Perilipin 1 (PLIN1)-modulating compositions and methods of use thereof

Abstract

Aspects of the disclosure provide compounds, compositions, and methods for modulating the expression or activity of Perilipin 1 (PLIN1). In certain aspects, the compounds, compositions, and methods of the disclosure can be used to reduce the expression of PLIN 1 mRNA in a cell or animal. In certain aspects, the compounds, compositions, and methods of the disclosure can be used to reduce the expression of PLIN 1 protein in a cell or animal.

Description

PERILIPIN 1 (PLINl)-MODULATING COMPOSITIONS AND METHODS OF USE THEREOFCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 715,296, filed November 1, 2024. The disclosure of the prior application is considered part of and is incorporated by reference in its entirety in the disclosure of this application.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (A127870037WO00-SEQ-JIB.xml; Size 45,427 bytes; and Date of Creation: October 30, 2025) is incorporated herein by reference in its entirety.BACKGROUND

[0003] Excessive abdominal obesity, along with other risk factors, is associated with metabolic syndrome, which can lead to heart disease, Type-2 diabetes, and death. Perilipin 1 (PLIN1) is a lipid droplet coating protein known to regulate lipid metabolism in adipocytes, in which it is primarily expressed. PLIN1 is thought to act dually to both suppress basal lipolysis and augment stimulated lipolysis (e.g., when phosphorylated by protein kinase A). Loss of PLIN 1 function in mice results in lean and healthy mice that are resistant to diet- induced obesity, insulin resistance and many related metabolic abnormalities. Similarly, abnormal (e.g., reduced) PLIN1 function in humans results in reduced fat mass, among other potential phenotypes.

[0004] Accordingly, there is a need for agents that modulate the expression or activity of PLIN1, and that selectively localize to the specifically desired cell type, organ, or tissue compartment.SUMMARY

[0005] The present disclosure provides compounds, compositions, and methods for modulating the expression or activity of perilipin 1 (hereinafter, “PLIN1”). In certain embodiments, the compounds, compositions, and methods can be used to reduce the expression of PLIN1 mRNA in a cell or animal. In certain embodiments, the compounds,1#14556606vlcompositions, and methods can be used to reduce the amount of PLIN 1 protein in a cell or animal.

[0006] In certain embodiments, the animal has or is at risk of having a metabolic syndrome related disease, disorder or condition or a symptom thereof. In certain embodiments, the syndrome, disease, disorder, or condition is associated with PLIN1. In certain embodiments the syndrome, disease, disorder, or condition is metabolic syndrome, obesity, cardiovascular disease (e.g., high blood pressure, high cholesterol, high blood sugar, coronary artery disease, congestive heart failure, heart attack, and stroke), diabetes mellitus (e.g., Type-2 diabetes), insulin resistance, fatty liver disease, kidney disease, energy homeostasis, immune / inflammatory conditions, nausea, diarrhea, fibrogenesis, alcoholic steatohepatitis and diabetic nephropathy.

[0007] Certain aspects provide a compound comprising a modified oligonucleotide 8 to 30 (e.g., 8 to 23, 14 to 23, 13 to 20) linked nucleosides in length having a nucleobase sequence comprising at least 8 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence of one or more of SEQ ID NOs: 1 or 2. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises at least 8 contiguous nucleobases of a nucleobase sequence of any one of SEQ ID NOs: 34-53. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises at least 8 contiguous nucleobases of a nucleobase sequence of any one of SEQ ID NOs: 34, 35, and 39.

[0008] Certain aspects provide a compound comprising a modified oligonucleotide 8 to 30 (e.g., 8 to 23, 14 to 23, 13 to 20) linked nucleosides in length having a nucleobase sequence comprising at least 8 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence that is fully complementary to an equal length portion of one or more of SEQ ID NOs: 1 or 2. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises at least 8 contiguous nucleobases of a nucleobase sequence of any one of SEQ ID NOs: 11-33. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises at least 8 contiguous nucleobases of a nucleobase sequence of any one of SEQ ID NOs: 11, 12, and 16.

[0009] In certain embodiments, a modified oligonucleotide described herein comprises a conjugate group. In certain embodiments, the conjugate group comprises a targeting moiety. In certain embodiments, the conjugate group comprises a ligand (e.g., a receptor ligand). In certain embodiments, the conjugate group comprises a lipid. In certain embodiments, the conjugate group comprises polyethylene glycol. In certain embodiments, the modified oligonucleotide comprises one or more ligands and one or more lipids. In certain embodiments, the modified oligonucleotide comprises one or more ligands and polyethylene2#14556606vlglycol. In certain embodiments, the modified oligonucleotide comprises one or more lipids and polyethylene glycol. In certain embodiments, the modified oligonucleotide comprises one or more ligands, one or more lipids, and polyethylene glycol.

[0010] In certain embodiments, a targeting moiety is attached to one or more internal positions in the modified oligonucleotide. In certain embodiments, the targeting moiety is attached to the 5’ end and / or the 3’ end of the modified oligonucleotide. In certain embodiments, the targeting moiety comprises one or more ligands selected from one or more Tropomyosin receptor B (TrkB) ligands, one or more cannabinoid receptor type 1 (CBi) ligands, one or more a4pi / 7 integrin ligands, one or more N-methyl-D-aspartate receptor (NMDA) ligands, one or more glutamate transporter-1 (GLT-1) ligands, and one or more N- acetyl-galactosamine (GalNAc) moieties. In certain embodiments, the targeting moiety promotes localization of the compound to a target cell or tissue relative to a non-target cell or tissue. In certain embodiments, the target cell or tissue is an adipocyte or adipose tissue. In certain embodiments, the targeting moiety is a ligand for a receptor selectively expressed on adipocytes.

[0011] In certain embodiments, a lipid is attached to an intemucleoside linkage of the modified oligonucleotide. In certain embodiments, the lipid comprises a substituted or unsubstituted alkyl or alkenyl. In certain embodiments, the substituted or unsubstituted alkyl or alkenyl comprises a saturated or unsaturated Cs-C o hydrocarbon chain.

[0012] In certain embodiments, a modified oligonucleotide described herein comprises at least one modification selected from a modified nucleobase, a modified internucleoside linkage, and a modified sugar.

[0013] Certain aspects provide a compound comprising: a sense strand comprising at least 8 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence of one or more of SEQ ID NOs: 1 or 2; and an antisense strand forming a double-stranded region with the sense strand, where the compound comprises at least one modification selected from a modified nucleobase, a modified intemucleoside linkage, and a modified sugar.

[0014] Certain aspects provide a compound comprising: a sense strand comprising a modified oligonucleotide; and an antisense strand forming a double-stranded region with the sense strand, where the antisense strand comprises a region of complementarity to an mRNA encoding PLIN 1 or a domain thereof, and where the region of complementarity comprises at least 8 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence that is fully complementary to the applicable region of SEQ ID NO: 1.3#14556606vl

[0015] Certain aspects provide a compound comprising: a sense strand comprising a modified oligonucleotide; and an antisense strand forming a double-stranded region with the sense strand, where the antisense strand comprises a region of complementarity to an mRNA encoding the PAT domain of PLIN 1, and where the region of complementarity comprises at least 8 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence that is fully complementary to the applicable region of SEQ ID NO: 2.

[0016] Certain aspects provide a compound comprising: a sense strand comprising a modified oligonucleotide; and an antisense strand forming a double-stranded region with the sense strand, where the antisense strand comprises a region of complementarity to an mRNA encoding PLIN 1 or a domain thereof, and where the region of complementarity comprises at least 8 contiguous nucleobases differing by no more than 3 nucleobases from any one of the antisense sequences in Table 2 or 3.

[0017] Certain aspects provide a compound comprising: a sense strand comprising a modified oligonucleotide; and an antisense strand forming a double-stranded region with the sense strand, where the antisense strand comprises a region of complementarity to an mRNA encoding a PAT domain of PLIN 1, and where the region of complementarity comprises at least 8 contiguous nucleobases differing by no more than 3 nucleobases from any one of the antisense sequences in Table 2 or 3.

[0018] In certain embodiments, the sense and / or antisense strand is 8 to 23 linked nucleosides in length. In certain embodiments, the sense and / or antisense strand is 14 to 23 linked nucleosides in length.

[0019] In certain embodiments, the antisense strand comprises at least 8 contiguous nucleobases differing by no more than 3 nucleobases from the nucleobase sequence encoding the PAT domain of PLIN1 (e.g., nucleosides 255-539 of SEQ ID NO: 1; SEQ ID NO: 2). In certain embodiments, the antisense strand comprises at least 8 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence that is fully complementary to nucleosides 284-306, 285-307, 286-307, 286-308, 287-307, 287-309, 288- 310, 289-311, 290-311, 291-311, 291-313, 292-314, 293-315, 376-398, 377-399, 378-400, 415-437, 414-437, 413-434, 412-433, 411-432, 410-431, 409-430, 408-428, 415-436, 500- 521, 501-521, 539-560, 1356-1378, 1357-1379, 1486-1507, or 1486-1508 of SEQ ID NO: 1.

[0020] In certain embodiments, the antisense strand comprises a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% complementary to the sense strand in the double- stranded region. In certain embodiments, the antisense strand is fully complementary to the sense strand in the double-stranded region.4#14556606vl

[0021] In certain embodiments, the antisense strand comprises at least 14 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence that is fully complementary to an equal length portion of one or more of SEQ ID NOs: 1 or 2. In certain embodiments, the antisense strand comprises at least 14 contiguous nucleobases differing by no more than 3 nucleobases from any one of the antisense sequences in Table 2 or 3. In certain embodiments, the antisense strand comprises at least 14 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence of an antisense strand selected from the group consisting of Ref ID NOs: IA1892, IA1893, IA1894, IA1895, IA1896, IA1897, IA1899, IA1900, IA1901, IA1902, IA1903, IA1904, IA1905, IA1906, IA2889, IA2890, IA2891, IA2892, IA2893, IA2894, IA2895, IA2896, IA2897, and IA2898. In certain embodiments, the sense strand comprises at least 14 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence of a sense strand selected from the group consisting of Ref ID NOs: IS2463, IS2464, IS2465, IS2465, IS2466, IS2467, IS2468, IS2469, IS2470, IS2471, IS2472, IS2473, IS2474, IS2475, IS2476, IS2477, IS3527, IS3528, IS3529, IS3530, IS3531, IS3602, IS3603, IS3604, and IS3605. In certain embodiments, the nucleobase sequences of the sense and antisense strands comprise any one of the sense and antisense sequences in Table 2 or 3.

