Determination of genus and species of a fastidious microorganism

By amplifying conserved and species-specific nucleic acid sequences using PCR, the system enhances the detection and identification of Babesia species, addressing the challenges of low microorganism counts and improving diagnostic sensitivity.

WO2026096884A2PCT designated stage Publication Date: 2026-05-07NORTH CAROLINA STATE UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/053507
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-11-01
Filing Date
2025-10-31
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

Current methods for diagnosing Babesia infections, particularly in cases of chronic illnesses or coinfections, face challenges due to the fastidious nature of these microorganisms and the low number of microorganisms present in samples, leading to difficulties in detection and identification.

Method used

A system and method for determining the genus and species of fastidious microorganisms by amplifying conserved and species-specific nucleic acid sequences using PCR, targeting ribosomal RNA and internal transcribed spacers (ITS), with optional enrichment and probe-based detection to enhance sensitivity.

Benefits of technology

The approach significantly increases the sensitivity for detecting and identifying Babesia species, offering up to ten-fold higher sensitivity compared to conventional methods, and allows for tracking parasitemia fluctuations during treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025053507_07052026_PF_FP_ABST
    Figure US2025053507_07052026_PF_FP_ABST
Patent Text Reader

Abstract

Described herein is system, kit, or method for determining genus and species of one or more fastidious microorganisms. Also described herein is system, kit, or method for detecting and identifying one or more fastidious microorganisms in a subject experiencing fatigue, myalgia, or a neurological symptom.
Need to check novelty before this filing date? Find Prior Art

Description

WSGR Docket No. 68706-704.601DETERMINATION OF GENUS AND SPECIES OF A FASTIDIOUS MICROORGANISMCROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 715,241, filed November 1, 2024, which is incorporated herein by reference in its entirety.BACKGROUND

[0002] Piroplasmids are tick-bome protozoan parasites that infect animals and humans. Included in this group is a fastidious microorganism such as microorganism of a genus of Babesia.Currently, more than 100 Babesia species have been described. Several Babesia species have been associated with emerging and underdiagnosed zoonoses. Babesia parasites reproduce in red blood cells of an animal host or human. Diagnosis of Babesia infection (babesiosis) is typically made using a blood sample. Conventional Babesia detection methods include visualization of intraerythrocytic parasites in peripheral blood smear samples, antibody-based detection methods (e.g., ELISA, bead-based antibody capture assays), and amplification of Babesia DNA by quantitative PCR (qPCR). However, diagnosis of babesiosis can be challenging due to the relatively low numbers of circulating infected erythrocytes that may be that may be present in a blood sample (e.g.. parasitemia can fluctuate) and potential cross-reactivity among Babesia species and / or other pathogens. Further, Babesia infections or coinfections with other vector- borne pathogens have been identified in patients. For example, Babesia and Bartonella species infections or coinfections have been identified in patients experiencing chronic, nonspecific illnesses. Historically, the predominant clinical emphases for both genera have focused on acute illness presentations (e.g., hemolytic anemia and / or thrombocytopenia for Babesia species and acute febrile illness for Bartonella species). However, detection of these pathogens in the blood or tissues of patients with chronic illness, who lack the typical diagnostic symptoms associated with acute illness, can be challenging due to the fastidious nature of these microorganisms and the relatively low number of microorganisms that may be present in a sample. There is a need in the art for assays and methods that provide enhanced pathogen detection and identification for assessing acute illness or chronic illnesses in individual patients exhibiting atypical symptoms.SUMMARY

[0003] Accordingly, described herein, in some aspects, is a system for determining a genus and a species of a fastidious microorganism, the system comprising a first modality' for determiningWSGR Docket No. 68706-704.601 a genus of a fastidious microorganism by detecting amplification of a conserved nucleic acid sequence shared by the genus of the fastidious microorganism; and a second modality for determining a species of the fastidious microorganism by detecting amplification of a nucleic acid sequence unique to the species of the fastidious microorganism. In some embodiments, the first modality comprises a component for performing PCR. In some embodiments, the PCR comprises conventional PCR (cPCR), qPCR, or dPCR. In some embodiments, the component comprises a primer. In some embodiments, the primer targets the conserved nucleic acid sequence. In some embodiments, the conserved nucleic acid sequence encodes an RNA. In some embodiments, the RNA comprises ribosomal RNA (rRNA). In some embodiments, the rRNA comprises 18S rRNA, 5.8S rRNA, 28S rRNA, or a combination thereof. In some embodiments, the primer comprises a nucleic acid sequence that is at least 75%. at least 80%. at least 85%. at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 1-6. In some embodiments, the primer is a nucleic acid sequence that is any one of claim SEQ ID NOs: 1-6. In some embodiments, the primer comprises a nucleic acid sequence comprises at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides identical to any one of claim SEQ ID NOs: 1-6. In some embodiments, the nucleic acid sequence unique to the species of the fastidious microorganism comprises at least one internal transcribed spacer (ITS).

[0004] In some embodiments, the at least one ITS sequence is located between two rRNA of the fastidious microorganism. In some embodiments, the at least one ITS sequence is between 18S rRNA and 5.8S rRNA or 5.8S rRNA and 28S rRNA. In some embodiments, the second modality comprises a second component for performing a second PCR. In some embodiments, the second component comprises a second primer. In some embodiments, the second primer targets the at least one intergenic transcribed spacer (ITS) sequence. In some embodiments, the at least one ITS sequence is located between two rRNA of the fastidious microorganism. In some embodiments, the at least one ITS is between 18S rRNA and 5.8S r RNA or 5.8S rRNA and 28S rRNA. In some embodiments, the second PCR comprises cPCR, qPCR, dPCR, or a combination thereof. In some embodiments, the second primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 11-18. In some embodiments, the second primer is a nucleic acid sequence that is any one of claim SEQ ID NOs: 11-18. In some embodiments, the second primer comprises a nucleic acid sequence comprising at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 11-18. In some embodiments, the second PCR quantifies a parasitemia in a subject infected by the fastidious microorganism. In some embodiments, the second modality comprises a probe. In some embodiments, the probe targets the nucleic acid sequence unique to the species of the fastidious microorganism. In someWSGR Docket No. 68706-704.601 embodiments, the probe comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 21-25. In some embodiments, the probe is a nucleic acid sequence that is any one of claim SEQ ID NOs: 21-25. In some embodiments, the probe comprises a nucleic acid sequence comprising at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 21-25. In some embodiments, the system further comprises at least one additional modality for additional amplification for tracking fluctuation of a parasitemia in a subject infected by the fastidious microorganism. In some embodiments, the additional modality tracks the fluctuation of the parasitemia in the subject due to treatment of infection by the fastidious microorganism. In some embodiments, the system further comprises a culture medium for enriching the fastidious microorganism. In some embodiments, the system further comprises a trapping agent for binding to a molecule of the fastidious microorganism. In some embodiments, the trapping agent comprises an antibody. In some embodiments, the molecule comprises an antigen associated with the fastidious microorganism. In some embodiments, the antigen is expressed by the fastidious microorganism. In some embodiments, the antigen is complexed with the fastidious microorganism. In some embodiments, the trapping agent comprises nucleic acid binding agent. In some embodiments, the nucleic acid binding agent comprises a chaotropic agent. In some embodiments, the trapping agent binds to the molecule comprising a nucleic acid of the fastidious microorganism. In some embodiments, the second modality determines at least one additional species of the fastidious microorganism by detecting at least one additional intergenic transcribed spacer (ITS) associated with that at least one additional species of the fastidious microorganism. In some embodiments, the genus comprises Babesia, Theileria, Cytauxzoon, Rangelia, or a combination thereof. In some embodiments, the species comprises B. bovis, B. bigemina, B. crassa-Xi e. B. divergens, B. divergens- s, B. duncani, B. microti, B. microti-\\ e. B. odocoilei, B. venatorum, B. motasi, B. sp. EU3, B. sp. FR1, B. sp. KOI, B. sp. XXB, B. canis, B. capreoli, B. sp. Coco, B. conradae, B.felis, B. gibsoni, B. lengau, B. negevi, B. vogeli, B. vulpes, Cytauxzoon felis, or Theileria bicornis, B. divergens, B. duncani, B. microti, B. odocoilei, or a combination thereof. In some embodiments, the species of the fastidious microorganism is determined in a sample obtained from a subject. In some embodiments, the subject is human. In some embodiments, a parasitemia of the fastidious microorganism is decreased in the subject compared to a second parasitemia in a host of the fastidious microorganism. In some embodiments, the system increases a sensitivity for detecting the fastidious microorganism compared to detection of the fastidious microorganism based on only at genus level of the fastidious microorganism. In some embodiments, the system increases a sensitivity for detecting the fastidious microorganism compared to detection of theWSGR Docket No. 68706-704.601 fastidious microorganism based on only at species level of the fastidious microorganism. In some embodiments, the detection sensitivity for the fastidious microorganism is at least twofold, three-fold, four-fold, five-fold, six-fold, or greater than ten-fold higher than that obtained by amplification at only genus level or only species level of the fastidious microorganism.

[0005] Described herein, in some aspects, is a method for determining a genus and a species of a fastidious microorganism in a sample, the method comprising: amplifying a conserved nucleic acid sequence shared by a genus of the fastidious microorganism in the sample; amplifying a nucleic acid sequence unique to the species of the fastidious microorganism; and identifying the species of the fastidious microorganism based on amplification of the nucleic acid sequence unique to the species of the fastidious microorganism. In some embodiments, the amplify ing of the conserved nucleic acid sequence comprises performing PCR. In some embodiments, the PCR comprises conventional PCR (cPCR), qPCR, or dPCR. In some embodiments, the PCR is performed with a primer for targeting the conserved nucleic acid sequence. In some embodiments, the conserved nucleic acid sequence encodes an RNA. In some embodiments, the RNA comprises ribosomal RNA (rRNA). In some embodiments, the rRNA comprises 18S rRNA, 5.8S rRNA, 28S rRNA, or a combination thereof. In some embodiments, the primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 1-6. In some embodiments, the primer is a nucleic acid sequence that is any one of claim SEQ ID NOs: 1-6. In some embodiments, the primer comprises a nucleic acid sequence comprisingat least ten, at least 12. at least 14, or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 1-6. In some embodiments, the nucleic acid sequence unique to the species of the fastidious microorganism comprises at least one internal transcribed spacer (ITS). In some embodiments, the at least one ITS sequence is located between two rRNA of the fastidious microorganism. In some embodiments, the at least one ITS sequence is between 18S rRNA and 5.8S rRNA or 5.8S rRNA and 28S rRNA. In some embodiments, the amplify ing of the nucleic acid sequence unique to the species of the fastidious microorganism comprises performing a second PCR. In some embodiments, the second PCR comprises conventional PCR (cPCR). qPCR, or dPCR. In some embodiments, the second PCR is performed with a second primer for targeting the nucleic acid sequence unique to the species of the fastidious microorganism. In some embodiments, the second primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 11-18. In some embodiments, the second primer is a nucleic acid sequence that is any one of claim SEQ ID NOs: 1 1 -18. In some embodiments, the second primer comprises a nucleic acid sequence comprising at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides that isWSGR Docket No. 68706-704.601 identical to any one of claim SEQ ID NOs: 11-18. In some embodiments, the second PCR quantifies a parasitemia in a subject infected by the fastidious microorganism. In some embodiments, the method further comprises targeting the amplification of the nucleic acid sequence unique to the species of the fastidious microorganism with a probe. In some embodiments, the probe targets the nucleic acid sequence unique to the species of the fastidious microorganism. In some embodiments, the probe comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 21 -25. In some embodiments, the probe is a nucleic acid sequence that is any one of claim SEQ ID NOs: 21-25. In some embodiments, the probe comprises a nucleic acid sequence comprising at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 21-25. In some embodiments, the method further comprises prescribing a treatment to a subject infected by the fastidious microorganism. In some embodiments, the treatment is based on identification of the species of the fastidious microorganism. In some embodiments, the treatment is based on a parasitemia of the subject infected by the fastidious microorganism. In some embodiments, the treatment comprises prescribing atovaquone, azithromycin, clindamycin, disulfiram, doxycycline, moxifloxacin, quinine, tafenoquine, trimethoprim-sulfamethoxazole, or a combination thereof to the subject. In some embodiments, the method further comprises performing additional amplification for tracking fluctuation of the parasitemia in the subject infected by the fastidious microorganism. In some embodiments, the additional modalitv tracks the fluctuation of the parasitemia in the subject due to treatment of infection by the fastidious microorganism. In some embodiments, the method further comprises enriching the fastidious microorganism prior to the amplifying of the conserved nucleic acid sequence. In some embodiments, the enriching comprises culturing the fastidious microorganism in a culture medium. In some embodiments, the culture medium comprises an insect or mammalian cell culture medium, and optionally comprises a supplement selected from the group consisting of 0-Nicotinamide adenine dinucleotide (NAD), fy Nicotinamide adenine dinucleotide phosphate (NADPH), sodium pyruvate; adenosine 5'- triphosphate (ATP), essential amino acids, yeast extract, sodium bicarbonate, saponin, sodium polyanethol sulfonate (SPS), and fetal, newborn, or adult, horse, ovine, bovine, rabbit, or human serum, or any combination thereof. In some embodiments, the culture medium is protein-free. In some embodiments, the method further comprises binding to a molecule of the fastidious microorganism with a trapping agent. In some embodiments, the trapping agent comprises an antibody. In some embodiments, the molecule comprises an antigen associated with the fastidious microorganism. In some embodiments, the antigen is expressed by the fastidious microorganism. In some embodiments, the antigen is complexed with the fastidiousWSGR Docket No. 68706-704.601 microorganism. In some embodiments, the trapping agent comprises nucleic acid binding agent. In some embodiments, the nucleic acid binding agent comprises a chaotropic agent. In some embodiments, the trapping agent binds to the molecule comprising a nucleic acid of the fastidious microorganism. In some embodiments, the method further comprises determining at least one additional species of the fastidious microorganism by detecting at least one additional intergenic transcribed spacer (ITS) associated with that at least one additional species of the fastidious microorganism. In some embodiments, the genus comprises Babesia, Theileria, Cytauxzoon, Rangelia, or a combination thereof. In some embodiments, the species comprises B. bovis, B. bigemina, B. cra.s.sa-like. B. divergens, B. divergens-\\ e. B. duncani, B. microti, B. microti-hke, B. odocoilei, B. venatorum, B. motasi, B. sp. EU3, B. sp. FR1, B. sp. KOI, B. sp. XXB, B. canis. B. capreoli, B. sp. Coco. B. conradae. B. felis, B. gibsoni, B. lengau, B. negevi, B. vogeli, B. vulpes, Cytauxzoon felis, or Theileria bicornis, B. divergens, B. duncani, B. microti, B. odocoilei, or a combination thereof. In some embodiments, the species of the fastidious microorganism is determined in the sample obtained from a subject. In some embodiments, the subject is human. In some embodiments, a parasitemia of the fastidious microorganism is decreased in the subject compared to a second parasitemia in a host of the fastidious microorganism. In some embodiments, the method increases a sensitivity for detecting the fastidious microorganism compared to detection of the fastidious microorganism based on only at genus level of the fastidious microorganism. In some embodiments, the system increases a sensitivity for detecting the fastidious microorganism compared to detection of the fastidious microorganism based on only at species level of the fastidious microorganism. In some embodiments, the sample comprises blood, plasma, serum, urine, cerebrospinal fluid, pleural fluid, pulmonary mucus, sputum, transudates, modified transudates, exudates, chest fluid, abdominal fluid, synovial fluid, peritoneal fluid, lymph, or effusions.

[0006] Described herein, in some aspects, is a kit comprising: a nucleic acid for detecting a genus of a fastidious microorganism; at least one additional nucleic acid for detecting a species of the fastidious microorganism; and an instruction manual for using the nucleic acid and the at least one additional nucleic acid. In some embodiments, the nucleic acid comprises a primer for targeting a conserved nucleic acid sequence shared by the genus of the fastidious microorganism. In some embodiments, the primer is for performing PCR. In some embodiments, the PCR comprises conventional PCR (cPCR), qPCR, or dPCR. In some embodiments, the conserved nucleic acid sequence encodes an RNA. In some embodiments, the RNA comprises ribosomal RNA (rRNA). In some embodiments, the rRNA comprises 18S rRNA, 5.8S rRNA, 28S rRNA, or a combination thereof. In some embodiments, the primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%,WSGR Docket No. 68706-704.601 or at least 99% identical to any one of claim SEQ ID NOs: 1-6. In some embodiments, the primer is a nucleic acid sequence that is any one of claim SEQ ID NOs: 1-6. In some embodiments, the primer comprises a nucleic acid sequence comprising at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 1-6. In some embodiments, the at least one additional nucleic acid comprises a second primer for targeting a nucleic acid sequence unique to the species of the fastidious microorganism. In some embodiments, the nucleic acid sequence unique to the species of the fastidious microorganism comprises at least one internal transcribed spacer (ITS). In some embodiments, the at least one ITS sequence is located between two rRNA of the fastidious microorganism. In some embodiments, the at least one ITS sequence is between 18S rRNA and 5.8S rRNA or 5.8S rRNA and 28S rRNA. In some embodiments, the second primer targets the at least one intergenic transcribed spacer (ITS) sequence. In some embodiments, the at least one ITS sequence is located between two rRNA of the fastidious microorganism. In some embodiments, the at least one ITS is between 18S rRNA and 5.8S rRNA or 5.8S rRNA and 28S rRNA. In some embodiments, the second primer is for performing a second PCR. In some embodiments, the second PCR comprises cPCR, qPCR, dPCR, or a combination thereof. In some embodiments, the second primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 11-18. In some embodiments, the second primer is a nucleic acid sequence that is any one of claim SEQ ID NOs: 11-18. In some embodiments, the second primer comprises a nucleic acid sequence comprising at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 11-18. In some embodiments, the second PCR quantifies a parasitemia in a subject infected by the fastidious microorganism. In some embodiments, the kit further comprises a probe. In some embodiments, the probe targets the nucleic acid sequence unique to the species of the fastidious microorganism. In some embodiments, the probe comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 21-25. In some embodiments, the probe is a nucleic acid sequence that is any one of claim SEQ ID NOs: 21-25. In some embodiments, the probe comprises a nucleic acid sequence comprising at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 21-25. In some embodiments, the kit further comprises at least one additional modality for additional amplification for tracking fluctuation of a parasitemia in a subject infected by the fastidious microorganism. In some embodiments, the additional modality tracks the fluctuation of the parasitemia in the subject due to treatment of infection by the fastidious microorganism. In some embodiments, the kit further comprises a culture medium forWSGR Docket No. 68706-704.601 enriching the fastidious microorganism. In some embodiments, the culture medium comprises an insect or mammalian cell culture medium, and optionally comprises a supplement selected from the group consisting of P-Nicotinamide adenine dinucleotide (NAD), 0-Nicotinamide adenine dinucleotide phosphate (NADPH), sodium pyruvate; adenosine 5'-triphosphate (ATP), essential amino acids, yeast extract, sodium bicarbonate, saponin, sodium polyanethol sulfonate (SPS), and fetal, newborn, or adult, horse, ovine, bovine, rabbit, or human serum, or any combination thereof. In some embodiments, the culture medium is protein-free. In some embodiments, the kit further comprises a trapping agent for binding to a molecule of the fastidious microorganism. In some embodiments, the trapping agent comprises an antibody. In some embodiments, the molecule comprises an antigen associated with the fastidious microorganism. In some embodiments, the antigen is expressed by the fastidious microorganism. In some embodiments, the antigen is complexed with the fastidious microorganism. In some embodiments, the trapping agent comprises nucleic acid binding agent. In some embodiments, the nucleic acid binding agent comprises a chaotropic agent. In some embodiments, the trapping agent binds to the molecule comprising a nucleic acid of the fastidious microorganism. In some embodiments, the kit further comprises additional nucleic acid determining at least one additional species of the fastidious microorganism by detecting at least one additional intergenic transcribed spacer (ITS) associated with that at least one additional species of the fastidious microorganism. In some embodiments, the genus comprises Babesia. Thellerla, Cylauxzoon, Rangelia, or a combination thereof. In some embodiments, the species comprises B. bovis, B. bigemina, B. crassa-like, B. divergens, B. divergensAike, B. duncani, B. microti, B. microtiAike, B. odocoilei, B. venatorum, B. motasi, B. sp. EU3, B. sp. FR1, B. sp. KOI, B. sp. XXB, B. cams, B. capreoli, B. sp. Coco, B. conradae, B. felis, B. gibsoni, B. lengau. B. negevi, B. vogeli, B. vulpes, Cytauxzoon felis, or Theileria bicornis, B. divergens. B. duncani, B. microti. B. odocoilei, or a combination thereof. In some embodiments, the species of the fastidious microorganism is determined in a sample obtained from a subject. In some embodiments, the subject is human. In some embodiments, a parasitemia of the fastidious microorganism is decreased in the subject compared to a second parasitemia in a host of the fastidious microorganism. In some embodiments, the kit further comprises a treatment for treating a subject. In some embodiments, the subject is infected by the fastidious microorganism. In some embodiments, the treatment is based on identification of the species of the fastidious microorganism. In some embodiments, the treatment is based on a parasitemia of the subject infected by the fastidious microorganism. In some embodiments, the treatment comprises prescribing atovaquone, azithromycin, clindamycin, disulfiram, doxycycline, moxifloxacin, quinine, tafenoquine, trimethoprim-sulfamethoxazole, or a combination thereof to the subject.WSGR Docket No. 68706-704.601

[0007] Described herein, in some aspects, is a system for determining a plurality of species of fastidious microorganisms infecting a subject, the system comprising: a modality for determining a plurality of species of fastidious microorganisms in a sample obtained from the subject by detecting amplification of a plurality of nucleic acid sequences associated with the plurality of species of the fastidious microorganisms, wherein the nucleic acid sequences associated with the plurality of species of the fastidious microorganisms comprise at least one intergenic transcribed spacer (ITS) sequence, and wherein the subject is not a host for the fastidious microorganisms.

