiments, each nucleoside in one or more or all separating blocks independently comprise a 2’-OMe or 2 -MOE modification. In some embodiments, each of such 2’-F and separating blocks independently comprises 1, 2, 3, 4 or 5 nucleosides. In some embodiments, nucleosides close to No, e.g., N, Ni, No, N.i, N?, etc., do not contain large 2’-modificatoins such as 2’-MOE. In some embodiments, sugars of N2, Ni, No, N.i, and N.; are independently natural DNA sugar, 2’-F modified sugar, or 2’-OMc modified sugar. In some embodiments, sugars of Ni, No, N.i arc each a natural DNA sugar. In some embodiments, each chiral intern ucleotidic linkage is independently chirally controlled.

[0006] As demonstrated herein, among other things, the present disclosure provides useful modified sugars, modified nucleobases, and modified nucleosides that are useful at various positions in oligonucleotides, e.g., for target adenosine editing. Particularly, in some embodiments, the present disclosure provides useful modified sugars, modified nucleobases, and modified nucleosides that can be utilized at Ni, No, or N.i. In some embodiments, provided technologies can provide improved properties, e.g., improved stability and / or editing activities, when compared to reference technologies, e.g., using 2 -F modified sugar or DNA sugar at No, using cy tosine at No, etc. In some embodiments, the present disclosure provides an oligonucleotide comprising 5 ’-NiNoN, -3’, wherein Ni, No, and N.i are each independently a nucleoside and are linked by internucleotidic linkages. In some embodiments, the present disclosure provides an oligonucleotidecomprising 5’-NiNoN.i-3’, wherein Mi, No, and N.i are each independently a nucleoside and are linked by internucleotidic linkages, wherein the oligonucleotide is capable of binding to a target nucleic acid with No opposite to a target adenosine. In some embodiments, No comprises a modified sugar, amodified nucleobase, or a modified nucleoside. In some embodiments, Ni comprises a modified sugar, a modified nucleobase, or a modified nucleoside. In some embodiments, N.i comprises a modified sugar, a modified nucleobase, or a modified nucleoside.

[0007] In some embodiments, the present disclosure provides an oligonucleotide comprising a first domain and a second domain, wherein the first domain comprises one or more 2 -F modifications, and the second domain comprises one or more sugars that do not have a 2’-F modification. In some embodiments, a provided oligonucleotide comprises one or more chiral modified internucleotidic linkages.

[0008] In some embodiments, the present disclosure provides an oligonucleotide comprising:(a) a first domain; and(b) a second domain,wherein:the first domain comprises at least 1, 2, 3, 4, 5. 6, 7, 8, 9, 10, 11, 12. 13. 14, 15, 16, 17, 18, 19, or 20 or more sugars comprising a 2’-F modification;the second domain comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more sugars each independently comprising a 2’-OR modification wherein R is not -H (e.g., 2 '-OMe, 2, -MOE, 2’-O“LB~4’ wherein LBis optionally substituted -CH2~, etc.);the oligonucleotide comprises 5’-NiNoN.i-3’, wherein Ni, No, and N.; are each independently a nucleoside and are linked by internucleotidic linkages;the oligonucleotide comprises a modified sugar, a modified nucleobase, or a modified nucleoside at No, N.i or Ng andthe oligonucleotide is capable of binding to a target nucleic acid with No opposite to a target adenosine.

[0009] In some embodiments, the present disclosure provides an oligonucleotide comprising:(a) a first domain: and(b) a second domain,wherein about 20%-80% (e g., about 25%-80?% 30%-80%, 35%-80%, 40%-80%, 40%-70%, 40%-60%, 50%-80%, 50%-75%, 50?%60%, 55%-80%, 60-80%, or about 50%, 55?% 60?% 65%, 70?% 75%, or 80?% of all sugars of the first domain comprises a2’-F modification;the second domain comprises at least 1, 2. 3, 4, 5, 6. 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more modified sugars comprising no 2"-F modification, or at least 50?% 60%, 70%, 75?% 80%, 85%, 90%, 95?% or 99% of all sugars of the second domain comprise no 2’-F modification;the oligonucleotide comprises 5’-NiNoN.i-3’, wherein Ni, No, and N.i are each independently a nucleoside and are linked by internucleotidic linkages;the oligonucleotide comprises a modified sugar, a modified nucleobase, or a modified nucleoside at No, N 1 or Ni; andthe oligonucleotide is capable of binding to a target nucleic acid with No opposite to a target adenosine.

[0010] In some embodiments, the present disclosure provides an oligonucleotide comprising:(a) a first domain; and(b) a second domain,wherein the first domain comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15. 16, 17, 18, 19, or 20 or more sugars comprising a 2’-F modification and 1, 2, 3. 4, 5, 6, 7. 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more sugars each independently comprising a 2 -OR modification wherein R is not ~H (e.g., 2’-OMe, 2, -MOE, 2.'-O-LB~4' wherein Lbis optionally substituted ( 11. etc ); andthe second domain comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more sugars each independently comprising a 2’-OR modification wherein R is not -II (e.g., 2’-OMe, 2, -MOE, 2’-O-LH--4’ wherein LBis optionally substituted -CH -, etc.).

[0011] In some embodiments, the present disclosure provides an oligonucleotide comprising:(a) a first domain; and(b) a second domain,wherein about 20%-80% (e.g., about 25%-80%, 30%-80%, 35%-80%, 40%-80%, 40%-70%, 40%-60%, 50%-80%, 50%-75%, 50%-60%, 55%-80%, 60-80%, or about 50%, 55%, 60%, 65%, 70%, 75%, or 80%) of all sugars of the first domain comprises a 2’-F modification, and about 20%-70? / o (e.g., about 20%-60%, 20%-50%. 30%-60%, 30%-50%, 40%-50%. or about 20%, 25%, 30%, 35%, 40%, 45%. 50%. 55%, or 60%) of all sugars of the first domain independently comprises a 2 -OR modifications wherein R is not H (e.g.. 2’-OMe, 2.-MOE, 2’-O-LB-4’ wherein LBis optionally substituted -CH -, etc.); andthe second domain comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more modified sugars comprising no 2’-F modification, or at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of all sugars of the second domain comprise no 2’-F modification.

[0012] In some embodiments, a second domain comprises or consists of a first subdomain, a second subdomain and a third subdomain as described herein. In some embodiments, a first subdomain comprises one or more (e.g., 1-10, 1 -5, 1-3, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) sugars each independently comprising a 2’-OR modification wherein R is not -H (e.g., 2’-OMe, 2, -MOE, 2’-O-LB-4’ wherein LBis optionally substituted CH2, etc.). In some embodiments, there arc more such sugars in a first subdomain than 2’-F modified sugars. In some embodiments, none of sugars in a second subdomain contain any 2 ’-OR modifications wherein Ris optionally substituted Cue aliphatic or 2'-0-LB-4'). In some embodiments, each sugar of a second subdomain is independently a natural DNA sugar, a natural RNA sugar or a 2'-F modified sugar. In some embodiments, each sugar of a second subdomain is independently a natural DNA sugar or a natural RNA sugar. In some embodiments, each sugar of a second subdomain is independently a natural DN A sugar or a 2’-F modifiedsugar. In some embodiments, each sugar of a second subdomain is independently a natural DMA sugar. In some embodiments, there are three nucleosides in a second subdomain. In some embodiments, when binding to a target the second nucleoside the three is opposite to a target adenosine. In some embodiments, the sugar of a second nucleoside does not contain any 2’-OR modifications as described herein (e.g., 2'-0Me. 2’-M0E etc.). In some embodiments, such a sugar is a natural DNA sugar. In some embodiments, it is a natural RNA sugar. In some embodiments, it is a 2 ’-F modified sugar. In some embodiments, a third subdomain comprises one or more (e.g., 1-10, 1-5, 1-3, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) sugars each independently comprising a 2 ’-OR modification wherein R is not -H (e.g., 2’-OMe, 2, -MOE, 2‘-O-LB-4’ wherein LBis optionally substituted ( I f. etc.). In some embodiments, there are more such sugars in a third subdomain than 2’-F modified sugars.[0013J In some embodiments, a second domain comprises at least 1, 2. 3, 4, 5, 6, 7, 8, 9, 10. 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more modified sugars independently comprising a 2’-OR modification, or at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of all sugars of a second domain comprise a 2’-OR modification, wherein R is optionally substituted Ci 6 aliphatic. In some embodiments, R is methyl. In some embodiments, R is “CH2CH2OCH3. As described herein, other sugar modifications may also be utilized in accordance with the present disclosure, optionally with base modifications and / or intemucleotidic linkage modifications described herein.

[0014] In some embodiments, an oligonucleotide comprises or is of a 5 ’-first domain-second domain-3’ structure. In some embodiments, a second domain comprises or is of a 5’-first subdomain-second subdomain-third subdomain-3’ structure. In some embodiments, an oligonucleotide comprises or is of a 5 '-first domain-first subdomain-second subdomain-third subdomain-3’ structure. In some embodiments, oligonucleotide is conjugated to an additional moiety, e.g., various additional chemical moieties as described herein. In some embodiments, an oligonucleotide comprises an additional moiety, e.g., an additional moiety as described herein. In some embodiments, an additional chemical moiety is or comprises a small molecule moiety, a carbohydrate moiety (e.g., GalNAc moiety), a nucleic acid moiety (e.g., an oligonucleotide moiety, a nucleic acid moiety which can provide and / or modulate one or more properties and / or activities, etc. (e.g., a moiety of RNase H-dependent oligonucleotide, RNAi oligonucleotide, aptamer, gRNA, etc.), and / or a peptide moiety.

[0015] In some embodiments, base sequence of a provided oligonucleotide is substantially complementary’ to the base sequence of a target nucleic acid comprising a target adenosine In some embodiments, a provided oligonucleotide when aligned to a target nucleic acid comprises one or more mismatches (non-Watson-Crick base pairs). In some embodiments, a provided oligonucleotide when aligned to a target nucleic acid comprises one or more wobbles (e.g., G-U, I-A, G-A, I-U, 1-C, etc.). In some embodiments, mismatches and / or wobbles may help one or more proteins, e.g,. ADAR1. ADAR2. etc., to recognize a duplex formed by a provided oligonucleotide and a target nucleic acid. In some embodiments, provided oligonucleotides form duplexes with target nucleic acids. In some embodiments, ADAR proteins recognize and bind to such duplexes. In some embodiments, nucleosides opposite to target adenosines arelocated in the middle of provided oligonucleotides, e.g., with 5-50 nucleosides to 5" side, and 1-50 nucleosides on its 3" side. In some embodiments, a 5’ side has more nucleosides than a 3’ side. In some embodiments, a 5' side has fewer nucleosides than a 3' side. In some embodiments, a 5' side has the same number of nucleosides as a 3’ side. In some embodiments, provided oligonucleotides comprise 15-40, e.g.. 15. 20. 25.30, etc. contiguous bases of oligonucleotides described in the Tables. In some embodiments, base sequences of provided oligonucleotides are or comprises base sequences of oligonucleotides described in the Tables.

[0016] In some embodiments, with utilization of various structural elements (e.g., various modifications, stereochemistry, and patterns thereof), the present disclosure can achieve desired properties and high activities with short oligonucleotides, e.g.. those of about 20-40, 25-40, 25-35, 26-32, 25, 26, 27, 28, 29, 30, 31, 32. 33, 34 or 35 nucleobases in length.

[0017] In some embodiments, provided oligonucleotides comprise modified nucleobases. In some embodiments, a modified nucleobase promotes modification of a target adenosine. In some embodiments, a nucleobase which is opposite to atarget adenine maintains interactions with an enzyme, e.g., ADAR, compared to when a U is present, while interacts with a target adenine less strongly than U (e.g., forming fewer hydrogen bonds). In some embodiments, an opposite nucleobase and / or its associated sugar provide certain flexibility (e.g., when compared to U) to facility modification of a target adenosine by enzymes, e.g., ADAR 1. ADAR2, etc. In some embodiments, a nucleobase immediately 5’ or 3’ to the opposite nucleobase (to atarget adenine), e.g., I and derivatives thereof, enhances modification of a target adenine. Among other things, the present disclosure recognizes that such a nucleobase may causes less steric hindrance than G -when a duplex of a provided oligonucleotide and its target nucleic acid interact with a modifying enzyme, e.g., ADARl or ADAR2. In some embodiments, base sequences of oligonucleotides are selected (e.g., w hen several adenosine residues are suitable targets) and / or designed (e.g., through utilization of various nucleobases described herein) so that steric hindrance may be reduced or removed (e g., no G next to the opposite nucleoside of a target A).

[0018] Various intemucleotidic linkages may be utilized in oligonucleotides in accordance with the present disclosure In some embodiments, an oligonucleotide comprises one or more types of intemucleotidic linkage. In some embodiments, an oligonucleotide comprises two or more types of intemucleotidic linkage. In some embodiments, an oligonucleotide comprises at least three types of intemucleotidic linkages. In some embodiments, a linkage contains a linkage phosphorus atom bonded to an oxygen atom which oxygen atom is not bonded to or is not part of a backbone sugar (‘"a PO linkage”, e.g., a natural phosphate linkage). In some embodiments, a linkage contains a linkage phosphorus atom bonded to a sulfur atom which sulfur atom is not bonded to or is not part of a backbone sugar (“a PS linkage”, e.g., a phosphorothioatc intemucleotidic linkage). In some embodiments, a linkage contains a linkage phosphorus atom bonded to a nitrogen atom which nitrogen atom is not bonded to or is not. part of a backbone sugar (‘‘a PN linkage”, e.g., nOO l). In some embodiments, an oligonucleotide comprises one or more PS linkages. In some embodiments, an oligonucleotide comprises one or more PO linkages. In some embodiments, an oligonucleotide comprises one or more PM linkages. In some embodiments, an oligonucleotide comprises one or more PS and one or more PO linkages. In someembodiments, an oligonucleotide comprises one or more PS and one or more PN linkages. In some embodiments, an oligonucleotide comprises one or more PS, one or more PN and one or more PO linkages. In some embodiments, a PS linkage is a phosphorothioate linkage. In some embodiments, each PS linkage is independently a phosphorothioate linkage. In some embodiments, a PO linkage is a natural phosphate linkage. In some embodiments, each PO linkage is independently a natural phosphate linkage. In some embodiments, a PN linkage is a phosphoryl guanidine linkage. In some embodiments, each PN linkage is independently a phosphoryl guanidine linkage.

[0019] In some embodiments, a first domain composes one or more PO linkages, one or more PS linkages and one or more PN linkages. In some embodiments, a first subdomain comprises one or more PO linkages, one or more PS linkages and / or one or more PN linkages. In some embodiments, a first subdomain comprises one or more PO linkages. In some embodiments, a first subdomain comprises one or more natural phosphate linkages. In some embodiments, second subdomain comprises one ormore modified internucleotidic linkages. In some embodiments, each internucleotidic linkage bonded to a nucleoside of a second subdomain is independently a modified internucleotidic linkage. In some embodiments, each internucleotidic linkage bonded to a nucleoside of a second subdomain is independently a PS or PN linkages. In some embodiments, a third subdomain comprises one or more PO linkages, one or more PS linkages and / or one or more PN linkages. In some embodiments, a third subdomain comprises one or more PO linkages. In some embodiments, a third subdomain comprises one or more natural phosphate linkages. In some embodiments, a third subdomain comprises one or more PS linkages In some embodiments, a third subdomain comprises one or more PN linkages. In some embodiments, a third subdomain comprises one or more PO linkages, one or more PS linkages and one or more PN linkages. In some embodiments, the first internucleotidic linkage of a first domain or an oligonucleotide is a PN linkage. In some embodiments, the last internucleotidic linkage of a third subdomain oran oligonucleotide is a N linkage In some embodiments, a natural DNA sugaris bonded to a modified internucleotidic linkage. In some embodiments, a natural DNA sugar is bonded to a PN or PS internucleotidic linkage. In some embodiments, each natural DNA sugar in an oligonucleotide or a portion thereof (e.g., a first domain, a first subdomain, a second subdomain, a third subdomain, etc.) is independently bonded to a modified internucleotidic linkage. In some embodiments, each natural DNA sugar is independently bonded to a PN or PS internucleotidic linkage. In some embodiments, a natural RNA sugar is bonded to a modified internucleotidic linkage. In some embodiments, a natural RNA sugar is bonded to a PN or PS internucleotidic linkage. In some embodiments, each natural RNA sugar in an oligonucleotide or a portion thereof (e.g., a first domain, a first subdomain, a second subdomain, a third subdomain, etc.) is independently bonded to a modified internucleotidic linkage. In some embodiments, each natural RNA sugar is independently bonded to a PN or PS internuc eotidic linkage,

[0020] In some embodiments, a 2’-F modified sugar is bonded to a modified internucleotidic linkage. In some embodiments, a 2’-F modified sugar is bonded to a PN or PS internucleotidic linkage. In some embodiments, each 2’-F modified sugar in an oligonucleotide or a portion thereof (e.g., a first domain, a firstsubdomain, a second subdomain, a third subdomain, etc.) is independently bonded to a modified internucleotidic linkage. In some embodiments, each 2’-F modified sugar is independently bonded to a PN or PS internucleotidic linkage. In some embodiments, each PO linkage is independently a natural phosphate linkage. In some embodiments, each PS linkage is independently a phosphorothioate internucleotidic linkage. In some embodiments, one or more PN linkages are independently non-negatively charged internucleotidic linkage. In some embodiments, one or more PN linkages are independently neutral internucleotidic linkage. In some embodiments, one or more PN linkages are independently phosphoryl guanidine linkages. In some embodiments, each PN linkage is independently a phosphoryl guanidine linkage. In some embodiments, one or more PN linkages are independently nOOl. In some embodiments, each PN linkage is independently nOOl.

[0021] In some embodiments, oligonucleotides of the present disclosure provides modified internucleotidic linkages (i.e., internucleotidic linkages that are not natural phosphate linkages). In some embodiments, linkage phosphonis of modified internucleotidic linkages (e.g., chiral internucleotidic linkages) are chiral and can exist in different configurations (J?p and p). Among other things, the present disclosure demonstrates that incorporation of modified internucleotidic linkage, particularly with control of stereochemistry of linkage phosphorus centers (so that at such a controlled center one configuration is enriched compared to stereorandom oligonucleotide preparation), can significantly improve properties (e.g,. stability) and / or activities (e g., adenosine modifying activities (e g., converting an adenosine to inosine). In some embodiments, provided oligonucleotides have stereochemical purity significantly higher than stereorandom preparations. In some embodiments, provided oligonucleotides are chirally controlled.

[0022] In some embodiments, oligonucleotides of the present disclosure comprise one or more chiral internucleotidic linkages whose linkage phosphorus is chiral (e.g., a phosphorothioate internucleotidic linkage). In some embodiments, at least 1. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13. 14, 15, 16, 17, 18, 19, or 20, or at least 50%. 60%, 70%. 75%, 80%. 85%, 90%. 95%, or 99% (e.g., 50%- 100%. 60%-100%, 70-100%, 75%-100%, 80%-I00%, 90%-100%, 95%-100%, 60%-95%, 70%-95%, 75-95%, 80-95%, 85-95%, 90-95%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, etc.) of all, or all internucleotidic linkages in an oligonucleotide, are chiral internucleotidic linkages. In some embodiments, at least one internucleotidic linkage is a chiral internucleotidic linkage. In some embodiments, at least one internucleotidic linkage is a natural phosphate linkage. In some embodiments, each internucleotidic linkage is independently a chiral internucleotidic linkage. In some embodiments, at least one chiral internucleotidic linkage is a phosphorothioate internucleotidic linkage. In some embodiments, each is a phosphorothioate internucleotidic linkage. In some embodiments, one or more chiral internucleotidic linkages arc independently a non-negatively charged internucleotidic linkage or a neutral internucleotidic linkage. In some embodiments, one or more chiral internucleotidic linkages are independently a phosphoryl guanidine internucleotidic linkage. In some embodimen ts, one or more chiral internucleotidic linkages are independently chirally controlled. In some embodiments, each chiral internucleotidic linkage is independently chirally controlled, in some embodiments, one or more chiral internucleotidic linkages are not chirally controlled. In some embodiments, eachphosphorothioate intemucleotidic linkage is independently chirally controlled. In some embodiments, each modified intemucleotidic linkage is independently a phosphorothioate or a non-negatively charged intemucleotidic linkage In some embodiments, each modified intemucleotidic linkage is independently a phosphorothioate or a neutral intemucleotidic linkage. In some embodiments, each modified intemucleotidic linkage is independently a phosphorothioate or a neutral intemucleotidic linkage. In some embodiments, each modified intemucleotidic linkage is independently a phosphorothioate or a phosphoryl guanidine intemucleotidic linkage. In some embodiments, a phosphoryl guanidine intemucleotidic linkage is nOOl. In some embodiments, each phosphoryl guanidine intemucleotidic linkage is nOOl. In some embodiments, each non-negatively charged intemucleotidic linkage is nOOl. In some embodiments, each neutral intemucleotidic linkage is nOOl. In some embodiments, a modified intemucleotidic linkage n002. In some embodiments, it is n006. In some embodiments, it is n020. In some embodiments, it is n004. In some embodiments, it is n008. In some embodiments, it is n025. In some embodiments, it is n026. V arious modified intemucleotidic linkages are described herein. A linkage phosphorus can be either 7?p or. So In some embodiments, at least one linkage phosphorus is Rp. In some embodiments, at least one linkage phosphorus is Sp. In some embodiments, at least 1, 2, 3, 4. 5, 6, 7, 8. 9, 10. 11. 12, 13, 14, 15, 16, 17, 18. 19. or 20, or at least 50%, 60%, 70%. 75%. 80%, 85%, 90%, 95%, or 99% (e.g.. 50%- 100%, 60%-100%. 70-100%. 7.5%-100%, 80%-100%, 90%-100%. 95%-100%. 60%-95%, 70%-95%, 75-95%. 80-95%, 85-95%, 90-95%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, etc.) of all, or all chiral intemucleotidic linkages in an oligonucleotide, are Sp. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15. 16, 17, 18, 19, or 20, or at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% (e.g., 50%-100%, 60%-100%, 70-100%, 75%-100%, 80%-100%, 90%-l00%, 95%-100%. 60%-95%. 70%-95%, 75-95%, 80-95%. 85-95%. 90-95%, 50%, 60%, 70%, 75%, 80%, 85%, 90%. 95%, or 99%, etc.) of all, or all phosphorothioate intemucleotidic linkages in an oligonucleotide, are. Sp. In some embodiments, at least 50% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, at least 60% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, at least 70% of all phosphorothioate intemucleotidic linkage arc Sp. In some embodiments, at least 75% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, at least 80% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, at least 85% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, at least 90% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, at least 95% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, at least 96% of all phosphorothioate intemucleotidic linkage are Sp. Tn some embodiments, at least 97% of all phosphorothioate intemucleotidic linkage arc Sp. In some embodiments, at least 98% of all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, all phosphorothioate intemucleotidic linkage are Sp. In some embodiments, no more than 3. 4, 5, 6, 7, 8. 9, or 10 consecutive phosphorothioate intemucleotidic linkages are?p. In some embodiments, no more than 3 consecutive phosphorothioate intemucleotidic linkages are Ap. In some embodiments, no more than 4 consecutive phosphorothioate intemucleotidic linkages are Rp. In some embodiments, no more than 5 consecutivephosphorothioate intemucleotidic linkages are Rp. In some embodiments, no more than 6 consecutive phosphorothioate intemucleotidic linkages are Rp. In some embodiments, no more than 7 consecutive phosphorothioate intemucleotidic linkages are Rp. In some embodiments, no more than 8 consecutive phosphorothioate intemucleotidic linkages are Rp. In some embodiments, no more than 9 consecutive phosphorothioate intemucleotidic linkages are Rp. In some embodiments, no more than 10 consecutive phosphorothioate intemucleotidic linkages are Rp. In some embodiments, consecutive Rp phosphorothioate intemucleotidic linkages are not utilized in portions wherein the majority (e.g., greater than 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or more) or all of sugars are natural DNA and / or RNA and / or 2’-F modified sugars. In some embodiments, when consecutive Rp phosphorothioate intemucleotidic linkages are utilized, one or more or the majority' (e.g., greater than 50%, 60%, 70%, 75%. 80%, 85%, 90%, 95% or more) or all of such intemucleotidic linkages are independently bonded to sugars which can improve stability. In some embodiments, when consecutive Rp phosphorothioate intemucleotidic linkages are utilized, one or more or the majority (e.g., greater than 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or more) or all of such intemucleotidic linkages are independently bonded to bicyclic sugars or 2'-OR modified sugars wherein R is optionally substituted Civ, aliphatic. In some embodiments, when consecutive Rp phosphorothioate intemucleotidic linkages are utilized, one or more or the majority (e.g, greater than 50%. 60%, 70%. 75%, 80%. 85%. 90%, 95% or more) or all of such intemucleotidic linkages are independently bonded to 2 -OR modified sugars wherein R is optionally substituted Civ aliphatic, hi some embodiments, each 2’-OR modified sugar is independently a 2’-OMe modified sugar or a 2 ’-MOE modified sugar. In some embodiments, each 2 ’-OR modified sugar is independently' a 2'-OMe modified sugar. In some embodiments, each 2 -OR modified sugar is independently a 2 -MOE modified sugar.10023 J In some embodiments, stereochemistry-' of one or more chiral linkage phosphorus of provided oligonucleotides are controlled in a composition. In some embodiments, the present disclosure provides a composition comprising a plurality of oligonucleotides, wherein oligonucleotides of a plurality share a common base sequence, and the same configuration of linkage phosphorus (e.g., all arc Rp or all arc 5p for the chiral linkage phosphorus) independently at one or more (e.g., about 1-50, 1-40, 1-30, 1-25. 1-20, 1-15, 1-10, 5-50, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 1, 2, 3. 4, 5, 6. 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19. 20. 21.22, 23, 24, or 25 or more, or at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of all chiral intemucleotidic linkages) chiral intemucleotidic linkages (“chirally controlled intemucleotidic linkages”) In some embodiments, they share the same stereochemistry at each chiral linkage phosphorus. In some embodiments, oligonucleotides of a plurality share the same constitution. In some embodiments, oligonucleotides of a plurality' are structurally identical except the intemucleotidic linkages. In some embodiments, oligonucleotides of a plurality are structurally identical. In some embodiments, at least at least about 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of ail oligonucleotides in a composition, or of all oligonucleotides sharing the common base sequence, share the pattern of backbone chiral centers of oligonucleotides of the plurality In some embodiments, at least about 50%, 60%, 65%, 70%, 75%, 80%, 85%,90%, or 95% of all oligonucleotides in a composition, or of all oligonucleotides sharing the common base sequence, are oligonucleotides of the plurality.

[0024] In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide, wherein at least about 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of all oligonucleotides in a composition, or of all oligonucleotides having the same base sequence of the oligonucleotide, or of all oligonucleotide having the same base sequence and sugar and base modifications, or of all oligonucleotides of the same constitution, share die same configuration of linkage phosphorus (e.g., all are Zip or all are 5p for the chiral linkage phosphorus) independently at one or more (e.g., about 1 -50, 1-40, 1-30, 1-25, 1-20, 1-15, 1-10. 5-50, 5-40. 5-30. 5-25. 5-20, 5-15, 5-10, 1, 2, 3, 4. 5, 6, 7, 8. 9, 10, 11, 12. 13. 14, 15, 16. 17, 18. 19. 20. 21, 22, 23, 24, or 25 or more, or at least 50%, 60%, 70%, 75%, 80%. 85%, 90%. 95%. or 99% of all chiral intemucleotidic linkages) chiral intemucleotidic linkages with the oligonucleotide. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide, wherein at least about 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of all oligonucleotides in a composition, or of all oligonucleotides having the same base sequence of the oligonucleotide, or of all oligonucleotide having the same base sequence and sugar and base modifications, or of all oligonucleotides of the same constitution, are one or more forms of the oligonucleotide (e.g., acid forms, salt forms (e g. pharmaceutically acceptable salt forms; as appreciated by those skilled in the art, in case the oligonucleotide is a salt, other salt forms of the corresponding acid or base form of the oligonucleotide), etc.).

[0025] In some embodiments, as demonstrated herein chirally controlled oligonucleotide compositions provide a number of advantages, e.g., higher stability, activities, etc,, compared to corresponding stereorandom oligonucleotide compositions. In some embodiments, it was observed that chirally controlled oligonucleotide compositions provide high levels of adenosine modifying (e.g., converting A to I) activities with various isoforms of an ADAR protein (e.g, pl50 and pl 10 forms of ADAR I) while corresponding stereorandom compositions provide high levels of adenosine modifying (e.g., converting A to I) activities with only certain isofomis of an ADAR protein (e.g., p 150 isoform of ADAR1).

[0026] In some embodiments, provided oligonucleotides comprise an additional moiety, e.g., a targeting moiety, a carbohydrate moiety, etc. In some embodiments, an additional moiety is or comprises a ligand for an asialoglycoprotein receptor. In some embodiments, an additional moiety is or comprises GalNAc or derivatives thereof. Among other things, additional moieties may facilitate delivery to certain target locations, e.g., cells, tissues, organs, etc. (e.g., locations comprising receptors that interact with additional moieties). In some embodiments, additional moieties facilitate delivery to liver.

[0027] In some embodiments, the present disclosure provides technologies for preparing oligonucleotides and compositions thereof, particularly chtrally controlled oligonucleotide compositions. In some embodiments, provided oligonucleotides and compositions thereof are of high purity. In some embodiments, oligonucleotides of the present disclosure are at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% stereochemically pure at linkage phosphorus of chiral intemucleotidic linkages. In some embodiments,oligonucleotides of the present disclosure are prepared stereoselectively and are substantially free of stereoisomers. In some embodiments, in provided compositions comprising a plurality of oligonucleotides which share the same base sequence of the same pattern of chiral linkage phosphorus stereochemistry (e.g., comprising one or more of Ap and / or 5p, wherein each chiral linkage phosphorus is independently 7?p or Sp). at least 50%, 60%, 70%, 75%. 80%, 85%. 90%, 95%. or 99% of all oligonucleotides in the composition that share the same base sequence as oligonucleotides of the plurality share the same patern of chiral linkage phosphorus stereochemistry or are oligonucleotides of the plurality. In some embodiments, in provided compositions comprising a plurality of oligonucleotides which share the same base sequence of the same pattern of chiral linkage phosphorus stereochemistry', at least 50%, 60%. 70%. 75%, 80%, 85%, 90%, 95%, or 99% of all oligonucleotides in the composition that share the same constitution as oligonucleotides of the plurality share the same pattern of chiral linkage phosphorus stereochemistry' or are oligonucleotides of the plurality.

[0028] In some embodiments, the present disclosure describes useful technologies for assessing oligonucleotide and compositions thereof. For example, various technologies of the present disclosure are useful for assessing adenosine modification. As appreciated by those skilled in the art, in some embodiments, modification / editmg of adenosine can be assessed through sequencing, mass spectro etry', assessment (e.g., levels, activities, etc.) of products (e.g, RNA, protein, etc.) of modified nucleic acids (e g., wherein adenosines of target nucleic acids are converted to inosines), etc., optionally' in view of other components (e.g., ADAR proteins) presence in modification systems (e.g., an in vitro system, an ex vivo system, cells, tissues, organs, organisms, subjects, etc.). Those skilled in the art will appreciate that oligonucleotides which provide adenosine modification of a target nucleic acid can also provide modified nucleic acid (e.g., wherein a target adenosine is converted into I) and one or more products thereof (e.g., mRNA, proteins, etc.). Certain useful technologies are described in the Examples

[0029] As described herein, oligonucleotides and compositions of the present disclosure may be providcd / utilizcd in various forms. In some embodiments, the present disclosure provides compositions comprising one or more forms of oligonucleotides, e.g., acid forms (e.g., in which natural phosphate linkages exist as O(P(O)(OH) -O -, phosphorothioate internucleotidic linkages exist as O(P(O)(SH) O -). base forms, salt forms (e.g., in which natural phosphate linkages exist as salt forms (e.g., sodium salt (-O(P(O)(O Na )-O-), phosphorothioate internucleotidic linkages exist as salt forms (e g., sodium salt (-O(P(O)(S-Na+)“O“) etc. As appreciated by those skilled in the art, oligonucleotides can exist in various salt forms, including pharmaceutically acceptable salts, mid in solutions (e.g., various aqueous buffering system), cations may dissociate from anions. In some embodiments, the present disclosure provides a pharmaceutical composition comprising a provided oligonucleotide and / or one or more pharmaceutically acceptable salts thereof, and a pharmaceutically acceptable carrier. In some embodiments, pharmaceutical compositions are chirally controlled oligonucleotide compositions

[0030] Provided technologies can be utilized for various purposes. For example, those skilled in the artwill appreciate that provided technologies are useful for many purposes involving modification of adenosine, e.g., correction of G to A mutations, modulate levels of certain nucleic acids and / or products encoded thereby (e.g., reducing levels of proteins by introducing A to G / I modifications), modulation of splicing, modulation of translation (e.g., modulating translation start and / or stop site by introducing A to G / I modifications), modulation of RNA / protein interactions, etc.

[0031] In some embodiments, the present disclosure provides technologies for preventing or treating a condition, disorder or disease that is amenable to an adenosine modification, e.g. conversion of A to I or G. As appreciated by those skilled in the art, I may perform one or more functions of G, e.g., in base pairing, translation, etc. In some embodiments, the present disclosure provides technologies for preventing or treating a condition, disorder or disease associated with a mutation, comprising administering to a subject susceptible thereto or suffering therefrom a provided oligonucleotide or composition thereof, which oligonucleotide or composition can edit a mutation In some embodiments, the present disclosure provides technologies for preventing or treating a condition, disorder or disease associated with LDLR, comprising administering to a subject susceptible thereto or suffering therefrom a provided oligonucleotide or composition thereof, which oligonucleotide or composition can modify an A. In some embodiments, provided technologies modify an A in a transcript, e.g., RNA transcript. In some embodiments, an A is converted into an I. In some embodiments, an A form has one or more higher desired activities and / or one or more better desired properties compared those its corresponding G form. In some embodiments, an A form provides higher levels, compared to its corresponding G form, of one or more proteins that have desired activities and / or desired properties. In some embodiments, an A fonn provides structurally identical products (e.g., proteins) compared to its corresponding G form.