[0022] In certain embodiments, a compound described herein comprises a conjugate group. In certain embodiments, the conjugate group comprises a targeting moiety. In certain embodiments, the conjugate group comprises a ligand (e.g., a receptor ligand). In certain embodiments, the conjugate group comprises a lipid. In certain embodiments, the conjugate group comprises polyethylene glycol. In certain embodiments, the compound comprises one or more ligands and one or more lipids. In certain embodiments, the compound comprises one or more ligands and polyethylene glycol. In certain embodiments, the compound comprises one or more lipids and polyethylene glycol. In certain embodiments, the compound comprises one or more ligands, one or more lipids, and polyethylene glycol.

[0023] In certain embodiments, the sense and / or antisense strand is attached to one or more targeting moieties. In certain embodiments, the targeting moiety is attached to one or more internal positions in the double-stranded region of the compound. In certain embodiments, the targeting moiety is attached to the 5’ end and / or the 3’ end of the sense strand. In certain embodiments, the targeting moiety is attached to the 5’ end and / or the 3’ end of the antisense strand. In certain embodiments, the targeting moiety is attached to the compound through a conjugate linker. In certain embodiments, the targeting moiety comprises one or more ligands selected from one or more Tropomyosin receptor B (TrkB) ligands, one or more cannabinoid receptor type 1 (CBi) ligands, one or more a.4 1 / 7 integrin ligands, one or more5#14556606vl / V-methyl-D-aspartate receptor (NMDA) ligands, one or more glutamate transporter- 1 (GLT- 1) ligands, and one or more / V-acetyl-galactosamine (GalNAc) moieties. In certain embodiments, the targeting moiety promotes localization of the compound to a target cell or tissue relative to a non-target cell or tissue. In certain embodiments, the target cell or tissue is an adipocyte or adipose tissue. In certain embodiments, the targeting moiety is a ligand for a receptor selectively expressed on adipocytes.

[0024] In certain embodiments, the sense and / or antisense strand comprises one or more lipids. In certain embodiments, the lipid is attached to an intemucleoside linkage of the compound. In certain embodiments, the lipid comprises a substituted or unsubstituted alkyl or alkenyl. In certain embodiments, the substituted or unsubstituted alkyl or alkenyl comprises a saturated or unsaturated Cs-C o hydrocarbon chain.

[0025] In certain embodiments, the sense and / or antisense strand comprises at least one modified intemucleoside linkage. In certain embodiments, the modified internucleoside linkage is a phosphorothioate intemucleoside linkage or a methylphosphonate intemucleoside linkage. In certain embodiments, the sense and / or antisense strand comprises at least one modified sugar. In certain embodiments, the modified sugar comprises a modification selected from the group consisting of a halogen, an alkoxy group, and a bicyclic sugar. In certain embodiments, the modified sugar comprises a modification selected from group consisting of LNA, cEt, 2’-MOE, 2’-F, 2’-OMe, and 2’-deoxy, or a combination thereof. In certain embodiments, the antisense strand comprises no more than ten 2’-F sugar modifications. In certain embodiments, the sense strand comprises no more than five 2’-F sugar modifications. In certain embodiments, the sense and / or antisense strand comprises at least one modified nucleobase.

[0026] Certain aspects provide a cell containing a compound or modified oligonucleotide described herein.

[0027] Certain aspects provide a pharmaceutical composition for inhibiting expression of a gene encoding PLIN1, comprising a compound or modified oligonucleotide described herein. In certain embodiments, the compound or modified oligonucleotide is in a pharmaceutically acceptable salt form. In certain embodiments, the pharmaceutically acceptable salt is a sodium salt or a potassium salt. In certain embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0028] Certain aspects provide a method of inhibiting expression of an PLIN1 gene in a cell, the method comprising contacting the cell with a compound, modified oligonucleotide, or pharmaceutical composition described herein, thereby inhibiting expression of the PLIN 1 gene in the cell.6#14556606vl

[0029] Certain aspects provide a method of treating, alleviating, preventing, or slowing the progression of a PLINl-associated disorder in a subject comprising administering to the subject a compound, modified oligonucleotide, or pharmaceutical composition described herein, thereby treating, alleviating, preventing, or slowing the progression of the PLIN 1 associated disorder.

[0030] In certain embodiments, the PLINl-associated disorder is metabolic syndrome, obesity, cardiovascular disease (e.g., high blood pressure, high cholesterol, high blood sugar, coronary artery disease, congestive heart failure, heart attack, and stroke), diabetes mellitus (e.g., Type-2 diabetes), insulin resistance, fatty liver disease, kidney disease, energy homeostasis, immune / inflammatory conditions, nausea, diarrhea, fibrogenesis, alcoholic steatohepatitis and diabetic nephropathy. In certain embodiments, the PLINl-associated disorder is diabetes mellitus (e.g., Type-2 diabetes), obesity, insulin resistance, high blood sugar, and / or cardiovascular disease.

[0031] Certain aspects provide a method of reducing body mass index (BMI), excess amounts of abdominal fat, waist circumference, sweating, tiredness, joint and back pain, difficulty breathing, sleep problems, high blood pressure, or mental conditions such as depression associated with obesity in a subject, the method comprising administering to the subject a compound, modified oligonucleotide, or pharmaceutical composition described herein.

[0032] In certain embodiments, a method described herein further comprises administering to the subject an anti-incretin therapy, an anti-leptin therapy, GLP-1 receptor agonist therapy, DPP-4 inhibitor therapy, or other treatment for obesity.

[0033] Certain aspects provide a container comprising a compound, modified oligonucleotide, or pharmaceutical composition described herein. Certain aspects provide a kit comprising the container. In certain embodiments, the container is a vial, a test tube, a flask, a bottle, or a syringe.

[0034] Certain compounds, compositions and methods provided herein are directed to reduction of one or more of: body mass index (BMI), excess amounts of abdominal fat, waist circumference, sweating, tiredness (e.g., fatigue), joint and back pain, difficulty breathing, sleep problems, thirst, frequent urination, dysregulated hunger signals, impaired vision, peripheral neuropathy, weakness, confusion, nausea, dizziness, headaches, dry mouth, water retention, heart palpitations, hypertension (e.g., high blood pressure), dyslipedima, insulin resistance, hyperinsulinemia, hepatic steatosis, dysglycemia (e.g., hyperglycemia, hypoglycemia), mental conditions associated with obesity (e.g., depression), or a combination thereof.7#14556606vl

[0035] Certain compounds, compositions and methods provided herein are directed to one or more of: reducing adipose tissue (white or brown), reducing BMI (e.g., to <25), reducing waist circumference (e.g., to <35 inches for females, <40 inches for males), reducing serum triglyceride levels (e.g., to <150mg / dL), increasing serum high-density lipoprotein cholesterol levels (e.g., >50mg / dL for females, >40mg / dL for males), reducing serum fasting glucose levels (e.g., to <100mg / dL), reducing systolic and / or diastolic blood pressure values at rest (e.g., < 130mm Hg systolic, <85 mm Hg diastolic), regulating (e.g., increasing) adipocyte lipolysis and / or rate of lipolysis, increasing leptin production, increasing lean body mass (e.g., increasing skeletal muscle mass), decreasing adiponectin expression, increasing indicators of white adipose browning (e.g., increasing Ucpl expression), or any combination thereof. In certain embodiments, compositions or methods provided herein are directed to one or more of: not increasing ectopic lipid accumulation (for instance, in the heart or liver), and / or not increasing tissue triglyceride levels (e.g., in the heart); increasing satiety and emesis; decreasing fat storage; increasing adiponectin secretion; increasing thermogenesis in brown adipose tissue; decreasing lipogenesis; decreasing gluconeogenesis; increasing insulin- mediated glucose update (e.g., in muscle); increasing glucose signaling (e.g., in muscle tissue); decreasing palatability of high fat, high sugar food; increasing acetylcholine release in stomach; improving gastric emptying; improving interaction with gut microbiome; or any combination thereof.

[0036] In certain embodiments, compounds, compositions or methods provided herein are directed to one or more of: increasing lipolysis in fat tissue and liver; increasing satiety and emesis; decreasing fat storage; increasing adiponectin secretion; increasing thermogenesis in brown adipose tissue; increasing oxygen consumption; decreasing lipogenesis; decreasing gluconeogenesis; increasing insulin-mediated glucose update (e.g., in muscle); increasing glucose signaling (e.g., in muscle tissue); decreasing palatability of high fat, high sugar food; increasing acetylcholine release in stomach; improving interaction with gut microbiome; or any combination thereof.

[0037] Certain compounds, compositions and methods provided herein are directed to metabolic syndrome, obesity, cardiovascular disease (e.g., high blood pressure, high cholesterol, high blood sugar, coronary artery disease, congestive heart failure, heart attack, and stroke), diabetes mellitus (e.g., Type-2 diabetes), insulin resistance, fatty liver disease, kidney disease, energy homeostasis, immune / inflammatory conditions, nausea, diarrhea, fibrogenesis, alcoholic steatohepatitis and diabetic nephropathy in an animal (e.g., a human).

[0038] In certain embodiments, the compounds and compositions provided herein are potent, tolerable, and inhibit PLIN1 expression, which can be used to treat, prevent, ameliorate, or8#14556606vlslow progression of a syndrome, disease, disorder, or condition associated with PLIN1 or a symptom thereof. In certain embodiments, the compounds and compositions provided herein are potent, tolerable and inhibit PLIN 1 expression, which can be used to treat, prevent, ameliorate, or slow progression of diabetes mellitus (e.g., Type-2 diabetes), obesity, insulin resistance, high blood sugar, and / or cardiovascular disease. In some instances, the compounds and compositions provided herein may also treat, prevent, ameliorate, or slow progression of any of the following: breathing disorders such as asthma, sleep apnea, and obesity hyperventilation syndrome; bone disorders including osteoarthritis and back pain; other conditions such as gout; Alzheimer’s and dementia; depression or mood disorders; and / or some cancers including but not limited to esophageal, pancreatic, colorectal, breast, uterine, and / or ovarian cancers.