[0008] In some embodiments, the modality comprises a primer. In some embodiments, the primer targets the plurality of nucleic acid sequences associated with the plurality of species of the fastidious microorganisms. In some embodiments, the plurality of nucleic acid sequences associated with the plurality of species of the fastidious microorganisms comprises at least one intergenic transcribed spacer (ITS) sequence. In some embodiments, the at least one ITS sequence is located between two rRNA of the fastidious microorganism. In some embodiments, the at least one ITS is between 18S rRNA and 5.8S rRNA or 5.8S rRNA and 28S rRNA. In some embodiments, the primer is for performing PCR comprising cPCR, qPCR, dPCR, or a combination thereof. In some embodiments, the primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 11-18. In some embodiments, the primer is a nucleic acid sequence that is any one of claim SEQ ID NOs: 11-18. In some embodiments, the primer comprises a nucleic acid sequence comprising at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 11-18. In some embodiments, the PCR quantifies a parasitemia in a subject infected by the fastidious microorganisms. In some embodiments, the system further comprises a probe. In some embodiments, the probe targets the plurality of nucleic acid sequences associated with the plurality of species of the fastidious microorganisms. In some embodiments, the probe comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 21-25. In some embodiments, the probe is a nucleic acid sequence that is any one of claim SEQ ID NOs: 21-25. In some embodiments, the probe comprises a nucleic acid sequence comprising at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 21-25. In some embodiments, the system further comprises at least one additional modality for additional amplification for tracking fluctuation of a parasitemia in a subject infected by the fastidious microorganisms. In some embodiments, the additional modality tracks the fluctuation of the parasitemia in the subject due to treatment of infection by the fastidious microorganisms. In some embodiments, the systemWSGR Docket No. 68706-704.601 further comprises a culture medium for enriching the fastidious microorganisms. In some embodiments, the culture medium comprises an insect or mammalian cell culture medium, and optionally comprises a supplement selected from the group consisting of P-Nicotinamide adenine dinucleotide (NAD), P-Nicotinamide adenine dinucleotide phosphate (NADPH), sodium pyruvate; adenosine 5 '-triphosphate (ATP), essential amino acids, yeast extract, sodium bicarbonate, saponin, sodium polyanethol sulfonate (SPS), and fetal, newborn, or adult, horse, ovine, bovine, rabbit, or human serum, or any combination thereof. In some embodiments, the culture medium is protein-free. In some embodiments, the system further comprises a trapping agent for binding to a molecule of the fastidious microorganisms. In some embodiments, the trapping agent comprises an antibody. In some embodiments, the molecule comprises an antigen associated with the fastidious microorganisms. In some embodiments, the antigen is expressed by the fastidious microorganisms. In some embodiments, the antigen is complexed with the fastidious microorganisms. In some embodiments, the trapping agent comprises nucleic acid binding agent. In some embodiments, the nucleic acid binding agent comprises a chaotropic agent. In some embodiments, the trapping agent binds to the molecule comprising a nucleic acid of the fastidious microorganisms. In some embodiments, the system further comprises a second modality for determining a genus of the fastidious microorganisms by detecting a conserved nucleic acid sequence shared by the genus of the fastidious microorganisms. In some embodiments, the genus comprises Babesia. Thellerla, Cylauxzoon, Rangelia, or a combination thereof. In some embodiments, the plurality of species of the fastidious microorganisms comprises B. bovis, B. bigemina, B. cra.s.sfl-like. B. divergens, B. divergens-\ike, B. duncani. B. microti, B. microti-hke, B. odocoilei, B. venatorum, B. motasi, B. sp. EU3, B. sp. FR1, B. sp. KOI, B. sp. XXB, B. canis, B. capreoli, B. sp. Coco, B. conradae, B. felis, B. gibsoni, B. lengau, B. negevi, B. vogeli, B. vulpes. Cytauxzoon felis , or Theileria bicornis, B. divergens, B. duncani, B. microti, B. odocoilei, or a combination thereof. In some embodiments, the plurality of species of the fastidious microorganisms is determined in a sample obtained from a subject. In some embodiments, the subject is human. In some embodiments, a parasitemia of the fastidious microorganisms is decreased in the subject compared to a second parasitemia in a host of the fastidious microorganisms. In some embodiments, the system increases a sensitivity for detecting the fastidious microorganism compared to detection of the fastidious microorganisms based on only at genus level of the fastidious microorganisms. In some embodiments, the system further comprises a treatment for treating a subj ect infected by the plurality of species of the fastidious microorganisms. In some embodiments, the treatment is based on identification of the plurality of species of the fastidious microorganisms. In some embodiments, the treatment is based on a parasitemia of the subject infected by the plurality of species of the fastidiousWSGR Docket No. 68706-704.601 microorganisms. In some embodiments, the treatment comprises prescribing atovaquone, azithromycin, clindamycin, disulfiram, doxycycline, moxifloxacin, quinine, tafenoquine. trimeth oprim-sulfamethoxazole, or a combination thereof to the subject.

[0009] Described herein, in some aspects is In some embodiments, is a method for determining a plurality of species of fastidious microorganisms infecting a subject, the system comprising: determining a plurality of species of fastidious microorganisms in a sample obtained from the subject by detecting amplification of a plurality of nucleic acid sequences associated with the plurality of species of the fastidious microorganisms, wherein the nucleic acid sequences associated with the plurality of species of the fastidious microorganisms comprise at least one intergenic transcribed spacer (ITS) sequence, and wherein the subject is not a host for the fastidious microorganisms. In some embodiments, the amplification is obtained by a primer targeting the at least one intergenic transcribed spacer (ITS) sequence. In some embodiments, the at least one ITS sequence is located between two rRNA of the fastidious microorganisms. In some embodiments, the at least one ITS is between 18S rRNA and 5.8S rRNA or 5.8S rRNA and 28S rRNA. In some embodiments, the primer is for performing PCR. In some embodiments, the PCR comprises cPCR, qPCR, dPCR, or a combination thereof. In some embodiments, the primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 11-18. In some embodiments, the primer is a nucleic acid sequence that is any one of claim SEQ ID NOs: 11-18. In some embodiments, the primer comprises a nucleic acid sequence comprising at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 11-18. In some embodiments, the PCR quantifies a parasitemia in a subject infected by the fastidious microorganisms. In some embodiments, the method further comprises targeting the plurality of nucleic acid sequences associated with the plurality of species of the fastidious microorganisms with a probe. In some embodiments, the probe comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 21-25. In some embodiments, the probe is a nucleic acid sequence that is any one of claim SEQ ID NOs: 21-25. In some embodiments, the probe comprises a nucleic acid sequence comprising at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 21-25. In some embodiments, the method further comprises tracking fluctuation of a parasitemia in a subject infected by the fastidious microorganisms. In some embodiments, the fluctuation of the parasitemia in the subject is due to treatment of infection by the fastidious microorganisms. In some embodiments, the method further comprises enriching the fastidious microorganisms by culturing the fastidious microorganisms in a culture medium. In some embodiments, the cultureWSGR Docket No. 68706-704.601 medium comprises an insect or mammalian cell culture medium, and optionally comprises a supplement selected from the group consisting of P-Nicotinamide adenine dinucleotide (NAD), -Nicotinamide adenine dinucleotide phosphate (NADPH), sodium pyruvate; adenosine 5'- triphosphate (ATP), essential amino acids, yeast extract, sodium bicarbonate, saponin, sodium polyanethol sulfonate (SPS), and fetal, newborn, or adult, horse, ovine, bovine, rabbit, or human serum, or any combination thereof. In some embodiments, the culture medium is protein-free. In some embodiments, the method further comprises binding to a molecule of the fastidious microorganisms with a trapping agent. In some embodiments, the trapping agent comprises an antibody. In some embodiments, the molecule comprises an antigen associated with the fastidious microorganisms. In some embodiments, the antigen is expressed by the fastidious microorganisms. In some embodiments, the antigen is complexed with the fastidious microorganisms. In some embodiments, the trapping agent comprises nucleic acid binding agent. In some embodiments, the nucleic acid binding agent comprises a chaotropic agent. In some embodiments, the trapping agent binds to the molecule comprising a nucleic acid of the fastidious microorganisms. In some embodiments, the method further comprises determining a genus of the fastidious microorganisms by detecting a conserved nucleic acid sequence shared by the genus of the fastidious microorganism. In some embodiments, the genus comprises Babesia, Theileria, Cytauxzoon, Rangelia, or a combination thereof. In some embodiments, the plurality of species of the fastidious microorganisms comprises B. bovis, B. bigemina, B. crassa- like, B. divergens, B. diver gens -like. B. duncani, B. microti. B. microti-hke, B. odocoilei, B. venatorum, B. motasi, B. sp. EU3, B. sp. FR1 , B. sp. KOI , B. sp. XXB, B. canis, B. capreoli, B. sp. Coco, B. conradae, B. felis, B. gibsoni, B. lengau, B. negevi, B. vogeli, B. vulpes, Cytauxzoon felis, or Theileria bicornis, B. divergens. B. duncani, B. microti, B. odocoilei, or a combination thereof. In some embodiments, the plurality of nucleic acid sequences associated with the plurality of species of the fastidious microorganisms is determined in the sample obtained from a subject. In some embodiments, the sample comprises blood, plasma, serum, urine, cerebrospinal fluid, pleural fluid, pulmonary mucus, sputum, transudates, modified transudates, exudates, chest fluid, abdominal fluid, synovial fluid, peritoneal fluid, lymph, or effusions. In some embodiments, the subject is human. In some embodiments, a parasitemia of the fastidious microorganisms is decreased in the subject compared to a second parasitemia in a host of the fastidious microorganisms. In some embodiments, the method increases a sensitivity' for detecting the fastidious microorganisms compared to detection of the fastidious microorganisms based on only at genus level of the fastidious microorganisms. In some embodiments, the method further comprises treating a subject infected by the plurality of species of the fastidious microorganisms. In some embodiments, the treating is based on identification of the plurality7ofWSGR Docket No. 68706-704.601 species of the fastidious microorganisms. In some embodiments, the treating is based on a parasitemia of the subject infected by the plurality of species the fastidious microorganisms. In some embodiments, the treating comprises prescribing atovaquone, azithromycin, clindamycin, disulfiram, doxycycline, moxifloxacin, quinine, tafenoquine, trimethoprim-sulfamethoxazole, or a combination thereof to the subject.

[0010] Described herein, in some aspects, is a method for diagnosing an infection of a plurality of species of fastidious microorganisms in a subject, the method comprising: determining a plurality of species of the fastidious microorganisms by detecting amplification of unique nucleic acid sequences associated with the plurality of species of the fastidious microorganisms in the sample; and diagnosing the subject as having the infection of the plurality of species of the fastidious microorganisms. In some embodiments, the unique nucleic acid sequences associated with the plurality of species of the fastidious microorganisms comprises at least one intergenic transcribed spacer (ITS) sequence. In some embodiments, the at least one ITS sequence is located between two rRNA of the fastidious microorganism. In some embodiments, the at least one ITS is between 18S rRNA and 5.8S rRNA or 5.8S rRNA and 28S rRNA. In some embodiments, the amplification is obtained by a primer targeting the unique nucleic acid sequences for performing PCR. In some embodiments, the PCR comprises cPCR, qPCR, dPCR, or a combination thereof. In some embodiments, the primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 11-18. In some embodiments, the primer is a nucleic acid sequence that is any one of claim SEQ ID NOs: 11 -18. In some embodiments, the primer comprises a nucleic acid sequence comprising at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 11-18. In some embodiments, the PCR quantifies a parasitemia in a subject infected by the fastidious microorganism. In some embodiments, the method further comprises targeting the nucleic acid sequence unique to the plurality of species of the fastidious microorganisms with a probe. In some embodiments, the probe comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 21-25. In some embodiments, the probe is a nucleic acid sequence that is any one of claim SEQ ID NOs: 21-25. In some embodiments, the probe comprises a nucleic acid sequence comprising at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 21-25. In some embodiments, the method further comprises tracking fluctuation of a parasitemia in a subject infected by the fastidious microorganism. In some embodiments, the fluctuation of the parasitemia in the subject is due to treatment of infection by the fastidious microorganism. In some embodiments, the method further comprises enriching the fastidious microorganism byWSGR Docket No. 68706-704.601 culturing the fastidious microorganism in a culture medium. In some embodiments, the culture medium comprises an insect or mammalian cell culture medium, and optionally comprises a supplement selected from the group consisting of P-Nicotinamide adenine dinucleotide (NAD), P-Nicotinamide adenine dinucleotide phosphate (NADPH), sodium pyruvate; adenosine 5'- triphosphate (ATP), essential amino acids, yeast extract, sodium bicarbonate, saponin, sodium polyanethol sulfonate (SPS). and fetal, newborn, or adult, horse, ovine, bovine, rabbit, or human serum, or any combination thereof. In some embodiments, the culture medium is protein-free. In some embodiments, the method further comprises binding to a molecule of the fastidious microorganism with a trapping agent. In some embodiments, the trapping agent comprises an antibody. In some embodiments, the molecule comprises an antigen associated with the fastidious microorganism. In some embodiments, the antigen is expressed by the fastidious microorganism. In some embodiments, the antigen is complexed with the fastidious microorganism. In some embodiments, the trapping agent comprises nucleic acid binding agent. In some embodiments, the nucleic acid binding agent comprises a chaotropic agent. In some embodiments, the trapping agent binds to the molecule comprising a nucleic acid of the fastidious microorganism. In some embodiments, the method further comprises determining a genus of the fastidious microorganism by detecting a conserved nucleic acid sequence shared by the genus of the fastidious microorganism. In some embodiments, the genus comprises Babesia, Theileria, Cytauxzoon, Rangelia, or a combination thereof. In some embodiments, the plurality of species of the fastidious microorganisms comprise B. bovis, B. bigemina, B. crassa ike, B. divergens, B. divergensAike, B. duncani, B. microti, B. microtiAike, B. odocoilei, B. venatorum, B. motasi, B. sp. EU3, B. sp. FR1, B. sp. KOI, B. sp. XXB, B. cams, B. capreoli, B. sp. Coco, B. conradae, B. felis, B. gibsoni, B. lengau. B. negevi, B. vogeli, B. vulpes, Cytauxzoon felis, or Theileria bicornis, B. divergens. B. duncani, B. microti. B. odocoilei, or a combination thereof. In some embodiments, the plurality of species of the fastidious microorganisms of the fastidious microorganism is determined in the sample obtained from a subject. In some embodiments, the sample comprises blood, plasma, serum, urine, cerebrospinal fluid, pleural fluid, pulmonary mucus, sputum, transudates, modified transudates, exudates, chest fluid, abdominal fluid, synovial fluid, peritoneal fluid, lymph, or effusions. In some embodiments, the subject is human. In some embodiments, a parasitemia of the fastidious microorganism is decreased in the subject compared to a second parasitemia in a host of the fastidious microorganism. In some embodiments, the method increases a sensitivity for detecting the fastidious microorganism compared to detection of the fastidious microorganism based on only at genus level of the fastidious microorganism. In some embodiments, the method further comprises treating a subject infected by the fastidious microorganism based on the diagnosing. In someWSGR Docket No. 68706-704.601 embodiments, the treating is based on identification of the lurality of species of the fastidious microorganisms. In some embodiments, the treating is based on a parasitemia of the subject infected by the fastidious microorganism. In some embodiments, the treating comprises prescribing atovaquone, azithromycin, clindamycin, disulfiram, doxycycline, moxifloxacin, quinine, tafenoquine, trimethoprim-sulfamethoxazole, or a combination thereof to the subject. In some embodiments, the subject is not a host for the plurality’ of species of the fastidious microorganisms.

[0011] Described herein, in some aspects, is a method of identifying a fastidious microorganism in a subject experiencing fatigue, myalgia, or neurological symptoms, the method comprising: performing amplification of at least one genomic nucleic acid sequence of at least one fastidious microorganism in a sample from a subject to obtain at least one nucleic acid amplification product, wherein the subject has fatigue, myalgia, or a neurological symptom; analyzing the at least one nucleic acid amplification product to determine a presence of the at least one of the genomic nucleic acid sequence of the at least one fastidious microorganism in the sample: and diagnosing the subject of having an infection by the at least one fastidious microorganism by detecting the presence of the at least one genomic nucleic acid sequence. In some embodiments, the method further comprises extracting nucleic acids associated with the at least one fastidious microorganism prior to performing the nucleic acid amplification. In some embodiments, the analyzing of the at least one nucleic acid amplification product comprises sequencing the at least one nucleic acid amplification product. In some embodiments, the at least one fastidious microorganism comprises Babesia, Bartonella, or a combination thereof. In some embodiments, the Babesia comprises Babesia microti, Babesia divergens, Babesia odocoilei, Babesia duncani, or a combination thereof. In some embodiments, the Bartonella comprises Bartonella quintana. Bartonella koehlerae, Bartonella henselae, Bartonella vinsonii berkoffliii, or a combination thereof. In some embodiments, the at least one genomic nucleic acid sequence comprises an intergenic transcribed spacer (ITS). In some embodiments, the ITS is located between two rRNA genes. In some embodiments, the two rRNA genes comprise 18S rRNA, 5.8S rRNA, or 28S rRNA gene. In some embodiments, the two rRNA genes comprise 18S rRNA and 5.8S rRNA genes. In some embodiments, the two rRNAs comprise 5.8S rRNA and 28S rRNA genes. In some embodiments, the two rRNAs comprise 16S rRNA and 23S rRNA genes. In some embodiments, the at least one nucleic acid amplification product is obtained by contacting the at least one of the genomic nucleic acid sequences with a primer. In some embodiments, the primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% to any one of SEQ ID NOs: 1 -4, 6, 7, 9, 10, 12, or 13. In some embodiments, the analyzing the at least one nucleic acid amplification product comprisesWSGR Docket No. 68706-704.601 contacting the at least one nucleic acid amplification product with a probe. In some embodiments, the probe comprises a nucleic acid sequence that is at least 75%, at least 80%. at least 85%, at least 90%, or at least 99% to any one of SEQ ID NOs: 5, 8, 11, or 14. In some embodiments, the at least one fastidious microorganism is cultured in an enrichment media prior to the amplification of the at least one genomic nucleic acid sequence. In some embodiments, the sample comprises bodily fluid. In some embodiments, the bodily fluid comprises blood. In some embodiments, the at least one nucleic acid amplification product is obtained from PCR. In some embodiments, the PCR comprises conventional PCR (cPCR), quantification (qPCR), or digital PCR (dPCR). In some embodiments, the fatigue is chronic fatigue. In some embodiments, the subject experiences the fatigue, myalgia, or the neurological symptom for at least six months. In some embodiments, the neurological symptom comprises difficult remembering, disorientation, irritability, rage, aggression, difficulty sleeping, seizures, tremors, headache, mental confusion, hallucinations, anxiety, or panic attacks. In some embodiments, the subject experiences the fatigue, myalgia, and the neurological symptom. In some embodiments, the infection by the at least one fastidious microorganism causes the fatigue, myalgia, or the neurological symptom in the subject. In some embodiments, the method further comprises treating the subject infected by the at least one the fastidious microorganism.

[0012] Described herein, in some aspects, is a kit comprising: a nucleic acid for detecting at least one fastidious microorganism in a sample obtained from subject suspect of being infected by the at least one fastidious microorganism; and an instruction manual for using the nucleic acid. In some embodiments, the nucleic acid comprises a primer. In some embodiments, the primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% to any one of SEQ ID NOs: 1-4, 6, 7, 9, 10, 12, or 13. In some embodiments, the nucleic acid comprises a probe. In some embodiments, the probe comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% to any one of SEQ ID NOs: 5, 8, 11, or 14. In some embodiments, the kit further comprises an enrichment media for enriching the at least one fastidious microorganism in the sample.INCORPORATION BY REFERENCE

[0013] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and / or take precedence over any such contradictory material.WSGR Docket No. 68706-704.601BRIEF DESCRIPTION OF DRAWINGS

[0014] FIG. 1A is a schematic diagram illustrating the arrangement of ITS regions among the 18S rRNA, 5.8S rRNA, or 28S rRNA genes.

[0015] FIG. IB is a schematic diagram of an example of an arrangement of ITS 1 and ITS2 primer pairs for amplification of Babesia species.

[0016] FIG. 2 is a flow diagram of an example of an ITS assay workflow for detection and identification of a pathogen in a subject sample.

[0017] FIG. 3A is a plot showing an example of parasite levels in blood samples from an animal host.

[0018] FIG. 3B is a plot showing an example of parasite levels in blood samples from a human host.

[0019] FIG. 4A is a screenshot of a sequence alignment and homology analysis for the conserv ed downstream 18S rRNA region for primer Apil8S-1690s.

[0020] FIG. 4B is a screenshot of a sequence alignment and homology analysis for the conserved downstream 5.8S RNA for primers Api5.8S-20s and Api5.8S-20as.