[0032] In some embodiments, the present disclosure provides technologies for modulating RNA / protein interactions by, e.g., editing target adenosines using oligonucleotides and composition described herein In some embodiments, the present disclosure provides technologies for modulating levels of RNA and / or products encoded thereby by, e.g., editing a target adenosine. In some embodiments, the present disclosure provides technologies for increasing levels of RNA and / or products (e.g., polypeptides) encoded thereby by, e.g., editing a target adenosine. In some embodiments, a target adenosine is present in a RNA motif, e.g., an AU -rich element (ARE) motif. In some embodiments, a RNA motif is or comprises a regulatory' element. In some embodiments, a RNA motif is or comprises a civ-acting regulatory' element. In some embodiments, a motif, e.g., an ARE motif, comprises one or more AUUUA in an A and U rich region. In some embodiments, an ARE motif comprise a core sequence of AUUUA within a U-rich sequence (e.g., WWWU(AUUUA)UUUW wherein W is A or U). In some embodiments, AUUUA element are repeated. In some embodiments, ARE motifs comprise dispersed AUUUA motifs within or near U-rich regions. In some embodiments, ARE motifs comprise overlapping AUUUA motifs within or near U-rich regions. In some embodiments, ARE motifs comprise one or more of WUUUW, WWUUUWW, WWWUUUWWW, WWWWUUUXWWW, WWWWWUUUWWWWW, and / or AWUAAA, yvherem W is U or A. ARE motifs can have various lengths.In some embodiments, an ARE motif comprises UUUUAUAUAUUUAUU, UUAAUAUUUAUUAA, or AUUUGUGUUAUUAUUUU. In some embodiments, an ARE motif is or comprises about a 50-150 base sequence. As appreciated by those skilled in the art, various RNA motifs, e.g., ARE motifs, can facilitate binding of various RNA-binding polypeptides or proteins. In some embodiments, editing of an adenosine in a RNA modulates properties, structures, functions, etc. of a RNA. In some embodiments, editing of an adenosine in a RNA modulates RNA processing, stability, transport, etc. In some embodiments, editing of an adenosine in a RNA modulates RNA interactions with other entities, e.g., RNA-binding polypeptides such as ARE-binding polypeptides, miRNA, etc. A number of polypeptides (e.g. HuA. HuB, HuC, HuD, HuR, etc.) are reported to bind to ARE motifs and stabilize mRNA. while others (e.g., AUF1, TTP. BRF1, TIA-1, TIAR, KSRP, etc.) have been reported to bind to ARE motifs and destabilize mRNA. In some embodiments, adenosine editing enhances binding to an ARE motif that stabilizes mRNA. In some embodiments, adenosine editing reduces binding to an ARE motif that destabilizes mRNA. In some embodiments, adenosine editing enhances binding to an ARE motif that stabilizes mRNA, and reduces binding to an ARE motif that destabilizes mRNA. In some embodiments, adenosine editing reduces binding to an ARE motif that stabilizes mRNA. In some embodiments, adenosine editing enhances binding to an ARE motif that destabilizes mRNA. In some embodiments, adenosine editing reduces binding to an ARE motif that stabilizes mRNA. and enhances binding to an ARE motif that destabilizes mRNA. In some embodiments, editing of an adenosine in a RNA modulates level of a RNA. In some embodiments, editing of an adenosine in a RNA modulates level of a product (e.g., a polypeptide) encoded thereby. In some embodiments, editing of an adenosine in a RNA increases level of the RNA. In some embodiments, editing of an adenosine in a RNA increases level of a product (e.g., a polypeptide) encoded thereby. In some embodiments, a RNA is a transcript. In some embodiments, a RNA is mRNA. In some embodiments, an adenosine is in a UTR region. In some embodiments, an adenosine is in a 5’-UTR region. In some embodiments, an adenosine is in a 3 ’-UTR region. In some embodiments, an adenosine is in a RN A motif. In some embodiments, a RNA motif is an ARE motif. In some embodiments, the present disclosure provides technologies for preventing or treating a condition, disorder or disease associated with levels of a transcript and / or a product encoded thereby, comprising administering to a subject susceptible thereto or suffering therefrom a provided oligonucleotide or composition thereof, which oligonucleotide or composition can modify a target adenosine in the transcript. In some embodiments, the present disclosure provides technologies for preventing or treating a condition, disorder or disease, comprising administering to a subject susceptible thereto or suffering therefrom a provided oligonucleotide or composition thereof, which oligonucleotide or composition can modify a target adenosine in a RNA thereby modulating (e.g., increasing) levels of a RNA and / or a product encoded thereby. In some embodiments, a RNA is a transcript. In some embodiments, a transcript is a LDLR transcript, e.g., a LDLR mRNA. In some embodiments, a product encoded thereby is a LDLR polypeptide, e.g., a LDLR protein. In some embodiments, a RNA motif is in a LDLR transcript, e.g., in 5’ UTR of a LDLR mRNA. In some embodiments, a RNA motif is in a LDLR transcript, e.g., in 3’ UTR of a LDLR mRNA. Various target adenosines and targeting regionsare described as described herein, e.g., those targeted by oligonucleotides in the relevant Tables.

[0033] As those skilled in the art will appreciate, many conditions, disorders or diseases are associated with mutations that can be modified by provided technologies and can be prevented and / or treated using provided technologies. In some embodiments, a condition, disorder or disease is associated with LDLR. In some embodiments, a condition, disorder or disease is associated with a mutation of LDLR. In some embodiments, a condition, disorder or disease is hyperlipidemia. In some embodiments, a condition, disorder or disease is hypercholesterolemia. In some embodiments, a condition, disorder or disease is familial hypercholesterolemia (FH). In some embodiments, a condition, disorder or disease is heterozygous familial hypercholesterolemia (HeFII). In some embodiments, a condition, disorder or disease is atherosclerotic cardiovascular disease (ASCVD).BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1. Provided technologies can provide editing of target transcripts and upregulation of polypeptides encoded thereby. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2’-F, 2 -OMe), base modifications (e.g.. [3nUj), and stereochemistry and patterns thereof were designed and assessed. Primary human hepatocytes were dosed gymnotically with 10 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 48 hrs later. As shown in the left graph, RNA was collected and transcribed into cDNA. Editing was quantified by Sanger sequencing. As shown in the right graph, protein was collected and quantified by Bradford assay (for total protein) and LDLR ELISA. Error bars represent standard deviation. N=4 for left graph; N=14 for right graph. NT = Mock treated with PBS.

[0035] Figure 2. Provided technologies can provide increased levels of target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2 -F, 2‘-0Me), base modifications (e.g., [3nU]), and stereochemistry' and patterns thereof were designed and assessed. Primary human hepatocytes (Hu8372) were dosed gymnotically with 5 uM of the indicated oligonucleotides targeting LDLR or with 10 uM of simvastatin or lovastatin. Non-targeting control oligonucleotides (ADR-0101520. ADR-0102055) were also assessed. Cells were harvested after 72 hours. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Graphs display mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. Error bars represent standard error of the mean (SEM).

[0036] Figure 3. Provided technologies can provide increased levels of target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g.. 2'-F, 2’-OMe). base modifications (e.g, [3nU]), and stereochemistry' and patterns thereof were designed and assessed. Primary' human hepatocytes (Hu8372) were dosed gymnotically with 5 uM of indicated oligonucleotides targeting LDLR with or without 5 uM of simvastatin. Non-targeting control oligonucleotides (ADR-0101520, ADR-0102055) were also assessed. Cells were harvested after 96 hours. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. Error bars represent SEM

[0037] Figure 4. Provided technologies can provide increased levels of target transcripts. Oligonucleotides comprising various base sequences and modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2’-F, 2’-0Me), base modifications (e.g., [3nU]), and stereochemistry and patterns thereof were designed and assessed. Primary human hepatocytes (Hu8372) were dosed gymnotically with 3 uM of indicated oligonucleotides targeting LDLR. All oligonucleotides were GalNAc conjugated. Lovastatin was dosed at 1.5 uM. Nontargeting control oligonucleotide (ADR-0100230) was also assessed. Cells were harvested after 96 hours. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. Error bars represent SEM.

[0038] Figure 5. Provided technologies can provide increased levels of proteins encoded by target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl). etc.), sugar modifications (e.g., 2’-F, 2'-0Me). base modifications (e.g,, [3nUj). and stereochemistry’ and patterns thereof were designed and assessed. Primary human hepatocytes (Hu8372) were dosed gymnotically with 3 uM of indicated oligonucleotides targeting LDLR. All oligonucleotides were GalNAc conjugated. Lovastatin was dosed at 1.5 uM. Non-targeting control oligonucleotide (ADR-0100230) was also assessed. Cells wrere harvested after 96 hours. Cells were lysed in RIPA buffer, levels of total protein in ly sates quantified using a DC Protein Assay kit (BioRad 5000111), and levels of LDLR protein in lysates quantified using a LDLR ELISA kit (Abeam ab270212) according to manufacturer’s instructions. Graph displays mean LDLR protein concentration normalized to total protein concentration Error bars represent SEM

[0039] Figure 6. Provided technologies can provide increased levels of target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g,, PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2'-F, 2"-0Me), base modifications (e.g., [3nL7]), and stereochemistry and patterns thereof were designed and assessed. Primary human hepatoeyftes (Hu8372) were dosed gymnotically with either 10 uM or 3 uM of indicated oligonucleotides targeting LDLR. All oligonucleotides were GalNAc conjugated. For ‘All AIMers”, a combination of ADR-0100230, ADR-0108472, ADR-0108476 was used at equal concentrations to form the total concentration (e.g., 1.11 uM of each oligonucleotide for 3.33 uM total concentration). Non-targeting control oligonucleotide (ADR-0100230) was also assessed. Cells were harvested after 96 hours. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR, Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. Error bars represent SEM.

[0040] Figure 7. Provided technologies can provide increased levels of proteins encoded by target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN(e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2’-F, 2’-0Me), base modifications (e.g., [3nU]), and stereochemistry and patterns thereof were designed and assessed. Primary human hepatocytes (Hu8372) were dosed gymnotically with either 10 uM or 3 uM of indicated oligonucleotides targeting LDLR. All oligonucleotides were GalNAc conjugated. For “All AIMers”, a combination of ADR-0100230, ADR-0108472, ADR-0108476 was used at equal concentrations to form the total concentration (e.g., 1.11 uM of each oligonucleotide for 3.33 uM total concentration). Non-targeting control oligonucleotide (ADR-0100230) was also assessed. Celis were harvested after 96 hours. Ceils were lysed in RIPA buffer, levels of total protein in lysates quantified using a DC Protein Assay kit (BioRad 5000111), and levels of LDLR protein in lysates quantified using a LDLR ELISA kit (Abeam ab270212) according to manufacturer’s instructions. Graph displays mean LDLR protein concentration normalized to total protein concentration. Error bars represent SEM.

[0041] Figure 8 Provided technologies can provide increased levels of target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as n001), etc.), sugar modifications (e.g., 2’-F, 2'-0Me), base modifications (e.g., [3nU]), and stereochemistry and patterns thereof were designed and assessed. Primary human hepatocytes (Hu8372) were dosed gymnotically with 3 uM of indicated oligonucleotides targeting LDLR. All oligonucleotides were GalNAc conjugated. Non-targeting control oligonucleotide (ADR-0100261) was also assessed. Cells were harvested after 96 hours. Total RNA was isolated and levels of LDLR mR A were quantified using qPCR. Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control, Error bars represent SEM.

[0042] Figure 9. Provided technologies can provide increased levels of target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g, 2 / -F, 2‘-OMe), base modifications (e.g, [3nU]), and stereochemistry and patterns thereof were designed and assessed. Primary human hepatocytes (Hu8372) were dosed gymnotically with 3 uM of indicated oligonucleotides targeting LDLR. All oligonucleotides ere GalNAc conjugated. Statin (lovastatin) as dosed at 3 uM. Non-targeting control oligonucleotide (ADR-0100230) was also assessed. Cells were harvested after 96 hours. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. Error bars represent SEM.

[0043] Figure 10. Provided technologies can provide increased levels of proteins encoded by target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2’-F, 2 -OMe), base modifications (e.g., [3nU]), and stereochemistry' and patterns thereof were designed and assessed. Primary human hepatocytes (Hu8372) were dosed gymnotically with 3 uM of indicated oligonucleotides targeting LDLR. All oligonucleotides were GalNAc conjugated. Statin (lovastatin) was dosed at 3 uM. Non-targeting control oligonucleotide (ADR-0100230) was also assessed. Cells w;ere harvested after 96 hours. Cells w7erelysed m RIP A buffer, levels of total protein in lysates quantified using a DC Protein Assay kit (BioRad 5000111), and levels of LDLR protein in lysates quantified using a LDLR ELISA kit (Abeam ab270212) according to manufacturer’s instructions. Graph displays mean LDLR protein concentration normalized to total protein concentration. Error bars represent SEM.

[0044] Figure 11. Provided technologies can provide increased levels of target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl). etc.), sugar modifications (e.g., 2’-F, 2 -OMe), base modifications (e.g., [3nU]), and stereochemistry and patterns thereof were designed and assessed. Primary human hepatocytes (PHH) from multiple donors (DQQ. Hu8373, Hu8409, Hu8413, Hu8235) were dosed gymnotically with either 3 uM or 0.3 uM of indicated oligonucleotides targeting LDLR. All oligonucleotides were GalNAc conjugated. Cells were harvested after 96 hours. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. For each donor, from left to right, columns represent data from Mock, ADR-0108472 (0.3 uM), ADR-0108472 (3 uM), ADR-0108474 (0.3 uM), ADR-0108474 (3 uM), ADR-0108476 (0.3 uM), and ADR-0108476 (3 uM). Error bars represent SEM.[0045J Figure 12. Provided technologies can provide increased levels of proteins encoded by target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2 -1'. 2’-0Me), base modifications (e.g., [3nU]), and stereochemistry and patterns thereof were designed and assessed. Primary human hepatocytes (PHH) from multiple donors (DQQ, Hu8409, Hu8413) were dosed gymnotically with either 3 uM or 0.3 uM of indicated oligonucleotides targeting LDLR. All oligonucleotides were GalNAc conjugated. Cells were harvested after 96 hours. Cells were lysed in RIPA buffer, le vels of total protein in lysates quantified using a DC Protein Assay' kit (BioRad 50001 11), and levels of LDLR protein in lysates quantified using a LDLR ELISA kit (Abeam ab270212) according to manufacturer’s instructions. Graph displays mean I, DLR protein concentration normalized to total protein concentration. For each donor, from left to right, columns represent data from Mock, ADR-0108472 (0.3 uM), ADR-0108472 (3 uM), ADR-0108474 (0.3 uM), ADR-0108474 (3 uM), ADR-0108476 (0.3 uM), and ADR-0108476 (3 uM). Error bars represent SEM.

[0046] Figure 13. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g.. PS. PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2'-F, 2'-0Mc), base modifications (e.g., [3nU]), and stereochemistry and patterns thereof were designed and assessed. Primary human hepatocytes (PHH) from multiple donors (DQQ, Hu8373. Hu8409, Hu8413, Hu823.5) were dosed gymnotically with either 3 uM or 0.3 uM of indicated oligonucleotides targeting LDLR or UGP2. All oligonucleotides were GalNAc conjugated. Cells were harvested after 96 hours. Total RNA was isolated and editing was quantified by Sanger sequencing. Graph displays mean editing percentage. For DQQ, Hu8409, Hu8413, and Hu8235, from left to right, columnsrepresent data from Mock, ADR-0108273 (0.3 uM), ADR-0108273 (3 uM), ADR-0108472 (0.3 uM), ADR-0108472 (3 uM), ADR-0108476 (0.3 uM), and ADR-0108476 (3 uM). ForHu8373, from left to right, columns represent data from Mock, ADR-0108273 (0.3 uM), ADR-0108273 (3 uM), ADR-0108472 (0.3 uM), ADR-0108472 (3 uM), and ADR-0108476 (3 uM). Error bars represent SEM

[0047] Figure 14. Provided technologies can provide increased levels of target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2'-F, 2‘-OMe), base modifications (e.g., [3nU]), and stereochemistry and patterns thereof were designed and assessed. Primary human hepatocytes (DQQ) -were dosed gymnotically with 3 uM, 0.75 uM, 0.19 uM or 0.05 uM of indicated oligonucleotides targeting LDLR or UGP2. All oligonucleotides were GalNAc conjugated. Cells were harvested after 96 hours. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Graphs display mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. Error bars represent SEM.

[0048] Figure 15. Provided technologies can provide increased levels of proteins encoded by target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl). etc.), sugar modifications (e.g.. 2'-F, 2'-OMe), base modifications (e.g, [3nU]), and stereochemistry' and patterns thereof were designed and assessed. Primary' human hepatocy tes (DQQ) were dosed gymnotically with 3 uM, 0.75 uM, 0.19 uM or 0.05 uM of indicated oligonucleotides targeting LDLR or UGP2. All oligonucleotides w7ere GalNAc conjugated. Cells were harvested after 96 hours. Cells were lysed in RIPA buffer, levels of total protein in lysates quantified using a DC Protein Assay kit (BioRad 5000111), and levels of LDLR protein in lysates quantified using a LDLR ELISA kit (Abeam ab270212) according to manufacturer’s instructions. Graph displays mean LDLR protein concentration normalized to total protein concentration. Error bars represent SEM

[0049] Figure 16 Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2’-F, 2'-0Me), base modifications (e.g., [3nU]), and stereochemistry and patterns thereof 'ere designed and assessed. Primary human hepatocytes (DQQ) were dosed gymnotically with 3 uM, 0.75 uM, 0.19 uM or 0.05 uM of indicated oligonucleotides targeting LDLR or UGP2. Cells were harvested after 96 hours. Total RNA was isolated and editing was quantified by Sanger sequencing. Graph displays mean editing percentage. Error bars represent SEM. Absence of column indicates no data reported (e.g., ADR-0110497 at 0.19 uM and 0.05 uM).

[0050] Figure 17. Provided technologies can provide increased levels of target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g,. PS, PN (e.g.. phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2 -F. 2’-0Me), base modifications (e g., [3n(J ]), and stereochemistry and patterns thereof were designed and assessed. Non-human primate hepatocydes were transfected with indicated oligonucleotides targeting LDLR or UGP2 at either 50nM or 20 nM. All oligonucleotides were GalNAc conjugated. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Graphs display mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control, Error bars represent SEM.

[0051] Figure 18. Provided technologies can provide increased levels of proteins encoded by target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g.. phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2’-F, 2 -OMe). base modifications (e g., [3nU]), and stereochemistry and patterns thereof were designed and assessed. Non-human primate hepatocytes were transfected with indicated oligonucleotides targeting LDLR or UGP2 at either 50 nM or 20 nM. All oligonucleotides were GalNAc conjugated. Cells were lysed in RIPA buffer, levels of total protein in lysates quantified using a DC Protein Assay kit (BioRad 5000111), and levels of LDLR protein in lysates quantified using a LDLR ELISA kit (Abeam ab270212) according to manufacturer’s instructions. Graph displays mean LDLR protein concentration normalized to total protein concentration. Error bars represent SEM.

[0052] Figure 19. Provided technologies can provide editing of target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g.. PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g.. 2’-F. 2’-OMe), base modifications (e.g., [3nU]). and stereochemistry' and patterns thereof were designed and assessed. Non-human primate hepatocytes were transfected with indicated oligonucleotides targeting LDLR or UGP2 at either 50 nM or 20 nM. All oligonucleotides were GalNAc conjugated. Total RNA was isolated and editing was quantified by Sanger sequencing. Graph displays mean editing percentage. Error bars represent SEM.

[0053] Figure 20. Provided technologies can provide increased uptake of LDL cholesterol. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc,), sugar modifications (e.g, 2 / -F, 2"-OMe), base modifications (e.g, [3nU]), and stereochemistry and patterns thereof were designed and assessed. Primary human hepatocytes (DQQ) were plated onto high content imaging plates and dosed with 3 uM of indicated oligonucleotides targeting LDLR. All oligonucleotides 'ere GalNAc conjugated. Lovastatin was dosed at 1 uM. After 96 hours, media was removed and replaced with Williams media containing 15 ug / ml fluorescently labeled LDL cholesterol. Cells w'ere incubated for a further 24 hours and then fixed and stained with DAPI. Cells were examined for fluorescently labeled LDL cholesterol by counting the number of positive pixels per cell per field of view' for 40 fields per treatment condition. Graph displays resulting data. **** p < 0.0001, using a Kruskal-Wallis test.

[0054] Figure 21. Provided technologies can provide increased levels of target transcripts. Oligonucleotides comprising various modifications, such as linkage modifications (e.g,. PS, PN (e.g.. phosphoryl guanidine linkages such as nOOl), etc,), sugar modifications (e.g., 2’-F, 2’-0Me), base modifications (e.g, [3nU]), and stereochemistry and patterns thereof were designed and assessed. Primary human hepatocytes were dosed with 3.3 uM of indicated oligonucleotides targeting LDLR or with 5 uM ofsimvastatin or lovastatin. Non-targeting control oligonucleotide (ADR-0100230) was also assessed. Cells were harvested after 96 hours. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. Error bars represent SEM.

[0055] Figure 22. Provided technologies can provide increased uptake of LDL cholesterol. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes (DQQ) were plated onto high content imaging plates and dosed with 3 uM of indicated oligonucleotides targeting LDLR. All oligonucleotides were GalN c conjugated. Lovastatin was dosed at 1 uM. After 96 hours, media was removed and replaced with Williams media containing 15 ug / ml fluorescently labeled LDL cholesterol. Celis were incubated for a further 24 hours and then fixed and stained with DAPI. Cells were examined for fluorescently labeled LDL cholesterol by counting the number of positive pixels per cell per field of view for 40 fields per treatment condition. Graph displays resulting data. ** p < 0.01, **** p < 0.0001, using a Kruskal -Wallis test.

[0056] Figure 23. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary’ human hepatocytes were dosed gymnotically with 100 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRN A as a percentage of total LDLR mRNA (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLRprotein levels relative to mock-treated control For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 100 nM and bottom bar represents data for 1 uM.

[0057] Figure 24. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 100 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein le els relative to mock-trcatcd control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 100 nM and bottom bar represents data for 1 uM.

[0058] Figure 25. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary7human hepatocytes were dosed gymnotically with 100 nM or 1 uM of the indicatedoligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLRmRNA as a percentage of total LDLR mRNA (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock -treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 100 nM and bottom bar represents data for 1 uM.

[0059] Figure 26. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 100 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLRmRNA. (B) Graph displays mean LDLRmRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock-treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 100 nM and bottom bar represents data for 1 uM.

[0060] Figure 27. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gy mnotically with 100 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock-treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 100 nM and bottom bar represents data for 1 uM.

[0061] Figure 28. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically' with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock-treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 200 nM and bottom barrepresents data for 1 uM.

[0062] Figure 29. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock-treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 200 nM and bottom bar represents data for 1 uM.

[0063] Figure 30. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock-treated control For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 200 nM and bottom bar represents data for 1 uM.

[0064] Figure 31. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes w ere dosed gymnotically w ith 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mR A. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control (C) Graph displays I TIER protein levels relative to mock -treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 200 nM and botom bar represents data for 1 uM.

[0065] Figure 32. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR proteinlevels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLRmRNA (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control, (C) Graph displays LDLR protein levels relative to mock -treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 200 nM and bottom bar represents data for 1 uM.

[0066] Figure 33. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock-treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 1 uM and bottom bar represents data for 200 nM.[0067J Figure 34. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR, Editing was quantified by Sanger sequencing, LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock -treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 1 uM and bottom bar represents data for 200 nM

[0068] Figure 35. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLRmRNA. (B) Graph displays mean LDLRmRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock-treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 1 uM and bottom bar represents data for 200 nM.

[0069] Figure 36. Provided technologies can provide editing of target transcripts, increased levels oftarget transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR, Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock -treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 1 uM and bottom bar represents data for 200 nM.

[0070] Figure 37. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR m RNA. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock-treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 200 nM and bottom bar represents data for 1 uM.

[0071] Figure 38. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA, wherein the top bar represents data for 1 uM and bottom bar represents data for 200 nM. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control, wherein the top bar represents data for 200 nM and bottom bar represents data for 1 uM. (C) Graph displays LDLR protein levels relative to mock -treated control, wherein the top bar represents data for 1 uM and bottom bar represents data for 200 nM. For all graphs, error bars represent SEM.

[0072] Figure 39. Provided technologies can provide increased levels of target transcripts and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA. (B) Graphdisplays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock-treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 1 uM and botom bar represents data for 200 nM.

[0073] Figure 40 Provided technologies can provide increased levels of target transcripts and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing, LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock-treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 1 uM and botom bar represents data for 200 nM.

[0074] Figure 41. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications w ere designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control, (C) Graph displays LDLR protein levels relative to mock -treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 1 uM and bottom bar represents data for 200 nM.

[0075] Figure 42. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary’ human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock-treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 1 uM and bottom bar represents data for 200 nM.

[0076] Figure 43. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels ofLDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock-treated control For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 1 uM and bottom bar represents data for 200 nM.

[0077] Figure 44. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Celis were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock-treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 1 uM and bottom bar represents data for 200 nM

[0078] Figure 45. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR, Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock-treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 1 uM and bottom bar represents data for 200 nM. n.d. = no data reported.

[0079] Figure 46. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock-treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 1 uM and bottom bar represents data for 200 nM.

[0080] Figure 47. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock-treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 1 uM and bottom bar represents data for 200 nM.

[0081] Figure 48. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock-treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 1 uM and bottom bar represents data for 200 nM.

[0082] Figure 49. Provided technologies can provide protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control. (C) Graph displays LDLR protein levels relative to mock -treated control. For all graphs, error bars represent SEM. For each oligonucleotide, top bar represents data for 1 uM and bottom bar represents data for 200 nM

[0083] Figure 50. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications w ere designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of the indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRN A, wherein the top bar represents data for 1 uM and bottom bar represents data for 200nM. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control, wherein the top bar represents data for 1 uM and bottom bar represents data for 200 nM. (C) Graph displays LDLR protein levels relative to mock-treated control, wherein the top bar represents data for 200 nM and bottom bar represents data for 1 uM. For all graphs, error bars represent SEM.

[0084] Figure 51. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 50 nM, 200 nM, or 1 uM of indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA. wherein the bars for each oligonucleotide represent, from top to bottom, data for 50 nM, 200 nM, and 1 uM. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control, wherein the bars for each oligonucleotide represent, from top to botom, data for 50 nM, 200 nM, and 1 uM. (C) Graph displays LDLR protein levels relative to mock -treated control, wherein the bars for each oligonucleotide represent, from top to bottom, data for 50 nM, 200 nM, and 1 uM. For all graphs, error bars represent standard deviation.

[0085] Figure 52. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 50 nM, 200 nM, or 1 uM of indicated oligonucleotides targeting LDLR, Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA, wherein the bars for each oligonucleotide represent, from top to bottom, data for 50 nM, 200 nM, and 1 uM. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative to a mock treated control, wherein the bars for each oligonucleotide represent, from top to bottom, data for 50 nM, 200 nM, and 1 uM. (C) Graph displays LDLR protein levels relative to mock -treated control, wherein the bars for each oligonucleotide represent, from top to bottom, data for 50 nM, 200 nM, and 1 uM. For all graphs, error bars represent standard deviation.

[0086] Figure 53. Provided technologies can provide editing of target transcripts, increased levels of target transcripts, and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 50 nM, 200 nM, or 1 uM of indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA, wherein the bars for each oligonucleotide represent, from top to bottom, data for 50 nM, 200 nM, and 1 uM. (B) Graph displays mean LDLR mRNA expression normalized to SRSF9 relative toa mock treated control, wherein the bars for each oligonucleotide represent, from top to bottom, data for 50 nM, 200 nM, and 1 uM. (C) Graph displays LDLR protein levels relative to mock -treated control, wherein the bars for each oligonucleotide represent, from top to bottom, data for 50 nM, 200 nM, and 1 uM For all graphs, error bars represent standard deviation.

[0087] Figure 54. Provided technologies can provide editing of target transcripts and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. (B) Graph displays LDLR protein levels relative to mock -treated control, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. For all graphs, error bars represent standard deviation.

[0088] Figure 55. Provided technologies can provide editing of target transcripts and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. (B) Graph displays LDLR protein levels relative to mock -treated control, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. For all graphs, error bars represent standard deviation.

[0089] Figure 56. Provided technologies can provide editing of target transcripts and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. (B) Graph displays LDLR protein levels relative to mock-treated control, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. For all graphs, error bars represent standard deviation.

[0090] Figure 57. Provided technologies can provide editing of target transcripts and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantifiedusing an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. (B) Graph displays LDLR protein levels relative to mock -treated control, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. For all graphs, error bars represent standard deviation.

[0091] Figure 58. Provided technologies can provide editing of target transcripts and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. (B) Graph displays LDLR protein levels relative to mock -treated control, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. For all graphs, error bars represent standard deviation.

[0092] Figure 59. Provided technologies can provide editing of target transcripts and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. (B) Graph displays LDLR protein levels relative to mock -treated control, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. For all graphs, error bars represent standard deviation.

[0093] Figure 60. Provided technologies can provide editing of target transcripts and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. (B) Graph displays LDLR protein levels relative to mock-treated control, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. For all graphs, error bars represent standard deviation.

[0094] Figure 61. Provided technologies can provide editing of target transcripts and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantifiedusing an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. (B) Graph displays LDLR protein levels relative to mock -treated control, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. For all graphs, error bars represent standard deviation.

[0095] Figure 62. Provided technologies can provide editing of target transcripts and protein upregulation. Oligonucleotides comprising various modifications were designed and assessed. Primary human hepatocytes were dosed gymnotically with 200 nM or 1 uM of indicated oligonucleotides targeting LDLR. Cells were harvested 96 hrs later. Total RNA was isolated and levels of LDLR mRNA were quantified using qPCR. Editing was quantified by Sanger sequencing. LDLR protein levels in cell lysates were quantified using an ELISA. (A) Graph displays edited LDLR mRNA as a percentage of total LDLR mRNA, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. (B) Graph displays LDLR protein levels relative to mock -treated control, wherein the bars for each oligonucleotide represent, from top to bottom, data for 200 nM and 1 uM. For all graphs, error bars represent standard deviation.DETAILED DESCRIPTION OF CERTAIN EMBODIMEN TS[0096J Technologies of the present disclosure may be understood more readily by reference to the following detailed description of certain embodiments.Definitions

[0097] As used herein, the following definitions shall apply unless otherwise indicated. For purposes of this disclosure, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Ed. Additionally, general principles of organic chemistry are described in "Organic Chemistry", Thomas Sorrell, University Science Books, Sausalito: 1999, and "March's Advanced Organic Chemistry", 5th Ed., Ed.: Smith, M. B. and March, J._ John Wiley & Sons, New York: 2001.

[0098] As used herein in the present disclosure, unless otherwise clear from context, (i) the term “a” or "‘an" may be understood to mean “at least one’’; (ii) the term “or” may be understood to mean “and / or”; (iii) the terms “comprising”, “comprise”, “including” (whether used with “not limited to” or not), and “include” (whether used with “not limited to” or not) may be understood to encompass itemized components or steps whether presented by themselves or together with one or more additional components or steps; (iv) the term “another” may be understood to mean at least an additional / second one or more; (v) the terms “about” and “approximately” may be understood to permit standard variation as would be understood by those of ordinary skill in the art; and (vi) where ranges are provided, endpoints are included.

[0099] Unless otherwise specified, description of oligonucleotides and elements thereof (e.g.. base sequence, sugar modifications, intemucleotidic linkages, linkage phosphorus stereochemistry, patterns thereof, etc.) is from 5’ to 3’. As those skilled in the art will appreciate, in some embodiments, oligonucleotides may be provided and / or utilized as salt forms, particularly pharmaceutically acceptable salt forms, e.g., sodiumsalts. As those skilled in the art will also appreciate, in some embodiments, individual oligonucleotides within a composition may be considered to be of the same constitution and / or structure even though, within such composition (e.g., a liquid composition), particular such oligonucleotides might be in different salt form(s) (and may be dissolved and the oligonucleotide chain may exist as an anion form when, e.g.. in a liquid composition) at a particular moment in time. For example, those skilled in the art will appreciate that, at a given pH, individual internucleotidic linkages along an oligonucleotide chain may be in an acid (H) form, or in one of a plurality of possible salt forms (e.g., a sodium salt, or a salt of a different cation, depending on which ions might be present in the preparation or composition), and will understand that, so long as their acid forms (e.g., replacing all cations, if any, with H ) are of the same constitution and / or structure, such individual oligonucleotides may properly be considered to be of the same constitution and / or structure.

[0100] Aliphatic: As used herein, -aliphatic” means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation (but not aromatic), or a substituted or unsubstituted monocyclic, bicyclic, or polycyclic hydrocarbon ring that is completely saturated or that contains one or more units of unsaturation (but not aromatic), or combinations thereof. In some embodiments, aliphatic groups contain 1-50 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-20 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-10 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-9 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-8 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-7 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-6 aliphatic carbon atoms. In still other embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1, 2, 3, or 4 aliphatic carbon atoms. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl.

[0101] Alkenyl: As used herein, the term “alkenyl” refers to an aliphatic group, as defined herein, having one or more double bonds.

[0102] Alkyl: As used herein, the term “alkyl” is given its ordinary meaning in the art and may include saturated aliphatic groups, including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl substituted cycloalkyl groups, and cycloalkyl substituted alkyl groups. In some embodiments, alkyl has 1-100 carbon atoms In certain embodiments, a straight chain or branched chain alkyl has about 1-20 carbon atoms in its backbone (e.g., C1-C20 for straight chain, C2-C20 for branched chain), and alternatively, about 1-10. In some embodiments, cycloalkyl rings have from about 3-10 carbon atoms in their ring structure where such rings are monocyclic, bicyclic, or polycyclic, and alternatively about 5, 6 or 7 carbons in the ring structure. In some embodiments, an alkyl group may be a lower alkyl group, wherein a lower alkyl group comprises 1-4 carbon atoms (e.g., C1-C4 for straight chain lower alkyls).

[0103] Alkynyl: As used herein, the term “alkynyl” refers to an aliphatic group, as defined herein, having one or more triple bonds.

[0104] Analog: The term “analog” includes any chemical moiety which differs structurally from a reference chemical moiety or class of moieties, but which is capable of performing at least one function of such a reference chemical moiety or class of moieties. As non-limiting examples, a nucleotide analog differs structurally from a nucleotide but performs at least one function of a nucleotide; a nucleobase analog differs structurally from a nucleobase but performs at least one function of a nucleobase; etc.

[0105] Animal: As used herein, the term “animal” refers to any member of the animal kingdom. In some embodiments, “animal” refers to humans, at any stage of development. In some embodiments, “animal” refers to non-human animals, at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate and / or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish and / or worms. In some embodiments, an animal may be a transgenic animal, a genetically -engineered animal and / or a clone.

[0106] Aryl: Tire term “aryl", as used herein, used alone or as part of a larger moiety as in “aralkyl,” “aralkoxy,” or “aryloxyalkyl,” refers to monocyclic, bicyclic or polycyclic ring systems having a total of five to thirty ring members, wherein at least one ring in the system is aromatic. In some embodiments, an aryl group is a monocyclic, bicyclic or polycyclic ring system having a total of five to fourteen ring members, wherein at least one ring in the system is aromatic, and wherein each ring in the system contains 3 to 7 ring members. In some embodiments, each monocyclic ring unit is aromatic. In some embodiments, an aryl group is a biaryl group. The temi “aryl” may be used interchangeably with the term “aryl ring.” In certain embodiments of the present disclosure, “aryl” refers to an aromatic ring system which includes, but is not limited to, phenyl, biphenyl, naphthyl, binaphthyl, anthracyl and the like, which may bear one or more substituents. Also included within the scope of the term “aryl,” as it is used herein, is a group in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimidyl. naphthimidyl, phenanthridinyl, or tetrahydronaphthyl, and the like.