[0039] In certain embodiments, the compounds and compositions comprise one or more features that are effective for increasing potency. In certain embodiments, the compounds and compositions comprise one or more features that are effective for increasing tolerability. In certain embodiments, compounds and compositions comprise one or more features that are effective for targeting the compound or composition to a cell or tissue; or to keeping the compound out of a particular biological compartment. In certain embodiments, the compounds and compositions are more potent or have greater therapeutic value than compounds publicly disclosed.BRIEF DESCRIPTION OF THE DRAWINGS

[0040] The accompanying Drawings, which constitute a part of this specification, illustrate embodiments of the disclosure.

[0041] FIG. 1 shows effects of certain compounds on expression of PLIN1 and GAPDH.

[0042] FIGs. 2A-2B show in vivo effects of certain modified compounds on body weight in mice. FIG. 2A shows effects of compound administration on body weight in pre-obese mice. FIG. 2B shows effects of compound administration on body weight in obese mice.DETAILED DESCRIPTION

[0043] It is to be understood that both the foregoing summary and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0044] All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank, NCBI and9#14556606vlother sequence reference records are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety as of the date of filing this application.

[0045] It is understood that the sequence set forth in each SEQ ID NO contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase even if shown in context with a modified compound. As such, compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase. Oligomeric compounds referenced by Compound Number or Ref ID NO indicate a combination of nucleobase sequence, chemical modification, and motif.

[0046] Herein, the use of the singular includes the plural unless specifically stated otherwise. For example, the articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements. As used herein, the use of “or” means “and / or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included,” is not limiting and is used interchangeably with, the phrase “including but not limited to.”Definitions

[0047] Unless otherwise indicated, the following terms have the following meanings:

[0048] “Perilipin 1,” used interchangeably with the term “PLIN1,” refers to any nucleic acid or protein of PLIN1. An exemplary nucleotide sequence of PLIN 1 can be found, for example, at GenBank Accession No. NM_002666.5, incorporated herein as SEQ ID NO: 1.

[0049] Additional examples of PLIN 1 sequences are readily available through publicly available databases, e.g., GenBank, UniProt, and OMIM, and may include, for instance: NCBI Accession Nos. NM_001145311.2, NP_001138783.1, NM_175640.2, NM_001113471.1, and XM_011250776.3; GenBank Gene ID 5346; UniProt Accession Nos.060240 and Q8N5Y6; and OMIM Entry No. 70290. Further information on PLIN1, including PLIN1 sequences for non-human species (e.g., mice, rats, and non-human primates) can be found, for example, on the worldwide web at ncbi.nlm.nih.gov / gene / ?term=PLINl. PLIN1, as used herein, also refers to variations of the PLIN1 gene including variants provided in the SNP database. Numerous sequence variations within the PLIN 1 gene have been identified and may be found at, for example, NCBI dbSNP and UniProt (see, e.g., ncbi.nlm.nih.gov / snp / ?term=PLINl, uniprot.org / uniprotkb / 060240). “PLIN1 mRNA” means an mRNA encoding a PLIN 1 protein. An exemplary amino acid sequence of PLIN 1 can be found, for example, at GenBank Accession No. NP_002657.3. The entire contents of each of 10#14556606vlthe foregoing GenBank Accession number and the gene database numbers are incorporated herein by reference as of the date of filing of this application. PLIN 1 may be referred to in either upper or lower case.

[0050] “Perilipin-adipophilin / adipose differentiation-related protein (ADRP)-tail-interacting protein 47 (TIP47)” domain (hereinafter, “PAT” domain) refers to a domain common to proteins of the PAT family (e.g., PLIN1, PLIN2, PLIN3). In PLIN1, the PAT domain is an N-terminal domain having a high-affinity for diacylglycerol (DAG)-enriched phospholipid bilayers. In some embodiments, the PAT domain of PLIN1 corresponds to Q22-L116 of GenBank Accession No. NP_002657.3. The PAT domain is thought to contribute to association of PLIN1 with hormone-lipid droplet structure surfaces. In some embodiments, an agent described herein targets a nucleobase sequence encoding the PAT domain of PLIN 1, for example, nucleosides 255-539 of SEQ ID NO: 1: ACCAGCACUAAGGAAGCCCACCCCCUGGUGGCCUCUGUGUGCAAUGCCUAUGAGAAGGGCGU GCAGAGCGCCAGUAGCUUGGCUGCCUGGAGCAUGGAGCCGGUGGUCCGCAGGCUGUCCACCC AGUUCACAGCUGCCAAUGAGCUGGCCUGCCGAGGCUUGGACCACCUGGAGGAAAAGAUCCCC GCCCUCCAGUACCCCCCUGAAAAGAUUGCUUCUGAGCUGAAGGACACCAUCUCCACCCGCCU CCGCAGUGCCAGAAACAGCAUCAGCGUUCCCAUCGCG (SEQ ID NO: 2).

[0051] ‘ ‘PLIN 1 specific inhibitor” refers to any agent capable of specifically inhibiting PLIN1 RNA and / or PLIN1 protein expression, translation, and / or activity at the molecular level. For example, PLIN 1 specific inhibitors include nucleic acids (including oligonucleotide compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression, translation, and / or activity of PLIN1 RNA and / or PLIN1 protein.

[0052] “2'-0-methoxyethyl” or “2'-MOE” means a 2'-O(CH2)2-OCH3 modification. A 2'-O- methoxy ethyl modified sugar is a modified sugar with 2'-O(CH2)2-OCH3 in the place of the 2'-OH group of a ribosyl ring.

[0053] “5' start site” means the nucleotide of the target nucleic acid or region which is complementary to the 3 '-most nucleoside of an antisense oligonucleotide.

[0054] “3' stop site” means the nucleotide of the target nucleic acid or region which is complementary to the 5 '-most nucleoside of an antisense oligonucleotide.

[0055] ‘ ‘About” means within ±10% of a value. For example, if it is stated, “a compound achieved about 70% inhibition of PLIN1”, it is implied that PLIN1 levels are inhibited within a range of 60% and 80%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range.

[0056] ‘ ‘Administer” or “administering” refers to routes of introducing a compound or composition provided herein to an individual to perform its intended function. Administration may be systemic or local. An example, routes of administration that can be used include, but11#14556606vlare not limited to, parenteral administration, such as subcutaneous, intravenous, intramuscular injection or infusion, epidural, intracerebral, or intracerebroventricular.

[0057] ‘ ‘Ameliorate” refers to an improvement or lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression or severity of one or more indicators of a condition or disease. The progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.

[0058] ‘ ‘Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

[0059] ‘ ‘Antisense oligonucleotide” or “antisense strand” means an oligonucleotide which includes a region that is complementary to a target nucleic acid, e.g., a PLIN1 RNA or a region thereof.

[0060] “Complementarity” in reference to an oligonucleotide means the nucleobase sequence of such oligonucleotide or one or more regions thereof that is complementary to the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), and cytosine (C) and guanine (G) unless otherwise specified. Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. By contrast, “fully complementary” or “100% complementary” in reference to oligonucleotides means that such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.

[0061] “Composition” or “pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a composition may comprise one or more compounds or salt thereof and a sterile aqueous solution.

[0062] “Co-administration” means administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Co-administration does not require both compounds to be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Co-administration includes parallel or sequential administration of the one or more compounds.12#14556606vl

[0063] “Conjugate group” means a group of atoms that is attached to an oligonucleotide. A conjugate group is optionally attached to an oligonucleotide through a conjugate linker. A conjugate group may, for example, alter the distribution, targeting, or half-life of a compound into which it is incorporated. Conjugate groups include lipids (or lipophilic moieties), ligands, and other targeting moieties. “Conjugate linker” means a group of atoms comprising at least one bond that connects a linked moiety to an oligonucleotide.

[0064] In reference to a conjugate group or targeting moiety, a “lipid” or “lipophilic moiety” refers to an aliphatic, cyclic (such as alicyclic), or polycyclic (such as polyalicyclic) compound, such as a steroid (e.g., sterol) or a linear or branched aliphatic hydrocarbon. The term lipid includes cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1 -pyrene butyric acid, dihydrotestosterone, 1,3-bis- O(hexadecyl)glycerol, geranyloxyhexyanol, hexadecylglycerol, borneol, menthol, 1,3- propanediol, heptadecyl group, palmitic acid, myristic acid, 03-(oleoyl)lithocholic acid, 03- (oleoyl)cholenic acid, ibuprofen, naproxen, dimethoxytrityl, or phenoxazine. The term lipid includes a saturated or unsaturated C4-C30 hydrocarbon chain (e.g., C4-C30 alkyl or alkenyl). In certain embodiments, the lipophilic moiety contains a saturated or unsaturated C5-C20 hydrocarbon chain (e.g., a linear C5-C20 alkyl or alkenyl). In certain embodiments, the lipophilic moiety contains a saturated or unsaturated C14-C20 hydrocarbon chain (e.g., a linear C14-C20 alkyl or alkenyl). In certain embodiments, the lipophilic moiety contains a saturated or unsaturated Ce-Cis hydrocarbon chain (e.g., a linear Ce-Cis alkyl or alkenyl). In certain embodiments, the lipophilic moiety contains a saturated or unsaturated Ci6 hydrocarbon chain (e.g., a linear Ci6 alkyl or alkenyl). In certain embodiments, the lipophilic moiety contains a saturated or unsaturated C17 hydrocarbon chain (e.g., a linear C17 alkyl or alkenyl). In certain embodiments, the lipophilic moiety contains a saturated or unsaturated Cis hydrocarbon chain (e.g., a linear Cis alkyl or alkenyl). In certain embodiments, the lipophilic moiety contains a saturated or unsaturated C22 hydrocarbon chain (e.g., a linear C22 alkyl or alkenyl).

[0065] In reference to a conjugate group or targeting moiety, a ligand of “a.4 1 / 7 integrin receptor” refers to a ligand of heterodimeric integrin receptors formed by association of integrin alpha 4 and integrin beta 1 (z.e., the a401 integrin receptor) and integrin alpha 4 and integrin beta 7 (z.e., the cuP? integrin receptor). In certain embodiments, the a.401 / 7 integrin receptor ligand has a higher binding affinity for ct401 integrin receptor than c P? integrin receptor. In certain embodiments, the a40i / 7 integrin receptor ligand has a higher binding affinity for c P? integrin receptor than ct4 1 integrin receptor.