[0021] FIG. 4C is a screenshot of a sequence alignment and homology analysis for the conserv ed downstream 28S rRNA for primer Api28S-las;

[0022] FIG. 5A is a schematic diagram of the 18S rRNA DNA region targeted for amplification and detection of Babesia at the genus level;

[0023] FIG. 5B is a screenshot of a partial sequence alignment and homology analysis for the conserv ed 18S rRNA target by the primers of FIG. 5 A;

[0024] FIG. 6A is a schematic diagram of the ITS1 and ITS2 regions targeted for amplification of Babesia species;

[0025] FIG. 6B is a screenshot of a partial sequence alignment and homology analysis for the ITS1 region targeted by the Apil8S rRNA-1690s and Api5.8S rRNA-20as primers of FIG. 6A;

[0026] FIG. 7 is a summary table illustrating an example of the relative sensitivity of qPCR vs dPCR for detecting Babesia in serum, blood and blood culture samples;

[0027] FIG. 8 is a plot showing the number of positive test results of FIG. 7 for PCR reactions targeting the 18S rRNA region and PCR reactions targeting the ITS1 region;

[0028] FIG. 9A is a summary table showing Babesia detection in n = 79 uncultured blood samples using ITS region primers (ApilTSl) for amplification;

[0029] FIG. 9B is a summary showing Babesia detection in n = 82 uncultured and cultured blood samples using ITS region primers (ApilTSl) for amplification;

[0030] FIG. 10A is a screenshot of sequence alignments of B. odocoilei ITS1 sequence region;

[0031] FIG. 10B is a screenshot of sequence alignments ofB. divergens ITS1 sequence region;WSGR Docket No. 68706-704.601

[0032] FIG. 10C is a screenshot of sequence alignments of B. duncani ITS1 sequence region;

[0033] FIG. 10D is a screenshot of sequence alignments of B. microti ITS1 sequence region;

[0034] FIG. 11 is screenshot of an example of a mixed sequencing chromatogram that may indicate the potential for alternative allele sequences;

[0035] FIG. 12A is a summary' table showing a ranking for an expected incidence of Babesia detected and sequenced;

[0036] FIG. 12B is a summary showing the observed incidence of Babesia detected and sequenced in a study;

[0037] FIG. 13A is a pie chart showing the prevalence of Babesia species identified in the 12 individuals (out of 50 total participants) experiencing chronic fatigue and neurological symptoms; and

[0038] FIG. 13B is a pie chart showing the prevalence of Bartonella species identified in the 13 individuals (out of 50 total participants) experiencing chronic fatigue and neurological symptoms.DETAILED DESCRIPTION

[0039] Described herein is a system, kit, or method for deterring genus or species of one or more fastidious microorganisms. In some aspects, described herein is a system for determining a genus and a species of a fastidious microorganism, the system comprising: a first modality' for determining a genus of a fastidious microorganism by detecting amplification of a conserved nucleic acid sequence shared by the genus of the fastidious microorganism; and a second modality for determining a species of the fastidious microorganism by detecting amplification of a nucleic acid sequence unique to the species of the fastidious microorganism. In some embodiments, the first modality or the second modality comprises a component for performing PCR. In some embodiments, the PCR comprises conventional PCR (cPCR), quantitative PCR (qPCR), or digital PCR (dPCR). In some embodiments, the PCR is performed with a component comprising a primer. In some embodiments, the primer targets the conserved nucleic acid sequence of one or more fastidious microorganisms. In some embodiments, the conserved nucleic acid sequence encodes an RNA. In some embodiments, the RNA comprises ribosomal RNA (rRNA). In some embodiments, the rRNA comprises 18S rRNA, 5.8S rRNA, 28S rRNA, or a combination thereof. In some embodiments, the primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 1-6. In some embodiments, the nucleic acid sequence unique to the species of the fastidious microorganism comprises at least one internal transcribed spacer (ITS). In some embodiments, the at least one ITS sequence is located between two rRNA of the fastidious microorganism. In some embodiments, the at least one ITS sequence is between 18SWSGR Docket No. 68706-704.601 rRNA and 5.8S rRNA or 5.8S rRNA and 28S rRNA. In some embodiments, the primer targeting the nucleic acid sequence unique to the species of the fastidious microorganism comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 11-18. In some embodiments, the system, kit, or method described herein quantifies a parasitemia in a subject infected by the fastidious microorganism. In some embodiments, the system, kit, or method described herein further comprises using a probe for binding to the nucleic acid sequence unique to the species of the fastidious microorganism. In some embodiments, the probe comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 21-25. In some embodiments, the system, kit, or method described herein further comprises at least one additional modality for additional amplification for tracking fluctuation of a parasitemia in a subject infected by the fastidious microorganism. In some embodiments, the additional modality tracks the fluctuation of the parasitemia in the subject due to treatment of infection by the fastidious microorganism. In some embodiments, the system, kit, or method described herein further comprises utilizing a culture medium for enriching the fastidious microorganism. In some embodiments, the system, kit, or method described herein further comprises a trapping agent for binding to a molecule of the fastidious microorganism. In some embodiments, the trapping agent comprises an antibody. In some embodiments, the trapping agent comprises nucleic acid binding agent. In some embodiments, the system, kit, or method described herein further comprises at least one additional species of the fastidious microorganism by detecting at least one additional intergenic transcribed spacer (ITS) associated with that at least one additional species of the fastidious microorganism. In some embodiments, the genus to be determined by the system, kit, or method described herein comprises Babesia, Theileria, Cytauxzoon. Rangelia, or a combination thereof. In some embodiments, the species to be determined by the system, kit, or method described herein comprises B. bovis, B. bigemina, B. crasra-like, B. divergens, B. diver gens -like, B. duncani, B. microti, B. microti-Uke, B. odocoilei, B. venatorum, B. motasi, B. sp. EU3, B. sp. FR1, B. sp. KOI, B. sp. XXB, B. cams, B. capreoli, B. sp. Coco, B. conradae, B. felis, B. gibsoni, B. lengau. B. negevi, B. vogeii, B. vulpes, Cytauxzoon felis. or Theileria bicornis, B. divergens, B. duncani, B. microti, B. odocoilei, or a combination thereof. In some embodiments, the species of the fastidious microorganism is determined in a sample obtained from a subject. In some embodiments, the subject is human. In some embodiments, the subject is not a host for the fastidious microorganism.

[0040] Described herein, in some aspects, is a system, kit. or method for determining a plurality of species of fastidious microorganisms infecting a subject. In some embodiments, the system, kit, or method described herein further comprises a modality for determining a pluralityWSGR Docket No. 68706-704.601 of species of fastidious microorganisms in a sample obtained from the subject by detecting amplification of a plurality of nucleic acid sequences associated with the plurality of species of the fastidious microorganisms. In some embodiments, the nucleic acid sequences associated with the plurality of species of the fastidious microorganisms comprise at least one intergenic transcribed spacer (ITS) sequence. In some embodiments, the subject is not a host for the fastidious microorganisms. In some embodiments, the modality comprises a primer for targeting the plurality of nucleic acid sequences associated with the plurality of species of the fastidious microorganisms. In some embodiments, the plurality of nucleic acid sequences associated with the plurality of species of the fastidious microorganisms comprises at least one intergenic transcribed spacer (ITS) sequence. In some embodiments, the at least one ITS sequence is located between two rRNA of the fastidious microorganism. In some embodiments, the at least one ITS is between 18S rRNA and 5.8S rRNA or 5.8S rRNA and 28S rRNA. In some embodiments, the primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 11-18. In some embodiments, the PCR quantifies a parasitemia in a subject infected by the fastidious microorganisms. In some embodiments, the system, kit, or method described herein further comprises utilizing a probe. In some embodiments, the probe targets the plurality' of nucleic acid sequences associated with the plurality of species of the fastidious microorganisms. In some embodiments, the probe comprises a nucleic acid sequence that is at least 75%, at least 80%. at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 21-25. In some embodiments, the system, kit, or method described herein further comprises utilizing at least one additional modality' for additional amplification for tracking fluctuation of a parasitemia in a subject infected by the fastidious microorganisms. In some embodiments, the additional modality tracks the fluctuation of the parasitemia in the subject due to treatment of infection by the fastidious microorganisms. In some embodiments, the system, kit, or method described herein further comprises utilizing a culture medium for enriching the fastidious microorganisms. In some embodiments, the system, kit, or method described herein further comprises utilizing a trapping agent for binding to a molecule of the fastidious microorganisms. In some embodiments, the trapping agent comprises an antibody. In some embodiments, the trapping agent comprises nucleic acid binding agent. In some embodiments, the system, kit, or method described herein further comprises a second modality for determining a genus of the fastidious microorganisms by detecting a conserved nucleic acid sequence shared by the genus of the fastidious microorganisms. In some embodiments, the genus comprises Babesia, Theileria, Cytauxzoon, Rangel 'ia, or a combination thereof. In some embodiments, the plurality of species of the fastidious microorganisms comprises B. bovis, B. bigemina, B. cra^.ya-like, B.WSGR Docket No. 68706-704.601 diver gens, B. divergens-like, B. duncani, B. microti, B. microti-like, B. odocoilei, B. venatorum, B. motasi, B. sp. EU3, B. sp. FR1, B. sp. KOI, B. sp. XXB, B. cants, B. capreoli. B. sp. Coco, B. conradae, B. felis, B. gibsoni, B. lengau, B. negevi, B. vogeli, B. vulpes, Cytauxzoonfelis, or Theileria bicornis, B. divergens, B. duncani, B. microti, B. odocoilei, or a combination thereof. In some embodiments, the plurality of species of the fastidious microorganisms is determined in a sample obtained from a subject. In some embodiments, the subject is human. In some embodiments, the subject is not a host for the plurality of species of the fastidious microorganisms. In some embodiments, the system, kit, or method described herein further comprises prescribing a treatment for treating a subject infected by the plurality of species of the fastidious microorganisms. In some embodiments, the treatment is based on identification of the plurality of species of the fastidious microorganisms. In some embodiments, the treatment is based on a parasitemia of the subject infected by the plurality of species of the fastidious microorganisms. In some embodiments, the treatment comprises prescribing atovaquone, azithromycin, clindamycin, disulfiram, doxycycline, moxifloxacin, quinine, tafenoquine, trimethoprim-sulfamethoxazole, or a combination thereof to the subject. Table 4 illustrates detection of plurality of species of the fastidious microorganisms based on the system, kit, or method described herein. Table 5 illustrates treating a subjected infected by one or more of the fastidious microorganisms detected based on the system, kit, or method described herein.

[0041] The disclosure provides a system for determining a genus and species of a fastidious microorganism. The system generally includes a first modality for determining a genus by detecting amplification of a conserved nucleic acid sequence shared by the genus and a second modality for determining a species by detecting amplification of a nucleic acid sequence unique to the species. For example, the first modality may include an oligonucleotide component (e.g., oligonucleotide primer) for amplification of a conserved nucleic acid sequence associated with the genus and the second modality may include an oligonucleotide component (e.g., oligonucleotide primer) for amplification of a nucleic acid sequence unique to a species in the genus. In some embodiments, the nucleic acid sequence unique to a species in the genus is a sequence that is specific to the species and not conserved among other species within the same genus.

[0042] In some embodiments, the conserved nucleic acid sequence encodes an RNA. In some embodiments, the RNA comprises ribosomal RNA (rRNA).

[0043] In various embodiments, oligonucleotide components in the first and second modalities may be designed to target and amplify genomic ribosomal DNA (rDNA) sequences in the intergenic transcribe spacer region (ITS) between the 18S rRNA, 5.8S rRNA, and 28S rRNA genes of a microorganism of interest.WSGR Docket No. 68706-704.601

[0044] In some embodiments, oligonucleotide primers (“ITS primers”) in the first modality may be designed to target conserved sequences in the 18S rRNA and 5.8S rRNA region that flank a first ITS region (ITS1) or target conserved sequences in 5.8S rRNA and 28S rRNA region that flank a second ITS region (ITS2).

[0045] In some embodiments, oligonucleotide primers in the first modality may be designed to target conserved sequences in the 18S rRNA gene.

[0046] In some embodiments, oligonucleotide components in the second modality may be designed to target a variable sequence in the ITS regions between the 18S rRNA, 5.8S rRNA, and 28S rRNA genes. For example, an oligonucleotide component (e.g., ITS primer) may be designed to target and amplify a nucleic acid sequence unique to a species in the genus of interest. In another example, an oligonucleotide component (e.g., ITS probe) may be designed to target a species-specific amplicon for detection and / or quantitation of an amplified target.

[0047] The disclosure provides nucleic acid assays and methods for determining the genus and species of a fastidious microorganism (e.g., a low abundance pathogen) that may be present in a sample. In various embodiments, a method for determining the genus and species of a microorganism in a sample may include: (i) amplifying a conserved nucleic acid sequence shared by a genus of the microorganism in the sample; and (ii) amplifying a nucleic acid sequence unique to the species of the microorganism.

[0048] In various embodiments, oligonucleotide primers and / or probes targeting conserved and / or unique sequences in the ITS regions between the 18S rRNA, 5.8S rRNA, and 28S rRNA genes may be used in a nucleic acid assay (an “ITS assay”) to determine the genus and species of a microorganism in a sample.

[0049] In some embodiments, an ITS assay may include: (i) an enrichment step, in which a sample is cultured in a selected growth medium to increase the quantity of microorganisms in the sample to yield an enriched sample; (ii) a nucleic acid purification step, in which DNA in the enriched sample is isolated to provide a DNA sample potentially comprising a DNA target analyte of interest; (iii) a genus-level detection step, in which target-specific oligonucleotides (e.g., ITS primers) are used in an amplification reaction to detect the presence of the target analyte; and (iv) a species-specific identification step, in which the target-specific oligonucleotides (e.g., ITS primers) and a species-specific ITS probe are used in an amplification reaction to identify' the species and / or strain (sub-species) of the pathogen.

[0050] In some embodiments, an ITS assay for pathogen detection may include: (i) an enrichment step, in which a sample is cultured in a selected growth medium to increase the quantity of microorganisms in the sample and yield an enriched sample; (ii) a nucleic acid purification step, in which DNA in the enriched sample is isolated to provide a DNA sampleWSGR Docket No. 68706-704.601 potentially comprising a target analyte of interest; (iii) a genus-level detection step, in which target-specific primers are used to amplify a conserved nucleic acid sequence and detect the presence of the target analyte; and (iv) a species-specific identification step in which the ITS amplicons are sequenced to identify the pathogen species.

[0051] In various embodiments, the sample may be a whole blood sample.

[0052] In some embodiments, the sample may be a whole blood sample collected from an animal that is a host for a pathogen (e.g., a fastidious microorganism) described herein.

[0053] In some embodiments, the sample may be a whole blood sample collected from a wild animal.

[0054] In some embodiments, the sample may be a whole blood sample collected from a domestic animal.

[0055] In some embodiments, the sample may be a whole blood sample collected from a human.

[0056] In some embodiments, the sample may be a whole blood sample obtained from a human subject experiencing a set of diagnostic symptoms of undetermined etiology. In some embodiments, the set of diagnostic symptoms may include: (i) fatigue or chronic fatigue for a pre-determined duration (e.g., at least six months); and (ii) one or more neurological symptoms such as difficulty7remembering, disorientation, irritability7, rage, aggression, difficulty7sleeping, seizures, tremors, headache, mental confusion, hallucinations, and anxiety / panic attacks.

[0057] In some embodiments, multiple whole blood samples may be collected from a subject to improve the likelihood of capturing a microorganism (e g., pathogen) of interest. In one example, three (n =3) whole blood samples may be collected from a subject over a 7-day period.

[0058] In some embodiments, the whole blood sample may be cultured in a growth medium selected to increase the quantity of microorganisms (e.g., a pathogen of interest) in the sample. In one example, the growth medium may be a medium designed to support the growth of known microorganisms (e.g., pathogen) such as BAPGM™ or a modified version of thereof. In another example, the grow th medium may be a medium designed to support the growth of human and / or animal cells, or a modified version thereof.

[0059] In one embodiment, the whole blood sample may be cultured in the selected growth medium for about 7 days.

[0060] In one embodiment, the whole blood sample may be cultured in the selected growth medium for about 14 days.

[0061] In one embodiment, the whole blood sample may be cultured in the selected growth medium for about 21 days.WSGR Docket No. 68706-704.601

[0062] In various embodiments, a microorganism (e.g., pathogen) of interest may be a piroplasmid in the polyphyletic group comprising the four genera: Babesia, Theileria, Cytauxzoon, and Rangelia.

[0063] In some embodiments, the microorganism (e.g., pathogen) of interest may be a member of the Babesia genus. Currently, there are more than 100 Babesia species known to infect domestic, wildlife, and human hosts, with several new species and genotypes identified every year (see Beattie, J.F., et al.. N Engl J Med, 2002. 347(9): p. 697-8; and Calvopina, M., et al., Front Public Health, 2023. 1 1 : p. 1079042, which are incorporated herein by reference in their entirety). In various embodiments, Babesia species of interest may include, but is not limited to, Babesia microti, Babesia divergens, Babesia odocoilei, Babesia duncani, Babesia sp. EU3, Babesia bigemina, Babesia divergens-like, Babesia venatorum, Babesia sp. FR1. Babesia crassa-like, Babesia microti-like. Babesia motasi, Babesia sp. KOI. and Babesia sp. XXB. Accordingly, ITS oligonucleotides (e.g., ITS primers and ITS probes) may be designed to amplify the ITS1 or ITS2 regions of the Babesia rRNA gene region.

[0064] In some embodiments, the microorganism (e.g., pathogen) of interest may be a bacterium. In one embodiment, the microorganism of interest may be a member of the Bartonella genus of bacteria. In some embodiments, Bartonella species of interest may include, but are not limited to, Bartonella quintana, Bartonella koehlerae, Bartonella henselae, and Bartonella vinsonii berkoffhii.

[0065] In some embodiments, the system, kit, or methods described herein make use of T / artoweZ / o-specific amplification primers and / or probes for detection and identification of one or more Bartonella species. In some embodiments, primers and probes for Bartonella DNA detection target a segment of the ITS region located between the 16S rRNA-23S rRNA genes.

[0066] In some embodiments, a genus-level amplification reaction in an ITS assay may be conventional PCR (cPCR) reaction.

[0067] In some embodiments, a genus-level amplification reaction in an ITS assay may be a quantitative PCR (qPCR) reaction.

[0068] In some embodiments, a genus-level amplification reaction in an ITS assay may be a digital PCR (dPCR) reaction (e.g., droplet digital PCR (ddPCR)).

[0069] In some embodiments, a species-specific amplification reaction in an ITS assay may be a real-time quantitative PCR (qPCR) reaction.

[0070] In some embodiments, a species-specific amplification reaction in an ITS assay may be a digital PCR (dPCR) reaction (e.g.. droplet digital (ddPCR)

[0071] In one embodiment, a qPCR reaction for species identification may be performed using ITS primers and species-specific ITS TaqMan probes.WSGR Docket No. 68706-704.601

[0072] In one embodiment, a qPCR reaction for species identification may be performed using ITS primers in a SYBER Green assay.

[0073] In some embodiments, a species-specific amplification reaction may be a single-plex reaction for identification of a Babesia species.

[0074] In some embodiments, a species-specific amplification reaction may be a multiplexed reaction. The multiplexing reaction may, for example, use ITS primers and two or more speciesspecific ITS probes that target 2. 3, 4, 5. 6, 7, 8. 9. 10. 1 1. 12. 13. 14. 15, or more species of Babesia.

[0075] In some embodiments, a multiplexed amplification reaction may be designed to detect the predominant or suspected species that infect humans and / or animals in a certain geographic region. For example, a multiplexed amplification reaction may be designed to detect Babesia odocoilei, Babesia divergens, Babesia duncani, and Babesia microti, four Babesia species prominent in the USA.

[0076] In some embodiments, the ITS assay and methods described herein may be used to detect a coinfection in a subject sample. In some embodiments, the ITS assay and methods may be used to detect a coinfection of two or more Babesia species in a subject. In some embodiments, the ITS assay and methods may be used to detect a Babesia and Bartonella coinfection in a subject.

[0077] In some embodiments, species-specific identification of a pathogen may be confirmed by sequencing the target amplicons.

[0078] In some embodiments, the ITS assay and methods described herein may be used to inform treatment strategies and / or monitor a treatment regimen.

[0079] In one embodiment, the ITS assay and methods may be used to select a drug therapy for a. Babesia infection. In one embodiment, the ITS assay and methods may be used to select a drug therapy for a Bartonella infection. In one embodiment, the ITS assay and methods may be used to select a drug therapy for a Babesia and Bartonella coinfection.

[0080] In one embodiment, the ITS assay and methods may be used to monitor a treatment regimen for a Babesia infection. In one embodiment, the ITS assay and methods may be used to monitor a treatment regimen for a Bartonella infection. In one embodiment, the ITS assay and methods may be used to monitor a treatment regimen for a Babesia and Bartonella coinfection.

[0081] In some aspects, the assays, methods, and kits described herein may be used to determine a plurality of species of fastidious microorganisms (e.g., vector-borne pathogens) infecting a subject experiencing a set of diagnostic symptoms of undetermined etiology. In some embodiments, the plurality of species of fastidious microorganisms comprises more than oneWSGR Docket No. 68706-704.601 species, more than two species, more than three species, more than four species, more than five species, more than eight species, or more than ten species.

[0082] In some embodiments, the assays, methods, or kits described herein may be used to determine a plurality of species of fastidious microorganisms (e.g., vector-borne pathogens) infecting a subject experiencing a set of neurologic symptoms of undetermined etiology.

[0083] Use of absolute or sequential terms, for example, “will.” “will not,” “shall,” “shall not.” “must,” “must not.” “first,” “initially,” “next,” “subsequently,” “before,” “after.” “lastly,” and “finally,” are not meant to limit scope of the present embodiments disclosed herein but as exemplary.

[0084] As used herein, the singular forms “a”, “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms “including”, “includes”, “having”, “has”, “with”, or variants thereof are used in either the detailed description and / or the claims, such terms are intended to be inclusive in a manner similar to the term “comprising.”

[0085] As used herein, the phrases “at least one”, “one or more”, and “and / or” are open-ended expressions that are both conjunctive and disjunctive in operation. For example, each of the expressions “at least one of A, B and C”, “at least one of A, B, or C”, “one or more of A, B, and C”, “one or more of A, B, or C” and “A, B, and / or C” means A alone, B alone, C alone, A and B together, A and C together, B and C together, or A, B and C together.

[0086] As used herein, “or” may refer to “and”, “or,” or “and / or” and may be used both exclusively and inclusively. For example, the term “A or B” may refer to “A or B”, “A but not B”, “B but not A”, and “A and B”. In some cases, context may dictate a particular meaning.

[0087] Any systems, methods, software, and platforms described herein are modular. Accordingly, terms such as “first” and “second” do not necessarily imply priority, order of importance, or order of acts.

[0088] The term “about” when referring to a number or a numerical range means that the number or numerical range referred to is an approximation within experimental variability (or within statistical experimental error), and the number or numerical range may vary from, for example, from 1% to 15% of the stated number or numerical range. In examples, the term “about” refers to ± 10% of a stated number or value.

[0089] The terms “increased”, “increasing”, or “increase” are used herein to generally mean an increase by a statically significant amount. In some aspects, the terms “increased,” or “increase,” mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 10%, at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least aboutWSGR Docket No. 68706-704.60190% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, standard, or control. Other examples of “increase” include an increase of at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 1000-fold or more as compared to a reference level.

[0090] The terms “decreased”, “decreasing”, or “decrease” are used herein generally to mean a decrease by a statistically significant amount. In some aspects, “decreased” or “decrease” means a reduction by at least 10% as compared to a reference level, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease (e.g., absent level or non-detectable level as compared to a reference level), or any decrease between 10-100% as compared to a reference level. In the context of a marker or symptom, by these terms is meant a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40% or more, and is preferably down to a level accepted as within the range of normal for an individual without a given disease.

[0091] The term “at least one” used herein refers to one, two, three, four, five, six, seven, eight, nine, or more than ten.Babesia Detection and IdentificationITS Primers and Probes

[0092] Oligonucleotide primers and probes may be designed to target variable genomic rDNA sequences in the intergenic transcribed spacer regions (ITS) between the 18S rRNA, 5.8S rRNA, and 28S rRNA genes of a pathogen of interest, e.g., Babesia species. Nucleic acid sequences for primers and probes described herein are shown in Table 6.

[0093] In various embodiments, gene reference sequences from a pathogen species of interest (e.g., Babesia species) may be retrieved from the GenBank database (httD: / / www.ncbi.nim.nih.gov). aligned, and used to design genus and species-specific oligonucleotides targeting the ITS region.

[0094] The disclosure provides Babesia-specific amplification primers and probes for conducting an ITS assay for detection and identification of one or more Babesia species. Briefly, reference sequences from representative Babesia species may be retrieved from the GenBank database and used as reference genes for alignment and homology analysis between the 18S rRNA - 5.8S rRNA and the 5.8S rRNA-28S rRNA regions.

[0095] FIG. 1A is a schematic diagram illustrating the arrangement of ITS regions between the 18S rRNA. 5.8S rRNA, and 28S rRNA genes. The ITS1 region is located between the 18SWSGR Docket No. 68706-704.601 rRNA and 5.8S rRNA genes, and the ITS2 region is located between the 5.8S rRNA and 28S rRNA genes.

[0096] In some embodiments, oligonucleotide primers may be designed to target conserved regions of the 18S rRNA and 5.8S rRNA gene sequences that flank the ITS1 region. In some embodiments, oligonucleotide primers may be designed to target conserved regions of the 5.8S rRNA and 28S rRNA gene sequences that flank the ITS2 region.