[0107] Characteristic portion: As used herein, the term “characteristic portion”, in the broadest sense, refers to a portion of a substance whose presence (or absence) correlates with presence (or absence) of a particular feature, attribute, or activity of the substance. In some embodiments, a characteristic portion of a substance is a portion that is found m the substance and in related substances that share the particular feature, attribute or activity, but not in those that do not share the particular feature, attribute or activity. In certain embodiments, a characteristic portion shares at least one functional characteristic with the intact substance. For example, in some embodiments, a “characteristic portion” of a protein or polypeptide is one that contains a continuous stretch of amino acids, or a collection of continuous stretches of amino acids, that together are characteristic of a protein or polypeptide. In some embodiments, each such continuous stretch generally contains at least 2, 5, 10, 15, 20, 50, or more amino acids. In general, a characteristic portion of a substance (e.g., of a protein, antibody, etc.) is one that, in addition to tire sequence and / or structural identity specified above, shares at least one functional characteristic with the relevant intact substance. In some embodiments,a characteristic portion may be biologically active.

[0108] Chiral control: As used herein, “chiral control” refers to control of the stereochemical designation of the chiral linkage phosphorus in a chiral intemucleotidic linkage within an oligonucleotide. As used herein, a chiral intemucleotidic linkage is an intemucleotidic linkage whose linkage phosphorus is chiral. In some embodiments, a control is achieved through a chiral element that is absent from the sugar and base moieties of an oligonucleotide, for example, in some embodiments, a control is achieved through use of one or more chiral auxiliaries during oligonucleotide preparation, which chiral auxiliaries often are part of chiral phosphoramidites used during oligonucleotide preparation. In contrast to chiral control, a person having ordinary skill in the art will appreciate that conventional oligonucleotide synthesis which does not use chiral auxiliaries cannot control stereochemistry at a chiral intemucleotidic linkage if such conventional oligonucleotide synthesis is used to form the chiral intemucleotidic linkage. In some embodiments, the stereochemical designation of each chiral linkage phosphorus in each chiral intemucleotidic linkage within an oligonucleotide is controlled.

[0109] Chirally controlled oligonucleotide composition: Hie terms “chirally controlled oligonucleotide composition”, “chirally controlled nucleic acid composition”, and the like, as used herein, refers to a composition that comprises a plurality of oligonucleotides (or nucleic acids) which share a common base sequence, wherein the plurality of oligonucleotides (or nucleic acids) share the same linkage phosphorus stereochemistry at one or more chiral intemucleotidic linkages (chirally controlled or stereodefmed intemucleotidic linkages, whose chiral linkage phosphorus is Rp or Sp in the composition (“stereodefined”), not a random Rp and Sp mixture as non-chirally controlled intemucleotidic linkages). In some embodiments, a chirally controlled oligonucleotide composition comprises a plurality of oligonucleotides (or nucleic acids) that share: 1) a common base sequence, 2) a common pattern of backbone linkages, and 3) a common pattern of backbone phosphorus modifications, wherein the plurality of oligonucleotides (or nucleic acids) share the same linkage phosphorus stereochemistry at one or more chiral intemucleotidic linkages (chirally controlled or stereodefined intemucleotidic linkages, whose chiral linkage phosphorus is Rp or Sp in the composition (“stereodefmed”), not a random Rp and Sp mixture as non-chirally controlled intemucleotidic linkages). Level of the plurality of oligonucleotides (or nucleic acids) in a chirally controlled oligonucleotide composition is pre-determined / controlled or enriched (e.g.. through chirally controlled oligonucleotide preparation to stereoselectively form one or more chiral intemucleotidic linkages) compared to a random level in a nonchirally controlled oligonucleotide composition. In some embodiments, about l%-100%, (e.g.. about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%.95-100%, 50%-90%, or about 5%, 10%, 20%, 30%.40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%. 92%, 93%, 94%, 95%, 96%. 97%. 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%. 80%.85%. 90%, 91%, 92%, 93%, 94%. 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a chirally controlled oligonucleotide composition are oligonucleotides of the plurality. In some embodiments, about 1%-100%, (e.g, about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%. 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%. 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%. 80%, 85%, 90%. 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides m a chirally controlled oligonucleotide composition that share the common base sequence, the common pattern of backbone linkages, and the common pattern of backbone phosphorus modifications are oligonucleotides of the plurality, in some embodiments, a level is about l%-100%, (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%. 92%, 93%, 94%, 95%, 96%. 97%. 98%, 99%, or 100%, or at least 5%. 10%, 20%. 30%, 40%, 50%, 60%, 70%. 80%. 85%, 90%, 91%, 92%, 93%, 94%. 95%, 96%, 97%. 98%, or 99%) of all oligonucleotides in a composition, or of all oligonucleotides in a composition that share a common base sequence (e g., of a plurality of oligonucleotide or an oligonucleotide type), or of all oligonucleotides in a composition that share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications, or of all oligonucleotides in a composition that share a common base sequence, a common patter of base modifications, a common pattern of sugar modifications, a common pattern of intemucleotidic linkage types, and / or a common patern of intemucleotidic linkage modifications. In some embodiments, the plurality of oligonucleotides share the same stereochemistry at about 1-50 (e.g., about 1-10, 1-20, 5-10, 5-20, 10-15, 10-20, 10-25, 10-30, or about 1. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10. 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) chiral intemucleotidic linkages. In some embodiments, the plurality of oligonucleotides share the same stereochemistry at about 1%-100% (e.g., about 5%-100%. 10%-100%, 20%-100%, 30%-l 00%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%. about 5%, 10%, 15%. 20%, 25%, 30%, 35%. 40%, 45%. 50%. 55%. 60%.65%, 70%, 75%, 80%, 85%, 90%, 95%, or 1 0%, or at least 5%, 10%, 15%, 20%, 25%. 30%. 35%, 40%, 45%, 50%, 55%, 60%, 65%. 70%, 75%, 80%, 85%, 90%, 95%, or 99%) of chiral intemucleotidic linkages. In some embodiments, oligonucleotides (or nucleic acids) of a plurality share the same pattern of sugar and / or nucleobase modifications, in any. In some embodiments, oligonucleotides (or nucleic acids) of a plurality are various forms of the same oligonucleotide (e.g., acid and / or various salts of the same oligonucleotide). In some embodiments, oligonucleotides (or nucleic acids) of a plurality are of the same constitution. In some embodiments, level of the oligonucleotides (or nucleic acids) of the plurality is about 1 %-100%, (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%. 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%. 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides (or nucleic acids) in a composition that share the same constitution as the oligonucleotides (or nucleic acids) of the plurality. In some embodiments, each chiral intemucleotidic linkage is a chiral controlled intemucleotidic linkage, and the composition is a completely chirally controlled oligonucleotide composition. In someembodiments, oligonucleotides (or nucleic acids) of a plurality are structurally identical. In some embodiments, a chirally controlled intemucleotidic linkage has a diastereopurity of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%. typically at least 90%. 91%. 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%. In some embodiments, a chirally controlled intemucleotidic linkage has a diastereopurity of at least 95%. In some embodiments, a chirally controlled intemucleotidic linkage has a diastereopurity of at least 96%. In some embodiments, a chirally controlled intemucleotidic linkage has a diastereopurity of at least 97%. In some embodiments, a chirally controlled intemucleotidic linkage has a diastereopurity of at least 98%, In some embodiments, a chirally controlled intemucleotidic linkage has a diastereopurity of at least 99%. In some embodiments, a percentage of a level is or is at least (DS)nc, wherein DS is a diastereopurity as described in the present disclosure (e.g.. 90%, 91%, 92%, 93%, 94%, 95%, 96%.97%. 98%, 99% or 99.5% or more) and nc is the number of chiral linkage phosphorus as described in the present disclosure (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 5-50, 5-40, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more). In some embodiments, a percentage of a level is or is at least (DS)r,c, wherein DS is a diastereopurity as described in the present disclosure (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%. 97%. 98%, 99% or 99.5% or more) and nc is the number of chirally controlled intemucleotidic linkages as described in the present disclosure (e.g.. 1-50. 1-40, 1-30. 1-25, 1-20.5-50. 5-40, 5-30, 5-25.5-20, 1.2, 3, 4.5, 6, 7, 8, 9, 10, 11, 12. 13, 14, 15, 16. 17, 18. 19, 20, 21, 22, 23, 24, 25 or more). In some embodiments, a percentage of a level is or is at least (DS)nc, wherein DS is 95%-100%. For example, when DS is 99% and nc is 10, the percentage is or is at least 90% ((99%)100.90 = 90%). In some embodiments, level of a plurality of oligonucleotides in a composition is represented as the product of the diastereopurity of each chiral linkage phosphorus. In some embodiments, level of a plurality of oligonucleotides in a composition is represented as the product of the diastereopurity of each chirally controlled intemucleotidic linkage in the oligonucleotides In some embodiments, diastereopurity of an intemucleotidic linkage connecting two nucleosides in an oligonucleotide (or nucleic acid) is represented by the diastereopurity of an intemucleotidic linkage of a dimer connecting the same two nucleosides, wherein the dimer is prepared using comparable conditions, in some instances, identical synthetic cycle conditions (e.g., for the linkage between Nx and Ny in an oligonucleotide.... Nxbly, the dimer is NxNy). In some embodiments, not all chiral intemucleotidic linkages are chiral controlled intemucleotidic linkages, and the composition is a partially chirally controlled oligonucleotide composition. In some embodiments, a non-chirally controlled intemucleotidic linkage has a diastereopurity of less than about 80%, 75%, 70%, 65%, 60%, 55%, or of about 50%, as typically observed in stereorandom oligonucleotide compositions (e.g., as appreciated by those skilled in the art, from traditional oligonucleotide synthesis, e.g., the phosphoramidite method). In some embodiments, oligonucleotides (or nucleic acids) of a plurality are of the same type. In some embodiments, a chirally controlled oligonucleotide composition comprises non-random or controlled levels of individual oligonucleotide or nucleic acids types. For instance, in some embodiments a chirally controlled oligonucleotide composition comprises one and no more than one oligonucleotide type. In some embodiments,a chirally controlled oligonucleotide composition comprises more than one oligonucleotide type. In some embodiments, a chirally controlled oligonucleotide composition comprises multiple oligonucleotide types. In some embodiments, a chirally controlled oligonucleotide composition is a composition of oligonucleotides of an oligonucleotide type, which composition comprises a non-random or controlled level of a plurality of oligonucleotides of the oligonucleotide type.

[0110] Comparable: The term ‘"comparable’" is used herein to describe two (or more) sets of conditions or circumstances that are sufficiently similar to one another to permit comparison of results obtained or phenomena observed. In some embodiments, comparable sets of conditions or circumstances are characterized by a plurality of substantially identical features and one or a small number of varied features. Those of ordinary skill in the art will appreciate that sets of conditions are comparable to one another when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in results obtained or phenomena observed under the different sets of conditions or circumstances are caused by or indicative of the variation in those features that are varied.

[0111] Cycloaliphatic: The term “cycloaliphatic,” “carbocycle,” “carbocyclyl,” “carbocyclic radical,” and “carbocyclic ring,"’ are used interchangeably, and as used herein, refer to saturated or partially unsaturated, but non-aromatic. cyclic aliphatic monocyclic, bicyclic, or polycyclic ring systems, as described herein, having, unless otherwise specified, from 3 to 30 ring members. Cycloaliphatic groups include, without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, norbornyl, adamantyl, and cyclooctadienyl. In some embodiments, a cycloaliphatic group has 3-6 carbons. In some embodiments, a cycloaliphatic group is saturated and is cycloalkyl. Tire term “cycloaliphatic” may also include aliphatic rings that are fused to one or more aromatic or nonaromatic rings, such as decahydronaphthyl or tetrahydronaphthyl. In some embodiments, a cycloaliphatic group is bicyclic. In some embodiments, a cycloaliphatic group is tricyclic. In some embodiments, a cycloaliphatic group is polycyclic. In some embodiments, “cycloaliphatic” refers to C3-C7, monocyclic hydrocarbon, or C5-C10 bicyclic or polycyclic hydrocarbon, that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule, or a C6-C16 polycyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule.

[0112] Effective amount: As used herein, the term “effective amount” means an amount of a substance (e.g, an oligonucleotide, therapeutic agent, composition, and / or formulation) that elicits a desired biological response when administered or delivered. In some embodiments, an effective amount of a substance is an amount that is sufficient, when administered or delivered to a subject suffering from or susceptible to a disease, disorder, and / or condition, to treat, diagnose, prevent, and / or delay the onset of the disease, disorder, and / or condition, or to otherwise produce a biological effect (e.g., increasing or reducing level of a target nucleic acid or a product encoded thereby) As will be appreciated by those of ordinary skill in the art, an effective amount of a substance may vary depending on such factors as the desired biological effect or endpoint, the substanceto be delivered, the target cell or tissue, etc. in some embodiments, an effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver an effective amount.

[0113] Heteroaliphatic: The term “heteroaliphatic”, as used herein, is given its ordinary meaning in the art and refers to aliphatic groups as described herein in which one or more carbon atoms are independently replaced with one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, and the like). In some embodiments, one or more units selected from C, CH, CH2, and CH3are independently replaced by one or more heteroatoms (including oxidized and / or substituted forms thereof). In some embodiments, a heteroaliphatic group is heteroalkyl. In some embodiments, a heteroaliphatic group is heteroalkenyl.

[0114] Heteroalkyl: The term “heteroalkyl”, as used herein, is given its ordinary meaning in the art and refers to alkyl groups as described herein in which one or more carbon atoms are independently replaced with one or more heteroatoms (e.g, oxygen, nitrogen, sulfur, silicon, phosphorus, and the like) Examples of heteroalkyl groups include, but are not limited to, alkoxy, poly(ethylene glycol)-, alkyl-substituted amino, tetrahydrofuranyl, piperidinyl, morpholinyl, etc.

[0115] Heteroaryl: The terms “heteroaryl” and “heteroar--”, as used herein, used alone or as part of a larger moiety, e.g., “heteroaralkyl,” or “heteroaralkoxy,” refer to monocyclic, bicyclic or polycyclic ring systems having a total of five to thirty ring members, wherein at least one ring in the system is aromatic and at least one aromatic ring atom is a heteroatom In some embodiments, a heteroaryl group is a group having 5 to 10 ring atoms (i.e., monocyclic, bicyclic or polycyclic), in some embodiments 5, 6, 9, or 10 ring atoms. In some embodiments, each monocyclic ring unit is aromatic. In some embodiments, a heteroaryl group has 6, 10, or 14 a: electrons shared in a cyclic array; and having, in addition to carbon atoms, from one to five heteroatoms. Heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl. triazolyl. tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl,pyrazinyl. indolizinyl, purinyl, naphthyridinyl, andpteridinyl. In some embodiments, a heteroaryl is a heterobiaryl group, such as bipyridyl and the like. The terms “heteroa ry 1 ” and “heteroar-”, as used herein, also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or hctcrocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl. indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl. quinoxalinyl, 4H-qumolizinyl, carbazolyl. acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-l,4-oxazin-3(4H)-one. A heteroaryl group may be monocyclic, bicyclic or polycyclic. Tire term “hctcroaryl” may be used interchangeably with the terms “hctcroaryl ring,” “hctcroaryl group,” or “heteroaromatic,” any of which terms include rings that are optionally substituted, lire term “heteroaralkyl” refers to an alkyl group substituted by a heteroaryl group, wherein the alkyl and heteroaryl portions independently are optionally substituted.

[0116] Heteroatom: The term “heteroatom", as used herein, means an atom that is not carbon or hydrogen. In some embodiments, a heteroatom is boron, oxygen, sulfur, nitrogen, phosphorus, or silicon (includingoxidized forms of nitrogen, sulfur, phosphorus, or silicon; charged forms of nitrogen (e.g., quatemized forms, forms as in iminium groups, etc.), phosphorus, sulfur, oxygen; etc.). In some embodiments, a heteroatom is silicon, phosphorus, oxygen, sulfur or nitrogen, In some embodiments, a heteroatom is silicon, oxygen, sulfur or nitrogen. In some embodiments, a heteroatom is oxygen, sulfur or nitrogen.

[0117] Heterocycle: As used herein, the terms '‘heterocycle,” “heterocyclyl,” “heterocyclic radical,” and “heterocyclic ring", as used herein, are used interchangeably and refer to a monocyclic, bicyclic or polycyclic ring moiety (e g., 3-30 membered) that is saturated or partially unsaturated and has one or more heteroatom ring atoms. In some embodiments, a heterocyclyl group is a stable 5- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated, and having, in addition to carbon atoms, one or more, preferably one to four, heteroatoms, as defined above. When used in reference to a ring atom of a heterocycle, the term "nitrogen" includes substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 0-3 heteroatoms selected from oxygen, sulfur and nitrogen, the nitrogen may be N (as in 3,4-dihydro-2EI-py rrolyl), NH (as in pyrrolidinyl), or+NR (as in N-substituted pyrrolidinyl). A heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure and any of the ring atoms can be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, without limitation, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinol inyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl. thiazepinyl, morpholinyl. and quinuclidinyl. The terms “heterocycle,” “heterocyclyl,” “heterocyclyl ring,” “heterocyclic group,” “heterocyclic moiety,” and “heterocyclic radical,” are used interchangeably herein, and also include groups in which a heterocyclyl ring is fused to one or more ary I. heteroaryl, or cycloaliphatic rings, such as indolinyl.3H-indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl. A heterocyclyl group may be monocyclic, bicyclic or polycyclic. The term “heterocyclylalkyl” refers to an alkyl group substituted by a heterocyclyl, wherein the alkyl and heterocyclyl portions independently are optionally substituted.

[0118] Identity: As used herein, the term “identity” refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., oligonucleotides, DNA, RNA, etc.) and / or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be “substantially identical” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%.70%, 75%. 80%, 85%, 90%, 95%, or 99% identical. Calculation of the percent identity of two nucleic acid or polypeptide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g.. gaps can be introduced in one or both of a first and a second sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%. at least 40%, at least 50%, at least 60%. at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of a reference sequence. The nucleotides at corresponding positions are then compared. When a position m the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, thenthe molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparisons made with the ALIGN program use a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. Tire percent identity between two nucleotide sequences can, alternatively, be determined using the GAP program in the GCG softw are package using an NWSgapdna. CMP matrix.

[0119] Intemucleotidic linkage: As used herein, the phrase “intemucleotidic linkage"’ refers generally to a linkage linking nucleoside units of an oligonucleotide or a nucleic acid. In some embodiments, an intemucleotidic linkage is a phosphodiester linkage, as extensively found in naturally occurring DNA and RNA molecules (natural phosphate linkage ( OP(=O)(OH)O ), which as appreciated by those skilled in the art may exist as a salt form). In some embodiments, an intemucleotidic linkage is a modified intemucleotidic linkage (not a natural phosphate linkage). In some embodiments, an intemucleotidic linkage is a "modified intemucleotidic linkage’" wherein at least one oxygen atom or -OH of a phosphodiester linkage is replaced by a different organic or inorganic moiety. In some embodiments, such an organic or inorganic moiety is selected from =S, =Se, =NR’, -SR’, -SeR’, -N(R’)2, B(R’)3, -S-, -Se- and -N(R’)-, wherein each R’ is independently as defined and described in the present disclosure. In some embodiments, an intemucleotidic linkage is a phosphotriester linkage, phosphorothioate linkage (or phosphorothioate diester linkage, ~OP(=O)(SH)O”, which as appreciated by those skilled in the art may exist as a salt form), or phosphorothioate triester linkage. In some embodiments, a modified intemucleotidic linkage is a phosphorothioate linkage. In some embodiments, an intemucleotidic linkage is one of, e.g., PNA (peptide nucleic acid) or PMO (phosphorodiamidate Morpholino oligomer) linkage In some embodiments, a modified intemucleotidic linkage is a non-negatively charged intemucleotidic linkage. In some embodiments, a modified intemucleotidic linkage is a neutral intemucleotidic linkage (e.g., nOOl in certain provided oligonucleotides). It is understood by a person of ordinary skill in the art that an intemucleotidic linkage may exist as an anion or cation at a given pH due to the existence of acid or base moieties in the linkage. In some embodiments, a modified intemucleotidic linkages is a modified intemucleotidic linkages designated as s, si, s2, s3, s4, s5, s6, s7, s8, s9, slO, si 1, si 2, si 3, si 4, s!5, si 6, s 17 and s 18 as described in WO 2017 / 210647.

[0120] In vitro: As used herein, the term ‘‘in vitro” refers to events that occur in an artificial environment, e.g.. in a test tube or reaction vessel, in cell culture, etc., rather than within an organism (e.g.. animal, plant and / or microbe).

[0121] In vivo: As used herein, the term “in vivo” refers to events that occur within an organism (e g., animal, plant and / or microbe).

[0122] Linkage phosphorus: as defined herein, the phrase “‘linkage phosphorus” is used to indicate that the particular phosphorus atom being referred to is the phosphorus atom present in the internucleotidic linkage, which phosphorus atom corresponds to the phosphorus atom of a phosphodiester internucleotidic linkage as occurs in naturally occurring DNA and RNA. In some embodiments, a linkage phosphorus atom is in a modified internucleotidic linkage, wherein each oxygen atom of a phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, a linkage phosphorus atom is chiral (e.g., as in phosphorothioate internucleotidic linkages). In some embodiments, a linkage phosphorus atom is achiral (e.g., as in natural phosphate linkages)

[0123] Modified nucleobase: The terms "modified nucleobase", "modified base" and the like refer to a chemical moiety which is chemically distinct from a nucleobase, but which is capable of performing at least one function of a nucleobase. In some embodiments, a modified nucleobase is a nucleobase which comprises a modification. In some embodiments, a modified nucleobase is capable of at least one function of a nucleobase, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases. In some embodiments, a modified nucleobase is substituted A, T, C, G, or U. or a substituted tautomer of A, T. C, G. or U. In some embodiments, a modified nucleobase in the context of oligonucleotides refer to a nucleobase that is not A. T, C. G or U.

[0124] Modified nucleoside: The term "modified nucleoside" refers to a moiety derived from or chemically similar to a natural nucleoside, but which comprises a chemical modification which differentiates it from a natural nucleoside. Non-limiting examples of modified nucleosides include those which comprise a modification at. the base and / or the sugar. Non-limiting examples of modified nucleosides include those with a 2’ modification at a sugar. Non-limiting examples of modified nucleosides also include abasic nucleosides (which lack a nucleobase). In some embodiments, a modified nucleoside is capable of at least one function of a nucleoside, e.g., forming a moiety in a polymer capable of base-pai ring to a nucleic acid comprising an at least complementary sequence of bases.

[0125] Modified nucleotide: Tire term “modified nucleotide” includes am chemical moiety which differs structurally from a natural nucleotide but is capable of performing at least one function of a natural nucleotide. In some embodiments, a modified nucleotide comprises a modification at a sugar, base and / or internucleotidic linkage. In some embodiments, a modified nucleotide comprises a modified sugar, modified nucleobase and / or modified internucleotidic linkage. In some embodiments, a modified nucleotide is capable of at least one function of a nucleotide, e.g., forming a subunit in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases.

[0126] Modified sugar. The term “modified sugar” refers to a moiety that can replace a sugar. A modified sugar mimics the spatial arrangement, electronic properties, or some other physicochemical property of a sugar. In some embodiments, as described in the present disclosure, a modified sugar is substituted ribose or deoxyribose. In some embodiments, a modified sugar comprises a 2’-modification Examples of useful 2’-modification are widely utilized in the art and described herein. In some embodiments, a 2’ -modification is2’-F. In some embodiments, a 2 ’-modification is 2’-OR, wherein R is optionally substituted CMO aliphatic. In some embodiments, a 2 ’-modification is 2’-0Me. In some embodiments, a 2 '-modification is 2’-M0E. In some embodiments, a modified sugar is a bicyclic sugar (e.g,, a sugar used in LNA, BNA, etc.). In some embodiments, in the context of oligonucleotides, a modified sugar is a sugar that is not ribose or deoxyribose as typically found in natural RNA or DNA.

[0127] Nucleic acid: The term "‘nucleic acid”, as used herein, includes any nucleotides and polymers thereof. The term “polynucleotide”, as used herein, refers to a polymeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA) or a combination thereof. These terms refer to the primary structure of the molecules and, thus, include double- and single-stranded DNA, and double- and single-stranded RNA. These terms include, as equivalents, analogs of either RNA or DNA comprising modified nucleotides and / or modified polynucleotides, such as, though not limited to, methylated, protected and / or capped nucleotides or polynucleotides The terms encompass poly- or oligo-ribonucleotides (RNA) and poly- or oligo-deoxyribonucleotides (DNA); RNA or DNA derived from N-glycosides or C -glycosides of nucleobases and / or modified nucleobases; nucleic acids derived from sugars and / or modified sugars, and nucleic acids derived from phosphate bridges and / or modified intemucleotidic linkages. The term encompasses nucleic acids containing any combinations of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges or modified intemucleotidic linkages. Examples include, and are not limited to, nucleic acids containing ribose moieties, nucleic acids containing deoxy-ribose moieties, nucleic acids containing both ribose and deoxyribose moieties, nucleic acids containing ribose and modified ribose moieties. Unless otherwise specified, the prefix poly- refers to a nucleic acid containing 2 to about 10,000 nucleotide monomer units and wherein the prefix oligo- refers to a nucleic acid containing 2 to about 200 nucleotide monomer units.

[0128] Nucleobase: The term “nucleobase” refers to the parts of nucleic acids that are involved in the hydrogen-bonding that binds one nucleic acid strand to another complementary strand in a sequence specific manner. The most common naturally-occurring nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, a naturally-occurring nucleobases are modified adenine, guanine, uracil, cytosine, or thymme. In some embodiments, a naturally-occurring nucleobases are methylated adenine, guanine, uracil, cytosine, orthymine. In some embodiments, a nucleobase comprises a heteroaryl ring wherein a ring atom is nitrogen, and when in a nucleoside, the nitrogen is bonded to a sugar moiety’. In some embodiments, a nucleobase comprises a heterocyclic ring wherein a ring atom is nitrogen, and when in a nucleoside, the nitrogen is bonded to a sugar moiety. In some embodiments, a nucleobase is a “modified nucleobase,” a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, a modified nucleobase is substituted A. T, C. G or U. In some embodiments, a modified nucleobase is a substituted tautomer of A, T, C, G, or U. In some embodiments, a modified nucleobases is methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a modified nucleobase mimics the spatial arrangement, electronic properties, or some other physicochemical property of tirenucleobase arid retains the property of hydrogen-bonding that binds one nucleic acid strand to another in a sequence specific manner. In some embodiments, a modified nucleobase can pair with all of the five naturally occurring bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting the melting behavior, recognition by intracellular enzymes or activity of the oligonucleotide duplex. As used herein, the term "nucleobase'’ also encompasses structural analogs used in lieu of natural or naturally-occurring nucleotides, such as modified nucleobases and nucleobase analogs. In some embodiments, a nucleobase is optionally substituted A, T, C, G, or U, or an optionally substituted tautomer of A, T, C, G, or U. In some embodiments, a "nucleobase” refers to a nucleobase unit in an oligonucleotide or a nucleic acid (e.g., A, T, C, G or U as in an oligonucleotide or a nucleic acid).

[0129] Nucleoside: Tire term "nucleoside” refers to a moiety wherein a nucleobase or a modified nucleobase is covalently bound to a sugar or a modified sugar. In some embodiments, a nucleoside is a natural nucleoside, e.g., adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, or deoxy cytidine. In some embodiments, a nucleoside is a modified nucleoside, e.g., a substituted natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, a nucleoside is a modified nucleoside, e.g., a substituted tautomer of a natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxy cytidine. In some embodiments, a “nucleoside” refers to a nucleoside unit in an oligonucleotide or a nucleic acid.

[0130] Nucleotide: The term “nucleotide” as used herein refers to a monomeric unit of a polynucleotide that consists of a nucleobase, a sugar, and one or more internucleotidic linkages (e.g., phosphate linkages in natural DNA and RNA). The naturally occurring bases [guanine, (G), adenine, (A), cytosine, (C). thymine, (T), and uracil (U)] are derivatives of purine or pyrimidine, though it should be understood that naturally and non-naturally occurring base analogs are also included. The naturally' occurring sugar is the pentose (five-carbon sugar) deoxyribose (which forms DNA) or ribose (which forms RNA), though it should be understood that naturally and non-naturally occurring sugar analogs arc also included. Nucleotides are linked via internucleotidic linkages to form nucleic acids, or polynucleotides. Many internucleotidic linkages are known in the art (such as, though not limited to, phosphate, phosphorothioates, boranophosphates and the like). Artificial nucleic acids include PNAs (peptide nucleic acids), phosphotriesters, phosphorothionates, H-phosphonates, phosphoramidates, boranophosphates, methylphosphonates, phosphonoacetates, thiophosphonoacetates and other variants of the phosphate backbone of native nucleic acids, such as those described herein. In some embodiments, a natural nucleotide comprises a naturally occurring base, sugar and internucleotidic linkage. As used herein, the term “nucleotide’’ also encompasses structural analogs used in lieu of natural or naturally-occurring nucleotides, such as modified nucleotides and nucleotide analogs. In some embodiments, a “nucleotide” refers to a nucleotide unit in an oligonucleotide or a nucleic acid.

[0131] Oligonucleotide: The term "oligonucleotide" refers to a polymer or oligomer of nucleotides, and may contain any combination of natural and non-natural nucleobases, sugars, and internucleotidic linkages.

[0132] Oligonucleotides can be single -stranded or double-stranded. A single -stranded oligonucleotide can have double-stranded regions (formed by two portions of the single-stranded oligonucleotide) and a double-stranded oligonucleotide, which comprises two oligonucleotide chains, can have single -stranded regions for example, at regions where the two oligonucleotide chains are not complementary to each other. Example oligonucleotides include, but are not limited to structural genes, genes including control and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and doublestranded RNAi agents and other RNA interference reagents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribozymes, microRNAs, microRNA mimics, supermirs, aptamers, antimirs, antagomirs, U1 adaptors, triplex-forming oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immunostimulatory oligonucleotides, and decoy oligonucleotides.

[0133] Oligonucleotides of the present disclosure can be of various lengths In particular embodiments, oligonucleotides can range from about 2 to about 200 nucleosides in length. In various related embodiments, oligonucleotides, single-stranded, double-stranded, or triple-stranded, can range in length from about 4 to about 10 nucleosides, from about 10 to about 50 nucleosides, from about 20 to about 50 nucleosides, from about 15 to about 30 nucleosides, from about 20 to about 30 nucleosides in length. In some embodiments, an oligonucleotide is from about 9 to about 39 nucleosides in length. In some embodiments, an oligonucleotide is from about 25 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 26 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 27 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 28 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 29 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 30 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 31 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 32 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 25 to about 60 nucleosides in length. In some embodiments, an oligonucleotide is from about 25 to about 50 nucleosides in length. In some embodiments, an oligonucleotide is from about 25 to about 40 nucleosides in length. In some embodiments, an oligonucleotide is from about 30 to about 40 nucleosides in length. In some embodiments, the oligonucleotide is at least 4, 5, 6. 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17. 18.19, 20, 21, 22, 23, 24, or 25 nucleosides m length. In some embodiments, an oligonucleotide is at least 4 nucleosides in length. In some embodiments, an oligonucleotide is at least 5 nucleosides in length. In some embodiments, an oligonucleotide is at least 6 nucleosides in length. In some embodiments, an oligonucleotide is at least 7 nucleosides in length. In some embodiments, an oligonucleotide is at least 8 nucleosides in length. In some embodiments, an oligonucleotide is at least 9 nucleosides in length. In some embodiments, an oligonucleotide is at least. 10 nucleosides in length. In some embodiments, an oligonucleotide is at least 11 nucleosides in length. In some embodiments, an oligonucleotide is at least 12 nucleosides in length. In some embodiments, an oligonucleotide is at least 15 nucleosides in length. In some embodiments, an oligonucleotide is at least 15 nucleosides in length. In some embodiments, an oligonucleotide is at least 16 nucleosides inlength. In some embodiments, an oligonucleotide is at least 17 nucleosides in length. In some embodiments, an oligonucleotide is at least 18 nucleosides in length. In some embodiments, an oligonucleotide is at least 19 nucleosides in length. In some embodiments, an oligonucleotide is at least 20 nucleosides in length. In some embodiments, an oligonucleotide is at least 25 nucleosides in length. In some embodiments, an oligonucleotide is at least 26 nucleosides in length. In some embodiments, an oligonucleotide is at least 27 nucleosides in length. In some embodiments, an oligonucleotide is at least 28 nucleosides in length. In some embodiments, an oligonucleotide is at least 29 nucleosides in length. In some embodiments, an oligonucleotide is at least 30 nucleosides in length. In some embodiments, an oligonucleotide is at least 31 nucleosides in length. In some embodiments, an oligonucleotide is at least 32 nucleosides in length. In some embodiments, an oligonucleotide is at least 33 nucleosides in length. In some embodiments, an oligonucleotide is at least 34 nucleosides in length. In some embodiments, an oligonucleotide is at least 35 nucleosides in length. In some embodiments, an oligonucleotide is at least 36 nucleosides in length. In some embodiments, an oligonucleotide is at least 37 nucleosides in length. In some embodiments, an oligonucleotide is at least 38 nucleosides in length. In some embodiments, an oligonucleotide is at least 39 nucleosides in length. In some embodiments, an oligonucleotide is at least 40 nucleosides in length. In some embodiments, an oligonucleotide is 25 nucleosides in length. In some embodiments, an oligonucleotide is 26 nucleosides in length. In some embodiments, an oligonucleotide is 27 nucleosides in length. In some embodiments, an oligonucleotide is 28 nucleosides in length. In some embodiments, an oligonucleotide is 29 nucleosides m length. In some embodiments, an oligonucleotide is 30 nucleosides in length In some embodiments, an oligonucleotide is 31 nucleosides in length. In some embodiments, an oligonucleotide is 32 nucleosides in length. In some embodiments, an oligonucleotide is 33 nucleosides in length In some embodiments, an oligonucleotide is 34 nucleosides in length. In some embodiments, an oligonucleotide is 35 nucleosides in length. In some embodiments, an oligonucleotide is 36 nucleosides in length. In some embodiments, an oligonucleotide is 37 nucleosides in length. In some embodiments, an oligonucleotide is 38 nucleosides in length. In some embodiments, an oligonucleotide is 39 nucleosides in length. In some embodiments, an oligonucleotide is 40 nucleosides in length. In some embodiments, each nucleoside counted in an oligonucleotide length independently comprises a nucleobase comprising a ring having at least one nitrogen ring atom. In some embodiments, each nucleoside counted in an oligonucleotide length independently comprises A, T, C. G, or U, or optionally substituted A. T, C, G, or U, or an optionally substituted tautomer of A, T, C, G or U.

[0134] Oligonucleotide type: As used herein, the phrase “oligonucleotide type” is used to define an oligonucleotide that has a particular base sequence, pattern of backbone linkages (i.e., pattern of internucleotidic linkage types, for example, phosphate, phosphorothioate, phosphorothioate triester, etc ), pattern of backbone chiral centers [i.e., pattern of linkage phosphorus stereochemistry (Rp / Sp)], and pattern of backbone phosphorus modifications. In some embodiments, oligonucleotides of a common designated “type” are structurally identical to one another.