[0066] In reference to a conjugate group or targeting moiety, a ligand of “Cannabinoid Receptor Type 1” or “CB1” refers to a ligand of the G protein-coupled receptor for13#14556606vlcannabinoids. In humans, CB1 is encoded by the CNR1 gene. CB1 is also known as cannabinoid receptor 1.

[0067] In reference to a conjugate group or targeting moiety, a ligand of “Glutamate Transporter 1” or “GLT-1” refers to a ligand of the transmembrane glutamate transporter that is found in the brain. In humans, GLT-1 is encoded by the SLC1A2 gene.

[0068] In reference to a conjugate group or targeting moiety, a ligand of ‘W-methyl-D- aspartate receptor” or “NMDA receptor” refers to a ligand of the glutamate receptor and ion channel that is found in neurons, e.g., in humans. Many ligands of the NMDA receptor are known in the art including, for example, those disclosed in Neuropharmacology 2007, 53(6), 699-723; J. Med. Chem. 1990, 33(2), 789-808; Neuroscience 2001, 105(3), 663-669; J. Med. Chem. 2022, 65(13), 9063-9075; Drugs Fut. 2004, 29(10), 992; Drugs Fut. 2004, 29(10), 993; and British Journal of Pharmacology 2022, 179(6), 1146-1187, each of which is incorporated by reference herein.

[0069] In reference to a conjugate group or targeting moiety, a ligand of “Tropomyosin Receptor Kinase B” or “TrkB” refers to a ligand of the receptor for brain-derived neurotrophic factor (BDNF) protein encoded by the NTRK2 gene. TrkB is also known as tyrosine receptor kinase B, BDNF / NT-3 growth factors receptor and neurotrophic tyrosine kinase, receptor, type 2.

[0070] “Identity” in reference to an oligonucleotide means the nucleobase sequence of such oligonucleotide or one or more regions thereof that matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof. Identity of an oligonucleotide to another oligonucleotide or nucleic acid need not require each nucleobase to match and may include one or more different nucleobases. By contrast, “fully identical” or “100% identity” in reference to oligonucleotides means that such oligonucleotides have the same nucleobase at each relative position over its length as the other oligonucleotide or nucleic acid.

[0071] ‘ ‘Individual” means a human or non-human animal selected for treatment or therapy.

[0072] “Inhibiting the expression, translation, and / or activity” with reference to a target nucleic acid or protein means to reduce or block the expression, translation, and / or activity of such target relative to the expression, translation, and / or activity in an untreated or control sample and does not necessarily indicate a total elimination of expression, translation, and / or activity.

[0073] ‘ ‘Internucleoside linkage” refers to the covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein, “modified intemucleoside linkage” means any intemucleoside linkage other than a phosphodiester internucleoside linkage.14#14556606vl“Phosphorothioate internucleoside linkage” is a modified intemucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.

[0074] Representative intemucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations as further described below. Unless otherwise indicated, chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

[0075] The compounds of the present disclosure may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. For example, the compounds may be radiolabeled with radioactive isotopes, such as for example tritium (3H), iodine-125 (125I), or carbon-14 (14C). All isotopic variations of the compounds of the present disclosure, whether radioactive or not, are encompassed within the scope of the present disclosure.

[0076] “Isotopic variant” refers to a therapeutic agent (e.g., a compound and / or modified oligonucleotide disclosed herein) that contains an unnatural proportion of an isotope at one or more of the atoms that constitute such a therapeutic agent. In certain embodiments, an “isotopic variant” of a therapeutic agent contains unnatural proportions of one or more isotopes, including, but not limited to, hydrogen (H), deuterium (2H), tritium (3H), carbon- 11 (nC), carbon-12 (12C), carbon-13 (13C), carbon-14 (14C), nitrogen-13 (13N), nitrogen-14 (14N), nitrogen-15 (15N), oxygen-14 (14O), oxygen-15 (15O), oxygen-16 (16O), oxygen-17 (17O), oxygen- 18 (18O), fluorine- 17 (17F), fluorine- 18 (18F), phosphorus-31 (31P), phosphorus-32 (32P), phosphorus-33 (33P), sulfur-32 (32S), sulfur-33 (33S), sulfur-34 (34S), sulfur-35 (35S), sulfur-36 (36S), chlorine-35 (35C1), chlorine-36 (36C1), chlorine-37 (37C1), bromine-79 (79Br), bromine-81 (81Br), iodine-123 (123I), iodine-125 (125I), iodine-127 (127I), iodine-129 (129I), and iodine-131 (131I). In certain embodiments, an “isotopic variant” of a therapeutic agent contains unnatural proportions of one or more isotopes, including, but not limited to, hydrogen (H), deuterium (2H), tritium (3H), carbon-11 (nC), carbon-12 (12C), carbon-13 (13C), carbon-14 (14C), nitrogen-13 (13N), nitrogen-14 (14N), nitrogen-15 (15N), oxygen-14 (14O), oxygen-15 (15O), oxygen-16 (16O), oxygen-17 (17O), oxygen-18 (18O), fluorine-17 (17F), fluorine- 18 (18F), phosphorus-31 (31P), phosphorus-32 (32P), phosphorus-33 (33P), sulfur-32 (32S), sulfur-33 (33S), sulfur-34 (34S), sulfur-35 (35S), sulfur-36 (36S), chlorine-3515#14556606vl(35C1), chlorine-36 (36C1), chlorine-37 (37C1), bromine-79 (79Br), bromine-81 (81Br), iodine- 123 (123I), iodine-125 (125I), iodine-127 (127I), iodine-129 (129I), and iodine-131 (131I).

[0077] It will be understood that, in a therapeutic agent (e.g., a compound and / or modified oligonucleotide disclosed herein), any hydrogen can be2H, for example, or any carbon can be13C, for example, or any nitrogen can be15N, for example, or any oxygen can be18O, for example, where feasible according to the judgment of one of skill. In certain embodiments, an “isotopic variant” of a therapeutic agent contains unnatural proportions of deuterium (D).

[0078] ‘ ‘Mismatch” or “non-complementary” refers to a first nucleobase of a first nucleobase sequence that does not form a canonical base pair with a second nucleobase at the corresponding position in a second nucleobase sequence when the first and second nucleobase sequences are aligned in an antiparallel orientation. In certain embodiments, the first and second nucleobases of a mismatch do not form a base pair (e.g., through hydrogen bonding). In certain embodiments, the first and second nucleobases of a mismatch form a non-canonical base pair. For example, nucleobases including, but not limited to, a universal nucleobase and hypoxanthine (inosine (I)), are capable of forming a non-canonical base pair with one or more other types of nucleobases but may still be referred to as mismatched or non-complementary with respect to the one or more other types of nucleobases. In certain embodiments, a non-canonical base pair comprises a wobble base pair (e.g., I:U, G:U, I:A, I:C). In certain embodiments, an oligonucleotide described herein comprises one or more mismatches. In certain embodiments, an oligonucleotide comprises one or more mismatches relative to a target nucleic acid (e.g., an mRNA encoding PLIN1). In certain embodiments, an oligonucleotide sense strand comprises one or more mismatches relative to an oligonucleotide antisense strand. A mismatch can occur at an internal or terminal region of an oligonucleotide duplex; e.g., at an internal or terminal region of a duplex between an oligonucleotide of the present disclosure and a target nucleic acid; at an internal or terminal region of a duplex between sense and antisense strands of the present disclosure.

[0079] ‘ ‘Modified oligonucleotide” means an oligonucleotide, wherein at least one sugar, nucleobase, or internucleoside linkage is modified. In certain embodiments, the compounds described herein comprise at least one modified oligonucleotide.

[0080] “Modulating” refers to changing or adjusting a feature in a cell, tissue, organ, or organism. For example, modulating PLIN 1 RNA can mean to increase or decrease the level and / or activity of PLIN 1 RNA and / or PLIN 1 protein in a cell, tissue, organ, or organism. A “modulator” effects the change in the cell, tissue, organ, or organism. For example, a PLIN1 compound can be a modulator that decreases the amount and / or activity of PLIN 1 RNA and / or PLIN1 protein in a cell, tissue, organ, or organism.16#14556606vl

[0081] “Motif’ means the pattern of unmodified and modified sugar moieties, nucleobases, and / or internucleoside linkages, in an oligonucleotide.

[0082] “Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, and double- stranded nucleic acids.

[0083] “Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid. As used herein a “naturally occurring nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). A “modified nucleobase” is a naturally occurring nucleobase that is chemically modified. A “universal base” or “universal nucleobase” is a nucleobase other than a naturally occurring nucleobase and modified nucleobase and is capable of pairing with any nucleobase.

[0084] “Nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage.

[0085] ‘ ‘Nucleoside” means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. “Modified nucleoside” means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.

[0086] “Oligomeric Compound” means a compound comprising one or more oligonucleotides and optionally one or more additional features, such as a conjugate group or terminal group. Examples of oligomeric compounds include single-stranded and doublestranded compounds, such as, oligonucleotides, antisense oligonucleotides, interfering RNA compounds (RNAi compounds), microRNA targeting oligonucleotides, occupancy-based compounds (e.g., mRNA processing or translation blocking compounds and splicing compounds). RNAi compounds include double-stranded compounds (e.g., short-interfering RNA (siRNA) and double- stranded RNA (dsRNA)) and single- stranded compounds (e.g., single- stranded siRNA (ssRNA), single- stranded RNAi (ssRNAi), short hairpin RNA (shRNA) and microRNA mimics) which work at least in part through the RNA-induced silencing complex (RISC) pathway resulting in sequence specific degradation and / or sequestration of a target nucleic acid through a process known as RNA interference (RNAi). The term “RNAi compound” is meant to be equivalent to other terms used to describe nucleic acid compounds that are capable of mediating sequence- specific RNA interference, for example, interfering RNA (iRNA), iRNA agent, RNAi agent, short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, and others. Additionally, the term “RNAi” is meant to be equivalent to other terms used to describe sequence- specific RNA interference.17#14556606vl

[0087] “Oligomeric duplex” refers to a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.” The oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides. In certain embodiments, the terms “duplexed oligomeric compound” and “modified oligonucleotide” are used interchangeably. In other embodiments, the terms “oligomeric duplex” and “compound” are used interchangeably.