[0097] FIG. IB is a schematic diagram of an example of an arrangement of ITS 1 and ITS2 primer pairs for amplification of Babesia species. In this example, the positions of an ITS1 primer pair comprising Apil8S rRNA- 1690s and Api5.8S rRNA-20as; and an ITS2 primer pair comprising Api5.8S rRNA-20s and Api28S rRNA-las are represented by black arrows.

[0098] The disclosure provides oligonucleotide primers (primer pairs) for amplification of Babesia DNA. The oligonucleotide primers may be designed to target conserved regions of rRNA genes that flank the ITS1 or ITS2 regions.

[0099] In one embodiment, a primer pair targeting the ITS1 region includes oligonucleotide Apil8S rRNA- 1690s: 5’ CTCCTACCGATCGAGTGATCCGGT 3’ selected from a Babesia conserved region at the 3' end of the 18S rRNA gene and oligonucleotide Api5.8S rRNA-20as: 5’ GCTGCGTCCTTCATCGTTGTGTGAG 3’.[000100] In one embodiment, a primer pair targeting the ITS2 region includes oligonucleotide Api5.8S rRNA-20s: 5" CTCACACAACGATGAAGGACGCAGC 3" (selected from a Babesia conserved region in the 5.8S rRNA gene) and oligonucleotide Api28S rRNA-las: 5’ CCGCTGAATTTAAGCATAAAAYTAAGCGG 3’ (selected from a Babesia conserved region at the 5’ end of the 28S rRNA gene).[000101] In various embodiments, the primer pairs may be used in an amplification reaction to detect Babesia species.[000102] More details of Babesia ITS primer design are described hereinbelow with reference to Table I, FIG. 4 A, FIG. 4B, and FIG. 4C.[000103] In various embodiments, ITS primer pairs in combination with a species-specific probe may be used in an amplification reaction to identify a specific Babesia species.[000104] In some embodiments, the ITS probe may be a fluorogenic probe, such as a TaqMan probe.[000105] In various embodiments, the disclosure provides sets of ITS 1 primers and probes for identification of a specific Babesia species.[000106] In one embodiment, a set of primers and probe targeting the Babesia divergens ITS1 region (225 bp) includes:Primer BdivergensITS 1 -25s: 5’ CTCGGCTTCGACATTTACGTTGTGTAAGCT 3’WSGR Docket No. 68706-704.601Primer BdivergensITS 1 - 150as: 5 ’ CAACTAC AGTAGTTACACCGYAGTAARC AT AC3’Probe BdivergensITS 1-70: 5’ HEX CTTTTKGTGGTTTCGTATTTGYCGTTG BHQ2 3’In one embodiment, a set of primers and probe targeting the Babesia duncani ITS1 region (170 bp) includes:Primer BduncamTSl-ls: 5’ GTGTTTAAACCGCGCTTATGCGCAGGTC 3’Primer BduncamTSl-130as: 5’ CTGCACTGGCGGGGTGAAAAGTAAC 3’Probe BduncamTS 1-80: 5’ Cy5-TGGCTTTGCGGTTCGCCGTACGGCCCC-BHQ3 3’In one embodiment, a set of primers and probe targeting the Babesia microti ITS1 region (185 bp) includes:Primer BmicrotiITSl-25s: 5’ TATCAGAGTTCTTTGTATCCCATTTGGGTTA 3’Primer BmicrotiITSl-160as: 5’ GAAAATACCTTGGGAGTGAGAACGCCCCGT 3’Probe BmicrotilTS 1-70: 5’ CalFluoRed590-AGAAGAGTGGCCTTGGACGTAG-BHQ2 3’In one embodiment, a set of primers and probe targeting the Babesia odocoilei ITS1 region (150 bp) includes:Primer BodocoITSla-lOOs: 5’ CTGTTGCACTTTTGTGCTTGACGTTGT 3’Primer BodocoITS la-255 as: 5’ CAAGCGCAGGGATGGAAACGGA 3 ’Probe BodocoITS la-200probe: 5’ FAM-GGCCTCGTCATGGCGACGTGGT - BHQ1 3’[000107] More details of species-specific primer and probe design are described hereinbelow with reference to FIG. 10A, FIG. 10B, FIG. 10C, FIG. 10D and Table 2ITS Assay Workflow[000108] The disclosure provides assays and methods for detection and identification of a pathogen(s) present in a subject sample. In various embodiments, the assays make use of ITS primers and / or ITS probes for amplifying and detecting a specific nucleic acid target.[000109] FIG. 2 is a flow diagram of an example of an ITS assay workflow 200 for detection and identification of a pathogen in a subject sample. In one example, assay workflow 200 may be used for the detection and identification of a Babesia species. Assay workflow 200 may include, but is not limited to, the following steps.[000110] At a step 210, a whole blood sample is collected. In some embodiments, multiple whole blood samples may be collected to improve the likelihood of capturing a microorganism (e.g., pathogen) of interest. In one example, three whole blood samples may be collected from a subject over a 7-day period.WSGR Docket No. 68706-704.601[000111] At a step 215, the whole blood sample(s) is cultured to increase the quantity7of microorganisms in the sample to yield an enriched sample for subsequent detection. For example, the whole blood sample may be cultured in a selected growth medium for about 7 days or about 14 days or about 21 days. In one example, the growth medium may be selected to enrich for Babesia microorganisms.[000112] At a step 220, a nucleic acid extraction process is performed to isolate DNA from the cultured whole blood sample to provide a DNA sample for analysis.[000113] At a step 225, a detection amplification reaction for a target analyte is performed to determine the presence of the target in the DNA sample. In one example, target-specific oligonucleotides (e.g., ITS primers) are used in an amplification reaction to detect the presence of the target analyte; and (iv) a species-specific identification step, in which the target-specific oligonucleotides (e.g., ITS primers) and a species-specific ITS probe are used in an amplification reaction to identify the species and / or strain (sub-species) of the pathogen.[000114] At a step 230, an identification amplification reaction is performed to determine the species and / or strain of the pathogen associated with the target analyte.Treatment Strategies and Monitoring[000115] Current treatments for human babesiosis are limited and typically consist of combinations of therapeutic drugs selected for efficacy against other comparable apicomplexan protozoans (i.e., piroplasmids). For example, combinations of atovaquone and azithromycin, or clindamycin and quinine have been used for treatment of human babesiosis as described in Renard I., et al., Pathogens 2021. 10(9); p 1120; and Homer M.J., et al., Clin Microbiol Rev 2000. 13(3): p 1120, which are incorporated herein by reference in their entirety. These treatment regimens are based on efficacy against other comparable apicomplexan and are not designed based on criteria unique to Babesia. Further, current treatment regimens have been associated with adverse events during treatment and a rapid emergence of drug resistance as described in Marcos L.A., et al., Open Forum Infect Dis 2023. 20(10(8): ofad391, which is incorporated herein by reference in its entirety.[000116] In animal health care, the size of a Babesia organism visualized by Giemsa or Wright staining of a peripheral blood smear has been used as a basis for selecting a therapeutic treatment. Based on the size criteria (see Table 5), Babesia species have been divided into two groups: (a) small Babesia (< 2 pm), which includes, but is not limited to B. microti, B. duncani, B. odocoilei, B. gibsoni, B. conradae, B. bovis, and B. vulpes: and (b) large Babesia (> 2 pm), which includes, but is not limited to, B. divergens, B. bigemina, B. caballi, B. vogeli, B. rossi, and B. canis. Using this criteria, a treatment regimen for "small" Babesia may include aWSGR Docket No. 68706-704.601 combination of atovaquone and azithromycin; and a treatment regimen for “large” Babesia may include imidocarb dipropri onate (see Almazan, C. et al., Pathogens 2022. 11(2): p 168, which is incorporated herein by reference in its entirety).[000117] The disclosure provides methods for selecting a therapy for a Babesia infection. The method may include the steps of: (a) collecting a patient sample (e.g., a whole blood sample); (b) performing an ITS assay to determine the species of Babesia from the sample; and (c) based on the species of Babesia present, selecting an effective drug therapy to administer to the patient.[000118] The disclosure provides methods for monitoring a drug therapy administered to a patient to treat a Babesia infection. In one embodiment, the method may include the steps of: (a) collecting a first post-treatment sample (e.g., a whole blood sample) from the patient at a predetermined time after administration of the drug; (b) performing an ITS assay (e.g., a dPCR assay) on the first post-treatment sample to determine the level of Babesia in the sample; (c) collecting a second post-treatment sample (e.g., a whole blood sample) from the patient at a second predetermined time; (d) performing an ITS assay (e.g., a dPCR assay) on the second post-treatment sample to determine the level of Babesia in the sample; and (e) determining, based on the levels of Babesia in the first and second patient samples, the efficacy of the drug therapy.[000119] In certain aspects, the present disclosure provides a method of grouping the plurality of species into groups based on a particle size of the fastidious microorganisms, species, or phylogenetic clade. In some embodiments, the size of the fastidious microorganism is smaller than 2 micrometer (pm). In some embodiments, the size of the fastidious microorganism is larger than 2 micrometer (pm). In some embodiments, the phylogenetic clade comprises Babesia species belongs to phylogenetic Clades I, III, or X within the Piroplasmida order, as determined by 18S rRNA gene sequence analysis. In some embodiments, the Babesia species belongs to phylogenetic Clades I, III, or X includes variants having at least 90% sequence identity to a reference sequence of a representative species, which comprises Babesia microti (Clade I), Babesia duncani (Clade III), or Babesia divergens (Clade X).Kits[000120] The disclosure provides a kit for determining the genus and species of a fastidious microorganism (e.g., a pathogen), the kit comprising:(a) a nucleic acid for detecting a genus of a fastidious microorganism;(b) at least one additional nucleic acid for detecting a species of the fastidious microorganism; andWSGR Docket No. 68706-704.601(c) an instruction manual for using the nucleic acid and the at least one additional nucleic acid.[000121] In some embodiments, the kit for determining the genus and species of a microorganism (e.g., a pathogen) may be a kit designed for performing a multiplexed assay for detecting 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more species of a genus of interest.[000122] In some embodiments, the kit may be designed to detect the predominant or suspected species that infect humans and / or animals in a certain geographic region.[000123] In one embodiment, a kit may include primers and / or probes for performing a multiplexed amplification reaction to detect Babesia odocoilei, Babesia divergens, Babesia duncani, and Babesia microti, four Babesia species prominent in the USA.[000124] In some embodiments, a kit for determining the genus and species of Babesia may be designed to include primers and / or probes for detection of a second genus and / or species of a fastidious microorganism that may be present in a sample obtained from a subject experiencing a set of diagnostic symptoms of undetermined etiology7.Pathogen Detection in Chronic, Nonspecific Illnesses[000125] Described herein are assays, methods, and kits for identifying one or more fastidious microorganisms in a sample obtained from a subject experiencing a set of diagnostic symptoms of undetermined etiology'. In some embodiments, the assays, methods, or kits described herein may be used to determine a plurality of species of fastidious microorganisms (e.g., vector-borne pathogens) infecting a subject experiencing a set of neurologic symptoms of undetermined etiology.[000126] In some aspects, the assays (e.g., ITS assays), methods, and kits make use of a system for determining a genus and a species of a fastidious microorganism as described herein above with reference to FIG. 1 through FIG. 12. For example, the system may include a first modality for determining a genus of a fastidious microorganism by detecting amplification of a conserved nucleic acid sequence shared by the genus of the microorganism; and a second modality for determining a species of the fastidious microorganism by detecting amplification of a nucleic acid sequence unique to the species of the microorganism.[000127] In some embodiments, the oligonucleotide components in the first and second modalities may be designed to target and amplify genomic ribosomal DNA (rDNA) sequences in the intergenic transcribed spacer region (ITS) between the 18S rRNA, 5.8S rRNA, and 28S rRNA genes of Babesia species. Accordingly, the assays (e g., ITS assays) and methods described herein make use of / A / / ie.s' / o-specific ITS amplification primers and probes for detection and identification of one or more Babesia species in a sample obtained from a subjectWSGR Docket No. 68706-704.601 experiencing a set of diagnostic symptoms of undetermined etiology7. In some embodiments, oligonucleotide primers (ITS primers) in the first modality may be designed to target conserved sequences in the 18S rRNA and 5.8S rRNA region that flank a first internal transcribed spacer (ITS) region (i.e., ITS1) or target conserved sequences in 5.8S rRNA and 28S rRNA region that flank a second ITS region (i.e., ITS2). In some embodiments, the oligonucleotide components in the second modality may be designed to target a variable sequence in the ITS regions between the 18S rRNA. 5.8S rRNA, and 28S rRNA genes. For example, an oligonucleotide component (e.g., ITS primer) may be designed to target and amplify a nucleic acid sequence unique to a species in the genus of interest. In another example, an oligonucleotide component (e.g., ITS probe) may be designed to target a species-specific amplicon for detection and / or qualification of an amplified target.[000128] In some embodiments, the oligonucleotide primers may be designed to target conserv ed regions of rRNA genes that flank the Babesia ITS1 region. For example, oligonucleotide primers and probes designed to target variable genomic rDNA sequences in the ITS regions between the 18S rRNA, 5.8S rRNA, and 28S rRNA genes may be used in a nucleic acid assay (an ITS assay) to detect and identify one or more Babesia species as described in Calchi AC et al., Pathogens. 2024 Dec; 13(12); and Maggi RG et al., Parasites & Vectors. 2024 Jul 11; 17(l):302, which are incorporated herein by reference in their entirety7.[000129] Referring now again to FIG. 1A is a schematic diagram illustrating the arrangement of ITS regions between the 18S rRNA. 5.8S rRNA, and 28S rRNA genes. The ITS1 region is located between the 18S rRNA and 5.8S rRNA genes, and the ITS2 region is located between the 5.8S rRNA and 28S rRNA genes. In some embodiments, oligonucleotide primers may be designed to target conserved regions of the 18S rRNA and 5.8S rRNA gene sequences that flank the ITS 1 region. In some embodiments, oligonucleotide primers may be designed to target conserv ed regions of the 5.8S rRNA and 28S rRNA gene sequences that flank the ITS2 region. [000130] Referring now again to FIG. IB is a schematic diagram of an example of an arrangement of ITS 1 and ITS2 primer pairs for amplification of Babesia species. In this example, the positions of an ITS1 primer pair comprising Apil8S rRNA- 1690s and Api5.8S rRNA-20as; and an ITS2 primer pair comprising Api5.8S rRNA-20s and Api28S rRNA- las are represented by black arrows.[000131] In some embodiments, ITS primer pairs that flank the ITS1 region in combination with a species-specific probe may be used in an amplification reaction to identify a specific Babesia species. In some embodiments, the ITS probe may be a fluorogenic probe, such as a TaqMan probe. In one embodiment, an ITS primer and probe set targeting the ITS 1 region may be used for identification of B. divergens. In one embodiment, an ITS primer and probe set targeting theWSGR Docket No. 68706-704.601ITS1 region may be used for identification of B. microti. In one embodiment, an ITS primer and probe set targeting the ITS1 region may be used for identification of B. odocoilei. Examples of primer and probe sets targeting the ITS1 region for identification of B. divergens, B. duncani, B. microti, and B. odocoilei are shown in Table 7.[000132] In some embodiments, the assays and methods described herein may further include detecting at least one additional species of the fastidious microorganism. In this case, the second modality determines at least one additional species of the fastidious microorganism by detecting at least one additional intergenic transcribed spacer (ITS) associated with that at least one additional species of the fastidious microorganism.[000133] In some embodiments, the assays and methods described herein make use of Bartonella-specific amplification primers and probes for detection and identification of one or more Bartonella species. In some embodiments, primers and probes for Bartonella DNA detection target a segment of the ITS region located between the 16S rRNA-23S rRNA Maggi RG, et al., Parasites & Vectors. 2024 Jul 11: 17(1): 302; and Maggi R, et al., Pathogens. 2021; 10: 1462, which is incorporated herein by reference in its entirety.[000134] The disclosure provides a method of identifying a fastidious microorganism in a subject experiencing fatigue, myalgia, or neurological symptoms, the method comprising: (i) performing amplification of at least one genomic nucleic acid sequence of at least one fastidious microorganism in a sample from a subject to obtain at least one nucleic acid product, wherein the subject has fatigue, myalgia, or a neurological symptom; (ii) analyzing the at least one nucleic acid amplification product to determine a presence of the at least one of the genomic nucleic acid sequence of the at least one fastidious microorganism in the sample; and (iii) diagnosing the subject of having an infection by the at least one fastidious microorganism by detecting the presence of the at least one genomic nucleic acid sequence.[000135] In some embodiments, the subject may have symptoms of infection caused by a fastidious microorganism. In another embodiments, the subject may not have symptoms of infection caused by a fastidious microorganism.[000136] In some embodiments, a method for detection and identification of a pathogen(s) present in a sample may include, but is not limited to, (i) providing a set of diagnostic symptoms that may be associated with an infection by a fastidious microorganism (e g., a vector-bome pathogen); (ii) obtaining a sample from a subject, wherein the subject is experiencing one or more symptoms in the set of diagnostic symptoms; (iii) isolating nucleic acids from the subject sample; (iv) performing an ITS assay to determine a genus and / or a species to identify the fastidious microorganism(s) in the sample: and (v) based on presence of the fastidiousWSGR Docket No. 68706-704.601 microorganism(s) establishing an association linking the symptoms experienced by the subject to an infection by the fastidious microorganism(s).[000137] In some embodiments, the set of diagnostic symptoms may include: (i) fatigue or chronic fatigue for a pre-determined duration (e.g., at least six months); and (ii) one or more neurological symptoms such as difficulty remembering, disorientation, irritability, rage, aggression, difficulty sleeping, seizures, tremors, headache, mental confusion, hallucinations, and anxiety / panic attacks.[000138] Tn some embodiments, the sample may be a whole blood sample. Tn some embodiments, multiple whole blood samples may be collected from a subject to improve the likelihood of capturing a microorganism (e.g., pathogen) of interest. In one example, three (n =3) whole blood samples may be collected from a subject over a 7-day period. In some embodiments, the whole blood sample(s) may be cultured in a growth medium selected to increase the quantity of microorganisms (e.g., a pathogen of interest) in the sample. In one example, the grow th medium may be a medium designed to support the growth of know n microorganisms (e.g., pathogen) such as BAPGM™ or a modified version of thereof. In another example, the growth medium may be a medium designed to support the growth of human and / or animal cells, or a modified version thereof. In one embodiment, the whole blood sample may be cultured in the selected growth medium for about 7 days. In one embodiment, the whole blood sample may be cultured in the selected grow th medium for about 14 days. In one embodiment, the whole blood sample may be cultured in the selected growth medium for about 21 days. [000139] Tn some embodiments, the analyzing of the at least one nucleic acid amplification product comprises sequencing the at least one nucleic acid amplification product.[000140] In some embodiments, the at least one fastidious microorganism comprises Babesia, Bartonella, or a combination thereof. In some embodiments, the Babesia comprises Babesia microti, Babesia divergens, Babesia odocoilei, Babesia duncani, or a combination thereof. In some embodiments, Bartonella comprises Bartonella quintana, Bartonella koehlerae, Bartonella henselae, and Bartonella vinsonii berkoffhii, or a combination thereof.[000141] In some embodiments, the at least one genomic nucleic acid sequence comprises an intergenic transcribed spacer (ITS). In some embodiments, the ITS is located between tw o rRNA genes. In some embodiments, the two rRNA genes comprise 18S rRNA, 5.8S rRNA, or 28S rRNA gene. In some embodiments, the two rRNA genes comprise 18S rRNA and 5.8S rRNA genes. In some embodiments, the two rRNAs comprise 5.8S rRNA and 28S rRNA genes. In some embodiments, the two rRNAs comprise 16S rRNA and 23S rRNA genes.[000142] Tn some embodiments, the at least one nucleic acid amplification product is obtained by contacting the at least one of the genomic nucleic acid sequences with a primer. In someWSGR Docket No. 68706-704.601 embodiments, the primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% to any one of SEQ ID NOs: 1-4, 6, 7, 9, 10, 12, or 13.[000143] In some embodiments, the analyzing the at least one nucleic acid amplification product comprises contacting the at least one nucleic acid amplification product with a probe. In some embodiments, the probe comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% to any one of SEQ ID NOs: 5, 8, 11, or 14.[000144] In some embodiments, the at least one fastidious microorganism is cultured in an enrichment media prior to the amplification of the at least one genomic nucleic acid sequence. [000145] In some embodiments, the sample comprises bodily fluid. In some embodiments, the bodily fluid comprises blood.[000146] In some embodiments, the at least one nucleic acid amplification product is obtained from PCR. In some embodiments, the PCR comprises conventional PCR (cPCR), quantification (qPCR), or digital PCR (dPCR).[000147] In some embodiments, the fatigue is chronic fatigue. In some embodiments, the subject experiences the fatigue, the myalgia, or the neurological symptom for at least six months. In some embodiments, the neurological symptom comprises difficult remembering, disorientation, irritability , rage, aggression, difficulty sleeping, seizures, tremors, headache, mental confusion, hallucinations, anxiety, or panic attacks. In some embodiments, the subject experiences the fatigue, the myalgia, and the neurological symptom. In some embodiments, the infection by the at least one fastidious microorganism causes the fatigue, myalgia, or the neurological symptom in the subject. In some embodiments, the method further comprises treating the subj ect infected by the at least one the fastidious microorganism.Treatment Strategies and Monitoring[000148] In some aspects, the ITS assay and methods described herein may be used to inform treatment strategies. In one embodiment, the ITS assay and methods may be used to select a drug therapy for a Babesia infection. In one embodiment, the ITS assay and methods may be used to select a drug therapy for a Bartonella infection. In one embodiment, the ITS assay and methods may be used to select a drug therapy for a Babesia and Bartonella coinfection. Documentation of individual or coinfections with Babesia and Bartonella microorganisms may facilitate directed antimicrobial treatment, thereby potentially improving patient outcomes.[000149] The disclosure provides methods for selecting a therapy, the method comprising the steps of: (a) collecting a patient sample (e.g., a whole blood sample); (b) performing an ITS assay to determine the genus and / or species of a microorganism in the sample; and (c) based on the genus and / or species of the microorganism, selecting an effective drug therapy to administer to the patient.WSGR Docket No. 68706-704.601[000150] In some aspects, the ITS assay and methods described herein may be used to monitor a treatment regimen. In one embodiment, the ITS assay and methods may be used to monitor a treatment regimen for a Babesia infection. In one embodiment, the ITS assay and methods may be used to monitor a treatment regimen for a Bartonella infection. In one embodiment, the ITS assay and methods may be used to monitor a treatment regimen for a Babesia and Bartonella coinfection.[000151] The disclosure provides methods for monitoring a drug therapy administered to a patient to treat a microbial infection. In one embodiment, the method may include the steps of: (a) collecting a first post-treatment sample (e.g., a whole blood sample) from the patient at a predetermined time after administration of the drug: (b) performing an ITS assay on the first post-treatment sample to determine the level of the microorganism in the sample; (c) collecting a second post-treatment sample (e.g., a whole blood sample) from the patient at a second predetermined time; (d) performing an ITS assay on the second posttreatment sample to determine the level of the microorganism in the sample; and (e) determining, based on the levels of the microorganism in the first and second patient samples, the efficacy of the drug therapy. [000152] In some aspects, the ITS assay and methods described herein may be used in a clinical studies application designed to assess a potential causative role for Babesia and Bartonella species in patients experiencing chronic fatigue, myalgia, and concurrent neurological symptoms.Kits[000153] The disclosure provides a kit for identifying a fastidious microorganism in a subject experiencing a set of diagnostic symptoms of undetermined etiology, the kit comprising: a nucleic acid for detecting a genus of a fastidious microorganism; at least one additional nucleic acid for detecting a species of the fastidious microorganism; and an instruction manual for using the nucleic acid and the at least one additional nucleic acid.[000154] In some embodiments, the genus of the fastidious microorganism comprises Babesia. In some embodiments, the species of the fastidious microorganism comprises B. divergens, B. duncani, B. microti, B. odocoilei, or a combination thereof.[000155] In some embodiments, the genus of the fastidious microorganism comprises Bartonella. In some embodiments, the species of the fastidious microorganism comprises B. quinlana, B. koehlerae, B. henselae, B. vinsonii berkofftiii, or a combination thereof.[000156] In some embodiments, the kit may further include culture medium for enriching a fastidious microorganism. In one embodiment, the kit may include a culture medium for enriching a Babesia species. In one embodiment, the kit may include a culture medium for enriching a Bartonella species.WSGR Docket No. 68706-704.601[000157] In some embodiments, the kit for determining the genus and species of a microorganism (e.g.. a pathogen) may be a kit designed for performing a multiplexed assay for two or more species of a genus of interest.[000158] While preferred embodiments of the present invention have been show n and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. It is not intended that the invention be limited by the specific examples provided within the specification. While the invention has been described with reference to the aforementioned specification, the descriptions and illustrations of the embodiments herein are not meant to be construed in a limiting sense. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. Furthermore, it shall be understood that all aspects of the invention are not limited to the specific depictions, configurations or relative proportions set forth herein which depend upon a variety of conditions and variables. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is therefore contemplated that the invention shall also cover any such alternatives, modifications, variations or equivalents. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.ExamplesExample 1. Determination of Babesia species[000159] Animals (domestic and wildlife) are the natural reservoirs ior Babesia species, with humans as the accidental reservoir. As natural reservoirs for Babesia species, parasite levels in an animal host’s blood may be relatively high compared to a human host.