[0135] One of skill in the art will appreciate that synthetic methods of the present disclosure provide fora degree of control during the synthesis of an oligonucleotide strand such that each nucleotide unit of the oligonucleotide strand can be designed and / or selected in advance to have a particular stereochemistry at the linkage phosphorus and / or a particular modification at the linkage phosphorus, and / or a particular base, and / or a particular sugar. In some embodiments, an oligonucleotide strand is designed and / or selected in advance to have a particular combination of stereocenters at the linkage phosphorus. In some embodiments, an oligonucleotide strand is designed and / or determined to have a particular combination of modifications at the linkage phosphorus. In some embodiments, an oligonucleotide strand is designed and / or selected to have a particular combination of bases. In some embodiments, an oligonucleotide strand is designed and / or selected to have a particular combination of one or more of the above structural characteristics. In some embodiments, the present disclosure provides compositions comprising or consisting of a plurality of oligonucleotide molecules (e.g., chirally controlled oligonucleotide compositions). In some embodiments, all such molecules are of the same type (i.e., are structurally identical to one another). In some embodiments, however, provided compositions comprise a plurality of oligonucleotides of different types, typically in pre-determined relative amounts.

[0136] Optionally Substituted: As described herein, compounds of the disclosure may contain optionally substituted, substituted and / or unsubstituted moieties. In general, the term '‘substituted.” means that one or more hydrogens of the designated moiety are independently replaced with a substituent. Unless otherwise indicated, an “optionally substituted” group may independently have a substituent at each substitutable position of the group, and when more than one position in any given structure may be substituted with two or more substituents, the substituents may be either the same or different at every position. In some embodiments, an optionally substituted group is unsubstituted. In some embodiments, an optionally substituted group is substituted. Various substituents are described below.

[0137] Monovalent substituents are independently halogen; -(CH2)o-4R°; -(CH2)o OR°; -0(CH2)o.4R°, -0-(CH2)O.: C(O)OR°; -(CH2)o-4CH(OR0)2; -(CH2)O4Ph, which may be substituted with R°; -(CH2)o 40(CH2)o-iPh which may be substituted with R°; -CH=CHPh, which may be substituted with R°; -(CH2)O-40(CH2)O-I -pyridyl which may be substituted with R°; -NO2; -CN; -N₂; -(CH2)o-4N(R°)2; -(CH2)0-4N(R°)C(O)R°; -N(R°)C(S)R°; -(CH2)0 4N(RO)C(O)N(R°)2; -N(RO)C(S)N(R°)2; -(CH2)O-4N(R°)C(0)ORA -N(R°)N(R°)C(O)R°; -N(R°)N(R°)C(O)N(R°)2; ~-N(R°)N(R°)C(0)0Ro; ~-(CH2)0 4C(O)RO; -C(S)R°; -(CH2)O^C(0)OR°; -(CH2)OMC(0)SR°; -(CH2)0^C(O)OSi(R°)3; -(CH2)0^OC(O)R°; -OC(O)(CH2)0MSRC, -SC(S)SR°; -(CH2)^SC(O)R°; -(CH2)OMC(0)N(R°)2; -C(S)N(RO)2; -C(S)SR°; -SC(S)SR°, -(CH2)0-4OC(O)N(R°)2; -C(O)N(OR°)R°; -C(O)C(O)R°; -C(O)CH2C(O)RO; -C(NOR°)R° -(CH2)O 4SSR°; -(CH2)0-4S(O)-R: ~(CH2)O4S(0)2OR0; -(CH2)(MOS(O)2R°; -S(O)2N(R°)2; -(CH2)0-4S(O)R°; -N(R°)S(0)2N(RO)2; -N(R°)S(O)2R°; -N(OR°)R°; -C(NH)N(RO)2; -Si(R°)3; -OSi(R°)3: -P(R°)2; -P(OR°)2; -OP(R°)2; -0P(0Ro)2: “N(RO)P(R°)2; -B(RO)2; -OB(RO)2; ~P(O)(R°)2; -0P(0)(RO)2; -N(R°)P(O)(RO)2; -(CI-4 straight or branched alkylene)0 -N(Ro)2; or -(Ci4straight or branched alkylene)C(0)0--N(Ro)2; wherein each R° may be independently substituted as defined below and is independently hydrogen, C1-10(e.g., C1-8, C1-4, etc.)aliphatic, CMO (e.g., Ci.6, C1.4, etc.) heteroaliphatic having 1-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, Ce-io (e.g., C«,, C10, etc.) aryl. 5-10 (e.g., 5-9, 5-6, 5, 6, 9, 10, etc.) membered heteroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen and sulfur, -CI- Cs-jo (e.g.. C6, Cio. etc.) aryl), -0(CH2)O. I(C6-IO (e.g.. C6. C10, etc.) aryl), -CH2-(5-10 (e.g.. 5-9, 5-6, 5.6, 9, 10, etc.) membered heteroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen and sulfur), -O(CH2)0-1(5-10 (e.g., 5-9, 5-6, 5, 6, 9, 10, etc.) membered heteroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen and sulfur), a 3-10 (e.g., 3-6, 5-6, 3, 4, 5, 6, 7, 8, 9, 10, etc.) membered, monocyclic, bicyclic, or polycyclic, saturated, or partially unsaturated ring having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, or, notwithstanding the definition above, two independent occurrences of R°, taken together with their intervening atom(s), form a 3-10 (e.g, 3-6, 5-6. 3, 4, 5, 6, 7. 8, 9, 10, etc.) membered, monocyclic, bicyclic, or polycyclic, saturated, partially unsaturated or aromatic ring (for aromatic ring, 5-10 (e.g., 5-9, 5-6, 5, 6, 9, 10, etc.) membered) having, in addition to the intervening atom(s), 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, which may be substituted as defined below.

[0138] Monovalent substituents on R° (or the ring formed by taking two independent occurrences of R° together with their intervening atoms), are independently halogen. -(CH2)0-3R1, -(haloR1), -(CH2)0-3OH,OSiR’s, -C OJSR1, -(Ci 4 straight or branched alkylene)C(O)OR!, or -SSR1wherein each R!is unsubstituted or where preceded by “halo’' is substituted only with one or more halogens, and is independently selected from CH aliphatic, -CH2Ph, ~0(CH2)o iPh. or a 3-6 (e.g.. 3-5, 5-6, etc. (-membered saturated, partially unsaturated, or aromatic ring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Divalent substituents on a saturated carbon atom of R° are independently =0 or =S.

[0139] Divalent substituents arc independently the following: =0, =S, =NNR*2, =NNHC(O)R’, =NNHC(O)OR‘, =NNHS(O)2R*, =NR*, =N0R*, -O(C(R*2))2-3O- or “S(C(R*2))2-3S“, wherein each independent occurrence of R* is selected from hydrogen, Cvs aliphatic which may be substituted as defined below, or an unsubstituted 3-6 (e g., 3-5, 5-6, etc.)-membered saturated, partially unsaturated, or aromatic ring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Divalent substituents that are bound to vicinal substitutable carbons of an “optionally substituted” group arc independently -O(CR*2)2-3O-, wherein each independent occurrence of R is selected from hydrogen, Civ, aliphatic which may be substituted as defined below, or an unsubstituted 3-6 (e.g., 3-5, 5-6, etc.)-membered saturated, partially unsaturated, or aromatic ring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur In some embodiments, a divalent substituent is =N. In some embodiments, it is =CR* wherein R is selected from hydrogen, CYs aliphatic which may be substituted as defined below, or an unsubstituted 3-6 (e g., 3-5, 5-6, etc.)-membered saturated, partiallyunsaturated, or aromatic ring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0140] Substituents on the aliphatic group of R* are independently halogen, -R1, -(haloR1), -OH, -OR1, -O(haloR'). -CN, -C(O)OH. -C(O)OR\ -NH2, -NHR1, -NR12, or -NO2, wherein each R1is unsubstituted or where preceded by ‘'halo” is substituted only with one or more halogens, and is independently C1.4 aliphatic, CH2Ph, -0(CH2)o iPh, or a 3-6 (e.g., 3-5, 5-6, etc.)-membered saturated, partially unsaturated, or aromatic ring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0141] Substituents on a substitutable nitrogen are independently -Rt, -NRt2, -C(O)Rt, -C(O)ORt, -C(O)C(O)R!, -C(O)CH2C(O)Rr, -S(O)2Rt, -S(O)2NRf2, -C(S)NRt2, -C(NH)NRt2, or -N(Rf)S(O)? R1: wherein each Rfis independently hydrogen. C1-6aliphatic which may be substituted as defined below, unsubstituted -OPh, or an unsubstituted 3-6 (e.g., 3-5, 5-6. etc.)-membered saturated, partially unsaturated, or aromatic ring (for aromatic nng, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or, notwithstanding the definition above, two independent occurrences of R. taken together with their intervening atom(s) form an unsubstituted 3-12 (e.g., 3-10. 3-6, 5-10, 5-6, 3, 4. 5, 6, 7. 8, 9, 10. etc.) membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0142] Substituents on the aliphatic group of R are independently halogen, -R1, -(haloR1), OH, -OR1, -OfhaloR1), -CN. -C(O)OH, -C(O)OR!, -NH2, -NHR1, -NR12, or NO-. wherein each R:is unsubstituted or where preceded by ‘'halo” is substituted only with one or more halogens, and is independently C1-4aliphatic, -CH2Ph, -O(CH2)0-1Ph, or a 3-6 (e.g., 3-5, 5-6. etc.)-membered saturated, partially unsaturated, or aromatic ring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0143] P-modification: as used herein, the term “P-modification” refers to any modification at the linkage phosphorus other than a stereochemical modification. In some embodiments, a P-modification comprises addition, substitution, or removal of a pendant moiety covalently attached to a linkage phosphorus.

[0144] Partially unsaturated: As used herein, the term '‘partially unsaturated” refers to a ring moiety that includes at least one double or triple bond. The term '‘partially unsaturated” is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties, as herein defined.

[0145] Pharmaceutical composition: As used herein, the term “pharmaceutical composition” refers to an active agent, formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, an active agent is present in unit dose amount appropriate for administration in a therapeutic regimen that show’s a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population In some embodiments, pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: oraladministration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravagmally or mtrarectally. for example, as a pessary, cream, or foam; sublingually; ocularly; transdermally; or nasally, pulmonary, and to other mucosal surfaces.

[0146] Pharmaceutically acceptable: As used herein, the phrase “pharmaceutically acceptable'’ refers to those compounds, materials, compositions and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0147] Pharmaceutically acceptable carrier: As used herein, the term “pharmaceutically acceptable carrier” means a pharmaceutically -acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as com starch and potato starch: cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-frcc water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and / or polyanhydrides; and other non-toxic compatible substances employed in pharmaceutical formulations.

[0148] Pharmaceutically acceptable salt: The term “pharmaceutically acceptable salt”, as used herein, refers to salts of such compounds that are appropriate for use in pharmaceutical contexts, i.e., salts which are. within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts arc well known in the art. For example, S. M. Berge, et al. describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977), In some embodiments, pharmaceutically acceptable salt include, but are not limited to, nontoxic acid addition salts, which are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the artsuch as ion exchange. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2 -naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-tohienesulfonate, undecanoate, valerate salts, and the like. In some embodiments, a provided compound comprises one or more acidic groups, e.g., an oligonucleotide, and a pharmaceutically acceptable salt is an alkali, alkaline earth metal, or ammonium (e.g., an ammonium salt of N(R)s, wherein each R is independently defined and described in the present disclosure) salt. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. In some embodiments, a pharmaceutically acceptable salt is a sodium salt. In some embodiments, a pharmaceutically acceptable salt is a potassium salt. In some embodiments, a pharmaceutically acceptable salt is a calcium salt, in some embodiments, pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, alkyl having from 1 to 6 carbon atoms, sulfonate and aryl sulfonate. In some embodiments, a provided compound comprises more than one acid groups, for example, an oligonucleotide may comprise two or more acidic groups (e.g., in natural phosphate linkages and / or modified intemucleotidic linkages). In some embodiments, a pharmaceutically acceptable salt, or generally a salt, of such a compound comprises two or more cations, which can be the same or different. In some embodiments, in a pharmaceutically acceptable salt (or generally, a salt), all ionizable hydrogen (e.g., in an aqueous solution with a pKa no more than about 11, 10, 9, 8, 7. 6, 5, 4, 3, or 2; in some embodiments, no more than about 7; in some embodiments, no more than about 6; in some embodiments, no more than about 5: in some embodiments, no more than about 4; in some embodiments, no more than about 3) in the acidic groups arc replaced with cations. In some embodiments, each phosphorothioate and phosphate group independently exists in its salt form (e.g., if sodium salt, 0 P(O)(SNa) 0 and O P(O)(ONa) O respectively). In some embodiments, each phosphorothioate and phosphate intemucleotidic linkage independently exists in its salt form (e.g., if sodium salt, -O-P(O)(SNa)-O- and -O-P(O)(ONa)-O-, respectively). In some embodiments, a pharmaceutically acceptable salt is a sodium salt of an oligonucleotide. In some embodiments, a pharmaceutically acceptable salt is a sodium salt of an oligonucleotide, wherein each acidic phosphate and modified phosphate group (e.g., phosphorothioate, phosphate, etc.), if any, exists as a salt form (all sodium salt).

[0149] Predetermined: By predetermined (or pre-determined) is meant deliberately selected or nonrandom or controlled, for example as opposed to randomly occurring, random, or achieved without control. Those of ordinary skill in the art, reading the present specification, will appreciate that the present disclosure provides technologies that permit selection of particular chemistry and / or stereochemistry features to beincorporated into oligonucleotide compositions, and further pennits controlled preparation of oligonucleotide compositions having such chemistry and / or stereochemistry features. Such provided compositions are “predetermined" as described herein. Compositions that may contain certain oligonucleotides because they happen to have been generated through a process that are not controlled to intentionally generate the particular chemistry and / or stereochemistry features are not “predetermined" compositions. In some embodiments, a predetermined composition is one that can be intentionally reproduced (e.g., through repetition of a controlled process). In some embodiments, a predetermined level of a plurality of oligonucleotides in a composition means that the absolute amount, and / or the relative amount (ratio, percentage, etc ) of the plurality of oligonucleotides in the composition is controlled. In some embodiments, a predetermined level of a plurality of oligonucleotides in a composition is achieved through chirally controlled oligonucleotide preparation.

[0150] Protecting group: The term “protecting group," as used herein, is well known in the art and includes those described in detail in Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3rHedition, John Wiley & Sons, 1999, the entirety of which is incorporated herein by reference. Also included are those protecting groups specially adapted for nucleoside and nucleotide chemistry described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al. 06 / 2012. the entirety of Chapter 2 is incorporated herein by reference. Suitable amino-protecting groups include methyl carbamate, ethyl carbamante, 9-fluorenylm ethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl carbamate, 9-(2,7-dibromo)fluoroenylmethyl carbamate, 2,7-di-t-butyl- [9-( 10, 10-dioxo- 10,10,10,10-tetrahydrothioxanthyl)] methyl carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2 -phenylethyl carbamate (hZ), 1-(1-adamantyl)-l-methylethyl carbamate (Adpoc), l, I-dimethyl-2-haloethyl carbamate, I,l-dimethyl-2,2-dibromoethyl carbamate (DB t-BOC), 1, 1 - dimethyl -2,2,2 -trichloroethyl carbamate (TCBOC), 1 -methyl -1-(4-biphenylyl)ethyl carbamate (Bpoc), l-(3,5-di-t-butylphenyl)-l-methylethyl carbamate (t-Bumeoc), 2-(2’- and 4’-pyridyl)ethyl carbamate (Pyoc), 2-(N, N-dicyclohexylcarboxamido)ethyl carbamate, t-butyl carbamate (BOC), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc), ally I carbamate (Alloc), 1-isopropylallyl carbamate (Ipaoc), cinnamyl carbamate (Coc), 4-nitrocinnamyl carbamate (Noc), 8-quinolyl carbamate, N -hydroxypiperidinyl carbamate, alkyldithio carbamate, benzyl carbamate (Cbz), -methoxybenzyl carbamate (Moz), p-nitobenzyl carbamate, p-bromobenzyl carbamate, p-chlorobenzyl carbamate, 2,4-dichlorobenzyl carbamate, 4-methylsulfinylbenzyl carbamate (Msz), 9-anthrylmethyl carbamate, diphenylmethyl carbamate, 2-methylthioethyl carbamate, 2-methylsulfonylethyl carbamate, 2-(p-tolucncsulfonyl)cthyl carbamate, [2--(l,3 -dithianyl)]mcthyl carbamate (Dmoc), 4 -mcthylthiophcnyl carbamate (Mtpc), 2,4-dimethylthiophenyl carbamate (Bmpc), 2-phosphonioethyl carbamate (Peoc), 2-triphenylphosphonioisopropyl carbamate (Ppoc), 1, 1 -dimethyl-2-cyanoethyl carbamate, m-chloro-p-acyloxybenzyl carbamate, p-(dihydroxyboryl)benzyl carbamate, 5-benzisoxazolylmethyl carbamate, 2-(trifluoromethyl)--6-chromonylmethyl carbamate (Tcroc), m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate, o-nitrobenzyl carbamate, 3,4-dimethoxy-6-nitrobenzyl carbamate, phenyl(o-mtrophenyl)methylcarbamate, phenothiazinyl-(10)-carbonyl derivative, N’-p-toluenesulfonylaminocarbonyl derivative, N’-phenylaminothiocarbonyl derivative, t-amyl carbamate, S-benzyl thiocarbamate, p-cyanobenzyl carbamate, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl carbamate, p-decvloxybenzyl carbamate, 2,2-dimethoxycarbonylvinyI carbamate. o-(N, N-dimethylcarboxamido)benzyl carbamate, 1.1--dimethyl-- 3-(N, N-dimethylcarboxamido)propyl carbamate, 1, 1 -diinethylpropynyl carbamate, di(2-pyridyl)methyl carbamate, 2-furanylmethyI carbamate, 2-iodoethyl carbamate, isoborynl carbamate, isobutyl carbamate, isonicotinyl carbamate, p ~(p’ -methoxyphenylazo)benzyl carbamate, 1 methylcyclobutyl carbamate, 1 -methyl cyclohexyl carbamate, 1 -methyl- 1-cyclopropylmethyl carbamate, l-methyl-l-(3,5-dimethoxyphenyl)ethyl carbamate, 1 -methyl- l-(p-phenylazophenyl)ethyl carbamate, 1-methyl-l-phenylethyl carbamate, 1 -methyl -1 - (4 -pyridyl)ethyl carbamate, phenyl carbamate, p -(phenylazo)benzyl carbamate. 2,4,6-tri-t-butylphenyl carbamate, 4-(trimethylammonium)benzyl carbamate, 2,4,6-tri methyl benzyl carbamate, formam ide, acetamide, chloroacetaro ide, trichloroacetam ide, trifluoroacetamide, phenylacetamide, 3-phenylpropanamide, picolinamide, 3-pyridylcarboxamide, N-benzoylphenylalanyl derivative, benzamide, p-phenylbenzamide, o -nitophenylacetaniide, o--nitrophenoxyacetamide, acetoacetamide, (N'-dithiobenzyloxycarbonylamino)acetamide, 3-(p-hydroxyphenyl)propanamide, 3-(o-nitrophenyl)propanamide. 2-methyl-2-(o-mtrophenoxy)propanamide, 2-raethyl-2-(o-phenylazophenoxy)propanamide, 4-chlorobutanamide, 3-methyl-3-nitrobutanamide, o-nitrocinnamide, N-acetylmethionine derivative, o -nitrobenzamide, o -(benzoyloxymethyl)benzamide, 4,5 -diphenyl -3 -oxazolin • 2-one, N-phthalimide, N-dithiasuccinimide (Dts), N-2,3-diphenylmaieimide, N-2,5-dimethylpyrrole, N-1,1,4,4-tetramediyldisilylazacyclopentane adduct (STABASE), 5-substituted l,3-dimethyl-l,3,5-triazacyclohexan-2-one, 5-substituted 1.3-dibenzyl-l,3.5-triazacyclohexan-2-one. 1-substituted 3,5-dinitro -4 --pyridone, N -methylamine, N -allylamine, N -| 2 -(trimethylsilyl)ethoxyjmethylamine (SEM), N-3-acetoxypropylamine, N-(l-isopropyi-4-nitro-2-oxo-3-pyroolin-3-yl)amine, quaternary' ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamme, N-5-dibenzosuberylamine, bi -triphenylmethylamine (Tr), N-[(4-mcthoxyphcnyl)diphcnylmcthyl]aroinc (MMTr), N-9-phcnylfluorcnylaminc (PhF), N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino (Fem), N-2-picolylamino N'-oxide, N-1, 1-dimeth lthiomethyleneamine, N-benzylideneamme, M -p-methoxybenzylideneamine, N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneamine, N-(N', N'-dimethylaminomethylene)amine, N. N’-isopropylidenediamine, N-p-nitrobenzylideneamine, N-salicylideneamine, N-5-chlorosalicylideneamine, N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N-cyclohcxylidcncaminc, N-(5,5-dimcthyl-3-oxo- l-cyclohcxcnyl)aminc, N-boranc derivative, N-diphenylborinic acid derivative, N- phenyl(pentacarbonylchromium- or tungsten)carbonyl]amme, N-copper chelate, N-zinc chelate, N-nitroamine, N-nitrosoamine, amine N-oxide, diphenylphosphinamide (Dpp). dimethylthiophosphinamide (Mpt), diphenylthiophosphinamide (Ppt), dialkyl phosphoramidates, dibenzyl phosphoramidate, diphenyl phosphoramidate, benzenesulfenamide, o -nitrobenzenesulfenamide (Nps). 2,4 dinitrobenzene suite namide, pentachlorobenzenesulfenamide, 2-nitro-4-methoxybenzenesulfenamide,triphenylmethylsulfenamide, 3 -nitropyridinesulfenamide (Npys), p-toluene sulfonamide (Ts), benzenesuifonamide, 2,3,6,-trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimetbyl-4-methoxybenzenesulfonamide (Pme), 2, 3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte). 4-methoxybenzenesulfonamide (Mbs). 2,4,6-trimethylbenzenesulfonamide (Mis), 2,6-dimethoxy-4--methylbenzenesulfonamide (iMds), 2, 2, 5,7,8-pentamethylchroman -6-sulfonamide (Pmc), methanesulfonamide (Ms), 0 -trimethylsilylethanesulfonamide (SI'S). 9 anthracenesulfonamide, 4 (4 ’,8 ’ dimethoxynaphthylmethyl) benzenesulfonamide (DMMBS), benzylsulfonamide, trifluoromethyl sulfonamide, and phenacylsulfonamide.

[0151] Suitably protected carboxylic acids further include, but are not limited to. silyl-, alkyl-, alkenyl-, aryl-, and arylalkyl -protected carboxylic acids. Examples of suitable silyl groups include trimethylsilyl, tri ethylsilyl, t-butyl dim ethylsilyl, t-butyl diphenylsilyl, triisopropylsilyl, and the like. Examples of suitable alkyl groups include methyl, benzyl, p-m ethoxybenzyl, 3,4-dimethoxybenzyl, trityl, t-butyl, tetrahydropyran-2-yl. Examples of suitable alkenyl groups include allyl. Examples of suitable and groups include optionally substituted phenyl, biphenyl, or naphthyl. Examples of suitable ar lalky 1 groups include optionally substituted benzyl (e.g.. p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl. p-cyanobenzyl), and 2- and 4-picolyl.

[0152] Suitable hydroxyl protecting groups include methyl, methoxylmethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t-butoxyniethyl. 4-pentenyloxymethyl (POM), siloxymethyl, 2-methoxyethoxym ethyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyI (SEMOR), tetrahydropyranyl (THP), 3 -bromotetrahydropyranyl, tetrahydrothiopyranyl, 1- -methoxycyclohexyl, 4 methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl S. S dioxide, l-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (CTMP), 1,4-dioxan-2-yl, tctrahydrofuranyl, tctrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimcthyl-4,7-methanobenzofuran-2-yl, 1 -ethoxyethyl, 1 -(2-chloroethoxy )ethyl, 1 -methyl- 1 -methox ethyl, 1 -methyl- 1-benzylox ethyl, 1 -methyl- l-benzyloxy-2 -fluoroeth l, 2.2,2-trichloroethyI, 2 -trimethylsilylethyl, 2-(phenylselenyl)ethyl, t-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dmitrophenyI, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl. p-cyanobenzyl, p-phenylbenzyl, 2-picolyl, 4-picolyl, 3-methyl-2-picolyl N-oxido, diphenylmethyl, p,p -dinitrobcnzhydryl, 5 -dibenzosubcryl, triphcnylmcthyl, a -naphthyldiphcnylmcthyl, p -methoxyphenyldiphenylmethyl, di(p-methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl, 4-(4’~ bromophenacyloxyphenyl)diphenylmethyl, 4,4’.4”-tris(4.5-dichlorophthalimidophenyl)methyl, 4,4',4’’-tris(levulinoyloxyphenyl)methyl, 4,4',4”-tris(benzoyloxyphenyl)methyl, 3-(imidazol-l-yl)bis(4’,4”-dimethoxyphenyl)methyl, l,l-bis(4-methoxyphenyl)- -pyrenylmethyl, 9-anthryL 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl, l,3-benzodithiolan-2-yl, benzisothiazolyl S. S-dioxido, trimethylsilyl ( IMS),triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl (DEIPS), dimethylthexylsily 1, t-butyldimethylsilyl (TBDMS), t-butyldiphenylsilyl (TBDPS), tribenzylsil 1, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), t-butylmethoxyphenyl silyl (TBMPS), formate, benzoylformate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, phenoxyacetate, p-chlorophenoxyacetate, 3 --phenylpropionate, 4-oxopentanoate (levulinate), 4,4-(ethylenedithio)pentanoate (levulinoyldithioacetal), pivaloate, adamantoate, crotonate, 4-methoxycrotonate. benzoate, p phenylbenzoate, 2,4,6 trimethyl benzoate (mesitoate), alkyl methyl carbonate, 9-fluorenylmethyl carbonate (Fmoc), alkyl ethyl carbonate, alkyl 2,2,2-trichloroethyl carbonate (Troc), 2-(trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl) ethyl carbonate (Psec), 2-(triphenylphosphonio) ethyl carbonate (Peoc). alkyl isobutyl carbonate, alkyl vinyl carbonate alkyl allyl carbonate, alkyl p -nitrophenyl carbonate, alkyl benzyl carbonate, alkyl p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o-nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl S-benzyl thiocarbonate, 4-ethoxy-l-napththyl carbonate, methyl dithiocarbonate, 2-iodobenzoate, 4-azidobutyrate, 4-nitro-4-methylpentanoate, o - (dibromomethyl)benzoate, 2 -formylbenzenesulfonate. 2 - (methylthiomethoxy )ethyl, 4 -(methylthiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4-m ethylphenoxyacetate, 2,6-dichloro-4-( l,l,3.3-tetramethylbutyl)phenoxyacetate, 2,4— bis( 1,1— dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinoate, (E)-2-methyl-2-butenoate, o - (methoxycarbonyl)benzoate, a-naphtlioate, nitrate, alkyl N, N, N\N’-tetramethylphosphorodiamidate, alkyl N-phenylcarbamate, borate, dimethylphosphinothioyl, alkyl 2,4-dinitrophenylsulfenate, sulfate, methane sulfonate (mesylate), benzylsulfonate, and tosylate (Ts). For protecting 1,2- or 1,3— diols, the protecting groups include methylene acetal, ethylidene acetal. 1-t-butylethylidene ketal, 1 -phenylethyhdene ketal, (4-methoxyphenyl)ethylidene acetal, 2,2,2-trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexyl idene ketal, cycloheptylidene ketal, benzylidene acetal. p-methoxybenzylidene acetal. 2,4-dimethoxybenzylidene ketal, 3,4-dimcthoxybcnzylidcnc acetal, 2-nitrobcnzylidcnc acetal, methoxym ethylene acetal, ctboxy ethylene acetal, dimethoxymethylene ortho ester, 1-methoxyethylidene ortho ester, 1 -ethoxyethylidine ortho ester. 1,2-dimethoxyethylidene ortho ester, a-methoxybenzylidene ortho ester, I -(N, N -dimethylamino)ethylidene derivative. a-(N, N’-dimethylamino)benzylidene derivative, 2-oxacyclopentylidene ortho ester, di— t— butylsilylene group (DTBS), l,3-(l,l,3,3-tetraisopropyldisiloxanylidene) derivative (TIPDS), tetra-t-butoxydisiloxane-l,3-diylidene derivative (TBDS), cyclic carbonates, cyclic boronates, ethyl boronate, and phenyl boronatc.

[0153] In some embodiments, a hydroxyl protecting group is acetyl, t-butyl, tbutoxymethyl, methoxymethyl, tetrahydropyranyl. 1 -ethoxyethyl. 1 -(2-chloroethoxy)ethyi. 2- trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6- dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl (trityl). 4,4'-dimethoxytrityl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl. triphenylsilyl, triisopropylsilyl, benzoylformate, chloroacetyl, trichloroacetyl,trifiuoroacetyl, pivaloyl. 9- fluorenylmethyl carbonate, mesylate, tosylate, triflate, trityl, monomethoxytrityl (MMTr), 4,4'-dimethoxytrityl, (DMTr) and 4,4',4"-trimethoxylrityl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl 2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenylsulfonyl)ethyl, 3.5-dichlorophenyl. 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenvl, 2,4,6-trimethylphenyl, 2-(2-nitrophenyl)ethyl, butylthiocarbonyl, 4,4',4"-tris(benzoyloxy)trityl, diphenylcarbamoyl, levulinyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenylxanthen-9-yl (pixyl) or 9-(p-methoxyphenyl)xanthine-9-y 1 (MOX). In some embodiments, each of the hydroxyl protecting groups is, independently selected from acetyl, benzyl, t- butyldimethylsilyl, t-butyldiphenylsilyl and 4,4'-dimethoxytrityl. In some embodiments, the hydroxyl protecting group is selected from the group consisting of trityl, monomethoxytrityl and 4,4'-dimethoxytrityl group. In some embodiments, a phosphorous linkage protecting group is a group attached to the phosphorous linkage (e.g., an mtemucleotidic linkage) throughout oligonucleotide synthesis. In some embodiments, a protecting group is attached to a sulfur atom of an phosphorothioate group. In some embodiments, a protecting group is attached to an oxygen atom of an internucleotide phosphorothioate linkage. In some embodiments, a protecting group is attached to an oxygen atom of the intemucleotide phosphate linkage. In some embodiments a protecting group is 2-cyanoethyl (CE or Cne). 2-trimethylsilylethyl, 2 -nitroethyl, 2 -sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylcarboxamido)-l -propyl, 4-oxopentyl, 4-methylthio-l-butyl, 2-cyano-l, 1 -dimethylethyl, 4-N-methylaminobutyl, 3 -(2 -pyridyl)-! -propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl, N-methyl)aminoethyl, or 4-[N -methyl -N-(2, 2,2-trifluoroacetyl)amino] butyl,

[0154] Subject: As used herein, the term “subject” or “test subject” refers to any organism to which a compound (e.g., an oligonucleotide) or composition is administered in accordance with the present disclosure e.g., for experimental, diagnostic, prophylactic and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.) and plants. In some embodiments, a subject is a human. In some embodiments, a subject may be suffering from and / or susceptible to a disease, disorder and / or condition

[0155] Substantially: As used herein, the term “substantially” refers to the qualitative condition of exhi biting total or near-total extent or degree of a characteristic or property of interest. A base sequence which is substantially identical or complementary to a second sequence is not hilly identical or complementary to the second sequence, but is mostly or nearly identical or complementary to the second sequence. In some embodiments, an oligonucleotide with a substantially complementary sequence to another oligonucleotide or nucleic acid forms duplex with the oligonucleotide or nucleic acid m a similar fashion as an oligonucleotide with a fully complementary sequence. In addition, one of ordinary skill in the biological and / or chemical arts will understand that biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and / or chemical phenomena.

[0156] Sugar: The term “sugar' refers to a monosaccharide or polysaccharide in closed and / or open form. In some embodiments, sugars are monosaccharides. In some embodiments, sugars are polysaccharides. Sugars include, but are not limited to, ribose, deoxyribose, pentofuranose, pentopyranose, and hexopyranose moieties. As used herein, the term “sugar” also encompasses structural analogs used in lieu of conventional sugar molecules, such as glycol, polymer of which forms the backbone of the nucleic acid analog, glycol nucleic acid (“GNA”), etc. As used herein, the term “sugar” also encompasses structural analogs used in lieu of natural or naturally -occurring nucleotides, such as modified sugars and nucleotide sugars. In some embodiments, a sugar is a RNA or DNA sugar (ribose or deoxyribose). In some embodiments, a sugar is a modified ribose or deoxyribose sugar, e.g., 2 Ariodified. 5’-modified, etc. As described herein, in some embodiments, when used in oligonucleotides and / or nucleic acids, modified sugars may provide one or more desired properties, activities, etc. In some embodiments, a sugar is optionally substituted ribose or deoxyribose. In some embodiments, a “sugar” refers to a sugar unit in an oligonucleotide or a nucleic acid.

[0157] Susceptible to: An individual who is “susceptible to” a disease, disorder and / or condition is one who has a higher risk of developing the disease, disorder and / or condition than does a member of the general public. In some embodiments, an individual who is susceptible to a disease, disorder and / or condition is predisposed to have that disease, disorder and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder and / or condition may not have been diagnosed with the disease, disorder and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder and / or condition may exhibit symptoms of the disease, disorder and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder and / or condition may not exhibit symptoms of the disease, disorder and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition wall develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will not develop the disease, disorder, and / or condition.

[0158] Therapeutic agent: As used herein, the term “therapeutic agent” in general refers to any agent that elicits a desired effect (e.g,, a desired biological, clinical, or pharmacological effect) when administered to a subject. In some embodiments, an agent is considered to be a therapeutic agent if it demonstrates a statistically significant effect across an appropriate population. In some embodiments, an appropriate population is a population of subjects suffering from and / or susceptible to a disease, disorder or condition. In some embodiments, an appropriate population is a population of model organisms. In some embodiments, an appropriate population may be defined by one or more criterion such as age group, gender, genetic background, preexisting clinical conditions, prior exposure to therapy. In some embodiments, a therapeutic agent is a substance that alleviates, ameliorates, relieves, inhibits, prevents, delays onset of. reduces severity of, and / or reduces incidence of one or more symptoms or features of a disease, disorder, and / or condition in a subject ■when administered to the subject in an effective amount. In some embodiments, a “therapeutic agent” is an agent that has been or is required to be approved by a government agency before it can be marketed for administration to humans. In some embodiments, a “therapeutic agent” is an agent for which a medicalprescription is required for administration to humans. In some embodiments, a therapeutic agent is a provided compound, e.g., a provided oligonucleotide.

[0159] Treat: As used herein, the term “treat,” “treatment,” or “'treating” refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of. reduce seventy of, and / or reduce incidence of one or more symptoms or features of a disease, disorder, and / or condition. Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and / or condition. In some embodiments, treatment may be administered to a subject who exhibits only early signs of the disease, disorder, and / or condition, for example for the purpose of decreasing the nsk of developing pathology associated with the disease, disorder, and / or condition.

[0160] Unsaturated: Hie term "unsaturated," as used herein, means that a moiety has one or more units of unsaturation.

[0161] Wild-type: As used herein, the term “wild-type” has its art-understood meaning that refers to an entity having a structure and / or activity as found in nature in a “normal” (as contrasted with mutant, diseased, altered, etc.) state or context. Those of ordinary skill in the art will appreciate that wild type genes and polypeptides often exist in multiple different fonns (e.g., alleles).