[0088] “Oligonucleotide” means a polymer of linked nucleosides, each of which can be modified or unmodified, independent from one another.

[0089] “Parenteral administration” means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventricular administration.

[0090] “Periphery” or “peripheral” refers to all cells, tissues, organs, organ systems, or other body parts (e.g., limbs) which are not part of the central nervous system (CNS). The CNS refers to parts of the nervous system which are enclosed in the meninges (i.e., dura mater, arachnoid mater, pia mater), including the brain and the spinal cord, as well as the retina, optic nerve, olfactory nerves, and the olfactory epithelium. Notably, blood vessels which supply the CNS, and peripheral nerves are considered part of the periphery.

[0091] “Pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an individual. In certain embodiments, a pharmaceutically acceptable carrier or diluent aids the administration of a compound to and absorption by an individual and can be included in the compositions of the present disclosure without causing a significant adverse toxicological effect on the patient. Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, normal saline solutions, and the like. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as PBS or water-for-injection. One of skill in the art will recognize that other pharmaceutical excipients are useful in the present disclosure.

[0092] “Pharmaceutically acceptable salt” refers to physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds or oligonucleotides, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. As used herein, a pharmaceutically acceptable salt is any salt of a compound provided herein which retains its biological properties and which is not toxic or otherwise undesirable for pharmaceutical use. The pharmaceutically acceptable salts of the therapeutic agents disclosed herein include salts that are prepared with relatively nontoxic18#14556606vlacids or bases, depending on the particular substituents found on the compounds or modified oligonucleotides described herein.

[0093] When compounds of the present disclosure contain relatively acidic functionalities, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, either neat or in a suitable inert solvent.

[0094] When compounds of the present disclosure contain relatively basic functionalities, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in a suitable inert solvent.

[0095] Thus, the compounds of the present disclosure may exist as salts, such as with pharmaceutically acceptable acids. Such salts may be derived from a variety of organic and inorganic counter-ions well known in the art.

[0096] Pharmaceutically acceptable salts further include, by way of example only and without limitation, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like, and when the compound contains a basic functionality, salts of non-toxic organic or inorganic acids, such as hydrohalides, e.g. hydrochloride and hydrobromide, sulfate, phosphate, sulfamate, nitrate, acetate, trifluoroacetate, trichloroacetate, propionate, hexanoate, cyclopentylpropionate, glycolate, glutarate, pyruvate, lactate, malonate, succinate, sorbate, ascorbate, malate, maleate, fumarate, tartarate, citrate, benzoate, 3-(4-hydroxybenzoyl)benzoate, picrate, cinnamate, mandelate, phthalate, laurate, methanesulfonate (mesylate), ethanesulfonate, 1,2-ethane-disulfonate, 2- hydroxy ethanesulfonate, benzenesulfonate (besylate), 4-chlorobenzenesulfonate, 2- naphthalenesulfonate, 4-toluenesulfonate, camphorate, camphorsulfonate, 4- methylbicyclo[2.2.2]-oct-2-ene- 1 -carboxylate, glucoheptonate, 3-phenylpropionate, trimethylacetate, tert-butylacetate, lauryl sulfate, gluconate, benzoate, glutamate, hydroxynaphthoate, salicylate, stearate, cyclohexylsulfamate, quinate, muconate, and the like. In certain embodiments, the pharmaceutically acceptable salt of the compounds and modified oligonucleotides disclosed herein is a sodium or a potassium salt. In certain embodiments, the pharmaceutically acceptable salt of the compounds and modified oligonucleotides disclosed herein is a sodium salt.

[0097] The neutral forms of the compounds are preferably regenerated by contacting the salt with a base or acid and isolating the parent compound in the conventional manner. The parent form of the compound may differ from the various salt forms in certain physical properties, such as solubility in polar solvents. In embodiments, compounds of the present disclosure contain both basic and acidic functionalities that allow the compounds to be converted into either base or acid addition salts. The neutral forms of the compounds may be regenerated by19#14556606vlcontacting the salt with a base or acid and isolating the parent compound in a conventional manner. The parent form of the compounds differs from the various salt forms in certain physical properties, such as solubility in polar solvents, but, unless specifically indicated, the salts disclosed herein are equivalent to the parent form of the compound for the purposes of the present disclosure.

[0098] “Pharmaceutical agent” means a compound that provides a therapeutic benefit when administered to an individual.

[0099] “Phosphorothioate linkage” means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom.

[0100] “Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an oligonucleotide.

[0101] “Prevent” refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time.

[0102] “RNA interference compound” or “RNAi compound” means a compound that acts, at least in part, through an RNA-induced silencing complex (RISC) pathway or Ago2, but not through RNase H, to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double- stranded siRNA, singlestranded siRNA, and microRNA, including microRNA mimics.

[0103] “Sense oligonucleotide” or “sense strand” means the strand of a double-stranded compound that includes a region that is substantially complementary to a region of the antisense strand of the compound.

[0104] “Specifically inhibit” with reference to a target nucleic acid or protein means to reduce or block expression, translation, and / or activity of the target nucleic acid or protein while minimizing or eliminating effects on non-target nucleic acids or proteins.

[0105] ‘ ‘Subunit” with reference to an oligonucleotide means a nucleotide, nucleoside, nucleobase or sugar or a modified nucleotide, nucleoside, nucleobase, or sugar as provided herein.

[0106] A syndrome, disease, disorder, or condition “associated with PLIN1” as used herein means one or more of metabolic syndrome, obesity, cardiovascular disease (e.g., high blood pressure, high cholesterol, high blood sugar, coronary artery disease, congestive heart failure, heart attack, and stroke), diabetes mellitus (e.g., Type-2 diabetes), insulin resistance, fatty liver disease, kidney disease, energy homeostasis, immune / inflammatory conditions, nausea, diarrhea, fibrogenesis, alcoholic steatohepatitis and diabetic nephropathy. In some20#14556606vlembodiments, a PLIN 1 -associated disorder is diabetes mellitus (e.g., Type-2 diabetes), obesity, insulin resistance, high blood sugar, and / or cardiovascular disease.

[0107] Symptoms of a syndrome, disease, disorder or condition associated with PLIN 1 as used herein include clinical symptoms and biochemical endpoints. Clinical symptoms may include, for example: a body mass index (BMI) indicative of overweight and / or obese status (e.g., a BMI >25), excess amounts of abdominal fat, a waist circumference indicative of overweight and / or obese status (e.g., >35 inches for females, >40 inches for males), excessive sweating, tiredness (e.g., fatigue), joint and back pain, difficulty breathing, sleep problems, thirst, frequent urination, dysregulated hunger signals, impaired vision, peripheral neuropathy, weakness, confusion, nausea, dizziness, headaches, dry mouth, water retention, heart palpitations, hypertension (e.g., high blood pressure), dyslipedima, insulin resistance, hyperinsulinemia, hepatic steatosis, dysglycemia (e.g., hyperglycemia, hypoglycemia), mental conditions associated with obesity (e.g., depression), and any combination thereof. Biochemical endpoints may include, for example: reducing adipose tissue (white or brown), reducing BMI (e.g., to <25), reducing waist circumference (e.g., to <35 inches for females, <40 inches for males), reducing serum triglyceride levels (e.g., to <150mg / dL), increasing high-density lipoprotein cholesterol (e.g., >50mg / dL for females, >40mg / dL for males), reducing fasting glucose (e.g., to <100mg / dL), reducing systolic and / or diastolic blood pressure values at rest (e.g., < 130mm Hg systolic, <85 mm Hg diastolic), regulating or increasing adipocyte lipolysis and / or rate of lipolysis, increasing leptin production, increasing lean body mass increase (e.g., increasing skeletal muscle mass), decreasing adiponectin expression, increasing indicators of white adipose browning (e.g., increasing Ucpl expression), or any combination thereof. In certain embodiments, compositions or methods provided herein do not increase ectopic lipid accumulation (for instance, in the heart or liver), and / or do not increase tissue triglyceride levels (e.g., in the heart). In certain embodiments, compositions or methods provided herein increase satiety and emesis; decrease fat storage; increase adiponectin secretion; increase thermogenesis in brown adipose tissue; increase oxygen consumption; decrease lipogenesis; decrease gluconeogenesis; increase insulin- mediated glucose update (e.g., in muscle); increase glucose signaling (e.g., in muscle tissue); decrease palatability of high fat, high sugar food; increase acetylcholine release in stomach; improve gastric emptying; improve secretion of cholecystokinin; improve interaction with gut microbiome; or any combination thereof.

[0108] “Target nucleic acid,” “target RNA,” and “nucleic acid target” all mean a nucleic acid capable of being targeted by compounds described herein.21#14556606vl

[0109] “Target region” means a portion of a target nucleic acid to which one or more compounds is targeted.

[0110] “Targeting moiety” refers to a conjugate group of a compound that provides preferential localization to a selected target, (e.g., a target molecule, cell or cell type, compartment such as a cellular compartment or organ compartment, tissue, organ, or region of the body), as compared to the same compound absent such a moiety. Targeting moieties may include lipids (or lipophilic moieties), ligands, and other compounds or molecular groups that functionally direct the compounds of the present invention to a selected target. In one embodiment, a targeting moiety may target to a selected target molecule, cell or cell type, or compartment. In another embodiment, a targeting moiety is a conjugate group that decreases, prevents, or excludes the conjugate group from binding to, passing through, or associating with a particular molecule, cell or cell type, or tissue compartment.

[0111] In certain embodiments, a targeting moiety provides preferential localization for a selected target by way of an enhanced affinity (e.g., binding affinity) of the compound for the selected target or portion thereof (e.g., a receptor on a target cell); for example, a targeting moiety can be considered to provide preferential localization to adipose tissue if it has high binding affinity for adipocytes. In certain embodiments, a targeting moiety provides preferential localization for a selected target by way of an enhanced stability of the compound (e.g., resistance to degradation in a target region of the body); for example, a targeting moiety can be considered to provide preferential localization to the lower intestine if it inhibits or decreases degradation of the compound by the acidic environment of the lower intestine. In certain embodiments, a targeting moiety provides preferential localization for a selected target by way of decreased localization of the compound to a non-target; for example, a targeting moiety can be considered to provide preferential localization to adipose tissue if it is excluded from muscle tissue. In certain embodiments, a targeting moiety provides preferential localization for a selected target by way of decreased affinity (e.g., binding affinity) of the compound for a non-target; for example, a targeting moiety can be considered to provide preferential localization to adipose tissue if it has decreased affinity for nonadipose tissue.