[000160] FIG. 3A is a plot 300 showing an example of parasite levels in blood samples from an animal host. FIG. 3B is a plot 310 showing an example of parasite levels in blood samples from a human host. In FIG. 3A and FIG. 3B. pathogen detection was conducted by digital PCR using primers for conserved regions in the 18S rRNA gene. Each dot in plot 300 and plot 310 represents detection of a parasite in the sample. The data show relatively high parasitemia in the animal host (plot 300) compared to a significantly low er level of parasitemia in the human host (plot 310). Due to the relatively low numbers of circulating infected ery throcytes that may be present in a blood sample, diagnosis of babesiosis can be challenging. The disclosure provides oligonucleotide primers and probes for detection and identification of a Babesia species present in a subject sample.WSGR Docket No. 68706-704.601[000161] Amplification primers and probes were evaluated using animal and human samples. Babesia-infected animal samples were obtained from the Vector-Borne Disease Diagnostic Laboratory, College of Veterinary Medicine (North Carolina State University), and from Cummings School of Veterinary Medicine (Tufts University). All human study participants provided three blood and serum specimens collected within a 7-day period. These individuals were selected because of a history of arthropod or animal contact as a component of an Institutional Review Board (IRB) approved study entitled: Detection of Bartonella Species in the Blood of People with Extensive Animal Contact (North Carolina State University Institutional Review Board, IRB#s 4925-0s and 164-08-05). The culture and molecular testing approach used was as described in Maggi, R.G., et al., Parasite Vectors, 2024. 17(1): p. 302; Lashnits, E., et al., Borne Zoonotic Dis, 2021. 21(6): p. 413-421; Portillo, A., et al., Pathogens, 2020. 9(3); and Breitschwerdt, E.B., et al., Pathogens, 2020. 9(12), which are incorporated herein by reference in their entireties.GenBank Reference Sequences[000162] Reference sequences for 18S rRNA. 5.8S rRNA, and 28S rRNA genes from representative Babesia species were retrieved from the GenBank database (http: / / www.ncbi.nlm.nih.gov). Using Clustal W multi-sequence alignment (AlignX, Vector NTI Advanced 10.3.0 from Invitrogen), the complete or partial regions between 18S rRNA to 28S rRNA from / ?, bigemina (HQ840960), B. canis (AY072926), I?, vogeli (HQ148664), B. coco (AY618928, EU 109720. EU 109721), B conradae (AF 158702). B. crassa (MK240324, AY260176, KX590751), B. divergens (AY572456, EU182599, EU185801 , EF458187, EU182603, EU182598), B. duncani (HQ289870, MH333111), B. gibsoni (CP141526), B. microti (AB112337, GU230755. LN871598, AB190435, MK609547, XR 002459986), B. motasi (AY260179), B. odocoilei (AF158711. AY339747, AY339754, AY339756, AY339757, AY339759, AY345122, BOU16369, KC1622888, MF357056), B. orientalis (HQ840969), B. poelea (DQ200887), B. rodhaini (AF510201), B. urriae (FJ17705), and B. venatorum (GQ888709, MG344777, AY046575, KF724377, OP522105), were used as species reference genes for alignments.Babesia ITS1 and Babesia ITS2 Region Genus Primer Design[000163] Alignment and homology analysis of GenBank reference Babesia gene sequences between the 18S rRNA - 5.8S rRNA and 5.8S rRNA-28S rRNA region was performed to design oligonucleotides specific for different Babesia species. Four different oligonucleotide primers were design for this region: Apil8S rRNA-1690s: 5' CTCCTACCGATCGAGTGATCCGGT 3’ (selected from a Babesia conserved region at the 3' end of the 18S rRNA gene); Api5.8S rRNA- 20as: 5’ GCTGCGTCCTTCATCGTTGTGTGAG 3’ and Api5.8S rRNA-20s: 5’WSGR Docket No. 68706-704.601CTCACACAACGATGAAGGACGCAGC 3' (selected from a Babesia conserved region in the 5.8S rRNA gene: and Api28S rRNA-las: 5' CCGCTGAATTTAAGCATAAAAYTAAGCGG 3’ (selected from a Babesia conserved region at the 5’ end of the 28S rRNA gene).[000164] The Apil8S-1690s, Api5.8S-20s, Api5.8S-20as, and Api28S-las primers were used for DNA amplification, using conventional PCR (cPCR) or quantitative PCR (qPCR), followed by sequencing of the complete intergenic ITS1 and ITS2 regions of several Babesia species from infected animals (previously characterized by qPCR and digital PCR or dPCR targeting 18S rRNA as described in Maggi, R., et al., Pathogens, 2021 . 10( 1 1), which is incorporated herein by reference in its entirety)- The Babesia species included: including B. odocoilei (from infected caribou and reindeers); Babesia vulpes, B. canis, B. vogeli and Babesia gibsoni (from infected dogs), B. lengau (from an infected cheetah), B. diver gens -like (isolate MO-1 from infected rabbit), B. duncani (strain J3 from infected hamster), B. microti (isolate GI from infected hamster), Theileria bicornis (from infected rhinoceros), and Cytauxzoon felis (from infected cat). GenBank accession numbers for the reference genes are shown in Table 1. The same conventional and qPCR, primers sets were used for amplification of Babesia ITS1 and Babesia ITS2 regions from each of the above Babesia sp.[000165] Conventional PCR (cPCR) amplification was performed using a master-mix reaction, at 25 pl final volume per reaction, comprising of 7.3 pl of molecular-grade water (QIAGEN Germantown, MD, USA), 12.5 pl of 2x My Taq HS Red Mix (Bioline, Tennessee, USA); 0. 1 pl of 100 pM of each Apil8S rRNA-1690s and Api5.8S rRNA-20as (fo Babesia ITS1 region) or Api5.8S rRNA-20s and Api28S rRNA-l as (for Babesia TTS2 region) as forward and reverse oligonucleotide primers (IDT-DNA Technologies Coralville, IA USA); and a 5 pl of extracted DNA. Molecular-grade water and DNA extracted from blood of a naive dog were used as negative controls. Amplification was performed using a CFX Opus Real-Time PCR Systems (Bio Rad, Hercules, CA, USA) under the following conditions: 95°C for 3 min, followed by 45 cycles of denaturing at 94°C for 10 s, annealing at 66°C for 15 s, and extension at 72 °C for 20 s. The products obtained in PCR assays were separated by horizontal electrophoresis on a 2% agarose gel stained with gel Green (Thermofisher Scientific, Greenville, NC. USA), visualized under ultraviolet light illumination using ChemiDoc MP Imaging System (Bio Rad, Hercules, CA, USA) and photographed using Image Lab Software (Bio Rad, Hercules, CA, USA).[000166] Similarly, real-time qPCR amplification of Babesia ITS1 and Babesia ITS2 were performed as above for cPCR with minor modifications: 7.5 pl of molecular-grade water (QIAGEN. Germantown MD), 12.5 pl of 2X SsoAdvanced SYBR green master mix (Bio Rad, Hercules, CA, USA), 0.2 pl of 100 pM each oligonucleotide primers Api l 8S rRNA- 1690s and Api5.8S rRNA-20as (for detection of Babesia ITS1) and Api5.8S rRNA-20s and Api28S rRNA-WSGR Docket No. 68706-704.601 las (for detection of Babesia ITS2), and 5 pl of extracted DNA. As described above for cPCR, molecular-grade water and DNA extracted from naive dog blood samples were used as PCR negative controls. Amplification was performed in a Bio-Rad CFX 96 well Opus PCR system machine under the following conditions: 95°C for 3 min, followed by 40 cycles of denaturing at 94°C for 15 s, annealing at 68°C for 15 s, and extension at 72 °C for 15 s. An additional gradient cycle from 65°C to 95°C was performed for melting curve analysis. Threshold cycles (Ct) values and melting temperature analysis were performed by reading fluorescent signals using FAM / Syber channel.[000167] For both cPCR and qPCR modalities, amplified products were purified and sequenced by Sanger’s method where sequences were assessed for quality and analyzed using Clustal W multi-sequence alignment (AlignX, Vector NTI Advanced 10.3.0 from Invitrogen). These sequences were compared to sequences previously deposited in the GenBank database as described in Saito-Ito, A., et al., J Clin Microbiol, 2000. 38(12): p. 4511-6, which is incorporated herein by reference in its entirety .[000168] FIG. 4A is a screenshot of a sequence alignment and homology’ analysis for the conserved downstream 18S rRNA region for primer Apil8S-1690s. The boxed region shows the conserved downstream 18S rRNA for primer Apil8S-1690s.[000169] FIG. 4B is a screenshot of a sequence alignment and homology analysis for the conserved downstream 5.8S RNA for primers Api5.8S-20s and Api5.8S-20as. The boxed region shows the conserved downstream 5.8S rRNA for primers Api5.8S-20s and Api5.8S-20as.[000170] FIG. 4C is a screenshot of a sequence alignment and homology' analysis for the conserved downstream 28S rRNA for primer Api28S-las. The boxed region shows the conserved downstream 28S rRNA for primer Api28S-las.Species-Specific qPCR Amplification Assessment[000171] Species-specific qPCR amplification, limit of detection, and cross-amplification assessment was performed for the detection of B. microti, B. duncani, B. divergens, and B. odocoilei ITS1 region. For each representative Babesia species (B. divergens-hke isolate MO-1, B. duncani isolate J3, B. microti isolate GI, and B. odocoilei isolate VB 19-09386), the entire Babesia ITS1 through ITS2 region PCR amplicon obtained using oligonucleotides Apil8S rRNA-1690s and Api28S rRNA-las, as forward and reverse primers, respectively were cloned into plasmid pGEM-T Easy (Promega® Madison, WI, USA), transformed into E. coli DH5-a strain competent cells, and purified using Qiagen plasmid miniprep kits. Plasmid insert DNAs were sequenced for species verification and quantified using Qubit Flex Fluorometric Quantification (QIAGEN, Germantown, MD, USA).WSGR Docket No. 68706-704.601[000172] Serial dilution in molecular grade water, ranging from 107to 1O'?copies / pl. were used as template to assess the limit of detection by real-time PCR (both using Taqman probes and SYBR Green followed by melting curve analysis).Single-plex Species-specific Real-time PCR[000173] Single-plex species-specific real-time PCR was performed using reaction mixture at 25 pl final volume per reaction. PCR reaction included 7.3 pl of molecular-grade water (QIAGEN. Germantown MD), 12.5 pl of 2X SsoAdvanced SYBR green master mix (Bio Rad, Hercules, CA, USA), 0.1 pl of each species-specific primer at 100 pM (TDT-DNA Technologies Coralville, IA USA), and 5 pl of DNA sample. Molecular-grade water and DNA extracted from naive dog and human blood specimens were used as PCR negative controls. Amplification was performed in a Bio-Rad CFX 96 well Opus PCR system machine under the following conditions: 95°C for 3 min, followed by 40 cycles of denaturing at 94°C for 10 s, annealing at 68°C for 10 s, and extension at 72°C for 10 s. An additional gradient temperature cycle from 65°C to 95°C at 0.2°C per second was performed for melting curve analysis. Threshold cycles (Ct) values and melting temperature analysis were performed by reading fluorescent signals using FAM / Syber channel. All PCR positive samples were sequenced by Sanger’s method and analyzed using Clustal W multi-sequence alignment as described above.Multiplex Species-Specific qPCR[000174] Multiplex species-specific qPCR was performed using reaction mixture at 25 pl final volume per reaction. PCR amplification included 7.3 pl of molecular-grade water (QIAGEN, Germantown MD), 12.5 pl of 2X SsoAdvanced probe master mix (Bio Rad, Hercules, CA, USA), 0.1 pl of each species-specific primer at 100 pM (IDT-DNA Technologies Coralville, IA USA), 0.1 pl of 100 pM (IDT-DNA Technologies Coralville, IA USA) of each species-specific probe, and 5pl of DNA sample. Molecular-grade water and DNA extracted from naive dog and human blood specimens were used as PCR negative controls. Amplification was performed in a Bio-Rad CFX 96 well Opus PCR system machine under the following conditions: 95°C for 3 min, followed by 40 cycles of denaturing at 94°C for 10 s, annealing at 68°C for 10 s, and extension at 72°C for 10 s. Reading of fluorescent signals for detection of each Babesia species was performed during the annealing phase of amplification using FAM (green) for B. odocoilei, HEX (yellow) for B. divergens , CalFluo590 (red) for B. microti, and Cy5 (crimson) for B. duncani. Recording of the fluorescent signal threshold value (Ct value) was used to assess positive and negative DNA amplification. As above, all PCR positive samples were sequenced by Sanger’s method (Genewiz from Azenta. Research Triangle Park, North Carolina, USA) and analyzed using Clustal W multi-sequence alignment (AlignX, Vector NTI Advance 10.3.0 from Invitrogen) to confirm species identification.WSGR Docket No. 68706-704.601Amplification oi Babesia ITS1 region and Babesia ITS2 region[000175] Using Apil8S rRNA-1690s and Api5.8S rRNA-20as (as forward and reverse primers), cPCR DNA amplification of the Babesia ITS1 region, generated a single 557-650bp band consistent with the expected DNA sizes (depending on species) for all Babesia spp from infected animals. Importantly, all amplicons generated using the Babesia ITS1 region assay rendered a high-quality DNA sequence chromatogram, facilitating clear and distinctive differentiation between species and strains (i.e. different !?, odocoilei strains were identified from different cervid species and from infected humans). Similarly, the Api5.8S rRNA-20s and Api28S rRNA-las (as forward and reverse primers) targeting the Babesia ITS2 regions, generated a single 385-436bp band consistent with the expected Babesia ITS2 region DNA size (depending on Babesia spp.) for all infected animals, (see Table 2). Similar results using the qPCR assay method were obtained for all animal samples tested, generating only a single signal with melting curve temperatures depending on the Babesia sp. Babesia species ITS1 and ITS2 sequences (amplified by either cPCR or qPCR) were deposited in GenBank (see Table 1).[000176] Previously, we described a digital PCR assay targeting the Babesia 18S rRNA region, aimed at genus-level detection of Babesia species in animals and human patients (see Maggi, R., et al., Pathogens, 2021. 10(1 1)). Despite the higher sensitivity of the digital PCR assay when compared with real-time PCR using the same sample and primers / probes, species identification using this approach was not possible due to the conservation of sequences in the 18S rRNA region across the genus and the inability to concentrate target DNA for sequence analysis of digital PCR products.[000177] FIG. 5A is a schematic diagram of the 18S rRNA DNA region targeted for amplification and detection of Babesia at the genus level. In this example, the positions of an 18S rRNA primer pair comprising pirol8S-238s and pirol8S-340as are represented by black arrows.[000178] FIG. 5B is a screenshot of a partial sequence alignment and homology7analysis for the conserved 18S rRNA target by the primers of FIG. 5 A. In this example, 26 Babesia species and / or strains were evaluated. The regions highlighted demonstrate the conservation of sequences across the Babesia genus. The data demonstrate that while amplification primers targeting the 18S rRNA region provide detection of Babesia across the genus, amplification of the 18S rRNA region alone does not provide species-specific identification of Babesia.[000179] In comparison, amplification of Babesia species using primers that target an ITS region between the 18S rRNA, 5.8S rRNA, and 28S rRNA may be used to differentiate among Babesia species.WSGR Docket No. 68706-704.601[000180] FIG. 6A is a schematic diagram of the ITS1 and ITS2 regions targeted for amplification of Babesia species. In this example, the positions of an ITS1 primer pair comprising Apil8S rRNA-1690s and Api5.8S rRNA-20as; and an ITS2 primer pair comprising Api5.8S rRNA-20s and Api28S rRNA-las are represented by black arrows.[000181] FIG. 6B is a screenshot of a partial sequence alignment and homology7analysis for the ITS1 region targeted by the Apil8S rRNA-1690s and Api5.8S rRNA-20as primers of FIG. 6A. In this example, sequence alignment for Babesia microti, Babesia duncani. Babesia divergens, and Babesia odocoilei are shown. The highlighted regions demonstrate the variability of sequences across the ITS 1 region. The data demonstrate that amplification of the ITS 1 region allows for differentiation among Babesia species.Comparison of Babesia genus detection in human clinical samples bv qPCR and dPCR [000182] The present disclosure provides a method for detecting a fastidious microorganism in a sample. The method comprises amplifying a conserved nucleic acid sequence shared by a genus of the fastidious microorganism, amplifying a nucleic acid sequence unique to a species of the fastidious microorganism, and identifying the genus and the species of the fastidious microorganism based on amplification products of the conserved nucleic acid sequence shared by the genus and the nucleic acid sequence unique to the species of the fastidious microorganism. In some embodiments, the conserved nucleic acid sequence shared by a genus encodes an RNA. The sensitivity of the method for detecting a fastidious microorganism disclosed herein is higher than that obtained by amplification at only genus level or only species level of the fastidious microorganism. In some embodiments, the detection sensitivity for the fastidious microorganism is at least two-fold, three-fold, four-fold, five-fold, six-fold, or greater than ten-fold higher than that obtained by amplification at only genus level or only species level of the fastidious microorganism.[000183] To assess the relative sensitivity and specificity of all four amplification modalities (18S rRNA qPCR, 18S rRNA dPCR, Babesia ITS1 qPCR, and Babesia ITS2 qPCR) 226 human blood and enrichment blood culture DNA samples belonging to selected 82 individuals previously tested in our laboratory (see Maggi, R.G., et al., Parasite Vectors, 2024. 17(1): p. 302; Lashnits, E., et al., Borne Zoonotic Dis, 2021. 21(6): p. 413-421; Portillo, A., et al.. Pathogens, 2020. 9(3); and Breits ch werdt, E.B., et al., Pathogens, 2020. 9(12)) were analyzed to determine the frequency of positive DNA amplification and to assess the amplified sequence quality (available for qPCR testing only) for obtaining a readable DNA sequence.[000184] From a total of 226 human DNA blood and enrichment blood culture samples tested for Babesia species, 19 were positive by qPCR targeting the 18S rRNA; 70 were positive byWSGR Docket No. 68706-704.601 dPCR targeting the 18S rRNA; 29 were positive by qPCR aiming at Babesia ITS 1 ; and 40 were positive by qPCR targeting Babesia ITS2.[000185] DNA sequence analysis and species identification (using Clustal W multi-sequence alignment; AlignX, Vector NTI Advance 10.3.0 from Invitrogen) was not possible for any of the 19 18S rRNA qPCR positive samples; whereas sequences were obtained for 26 of the 29 Babesia ITS1 qPCR; and 20 of 40 Babesia ITS2 qPCR samples, respectively.[000186] In most instances, Babesia ITS1 qPCR rendered higher quality DNA sequences (using both forward and reverse primers) compared to Babesia ITS2 qPCR for the same sample. Based upon these comparative ITS 1 and ITS2 results, the Babesia ITS 1 region was selected for detection of Babesia sp. at the genus level and for the design of species-specific primers and probes for the detection of / ?, divergens. B. duncani, B. microti, and B. odocoilei.[000187] FIG. 7 is a summary table 700 illustrating an example of the relative sensitivity of qPCR vs dPCR for detecting Babesia in serum, blood and blood culture samples. In this example, qPCR and dPCR were performed using two different sets of oligonucleotide primers: a first set targeting the 18S rRNA gene region (columns labeled qPCR18 and dPCR18, respectively, in table 800) and a second set targeting the ITS1 region (column labeled qPCR ApilTSl in table 800). The results shown are for 4 representative patient samples (i.e. , A.K., N.D., J.H., and E.S.). Data was generated for 26 separate reactions using serum, blood, and blood culture (enriched) samples. In table 700, serum samples are highlighted in green, blood samples are highlighted in red, and cultured blood samples are not highlighted.[000188] For the primers targeting the 18S rRNA region, the data show 1 out of 4 patients tested positive with qPCR of serum and blood samples; 2 out of 4 patients tested positive with qPCR of serum, blood, and blood culture (enriched) samples; and 4 out of 4 patients tested positive with dPCR of serum, blood, and blood culture (enriched) samples. The data indicate that while blood culture enrichment does improve detectability using qPCR, digital PCR has increased sensitivity across sample types.[000189] For the primers targeting the ITS1 region (ApilTSl), the data show 4 out of 4 patients tested positive with qPCR in serum, blood, and blood culture (enriched) samples. For qPCR detection using primers targeting the ITS1 region, multiple blood samples were required to provide sufficient target sample for detection. The data demonstrate that the ITS1 region is a superior target for Babesia detection using qPCR amplification compared to 18S primers.[000190] FIG. 8 is a plot showing the number of positive test results in FIG. 7 for PCR reactions targeting the 18S rRNA region and PCR reactions targeting the ITS 1 region. The data show that for reactions targeting the 18S rRNA region, 4.5% of serum and blood sample aliquots tested positive by qPCR; 11.5% of serum, blood, and blood-culture sample aliquots testedWSGR Docket No. 68706-704.601 positive by qPCR; and 61.5% of serum, blood, and blood-culture sample aliquots tested positive by dPCR. The data show that dPCR significantly improves detection sensitivity compared to qPCR.[000191] The data also show that aliquots testing positive using qPCR reactions targeting the ITS1 region are significantly higher than the number of positive blood sample aliquots detected using primers targeting the 18S rRNA region. The data show that the ITS1 region is a superior target for detection of Babesia using qPCR amplification.[000192] The data also show that culture enrichment of a blood sample prior to pathogen detection improves the likelihood of detecting the pathogen in a patient sample.[000193] The data shown in FIG. 7 and FIG. 8 indicate that the use of cultured blood samples may be used to increase the number of organisms present in a sample for subsequent detection. To assess the impact of culturing a blood sample prior to pathogen detection, two different blood sample sets were evaluated using primers targeting the ITS1 region (ApilTSl). A first blood sample set n = 79 (obtained from the Bay Area Lyme Foundation Biobank) was evaluated without culturing; a second blood sample set n = 82 (obtained from an IRB study group from NCSU) was evaluated without culturing and with culturing.[000194] FIG. 9A is a summary table 900 showing Babesia detection in n = 79 uncultured blood samples using ITS region primers (APilTSl) for amplification.[000195] FIG. 9B is a summary 920 showing Babesia detection in n = 82 uncultured and cultured blood samples using ITS region primers (APilTSl) for amplification.[000196] Referring now to FIG. 9A and FIG. 9B, the data show that using blood culturing to increase the levels of organism in a sample (i.e., enrich the sample) increases detection of Babesia by about four-fold (4X).Development of Babesia ITS 1 species-specific primers and probes[000197] After DNA sequence analysis of PCR amplicons from Babesia odocoilei positive animal blood specimens, from Babesia diver gens -like MO-I, from Babesia duncani isolate J3, and from Babesia microti isolate GI, the following species-specific primers and probes for amplification of the ITS1 region were designed and subsequently tested for amplification specificity:Babesia divergens ITS1 target region (225bp):Primer BdivergensITS 1 -25s: 5’ CTCGGCTTCGACATTTACGTTGTGTAAGCT 3’Primer BdivergensITS 1 - 150as: 5 ’ CAACTAC AGTAGTTACACCGYAGTAARC ATAC3'Probe BdivergensITS 1 -70: 5’ HEX CTTTTKGTGGTTTCGTATTTGYCGTTG BHQ2 3’ Babesia duncani ITS1 target region (170bp):WSGR Docket No. 68706-704.601Primer BduncaniTSl-ls: 5’ GTGTTTAAACCGCGCTTATGCGCAGGTC 3’Primer BduncaniTSl-130as: 5’ CTGCACTGGCGGGGTGAAAAGTAAC 3’Probe BduncamTS 1-80: 5’ Cy5-TGGCTTTGCGGTTCGCCGTACGGCCCC-BHQ3 3’Babesia microti ITS1 target region (185bp):Primer BmicrotilTS 1 -25 s : 5 ’ TATC AGAGTTCTTTGTATCC C ATTTGGGTTA 3 ’Primer BmicrotilTS 1-160as: 5’ GAAAATACCTTGGGAGTGAGAACGCCCCGT 3'Probe BmicrotilTS 1-70: 5’ CalFluoRed590-AGAAGAGTGGCCTTGGACGTAG-BHQ2 3’Babesia odocoilei ITS 1 target region (150bp):Primer BodocoITSla-lOOs: 5’ CTGTTGCACTTTTGTGCTTGACGTTGT 3’Primer BodocoITS la-255 as: 5’ CAAGCGCAGGGATGGAAACGGA 3’Probe BodocoITSla-200probe: 5’ FAM-GGCCTCGTCATGGCGACGTGGT - BHQ1 3’ [000198] For both TaqMan probes and SYBR green-based qPCR, species-specific ITS1 amplification was detectable at levels of 10’2(for B. microti and B. odocoilei) and 10'1(for B. diver gens and B. duncani) copies per microliter at each of the four targeted Babesia sp. Amplicons of the lowest DNA concentration detected generated good quality chromatograms with sequences that matched the targeted Babesia sp. Melting curves analyses for each species by SYBR green PCR. generated peaks at 89.5°C to 90° for B. odocoilei. 86.5°C for B. divergens, 89°C for i?, duncani, 88.5° C for / ?, microti.[000199] FIG. 10A is a screenshot of sequence alignments of B. odocoilei ITS 1 sequence region.[000200] FIG. 10B is a screenshot of sequence alignments of B. divergens ITS 1 sequence region.[000201] FIG. 10C is a screenshot of sequence alignments of B. duncani ITS 1 sequence region. Note that no B. duncani ITS1 region was available from the Genbank database.FIG. 10D is a screenshot of sequence alignments of B. microti ITS1 sequence region. Assessment of species-specific amplification for cross-amplification of non-target species No qPCR cross-amplification using either TaqMan probes or SYBR Green based assays was observed when B. divergens, B. duncani, B. microti and B. odocoilei species-specific primers and probes were tested against DNA extracted from B. vulpes, B. odocoilei, B. canis, B. vogeli, B. coco, B. gibsoni, B. lengau, B. felis, B. conradae infected animal blood specimens or when tested against B. microti. B. divergens, B. odocoilei. or B. duncani plasmid based DNA. Results are summarized in Table 3.WSGR Docket No. 68706-704.601Detection of Babesia species in infected human samples[000202] A group of 82 human research subjects were tested for an assay validation study. In this group, 22 subjects were determined to be infected with one or more Babesia species. Amplicon DNA sequence analysis of qPCR products targeting the Babesia ITS1 and / or Babesia ITS2 regions, identified the presence of single infection with Babesia divergens in 7 individuals, B. microti in 2 individuals, and B. odocoilei in 7 individuals. As a result of analyzing different samples (different time points within 7-day blood collections or blood vs 7,14. or 21 -day culture samples) from the same individuals, Babesia coinfection was detected in six individuals: 2 individuals infected with B. divergens and B. microti, 3 individuals infected with B. divergens and B. odocoilei, and 1 individual infected with B. microti and B. odocoilei. The results are summarized in Table 4. Of the 22 infected individuals, 27% were infected with more than one species of Babesia.[000203] For many of these individuals, the same Babesia species was detected at different blood sampling time points. Sequence analysis of some qPCR products obtained from people where coinfection was documented, indicated the presence of mixed sequencing chromatograms, usually double peaks with one chromatogram as a low signal as shown in Figure 1 lx, indicating the potential for alternative allele sequences.[000204] FIG. 11 is screenshot of an example of a mixed sequencing chromatogram that may indicate the potential for alternative allele sequences. In this example, the sequencing chromatogram for sample 20468C21 amplicon from a human patient obtained by Babesia ITS1 amplification is shown. The chromatogram shows the presence of overlapping sequencing chromatograms (double peaks) indicating potential alternative allele sequences due to coinfection. Coinfection was confirmed as B. divergens and B. odocoilei using species-specific ITS probes. In order to assess if these amplicons indicated coinfection with more than one Babesia sp. (beyond the primary species previously identified by qPCR and DNA sequencing), a single-plex species-specific real-time PCR was performed.