[0162] As those skilled in the art will appreciate, methods and compositions described herein relating to provided compounds (e.g, oligonucleotides) generally also apply to pharmaceutically acceptable salts of such compounds.Description of Certain Embodiments

[0163] Oligonucleotides are useful in various therapeutic, diagnostic, and research applications. Use of naturally occurring nucleic acids is limited, for example, by their susceptibility to endo- and exo-nucleases. As such, various synthetic counterparts have been developed to circumvent these shortcomings and / or to further improve various properties and activities. These include synthetic oligonucleotides that contain chemical modifications, e.g, base modifications, sugar modifications, backbone modifications, etc,, -which, among other things, render these molecules less susceptible to degradation and improve other properties and / or activities.

[0164] From a structural point of view, modifications to internucleotidic linkages can introduce chirality, and certain properties and activities may be affected by configurations of linkage phosphorus atoms of oligonucleotides. For example, binding affinity, sequence specific binding to complementary RNA, stability to nucleases, activities, delivery, pharmacokinetics, etc. can be affected by, inter alia, chirality of backbone linkage phosphorus atoms.

[0165] Among other things, the present disclosure utilizes technologies for controlling various structural elements, e g., sugar modifications and patterns thereof, nucleobase modifications and patterns thereof, modified internucleotidic linkages and patterns thereof, linkage phosphorus stereochemistry and patterns thereof, additional chemical moieties (moieties that are not typically in an oligonucleotide chain) and patternsthereof, etc. With the capability to fully control structural elements of oligonucleotides, the present disclosure provides oligonucleotides with improved and / or new properties and / or activities for various applications, e.g., as therapeutic agents, probes, etc. For example, as demonstrated herein, provided oligonucleotides and compositions thereof are particularly powerful for editing target adenosine in target nucleic acids to, in some embodiments, correct a G to A mutation by converting A to I.

[0166] In some embodiments, an oligonucleotide comprises a sequence that is identical to or is completely or substantially complementary to 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40. 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52. 53, 54, 55, 56, 57, 58. 59, 60, typically 15, 16, 17. 18. 19, 20, 21, 22, 23, 24, 25, 26. 27, 28, 29, 30, 31, 32, 33, 34. 35, 36, 37, 38, 39.40, 41, 42, 43.44,45, 46, 47, 48, 49, 50. 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more, contiguous bases ofa nucleic acid (e.g., DNA, pre-mRNA. mRNA, etc ). In some embodiments, a nucleic acid is a target nucleic acid comprising one or more target adenosine. In some embodiments, a target nucleic acid comprises one and no more than one target adenosine. In some embodiments, an oligonucleotide can hybridize with a target nucleic acid. In some embodiments, such hybridization facilitates modification of A (e.g.,. conversion of A to I) by, e.g., ADAR1, ADAR2, etc., in a nucleic acid or a product thereof.

[0167] In some embodiments, the present disclosure provides an oligonucleotide, wherein the oligonucleotide has a base sequence which is, or comprises about 10-40, about 15-40, about 20-40, or at least 27, at least 28. at least 29. at least 30, at least 31, at least 32, at least 33, at least 34 contiguous bases of, an oligonucleotide or nucleic acid disclosed herein (e.g., in the Tables), or a sequence that is complementary to a target RNA sequence gene, transcript, etc. disclosed herein, and wherein each T can be optionally and independently replaced with U and vice versa. In some embodiments, the present disclosure provides an oligonucleotide or oligonucleotide composition as disclosed herein, e.g., in a Table.

[0168] In some embodiments, an oligonucleotide is a single-stranded oligonucleotide for site-directed editing of a nucleoside (e.g., a target adenosine) in a target nucleic acid, e.g., RN A.

[0169] As described herein, oligonucleotides may contain one ormorc modified intemucleotidic linkages (non-natural phosphate linkages). In some embodiments, a modified intemucleotidic linkage is a chiral internucleotidic linkage whose linkage phosphorus is chiral. In some embodiments, a modified intemucleotidic linkage is a phosphorothioate intemucleotidic linkage. In some embodiments, oligonucleotides comprise one or more negatively charged intemucleotidic linkages (e.g., phosphorothioate intemucleotidic linkages, natural phosphate linkages, etc.). In some embodiments, oligonucleotides comprise one or more non-negatively charged intemucleotidic linkage. In some embodiments, oligonucleotides comprise one or more neutral intemucleotidic linkage.

[0170] In some embodiments, oligonucleotides are chirally controlled. In some embodiments, oligonucleotides are chirally pure (or ‘"stereopure”, “stereochemical ly pure”), wherein the oligonucleotide exists as a single stereoisomeric form (in many cases a single diastereoisomeric (or ‘"diastereomeric”) form as multiple chiral centers may exist in an oligonucleotide, e.g., at linkage phosphorus, sugar carbon, etc.). Asappreciated by those skilled in the art, a chirally pure oligonucleotide is separated from its other stereoisomeric forms (to the extent that some impurities may exist as chemical and biological processes, selectivities and / or purifications etc. rarely, if ever, go to absolute completeness). In a chirally pure oligonucleotide, each chiral center is independently defined with respect to its configuration (for a chirally pure oligonucleotide, each intemucleotidic linkage is independently stereodefmed or chirally controlled). In contrast to chirally controlled and chirally pure oligonucleotides which comprise stereodefined linkage phosphorus, racemic (or “stereorandom”, “non-chirally controlled”) oligonucleotides comprising chiral linkage phosphorus, e.g.. from traditional phosphoramidite oligonucleotide synthesis without stereochemical control during coupling steps in combination with traditional sulfurization (creating stereorandom phosphorothioate intemucleotidic linkages), refer to a random mixture of various stereoisomers (typically diastereoisomers (or “diastereomers”) as there are multiple chiral centers in an oligonucleotide; e.g, from traditional oligonucleotide preparation using reagents containing no chiral elements other than those in nucleosides and linkage phosphorus). For example, for A* A* A wherein * is a phosphorothioate intemucleotidic linkage (which comprises a chiral linkage phosphorus), a racemic oligonucleotide preparation includes four diastereomers [2~ ------ 4, considering the two chiral linkage phosphorus, each of which can exist in either of two configurations (5p or Rp)J: A * S A * S A, A *S A *R A, A *R A *S A, and A *R A *R A. wherein *S represents a 5p phosphorothioate intemucleotidic linkage and *R represents a Rp phosphorothioate intemucleotidic linkage. For a chirally pure oligonucleotide, e.g., A *S A *S A, it exists in a single stereoisomeric form and it is separated from the other stereoisomers (e.g., the diastereomers A *S A *R A, A *R A *S A, and A *R A *R A).

[0171] In some embodiments, oligonucleotides comprise 1. 2, 3, 4, 5, 6, 7, 8, 9, 10 or more stereorandom intemucleotidic linkages (mixture of Rp and Sp linkage phosphorus at the intemucleotidic linkage, e.g.. from traditional non-chirally controlled oligonucleotide synthesis). In some embodiments, oligonucleotides comprise one or more (e.g., 1-60, 1-50, 1-40, 1-30, 1-25, 1-20, 1, 2, 3, 4, 5, 6, 7, 8, 9. 10, 11, 12, 13. 14, 15, 16, 17. 18. 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29. 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 1, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more) chirally controlled intemucleotidic linkages ( / ?p or 5'p linkage phosphorus at the intemucleotidic linkage, e.g., from chirally controlled oligonucleotide synthesis). In some embodiments, an intemucleotidic linkage is a phosphorothioate intemucleotidic linkage. In some embodiments, an intemucleotidic linkage is a stereorandom phosphorothioate intemucleotidic linkage. In some embodiments, an intemucleotidic linkage is a chirally controlled phosphorothioate intemucleotidic linkage.

[0172] Among other things, the present disclosure provides technologies for preparing chirally controlled (in some embodiments, stereochemically pure) oligonucleotides. In some embodiments, oligonucleotides are stereochemically pure In some embodiments, oligonucleotides of the present disclosure are about 5%-100%.10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%. 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%. or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%. 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%,50%, 55%, 60%, 65%. 70%, 75%, 80%, 85%, 90%, 95%, or 99% stereochemically pure.

[0173] In some embodiments, the present disclosure provides various oligonucleotide compositions. In some embodiments, oligonucleotide compositions are stereorandom or not chirally controlled. In some embodiments, there are no chirally controlled intemucleotidic linkages in oligonucleotides of provided compositions. In some embodiments, intemucleotidic linkages of oligonucleotides in compositions comprise one or more chirally controlled intemucleotidic linkages (e.g., chirally controlled oligonucleotide compositions).

[0174] In some embodiments, an oligonucleotide composition comprises a plurality of oligonucleotides sharing a common base sequence, wherein one or more intemucleotidic linkages in the oligonucleotides are chirally controlled and one or more intemucleotidic linkages are stereorandom (not chirally controlled). In some embodiments, an oligonucleotide composition comprises a plurality of oligonucleotides sharing a common base sequence, wherein each intemucleotidic linkage comprising chiral linkage phosphorus in the oligonucleotides is independently a chirally controlled intemucleotidic linkage. In some embodiments, a plurality of oligonucleotides share the same base sequence, and the same base and sugar modification. In some embodiments, a plurality of oligonucleotides share the same base sequence, and the same base, sugar and intemucleotidic linkage modification, hi some embodiments, an oligonucleotide composition comprises oligonucleotides of the same constitution, wherein one or more intemucleotidic linkages are chirally controlled and one or more intemucleotidic linkages are stereorandom (not chirally controlled). In some embodiments, an oligonucleotide composition comprises oligonucleotides of the same constitution, wherein each intemucleotidic linkage comprising chiral linkage phosphorus is independently a chirally controlled intemucleotidic linkage. In some embodiments, at least 10%, 20%. 30%. 40%. 50%. 60%. 70%. 75%. 80%, 85%, 90% or 95% of all oligonucleotides, or all oligonucleotides of the common base sequence, are oligonucleotides of the plurality.

[0175] In some embodiments, the present disclosure provides technologies for preparing, assessing and / or utilizing provided oligonucleotides and compositions thereof.

[0176] As used in the present disclosure, in some embodiments, ‘‘one ormore’" is 1-200, 1-150, 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30. or 1, 2. 3, 4, 5, 6, 7, 8, 9. 10. 11, 12, 13, 14, 15, 16, 17, 18, 19. 20. 21.22, 23, 24, 25, 26. 27, 28, 29. 30, 31, 32, 33, 34, 35, 36. 37, 38, 39, 40. 41, 42, 43. 44, 45, 46, 47, 48, 49, 50.51, 52, 53, 54, 55, 56, 57, 58, 59, or 60. In some embodiments, ‘‘one ormore5is one. In some embodiments, “one or more” is two. In some embodiments, “one or more’5is three. In some embodiments, “one or more” is four. In some embodiments, “one or more55is five. In some embodiments, “one or more55is six. In some embodiments, “one or more” is seven. In some embodiments, “one or more” is eight. In some embodiments, “one or more” is nine. In some embodiments, “one or more” is ten. In some embodiments, “one or more” is at least one. In some embodiments, “one or more55is at least two. In some embodiments, “one or more” is at least three. In some embodiments, “one or more” is at least four. In some embodiments, “one or more” is at least five. In some embodiments, “one or more” is at least six In some embodiments, “one or more” is atleast seven. In some embodiments, “one or more” is at least eight. In some embodiments, “one or more” is at least nine. In some embodiments, “one or more” is at least ten.

[0177] As used in the present disclosure, in some embodiments, “at least one” is one or more.

[0178] Various embodiments are described for variables, e.g., R. RL, L, etc., as examples. Embodiments described for a variable, e.g., R, are generally applicable to all variables that can be such a variable (e.g., R’, R”, RL, R“!, etc.).Oligonucleotides

[0179] Among other things, the present disclosure provides oligonucleotides of various designs, which may comprise various nucleobases and patterns thereof sugars and patterns thereof, interiiucleotidic linkages and patterns thereof, and / or additional chemical moieties and patterns thereof as described in the present disclosure. In some embodiments, provided oligonucleotides can direct A to I editing in target nucleic acids. In some embodiments, oligonucleotides of the present disclosure are single-stranded oligonucleotides capable of site-directed editing of an adenosine (conversion of A into I) in a target RNA sequence.

[0180] In some embodiments, oligonucleotides are of suitable lengths and sequence complementarity to specifically hybridize with target nucleic acids. In some embodiments, oligonucleotide is sufficiently long and is sufficiently complementary to target nucleic acids to distinguish target nucleic acid from other nucleic acids to reduce off-target effects. In some embodiments, oligonucleotide is sufficiently short to facilitate delivery, reduce manufacture complexity and / or cost which maintaining desired properties and activities (e.g., editing of adenosine).

[0181] In some embodiments, an oligonucleotide has a length of about 10-200 (e.g., about 10-20, 10-30, 10-40, 10-50, 10-60, 10-70, 10-80, 10-90. 10-100. 10-120, 10-150, 20-30, 20-40, 20-50, 20-60. 20-70, 20-80.20-90, 20-100, 20-120, 20-1 0, 20-200, 25-30, 25-40, 25-50. 2.5-60, 25-70, 25-80, 25-90, 25-100, 25-120, 25-150, 25-200. 30-40, 30-50, 30-60, 30-70, 30-80, 30-90, 30-100, 30-120, 30-150, 30-200. 10, 20, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50, 60, etc.) nucleobases. In some embodiments, the base sequence of an oligonucleotide is about 10-60 nucleobases in length. In some embodiments, a base sequence is about 15-50 nucleobases in length. In some embodiments, a base sequence is from about 15 to about 35 nucleobases in length. In some embodiments, a base sequence is from about 25 to about 34 nucleobases in length. In some embodiments, a base sequence is from about 26 to about 35 nucleobases in length. In some embodiments, a base sequence is from about 27 to about 32 nucleobases in length. In some embodiments, a base sequence is from about 29 to about 35 nucleobases in length. In some embodiments, a base sequence is about 10, 11. 12, 13. 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28. 29, 30, 31, 32, 33, 34, 35, 36. 37, 38, 39, 40. 41. 42, 43, 44, 45, 46, 47. 48. 49. 50, 1, 52, 53, 54, 55. 56. 57. 58, 59, or 60 nucleobases in length. In some other embodiments, a base sequence is or is at least 35 nucleobases in length. In some other embodiments, a base sequence is or is at least 34 nucleobases in length. In some other embodiments, a base sequence is or is at least 33 nucleobases in length. In some other embodiments, a base sequence is or is at least32 nucleobases in length. In some other embodiments, a base sequence is or is at least 31 nucleobases in length. In some other embodiments, a base sequence is or is at least 30 nucleobases in length. In some other embodiments, a base sequence is or is at least 29 nucleobases in length. In some other embodiments, a base sequence is or is at least 28 nucleobases in length. In some other embodiments, a base sequence is or is at least 27 nucleobases in length. In some other embodiments, a base sequence is or is at least 26 nucleobases in length. In some other embodiments, the base sequence of the complementary portion in a duplex is at least 15, 16, 17, 18, 19, 20, 21. 22, 23, 24, 25, 16, 27, 28, 29, 30, 31, 32, 33, 34, 35 or more nucleobases in length. In some other embodiments, it is at least 18 nucleobases in length. In some other embodiments, it is at least 19 nucleobases in length. In some other embodiments, it is at least 20 nucleobases in length. In some other embodiments, it is at least 21 nucleobases in length, hi some other embodiments, it is at least 22 nucleobases in length. In some other embodiments, it is at least 23 nucleobases in length. In some other embodiments, it is at least 24 nucleobases in length. In some other embodiments, it is at least 25 nucleobases in length. Among other things, the present disclosure provides oligonucleotides of comparable or better properties and / or comparable or higher activities but of shorter lengths compared to prior reported adenosine editing oligonucleotides.

[0182] In some embodiments, a base sequence of the oligonucleotide is complementary to a base sequence of a target nucleic acid (e.g, complementarity to a portion of the target nucleic acid comprising the target adenosine) with 0-10 (e.g., 0-1, 0-2, 0-3, 0-4, 0-5, 0-6. 0-7, 0-8, 0-9. 0-10, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, I-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) mismatches which are not Watson-Crick base pairs (AT, AU and CG). In some embodiments, there are no mismatches. In some embodiments, there is 1 mismatch. In some embodiments, there are 2 mismatches. In some embodiments, there are 3 mismatches. In some embodiments, there are 4 mismatches. In some embodiments, there are 5 mismatches. In some embodiments, there are 6 mismatches. In some embodiments, there are 7 mismatches. In some embodiments, there are 8 mismatches. In some embodiments, there are 9 mismatches. In some embodiments, there arc 10 mismatches. In some embodiments, oligonucleotides may contain portions that are not designed for complementarity (e.g., loops, protein binding sequences, etc., for recruiting of proteins, e.g., ADAR). As those skilled in the art will appreciate, when calculating mismatches and / or complementarity, such portions may be properly excluded. In some embodiments, complementarity, e.g, between oligonucleotides and target nucleic acids, is about 50%-100% (e.g, about 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%. 80%-85%, 80%-90%, 80%-95%. 80%-100%, 85%-90%, 85%-95%, 85%- 100%. 90%-95%, 90%-100%. 50%. 60%. 65%. 70%. 75%. 80%. 85%. 90%. 95%. or 100%, etc.). In some embodiments, complementarity is at least about 60%. In some embodiments, complementarity is at least about 65%. In some embodiments, complementarity is at least about 70%. In some embodiments, complementarity is at least about 75%. In some embodiments, complementarity is at least about 80%. In some embodiments,complementarity is at least about 85%. In some embodiments, complementarity is at least about 90%. In some embodiments, complementarity' is at least about 95%. In some embodiments, complementarity is 100% across the length of an oligonucleotide. In some embodiments, comple entarity is 100% except at a nucleoside opposite to a target nucleoside (e.g., adenosine) across the length of an oligonucleotide. Typically, complementarity is based on Watson-Crick base pairs AT, AU and CG. Those skilled in the art will appreciate that when assessing complementarity of two sequences of different lengths (e.g., a provided oligonucleotide and a target nucleic acid) complementarity may' be properly based on the length of tire shorter sequence and / or maximum complementarity between the two sequences. In many embodiments, oligonucleotides and target nucleic acids are of sufficient complementarity such that modifications are selectively directed to target adenosine sites.

[0183] In some embodiments, one or more mismatches are independently wobbles In some embodiments, each mismatch is a wobble. In some embodiments, there are 0-10 (e.g., 0-1, 0-2, 0-3, 0-4, 0-5, 0-6, 0-7, 0-8, 0-9, 0-10, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 0, I, 2, 3, 4. 5, 6, 7, 8, 9, or 10, etc.) wobbles. In some embodiments, the number is 0. In some embodiments, the number is 1. In some embodiments, the number is 2. In some embodiments, the number is 3. In some embodiments, the number is 4 In some embodiments, the number is 5. In some embodiments, a wobble is G-U, I-A, G-A, I-U, I-C, I-T, A-A, or reverse A-T. In some embodiments, a wobble is G-U, I-A, G-A, I-U, or I-C. In some embodiments, I-C may be considered a match when I is a 3’ immediate nucleoside next to a nucleoside opposite to a target nucleoside. In some embodiments, a base that forms a wobble pair (e.g., U which can form a G-U wobble) may replace a base that forms a match pair (e g,, C which matches G) and can provide oligonucleotide with editing activity.

[0184] In some embodiments, duplexes of oligonucleotides and target nucleic acids comprise one or more bulges each of which independently comprise one or more mismatches that are not wobbles In some embodiments, there are 0-10 (e.g., 0-1, 0-2, 0-3, 0-4, 0-5, 0-6, 0-7, 0-8, 0-9, 0-10, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) bulges. In some embodiments, the number is 0. In some embodiments, the number is 1. In some embodiments, the number is 2. In some embodiments, the number is 3. In some embodiments, the number is 4. In some embodiments, the number is 5.

[0185] In some embodiments, distances between two mismatches, mismatches and one or both ends of oligonucleotides (or a portion thereof, e.g., first domain, second domain, first subdomain, second subdomain, third subdomain), and / or mismatches and nucleosides opposite to target adenosine can independently be 0-50, 0-40, 0-30, 0-25, 0-20, 0-15, 0-10 (e.g., 0-1, 0-2, 0-3, 0-4, 0-5, 0-6, 0-7, 0-8. 0-9, 0-10, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8. 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8. 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9. 3-10. 1, 2, 3, 4. 5, 6, 7, 8.9, 10, 11. 12, 13, 14, 15. 16, 17, 18. 19, 20, 21, 22. 23, 24, 25, 26, 27, 28, 29. 30, 31, 32, 33, 34, or 35 nucleobases (not including mismatches, end nucleosides and nucleosides opposite to target adenosine). In some embodiments, a number is 0-30. In some embodiments, a number is 0-20. In some embodiments, anumber is 1, 2, 3, 4, 5, 6. 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some embodiments, a distance between two mismatches is 0-20. In some embodiments, a distance between two mismatches is 1-10. In some embodiments, a distance between a mismatch and a 5’-end nucleoside of an oligonucleotide is 0-20, In some embodiments, a distance between a mismatch and a 5’-end nucleoside of an oligonucleotide is 5-20. In some embodiments, a distance between a mismatch and a 3 ’-end nucleoside of an oligonucleotide is 0-40. In some embodiments, a distance between a mismatch and a 3’-end nucleoside of an oligonucleotide is 5-20. In some embodiments, a distance between a mismatch and a nucleoside opposite to a target adenosine is 0-20. In some embodiments, a distance between a mismatch and a nucleoside opposite to a target adenosine is 1-10, In some embodiments, the number of nucleobases for a distance is 0. In some embodiments, it is 1. In some embodiments, it is 2. in some embodiments, it is 3. In some embodiments, it is 4. In some embodiments, it is 5. In some embodiments, it is 6. In some embodiments, it is 7. In some embodiments, it is 8 In some embodiments, it is 9. In some embodiments, it is 10. In some embodiments, it is 11. Tn some embodiments, it is 12. In some embodiments, it is 13. In some embodiments, it is 14. In some embodiments, it is 15. In some embodiments, it is 16. In some embodiments, it is 17. In some embodiments, it is 18. In some embodiments, it is 19. In some embodiments, it is 20. In some embodiments, a mismatch is at an end, e.g.. a 5’-end or 3’-end of a first domain, second domain, first subdomain, second subdomain, or third subdomain. In some embodiments, a mismatch is at a nucleoside opposite to a target adenosine.

[0186] Among other things, the present disclosure has demonstrated that various oligonucleotides with mismatches / wobbles at various positions (e.g., counting from the 5 '-end of the oligonucleotide, the 3 ’-end of the oligonucleotide, No, etc.) can provide editing and / or increased levels of LDLR mRNA and / or polypeptides. See, e.g., oligonucleotides and data in the Figures and the Examples.

[0187] In some embodiments, provided oligonucleotides can direct adenosine editing (e.g.., converting A to I) in a target nucleic acid and has a base sequence which consists of, comprises, or comprises a portion (e.g., a span of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or more contiguous bases) of the base sequence of an oligonucleotide disclosed herein, wherein each T can be independently replaced with U and vice versa, and the oligonucleotide comprises at least one non-naturally-occurring modification of a base, sugar and / or internucleotidic linkage.

[0188] In some embodiments, a provided oligonucleotide comprises one or more carbohydrate moieties. In some embodiments, a provided oligonucleotide comprises one or more GalNAc moieties. In some embodiments, a provided oligonucleotide comprises one or more targeting moieties. Non-limiting examples of such additional chemical moieties which can be conjugated to oligonucleotide chain arc described herein.

[0189] In some embodiments, provided oligonucleotides can direct a correction of a G to A mutation in a target sequence, or a product thereof. In some embodiments, a correction of a G to A mutation is or comprises conversion of A to I, which can be read as G during translation or other biological processes. In some embodiments, provided oligonucleotides can direct a correction of a G to A mutation in a target sequence or a product thereof via ADAR-mediated deamination. In some embodiments, provided oligonucleotides can directa correction of a G to A mutation in a target sequence or a product thereof via ADAR-mediated deamination by recruiting an endogenous ADAR (e.g., in a target ceil) and facilitating the ADAR-mediated deamination. Regardless, however, the present disclosure is not limited to any particular mechanism, In some embodiments, the present disclosure provides oligonucleotides, compositions, methods, etc., capable of operating via doublestranded RNA interference, single-stranded RNA interference, RNase H-mediated knock-down, steric hindrance of translation, ADAR-mediated deamination or a combination of two or more such mechanisms.

[0190] In some embodiments, an oligonucleotide comprises a structural element or a portion thereof described herein, e.g., in a Table. In some embodiments, an oligonucleotide has a base sequence which comprises the base sequence (or a portion thereof) wherein each T can be independently substituted with U, pattern of chemical modifications (or a portion thereof), and / or a format of an oligonucleotide disclosed herein, e.g., in a Table or in the Figures, or otherwise disclosed herein. In some embodiments, such oligonucleotide can direct a correction of a G to A mutation in a target sequence, or a product thereof.

[0191] Among other things, provided oligonucleotides may hybridize to their target nucleic acids (e.g., pre-mRNA, mature mRNA, etc.). In some embodiments, oligonucleotide can hybridize to a target RNA sequence nucleic acid in any stage of RNA processing, including but not limited to a pre-mRNA or a mature mRNA. In some embodiments, oligonucleotide can hybridize to any element of oligonucleotide nucleic acid or its complement, including but not limited to: a promoter region, an enhancer region, a transcriptional stop region, a translational start signal, a translation stop signal, a coding region, a non-coding region, an exon, an intron, an intron / exon or exon / intron junction, the 5' UTR, or the 3' UTR.

[0192] In some embodiments, oligonucleotide hybridizes to two or more variants of transcripts derived from a sense strand of a target site (e.g., a target sequence).

[0193] In some embodiments, provided oligonucleotides contain increased levels of one ormore isotopes. In some embodiments, provided oligonucleotides are labeled, e g., by one or more isotopes of one or ore elements, e.g., hydrogen, carbon, nitrogen, etc. In some embodiments, provided oligonucleotides in provided compositions, e.g., oligonucleotides of a plurality of a composition, comprise base modifications, sugar modifications, and / or intemucleotidic linkage modifications, wherein the oligonucleotides contain an enriched level of deuterium. In some embodiments, provided oligonucleotides are labeled with deuterium (replacing -’H with ~’H) at one or more positions. In some embodiments, one or more ’H of an oligonucleotide chain or any moiety conjugated to the oligonucleotide chain (e.g., a targeting moiety, etc.) is substituted with2H Such oligonucleotides can be used in compositions and methods described herein.

[0194] In some embodiments, oligonucleotides comprise one or more modified nuclcobascs, one or more modified sugars, and / or one or more modified intemucleotidic linkages as described herein. In some embodiments, oligonucleotides comprise a certain level of modified nucleobases, modified sugars, and / or modified intemucleotidic linkages, e.g., about 5%-100%, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-I00%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%. 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all nucleobases, sugars, and intemucleotidic linkages, respectively, within an oligonucleotide.

[0195] In some embodiments, oligonucleotides comprise one or more modified sugars. In some embodiments, an oligonucleotide comprises about 1-50 (e.g., about 5, 6. 7, 8, 9, or 10 - about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, etc., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, etc.) modified sugars. In some embodiments, an oligonucleotide comprises about 1-50 (e.g., about 5, 6. 7, 8, 9, or 10 - about 10. 11. 12, 13, 14, 15, 16, 17. 18, 19, 20. 21. 22. 23, 24, 25, 30, 40 or 50, or about 5, 6, 7, 8, 9, 10, 11, 12, 13. 14, 15, 16. 17, 18, 19, 20, 21, 22, 23, 24, 25. 30, 40 or 50, etc., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, etc ) modified sugars with 2’-F modification. In some embodiments, an oligonucleotide comprises about 2-50 (e.g., about 2, 3, 4, 5, 6, 7, 8, 9, or 10 - about 10, II, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17. 18. 19. 20, 21, 22, 23, 24, 25, 30. 40 or 50, etc., 2-40, 2-30. 2-25. 2-20. 2-15, 2-10, 3-40, 3-30, 3-25, 3- 20, 3-15, 3-10, 4-40. 4-30, 4-25, 4-20, 4-15, 4-10, 5-40, 5-30. 5-25. 5-20. 5-15. 5-10. 6-40. 6-30. 6-25. 6-20.6-15. 6-10, 7-40, 7-30. 7-25, 7-20, 7-15, 7-10, 8-40, 8-30, 8-25, 8-20, 8-15, 8-10. 9-40, 9-30, 9-25, 9-20. 9-15, 9-10, 10-40, 10-30, 10-25, 10-20, 10-15, about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, etc.) consecutive modified sugars with 2 -F modification. In some embodiments, an oligonucleotide comprises 2 consecutive 2'-F modified sugars. In some embodiments, an oligonucleotide comprises 3 consecutive 2’-F modified sugars. In some embodiments, an oligonucleotide comprises 4 consecutive 2’-F modified sugars. In some embodiments, an oligonucleotide comprises 5 consecutive 2’-F modified sugars. In some embodiments, an oligonucleotide comprises 6 consecutive 2’-F modified sugars. In some embodiments, an oligonucleotide comprises 7 consecutive 2’-F modified sugars. In some embodiments, an oligonucleotide comprises 8 consecutive 2'-F modified sugars In some embodiments, an oligonucleotide comprises 9 consecutive 2’-F modified sugars. In some embodiments, an oligonucleotide comprises 10 consecutive 2 -F modified sugars. In some embodiments, an oligonucleotide comprises two or more 2 -F modified sugar blocks, wherein each sugar in a 2 -F modified sugar block is independently a 2’-F modified sugar. In some embodiments, each 2’-F modified sugar block independently comprises or consists of 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive 2’-F modified sugars as described herein. In some embodiments, two consecutive 2’-F modified sugar blocks are independently separated by a separating block w hich separating block comprises one or more sugars that arc independently not 2’-F modified sugars. In some embodiments, an oligonucleotide comprises one or more (e.g., 1-20. 1-15, 1-14. 1-13. 1-12. 1-11, 1-10, 2-20, 3-15, 4-15, 5-15, 1, 2.3.4, 5, 6, 7. 8, 9, 10, 11, 12, 13. 14.15, 16. 17, 18, 19, 20. etc.) 2’-F blocks and one or more (e.g., 1-20, 1-15, 1-14, 1-13, 1-12, 1-1 1, 1-10, 2-20, 3-15, 4-15, 5-15, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17. 18. 19, 20, etc.) separating blocks. In some embodiments, a first domain comprises one or more (e.g., 1-20, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 2-20,3-15, 4-15, 5-15, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14. 15, 16, 17, 18, 19, 20, etc.) 2’ -F blocks and one or more (e.g., 1-20, 1-15, 1-14. 1-13, 1-12, 1-11, 1-10, 2-20, 3-15, 4-15, 5-15, 1, 2, 3, 4, 5, 6, 7, 8, 9. 10, 11, 12, 13, 14, 15, 16. 17, 18, 19, 20, etc.) separating blocks. In some embodiments, each first domain block bonded to a first domain 2’-F block is a separating block. In some embodiments, each first domain block bonded to a first domain separating block is a first domain 2’-F block. In some embodiments, each sugar in a separating block is independently not 2’-F modified. In some embodiments, two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) or all sugars in a separating block are independently not 2'-F modified. In some embodiments, a separating block comprises one or more bicyclic sugars (e.g,, LNA sugar, cEt sugar, etc.) and / or one or more 2 -OR modified sugars, wherein R is optionally substituted Cue aliphatic (e.g., 2’-OMe, 2 -MOE, etc.). In some embodiments, a separating block comprises one or more 2 ’-OR modified sugars, wherein R is optionally substituted Ci s aliphatic (e.g, 2’-OMe, 2 -MOE, etc ). In some embodiments, two or more non-2’-F modified sugars are consecutive. In some embodiments, two or more 2’-OR modified sugars wherein R is optionally substituted Ci-c aliphatic (e.g., 2’-OMe, 2 ’-MOE, etc.) are consecutive. In some embodiments, a separating block comprises two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9. or 10 or more) 2 -OR modified sugars wherein R is optionally substituted Ci-& aliphatic (e.g., 2’-OMe, 2 -MOE, etc.). In some embodiments, a separating block comprises two or more (e.g., 2, 3. 4, 5, 6, 7, 8, 9, or 10 or more) consecutive 2’-OR modified sugars wherein R is optionally substituted Ci-e aliphatic (e g., 2’-OMe, 2 ’-MOE, etc.). In some embodiments, each 2’-OR modified sugar is independently a 2’-OMe or 2 ’-MOE sugar. In some embodiments, each 2 ’-OR modified sugar is independently a 2’-OMe sugar. In some embodiments, each 2’-OR modified sugar is independently a 2 -MOE sugar. In some embodiments, a separating block comprises one or more 2’-F modified sugars In some embodiments, none of 2’-F modified sugars in a separating block are next to each other. In some embodiments, a separating block contain no 2’-F modified sugars. In some embodiments, each sugar in a separating block is independently a 2’-OR modified sugar wherein R is optionally substituted Ci.e aliphatic or a bicyclic sugar. In some embodiments, each sugar in each separating block is independently a 2’-OR modified sugar wherein R is optionally substituted Ci-s aliphatic or a bicyclic sugar In some embodiments, each sugar in a separating block is independently a 2’-ORmodified sugar -wherein Ris optionally substituted Ci-6 aliphatic. In some embodiments, each sugar in each separating block is independently a 2 '-OR modified sugar wherein R is optionally substituted Ci 6 aliphatic. In some embodiments, each sugar in a separating block is independently' a 2’-OMe or 2 -MOE modified sugar. In some embodiments, each sugar in each separating block is independently a 2’-OMe or 2’-MOE odified sugar. In some embodiments, each sugar in a separating block is independently a 2’-0Mc modified sugar. In some embodiments, each sugar in a separating block is independently a 2 -MOE modified sugar. In some embodiments, a separating block comprises a 2’-OMe sugar and 2 -MOE modified sugar. In some embodiments, each 2’-F block and each separating block independently contains 1, 2, 3, 4, or 5 nucleosides. In some embodiments, each 2'-F block and each separating block independently contains 1, 2, or 3 nucleosides

[0196] In some embodiments, one or more sugars of N2, N3, bU, Ns, Mi, Ns, Ns, N;o, Nu, N12, Nn, N15,N16, N17, NIS, N is, N2U, and N21 are independently a 2’-F modified sugar. In some embodiments, several of them are 2’-F modified sugars, and the others of them are 2 ’-OR modified sugars wherein R is optionally substituted CBS aliphatic. In some embodiments, several of them are 2 -F modified sugars, and the others of them are 2’-0Me modified sugar. In some embodiments, several of them are 2 -1 modified sugars, and the others of them are 2 ’-MOE modified sugar.

[0197] In some embodiments, one or more sugars of N12 and NB are independently a 2’-OR modified sugar wherein R is optionally substituted Ci « aliphatic. In some embodiments, one or more sugars of N12 and N13 are independently a 2’-OMe modified sugar. In some embodiments, sugar of NB. is a 2 ’-OR modified sugar. In some embodiments, sugar of N12 is a 2’-OMe modified sugar. In some embodiments, sugar of NB is a 2 -OR modified sugar. In some embodiments, sugar of N13 is a 2’-OMe modified sugar.