[0112] “Terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

[0113] “Therapeutically effective amount” or “effective amount” means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual. A “therapeutically effective amount” or “effective amount” is an amount sufficient for a compound to accomplish a stated purpose relative to the absence of the22#14556606vlcompound (e.g., achieve the effect for which it is administered, treat, prevent, or ameliorate a disease or reduce one or more symptoms of a disease or condition). An example of a “therapeutically effective amount” or “effective amount” is an amount sufficient to contribute to the treatment, prevention, amelioration, or reduction of a symptom or symptoms of a disease. A “reduction” of a symptom or symptoms (and grammatical equivalents of this phrase) means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s). A “prophylactically effective amount” of a drug is an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of an injury, disease, pathology, or condition, or reducing the likelihood of the onset (or reoccurrence) of an injury, disease, pathology, or condition, or their symptoms. The term “therapeutically effective amount,” as used herein, refers to that amount of the therapeutic agent sufficient to provide a therapeutic benefit to an individual, such as treating, preventing, or ameliorating the disease or disorder or symptom thereof, as described above. For example, for the given parameter, a therapeutically effective amount will show an increase or decrease of at least 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90%, or at least 100%. Therapeutic efficacy can also be expressed as “-fold” increase or decrease. For example, a therapeutically effective amount can have at least a 1.2- fold, 1.5-fold, 2-fold, 5-fold, or more effect over a control.

[0114] “Treating” or “treatment” as used herein (and as well-understood in the art) broadly includes any approach for obtaining beneficial or desired results in a subject’s condition, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of the extent of a disease, stabilizing (i.e., not worsening) the state of disease, prevention of a disease’s transmission or spread, delay or slowing of disease progression, amelioration or palliation of the disease state, diminishment of the reoccurrence of disease, and remission, whether partial or total and whether detectable or undetectable. In other words, “treatment” as used herein includes any cure, amelioration, or prevention of a disease. Treatment may prevent the disease from occurring; inhibit the disease’s spread; relieve the disease’s symptoms, fully or partially remove the disease’s underlying cause, shorten a disease’s duration, or do a combination of these things. The treatment or amelioration of symptoms can be based on objective or subjective parameters, including the results of a physical examination, biochemical endpoints, and patient reported outcomes.

[0115] “Treating” and “treatment” as used herein include prophylactic treatment. Treatment methods include administering to a subject a therapeutically effective amount of a compound described herein. “Treat” refers to administering a compound or pharmaceutical composition23#14556606vlto an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal. The administering step may consist of a single administration or may include a series of administrations. The length of the treatment period depends on a variety of factors, such as the severity of the condition, the age of the patient, the concentration of the compound, the activity of the compositions used in the treatment, or a combination thereof. It will also be appreciated that the effective dosage of an agent used for the treatment or prophylaxis may increase or decrease over the course of a particular treatment or prophylaxis regime. In some instances, chronic administration may be required. For example, the compositions are administered to the subject in an amount and for a duration sufficient to treat the patient.

[0116] Certain compounds of the present disclosure possess asymmetric carbon atoms (optical or chiral centers) or double bonds; the enantiomers, racemates, diastereomers, tautomers, geometric isomers, stereoisometric forms that may be defined, in terms of absolute stereochemistry, as (R)- or (S)- or, as (D)- or (L)-for amino acids, and individual isomers are encompassed within the scope of the present disclosure. The compounds of the present disclosure do not include those that are known in art to be too unstable to synthesize and / or isolate. The present disclosure is meant to include compounds in racemic and optically pure forms. Optically active (R)- and (S)-, or (D)- and (L)-isomers may be prepared using chiral synthons or chiral reagents or resolved using conventional techniques. When the compounds described herein contain olefinic bonds or other centers of geometric asymmetry, and unless specified otherwise, it is intended that the compounds include both E and Z geometric isomers.

[0117] As used herein, the term “isomers” refers to compounds having the same number and kind of atoms, and hence the same molecular weight, but differing in respect to the structural arrangement or configuration of the atoms.

[0118] The term “tautomer,” as used herein, refers to one of two or more structural isomers which exist in equilibrium, and which are readily converted from one isomeric form to another. It will be apparent to one skilled in the art that certain compounds of this disclosure may exist in tautomeric forms, all such tautomeric forms of the compounds being within the scope of the disclosure.

[0119] Unless otherwise stated, structures depicted herein are also meant to include all stereochemical forms of the structure (i.e., the R and S configurations for each asymmetric center). Therefore, single stereochemical isomers as well as enantiomeric and diastereomeric mixtures of the present compounds are within the scope of the disclosure.24#14556606vl

[0120] As used herein, “chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.

[0121] Unless otherwise stated, structures depicted herein are also meant to include compounds which differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures except for the replacement of a hydrogen by a deuterium or tritium, or the replacement of a carbon by13C- or14C-enriched carbon are within the scope of this disclosure.

[0122] As used herein, “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the results of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate intemucleoside linkage.Certain Embodiments

[0123] In certain aspects, the disclosure relates to methods, compounds, and compositions for inhibiting PLIN1. In certain embodiments, PLIN1 is specifically inhibited. In certain embodiments, PLIN1 is specifically degraded. In certain embodiments, PLIN1 expression is inhibited. In certain embodiments, PLIN1 translation is inhibited. In certain embodiments, PLIN 1 activity is inhibited.

[0124] In certain embodiments, PLIN1 expression, translation, or activity is reduced by at least 10% relative to the expression, translation, or activity in an untreated or control sample. For example, in certain embodiments, PLIN1 expression, translation, or activity is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, 10-50%, 25-50%, 25-75%, 50-75%, 50-99%, or 75- 25#14556606vl99% relative to the expression, translation, or activity in an untreated or control sample. In certain embodiments, PLIN1 expression, translation, or activity in adipose tissue (e.g., in adipocytes) is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, 10-50%, 25-50%, 25- 75%, 50-75%, 50-99%, or 75-99% relative to the expression, translation, or activity in an untreated or control sample. In certain embodiments, PLIN1 expression, translation, or activity in adipocytes is reduced by less than 10%, less than 20%, less than 30%, less than 40%, less than 50%, less than 60%, less than 70%, less than 80%, less than 90%, less than 95%, 10-50%, 10-25%, 25-50%, 25-75%, 50-75%, 50-90%, or 75-95% relative to the expression, translation, or activity in an untreated or control sample. In certain embodiments, PLIN 1 expression, translation, or activity is reduced as measured by any suitable assay, including but not limited to, an immunoassay, a hybridization-based assay, or a sequencingbased assay (e.g., RNA-Seq).

[0125] In certain aspects, the disclosure relates to compounds targeted to a PLIN 1 nucleic acid. In certain embodiments, the PLIN 1 nucleic acid has the sequence set forth in GENBANK Accession No. NM_002666.5 (SEQ ID NO: 1). In certain embodiments, the PLIN1 nucleic acid has the sequence set forth in SEQ ID NO: 2.

[0126] In certain embodiments, the compound is an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

[0127] Certain embodiments provide a compound comprising a modified oligonucleotide (e.g., of 8 to 30, for example, 8 to 23 or 13 to 20, linked nucleosides in length) having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of a nucleobase sequence that is identical or fully complementary to an equal length portion of one or more of the nucleobase sequences of SEQ ID NOs: 1 or 2. In certain embodiments, the modified oligonucleotide is a first modified oligonucleotide, and the compound comprises a second modified oligonucleotide (e.g., of 8 to 30, for example, 8 to 23 or 13 to 20, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, the second modified oligonucleotide has a nucleobase sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% complementary to the first modified oligonucleotide.

[0128] Certain embodiments provide a compound comprising a modified oligonucleotide (e.g., of 8 to 30, for example, 8 to 23 or 13 to 20, linked nucleosides in length) having a26#14556606vlnucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases differing by no more than 3 nucleobases from any one of the nucleobase sequences of SEQ ID NOs: 11-33 and 34-53. In certain embodiments, the modified oligonucleotide has a nucleobase sequence selected from any one of the nucleobase sequences of SEQ ID NOs: 11-33 and 34-53. In certain embodiments, the modified oligonucleotide has a nucleobase sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% complementary to an equal length portion of the nucleobase sequence of one or more of SEQ ID NOs: 1 or 2. In certain embodiments, the modified oligonucleotide comprises at least one modification selected from a modified intemucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the compound is double- stranded.

[0129] Certain embodiments provide a compound comprising a first modified oligonucleotide (e.g., of 8 to 30, for example, 8 to 23 or 13 to 20, linked nucleosides in length) having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-33 and 34-53 and a second modified oligonucleotide (e.g., of 8 to 30, for example, 8 to 23 or 13 to 20, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, the second modified oligonucleotide has a nucleobase sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% complementary to the first modified oligonucleotide.

[0130] Certain embodiments provide a compound comprising a modified oligonucleotide (e.g., of 8 to 30, for example, 8 to 23 or 13 to 20, linked nucleosides in length) having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases differing by no more than 3 nucleobases from any one of the nucleobase sequences of SEQ ID NOs: 11-33 and 34-53. In certain embodiments, the modified oligonucleotide has a nucleobase sequence selected from any one of the nucleobase sequences of SEQ ID NOs: 11-33 and 34-53. In certain embodiments, the modified oligonucleotide has a nucleobase sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% complementary to an equal length portion of the nucleobase sequence of one or more of SEQ ID NOs: 1 or 2. In certain embodiments, the modified oligonucleotide comprises at least one modification27#14556606vlselected from a modified intemucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the compound is double- stranded.

[0131] Certain embodiments provide a compound comprising a first modified oligonucleotide (e.g., of 8 to 30, for example, 8 to 23 or 13 to 20, linked nucleosides in length) having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-33 and 34-53, and a second modified oligonucleotide (e.g., of 8 to 30, for example, 8 to 23 or 13 to 20, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, the second modified oligonucleotide has a nucleobase sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% complementary to the first modified oligonucleotide. In certain embodiments, the first modified oligonucleotide has a nucleobase sequence selected from any one of the nucleobase sequences of SEQ ID NOs: 11-33, and the second modified oligonucleotide has a nucleobase sequence selected from any one of the nucleobase sequences of SEQ ID NOs: 34-53.