[000205] Using a qPCR single-plex assay targeting amplification of the four Babesia sp., coinfection with more than one Babesia sp. was confirmed by DNA sequencing, as these patient samples contained alternative allele sequences. For other individuals the single-plex assay amplified sequences of the same species (i.e. B. diver gens or B. odocoilei) previously identified by the Babesia ITS1 or ITS2 amplification, Babesia odocoilei was the “secondary” co-infecting species identified by species-specific ITS1 region amplification in all 8 individuals, with amplifications of very high threshold cycle (Ct) values (>37 to over 40 total cycles), indicating a very low level parasitemia. Coinfection with B. divergens and B. odocoilei was most frequentlyWSGR Docket No. 68706-704.601 detected (7 of 8 individuals), as illustrated by the patient depicted in Figure llx (for enrichment culture sample 20468C21). Another individual was co-infected with B. microti and B. odocoilei. [000206] Babesia sequences of amplicons (ITS1 and ITS2) obtained from these individuals has been deposited in the GenBank database under the following accession numbers: B. odocoilei'. PP693407, PP693408, PP693409, PQ452565, PQ452566, PQ452567, PQ452568, PQ452569, PQ452570. PP550653. PP550654, PP550655, PP550656, PP550657, PP550658, PP550659, PP550660. PP550661. PP592351, PP550644, PP550645, PP550646, PP550647, PP550648, PP550649, PP550650, PP550651, PP550652, PQ452561, PQ452562, PQ452563, PQ452564 ; B. divergens : PQ404846, PQ404847, PQ404848, PP693420, PP693421, PP693422, PP693423, PP693424, PP693425, PP693426, PQ452546, PQ452547. PQ452548, PQ394580, PQ459266, PQ459267. PQ459268, PQ459269, PQ459270, PQ459271, PQ459272. PQ459273. PQ459274, PQ459275 ; B. microti : PQ459008, PQ459009, PQ459010, PQ459011, PQ459012, PP693410, PP693411, PP693412, PP693413, PP693414, PP693415, PQ452571, PQ452572, PP693416, PP693417, PP693418, PP693419, PQ452549, PQ452550, PQ452551, PQ452552, PQ452553, PQ452554. PQ452555, PQ452556, PQ452557, PQ452558, PQ452559, PQ452560. PQ459293, PQ459262, PQ459263, PQ459264, PQ459265.[000207] Surprisingly, Babesia duncani DNA was not amplified as a single or coinfection in any of the 226 human patient samples analyzed in this study. This observation indicates that speciation results do not match expected findings predicted from current knowledge.[000208] FIG. 12A is a summary table 1200 showing a ranking for an expected incidence of Babesia detected and sequenced.[000209] FIG. 12B is a summary 1220 showing the observed incidence of Babesia detected and sequenced in this study.[000210] Referring to FIG. 12A and FIG. 12B, the incidence of Babesia divergens and Babesia odocoilei appear to be higher than expected.Example 2. Babesia and Bartonella spp. DNA in blood and enrichment blood cultures from subjects with chronic fatigue and concurrent neurological symptoms[000211] Human babesiosis, a disease caused by parasitic intraerythrocytic infection of red blood cells by Babesia species, is an emerging, zoonotic, tick-bome disease of increased prevalence in the USA and throughout much of the world (Schnittger L, et al., Infect Genet Evol. 2012 Dec; 12(8): 1788-809; Jia N, Zheng, et al.. Clin Infect Dis. 2018 Sep 14; 67(7): 1110- 1119; Doderer-Lang C, et al., Emerg Infect Dis. 2022 Feb; 28(2):449-452; Jahfari S, et al., PLoS Negl Trop Dis. 2016 Oct 5; 10(10):e0005042; Gonzalez LM, et al., Int J Infect Dis.;33:202-204; Saito-Ito A, et al., J Clin Microbiol. 2000 Dec; 38(12):4511-6; and Ssentongo P, et al., OpenWSGR Docket No. 68706-704.601Forum Infect Dis. 2024 Oct 8;l l(10):ofae504, which are incorporated herein by reference in their entirety). The infection is caused by members of the genus Babesia of the order Piroplasmida (Apicomplexa phylum), a genera comprised of over 100 species of which at least 8 species or sub-species have been described on the basis of DNA sequence evidence infecting people (Calchi AC, et al., Pathogens. 2024 Dec;13(12), which is incorporated herein by reference in its entirety). Acute human babesiosis is predominantly characterized by symptoms and clinical findings that include fatigue, fever, sweating, chills, generalized myalgia, sleep disorders, and hepatosplenomegaly. Severe symptoms such as hemolytic anemia and neurological complications (including headache, syncope, neuropathy, confusion, vertigo, and coma), have been reported, most frequently in patients with comorbidities such as immunodeficiencies (splenectomy, infection with HIV / AIDS, or patients receiving immunosuppressive drugs), diabetes, cancer, chronic heart, lung, renal, or liver diseases (Locke S, et al., Emerg Infect Dis. 2023 Jun; 29(6): 1127-35; Garcia HH, et al., Neuroparasitology and tropical neurology. Edinburgh; Philadelphia: Elsevier; 2013; Aikawa M et al., Mem Inst Oswaldo Cruz. 1992;87 Suppl 3:297-301; and Usmani-Brown S, et al., Handb Clin Neurol. 2013; 114: 199-203, which are incorporated herein by reference in their entirety).[000212] Neurobartonelloses represent a broad spectrum of neurological diseases caused by infection with a Bartonella species (Bush JC et al., Parasites & Vectors. 2024 Oct 5; 17(1):416, which is incorporated herein by reference in its entirety). Historically, various neurological presentations were reported as atypical manifestations of Cat Scratch Disease (CSD), caused by B. henselae. More recently, fatigue and chronic neurological symptoms have been reported in people who lack a history of fever, lymphadenopathy, and cat contact (CSD). Seizures, encephalitis, transverse myelitis, peripheral neuropathy (Gillian-Barre syndrome), psychoses, and schizophrenia have been associated with Bartonella infections. Like infection with Babesia species, healthy individuals and blood donors can be occultly infected, which complicates the medical assessment of the role or importance of these infections when confirmed in individual patients. Also, like babesiosis, bartonellosis, first recognized in North America among immunocompromised HIV-infected individuals with bacillary angiomatosis, has been diagnosed in patients in association with splenectomy, organ transplantation recipients, and patients receiving immunosuppressive drugs (Bullard RL, et al., PloS One. 2024; 19(2):e0297280; and Cheslock MA, et al., Trop Med Infect Dis. 2019 Apr 19;4(2):69, which are incorporated herein by reference in their entirety). Immunosuppression down regulates the suppression of these intracellular organisms resulting in enhanced PCR detection in blood and at times potentiation of the patient’s illness. Based upon survey questionnaire responses, no individual infected withWSGR Docket No. 68706-704.601Babesia, Bartonella or both genera in this study reported infection with AIDS, having had a splenectomy, or had a concurrent diagnosis of diabetes or active cancer.Retrospective study to determine prevalence of Babesia and Bartonella spp. coinfection [000213] Using recently developed and validated Babesia and Bartonella molecular assays (e.g., qPCR and dPCR), in conjunction with enrichment blood culture, the prevalence of Babesia spp. DNA was retrospectively evaluated in research participants previously tested for evidence of Bartonella spp. infection.Study population[000214] As reported in prior case reports and case series (Breitschwerdt EB, et al., J Cent Nerv Syst Dis. 2025; 17: 11795735251322456; Breitschwerdt EB, et al., Pathogens. 2025 Jan 23;14(2); Maggi R, et al., Parasites & Vectors. 2024 Jul 11; 17(l);302; Lashnits E. et al.. Vector Borne Zoonotic Dis. 2021 Jun; 21 (6):413-21 ; Portillo A, et al., Pathogens. 2020 Mar 4:9(3); Breitschwerdt EB, et al., Pathogens. 2020 Dec 4; 9(12); Breitschwerdt EB, et al., Vector Borne Zoonotic Dis. 2019 Apr; 19(4):234-41; and Oteo JA, et al., Parasites & Vectors. 2017 Nov 7; 10(1)553, which are incorporated herein by reference in their entirety), individuals previously tested for Bartonella spp. infection as a component of an Institutional Review Board (IRB) approved study entitled: Detection of Bartonella Species in the Blood of People with Extensive Animal Contact (North Carolina State University Institutional Review Board, IRB#s 4925-03 and 164-08-05) were retrospectively tested for DNA evidence of Babesia spp. infection. Questionnaires previously completed by study participants between March 2024 and February 2020 underwent a blinded sequential review' to select individuals 'ho satisfied entry criteria for this current study. The standardized questionnaire included: age, gender, animal and arthropod exposure, outdoor activity, travel, clinical symptoms, duration of illness, and co-morbid conditions. Participants were selected for study entry if they met the two following inclusion criteria: (1) based upon study questionnaire responses, they had experienced fatigue or chronic fatigue for a duration of at least six months and (2) they had reported (on a questionnaire checklist) one or more neurological symptoms, specifically including the following: difficult remembering, disorientation, irritability, rage, aggression, difficulty sleeping, seizures, tremors, headache, mental confusion, hallucinations, anxiety / panic attacks. Although duration of illness varied among individuals, as did prior diagnostic evaluations and previous treatments, these factors were not criteria for study inclusion or exclusion. Failure to report fatigue for at least six months duration or not experiencing neurological symptoms were exclusion criteria. Having been tested for serological or molecular evidence of Bartonella spp. infection, fifty individuals meeting the inclusion criteria were evaluated retrospectively for DNA evidence of Babesia spp.WSGR Docket No. 68706-704.601 infection. The individual reviewing the questionnaires for case selection and the individuals performing the molecular testing were blinded to prior Bartonella test results.Sample collection[000215] Stored extracted DNA from whole blood and enrichment blood culture samples, previously processed in the Intracellular Pathogens Research Laboratory (IPRL), College of Veterinary Medicine, North Carolina State University for attempted isolation or molecular detection of a. Bartonella species, were used for Babesia spp. testing in this study. Nearly all participants had provided three blood specimens (triple blood draw) collected within a 7-day period. Babesia PCR testing was performed using DNA extracted from blood and from the respective 7-, 14- and 21-day enrichment blood cultures. The culture and molecular testing approach used in this study was as previously described in Maggi R, et al., Parasites & Vectors. 2924 Jul 11 ; 17(l):302; Lashnits E, et al.. Vector Borne Zoonotic Dis. 2021 Jun;21(6):413-21; and Portillo A, et al., Pathogens. 2020 Mar 4:9(3) with minor modifications.[000216] Briefly, DNA extracted from blood and enrichment blood cultures (sampled at 7, 14, and 21 days of culture) were screened for Babesia spp. amplification using quantitative real-time PCR (qPCR) targeting the 18SrRNA-5.8SrRNA intergenic spacer (ITS) region (see Maggi R, et al., Parasites & Vectors. 2924 Jul 11 ; 17(l):302). Primers and probes used for the amplification and identification of Babesia divergens, Babesia duncani, Babesia microti, and Babesia odocoilei intergenic spacer (18SrRNA-5.8SrRNA) are shown in Table 7. Babesia genus and species-specific primers were used as described in Maggi R, et al., Parasites & Vectors. 2924 Jul 1 l ;17(l):302; and Calchi AC, et al., Pathogens. 2024 Dec;13(12).[000217] Real-time qPCR amplification of the Babesia ITS1 region was performed in a 25 pL reaction composed (per reaction) of 7.5 pL of molecular-grade water (QIAGEN, Germantown MD). 12.5 pl of 2X SsoAdvanced SYBR green master mix (Bio Rad. Hercules, CA, USA), 0.2 pL of 100 pM each oligonucleotide primers, and 5pL of extracted DNA (used as template). Molecular-grade water and DNA extracted from naive human blood samples were used as PCR negative controls. Pre-characterized blood DNA samples extracted from clinical cases of dogs infected with Babesia gibsonii were used as positive control templates. This species was selected not just for assessing PCR performance, but also to assess potential contamination / carry-over of Babesia DNA among patient samples during DNA amplification. Amplification was performed in a Bio-Rad CFX 96-well Opus PCR system machine under the following conditions: 95°C for 3 min, followed by 40 cycles of denaturing at 94°C for 15 s, annealing at 68°C for 15 s. and extension at 72°C for 15 s. An additional gradient cycle from 65°C to 95°C was performed for melting curve analysis. Quantification cycle (Cq) values andWSGR Docket No. 68706-704.601 melting temperature analysis were performed by reading fluorescent signals using the SYBR / FAM. HEX, Texas-Red / TAMRA, and Cy5 fluorescent dye channels.[000218] Amplified DNA products were punfied and sequenced by Sanger’s method. Sequences were analyzed using Clustal W multi-sequence alignment (AlignX, Vector NTI Advanced 10.3.0 from Invitrogen) and compared to sequences with previously deposited in the GenBank database using AlignX software (Vector NTI Suite 6.0, InforMax, Inc.).Study results: Identification of Babesia and / or Bartonella species in individuals experiencing chronic fati ue, myalgia, and neurological symptoms[000219] Between March 2024 and February 2020, 173 individuals (20 from 2024, 31 from 2023, 45 from 2022, 42 from 2021, and 35 from 2020) were previously tested for serological and molecular evidence of Bartonella spp. infection. For this study, 50 individuals, identified by retrospective questionnaire review, satisfied the entry criteria. There were 14 males and 36 females, ranging in age from 21 to 70 years, with a median age of 44 years. Of the 50 participants, 49 of 50 were White (one identified as Asian). Overall demographic participation included individuals from six different countries (Denmark. France, Israel, Mexico, United Kingdom, and the United States), with one individual from Denmark, France, Israel, and the United Kingdom, two from Mexico, and 44 from the United States. One participant from Ohio, and one participant each from Mexico, Michigan, North Carolina were previously included in two published studies, respectively (see Breitschwerdt EB, et al., Pathogens. 2025 Jan 23;14(2); Maggi R. et al., Parasites & Vectors. 2024 Jul 1 E17(l):302). Within the United States. 21 different states are represented, with most participants coming from North Carolina (nine individuals), California (four individuals), Illinois (four individuals), and Ohio (four individuals).[000220] Infection with Babesia, Bartonella, or Babesia and Bartonella coinfection were identified by DNA amplification in 23 of the 50 study participants (46%). Using Apil8S rRNA- 1690s and Api5.8SrRNA-20as (as forward and reverse primers), qPCR DNA amplification of the Babesia ITS1 region generated a single 450-650bp band consistent with the expected DNA sizes (depending on species) for each of the three identified Babesia species. Similarly, using species specific primers and probes, qPCR DNA amplification of the Babesia species-specific ITS1 region generated a single 150-225bp band consistent with the expected DNA sizes (depending on species) for each of the three Babesia species. The primers and probes used for the amplification and identification of B. divergens, B. duncani, B. microti, and B. odocoilei intergenic space (18SrRNA-5.8SrRNA) are shown in Table 7. Species and sequence homologies in the 12 participants where Babesia DNA was detected are shown in Table 8.WSGR Docket No. 68706-704.601[000221] Of the 50 human research subjects, 12 (24%) were infected with one or more Babesia species and 13 (26%) were infected with one or more Bartonella species. FIG. 13A is a pie chart showing the prevalence of Babesia species identified in the 12 individuals (out of 50 total participants) experiencing chronic fatigue and neurological symptoms. Abbreviations are B. micro'. Babesia microti,' B. odo: Babesia odocoilei. FIG. 13B is a pie chart showing the prevalence of Bartonella species identified in the 13 individuals (out of 50 total participants) experiencing chronic fatigue and neurological symptoms. Abbreviations are Blr Bartonella henselae; Bq: Bartonella quintana. Included in these counts are two participants who were coinfected with both a Bartonella and Babesia spp. ; one participant was co-infected with B. quintana, B. henselae and B. odocoilei, while the other individual was co-infected with B. henselae. B. odocoilei. and B. microti. Babesia and Bartonella DNA were not amplified from blood, serum or enrichment blood cultures from 27 (54%) individuals. Difficulty remembering, headaches, insomnia, anxiety and irritability' were the most frequently reported neurological symptoms among participants who were infected with either Babesia, Bartonella, Babesia and Bartonella, or tested PCR negative for Babesia and Bartonella DNA. The five most frequent neurological symptoms reported by participants (n=50) who were infected with either Babesia, Bartonella, Babesia and Bartonella, or tested PCR negative for Babesia and Bartonella DNA are shown in Table 9.[000222] Amplicon DNA sequence analysis of qPCR products or probe-based species-specific qPCR targeting the Babesia ITS1 region confirmed infection with Babesia microti in four individuals (33%), Babesia divergens-Xi e in three individuals (25%), B. odocoilei in two individuals (17%), and co-infection with B. microti and B. odocoilei in two individuals (17%). The number of Babesia positive individuals per DNA sample source is shown in Table 10. For some individuals, Babesia DNA was detected in more than one sample t pe from the same individual (i.e., DNA amplified from whole blood and from one or more blood enrichment culture at 7, 14, or 21 days. For one individual (8%), the Babesia species (participant 40, Table 4) could not be accurately determined due to a short, yet good quality ITS 1 DNA sequence that was a 70% match with B. odocoilei. Interestingly, B. microti and B. divergens detection occurred most often following enrichment blood culture, whereas B. odocoilei DNA was only amplified from blood. Babesia duncani was not amplified from blood, serum, or enrichment blood cultures from any of the 50 individuals included in this study. From these 50 individuals, B. gibsonii DNA (used as positive amplification control) was not detected in any of the 586 blood or enrichment blood culture DNA extraction samples tested from these 50 individuals. Similarly, no Babesia or Bartonella DNA was ever amplified from any DNA extraction or blood cultureWSGR Docket No. 68706-704.601 negative controls, which were processed concurrently each time the enrichment blood culture was performed.[000223] Of the Bartonella spp. infected participants, 1 participant was co-infected with both B. henselae and B. quintana (8%). Additionally, B. henselae DNA was amplified from blood or enrichment blood cultures from 9 individuals (69%), and B. quintana, B. koehlerae and an uncharacterized Bartonella spp. from 1 individual each (8%). Bartonella henselae and B. quintana DNA were amplified variably from blood or enrichment blood cultures incubated for 7,14, and 21 days, while B. koehlerae and the uncharacterized Bartonella were amplified from blood only. The number of Bartonella positive individuals per DNA sample source is shown in Table 11. For some individuals, Bartonella DNA was detected in more than one sample type from the same individual (i.e., DNA amplified from blood and from one or more blood enrichment culture at 7, 14, or 21 days).[000224] Individuals infected with Babesia microti resided in North Carolina (two individuals), Michigan (one individual), and Ohio (one individual). Individuals infected with Babesia diver gens -like MO-1 resided in Ohio (two individuals), and Illinois (one individual). Individuals infected with Babesia odocoilei resided in Mexico (one individual) and Ohio (one individual). The individual for which the Babesia species was not determined resided in North Carolina. There w ere two individuals co-infected with two Babesia species, both being co-infected with Babesia odocoilei and Babesia microti, they resided in North Carolina and Oregon. Travel histories varied among all study participants.[000225] Participants infected with Bartonella henselae resided in Denmark (one individual), North Carolina (three individuals), Mexico (one individual), Florida (one individual), Utah (one individual), California (one individual), and Nebraska (one individual). The one participant infected with Bartonella quintana resided in France, while the participant infected with Bartonella koehlerae resided in Texas, and the participant infected with the uncharacterized Bartonella resided in Louisiana. The Bartonella co-infected participant was from Mexico and was infected with both Bartonella quintana and Bartonella henselae.[000226] Diagnostic sensitivity for the detection of Babesia and Bartonella DNA is a major consideration when assessing infection by blood and enrichment blood culture testing. While Babesia odocoilei was detected only following blood DNA extraction, infection with Babesia diver gens -like MO-1 and Babesia microti were most often confirmed after blood enrichment culture for 7 to 21 days (see Table 10). Similarly, while Bartonella koehlerae was detected in the blood of a single individual, most Bartonella infection was confirmed after enrichment blood culture for 7 to 21 days (see Table 11).WSGR Docket No. 68706-704.601[000227] DNA amplification, using various molecular methods, has become the preferred methodology for the diagnosis of babesiosis and bartonellosis. In contrast to serology’, DNA amplification (e.g., PCR) provides direct evidence of infection as described in Maggi RG, et al.. Parasites & Vectors; 2024 Jul 11; 17(l):302 and Calchi AC, et al., Pathogens; 2024 Dec; 13(2). Further, previous studies have documented increased sensitivity’ for the diagnosis of bartonellosis when enrichment blood culture was combined with qPCR or dPCR testing and when three rather than one blood specimen was obtained within a 7-day period (see Breitschwerdt EB, et al., J Cent Nerv Syst Dis. 2025; 17: 1 1795735251322456; Portillo A, et al.. Pathogens. 2020 Mar 4:9(3); Breitschwerdt EB, et al., Pathogens. 2020 Dec 4; 9(12); Oteo JA, et al., Parasites & Vectors. 2017 Nov 7; 10(1)553; Calchi AC, et al., Pathogens; 2024 Dec; 13(2); and Breitschwerdt EB. et al.. J Cent Nerv Syst Dis. 2019; 11 : 1179573519832014; Lantos PM. et al., Vector Bome Zoonotic Dis. 2014 Aug; 14(8): 563-70; Maggi RG, et al., J Microbiol Methods. 2020 Sep; 176-106022; Mozayeni BR, et al., Medicine. 2018 Apr; 97(17):e0465;Balakrishnan N, et al., Parasites & Vectors. 2016; 9(1):254; Perez Vera C, et al., Comp Immunol Microbiol Infect Dis. 2013 Sep; 36(5):481-7; Mascarelli PE, Parasites & Vectors. 2013 Apr 15; 6(1):98, which are incorporated herein by reference in their entirety). Three blood collections within a 7-day period were provided by individuals entering our Bartonella spp. research study (i.e., individuals in this study previously tested for evidence of Bartonella spp. infection). DNA extracted from blood, serum, and three 7-day, 14-day and 21-day enrichment blood cultures generated fifteen samples for qPCR and dPCR testing per study participant. Rarely were there more than three or four of the fifteen DNA extractions from a patient PCR positive. Due to enhanced sensitivity, dPCR positivity’ consistently exceeded qPCR positivity’ (data not shown). The low parasitemia and bacteremia associated with these two genera impairs diagnostic sensitivity, thereby hindering acquisition of an accurate diagnosis. Among many others, two case reports illustrate the diagnostic complexity associated with these chronic intravascular infections. Firstly, infection with Bartonella henselae, Babesia odocoilei, and Babesia divergens- i ebMO- w as documented in an 8-year-old boy from Canada by PCR amplification and sequencing of DNA extracted from blood and enrichment brain biopsy cultures (see Breitschwerdt EB. et al.. J Cent Nerv Syst Dis. 2025; 17: 11795735251322456). Secondly, based upon molecular testing results, five family members (father, mother, two daughters and a son) and a pet dog were infected with Babesia diver gens -like MO-1, both parents were infected with Babesia microti, and all family members, both pet dogs, and fleas from one pet rabbit w ere infected with Bartonella (B. quintana and / or B. henselae, or an undetermined Bartonella species) (see Breitschwerdt EB, et al., Pathogens. 2025 Jan 23; 14(2)).WSGR Docket No. 68706-704.601[000228] The data show n here are from a retrospective study of a heterogeneous group of individuals, who were seeking Bartonella spp. research testing due to chronic symptoms. Testing was limited to two genera and documentation of Babesia, Bartonella or DNA of both genera and does not confirm causation for the fatigue or neurological symptoms that were selfreported. Based upon the predetermined study design, four of the 12 Babesia infected individuals in this study were included from two prior publications (see Breitschwerdt EB. et al., J Cent Nerv Syst Dis. 2025; 17: 11795735251322456; and Maggi RG, et al.. Parasites & Vectors; 2024 Jul 1 1 ; 17(1 ): 302). Repeat testing redocumented infection with B. odocoilei in two of three individuals and B. diver gens -like MO-1 in one individual, as previously reported (see Maggi RG, et al., Parasites & Vectors; 2024 Jul 11; 17(1): 302). By testing multiple blood, serum and enrichment blood culture time-points with different ITS PCR primers, infection was confirmed in two previously reported B. odocoilei infected individuals (see Maggi RG, et al.. Parasites & Vectors; 2024 Jul 11; 17(l):302).[000229] The study data show that using targeted qPCR amplification and DNA sequencing, infection with Babesia spp., Bartonella spp. or both genera were confirmed in 10, 11, and 2 individuals reporting fatigue and neurological symptoms, respectively. Importantly, the overall study cohort (n=173) from whom the fifty7participants were retrospectively identified, was extremely heterogenous. The only entry criteria involved reporting a history of animal contact or arthropod exposure in addition to experiencing fatigue of at least six months duration in conjunction with variable neurological symptoms. Among participants. 23 / 50 (46%) individuals were infected with Babesia, Bartonella or both genera. This suggests that infection or coinfections with these genera may represent a more compelling cause of sustained fatigue and neurological abnormalities than is currently supported by medical literature. Similarly, frequent, non-specific neurological symptoms were reported amongst the four groups, with anxiety and irritability reported more often by individuals infected with a Bartonella species.[000230] While the foregoing disclosure has been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the disclosure. For example, all the techniques and apparatus described above can be used in various combinations. All publications, patents, patent applications, and / or other documents cited in this application are incorporated by reference in their entirety7for all purposes to the same extent as if each individual publication, patent, patent application, and / or other document were individually and separately indicated to be incorporated by reference for all purposes.WSGR Docket No. 68706-704.601Table 1. Piroplasm sp., animal source, case identification and GenBank Accession number for the intergenic transcribed spacer regions between 18S rRNA and 5.8S rRNA (ITS1) and 5.8S rRNA and 28S rRNA (ITS2)WSGR Docket No. 68706-704.601Table 2. Babesia species specificity assessment and cross-amplification results with otherBabesia species for ITS1 assay. Note: “original” refers to blood DNA from precharacterized clinical infected sampleWSGR Docket No. 68706-704.601Table 3. Babesia species detected in 22 of 82 individuals tested.WSGR Docket No. 68706-704.601Table 4. Detection of plurality of species of the fastidious microorganismsTable 5. Treatment option based on species of the fastidious microorganismWSGR Docket No. 68706-704.601Table 6. Nucleic acid sequence for the primer and probe described hereinWSGR Docket No. 68706-704.601Table 7. Primers and probes used for the amplification and identification of B. divergens,B. duncani, B. microti, and B. odocoilei intergenic spacer (18S rRNA-5.8S rRNA)WSGR Docket No. 68706-704.601Table 8. Species and sequence homologies in the 12 participants where Babesia DNA was detectedNote:Aspecies-specific probe signal detected but no sequence available; * partial readable sequenceTable 9. The five most frequent neurological symptoms reported by participants (n=50) who were infected with either Babesia, Bartonella, Babesia and Bartonella, or tested PCR negative for Babesia and Bartonella DNAWSGR Docket No. 68706-704.601Table 10. Number of Babesia positive individuals per DNA sample source. Note: for some individuals Babesia DNA was detected in more than one sample type from the same individual (i.e., DNA amplified from blood and from one or more blood enrichment culture at 7, 14, or 21 days)Table 11. Number of Bartonella positive individuals per DNA sample source. Note: for some individuals Bartonella DNA was detected in more than one sample type from the same individual (i.e., DNA amplified from blood and from one or more blood enrichment culture at 7, 14, or 21 days)