[0198] In some embodiments, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-I00%. 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%. 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%. 50%. 60%, 65%, 70%, 75%, 80%, 85%, 90%. 95%, or 100%, etc, of all sugars are modified sugars. In some embodiments, about I0%-100%, 20-100%. 30%-100%. 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-I00%.90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%.65%, 70%, 75%, 80%. 85%, 90%. 95%. or 100%, etc. of all sugars are modified sugars independently selected from 2’-F modified sugars, 2 -OR modified sugars wherein R is optionally substituted Cve aliphatic, and bicyclic sugars (e.g., LN A sugars, cEt sugars, etc.). In some embodiments, a percentage is about or at least about 30%. In some embodiments, a percentage is about or at least about 40%. In some embodiments, a percentage is about or at least about 50%, In some embodiments, a percentage is about or at least about 60%. In some embodiments, a percentage is about or at least about 70%. In some embodiments, a percentage is about or at least about 80%. In some embodiments, a percentage is about or at least about 90%. In some embodiments, a percentage is about or at least about 95%.

[0199] In some embodiments, about 10%-100%, 20-100%, 30%-100%, 40%-I00%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%, 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%. 75%-95%, 75%-100%. 80%-85%, 80%-90%, 80%-95%. 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%. 50%. 60%, 65%, 70%, 75%, 80%, 85%, 90%. 95%. or 100%, etc. of all sugars are modified sugars independently selected from 2’-F modified sugars and 2 -OR modified sugars wherein R is optionally substituted Ci6aliphatic. In some embodiments, about 10%-100%, 20-100%, 30%-100%, 40%- 100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95?% 60%-100%, 65%-80%, 65%-85%, 65%-90?% 65%-95%, 65%-100%, 70%-80%. 70%-85%, 70%-90%. 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95?% 75%-100%, 80%-85%, 80?% 90%, 80%-95%.80%-100?% 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%.40%, 50%, 60?% 65%. 70%. 75%, 80%, 85?% 90%, 95%, or 100%. etc. of all sugars are modified sugars independently selected from 2’-F modified sugars. 2’-OMe modified sugars and 27-MOE modified sugars. In some embodiments, a percentage is about or at least about 30%. In some embodiments, a percentage is about or at least about 40%. In some embodiments, a percentage is about or at least about 50%. In some embodiments, a percentage is about or at least about 60%. In some embodiments, a percentage is about or at least about 70?% In some embodiments, a percentage is about or at least about 80%. In some embodiments, a percentage is about or at least about 90%. In some embodiments, a percentage is about or at least about 95%.

[0200] In some embodiments, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50?% 85%, 50%-90%, 50%-95%, 60%-80?% 60%-85%, 60%-90%, 60%-95%, 60%-100?% 65%-80%, 65%-85%, 65%-90%, 65?%95%, 65?% 100%, 70%-80%, 70%-85%, 70%-90 % 70%-95%, 70%-100%. 75%-80%, 75?% 85%, 75%-90?% 75%-95?% 75%-100%. 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100?% 10%, 20%, 30%, 40%. 50%. 60%, 65%, 70%, 75%, 80%, 85?% 90%. 95%, or 100%, etc. of all sugars are modified sugars independently selected from 2 -F modified sugars and 2 ’-OMe modified sugars. In some embodiments, a percentage is about or at least about 30%. In some embodiments, a percentage is about or at least about 40%. In some embodiments, a percentage is about or at least about 50%. In some embodiments, a percentage is about or at least about 60 % In some embodiments, a percentage is about or at least about 70%. In some embodiments, a percentage is about or at least about 80?% In some embodiments, a percentage is about or at least about 90%. In some embodiments, a percentage is about or at least about 95?%

[0201] In some embodiments, about 10?%l 00?% 20-100?% 30?%100%. 40%-100%, 50?%80%, 50%-85%, 50%-90?% 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60?%95%, 60%-100%, 65%-80?% 65%-85?% 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70?%100%, 75%-80%, 75%-85%, 75?%90?% 75%-95%, 75?% 100%, 80?%85%, 80%-90%, 80%-95%, 80%-100?% 85%-90%, 85%-95%, 85%-I00%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40?% 50?% 60%, 65%, 70%, 75%, 80%, 85%, 90%. 95%. or 100%. etc. of all sugars are 2’-F modified sugars. In some embodiments, a percentage is about or at least about 30%. In some embodiments, a percentage is about or at least about 40%. In some embodiments, a percentage is about or at least about 50?% In some embodiments, a percentage is about or at least about 60?% In some embodiments, a percentage is about or at least about 70?% In some embodiments, a percentage is about or at least about 80?% In some embodiments, a percentage is about or at least about 90?o. In some embodiments, a percentage is about or at least about 95?o. In some embodiments, 10 or more (e g., about or at least about 10. 11, 12, 13, 14, 15. 16, 17. 18, 19, 20.21, 22. 23, 24, 25, 26, 27. 28, 29 or 30 or more. 10-50, 10-40, 10-30, 10-25, 15-50, 15-40, 15-30, 15-25, 20-50, 20-40, 20-30, 20-25. etc.) sugars are 2’-F modified sugars. In some embodiments, an oligonucleotide comprises two or more (e.g., 2-30, 2-25, 2-20, 2-15, 3-10,3-30, 3-25, 3-20, 3-15, 3-10, 4-30, 4-25, 4-20, 4-15, 4-10, 5-30, 5-25, 5-20, 5-15, 5-10, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) consecutive 2'-F modified sugars. In some embodiments, an oligonucleotide comprises one or more 2’-F blocks each independently comprising two or more (e.g., 2-30, 2-25, 2-20, 2-15, 3-10, 3-30. 3-25, 3-20. 3-15, 3-10, 4-30, 4-25. 4-20. 4-15. 4-10. 5-30. 5-25. 5-20. 5-15. 5-10.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14. 15. 16, 17, 18, 19, or 20) consecutive 2 -F modified sugars. In some embodiments, an oligonucleotide comprises two or more 2’-F blocks as described herein separated by one or more separating blocks as described herein. In some embodiments, a 2’-F block has 2, 3, 4, 5, 6, 7, 8, 9, or 10 2’-F modified sugars. In some embodiments, a 2’-F block has no more than 2. 3, 4, 5. 6, 7, 8, 9, or 10 2 -F modified sugars. In some embodiments, each sugar in each 2'-F blocks is a 2’-F modified sugar, and each 2’-F block independently has 2. 3, 4, 5. 6, 7, 8, 9. or 102’-F modified sugars. In some embodiments, each sugar in each 2’-F blocks is a 2’-F modified sugar, and each 2’-F block independently has no more than 2, 3. 4, 5, 6, 7, 8, 9, or 10 2’-F modified sugars. In some embodiments, each sugar in each 2’-F blocks is a 2 -F modified sugar, and each 2’-F block independently has no more than 10 2’-F modified sugars. In some embodiments, each sugar in each 2’-F blocks is a 2’-F modified sugar, and each 2’-F block independently has no more than 9 2’-F modified sugars. In some embodiments, each sugar in each 2’-F blocks is a 2'-F modified sugar, and each 2’-F block independently has no more than 82 -F modified sugars. In some embodiments, each sugar in each 2’-F blocks is a 2’-F modified sugar, and each 2’-F block independently has no more than 72’-F modified sugars. In some embodiments, each sugar in each 2 -F blocks is a 2’-F modified sugar, and each 2’-F block independently has no more than 62’-F modified sugars. In some embodiments, each sugar in each 2 -F blocks is a 2’-F modified sugar, and each 2’-F block independently has no more than 52’-F modified sugars. In some embodiments, each sugar in each 2'-F blocks is a 2’-F modified sugar, and each 2'-F block independently has no more than 4 2 -F modified sugars. In some embodiments, each block bonded to a 2’-F block is independently a block that comprises no 2’-F modified sugar In some embodiments, each block bonded to a 2’-F block is independently a block that comprises a natural DNA or RNA sugar, a 2’ -OR modified sugar wherein R is optionally substituted C i.g aliphatic or a bicyclic sugar. In some embodiments, each block bonded to a 2 -1 block is independently a block that comprises a natural DNA or RNA sugar, a 2’-OMe modified sugar, 2‘-MOE modified sugar or a bicyclic sugar. In some embodiments, each block bonded to a 2"-F block is independently a block that comprises a natural DNA or RNA sugar, a 2’-OMe modified sugar or 2 ’-MOE modified sugar. In some embodiments, each nucleoside in a first domain bonded to a 2’-F block in a first domain is independently a 2 -OR modified sugar wherein R is optionally substituted Ci-6 aliphatic or a bicyclic sugar. In some embodiments, each nucleoside in a first domain bonded to a 2’-F block in a first domain is independently a 2 -OR modified sugar wherein R is optionally substituted Ci e aliphatic. In some embodiments, each nucleoside in a first domain bonded to a 2'-F block in a first domain is independently a 2'-OMe or 2’-M0E modified sugar. In some embodiments, each nucleoside in a second domain bonded to a 2’-F block in a second domain is independently a 2’-OR modified sugar wherein R is optionally substituted Ci s aliphatic or a bicyclic sugar. In some embodiments, each nucleoside m a second domain bonded to a 2’-Fblock in a second domain is independently a 2"-OR modified sugar wherein R is optionally substituted CM aliphatic. In some embodiments, each nucleoside in a second domain bonded to a 2'-F block in a second domain is independently a 2’-0Me or 2 -MOE modified sugar.

[0202] In some embodiments, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%. 60%-95%, 60%-100%. 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-100%, 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all sugars are 2'-OR modified sugars, wherein R is optionally substituted C aliphatic. In some embodiments, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%. 50%-85%, 50%-90%.50%-95%, 60%-80%, 60%-85%, 60%-90%. 60%-95%. 60%-100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%-l 00%, 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90?% 95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%. 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all sugars are 2’-OMe or 2 -MOE modified sugars. In some embodiments, a percentage is about or at least about 30%. In some embodiments, a percentage is about or at least about 40%. In some embodiments, a percentage is about or at least about 50?zo. In some embodiments, a percentage is about or at least about 60%. In some embodiments, a percentage is about or at least about 70%. In some embodiments, a percentage is about or at least about 80?% In some embodiments, a percentage is about or at least about 90%. In some embodiments, a percentage is about or at least about 95%.

[0203] In some embodiments, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50?% 85%, 50%-90%, 50%-95%. 60%-80%, 60%-85%, 60%-90%. 60%-95%, 60%-100%, 65%-80?zo, 65%-85%, 65%-90%, 65%-95%, 65%-l 00%, 70%-80%, 70%-85%, 70%-90%. 70%-95%, 70?% 100%. 75%-80%, 75%-85%, 75%-90%, 75%-95%, 75%-100%. 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100?zo, etc. of all sugars are 2’-OMe modified sugars. In some embodiments, a percentage is about or at least about 30%. In some embodiments, a percentage is about or at least about 40 %. In some embodiments, a percentage is about or at least about 50%. In some embodiments, a percentage is about or at least about 60%. In some embodiments, a percentage is about or at least about. 70%. In some embodiments, a percentage is about or at least about 80%. In some embodiments, a percentage is about or at least about 90%. In some embodiments, a percentage is about or at least about 95 %.

[0204] In some embodiments, about 10%-100%, 20-100%, 30%-100%, 40%-100%, 50?%80%, 50%-85%, 50%-90%, 50%-95%, 60%-80%, 60%-85%, 60%-90%, 60%-95%. 60?% 100%, 65%-80%, 65%-85%, 65%-90%, 65%-95%, 65° / % 100%, 70?%80%. 70%-85%, 70%-90%, 70?%95%, 70%-100%, 75%-80%, 75%-85%. 75%-90%, 75?%95%, 75%-100%, 80%-85%, 80%-90%, 80%-95%, 80%-100%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%. 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%. 90%, 95%,or 100%, etc. of all sugars are 2’-OR modified sugars, wherein R is optionally substituted Cue aliphatic. In some embodiments, about I0%-100%, 20-100%, 30%-100%, 40%-100%, 50%-80%, 50%-85%, 50%-90%, 50%-95%. 60%-80%, 60%-85%, 60%-90%, 60%-95%. 60%-100%, 65%-80%, 65%-85%. 65%-90%, 65%-95%, 65%-100%, 70%-80%, 70%-85%, 70%-90%, 70%-95%, 70%- 100%, 75%-80%, 75%-85%, 75%-90%.75%-95%, 75%- 100%, 80%-85%, 80%-90%, 80%-95%, 80%-l 00%, 85%-90%, 85%-95%, 85%-100%, 90%-95%, 90%-100%, 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, etc. of all sugars are 2" -MOE modified sugars.

[0205] In some embodiments, sugars of the first (5’-end) one or several (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 1-10, 1-9. 1-8, 1-7, 1-6. 1-5, 1-4, 1-3, 2-10, 2-9, 2-8, 2-7, 2-6. 2-5, 2-4, 2-3. 3-10. 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, etc.) and / or the last (3 ’-end) one or several (e.g., 1. 2, 3, 4, 5, 6, 7, 8, 9, 10, or 1-10, 1-9, 1-8, 1-7, 1-6, 1-5.1-4, 1-3, 2-10. 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3. 3-10, 3-9, 3-8, 3-7. 3-6, 3-5, 3-4, etc.) nucleosides are independently modified sugars In some embodiments, the first one or several sugars are independently modified sugars. In some embodiments, the last one or several sugars are independently modified sugars. In some embodiments, both the first and last one or several sugars are independently modified sugars. In some embodiments, modified sugars are independently non-2'-F modified sugars, e.g., bicyclic sugars, 2 -OR modified sugars wherein R is as described herein and is not -H (e g., optionally substituted Cve aliphatic). In some embodiments, they are independently selected from bicyclic sugars and 2 -OR modified sugars wherein R is optionally substituted C-c aliphatic. In some embodiments, they are independently 2’-ORmodified sugars wherein R is optionally substituted Ci.oaliphatic. In some embodiments, they are independently 2’-OMe modified sugars and 2'-MOE modified sugars. In some embodiments, the first several sugars comprises one or more 2’-OR modified sugars wherein R is optionally substituted Cj.6 aliphatic or bicyclic sugars (e.g., LNA, cEt, etc.) as described herein. In some embodiments, the first several sugars comprises one or more 2 -OR modified sugars wherein R is optionally substituted Ci 6 aliphatic In some embodiments, the first several sugars comprises one or more 2’-OMe modified sugars. In some embodiments, the first several sugars comprises one or more 2’-MOE modified sugars. In some embodiments, the first several sugars comprises one or more 2’-OMe modified sugars and one or more 2’-MOE modified sugars. In some embodiments, the last several sugars comprises one or more 2’-OR modified sugars wherein R is optionally substituted Ci-6 aliphatic or bicyclic sugars (e.g., LNA, cEt, etc.) as described herein. In some embodiments, the last several sugars comprises one or more 2’-OR modified sugars wherein R is optionally substituted C s aliphatic. In some embodiments, the last several sugars comprises one or more 2’-OMe modified sugars. In some embodiments, the last several sugars comprises one or more 2 -MOE modified sugars. In some embodiments, the last several sugars comprises one or more 2’-OMe modified sugars and one or more 2 ’-MOE modified sugars. In some embodiments, the last several sugars are independently 2’-OMe modified sugars. In some embodiments, the first several sugars comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) consecutive bicyclic sugars or 2 -OR modified sugars wherein R is optionally substituted Cue aliphatic. In some embodiments, the first several sugars comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) consecutive2 ’-OR modified sugars wherein R is optionally substituted Che aliphatic. In some embodiments, the first several sugars comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) consecutive modified sugars wherein each modified sugar is independently a 2'-OMe modified sugar or a 2'-MOE modified sugar. In some embodiments, the first several sugars comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) consecutive 2’-OMe modified sugars. In some embodiments, the first several sugars comprise two or more (e.g., 2. 3, 4, 5, 6, 7, 8, 9, or 10, etc.) consecutive 2 -MOE modified sugars. In some embodiments, the last several sugars comprise two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) consecutive 2’-OR modified sugars wherein R is optionally substituted Cue aliphatic. In some embodiments, the last several sugars comprise two or more (e.g., 2, 3. 4, 5, 6, 7, 8, 9, or 10, etc.) consecutive modified sugars wherein each modified sugar is independently a 2’-OMe modified sugar or a 2 -MOE modified sugar. In some embodiments, the last several sugars comprise two ormore (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10, etc.) consecutive 2’-OMe modified sugars. In some embodiments, the last several sugars comprise three or more consecutive 2’-OMe modified sugars. In some embodiments, the last several sugars comprise four or more consecutive 2’-OMe modified sugars. In some embodiments, the last several sugars comprise five ormore consecutive 2’-OMe modified sugars. In some embodiments, the last several sugars comprise six ormore consecutive 2’-OMe modified sugars. In some embodiments, the last several sugars comprise two or more (e.g., 2, 3, 4. 5, 6, 7. 8, 9, or 10, etc.) consecutive 2’-MOE modified sugars.

[0206] In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the first several (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) sugars are modified sugars. In some embodiments, one ormore (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the first several (1, 2, 3. 4, 5, 6, 7, 8, 9, or 10) sugars are modified sugars each independently selected from a 2’-OR modified sugar wherein R is optionally substituted CM aliphatic and a bicyclic sugar (e.g., a sugar comprising 2’-O-CH2~4’, wherein the -CH2- is optionally substituted (e.g., a LNA sugar, a cET sugar (e.g., (S)-cEt))). In some embodiments, two or more of the first several sugars are modified sugars each independently selected from a 2’-OR modified sugar wherein R is optionally substituted Ci <5 aliphatic and a bicyclic sugar. In some embodiments, three or more of the first several sugars arc modified sugars each independently selected from a 2’-OR modified sugar wherein R is optionally substituted CM aliphatic and a bicyclic sugar. In some embodiments, four or more of the first several sugars are modified sugars each independently selected from a 2 ’-OR modified sugar wherein R is optionally substituted Ci.g aliphatic and a bicyclic sugar. In some embodiments, the one ormore sugars are consecutive. In some embodiments, the first one, two, three or four sugars are modified sugars. In some embodiments, the first two sugars are modified sugars each independently selected from a 2’-OR modified sugar wherein R is optionally substituted CM aliphatic and a bicyclic sugar. In some embodiments, the first three sugars are modified sugars each independently selected from a 2 -OR modified sugar wherein R is optionally substituted CM aliphatic and a bicyclic sugar. In some embodiments, the first four sugars are modified sugars each independently selected from a 2’ -OR modified sugar wherein R is optionally substituted C aliphatic and a bicyclic sugar. In some embodiments, each 2’-OR modified sugar is independently a 2’-OMe or 2 -MOE modified sugar. In someembodiments, each bicyclic sugar is independently a LNA sugar or a cEt sugar. In some embodiments, each of the one or more (e.g., 1, 2, 3, 4, or 5) sugars of the first several sugars, or the first several (e.g., I, 2, 3, 4, or 5) sugar(s), is independently a 2 -OR modified sugar wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, each of the one or more (e.g., 1, 2, 3, 4, or 5) sugars of the first several sugars, or the first several (e.g., 1, 2, 3, 4. or 5) sugar(s), is independently a 2’-0Me or 2'-M0E modified sugar. In some embodiments, each of the one ormore (e.g., 1, 2, 3, 4, or 5) sugars of the first several sugars, orthe first several (e.g., 1, 2, 3, 4, or 5) sugar(s), is independently a 2’-0Me modified sugar. In some embodiments, each of the one or more (e.g., 1, 2, 3, 4, or 5) sugars of the first several sugars, or the first several (e.g., 1. 2, 3, 4, or 5) sugar(s), is independently a 2’-M0E modified sugar. In some embodiments, the first one, two, three, four or more sugars are independently 2’-0Me modified sugars. In some embodiments, the first sugar is a 2’-0Me modified sugar. In some embodiments, the first two sugars are independently 2 -OMe modified sugars. In some embodiments, the first three sugars are independently 2’-0Me modified sugars. In some embodiments, the first four sugars are independently 2’-0Me modified sugars. In some embodiments, the first one, two, three, four or more sugars are independently 2 -MOE modified sugars, in some embodiments, the first sugar is a 2 ’-MOE modified sugar. In some embodiments, the first two sugars are independently 2 ‘-MOE modified sugars. In some embodiments, the first three sugars are independently 2 -MOE modified sugars. In some embodiments, the first four sugars are independently 2’-M0E modified sugars. In some embodiments, each of such modified sugars is independently the sugar of a nucleoside whose nucleobase is optionally substituted or protected A, T, C, G, or U, or an optionally substituted or protected tautomer of A, T, C, G, or U. In some embodiments, one or more such sugars are independently bonded to a non -negatively charged intemucleotidic linkage. In some embodiments, one ormore such sugars are independently bonded to a neutral intemucleotidic linkage such as nOOl. In some embodiments, a non-negatively charged intemucleotidic linkage or neutral intemucleotidic linkage, e.g., nOOl, is chi rally controlled. In some embodiments, it is 7?p. In some embodiments, one or more such sugars are independently bonded to a phosphorothioate intemucleotidic linkage. In some embodiments, a phosphorothioate intemucleotidic linkage is chirally controlled. In some embodiments, it is 5'p. In some embodiments, as described herein, the intemucleotidic linkage between the first and second nucleosides is a non-negatively charged intemucleotidic linkage. In some embodiments, it is a neutral intemucleotidic linkage. In some embodiments, it is a phosphoryl guanidine intemucleotidic linkage. In some embodiments, it is nOOl. In some embodiments, it is chirally controlled. Tn some embodiments, it is Zip. In some embodiments, except the intemucleotidic linkage between the first and second nucleosides, each intemucleotidic linkages bonded to nucleosides comprising the one or more of the first several, or the first several modified sugars are independently phosphorothioate intemucleotidic linkages. In some embodiments, each is chirally controlled. In some embodiments, each is Sp. Tn some embodiments, a first nucleoside is connected to an additional moiety, e.g., ModOOl, optionally through a linker, e.g., LOOl, through its 5’-end carbon (in some embodiments, via a phosphate group).

[0207] In some embodiments, one or more (I, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the last several (1, 2, 3, 4, 5,6, 7, 8, 9, or 10) sugars are modified sugars. In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of the last several (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) sugars are modified sugars each independently selected from a 2'-OR modified sugar wherein R is optionally substituted Ci.g aliphatic and a bicyclic sugar (e.g,, a sugar comprising 2’-O-CH2-4’, wherein the -CEfe- is optionally substituted (e.g., a LNA sugar, a cET sugar (e.g.. (S)-cEt))). In some embodiments, two or more of the last several sugars are modified sugars each independently selected from a 2’-OR modified sugar wherein R is optionally substituted C e aliphatic and a bicyclic sugar. In some embodiments, three or more of the last several sugars are modified sugars each independently selected from a 2’-OR modified sugar wherein R is optionally substituted C i.g aliphatic and a bicyclic sugar. In some embodiments, four or more of the last several sugars are modified sugars each independently selected from a 2 -OR modified sugar wherein R is optionally substituted Ci.g aliphatic and a bicyclic sugar. In some embodiments, the one or more sugars are consecutive In some embodiments, the last one, two, three or four sugars are modified sugars. In some embodiments, the last two sugars are modified sugars each independently selected from a 2 ’-OR modified sugar wherein R is optionally substituted Cue aliphatic and a bicyclic sugar. In some embodiments, the last three sugars are modified sugars each independently selected from a 2 -OR modified sugar wherein R is optionally substituted Cw aliphatic and a bicyclic sugar. In some embodiments, the last four sugars are modified sugars each independently selected from a 2’-OR modified sugar wherein R is optionally substituted C,.6 aliphatic and a bicyclic sugar. In some embodiments, each 2’-OR modified sugar is independently a 2’-OMe or 2 -MOE modified sugar. In some embodiments, each bicyclic sugar is independently a LNA sugar or a cEt sugar. In some embodiments, each of the one or more (e.g,, 1, 2, 3, 4, or 5) sugars of the last several sugars, or the last several (e g., 1, 2, 3, 4, or 5) sugar(s), is independently a 2 -OR modified sugar wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, each of the one or more (e.g., 1, 2, 3, 4, or 5) sugars of the last several sugars, or the last several (e.g., L 2, 3, 4, or 5) sugar(s), is independently a 2’-OMe or 2’ -MOE modified sugar. In some embodiments, each of the one or more (e.g., I, 2, 3, 4, or 5) sugars of the last several sugars, or the last several (e.g., 1, 2, 3, 4, or 5) sugar(s), is independently a 2’-OMc modified sugar. In some embodiments, each of the one or more (e.g., 1, 2, 3, 4, or 5) sugars of the last several sugars, or the last several (e.g., 1, 2, 3, 4. or 5) sugar(s), is independently a 2 -MOE modified sugar. In some embodiments, the last one, two, three, four or more sugars are independently 2’-OMe modified sugars. In some embodiments, the last sugar is a 2’-OMe modified sugar. In some embodiments, the last two sugars are independently 2’-OMe modified sugars. In some embodiments, the last three sugars are independently 2'-()Me modified sugars. In some embodiments, the last four sugars are independently 2’-OMc modified sugars. In some embodiments, the last one, two, three, four or more sugars are independently 2 -MOE modified sugars. In some embodiments, the last sugar is a 2’-MOE modified sugar. In some embodiments, the last two sugars are independently 2 -MOE modified sugars. In some embodiments, the last three sugars are independently 2 -MOE modified sugars. In some embodiments, the last four sugars are independently 2 ’-MOE modified sugars. In some embodiments, each of such modified sugars is independently the sugar of a nucleoside whose nucleobase is optionally substituted or protected A,T, C, G, or U, or an optionally substituted or protected tautomer of A, T, C. G, or U. In some embodiments, one or more such sugars are independently bonded to a non-negatively charged intemucleotidic linkage. In some embodiments, one or more such sugars are independently bonded to a neutral intemucleotidic linkage such as nOOi. In some embodiments, a non-negatively charged intemucleotidic linkage or neutral intemucleotidic linkage, e.g., nOOL is chirally controlled. In some embodiments, it is 7?p. In some embodiments, one or more such sugars are independently bonded to a phosphorothioate intemucleotidic linkage. In some embodiments, a phosphorothioate intemucleotidic linkage is chirally controlled. In some embodiments, it is 5'p. In some embodiments, as described herein, the intemucleotidic linkage between the last and second last nucleosides is a non-negatively charged intemucleotidic linkage. In some embodiments, it is a neutral intemucleotidic linkage. In some embodiments, it is a phosphoryl guanidine intemucleotidic linkage. In some embodiments, it is nOOl. In some embodiments, it is chiralfy controlled. In some embodiments, it is Rp. In some embodiments, except the intemucleotidic linkage between the last and second last nucleosides, each intemucleotidic linkages bonded to nucleosides comprising the one or more of the last several, or the last several modified sugars are independently phosphorothioate intemucleotidic linkages, hi some embodiments, each is chirally controlled. In some embodiments, each is 5p.[OO2O8J In some embodiments, a sugar at position +1 is a 2 -!■' modified sugar. In some embodiments, a sugar at position +1 is a natural DNA sugar. In some embodiments, a sugar at position 0 is a natural DNA sugar (nucleoside at position 0 is opposite to a target adenosine when aligned). In some embodiments, a sugar at position -1 is a DNA sugar. In some embodiments, a sugar at position -2 is a 2"-OR modified sugar wherein R is optionally substituted Cu aliphatic or a bicyclic sugar (e.g., a sugar comprising 2' 0 ( 11 i' wherein the -CHj- is optionally substituted (e.g., a LNA sugar, a cET sugar (e.g., (S)-cEt))). In some embodiments, it is a 2’-OR modified sugar wherein R is optionally substituted Ci 6 aliphatic. In some embodiments, it is a 2’ -OMe modified sugar. In some embodiments, it is a 2 / -M0E modified sugar. In some embodiments, it is a bicyclic sugar. In some embodiments, it is a LNA sugar In some embodiments, it is a cEt sugar. In some embodiments, a sugar at position -3 is a 2’-F modified sugar. In some embodiments, each sugar after position -3 (e.g., position -4, -5, -6, etc.) is independently a 2’-OR modified sugar wherein R is optionally substituted Ci-6 aliphatic or a bicyclic sugar (e.g., a sugar comprising 2'-O~CH2”4', wherein the -CH2- is optionally substituted (e.g., a LNA sugar, a cET sugar (e.g.. (S)-cEt))). In some embodiments, each is independently a 2’-OR modified sugar wfterein R is optionally substituted C1-6 aliphatic or a bicyclic sugar. In some embodiments, each is independently a 2’-0Me or 2’-M0E modified sugar. In some embodiments, each is a ’-OMe modified sugar. In some embodiments, each is a 2 ’-MOE modified sugar. In some embodiments, one or more are independently 2"-0Me modified sugars, and one or more are independently 2’-M0E modified sugars. In some embodiments, as described herein, the intemucleotidic linkage between nucleosides at positions -1 and-2 is a non-negatively charged intemucleotidic linkage. In some embodiments, it is a neutral intemucleotidic linkage. In some embodiments, it is a phosphoryl guanidine intemucleotidic linkage In some embodiments, it is nOOl hr some embodiments, it is chirally controlled. In some embodiments, it is 5p. Insome embodiments, it is Rp. In some embodiments, the intemucleotidic linkage between nucleosides at positions -2 and -3 is a natural phosphate linkage. In some embodiments, as described herein, the intemucleotidic linkage between the last and second last nucleosides is a non-negatively charged intemucleotidic linkage. In some embodiments, it is a neutral intemucleotidic linkage In some embodiments, it is a phosphoryl guanidine intemucleotidic linkage. In some embodiments, it is nOO 1. In some embodiments, it is chirally controlled. In some embodiments, it is Rp. In some embodiments, each intemucleotidic linkages between nucleosides to the 3 ’-side of a nucleoside opposite to a target adenosine, except those between nucleosides at positions -1 and -2, and between nucleosides at positions -2 and -3, and between the last and the second last nucleosides, is independently a phosphorothioate intemucleotidic linkages. In some embodiments, each phosphorothioate intemucleotidic linkage is chirally controlled. In some embodiments, each is 5p.

[0209] In some embodiments, the first and / or last one or several sugars are modified sugars, e g., bicyclic sugars and / or 2’-OR modified sugars wherein R is optionally substituted Ci-e aliphatic (e.g., 2 -OMe modified sugars, 2’-M0E modified sugars, etc.). In some embodiments, such sugars may increase stability, affinity and / or activity of an oligonucleotide. In some embodiments, when conjugated to one or more additional chemical moieties, sugars at 5’ - and / or 3 "-ends of oligonucleotides are not bicyclic sugars or 2 ’-OR modified sugars wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, a 5 ’-end sugar is a bicyclic sugar or a 2’-OR modified sugar -wherein R is optionally substituted Cns aliphatic. In some embodiments, such a 5 ’-end sugar is not connected to an additional chemical moiety. In some embodiments, a 5 ’-end sugar is a 2 -F modified sugar. In some embodiments, a 5’-end sugar is a 2’-F modified sugar conjugated to an additional chemical moiety. In some embodiments, a 3’-end sugar is a bicyclic sugar or a 2 -OR modified sugar wherein R is optionally substituted Ci-e aliphatic. In some embodiments, such a 3’-end sugar is not connected to an additional chemical moiety. In some embodiments, a 3’-end sugar is a 2’-F modified sugar. In some embodiments, a 3’-end sugar is a 2 -F modified sugar conjugated to an additional chemical moiety. In some embodiments, the last several sugars are 3 ’-side sugars relative to a nucleoside opposite to a target adenosine (e.g., sugars of 3’-sidc nucleosides such as N.i, N.?_, etc.). In some embodiments, the last several sugars or the 3’-side sugars comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) 2'-F modified sugars. In some embodiments, the last several sugars or the 3’-side sugars comprises two or more (e.g., 2, 3.4, 5, 6, 7, 8, 9, or 10 or more) consecutive 2’-F modified sugars. In some embodiments, the last several sugars or the 3’-side sugars comprises one or more, or two or more consecutive, 2’-F modified sugars, and sugar of the last nucleoside of an oligonucleotide is a bicyclic sugar or a 2’-OR modified sugar wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, as described herein a 2’-OR modified sugar is a 2’-OMc modified sugar or a 2 ’-MOE modified sugar, in some embodiments, it is a 2 '-OMe modified sugar; in some embodiments, it is a 2’-MOE modified sugar. In some embodiments, the last several sugars or the 3’-side sugars comprises one or more, or two or more consecutive, 2’-F modified sugars, and sugar of the last nucleoside of an oligonucleotide is a 2 ’-OR modified sugar wherein Ris optionally substituted Ci t, aliphatic. In some embodiments, the last several sugars or the 3 ’-side sugars comprises one or more, or iwo or moreconsecutive, 2’-F modified sugars, and sugar of the last nucleoside of an oligonucleotide is a 2’-0Me modified sugar or a 2 ’-MOE modified sugar. In some embodiments, the last several sugars or the 3 ’-side sugars comprises one or more, or two or more consecutive. 2'-F modified sugars, and sugar of the last nucleoside of an oligonucleotide is a 2’-0Me modified sugar. In some embodiments, the last several sugars or the 3’-side sugars comprises one or more, or two or more consecutive. 2’-F modified sugars, and sugar of the last nucleoside of an oligonucleotide is a 2’-M0E modified sugar. In some embodiments, two and no more than two nucleosides at the 3 ’-side of a nucleoside opposite to an adenosine independently have a 2’-F modified sugar. In some embodiments, they are at positions -4 and -5, In some embodiments, they are the second and third last nucleosides of an oligonucleotide. In some embodiments, one and no more than one nucleoside at the 3 ’-side of a nucleoside opposite to an adenosine has a 2 -F modified sugar. In some embodiments, it is at position -3 In some embodiments, it is 4lhlast nucleoside of an oligonucleotide.

[0210] In some embodiments, a bicyclic sugar or a 2 -OR modified sugar wherein R is optionally substituted Ci-g aliphatic is present in a region which comprises one or more (e.g., 1-30, 1-25, 1-20, 1-15, 1-10, 2-30, 2-25, 2-20, 2-25, 2-10, or I, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) sugars are 2’-F modified. In some embodiments, a majority of sugars as described herein in such a region are 2’-F modified sugars. In some embodiments, two or more 2 -F modified sugars are consecutive. In some embodiments, a region is a first domain In some embodiments, a bicyclic sugar is present in such a region. In some embodiments, a 2’-OR modified sugar wherein R is optionally substituted Ci-s aliphatic is present in such a region. In some embodiments, a 2’-OMe modified sugar is present in such a region. In some embodiments, a 2‘-MOE modified sugar is present in such a region.[0021 1] In some embodiments, one or more sugars at positions -5, -4, -3. +1. +2, +4. +5, +6. +7. and +8 (position 0 being the position of a nucleoside opposite to a target adenosine: “■+” is going from a nucleoside opposite to a target adenosine toward 5 "-end of an oligonucleotide, andis going from a nucleoside opposite to a target adenosine toward ’-end of an oligonucleotide; for example, in 5’- iNoN-i-3’, if No is a nucleoside opposite to a target adenosine, it is at position 0, and Ni is at position +1 and N.; is at position -I) arc independently 2 -1 modified sugars. In some embodiments, a sugar at position +1, and one or more sugars at positions -5. -4, -3. +2, +4. -1-5. +6, +7, and +8, are independently 2'-F modified sugars. In some embodiments, a sugar at position +1. and one sugar at position -5, -4, -3, +2, +4, +5, +6, +7, and +8, are independently 2’-F modified sugars.