[0132] Certain embodiments provide a compound comprising a modified oligonucleotide (e.g., of 8 to 30, for example, 8 to 23 or 13 to 20, linked nucleosides in length) having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases differing by no more than 3 nucleobases from any one of the nucleobase sequences of SEQ ID NOs: 11-33 and 34-53. In certain embodiments, the modified oligonucleotide has a nucleobase sequence selected from any one of the nucleobase sequences of SEQ ID NOs: 11-33 and 34-53. In certain embodiments, the modified oligonucleotide has a nucleobase sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% complementary to an equal length portion of the nucleobase sequence of one or more of SEQ ID NOs: 1 or 2. In certain embodiments, the modified oligonucleotide comprises at least one modification selected from a modified intemucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the compound is double- stranded.

[0133] Certain embodiments provide a compound comprising a first modified oligonucleotide (e.g., of 8 to 30, for example, 8 to 23 or 13 to 20, linked nucleosides in length) having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase28#14556606vlsequences of SEQ ID NOs: 11-33 and 34-53, and a second modified oligonucleotide (e.g., of 8 to 30, for example, 8 to 23 or 13 to 20, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, the second modified oligonucleotide has a nucleobase sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% complementary to the first modified oligonucleotide. In certain embodiments, the first modified oligonucleotide has a nucleobase sequence selected from any one of the nucleobase sequences of SEQ ID NOs: 11-33, and the second modified oligonucleotide has a nucleobase sequence selected from any one of the nucleobase sequences of SEQ ID NOs: 34-53.

[0134] In certain embodiments, the first modified oligonucleotide of any preceding compound or other compound herein comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the second modified oligonucleotide of any preceding compound comprises at least one modification selected from a modified intemucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage or a methylphosphonate intemucleoside linkage. In certain embodiments, the phosphorothioate intemucleoside linkage or methylphosphonate intemucleoside linkage is at the 3' terminus of the first or second modified oligonucleotide or at the 5' terminus of the first modified oligonucleotide. In certain embodiments, the modified sugar comprises a modification selected from a halogen, an alkoxy group and a bicyclic sugar. In certain embodiments, the modified sugar comprises a 2'-F modification. In certain embodiments, the modified sugar comprises a 2'-OMe modification. In certain embodiments, each nucleoside of the first modified oligonucleotide comprises a modified sugar. In certain embodiments, each nucleoside of the second modified oligonucleotide comprises a modified sugar. In certain embodiments, the modified sugar comprises a modification selected from a halogen, an alkoxy group and a bicyclic sugar or a combination thereof. In certain embodiments, the modified sugar comprises a modification selected from 2'-MOE, 2'-F, and 2'-OMe or a combination thereof. In certain embodiments, the first modified oligonucleotide comprises no more than ten 2'-F sugar modifications. In certain embodiments, the second modified oligonucleotide comprises no more than five 2'-F sugar modifications.

[0135] In certain embodiments, the compound of any preceding embodiment comprises a conjugate group. In certain embodiments, the conjugate group is attached to the 5' end of a modified oligonucleotide. In certain embodiments, the conjugate group is attached to the 2' or 3' position of the ribosyl ring of a modified oligonucleotide. In certain embodiments, the conjugate group is attached to the 5' nucleoside of a modified oligonucleotide.29#14556606vl

[0136] Conjugate groups suitable for use in the present compounds include receptor ligands and lipids. Receptor ligands may comprise small molecules such as tropomyosin receptor B (TrkB) ligands, cannabinoid receptor type 1 (CBi) ligands, a.4 1 / 7 integrin ligands, N-methyl- D-aspartate receptor (NMDA) ligands, glutamate transporter 1 (GLT-1) ligands, or a sugar such as galactose, mannose, or sucrose, which may be modified or unmodified (e.g., one or more GalNAc moieties). Conjugate groups may also include PEG and albumin binding moieties or a combination of a PEG or an albumin binding group with a lipid or ligand. Further receptor ligands may be ligands that bind to receptors that are selectively expressed on adipocytes or are specifically related to metabolic dysregulation.

[0137] In certain embodiments, the conjugate group is a targeting moiety. In certain embodiments, the conjugate group comprises one or more targeting moieties selected from one or more TrkB ligands, one or more CBi ligands, one or more a.401 / 7 integrin ligands, one or more NMDA ligands, one or more GLT-1 ligands, and one or more GalNAc moieties.

[0138] In certain embodiments, a conjugate group of an oligonucleotide comprises one or more TrkB ligands. In certain embodiments, the one or more TrkB ligands is attached at the 5’ or 3’ end of the oligonucleotide or both the 5’ and 3’ ends of the oligonucleotide. In certain embodiments, the oligonucleotide is attached to the TrkB ligand through a phosphodiester group. In certain embodiments, the oligonucleotide is attached to the TrkB ligand through a phosphorothioate group.

[0139] In certain embodiments, a conjugate group of an oligonucleotide comprises one or more CBi ligands. In certain embodiments, the one or more CBi ligands is attached at the 5’ or 3’ end of the oligonucleotide or both the 5’ and 3’ ends of the oligonucleotide. In certain embodiments, the oligonucleotide is attached to the CBi ligand through a phosphodiester group. In certain embodiments, the oligonucleotide is attached to the CBi ligand through a phosphorothioate group.

[0140] In certain embodiments, a conjugate group of an oligonucleotide comprises one or more a40i / 7 integrin ligands. In certain embodiments, the one or more a40i / 7 integrin ligands is attached at the 5’ or 3’ end of the oligonucleotide or both the 5’ and 3’ ends of the oligonucleotide. In certain embodiments, the oligonucleotide is attached to the a40i / 7 integrin ligand through a phosphodiester group. In certain embodiments, the oligonucleotide is attached to the a40i / 7 integrin ligand through a phosphorothioate group.

[0141] In certain embodiments, a conjugate group of an oligonucleotide comprises one or more NMDA ligands. In certain embodiments, the one or more NMDA ligands is attached at the 5’ or 3’ end of the oligonucleotide or both the 5’ and 3’ ends of the oligonucleotide. In certain embodiments, the oligonucleotide is attached to the NMDA ligand through a30#14556606vlphosphodiester group. In certain embodiments, the oligonucleotide is attached to the NMDA ligand through a phosphorothioate group.

[0142] In certain embodiments, a conjugate group of an oligonucleotide comprises one or more GLT-1 ligands. In certain embodiments, the one or more GLT-1 ligands is attached at the 5’ or 3’ end of the oligonucleotide or both the 5’ and 3’ ends of the oligonucleotide. In certain embodiments, the oligonucleotide is attached to the GLT-1 ligand through a phosphodiester group. In certain embodiments, the oligonucleotide is attached to the GLT-1 ligand through a phosphorothioate group.

[0143] In certain embodiments, a conjugate group of an oligonucleotide comprises one or more GalNAc moieties. In certain embodiments, the one or more GalNAc moieties is attached at the 5’ or 3’ end of the oligonucleotide or both the 5’ and 3’ ends of the oligonucleotide. In certain embodiments, the oligonucleotide is attached to the GalNAc moiety through a phosphodiester group. In certain embodiments, the oligonucleotide is attached to the GalNAc moiety through a phosphorothioate group.

[0144] In certain embodiments, the conjugate group may be (or may include) a lipid. In certain embodiments the lipid is attached, with or without a linker, at the 5’ or 3’ end of the oligonucleotide, or at both the 5’ and 3’ ends of the oligonucleotide. In certain embodiments, the lipid may have an intemucleosidic attachment. In one embodiment, the lipid is branched or unbranched, and may be saturated or unsaturated. In one embodiment, the lipid is a saturated or unsaturated Cs-Cso lipid, a saturated or unsaturated C12-C30 lipid, or a C16-C22 lipid. In one embodiment the lipid is a saturated or unsaturated Ci6, C19, C21, C23, or C25 lipid. In one embodiment, the lipid is a C21 lipid. In one embodiment the lipid is attached to a PEG linker via an amine group.

[0145] In certain embodiments, the conjugate group may be (or may include) one or more substituted or unsubstituted alkyl or alkenyl. In certain embodiments, the substituted or unsubstituted alkyl or alkenyl is attached to an intemucleoside linkage of a modified oligonucleotide. In certain embodiments, a modified oligonucleotide comprises one or more substituted or unsubstituted alkyl or alkenyl. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl are attached to one or more intemucleoside linkages of a modified oligonucleotide. In certain embodiments, a modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C4-C30 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C5-C25 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C14-C2531#14556606vlhydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated Ci6, C19, C23, or C25 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C17 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C19 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C23 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C25 hydrocarbon chain. In some embodiments the hydrocarbon chain is joined to the oligonucleotide with a linker.

[0146] In certain embodiments, a substituted or unsubstituted alkyl or alkenyl is attached to an intemucleoside linkage of a modified oligonucleotide (e.g., a second modified oligonucleotide or sense oligonucleotide). In certain embodiments, the intemucleoside linkage is between nucleosides that are within 10 positions (e.g., within 8 positions, within 6 positions, within 5 positions, within 4 positions, within 3 positions, within 2 positions) from a terminal end (e.g., the 5' and / or 3' end) of the modified oligonucleotide. In certain embodiments, the intemucleoside linkage is between nucleosides that are within 5 positions from the 5' end of the modified oligonucleotide. In certain embodiments, the intemucleoside linkage is between nucleosides that are within 5 positions from the 3' end of the modified oligonucleotide.

[0147] In certain embodiments, the intemucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, positions 7 and 8, positions 8 and 9, positions 9 and 10, positions 10 and 11, positions 11 and 12, positions 12 and 13, or positions 13 and 14 from the 5' end of the modified oligonucleotide. In certain embodiments, the intemucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, or positions 7 and 8 from the 5' end of the modified oligonucleotide. In certain embodiments, the intemucleoside linkage is between positions 2 and 3 from the 5' end of the modified oligonucleotide. In certain embodiments, the intemucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, positions 7 and 8, positions 8 and 9, positions 9 and 10, positions 10 and 11, positions 11 and 12, positions 12 and 13, or positions 13 and 14 from the 3' end of the modified oligonucleotide. In certain embodiments, the intemucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, or positions 7 and 8 from the 3' end of the modified oligonucleotide. In32#14556606vlcertain embodiments, the intemucleoside linkage is between positions 2 and 3 from the 3' end of the modified oligonucleotide.