Claims

1. WSGR Docket No. 68706-704.601CLAIMSWhat is claimed is:

1. A method for detecting a fastidious microorganism in a sample, the method comprising: amplifying a conserved nucleic acid sequence shared by a genus of the fastidious microorganism; amplifying a nucleic acid sequence unique to a species of the fastidious microorganism; and identifying the genus and the species of the fastidious microorganism based on amplification products of the conserved nucleic acid sequence shared by the genus and the nucleic acid sequence unique to the species of the fastidious microorganism.

2. The method of claim 1, wherein the amplifying the conserved nucleic acid sequence comprises performing PCR.

3. The method of claim 2, wherein the PCR comprises conventional PCR (cPCR), quantitative PCR (qPCR), or digital PCR (dPCR).

4. The method of claim 3, wherein the PCR is performed with a primer for targeting the conserved nucleic acid sequence.

5. The method of claim 4, wherein the conserved nucleic acid sequence encodes an RNA.

6. The method of claim 5, wherein the RNA comprises ribosomal RNA (rRNA).

7. The method of claim 6, wherein the rRNA comprises 18S rRNA, 5.8S rRNA, 28S rRNA, or a combination thereof.

8. The method of claim 4, wherein the primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of SEQ ID NOs: 1-6.

9. The method of claim 4, wherein the primer is a nucleic acid sequence that is any one of SEQ ID NOs: 1-6.

10. The method of claim 4, wherein the primer comprises a nucleic acid sequence comprising at least 10, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of SEQ ID NOs: 1-6.

11. The method of any one of claims 1-10, wherein the nucleic acid sequence unique to the species of the fastidious microorganism comprises at least one internal transcribed spacer (ITS).

12. The method of claim 11, wherein the at least one ITS sequence is located between two rRNA of the fastidious microorganism.

13. The method of claim 12. wherein the at least one ITS sequence is between 18S rRNA and 5.8S rRNA or 5.8S rRNA and 28S rRNA.WSGR Docket No. 68706-704.60114. The method of any one of claims 1-13, wherein the amplifying the nucleic acid sequence unique to the species of the fastidious microorganism comprises performing a second PCR.

15. The method of claim 14, wherein the second PCR comprises conventional PCR (cPCR), quantitative PCR (qPCR), or digital PCR (dPCR).

16. The method of claim 15, wherein the second PCR is performed with a second primer for targeting the nucleic acid sequence unique to the species of the fastidious microorganism.

17. The method of claim 16. wherein the second primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of SEQ ID NOs: 11-18.

18. The method of claim 16, wherein the second primer is a nucleic acid sequence that is any one of SEQ ID NOs: 11-18.

19. The method of claim 16, wherein the second primer comprises a nucleic acid sequence comprises at least 10, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of SEQ ID NOs: 11-18.

20. The method of any one of claims 14-19, wherein the second PCR quantifies a parasitemia in a subject infected by the fastidious microorganism.

21. The method of any one of claims 1-20, further comprising targeting the amplification of the nucleic acid sequence unique to the species of the fastidious microorganism with a probe.

22. The method of claim 21, wherein the probe targets the nucleic acid sequence unique to the species of the fastidious microorganism.

23. The method of claim 21 , wherein the probe comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of SEQ ID NOs: 21-25.

24. The method of claim 21. wherein the probe is a nucleic acid sequence that is any one of SEQ ID NOs: 21-25.

25. The method of claim 21, wherein the probe comprises a nucleic acid sequence that is at least 10, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of SEQ ID NOs: 21-25.

26. The method of any one of claims 1-25, further comprising treating a subject infected by the fastidious microorganism.

27. The method of claim 26, wherein the treatment is determined based on identification of the species of the fastidious microorganism.

28. The method of claim 26. wherein the treatment is determined based on a parasitemia of the subject infected by the fastidious microorganism.WSGR Docket No. 68706-704.60129. The method of claim 26, wherein the treatment is determined based on a size of the fastidious microorganism.

30. The method of claim 28, wherein the size of the fastidious microorganism is smaller than 2 micrometer (pm).

31. The method of claim 28, wherein the size of the fastidious microorganism is larger than 2 micrometer (pm).

32. The method of claim 30. wherein the treatment comprises atovaquone, azithromycin, clindamycin, disulfiram, doxycycline, moxifloxacin, quinine, tafenoquine, trimethoprimsulfamethoxazole, or a combination thereof to the subj ect.

33. The method of any one of claims 29-31, wherein the treatment is different for a fastidious microorganism smaller than 2 micrometer (pm) and a fastidious microorganism larger than 2 micrometer (pm).

34. The method of claim 30, wherein the treatment comprises imidocarb diproprionate.

35. The method of any one of claims 26-28, further comprising performing additional amplification for tracking fluctuation of the parasitemia in the subject infected by the fastidious microorganism.

36. The method of claim 35, wherein the additional amplification tracks the fluctuation of the parasitemia in the subject due to treatment of infection by the fastidious microorganism.

37. The method of claims 1-36, further comprising enriching the fastidious microorganism or a molecule thereof prior to the amplifying the conserved nucleic acid sequence.

38. The method of claim 37, wherein the enriching comprises culturing the fastidious microorganism in a culture medium.

39. The method of claim 38, wherein the culture medium comprises an insect or mammalian cell culture medium, and optionally comprises a supplement selected from the group consisting of P- Nicotinamide adenine dinucleotide (NAD), P-Nicotinamide adenine dinucleotide phosphate (NADPH), sodium pyruvate; adenosine 5 '-triphosphate (ATP), essential amino acids, yeast extract, sodium bicarbonate, saponin, sodium polyanethol sulfonate (SPS), and fetal, newborn, or adult, horse, ovine, bovine, rabbit, or human serum, or any combination thereof.

40. The method of claim 38, wherein the culture medium is protein-free.

41. The method of any one of claims 37-40, wherein the enriching the fastidious microorganism or a molecule thereof comprises binding to the fastidious microorganism or a molecule thereof with a trapping agent.

42. The method of claim 41. wherein the trapping agent comprises an antibody.

43. The method of claim 41 , wherein the molecule comprises an antigen associated with the fastidious microorganism.WSGR Docket No. 68706-704.60144. The method of claim 43, wherein the antigen is expressed by the fastidious microorganism.

45. The method of claim 43, wherein the antigen is complexed with the fastidious microorganism.

46. The method of claim 41, wherein the trapping agent comprises a nucleic acid binding agent.

47. The method of claim 46, wherein the nucleic acid binding agent comprises a chaotropic agent.

48. The method of claim 46 or 47. wherein the trapping agent binds to the molecule comprising a nucleic acid of the fastidious microorganism.

49. The method of any one of claims 1-48, further comprising determining at least one additional species of the fastidious microorganism by detecting at least one additional intergenic transcribed spacer (ITS) associated with that at least one additional species of the fastidious microorganism.

50. The method of any one of claims 1-49, wherein the genus comprises Babesia, Theileria, Cytauxzoon, Rangelia, or a combination thereof.

51. The method of any one of claims 1-50, wherein the species comprises B. bovis. B. bigemina. B. crassa i ke, B. divergens, B. diver gens -like, B. duncani, B. microti, B. microti-like, B. odocoilei, B. venatorum, B. motasi, B. sp. EU3, B. sp. FR1, B. sp. KOI, B. sp. XXB, B. canis, B. capreoli, B. sp. Coco, B. conradae, B. felis, B. gibsoni, B. lengau, B. negevi, B. vogeli, B. vulpes, Cytauxzoon felis. or Theileria bicornis, or a combination thereof.

52. The method of any one of claims 1-51, wherein the species of the fastidious microorganism is determined in the sample obtained from a subject.

53. The method of claim 52, wherein the subject is human.

54. The method of claim 53, wherein the subject has fatigue, myalgia, or a neurological symptom.

55. The method of claim 35 or 36, wherein a parasitemia of the fastidious microorganism is decreased in the subject compared to a second parasitemia in a host of the fastidious microorganism.

56. The method of any one of claims 1-55, wherein detection sensitivity for the fastidious microorganism is higher than that obtained by amplification at only genus level or only species level of the fastidious microorganism.

57. The method of claim 56, wherein sensitivity' for detecting the fastidious microorganism is at least two-fold, three-fold, four-fold, five-fold, six-fold, or greater than ten-fold higher than that obtained by’ amplification at only genus level or only species level of the fastidious microorganism.WSGR Docket No. 68706-704.60158. The method of any one of claims 1-57, wherein the sample comprises blood, plasma, serum, urine, cerebrospinal fluid, pleural fluid, pulmonary mucus, sputum, transudates, modified transudates, exudates, chest fluid, abdominal fluid, synovial fluid, peritoneal fluid, lymph, or effusions.

59. A method for identifying a plurality7of species of fastidious microorganisms infecting a subject, the method comprising: amplifying nucleic acid sequences from the fastidious microorganisms in a sample obtained from the subject, wherein the amplifying is performed with a primer targeting at least one intergenic transcribed spacer (ITS) sequence located between 18S rRNA and 5.8S rRNA or between 5.8S rRNA and 28S rRNA; and detecting the plurality of species of fastidious microorganisms based on the amplifying.

60. The method of claim 59, wherein the plurality of species comprises two, three, four, five, six, or more than seven species.

61. The method of claim 59 or 60, wherein the amplification of the nucleic acid sequences comprises performing PCR with the primer.

62. The method of claim 61, wherein the PCR comprises conventional PCR (cPCR), quantitative PCR (qPCR), digital PCR (dPCR), or a combination thereof.

63. The method of claim 61, wherein the primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of SEQ ID NOs: 11-18.

64. The method of claim 61 , wherein the primer is a nucleic acid sequence that is any one of SEQ ID NOs: 11-18.

65. The method of claim 61, wherein the primer comprises a nucleic acid sequence comprising at least 10, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of SEQ ID NOs: 11-18.

66. The method of any one of claims 61-65, wherein the PCR quantifies a parasitemia in the subject infected by the fastidious microorganisms.

67. The method of any one of claims 59-66, further comprising targeting the nucleic acid sequences from the at least three species of the fastidious microorganisms with a probe.

68. The method of claim 67, wherein the probe comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of SEQ ID NOs: 21-25.

69. The method of claim 67. wherein the probe is a nucleic acid sequence that is any one of SEQ ID NOs: 21-25.WSGR Docket No. 68706-704.60170. The method of claim 67, wherein the probe comprises a nucleic acid sequence comprising at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of SEQ ID NOs: 21-25.