[0212] In some embodiments, an oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, 2-10, 3-10, 2-5, 2-4, 2-3, 3-5, 3-4, etc.) natural DNA sugars. In some embodiments, one or more natural DNA sugars are at an editing region, e.g., positions +1, 0, and / or -1. In some embodiments, a natural DNA sugar is within the first several nucleosides of an oligonucleotides (e.g., the first 1, 2. 3, 4, 5, 6. 7, 8, 9. or 10 nucleosides). In some embodiments, the first, second, and / or third nucleosides of an oligonucleotides independently have a natural DNA sugar. In some embodiments, a natural DNA sugar is bonded to a modified internucleotidic linkage such as a non-negatively charged internucleotidic linkage, a neutral intemucleotidiclinkage, a phosphoryl guanidine internucleotidic linkage, nOOl, or a phosphorothioate intemucleotidic linkage (in various embodiments, Sp).

[0213] Oligonucleotides may contain various types of intemucleotidic linkages. In some embodiments, oligonucleotides comprises one or more modified intemucleotidic linkages. In some embodiments, a modified internucleotidic linkage is a chiral intemucleotidic linkages. In some embodiments, a modified intemucleotidic linkage is a phosphorothioate intemucleotidic linkage. In some embodiments, a modified internucleotidic linkage is a non-negatively charged intemucleotidic linkage. In some embodiments, a modified intemucleotidic linkage is a neutral intemucleotidic linkage. In some embodiments, a modified intemucleotidic linkage is a phosphoryl guanidine intemucleotidic linkage. In some embodiments, a modified internucleotidic linkage is nOOl. In some embodiments, oligonucleotides comprises one or more natural phosphate linkages. In some embodiments, a natural phosphate linkage bonds to a nucleoside comprising a modified sugar that can improve stability (e.g., resistance toward nuclease). In some embodiments, a natural phosphate linkage bonds to a bicyclic sugar. In some embodiments, a natural phosphate linkage bonds to a 2’-modified sugar. In some embodiments, a natural phosphate linkage bonds to a 2 -OR modified sugar, wherein R is optionally substituted Ci s aliphatic. In some embodiments, a natural phosphate linkage bonds to a 2’-OMe modified sugar. In some embodiments, a natural phosphate linkage bonds to a 2 -MOE modified sugar. In some embodiments, an oligonucleotide comprises a phosphorothioate intemucleotidic linkage, a non-negatively charged internucleotidic linkage, and a natural phosphate linkage. In some embodiments, an oligonucleotide comprises a phosphorothioate intemucleotidic linkage, a neutral internucleotidic linkage, and a natural phosphate linkage. In some embodiments, an oligonucleotide comprises a phosphorothioate intemucleotidic linkage, a phosphory l guanidine intemucleotidic linkage, and a natural phosphate linkage. In some embodiments, an oligonucleotide comprises a phosphorothioate internucleotidic linkage. nOOl, and a natural phosphate linkage In some embodiments, each chiral internucleotidic linkage is independently chirally controlled In some embodiments, one or more chiral intemucleotidic linkage is not chirally controlled. In some embodiments, each phosphorothioate intemucleotidic linkage is independently chirally’ controlled. In some embodiments, each chiral intemucleotidic linkage is independently chirally controlled. In some embodiments, a majority or each phosphorothioate intemucleotidic linkage is 5p as described herein. In some embodiments, a majority or each non-negatively charged intemucleotidic linkage, e.g., nOOl, is Rp. In some embodiments, a majority’ or each non-negatively’ charged intemucleotidic linkage, e.g., nOOl, is Sp.

[0214] In some embodiments, an oligonucleotide comprises a phosphorothioate intemucleotidic linkage and a non-negatively charged intemucleotidic linkage. In some embodiments, an oligonucleotide comprises a phosphorothioate intemucleotidic linkage and a neutral intemucleotidic linkage. In some embodiments, an oligonucleotide comprises a phosphorothioate intemucleotidic linkage and a phosphoryl guanidine intemucleotidic linkage. In some embodiments, an oligonucleotide comprises a phosphorothioate internucleotidic linkage and nOO 1 In some embodiments, each chiral internucleotidic linkage is independently' chirally' controlled. In some embodiments, one or more chiral intemucleotidic linkage is not chirallycontrolled. In some embodiments, each phosphorothioate intemucleotidic linkage is independently chirally controlled. In some embodiments, each chiral intemucleotidic linkage is independently chirally controlled. In some embodiments, a majority or each phosphorothioate intemucleotidic linkage is Sp as described herein. In some embodiments, one or more (e.g., 1, 2. 3, 4, or 5) phosphorothioate intemucleotidic linkages are 7?p. In some embodiments, a majority or each non-negatively charged intemucleotidic linkage, e.g., nOOl, is Rp. In some embodiments, a majority or each non-negatively charged intemucleotidic linkage, e.g., nOOl, is Sp. In some embodiments, an oligonucleotide comprises no natural phosphate linkages. In some embodiments, each intemucleotidic linkage is independently a phosphorothioate or a non-negatively charged intemucleotidic linkage. In some embodiments, each intemucleotidic linkage is independently a phosphorothioate or a neutral charged intemucleotidic linkage. In some embodiments, each intemucleotidic linkage is independently a phosphorothioate or phosphoryl guanidine intemucleotidic linkages. In some embodiments, each intemucleotidic linkage is independently a phosphorothioate or nOOl intemucleotidic linkage. In some embodiments, the last intemucleotidic linkage of an oligonucleotide is a non-negatively charged intemucleotidic linkage, or is a neutral intemucleotidic linkage, or is a phosphoryl guanidine intemucleotidic linkage, or is nOO 1.[00215 j In some embodiments, oligonucleotides of the present disclosure comprise one or more modified nucleobases. In some embodiments, oligonucleotides of the present disclosure comprise one or more modified sugar. In some embodiments, oligonucleotides of the present disclosure comprise one or more modified intemucleotidic linkages. Various modifications can be introduced to a sugar, nucleobase, and / or intemucleotidic linkage in accordance with the present disclosure. For example, in some embodiments, a modification is a modification described in US 9006198. In some embodiments, a modification is a modification described in US 9394333, US 9744183. US 9605019, US 9982257. US 20170037399. US 20180216108, US 20180216107, US 9598458. WO 2017 / 062862, WO 201 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210647, WO 2018 / 098264, WO 2018 / 022473, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 032612, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784, WO 2019 / 032612, WO 2020 / 191252, WO 2021 / 071858, WO 2022 / 099159, WO 2023 / 201095, and / or WO 2025 / 072862. the sugars, bases, and intemucleotidic linkages of each of which are independently incorporated herein by reference. In some embodiments, a modification is a modification described in WO 2023 / 152371, WO 2024 / 110565, WO 2024 / 115635, WO 2024 / 121373, WO 2024 / 175550, or WO 2024 / 114908. In some embodiments, a combination or pattern of several modifications in these publications can be utilized in accordance with the present disclosure.

[0216] In some embodiments, a nucleobase in a nucleoside is or comprises Ring BA which has the structure of BA-I, BA-I-a. BA-I-b, BA-I-c, BA-I-d. BA-II, BA-II-a. BA-II-b. BA-II-c, BA-II-d, BA-III, BA-Ill-a, BA-III-b, BA-III-c, BA-III-d. BA-III-e, BA-IV, BA-IV-a, BA-IV-b. BA-V, BA-V-a. BA-V-b. or BA-VI. or a tautomer of Ring BA, wherein the nucleobase is optionally substituted or protected. Many useful nucleobases are described herein. Among other things, the present Examples demonstrate various nucleobasescan be utilized to provide target adenosine editing.

[0217] In some embodiments, a sugar is a modified sugar comprising a 2 '-modification, e.g., 2'-F, 2’-OR wherein R is optionally substituted aliphatic, or a bicyclic sugar (e.g,, a LNA sugar), or a acyclic sugar (e.g.. a UNA sugar). In some embodiments, a modified sugar comprises a 6-membered or larger ring (e.g., 6-9 membered) than a natural DNA or RNA sugar. Among other things, the present Examples demonstrate various sugars can be utilized to provide target adenosine editing.

[0218] Among other things, the present disclosure demonstrates that oligonucleotides of various designs can edit target adenosines in LDLR transcripts, increase level ofLDLRmRNA, and / or increase levels of LDLR polypeptide: certain designs may provide better results than others when assessed. In some embodiments, the sugar of N24 is a 2’-OR modified sugar, wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, the sugar of the first nucleoside from the 5 ‘-end of the oligonucleotide is a 2’-OR modified sugar, wherein R is optionally substituted Ci.g aliphatic. In some embodiments, the sugar ofNz;, is a 2’-OR modified sugar, wherein R is optionally substituted Ci.g aliphatic. In some embodiments, the sugar of the second nucleoside from the 5 ‘-end of the oligonucleotide is a 2 ’-OR modified sugar, wherein R is optionally substituted Ci s aliphatic. In some embodiments, the sugar of N22 is a 2’ -OR modified sugar, wherein R is optionally substituted Ci-e aliphatic. In some embodiments, the sugar of the third nucleoside from the 5’-end of the oligonucleotide is a 2’-OR modified sugar, wherein R is optionally substituted C1.6 aliphatic In some embodiments, the sugar of N is a 2’-OR modified sugar, w'herein R is optionally substituted CYs aliphatic. In some embodiments, the sugar of the 11“ nucleoside from the 5 ’-end of the oligonucleotide is a 2’-OR modified sugar, wherein R is optionally substituted C;.6 aliphatic. In some embodiments, the sugar of N& is a 2’-OR modified sugar, wherein R is optionally substituted Ci-s aliphatic. In some embodiments, the sugar of the 19thnucleoside from the 5 '-end of the oligonucleotide is a 2 '-OR modified sugar, wherein R is optionally substituted C1.6 aliphatic. In some embodiments, the sugar of Ni is a deoxyribose. In some embodiments, the sugar of Nois a 2 ’-O modified sugar, wherein R is optionally substituted Ci s aliphatic. In some embodiments, the sugar of No is a deoxyribose. In some embodiments, the sugar of N.i is a deoxyribose. In some embodiments, the sugar of N.2 is a 2’ -OR modified sugar, wherein R is optionally substituted Cus aliphatic. In some embodiments, the sugar of N.3 is a 2’-F modified sugar. In some embodiments, the sugar of N.3 is a 2’-OR modified sugar, wherein R is optionally substituted Ci o aliphatic. In some embodiments, the sugar of N.4 is a 2’-OR modified sugar, wherein R is optionally substituted Cvs aliphatic. In some embodiments, the sugar of the 2nanucleoside from the 3’-end of the oligonucleotide is a 2’-OR modified sugar, wherein R is optionally substituted Ci-6 aliphatic. In some embodiments, the sugar of N.4is a bicyclic sugar. In some embodiments, the sugar of the 2ndnucleoside from the 3 ’-end of the oligonucleotide is a bicyclic sugar. In some embodiments, the sugar of N.5 is a 2 -OR modified sugar, wherein R is optionally substituted Cus aliphatic. In some embodiments, the sugar of the 1stnucleoside from the 3 ’-end of the oligonucleotide is a 2’-OR modified sugar, w'herein R is optionally substituted Ci-6 aliphatic. In some embodiments, the sugar of N.s is a bicyclic sugar. In some embodiments, the sugar of the 1stnucleoside from the 3 ’-end of the oligonucleotide is a bicyclic sugar.In some embodiments, a 2 '-OR modified sugar is a 2 '-OR modified sugar, wherein R is optionally substituted Ci o alkyl. In some embodiments, a 2’-ORmodified sugar is a 2’-0Me modified sugar. In some embodiments, a 2’-OR modified sugar is a 2’-0Me modified sugar. In some embodiments, a bicyclic sugar is a LNA sugar. In some embodiments, the intemucleotidic linkage between N.j and N.3 is a natural phosphate linkage. In some embodiments, the 27thintemucleotidic linkage from the 5 ’-end of the oligonucleotide is a natural phosphate linkage. In some embodiments, linkage phosphorus of the natural phosphate linkage is independently bonded to an oxy gen atom bonded to the 5’-carbon or 3’-carbon of a nucleoside, wherein the nucleoside comprises a 2’-OR modified sugar, wherein R is optionally substituted Cue aliphatic. In some embodiments, linkage phosphorus of the natural phosphate linkage is independently bonded to an oxygen atom bonded to the 3’-carbon of a nucleoside, wherein the nucleoside comprises a 2 -OR modified sugar, wherein R is optionally substituted Cif, aliphatic. In some embodiments, linkage phosphorus of each natural phosphate linkage is independently bonded to an...

Claims

1. CLAIMS1. An oligonucleotide comprising 5'-N₋₁N₀N₁-3', wherein Ni, No, andN.i are each independently a nucleoside and are linked by intemucleotidic linkages, wherein the oligonucleotide is capable of binding to a target nucleic acid with No opposite to a target adenosine, wherein the target adenosine is in a LDLR transcript.

2. An oligonucleotide capable of editing a target adenosine in a LDLR transcript.

3. An oligonucleotide capable of hybridizing to a target sequence comprising UUUUAUAUAUUUAUU, UUAAUAUUUAUUAA. or AUUUGUGUUAUUAUUUU4. An oligonucleotide, wherein the base sequence of the oligonucleotide comprises at least 15, 16, 17. 18, 19, 20, 21, 22, 23, 24, or 25 contiguous bases of a base sequence that is identical with or complementary’ to a base sequence of a LDLR gene or a transcript thereof, wherein the oligonucleotide comprises one or more modified sugars, one or more modified nucleobases, and / or one or more modified intemucleotidic linkages.

5. An oligonucleotide comprising:7.a first domain; and8.a second domain,9.wherein:10.the first domain comprises one or more 2 -F modifications;11.the second domain comprises one or more sugars that do not have a 2 -F modification; or an oligonucleotide comprising a modified nucleobase. nucleoside, sugar or intemucleotidic linkage as described in the present disclosure: or12.an oligonucleotide comprising a second subdomain as described in the present disclosure; or an oligonucleotide comprising one or more modified sugars and / or one or more modified intemucleotidic linkages, wherein the oligonucleotide comprises a first domain and a second domain each independently comprising one or more nucleobases.

6. The oligonucleotide of any one of the preceding claims, wherein the target adenosine is in 3' UTR of a LDLR transcript, a RNA motif in a LDLR transcript, and / or an AU-Rich Element (ARE) motif in a LDLR transcript.

7. Tire oligonucleotide of any one of the preceding claims, wherein the target adenosine is in an ARE motif comprising UUUUAUAUAUUUAUU, U UAAUAUUU AUUAA, or AUUUGUGUUAUUAUUUU.

8. The oligonucleotide of any one of the preceding claims, wherein the target adenosine is in and / or the oligonucleotide can hybridize to an RNA who base sequence comprises or is UAUUAAGUGCCUGAGACACCCGGUUACCUU, UAUUUAUUAAGUGCCUGAGACACCCGGUUA, AUUUAUUAAGUGCCUGAGACACCCGGUUAC, UUUAUUAAGUGCCUGAGACACCCGGUUACC,UUAUUAAGUGCCUGAGACACCCGGUUACCU, AUUUAUUAAGUGCCUGAGACACCCGGUUAC, AAUAUUUAUUAAGUGCCUGAGACACCCGGU, AGUCACUGGUCACCCUUAAUAUUUAUUAAG, CCUGAGUCACUGGUCACCCUUAAUAUUUAU, CUGAGUCA CUGGUCACCCUUAAU AUUUA UU, UGAGUCACUGGUCACCCUUAAUAUUUAUUA. GAGUCACUGGUCACCCUUAAUAUUUAUUAA. GGUCACCCUUAAUAUUUAUUAAGUGCCUGA, CACUGGUCACCCUUAAUAUUUAUUAAGUGC. ACUGGUCACCCUUAAUAUUUAUUAAGUGCC, CUGGUCACCCUUAAUAUUUAUUAAGUGCCU, CUUAAUAUUUAUUAAGUGCCUGAGACACCC, CACCCUUAAUAU UUAUUAAGUGCCUGAGAC, ACCCUUAAUAUUUAUUAAGUGCCUGAGACA, CCCUUAAUAUUUAUUAAGUGCCUGAGACAC, CCUUAAUAUUUAUUAAGUGCCUGAGACACC, UAAUAUUUAUUAAGUGCCUGAGACACCCGG, CCCUUAAUAUUUAUUAAGUGCCUGAGACAC. CCU UAAUAUU UAUUAAGUGCCUGAGACACC, UGCAAACCCUGGUUGCCUGUAUUUGUUCAG, UUUUUGCAAACCCUGGUUGCCUGUAU UGU, UUUUGCAAACCCUGGUUGCCUGUAUUUGUU, UUUGCAAACCCUGGUUGCCUGUAUUUGUUC. UUGCAAACCCUGGUUGCCUGUAUUUGUUCA, UUGCAAACCCUGGUUGCCUGUAUUUGUUC, AUUUUUGCAAACCCUGGUUGCCUGUAUUUG, UUUUUGCAAACCCUGGUUGCCUGUAUUUGU, UUUUGCAAACCCUGGUUGCCUGUAUUUGUU, UUUGCAAACCCUGGUUGCCUGUAUUUGUUC, AUUUAUUUUUGCAAACCCUGGUUGCCUGUA, UCU AUUUAU U U U UGCAAACCCUGGU UGCCU, CUAUUUAUUUUUGCAAACCCUGGUUGCCUG, UAUUUAUUUUUGCAAACCCUGGUUGCCUGU, AUAUAUAAAUCUAUUUAUUU UUGCAAACCC, ACAUAUAUAUAAAUCUAUUUAUUUUUGCAA, CAUAUAUAUAAAUCUAUUUAUUU UUGCAAA, AUAU AUAUAAA CU AUUUAUU UUGCAAAC, UAUAUAUAAAUCUAUUUAUUUUUGCAAACC, AUAAAUCUAUUUAUUUUUGCAAACCCUGGU, AUAUAUAAAUCUAUUUAUUUUUGCAAACCC, UAUAUAA AUCUAUUU AUUUUUG CA AACCCU, AUAUAAAUCUAUUUAUUUUUGCAAACCCUG, U AU AAAU C U AU U U A U U U U UGC AAACCC UGG, AUCUAUUUAUUUUUGCAAACCCUGGUUGCC, AUAAAUCUAUUUAUUUUUGCAAACCCUGGU. UAAAUCUAU UUAUUUUUGCAAACCCUGGUU, UGGGAGGCAGAACAGGCUUCGGACAGUGCC, CAUCUGGGAGGCAGAACAGGCUUCGGACAG, AUCUGGGAGGCAGAACAGGCUUCGGACAGU, UCUGGGAGGCAGAACAGGCUUCGGACAGUG, CUGGGAGGCAGAACAGGCUUCGGACAGUGC, AUU C A U CU GGGAGGC AGAACAGGC U U CGGA, UUUAUUCAUCUGGGAGGCAGAACAGGCUUC, UUA UCAUCUGGGAGGCAGAACAGGCUUCG, U AU U C A C UGGGAGGCAGAACAGGCUUCGG, UUUGUUUUAU UAUUUAUUCAUCUGGGAGG, UUGUUUUAUAUAUUUAUUCAUCUGGGAGGC, UGUUUUAUAUAUUUAUUCAUCUGGGAGGCA, GUUUUAUAUAUUUAUUCAUCUGGGAGGCAG, AUUUAUUCAUCUGGGAGGCAGAACAGGCUU, CUUAAUAUUUAUCAAGUGCCUGAGACAACU, AAAUCUAUU UAUUUUUGCAAACCCUGAUUG, UAUAUAUUUAUUGUCUGGGGACAGAAAAGG, AGCCUACAUAGUGAGACCUUAUAUAUCUAA, CUGGUAACGUCAUCCUCUCUCACAGAGACA, AACUCAGGGCCUCUGUCUGGUGUUUAGUUA, UAGUUAGUCUGUUUGUUUGUUUGUUUGUUU, GGGGAAC UCAGGGCC UC UGUCUGGUGUUUA, GGGGGAACUCAGGGCCUCUGUCUGGUGUUU, UCUUCAGUACUGGGGGGAACUCAGGGCCUC, CCCUUAAUAUUUAUCAAGUGCCUGAGACAA.UCCXUAACCUCAGGACUUCCUGCAUUGACC, UCUUCAUUUCCUUGGAAGCCAAAUAGGCUG, UGGGCACCCACGUGGUCCACAL U UGUACUC UCUGGAL CGU UUGACGGGACU U CAGGUUCU, AUACAACUAUAAAAAAAUAAAUAAAUCCUC, AAUACA CUAUAAAAAAAUAAAUAAAUCCU, GGGCAACAGAUGAAGACCCUAUUUCAGAAA. GAGCCACUGCACUCCAGCCUGGGCAACAGA. GAUCGAGCCACUGCACUCCAGCC UGGGCAA, CUGUGAU CCCAGCU ACU UGGGAGGCUGAGG, AAAUCAGCUGGGUACGGUGGCACGLGCCUG, CAACAAAGCGAGAUCCCAUCUCUACAAAAA, GCAACAAAGCGAGAUCCCAUCUCUACAAAA, UCGUGAGCUAUGAUUAUGCCACUGCUUUCC, ACAAAAAAAAACCAUGCAUGGUGCAUCAGC, AACAAAAAAAAACCAUGCAUGGUGCAUCAG, AAACAAAAAAAAACCAUGCAUGGUGCAUCA, AAAAAACAAAAAAAAACCAUGCAUGGUGCA. AAAAAAACAAAAAAAAACCAUGCAUGGUGC. AAAAAAAACAAAAAAAAACCAUGCAUGGUG, AAAAAAAAACAAAAAAAAACCAUGCAUGGU, AAAAAAAAAACAAAAAAAAACCAUGCAUGG, GCGCCACUGCAGUCCGCAGUCUGGCCUGGG, AAAUUAGCCGGGCGUGGUGGCGGGCACCUG, AAAAAAUUAGCCGGGCGUGGUGGCGGGCAC, CAAAAAAUUAGCCGGGCGUGGUGGCGGGCA, ACAAAAAAUUAGCCGGGCGUGGUGGCGGGC, UACAAAAAAUUAGCCGGGCGUGGUGGCGGG, AITACAAAAAAUITAGCCGGGCGUGGUGGCGG. AAUACAAAAAAUUAGCCGGGCGUGGUGGCG, AAAAUACAAAAAAUUAGCCGGGCGUGGUGG. CUAACACGUGAAACCCCGIICUCUACUAAAA. GGCUAACACGUGAAACCCCGUCUCUACUAA, UGGCUAACACGUGAAACCCCGUCUCUACUA, GGCCGAGGCGGGUGGAUCAUGAGGUCAGGA, ULTGGGAGGCCGAGGCGGGUGGAUCAUGAGG, GGCUCACGCCUGUAAUCCCAGCACUUUGGG, GGCGCAGUGGCUCACGCCUGUAAUCCCAGC, UCUUUAUGUCCGCCCACCUAGUGCUUCCAC, CUGCCAUUGUCGUCUUUAUGUCCGCCCACC, UUCAAAGCCGUGAUCGUGAAUAUCGAGAAC. CUUCAAAGCCGUGAUCGUGAAUAUCGAGAA, ACUUCAAAGCCGUGAUCGUGAAUAUCGAGA. LICCCGACCCCLACCCACLIUCCALILICCCGUG, CCUGCACCCAGGUGUGGCUGUCAGGACACC, UGGUCACCCUUAAUAUUUAULTAAGUGCCUG, UUUCGAGGUGGGUUUGUACCUUCCLUAAGC, CCCUAAACUCAGGAGUCAACGUGUUUACCLL CCCCUAAACUCAGGAGUCAACGUGUUUACC, CCAGGAUGACACCUCCAUUUCUCUCCAGGA, GGACCAGGAUGACACCUCCAUUUCUCUCCA?UUGGGAUUUUGGUUUCUUCCUUUCCUCGUa CUGUGALTCAAUUAAAL1LTUCUUAAAUGAACC. UGUAUAGAAGGUUUUUGUAGCCUGAAUGUC, ACUGUAUAGAAGGU U UUUGUAGCCUGAAUG, AAACCACUGUAUAGAAGGU UUUUGUAGCCU, UUUAAACCACUGUAUAGAAGGUUUUUGUAG. UUUUAAACCACUGUAUAGAAGGUUUUUGUA, UUUUUAAACCACUGUAUAGAAGGUUUUUGUXJGUACAAAGAUUAUUUGCACGAACUGGACU, UAUGUACAAAGAUUAUUUGCACGAACUGGA, UGUAUAUUGGUUGAAACUGUUAUCACUUAU, CCUGUACAGAUAGUGGGGAUUUUUUGUUALT. AAAAUAAAUAAAUCCUCCAGUCUGGAUCGU, UGUACAUUUGGCAUUUGUGUUAUUAUUUUG, UAAAUAAAUCCUCCAGUCUGGAUCGUUUGA, UGUGUACAUUUGGCAUUUGUGUUAUUAUUU, UGUACACUGUGUACAUUUGGCAUUUGUGUU, GUUGUACACLTGUGUACAUITUGGCAUUUGITG, GUCUUACUGUGAUCAAUUAAAUUUCUUAAA, CCUGAAUGUCUUACUGUGAUCAAUUAAAUU, UGACUAUUCUCGGGGCCCUGUGUAGGGGGU,UGAUAAGCCUUUCUGGUUUCGGAGCACGUA, UGGCAAUUGUCCCCAGGGACAAAACACUGU, UUGGCAAUUGUCCCCAGGGACAAAACACUG, UULTAUAUAUUUAUUCAUCLGGGAGGCAGAA, UAUAUAUUUAUUCAUCUGGGAGGCAGAACA. UUUUAUAUAUUUAUUCAUCUGGGAGGCAGA, UAUUUAUUUUUGCAAACCCUGGUUGCUGUA. UAUUUAUUAAGUGCCUGAGACACCCGGUUA, LTUAUAUAUUUAUUCAUCUGGGAGGCAGAAC, AUAUUUAUUCAUCUGGGAGGCAGAACAGGC. AAUCUAUUUAUUUUUGCAAACCCUGGUUGC, AUAUAUUUAUUCAUCUGGGAGGCAGAACAG, ULTAAUAUUUAUUAAGUGCCUGAGACACCCG, UAUAUUUAUUCAUCUGGGAGGCAGAACAGG, AAAUCUAUUUAUUUUUGCAAACCCUGGUUG, CUAUUUAUUUUUGCAAACCGUGGUUGCUGU, AUAUUUAUUAAGUGCCUGAGACACCCGGUU, CUUAAUAUUUAUUAAGUGCCUGAGACACCC, UUUGUAUAUUGGUUGAAACUGUUAUCACUU, UAUULTAUUCAUCUGGGAGGCAGAACAGGCU, or UGUACAGALAGUGGGGAUL UU UUGUUAUGU, wherein each LT can be independently replaced with T and vice versa.

9. Tire oligonucleotide of any one of the preceding claims, wherein the base sequence is or comprises 20 or more contiguous bases of and / or the base sequence comprises or is AACCGGGUGUCUCAGGCACUUAAUAAAUAU, ACAGCAACCAGGGUUUGCAAAAAUAAAUAG, AGCCUGUUCUGCCUCCCAGAUGAAUAAAUA. CAACCAGGGUUUGCAAAAAUAAAUAGAUUU, CCUGUUCUGCCUCCCAGAUGAAUAAAUAUA, CGGGUGUCUCAGGCACUUAAUAAAUAUUAA, CUGUUCUGCCUCCCAGAUGAAUAAAUAUAU, GCAACCAGGGUUUGCAAAAAUAAAUAGALL1, GCCUGUUCUGCCUCCCAGAUGAAUAAAUAU, GGGUGUCUCAGGCACUUAAUAAAUAUUAAG, GUUCUGCCUCCCAGAUGAAUAAAUAUAUAA, UAACCGGGUGUCUCAGGCACUUAAUAAAUA, UACAGCAACCAGGGUUUGCAAAAAUAAAUA, UCUGCCUCCCAGAUGAAUAAAUAUAUAAAA, LIGUUCUGCCUCCCAGAUGAAUAAAUAUAUA, LIUCUGCCUCCCAGALIGAAUAAAUAUAUAAA, CAGUGUUUUGUCCCUGGGGACAATUGCCAA, ACAGUGUUUUGUCCCUGGGGACAALTGCCA, UACGUGCUCCGAAACCAGAAAGGCUTAUCA, ACCCCCUACACAGGGCCCCGAGAAUAGUCA, AAUUUAAUUGAUCACAGUAAGACAUTCAGG, UUUAAGAAAUUUAAUUGAUCACAGUAAGAC, CACAAAUGCCAAAUGUACACAGUGUACAAC, AACACAAAUGCCAAAUGUACACAGUGUACA, AAAUAAUAACACAAAUGCCAAAUGUACACA, UCAAACGAUCCAGACUGGAGGAUTUAUUUA, CAAAAUAAUAACACAAAUGCCAAAUGUACA, ACGAGCCAGACUGGAGGAUUUAUTUAUUULi, AUAACAAAAAAUCCCCACUAUCUGUACAGG, ACAUAACAAAAAAUCCCCACUAUCUGUACA, AAGUGAUAACAGUUUCAACCAAUAUACAAA, AUAAGUGAUAACAGUUUCAACCAAUAUACA, UCCAGUUCGUGCAAAUAAUCUUUGLACAUA, AGUCCAGUUCGUGCAAAUAAUCUTUGUACA, ACAAAAACCUUCUAUACAGUGGUTUAAAAA, UACAAAAACCUUCUAUACAGUGGTUTAAAA. CUACAAAAACCUUCUAUACAGUGGUTUAAA, AGGCUACAAAAACCUUCUAUACAGUGGUUU. CAUUCAGGCUACAAAAACCUUCUAUACAGU. GACAUUCAGGCUACAAAAACCUUCUAUACA, GGUUCAUUUAAGAAAUUUAAULTGAUCACAG, CACGAGGAAAGGAAGAAACCAAAAUCCCAA, UGGAGAGAAAUGGAGGLGUCAUCCUGGUCC, UCCUGGAGAGAAAUGGAGGUGUCAUCCUGG,GGUAAACACGUUGACUCCUGAGUTUAGGGG, AGGUAAACACGUUGACUCCUGAGTUTAGGG, GCUUAAGGAAGGUACAAACCCACCUCGAAA, CAGGCACUUAAUAAAUAUUAAGGGUGACCA, GGUGUCCUGACAGCCACACCUGGGUGCAGG, CACGGGAAUGGA AGUGGGUAGGGGUCGGGA, UCUCGAUAUUCACGAUCACGGCUTUGAAGU, UUCUCGAUAUUCACGAUCACGGCTUTGAAG, GUUCUCGAUAUUCACGAUCACGGCUTUGAA, GGUGGGCGGACAUz\AAGACGACAAUGGCAG, GUGGAAGCACUAGGUGGGCGGACAUAAAGA, GCUGGGAUUACAGGCGUGAGCCACUGCGCC, CCCAAAGUGCUGGGAUUACAGGCGUGAGCC, CCUCAUGAUCCACCCGCCUCGGCCUCCCAA, UCCUGACCUCAUGAUCCACCCGCCUCGGCC, UAGUAGAGACGGGGUUUCACGUGTUAGCCA, UUAGUAGAGACGGGGUUUCACGUGUTAGCC, UUUUAGUAGAGACGGGGUUUCACGUGUUAG, CCACCACGCCCGGCUAAUUUUUUGUAUUUU, CGCCACCACGCCCGGCUAAUUUUTUGUAUU. CCGCCACCACGCCCGGCUAAU U UTUTGUAU, CCCGCCACCACGCCCGGCUAAUUTUTUGUA, GCCCGCCACCACGCCCGGCUAAUTUTUUGU. UGCCCGCCACCACGCCCGGCUAATUTUUUG, GUGCCCGCCACCACGCCCGGCUAAUTUUUU, CAGGUGCCCGCCACCACGCCCGGCUAAUUU, CCCAGGCCAGACLGCGGACUGCAGUGGCGC, CCAUGCAUGGUUUUUUUUUGUUUTUTUUUU, ACCAUGCAUGGUUUUUUUUUGUUTLTUUUL, CACCAUGCAUGGUUUUUU U U UGUTUTU U U IT. GCACCAUGCAUGGUUUUUUUUUGTUTUUUU. UGCACCAUGCAUGGUUUUUUUUUGUTUUUU, UGAUGCACCAUGCAUGGUUUUUUTUTGUUU, CUGAUGCACCAUGCAUGGUUUUUTUTUGUU. GCUGALIGCACCAUGCAUGGUULUTUTUUGL^ GGAAAGCAGUGGCAUAAUCAUAGCUCACGA, UUUUGUAGAGAUGGGAUCUCGCUTUGUUGC, UUUUUGUAGAGAUGGGAUCLCGCTUTGUUG, CAGGCACGUGCCACCGUACCCAGCUGAUUU, CCUCAGCCUCCCAAGUAGCUGGGAUCACAG, UUGCCCAGGCUGGAGUGCAGUGGCUCGAUC, UCUGUUGCCCAGGCUGGAGUGCAGUGGCUC. LIUUCUGAAALIAGGGUCUUCAUCUGUTGCCC. AGGAUUUAUUUAUUUUUUUAUAGTUGLIAUU, GAGGAUUUAITUUAUUUUUUUAUAGUTGUAU. AGAACCUGAAGUCCCGUCAAACGAUCCAGA, GAGUACAAAUGUGGACCACGUGGGUGCCCA, CAGCCUAUUUGGCUUCCAAGGAAAUGAAGA, GGUCAAUGCAGGAAGUCCUGAGGTUAGGGA, UUGUCUCAGGCACUUGAUAAAUATUAAGGG, GAGGCCCUGAGUUCCCCCCAGUACUGAAGA, AAACACCAGACAGAGGCCCUGAGTUCCCCC, UAAACACCAGACAGAGGCCCUGAGUTCCCC, AAACAAACAAACAAACAAACAGACUAACUA, UAACUAAACACCAGACAGAGGCCCUGAGUU, UGlTCUCUGUGAGAGAGGAbGACGTUACCAG UUAGAUAUAUAAGGUCUCACUAUGUAGGCU, CCUUUUCUGUCCCCAGACAAUAAAUAUAUA. CAAUCAGGGUUUGCAAAAAUAAAUAGAUUU. AGUUGUCUCAGGCACUUGAUAAAUAUUAAG, AAGCCUGUUCUGCCUCCCAGAUGAAUAAAU5CUGCCUCCCAGAUGAAUAAAUAUAUAAAAC. UGCCUCCCAGAUGAAUAAAUAUAUAAAACA, GCCUCCCAGAUGAAUAAAUAUAUAAAACAA, CCUCCCAGAUGAAUAAAUAUAUAAAACAAA. CCGAAGCCUGUUCUGCCUCCCAGAUGAAUA. CGAAGCCUGUUCUGCCUCCCAGAUGAAUAA, GAAGCCUGUUCUGCCUCCCAGAUGAAUAAA, UCCGAAGCCUGUUCUGCCUCCCAGAUGAAU, GCACUGUCCGAAGCCUGUUCUGCCUCCCAG, CACUGUCCGAAGCCUGUUCUGCCUCCCAGA, ACUGUCCGAAGCCUGUUCUGCCUCCCAGAU,CUGUCCGAAGCCUGUUCUGCCUCCCAGAUG, GGCACUGUCCGAAGCCUGUUCUGCCUCCCA, AACCAGGGUUUGCAAAAAUAAAUAGAUUUA, ACCAGGGUU UGCAAAAAUAAAUAGAU UUAU, GGCAACCAGGGUUUGCAAAAAUAAAUAGAU. CCAGGGUUUGCAAAAAUAAAUAGAUTUAUA, CAGGGUUUGCAAAAAUAAAUAGAUTUAUAU. AGGGUUUGCAAAAAUAAAUAGAUTUAUAUA, GGGUUUGC AAAAAUA AA UAGAUTUAUAU A U, ACC AGGGUUUGC AAA AAUAAAU AGAUTUAU, GGUUUGCAAAAAUAAAUAGAUUUAUAUAUA, GUUUGCAAAAAUAAAUAGAUUUAUAUAUAU, UUUGCAAAAAUAAAUAGAUUUAUAUAUAUG, UUGCAAAAAUAAAUAGAUUUAUAUAUAUGU.17.GGGUUUGCAAAAAUAAAUAGAUUUAUAUAU, ACAGGCAACCAGGGUUUGCAAAAAUAAAUA, CAGGCAACCAGGGUUUGCAAAAAUAAAUAG, AGGCAACCAGGGUUUGCAAAAAUAAAUAGA, UACAGGCAACCAGGGUUUGCAAAAAUAAAU, GAACAAAUACAGGCAACCAGGGUTUGCAAA. AACAAAUACAGGCAACCAGGGUTUGCAAAA, ACAAAUACAGGCAACCAGGGUTUGCAAAAA, CAAAUACAGGCAACCAGGGUTUGCAAAAAU, UGAACAAAUACAGGCAACCAGGGUTUGCAA, UGAACAAAUACAGGCAACCAGGGTUTGCAA, GAACAAAUACAGGCAACCAGGGTU IGCAAA, AACAA UACAGGCAACCAGGGTUTGCAAA, ACAAAUACAGGCAACCAGGGTUTGCAAAAA. CUGAACAAAUACAGGCAACCAGGGTUTGCA, GGUGUCUCAGGCACUUAAUAAAUAUUAAGG, GUGUCUCAGGCACUUAAUAAAUAUUAAGGG, CCGGGUGUCUCAGGCACUUAAITAAAUAUUA, GGUGUC UCAGGCAC UUAAUAAAUAUTAAGG, GUGU CU CAGGCAC UUAAUAAAU AUTAAGGG, UGUCUCAGGCACUUAAUAAAUAUTAAGGGU, GUCUCAGGCACUUAAUAAAUAUTAAGGGUG, GGGUGUCUCAGGCACUUAAUAAAUAUTAAG, AGGCACUU AAUAAAU AUUAAGGGUGACCAG, GGCACLIUAAUAAAUAUUAAGGGUGACCAGU. GCACUUAAUAAAUALIUAAGGGIJGACCAGUG, UCAGGCACUUAAUAAAUAUUAAGGGUGACC UUAAUAAAUAUUAAGGGUGACCAGUGACUC, UAAUAAAUAUUAAGGGUGACCAGUGACUCA, AAUAAAUAUUAAGGGUGACCAGUGACUCAG, AUAAAUAUUAAGGGUGACCAGUGACUCAGG, CUUAAUAAAUAUUAAGGGUGACCAGUGACU, ACCGGGUGUCUCAGGCACUUAAUAAAUAUU, GUAACCGGGUGUCUCAGGCACUUAAUAAAU, AGGUAACCGGGUGUCUCAGGCACTUAAUAA, GGUAACCGGGUGUCUCAGGCACTUAAUAAA. GUAACCGGGUGUCUCAGGCACTU AAUAAAU, UAACCGGGUGUCUCAGGCACTUAAUAAAUA. AAGGUAACCGGGUGUCUCAGGCACTUAAUA, GCAUUGUCCGAAGCCUGUUCUGCCUCCCAG, GCAGUGUCCGAAGCCUGUUCUGCCUCCCAG, GCAAUGUCCGAAGCCUGUUCUGCCUCCCAG, GCACGGUCCGAAGCCUGUUCUGCCUCCCAG, GCACAGUCCGAAGCCUGUUCUGCCUCCCAG, GCACCGUCCGAAGCCUGUUCUGCCUCCCAG, GCACUCUCCGAAGCCUGUUCUGCCUCCCAG, GCACUAUCCGAAGCCUGUUCUGCCUCCCAG, GCACUUUCCGAAGCCUGUUCUGCCUCCCAG, GCACUGGCCGAAGCCUGUUCUGCCUCCCAG, GCACUGACCGAAGCCUGUUCUGCCUCCCAG. GCACUGCCCGAAGCCUGUUCUGCCUCCCAG, GCACUGUUCGAAGCCUGUUCUGCCUCCCAG, GCACUGUACGAAGCCUGUUCUGCCUCCCAG, GCACUGUGCGAAGCCUGUUCUGCCUCCCAG, GCACUGUCUGAAGCCUGUUCUGCCUCCCAG, GCACUGUCAGAAGCCUGUUCUGCCUCCCAG, GCACUGUCGGAAGCCUGUUCUGCCUCCCAG, GCACUGUCCCAAGCCUGUUCUGCCUCCCAG, GCACUGUCCAAAGCCUGUUCUGCCUCCCAG, GCACUGUCCUAAGCCUGUUCUGCCUCCCAG, GCACUGUCCGGAGCCUGUUCUGCCUCCCAG, GCACUGUCCGUAGCCUGUUCUGCCUCCCAG, GCACUGUCCGCAGCCUGUUCUGCCUCCCAG. GCACUGUCCGAGGCCUGUUCUGCCUCCCAG. GCACUGUCCGAUGCCUGUUCUGCCUCCCAG, GCACUGUCCGACGCCUGUUCUGCCUCCCAG, GCACUGUCCGAACCCUGUUCUGCCUCCCAG, GCACUGUCCGAAACCUGUUCUGCCUCCCAG, GCACUGUCCGAAUCCUGUUCUGCCUCCCAG, GCACUGUCCGAAGUCUGUUCUGCCUCCCAG, GCACUGUCCGAAGACUGUUCUGCCUCCCAG, GCACUGUCCGAAGGCUGUUCUGCCUCCCAG, GCACUGUCCGAAGCCUGUUCUGCCUCCCAG, GCACUGUCCGAAGCAUGUUCUGCCUCCCAG, GCACUGUCCGAAGCGUGUUCUGCCUCCCAG, GCACUGUCCGAAGCCGGUUCUGCCUCCCAG, GCACUGUCCGAAGCCAGUUCUGCCUCCCAG, GCACUGUCCGAAGCCGGUUCUGCCUCCCAG, GCACUGUCCGAAGCCUCUUCUGCCUCCCAG, GCACUGUCCGAAGCCUAUUCUGCCUCCCAG, GCACUGUCCGAAGCCUUUUCUGCCUCCCAG, GCACUGUCCGAAGCCUGGUCUGCCUCCCAG, GCACUGUCCGAAGCCUGAUCUGCCUCCCAG, GCACUGUCCGAAGCCUGGUCUGCCUCCCAG, GCACUGUCCGAAGCCUGUGCUGCCUCCCAG, GCACUGUCCGAAGCCUGUACUGCCUCCCAG. GCACUGUCCGAAGCCUGUCCUGCCUCCCAG, GCACUGUCCGAAGCCUGUUUUGCCUCCCAG, GCACUGUCCGAAGCCUGUUAUGCCUCCCAG, GCACUGUCCGAAGCCUGUUGUGCCUCCCAG, GCACUGUCCGAAGCCUGUUCGGCCUCCCAG, GCACUGUCCGAAGCCUGUUCAGCCUCCCAG, GCACUGUCCGAAGCCUGUUCCGCCUCCCAG, GCACUGUCCGAAGCCUGUUCUCCCUCCCAG, GCACUGUCCGAAGCCUGUUCUACCUCCCAG, GCACUGUCCGAAGCCUGUUCUUCCUCCCAG, GCACUGUCCGAAGCCUGUUCUGUCUCCCAG, GCACUGUCCGAAGCCUGUUCUGACUCCCAG, or GCACUGUCCGAAGCCUGUUCUGGCUCCCAG, wherein each IJ can be independently replaced with T and vice versa.

10. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide has a length of about 10-200 (e.g., about 10-20, 10-30, 10-40, 10-50, 10-60. 10-70, 10-80, 10-90, 10-100, 10-120, 10-150, 20-30, 20-40, 20-50, 20-60. 20-70, 20-80. 20-90, 20-100, 20-120. 20-150, 20-200, 25-30. 25-40, 25-50, 25-60, 25-70, 25-80, 25-90, 25-100. 25-120. 25-150. 25-200, 30-40, 30-50, 30-60. 30-70. 30-80, 30-90, 30-100, 30-120, 30-150, 30-200, 10, 20, 25, 26, 27, 28, 29, 30, 31. 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50, 60, etc.) nucleobases, optionally wherein the oligonucleotide has a length of about 26-35 nucleobases.

11. The oligonucleotide of any one of the preceding claims, wherein the intemucleotidic linkage between N20 and Nis is a natural phosphate linkage and / or wherein the 5thintemucleotidic linkage from the 5 ’-end of the oligonucleotide is a natural phosphate linkage.

12. The oligonucleotide of any one of the preceding claims, wherein the intemucleotidic linkage between NiSand N-;s is a natural phosphate linkage and / or wherein the 6thintemucleotidic linkage from the 5 ’-end of the oligonucleotide is a natural phosphate linkage.

13. The oligonucleotide of any one of the preceding claims, wherein the intemucleotidic linkage between NB and Ni? is a natural phosphate linkage or a PS intemucleotidic linkage and / or wherein the 12“ intemucleotidic linkage from the 5’-end of the oligonucleotide is a natural phosphate linkage or a PS intemucleotidic linkage.

14. The oligonucleotide of any one of the preceding claims, w herein the intemucleotidic linkage between Nn and Niu is a natural phosphate linkage or a PS intemucleotidic linkage and / or wherein the 14“ intemucleotidic linkage from the 5 "-end of the oligonucleotide is a natural phosphate linkage or a PS intemucleotidic linkage.

15. The oligonucleotide of any one of the preceding claims, wherein the intemucleotidic linkage between Ni and N2 is a natural phosphate linkage and / or wherein the 23rdintemucleotidic linkage from the 5 ’-end of the oligonucleotide is a natural phosphate linkage.

16. Tire oligonucleotide of any one of the preceding claims, wherein the intemucleotidic linkage between N.2 and N.3 is a natural phosphate linkage and / or wherein the 27thintemucleotidic linkage from the 5 ’-end of the oligonucleotide is a natural phosphate linkage.

17. The oligonucleotide of any one of the preceding claims, wherein the intemucleotidic linkage between Ni and No is a PS intemucleotidic linkage and / or wherein the 24thintemucleotidic linkage from the 5 ’-end of the oligonucleotide is a PS intemucleotidic linkage.

18. Tire oligonucleotide of any one of the preceding claims, wherein the intemucleotidic linkage between No and N.i is a PS intemucleotidic linkage and / or wherein the 25“ intemucleotidic linkage from the 5 ’-end of the oligonucleotide is a PS intemucleotidic linkage.

19. Tire oligonucleotide of any one of the preceding claims, wherein the intemucleotidic linkage between N.3 and N.4 is a PS intemucleotidic linkage and / or wherein the 28thintemucleotidic linkage from the 5 ’-end of the oligonucleotide is a PS intemucleotidic linkage.

20. lire oligonucleotide of any one of the preceding claims, wherein the intemucleotidic linkage between N24 and N23 is a PN intemucleotidic linkage and / or wherein the 1stintemucleotidic linkage from the 5’-end of the oligonucleotide is a PN intemucleotidic linkage.

21. The oligonucleotide of any one of the preceding claims, wherein the intemucleotidic linkage between N14 and N1 is a PN intemucleotidic linkage and / or wherein the 11thintemucleotidic linkage from the 5’-end of the oligonucleotide is a PN intemucleotidic linkage.

22. Tire oligonucleotide of any one of the preceding claims, wherein the intemucleotidic linkage between N 12 and N> 1 is a PN intemucleotidic linkage or a PS intemucleotidic linkage and / or wherein the 13thintemucleotidic linkage from the ’-end of the oligonucleotide is a PN intemucleotidic linkage or a PS intemucleotidic linkage.

23. The oligonucleotide of any one of the preceding claims, wherein the intemucleotidic linkage between Nn and N-;o is a PN intemucleotidic linkage or a PS intemucleotidic linkage and / or wherein the 14thintemucleotidic linkage from the 5 ’-end of the oligonucleotide is a PN intemucleotidic linkage or a PSinternucleotidic linkage.

24. The oligonucleotide of any one of the preceding claims, wherein the internucleotidic linkage between Nic and Ny is a PN internucleotidic linkage or a PS internucleotidic linkage and / or wherein the 15thinternucleotidic linkage from the 5 ’-end of the oligonucleotide is a PN internucleotidic linkage or a PS internucleotidic linkage.

25. The oligonucleotide of any one of the preceding claims, wherein the internucleotidic linkage between N? and Ns is a PN internucleotidic linkage and / or wherein the 18thinternucleotidic linkage from the 5 ’-end of the oligonucleotide is a PN internucleotidic linkage,26. The oligonucleotide of any one of the preceding claims, wherein the internucleotidic linkage between Ns and NT is a PN internucleotidic linkage or a PS internucleotidic linkage and / or wherein the 20thinternucleotidic linkage from the 5 ’-end of the oligonucleotide is a PN internucleotidic linkage or a PS internucleotidic linkage.

27. Tire oligonucleotide of any one of the preceding claims, wherein the internucleotidic linkage between N.i and.2 is a PN internucleotidic linkage and / or wherein the 26thinternucleotidic linkage from the 5 '-end of the oligonucleotide is a PN linkage.

28. The oligonucleotide of any one of the preceding claims, wherein the internucleotidic linkage between N.4 and N.s is a PN internucleotidic linkage and / or wherein the 29thinternucleotidic linkage from the 5 ’-end of the oligonucleotide is a PN internucleotidic linkage.

29. The oligonucleotide of am one of the preceding claims, wherein the first internucleotidic linkage from the 5’-end of an oligonucleotide is a PN intemucleotidic linkage and / or wherein the first internucleotidic linkage from the 3 ’-end of the oligonucleotide is a PN intemucleotidic linkage.

30. The oligonucleotide of any one of the preceding claims, wherein the PN intemucleotidic linkage is a phosphoramidate intemucleotidic linkage.

31. lire oligonucleotide of any one of the preceding claims, wherein the PN intemucleotidic linkage is a phosphoryl guanidine intemucleotidic linkage.

32. The oligonucleotide of any one of claims 1-31, wherein the PN intemucleotidic linkage is nOOl.

33. The oligonucleotide of any one of claims 1-31, wherein the PN intemucleotidic linkage is n006.

34. The oligonucleotide of any one of claims 1-31, wherein the PN intemucleotidic linkage is MsPA.

35. Tire oligonucleotide of any one of the preceding claims, wherein the linkage phosphorus of the PN intemucleotidic linkage is Rp.

36. The oligonucleotide of any one of the preceding claims, wherein each internucleotidic linkage is independently a natural phosphate linkage, a PS internucleotidic linkage, or a PN internucleotidic linkage.

37. The oligonucleotide of any one of the preceding claims, wherein each PS intemucleotidic linkage is independently a phosphorothioate intemucleotidic linkage.

38. The oligonucleotide of any one of the preceding claims, wherein each phosphorothioate internucleotidic linkage is independently > Sp.

39. The oligonucleotide of any one of the preceding claims, wherein each PN intemucleotidic linkage is independently a phosphoramidate intemucleotidic linkage.

40. Tire oligonucleotide of any one of the preceding claims, wherein each PN intemucleotidic linkage is independently a phosphoryl guanidine intemucleotidic linkage.

41. The oligonucleotide of any one of the preceding claims, wherein N24 is the first nucleoside from the 5 ’-end of the oligonucleotide.

42. lire oligonucleotide of any one of the preceding claims, wherein the oligonucleotide consists of a first domain and a second domain, optionally wherein the first domain has a length of about 2-50 (e.g., about 5, 6. 7, 8, 9, or 10 - about 10, 11, 12, 13, 14.

15. 16, 17, 18, 19, 20, 21, 22.

23. 24, 25, 30, 40 or 50, or about 5.

6.

7. 8, 9, 10, 11, 12, 13, 14, 15, 16.

17.

18. 19, 20, 21, 22, 23, 24.

25. 30, 40 or 50. etc.) nucleobases and wherein the second domain has a length of about 2-50 (e.g., about 5, 6, 7, 8, 9, or 10 - about 10, 11, 12, 13, 14, 15. 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50, etc.) nucleobases.

43. The oligonucleotide of any one of the preceding claims, w herein the first 1, 2, 3, 4, or 5 sugars at the 5’-end of the oligonucleotide are each independently a 2 -OR modified sugar, wherein R is optionally substituted Cue aliphatic, optionally wherein the first 1, 2, 3. 4, or 5 sugars at the 5 ’-end of the oligonucleotide are each independently a 2’-OMe or 2’-MOE modified sugar; and / or48.wherein the sugar of each of NN. N23, and / or N22 is independently a 2 ’-OR modified sugar, wherein R is optionally substituted Ci s aliphatic, optionally wherein the sugar of each of N24, N23, and / or N22 is independently a 2 -OMe or 2’-M0E modified sugar.

44. Tire oligonucleotide of any one of the preceding claims, wherein the sugar of N20 is a 2'-OR modified sugar and / or wherein the 5thsugar from the 5 ’-end of the oligonucleotide is a 2’-OR modified sugar, wherein R is optionally substituted Ci s aliphatic.

45. lire oligonucleotide of any one of the preceding claims, wherein the sugar of N19 is a 2’-OR modified sugar and / or wherein the 6thsugar from the 5 ’-end of the oligonucleotide is a 2 -OR modified sugar, wherein R is optionally substituted Cj.6 aliphatic.

46. The oligonucleotide of any one of the preceding claims, wherein the sugar of Nis is a 2’-OR modified sugar and / or w’herein the 9thsugar from the 5 ’-end of the oligonucleotide is a 2’-OR modified sugar, -wherein Ris optionally substituted Cue aliphatic.

47. The oligonucleotide of any one of the preceding claims, wherein the sugar of Nwis a 2’-OR modified sugar and / or wherein the 11thsugar from the 5’-cnd of the oligonucleotide is a 2’-OR modified sugar, wherein Ris optionally substituted Ci e aliphatic.

48. The oligonucleotide of any one of the preceding claims, wherein the sugar of N13 is a 2’-OR modified sugar and / or wherein the 12thsugar from the 5’-end of the oligonucleotide is a 2 -OR modified sugar, wherein Ris optionally substituted CYs aliphatic.54.49 'The oligonucleotide of any one of the preceding claims, wherein the sugar of Nn is a 2’-OR modified sugar and / or wherein the 14thsugar from the 5 '-end of the oligonucleotide is a 2 ’-OR modified sugar, wherein is optionally substituted Ci-6 aliphatic.

50. Ute oligonucleotide of any one of the preceding claims, wherein the sugar of Ns is a 2’-OR modified sugar and / or wherein the 17thsugar from the 5'-end of the oligonucleotide is a 2 -OR modified sugar, wherein Ris optionally substituted Ci.6 aliphatic.

51. The oligonucleotide of any one of the preceding claims, wherein the sugar of Nf, is a 2 ’-OR modified sugar and / or wherein the 19thsugar from the 5’-end of the oligonucleotide is a 2 -OR modified sugar, wherein R is optionally substituted Ci-g aliphatic.

52. The oligonucleotide of any one of the preceding claims, wherein the sugar of Ns is a 2 -OR modified sugar and / or wherein the 20thsugar from the 5 ‘-end of the oligonucleotide is a 2 -OR modified sugar, wherein Ris optionally substituted Ci.6 aliphatic.

53. The oligonucleotide of any one of the preceding claims, wherein the sugar of N is a 2’-OR modified sugar and / or wherein the 23rdsugar from the 5’-end of the oligonucleotide is a 2’-OR modified sugar, wherein Ris optionally substituted Ci-6 aliphatic.

54. The oligonucleotide of any one of claims 43-53, wherein the 2’-OR modified sugar is a 2’-OMe modified sugar.

55. The oligonucleotide of any one of the preceding claims, wherein the sugar of Ni is a deoxyribose.

56. The oligonucleotide of an} one of the preceding claims, wherein the nucleobase of Nu is64.

57. The oligonucleotide of any one of the preceding claims, wherein the sugar of No is a 2’-OMe modified sugar.

58. Tire oligonucleotide of any one of claims 1-56, wherein the sugar of No is deoxyribose.

59. The oligonucleotide of any one of the preceding claims, wherein the sugar of N.i is a deoxyribose.

60. The oligonucleotide of any one of the preceding claims, wherein the sugar of N.2 is a 2’-OR modified sugar, wherein R is optionally substituted Ci-s aliphatic, optionally wherein the sugar of N.2 is a 2‘-OMe modified sugar.

61. The oligonucleotide of any one of the preceding claims, wherein the sugar of Nj is a 2’-F modified sugar.

62. Tire oligonucleotide of any one of the preceding claims, wherein the sugar of N.4 is a 2’-OR modified sugar, wherein R is optionally substituted Ci-s aliphatic, optionally wherein the sugar of N.4 is a 2'-OMe modified sugar.

63. The oligonucleotide of any one of the preceding claims, wherein the sugar of N.5 is a 2 ’-OR modified sugar, wherein R is optionally substituted C1-6 aliphatic, optionally wherein the sugar of N s is a 2'-OMe modified sugar.

64. Tire oligonucleotide of any one of the preceding claims, wherein one or more sugars of N21. Nis, N 7, N15, NIS, Ni2, Nn, N10, Ne, N7, N4, N3. and N.3 are independently a 2’-F modified sugar and / or wherein one or more of the 4th, 7th, 8th, 10th, 12“‘, 13"", 14th, 15th, 16th, 18th, 21st, 22nc!, and 28thsugars from the 5’-end of the oligonucleotide is a 2 -F modified sugar.

65. An oligonucleotide comprising a duplexing region and a targeting region, wherein a targeting region is or comprises a second region of any one of the preceding claims or 5’-NiNToN.i-3’ of any one of the preceding claims.74.66 The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprises a targeting moiety, optionally wherein the moiety is or comprises a ligand for an asialoglycoprotein receptor and / or the moiety is or comprises GalNAc or a derivative thereof.

67. The oligonucleotide of claim 65, wherein the moiety is or comprises optionally substituted77.

68. The oligonucleotide of claim 65 or 66, wherein the moiety is connected to an oligonucleotide chain through a linker, optionally wherein the linker is a -NH-fCIT s- linker, optionally wherein the linker is connected to the 5’-end of the oligonucleotide chain through a phosphate group.

69. An oligonucleotide, wherein the oligonucleotide is an oligonucleotide selected from Table 1 or a salt thereof.

70. An oligonucleotide, which is a diastereomer of an oligonucleotide of any one of the preceding claims.

71. Tire oligonucleotide of any one of the preceding claims, wherein:83.(i) when the oligonucleotide is contacted with a target LDLR transcript comprising a target adenosine in a system, a target adenosine in the target LDLR transcript is modified; (ii) when the oligonucleotide is contacted with a target LDLR transcript comprising a target adenosine in a system, level of the target LDLR transcript is reduced compared to absence of the oligonucleotide or presence of a reference oligonucleotide;84.(hi) when the oligonucleotide is contacted with a target LDLR transcript comprising a target adenosine in a system, level of a product of the target LDLR transcript is altered compared to absence of the oligonucleotide or presence of a reference oligonucleotide;85.(iv) level of a product is increased, w herein the product is or is encoded by a nucleic acid which is otherwise identical to the target LDLR transcript but the target adenosine is modified;86.(v) level of a product is increased, wherein the product is or is encoded by a nucleic acid which is otherwise identical to the target LDLR transcript but the target adenosine is replaced with inosine; and / or (vi) level of a product is increased, wherein the product is or is encoded by a nucleic acid which is otherwise identical to the target LDLR transcript but the adenme of the target adenosine is replaced with guanine.

72. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide is in a salt form, optionally a pharmaceutically acceptable salt form.

73. The oligonucleotide of any one of the preceding claims, wherein each chiral linkage phosphorus independently has a diastereomeric purity of about or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%. 96%, 97%, 98% or 99%.

74. The oligonucleotide of any one of the preceding claims, wherein the diastereopurity of the oligonucleotide is about or at least about (DS)"C, wherein DS is about 85%-l 00% (e.g,, about 85%, 86%, 87%, 88%, 89%, 90%, 91%. 92%. 93%. 94%. 95%, 96%, 97%, 98%, 99% or 99.5% or more) and nc is the number of chiral linkage phosphorus.

75. A pharmaceutical composition comprising an oligonucleotide of any one of the preceding claims and a pharmaceutically acceptable carrier.

76. A chirally controlled composition comprising an oligonucleotide of any one of claims 1 -73.

77. The composition of claim 75 or 76, wherein each chiral linkage phosphorus of the oligonucleotide independently has a diastereomeric purity of about or at least about 85%, 90%, 91%. 92%. 93%, 94%, 95%, 96%, 97%, 98%, or 99%: or wherein the diastereomeric purity of the oligonucleotide in the composition is about or at least about (DS)”C, wherein DS is about 85%- 100% (e.g, about or at least about 85%, 90%, 91 %.93.92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%), and nc is the number of chiral linkage phosphorus in the oligonucleotide.

78. A composition comprising a plurality of oligonucleotides, wherein each oligonucleotide of the plurality is independently a particular oligonucleotide or a salt thereof, wherein the particular oligonucleotide is an oligonucleotide of any one of claims 1-73; or95.an oligonucleotide composition comprising a pl urality of oligonucleotides, wherein oligonucleotides of the plurality share: 1) a common base sequence, and96.2) the same linkage phosphorus stereochemistry independently at one or more (e.g., about 1-50, 1-40, 1-30, 1-25, 1-20. 1-15. 1-10. 5-50, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 1, 2. 3, 4, 5, 6. 7, 8, 9, 10, 11, 12, 13, 14, 15.

16.

17. 18, 19, 20, 21, 22. 23, 24. or 25 ormore) chiral intemucleotidic linkages (“chirally controlled intemucleotidic linkages”);97.wherein each oligonucleotide of the plurality is independently an oligonucleotide of any one of the claims 1-73 or an acid, base, or salt form thereof; or98.an oligonucleotide composition comprising a plurality of oligonucleotides, wherein oligonucleotides of the plurality share:99.1) a common base sequence, and100.2) the same linkage phosphorus stereochemistry independently at one or more (e.g, about 1-50. 1-40, 1-30, 1-25, 1-20, 1-15, 1-10, 5-50, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 ormore) chiral intemucleotidic linkages (“chirally controlled intemucleotidic linkages”);101.wherein the common base sequence is complementary to a base sequence of a portion of a LDLR transcript which portion comprises a target adenosine.

79. The composition of claim 78, wherein the level of oligonucleotides of the plurali ty in oligonucleotides in the composition that share the common constitution of the plurality is about or at least about (DS)nc, wherein DS is about 85%-100% (e.g., about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%. 98%, 99% or 99.5% ormore) and nc is the number of chiral linkage phosphorus; or wherein the level of oligonucleotides of the plurality in oligonucleotides in the composition that share the common constitution of the plurality is about 20%-100%, or is about or at least about 20%-95%, 30%-90%, 40%-85%, 40%-80%, 20%. 30%, 40%, 50%. 60%, 70%, 75%, 80%, 85%, or 90%.

80. A method for modifying a target adenosine in a LDLR transcript in a system, comprising administering or delivering to the system an oligonucleotide or composition of any one of the preceding claims; or104.a method for deaminating a target adenosine in a LDLR transcript in a system, comprising administering or delivering to the system an oligonucleotide or composition of any one of the preceding claims: or105.a method for modulating level, structure, and / or activity of a LDLR transcript and / or a product encoded thereby in a system, comprising administering or delivering to the system an oligonucleotide or composition of any one of the preceding claims; or106.a method for increasing level of LDLR mRNA in a system, composing administering or delivering to the system an oligonucleotide or composition of any one of the preceding claims; or107.a method for increasing level of LDLR polypeptide in a system, comprising administering or delivering to the system an oligonucleotide or composition of any one of the preceding claims; or a method for increasing level of LDLR activity m a system, comprising administering or delivering to the system an oligonucleotide or composition of any one of the preceding claims; or108.a method for regulating cholesterol metabolism in a system, comprising administering or delivering to the system an oligonucleotide or composition of any one of the preceding claims; or109.a method for reducing level of circulating low density lipoprotein cholesterol (LDLc) in a system, comprising administering or delivering to the system an oligonucleotide or composition of any one of the preceding claims; or110.a method for increasing level of low’ density lipoprotein cholesterol (LDLc) uptake in a system, comprising administering or delivering to the system an oligonucleotide or composition of any one of the preceding claims.111.81 The method of claim 80, wherein:112.(i) the method further comprises administering or delivering a statin to the system, optionally wherein the statin is or comprises atorvastatin, fluvastatin, lovastatin, pitavastatin, pravastatin, rosuvastatin, or simvastatin;113.(ii) the system comprises wild-type LDLR transcripts and / or mutant LDLR transcripts;114.(lii) levels of LDLR mRNA are increased as compared to prior to administering or delivering the oligonucleotide or composition, as compared to administering or delivering a reference oligonucleotide or composition to the system, and / or as compared to administering or delivering a statin to the system;115.(iv) levels of LDLR polypeptide are increased as compared to prior to administering or delivering the oligonucleotide or composition, as compared to administering or delivering a reference oligonucleotide or composition to the system, and / or as compared to administering or delivering a statin to the system;116.(v) levels of LDLR activity are increased as compared to prior to administering or delivering the oligonucleotide or composition, as compared to administering or delivering a reference oligonucleotide or composition to the system, and / or as compared to administering or delivering a statin to the system;117.(vi) the reduction is increased as compared to prior to administering or delivering the oligonucleotide or composition, as compared to administering or delivering a reference oligonucleotide or composition to the system, and / or as compared to administering or delivering a statin to the system; and / or (vii) level of LDLc uptake is increased as compared to prior to administering or delivering the oligonucleotide or composition, as compared to administering or delivering a reference oligonucleotide or composition to the system, and / or as compared to administering or delivering a statin to the system.

82. The method of claim 80 or 81, w herein the system is a subject.

83. A method for upregulating expression of LDLR in a subject, comprising administering or delivering an oligonucleotide or composition of any one of the preceding claims to the subject; or120.a method for regulating cholesterol metabolism in a subject, comprising administering or delivering an oligonucleotide or composition of any one of the preceding claims to the subject; or a method for reducing levels of low density lipoprotein cholesterol (LDLc) in a subject, comprising administering or delivering an oligonucleotide or composition of any one of the preceding claims to the subject; or121.a method for reducing levels of low density lipoprotein cholesterol (LDLc) in serum of a subject, comprising administering or delivering an oligonucleotide or composition of any one of the preceding claims to the subject.

84. A method for treating a condition, disorder, or disease, comprising administering or delivering to a subject susceptible thereto or suffering therefrom an effective amount of an oligonucleotide or composition of any one of the preceding claims.

85. A method for preventing or treating a condition, disorder, or disease, comprising administering or delivering to a subject susceptible thereto or suffering therefrom an effective amount of an oligonucleotide or composition of any one of the preceding claims; or124.a method for treating a subject having or at a risk of developing hyperlipidemia, comprising administering or delivering an oligonucleotide or composition of any one of the preceding claims to the subject; or125.a method for treating a subject having or at a risk of developing hypercholesterolemia, comprising administering or delivering an oligonucleotide or composition of any one of the preceding claims to the subject; or126.a method for treating a subject having or at a risk of developing familial hypercholesterolemia (FH), comprising administering or delivering an oligonucleotide or composition of any one of the preceding claims to the subject; or127.a method for treating a subject having or at a risk of developing heterozygous familial hypercholesterolemia (HeFH), comprising administering or delivering an oligonucleotide or composition of any one of the preceding claims to the subject; or128.a method for treating a subject having or at a risk of developing atherosclerotic cardiovascular disease (ASCVD), comprising administering or delivering an oligonucleotide or composition of any one of the preceding claims to the subject.

86. The method of any one of claims 82-85, wherein the subject:130.(i) is a human;131.(ii) comprises a mutation of LDLR and / or is heterozygous for a mutation of LDLR;132.(iii) has hypercholesterolemia, familial hy percholesterolemia (FH), and / or heterozygous familial hypercholesterolemia (HeFH);133.(i v) has a LDLc level that is higher than American Heart Association (AHA) guidelines and / or has a LDLc level of at least about 55 mg / dL, 70 mg / dL, 100 mg / dL, 130 mg / dL, 160 mg / dL, or 190 mg / dL; (v) has been or is being administered a statin and / or has been or is being administered atorvastatin, fluvastatin, lovastatin, pitavastatin, pravastatin, rosuvastatin, simvastatin, ezetimibe, bempedoic acid, inclisiran, alirocumab. and / or evolocumab;134.(vi) is administered a statin in a dosage amount that is the same as or lower than a standard dosage amount and / or is administered a statin in a dosage amount that is the same as or lower than a dosage amount of statin administered without the oligonucleotide or composition;135.(vii) is administered a PCSK9 inhibitor in a dosage amount that is the same as or lower than a standard dosage amount and / or is administered a PCSK9 inhibitor in a dosage amount that is the same as or lower than a dosage amount of statin administered without the oligonucleotide or composition, optionally wherein the PCSK9 inhibitor comprises or is a PCSK9-targeted antibody or PCSK9-targeted siRNA;136.(viii) is in need of reduction of LDLc levels without reducing high density lipoprotein cholesterol (HDLc) levels, PCSK9 levels, or ApoB levels; and / or137.(ix) is statin intolerant.

87. A method for preparing an oligonucleotide or composition of any one of the preceding claims, comprising utilizing a phosphoramidite (e.g., a phosphoramidite comprising a chiral auxiliary).

88. An oligonucleotide or an oligonucleotide composition of any one of claims 1-79 for use in a method for upregulating expression of LDLR in a system, a method for increasing levels of LDLR mRNA in a system, a method for increasing levels of LDLR polypeptide in a system, a method for increasing levels of LDLR activity in a system, a method for increasing level of low density lipoprotein cholesterol (LDLc) uptake in a system, a method for reducing levels of low density lipoprotein (LDLc) in a subject, a method for reducing levels of low? density lipoprotein (LDLc) in serum of a subject, a method for treating a condition, disease, or disorder, a method of any one of claims 80-86, or manufacturing a medicament for a method of any one of claims 80-86.

89. Use of an oligonucleotide or an oligonucleotide composition of any one of claims 1 -79 in a m ethod for upregulating expression of LDLR in a system, a method for increasing levels of LDLR mRNA in a system, a method for increasing levels of LDLR polypeptide in a system, a method for increasing levels of LDLR activity in a system, a method for increasing level of low density lipoprotein cholesterol (LDLc) uptake in a system, a method for reducing levels of low7density lipoprotein (LDLc) in a subject, a method for reducing levels of low7density lipoprotein (LDLc) in serum of a subject, a method for treating a condition, disease, or disorder, a method of any one of claims 80-86, or manufacturing a medicament for a method of any one of claims 80-86.

90. An oligonucleotide, composition, phosphoramidite, method, or use of any one of Embodiments 1-1382.

Images