71. The method of any one of claims 59-70, further comprising tracking fluctuation of a parasitemia in a subject infected by the fastidious microorganisms.

72. The method of claim 71, wherein the fluctuation of the parasitemia in the subject is due to treatment of infection by the fastidious microorganisms.

73. The method of any one of claims 59-72, further comprising enriching the fastidious microorganisms or a molecule thereof by culturing the fastidious microorganisms in a culture medium.

74. The method of claim 73. wherein the culture medium comprises an insect or mammalian cell culture medium, and optionally comprises a supplement selected from the group consisting of - Nicotinamide adenine dinucleotide (NAD), 0-Nicotinamide adenine dinucleotide phosphate (NADPH), sodium pyruvate; adenosine 5 '-triphosphate (ATP), essential amino acids, yeast extract, sodium bicarbonate, saponin, sodium polyanethol sulfonate (SPS), and fetal, newborn, or adult, horse, ovine, bovine, rabbit, or human serum, or any combination thereof.

75. The method of claim 73, wherein the culture medium is protein-free.

76. The method of any one of claims 59-75, further comprising binding to the fastidious microorganisms or a molecule thereof with a trapping agent.

77. The method of claim 76. wherein the trapping agent comprises an antibody.

78. The method of claim 76, wherein the molecule comprises an antigen associated with the fastidious microorganisms.

79. The method of claim 78, wherein the antigen is expressed by the fastidious microorganisms.

80. The method of claim 78. wherein the antigen is complexed with the fastidious microorganisms.

81. The method of claim 76, wherein the trapping agent comprises a nucleic acid binding agent.

82. The method of claim 81, wherein the nucleic acid binding agent comprises a chaotropic agent.

83. The method of claim 81 or 82, wherein the trapping agent binds to the molecule comprising a nucleic acid of the fastidious microorganisms.

84. The method of any one of claims 59-83, further comprising determining a genus of the fastidious microorganisms by detecting a conserved nucleic acid sequence shared by the genus of the fastidious microorganism.

85. The method of claim 84, wherein the genus comprises Babesia, Theileria, Cytauxzoon, Rangelia, or a combination thereof.WSGR Docket No. 68706-704.60186. The method of any one of claims 59-85, wherein the plurality of species of the fastidious microorganisms comprises B. bovis, B. btgemina, B. eras, sa-l ike, B. divergens, B. diver gens -like, B. duncani, B. microti, B. microti-like, B. odocoilei, B. venatorum, B. motasi, B. sp. EU3, B. sp. FR1, B. sp. KOI, B. sp. XXB, B. canis, B. capreoli, B. sp. Coco, B. conradae, B.felis, B. gibsoni, B. lengau, B. negevi, B. vogeli, B. wipes, Cytauxzoon felis, or Theileria bicornis, or a combination thereof.

87. The method of any one of claims 59-86. wherein the nucleic acid sequences from the at least three species of the fastidious microorganisms is determined in the sample obtained from the subject.

88. The method of claim 87, wherein the sample comprises blood, plasma, serum, urine, cerebrospinal fluid, pleural fluid, pulmonary mucus, sputum, transudates, modified transudates, exudates, chest fluid, abdominal fluid, synovial fluid, peritoneal fluid, lymph, or effusions.

89. The method of claim 87, wherein the subject is human.

90. The method of claim 89, wherein the subject has fatigue, myalgia, or a neurological symptom.

91. The method of claim 89 or 90, wherein a parasitemia of the fastidious microorganisms is decreased in the subject compared to a second parasitemia in a host of the fastidious microorganisms.

92. The method of any one of claims 59-91, wherein the method provides increased sensitivity for detecting the fastidious microorganisms compared to that obtained by amplification at only genus level or only species level of the fastidious microorganisms.

93. The method for any one of claims 59-92, further comprising diagnosing an infection caused by the plurality of species of fastidious microorganisms in a subject based on detecting the plurality of species of the fastidious microorganisms.

94. The method of any one of claims 59-93, further comprising treating a subject infected by the at least three species of the fastidious microorganisms.

95. The method of claim 94, wherein the treating is determined based on identification of the plurality of species of the fastidious microorganisms.

96. The method of claim 95, wherein the treatment is determined based on a size of the fastidious microorganism.

97. The method of claim 96, wherein the size of the fastidious microorganism is smaller than 2 micrometer (pm).

98. The method of claim 96. wherein the size of the fastidious microorganism is larger than 2 micrometer (pm).WSGR Docket No. 68706-704.60199. The method of claim 94, wherein the treating is determined based on a parasitemia of the subject infected by the plurality of species the fastidious microorganisms.

100. The method of any one of claims 97-98, wherein the treatment is different for a fastidious microorganism smaller than 2 micrometer (pm) and a fastidious microorganism larger than 2 micrometer (pm).

101. The method of claim 97, wherein the treating comprises atovaquone, azithromycin, clindamycin, disulfiram, doxycycline, moxifloxacin, quinine, tafenoquine, trimethoprimsulfamethoxazole, quinine, or a combination thereof to the subject.

102. The method of claim 98, wherein the treatment comprises imidocarb dipropri onate.

103. A method of identifying a fastidious microorganism in a subject experiencing fatigue, myalgia, or neurological symptoms, the method comprising: performing amplification of at least one genomic nucleic acid sequence of at least one fastidious microorganism in a sample from the subject to obtain at least one nucleic acid amplification product, wherein the subject has fatigue, myalgia, or a neurological symptom; and analyzing the at least one nucleic acid amplification product to determine a presence of the at least one of the genomic nucleic acid sequence of the at least one fastidious microorganism in the sample.

104. The method of claim 103, further comprising extracting nucleic acids associated with the at least one fastidious microorganism prior to performing the nucleic acid amplification.

105. The method of claim 103 or 104. wherein the analyzing of the at least one nucleic acid amplification product comprises sequencing the at least one nucleic acid amplification product.

106. The method of any one of claims 103-105, wherein the at least one fastidious microorganism comprises Babesia, Bartonella, or a combination thereof.

107. The method of claim 106, wherein the Babesia comprises B. bovis, B. bigemina, B. crassa- like, B. divergens, B. diver gens -like, B. duncani, B. microti, B. microtiAWs, B. odocoilei, B. venatorum, B. motasi, B. sp. EU3, B. sp. FR1, B. sp. KOI, B. sp. XXB, B. canis, B. capreoli, B. sp. Coco, B. conradae, B. felis, B. gibsoni, B. lengau, B. negevi, B. vogeli, B. vulpes, or a combination thereof.

108. The method of claim 106, wherein the Babesia comprises Babesia microti, Babesia divergens, Babesia odocoilei, Babesia duncani, or a combination thereof.

109. The method of claim 106, wherein the Bartonella comprises Bartonella quintana, Bartonella koehlerae, Bartonella henselae, Bartonella vinsonii berkofftiii, or a combination thereof.1 10. The method of any one of claims 103-109, wherein the at least one genomic nucleic acid sequence comprises an intergenic transcribed spacer (ITS).WSGR Docket No. 68706-704.601111. The method of claim 110, wherein the ITS is located between two rRNA genes.

112. The method of claim 111, wherein the two rRNA genes comprise 18S rRNA, 5.8S rRNA, or 28S rRNA gene.

113. The method of claim 112, wherein the two rRNA genes comprise 18S rRNA and 5.8S rRNA genes.

114. The method of claim 112, wherein the two rRNAs comprise 5.8S rRNA and 28S rRNA genes.1 15. The method of claim 1 12, wherein the two rRNAs comprise 16S rRNA and 23S rRNA genes.

116. The method of any one of claims 103-115, wherein the at least one nucleic acid amplification product is obtained by contacting the at least one of the genomic nucleic acid sequence with a primer.

117. The method of claim 116, wherein the primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% to any one of SEQ ID NOs: 1-4, 6, 7, 9, 10.

12. or 13.

118. The method of any one of claims 103-117, wherein the analyzing the at least one nucleic acid amplification product comprises contacting the at least one nucleic acid amplification product with a probe.

119. The method of claim 118, wherein the probe comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% to any one of SEQ ID NOs: 5, 8, 11 , or 14.

120. The method of any one of claims 103-119, wherein the at least one fastidious microorganism is cultured in an enrichment media prior to the amplification of the at least one genomic nucleic acid sequence.

121. The method of any one of claims 103-120, wherein the sample comprises bodily fluid.

122. The method of any one of claims 103-121, wherein the at least one nucleic acid amplification product is obtained from PCR.

123. The method of claim 122, wherein the PCR comprises conventional PCR (cPCR), quantification PCR (qPCR), or digital PCR (dPCR).

124. The method of any one of claims 103-123, further comprising diagnosing the subject as having an infection by the at least one fastidious microorganism based on detecting the presence of the at least one genomic nucleic acid sequence.

125. The method of any one of claims 103-124. wherein the subject has symptoms of infection caused by a fastidious microorganism.WSGR Docket No. 68706-704.601126. The method of any one of claims 103-124, wherein the subject does not have symptoms of infection caused by a fastidious microorganism.

127. The method of any one of claims 103-126, wherein the fatigue is chronic fatigue.

128. The method of any one of claims 103-127, wherein the subject experiences the fatigue, myalgia, or the neurological symptom for at least six months.

129. The method of any one of claims 103-128, wherein the neurological symptom comprises difficult remembering, disorientation, irritability, rage, aggression, difficulty sleeping, seizures, tremors, headache, mental confusion, hallucinations, anxiety, or panic attacks.

130. The method of any one of claims 103-129, wherein the infection by the at least one fastidious microorganism causes the fatigue, myalgia, or the neurological symptom in the subject.

131. The method of any one of claims 103-130, further comprising treating the subject infected by the at least one the fastidious microorganism.

132. A method for detecting two or more species of a plurality7of fastidious microorganisms infecting a subject, the method comprising: detecting the two or more species of the plurality of fastidious microorganisms in a sample obtained from the subject by amplification of nucleic acid sequences from the two or more species of the plurality7of fastidious microorganisms, and grouping the two or more species into groups based on a particle size of the fastidious microorganisms, species, or phylogenetic clade.

133. The method of claim 132, wherein the amplification is obtained by a primer targeting the at least one intergenic transcribed spacer (ITS) sequence.

134. The method of claim 133, wherein the at least one ITS sequence is located between two rRNA of the fastidious microorganisms.

135. The method of claim 134, wherein the at least one ITS is between 18S rRNA and 5.8S rRNA or 5.8S rRNA and 28S rRNA.

136. The method of claim 133, wherein the primer is for performing PCR.

137. The method of claim 136, wherein the PCR comprises conventional PCR (cPCR), quantification PCR (qPCR), or digital PCR (dPCR), or a combination thereof.

138. The method of claim 136, wherein the primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 11-18.

139. The method of claim 136, wherein the primer is a nucleic acid sequence that is any one of claim SEQ ID NOs: 1 1-18.WSGR Docket No. 68706-704.601140. The method of claim 136, wherein the primer comprises a nucleic acid sequence comprising at least ten, at least 12. at least 14. or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 11-18.

141. The method of any one of claims 136-140, wherein the PCR quantifies a parasitemia in a subject infected by the fastidious microorganisms.

142. The method of any one of claims 132-141, further comprising targeting the plurality’ of nucleic acid sequences associated with the plurality of species of the fastidious microorganisms with a probe.

143. The method of claim 142, wherein the probe comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 21-25.

144. The method of claim 143, wherein the probe is a nucleic acid sequence that is any one of claim SEQ ID NOs: 21-25.

145. The method of claim 142, wherein the probe comprises a nucleic acid sequence comprising at least ten. at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 21-25.

146. The method of any one of claims 132-145, further comprising tracking fluctuation of a parasitemia in a subject infected by the fastidious microorganisms.

147. The method of claim 146, wherein the fluctuation of the parasitemia in the subject is due to treatment of infection by the fastidious microorganisms.

148. The method of any one of claims 147, further comprising enriching the fastidious microorganisms or a molecule thereof by culturing the fastidious microorganisms in a culture medium.

149. The method of claim 148, wherein the culture medium comprises an insect or mammalian cell culture medium, and optionally comprises a supplement selected from the group consisting of 0-Nicotinamide adenine dinucleotide (NAD), -Nicotinamide adenine dinucleotide phosphate (NADPH), sodium pyruvate; adenosine 5 '-triphosphate (ATP), essential amino acids, yeast extract, sodium bicarbonate, saponin, sodium polyanethol sulfonate (SPS), and fetal, newborn, or adult, horse, ovine, bovine, rabbit,, or human serum, or any combination thereof.

150. The method of claim 149, wherein the culture medium is protein-free.

151. The method of any one of claims 132-150, further comprising binding to a molecule of the fastidious microorganisms with a trapping agent.

152. The method of claim 151, wherein the trapping agent comprises an antibody.

153. The method of claim 151 , wherein the molecule comprises an antigen associated with the fastidious microorganisms.WSGR Docket No. 68706-704.601154. The method of claim 153, wherein the antigen is expressed by the fastidious microorganisms.

155. The method of claim 153, wherein the antigen is complexed with the fastidious microorganisms.

156. The method of claim 154, wherein the trapping agent comprises anucleic acid binding agent.

157. The method of claim 156, wherein the nucleic acid binding agent comprises a chaotropic agent.

158. The method of claim 156 or 157, wherein the trapping agent binds to the molecule comprising a nucleic acid of the fastidious microorganisms.

159. The method of any one of claims 132-158, further comprising determining a genus of the fastidious microorganisms by detecting a conserved nucleic acid sequence shared by the genus of the fastidious microorganism.

160. The method of claim 159, wherein the genus comprises Babesia.

161. The method of any one of claims 132-160, wherein the plurality of species of the fastidious microorganisms comprises B. bovis. B. bigemina, B. crassa-hke, B. divergens. B. divergens-like, B. duncani, B. microti, B. microti-like, B. odocoilei, B. venatorum, B. motasi, B. sp. EU3, B. sp. FR1, B. sp. KOI, B. sp. XXB, B. cams, B. capreoli, B. sp. Coco, B. conradae, B.felis, B. gibsoni, B. lengau, B. negevi, B. vogeli, B. vulpes, or a combination thereof.

162. The method of any one of claims 132-161. wherein the plurality of nucleic acid sequences associated with the plurality of species of the fastidious microorganisms is determined in the sample obtained from a subject.

163. The method of claim 162, wherein the sample comprises blood, plasma, serum, urine, cerebrospinal fluid, pleural fluid, pulmonary mucus, sputum, transudates, modified transudates, exudates, chest fluid, abdominal fluid, synovial fluid, peritoneal fluid, lymph, or effusions.

164. The method of claim 162, wherein the subject is human.

165. The method of any one of claims 162-164, wherein a parasitemia of the fastidious microorganisms is decreased in the subject compared to a second parasitemia in a host of the fastidious microorganisms.

166. The method of any one of claims 132-165, wherein the method increases a sensitivity for detecting the fastidious microorganisms compared to detection of the fastidious microorganisms based on only at genus level of the fastidious microorganisms.

167. The method of claim 132, wherein the phylogenetic clade comprises Babesia species belongs to phylogenetic Clades I, III, or X within the Piroplasmida order, as determined by 18S rRNA gene sequence analysis, wherein the Babesia species belongs to phylogenetic Clades I,WSGR Docket No. 68706-704.601Ill, or X includes variants having at least 90% sequence identity to a reference sequence of a representative species, wherein the representative species comprises Babesia microti (Clade I), Babesia duncani (Clade III), or Babesia divergens (Clade X).

168. The method of any one of claims 132-167, further comprising treating a subject infected by the plurality7of species of the fastidious microorganisms.

169. The method of claim 168, wherein the treating is determined based on identification of the plurality of species of the fastidious microorganisms.

170. The method of claim 169, wherein the treatment is determined based on a size of the fastidious microorganism.

171. The method of claim 170, wherein the size of the fastidious microorganism is smaller than 2 micrometer (pm).

172. The method of claim 171, wherein the size of the fastidious microorganism is larger than 2 micrometer (pm).

173. The method of claim 168, wherein the treating is determined based on a parasitemia of the subject infected by the plurality of species the fastidious microorganisms.

174. The method of any one of claims 170-172, wherein the treatment is different for a fastidious microorganism smaller than 2 micrometer (pm) and a fastidious microorganism larger than 2 micrometer (pm).

175. The method of claim 171, wherein the treating comprises atovaquone, azithromycin, clindamycin, disulfiram, doxycycline, moxifloxacin, quinine, tafenoquine, trimethoprimsulfamethoxazole, quinine, or a combination thereof to the subject.

176. The method of claim 172, wherein the treatment comprises imidocarb dipropri onate.

177. A kit comprising:(a) a nucleic acid for detecting a genus of a fastidious microorganism; and(b) at least one additional nucleic acid for detecting a species of the fastidious microorganism.

178. The kit of claim 177, further comprising an instruction manual for amplifying the nucleic acid and the at least one additional nucleic acid.

179. The kit of claim 178, wherein the amplifying the nucleic acid is performed with a primer targeting at least one intergenic transcribed spacer (ITS) sequence located between 18S rRNA and 5.8S rRNA or between 5.8S rRNA and 28S rRNA.

180. The kit of claim 179, wherein the primer comprises a nucleic acid sequence that is at least 75%. at least 80%. at least 85%. at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 1 -6.WSGR Docket No. 68706-704.601181. The kit of claim 179, wherein the primer is a nucleic acid sequence that is any one of claim SEQ ID NOs: 1-6.

182. The kit of claim 179, wherein the primer comprises a nucleic acid sequence comprising at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 1-6.

183. The kit of any one of claims 177-182, wherein the at least one additional nucleic acid comprises a second primer for targeting a nucleic acid sequence unique to the species of the fastidious microorganism.

184. The kit of claim 183, wherein the nucleic acid sequence unique to the species of the fastidious microorganism comprises at least one internal transcribed spacer (ITS).

185. The kit of claim 184, wherein the at least one ITS sequence is located between two rRNA of the fastidious microorganism.

186. The kit of claim 184, wherein the at least one ITS sequence is between 18S rRNA and 5.8S rRNA or 5.8S rRNA and 28S rRNA.

187. The kit of any one of claims 183-186, wherein the second primer targets the at least one intergenic transcribed spacer (ITS) sequence.

188. The kit of claim 187, wherein the at least one ITS sequence is located between two rRNA of the fastidious microorganism.

189. The kit of claim 187, wherein the at least one ITS is between 18S rRNA and 5.8S rRNA or5.8S rRNA and 28S rRNA.

190. The kit of claim any one of claims 183-189, wherein the second primer is for performing a second PCR.

191. The kit of claim 190, wherein the second PCR comprises conventional PCR (cPCR), quantification PCR (qPCR), or digital PCR (dPCR), or a combination thereof.

192. The kit of claim 190, wherein the second primer comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 11-18.

193. The kit of claim 190, wherein the second primer is a nucleic acid sequence that is any one of claim SEQ ID NOs: 1 1-18.

194. The kit of claim 190, wherein the second primer comprises a nucleic acid sequence comprising at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 11-18.

195. The kit of any one of claims 190-194, wherein the second PCR quantifies a parasitemia in a subject infected by the fastidious microorganism.

196. The kit of any one of claims 177-195, further comprising a probe.WSGR Docket No. 68706-704.601197. The kit of claim 196, wherein the probe targets the nucleic acid sequence unique to the species of the fastidious microorganism.

198. The kit of claim 197, wherein the probe comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 99% identical to any one of claim SEQ ID NOs: 21-25.

199. The kit of claim 197, wherein the probe is a nucleic acid sequence that is any one of claim SEQ ID NOs: 21-25.

200. The kit of claim 197, wherein the probe comprises a nucleic acid sequence comprising at least ten, at least 12, at least 14, or at least 16 contiguous nucleotides that is identical to any one of claim SEQ ID NOs: 21-25.

201. The kit of any one of claims 177-197, further comprising at least one additional modality for additional amplification for tracking fluctuation of a parasitemia in a subject infected by the fastidious microorganism.

202. The kit of claim 201, wherein the additional modality tracks the fluctuation of the parasitemia in the subject due to treatment of infection by the fastidious microorganism.

203. The kit of any one of claims 177-202, further comprising a culture medium for enriching the fastidious microorganism.

204. The kit of claim 203, wherein the culture medium comprises an insect or mammalian cell culture medium, and optionally comprises a supplement selected from the group consisting of P- Nicotinamide adenine dinucleotide (NAD), P-Nicotinamide adenine dinucleotide phosphate (NADPH), sodium pyruvate; adenosine 5 '-triphosphate (ATP), essential amino acids, yeast extract, sodium bicarbonate, saponin, sodium polyanethol sulfonate (SPS), and fetal, newborn, or adult, horse, ovine, bovine, rabbit,, or human serum, or any combination thereof.

205. The kit of claim 204, wherein the culture medium is protein-free.

206. The kit of any one of claims 177-205, further comprising a trapping agent for binding to a molecule of the fastidious microorganism.

207. The kit of claim 206, wherein the trapping agent comprises an antibody.

208. The kit of claim 206, wherein the molecule comprises an antigen associated with the fastidious microorganism.

209. The kit of claim 208, wherein the antigen is expressed by the fastidious microorganism.

210. The kit of claim 208, wherein the antigen is complexed with the fastidious microorganism.

211. The kit of claim 206, wherein the trapping agent comprises nucleic acid binding agent.

212. The kit of claim 211, wherein the nucleic acid binding agent comprises a chaotropic agent.

213. The kit of claim 21 1 or 212, wherein the trapping agent binds to the molecule comprising a nucleic acid of the fastidious microorganism.WSGR Docket No. 68706-704.601214. The kit of any one of claims 209-213, further comprising additional nucleic acid determining at least one additional species of the fastidious microorganism by detecting at least one additional intergenic transcribed spacer (ITS) associated with that at least one additional species of the fastidious microorganism.

215. The kit of any one of claims 209-214, wherein the genus comprises Babesia, Theileria, Cytauxzoon, Rangelia, or a combination thereof.

216. The kit of any one of claims 209-215, wherein the species comprises B. bovis. B. bigemina. B. cra.s.w-like. B. divergens, B. divergensAike, B. duncani, B. microti, B. microtiAike, B. odocoilei, B. venatorum, B. motasi, B. sp. EU3, B. sp. FR1, B. sp. KOI, B. sp. XXB, B. cams, B. capreoli, B. sp. Coco, B. conradae, B. felis, B. gibsoni, B. lengau, B. negevi, B. vogeli, B. vulpes, Cytauxzoon felis. or Theileria bicornis, or a combination thereof.

217. The kit of any one of claims 209-216, wherein the species of the fastidious microorganism is determined in a sample obtained from a subject.

218. The kit of claim 217, wherein the subject is human.

219. The kit of 217 or 218, wherein a parasitemia of the fastidious microorganism is decreased in the subject compared to a second parasitemia in a host of the fastidious microorganism.