[0148] In certain embodiments, the modified oligonucleotide comprises one or more lipids and one or more targeting moieties selected from one or more TrkB ligands, one or more CBi ligands, one or more a.4 1 / 7 integrin ligands, one or more NMDA ligands, one or more GLT-1 ligands, and one or more GalNAc moieties. In certain embodiments, the modified oligonucleotide comprises one or more lipids and polyethylene glycol. In certain embodiments, the modified oligonucleotide comprises polyethylene glycol and one or more targeting moieties selected from one or more TrkB ligands, one or more CBi ligands, one or more a.401 / 7 integrin ligands, one or more NMDA ligands, one or more GLT-1 ligands, and one or more GalNAc moieties. In certain embodiments, the modified oligonucleotide comprises one or more lipids, polyethylene glycol, and one or more targeting moieties selected from one or more TrkB ligands, one or more CBi ligands, one or more a40i / 7 integrin ligands, one or more NMDA ligands, one or more GLT-1 ligands, and one or more GalNAc moieties.

[0149] Certain embodiments provide a compound comprising a first modified oligonucleotide selected from any one of Ref ID NOs: IA1892, IA1893, IA1894, IA1895, IA1896, IA1897, IA1899, IA1900, IA1901, IA1902, IA1903, IA1904, IA1905, IA1906, IA2889, IA2890, IA2891, IA2892, IA2893, IA2894, IA2895, IA2896, IA2897, and IA2898, and a second modified oligonucleotide 14 to 21 linked nucleosides in length fully complementary to the first modified oligonucleotide.

[0150] Certain embodiments provide a compound comprising a first modified oligonucleotide selected from any one of Ref ID NOs: IA1892, IA1893, and IA1897, and a second modified oligonucleotide selected from any one of Ref ID NOs: IS2463, IS2464, and IS2468.

[0151] Certain embodiments provide a compound comprising a first modified oligonucleotide of Ref ID NO: IA1892, and a second modified oligonucleotide of Ref ID NO: IS2463.

[0152] Certain embodiments provide a compound comprising a first modified oligonucleotide of Ref ID NO: IA1893, and a second modified oligonucleotide of Ref ID NO: IS2464. In certain embodiments, the second modified oligonucleotide of Ref ID NO:IS2464 comprises:the point of attachment to the5'-most nucleoside of the second modified oligonucleotide. In certain embodiments, the33#14556606vlsecond modified oligonucleotide of Ref ID NO: IS2464 comprises:, where a’ is the point of attachment to a linker / ligand, and b’ is the point of attachment to the 5'-most nucleoside of the second modified oligonucleotide.

[0153] Certain embodiments provide a compound comprising a first modified oligonucleotide of Ref ID NO: IA1897, and a second modified oligonucleotide of Ref ID NO: IS2468. In certain embodiments, the second modified oligonucleotide of Ref ID NO:IS2468 comprises:the point of attachment to the5'-most nucleoside of the second modified oligonucleotide. In certain embodiments, the second modified oligonucleotide of Ref ID NO: IS2468 comprises:the point of attachment to a linker / ligand, and b’ is the point of attachment to the 5'-most nucleoside of the second modified oligonucleotide.

[0154] In certain embodiments, the compound of any foregoing embodiment is in a pharmaceutically acceptable salt form. In certain embodiments, the pharmaceutically acceptable salt is a sodium salt. In certain embodiments, the pharmaceutically acceptable salt is a potassium salt.

[0155] Certain embodiments provide a compound of any foregoing embodiment that is a stereoisomer.

[0156] In certain embodiments, provided herein is a population of modified oligonucleotides, wherein all the phosphorothioate intemucleoside linkages of the modified oligonucleotide are stereorandom. In certain embodiments, provided herein is a population of compounds, wherein all the phosphorothioate intemucleoside linkages of the modified oligonucleotide are stereorandom.

[0157] Certain embodiments provide a composition comprising the compound of any preceding embodiment and a pharmaceutically acceptable carrier.

[0158] Certain embodiments provide a composition comprising a compound of any preceding embodiment, for use in therapy.

[0159] Certain embodiments provide a method of treating, preventing, or ameliorating a disease, disorder or condition associated with PLIN1 in an individual comprising34#14556606vladministering to the individual a compound targeted to PLIN1, thereby treating, preventing, or ameliorating the disease.

[0160] In certain embodiments, the compound or composition of any foregoing embodiment is administered to an individual. In certain embodiments, the disease, disorder, or condition is metabolic syndrome, obesity, cardiovascular disease (e.g., high blood pressure, high cholesterol, high blood sugar, coronary artery disease, congestive heart failure, heart attack, and stroke), diabetes mellitus (e.g., Type-2 diabetes), insulin resistance, fatty liver disease, kidney disease, energy homeostasis, immune / inflammatory conditions, nausea, diarrhea, fibrogenesis, alcoholic steatohepatitis, and / or diabetic nephropathy. In certain embodiments, administering the compound inhibits, reduces, and / or improves diabetes mellitus (e.g., Type- 2 diabetes), obesity, insulin resistance, high blood sugar, and / or cardiovascular disease, or a symptom thereof. In certain embodiments the compounds, compositions and methods provided herein are directed to reduction of BMI, excess amounts of abdominal fat, waist circumference, excess sweating, tiredness (e.g., fatigue), joint and back pain, difficulty breathing, sleep problems, thirst, frequent urination, dysregulated hunger signals, impaired vision, peripheral neuropathy, weakness, confusion, nausea, dizziness, headaches, dry mouth, water retention, heart palpitations, hypertension (e.g., high blood pressure), dyslipedima, insulin resistance, hyperinsulinemia, hepatic steatosis, dysglycemia (e.g., hyperglycemia, hypoglycemia), mental conditions associated with obesity (e.g., depression), or a combination thereof. In certain embodiments, the compounds, compositions, and methods provided herein are directed to reducing adipose tissue (white or brown), reducing BMI (e.g., to <25), reducing waist circumference (e.g., to <35 inches for females, <40 inches for males), reducing serum triglyceride levels (e.g., to <150mg / dL), increasing high-density lipoprotein cholesterol (e.g., >50mg / dL for females, >40mg / dL for males), reducing fasting glucose (e.g., to <100mg / dL), reducing systolic and / or diastolic blood pressure values at rest (e.g., < 130mm Hg systolic, <85 mm Hg diastolic), regulating or increasing adipocyte lipolysis and / or rate of lipolysis, increase leptin production, increasing lean body mass (e.g., increasing skeletal muscle mass), decreasing adiponectin expression, increasing indicators of white adipose browning (e.g., increasing Ucpl expression), or any combination thereof. In certain embodiments, compositions or methods provided herein do not increase ectopic lipid accumulation (for instance, in the heart or liver), and / or do not increase tissue triglyceride levels (e.g., in the heart). In certain compounds, compositions or methods provided herein are directed to increasing lipolysis in fat tissue and liver; increasing satiety and emesis; decreasing fat storage; increasing adiponectin secretion; increasing thermogenesis in brown adipose tissue; increasing oxygen consumption; decreasing lipogenesis; decreasing35#14556606vlgluconeogenesis; increasing insulin-mediated glucose update (e.g., in muscle); increasing glucose signaling (e.g., in muscle tissue); decreasing palatability of high fat, high sugar food; increasing acetylcholine release in stomach; improving gastric emptying; improving interaction with gut microbiome; or any combination thereof.

[0161] In certain embodiments, a compound or a composition comprising a compound of any preceding embodiment is administered to an individual in a therapeutically effective amount. In certain embodiments, a composition comprising a compound of any preceding embodiment is administered to an individual at a dosage level sufficient to deliver about 1 to 100 mg / kg of body weight of the individual. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual at a fixed dose of about 25 mg to about 1,000 mg. In certain embodiments, the compound or composition is administered to the individual one or more times in a day up to the dosage level or fixed dose.

[0162] In certain embodiments, a composition comprising a compound of any preceding embodiment is administered to an individual daily, weekly, monthly, quarterly, or yearly. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual about once per quarter (i.e., once every three months) to about once per year. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual about once per quarter, about once every six months or about once per year.

[0163] Certain embodiments provide a method of inhibiting expression of PLIN 1 in a cell, the method comprising contacting the cell with a compound targeted to PLIN1, thereby inhibiting expression of PLIN 1 in the cell.

[0164] In certain embodiments, the cell is in adipose tissue of an individual. In certain embodiments, a compound targeting PLIN 1 comprises a targeting moiety that preferentially localizes the compound to adipose tissue by increasing the affinity (e.g., binding affinity) of the compound for the adipocytes.

[0165] In certain embodiments, a compound targeting PLIN1 is provided in a formulation that preferentially localizes the compound to adipose tissue of an individual. In certain embodiments, the formulation comprises a polymer-based or lipid-based delivery system comprising the compound. Examples of such polymer-based and lipid-based delivery systems, including nanoparticle encapsulation for targeted delivery of nucleic acid compounds, are known in the art (see, for example, Dong Y, Siegwart DJ, Anderson DG. Strategies, design, and chemistry in siRNA delivery systems. Adv Drug Deliv Rev. 2019 Apr; 144:133-147, the entire contents of which are hereby incorporated herein by reference).36#14556606vl

[0166] In certain embodiments, the cell is in adipose tissue, liver tissue, breast or skeletal muscle. In certain embodiments, the adipose tissue is brown adipose tissue (e.g., brown fat). In certain embodiments, the adipose tissue is white adipose tissue (e.g., white fat). In certain embodiments, the adipose tissue is “beige” adipose tissue (e.g., white adipose tissue which has developed one or more features of brown adipose tissue, such as increased expression of uncoupling protein 1). In certain embodiments, a cell in adipose tissue is an adipocyte, a preadipocyte, fibroblast, vascular endothelial cell, or adipose tissue macrophage. In certain embodiments a cell in liver tissue is a hepatocyte or a non-parenchymal cell. In certain embodiments the tissue is adipocytes in breast. In certain embodiments, the tissue is skeletal muscle cells.

[0167] In certain embodiments, the individual has, or is at risk of having metabolic syndrome, obesity, cardiovascular disease (including high blood pressure, high cholesterol, high blood sugar, coronary artery disease, congestive heart failure, heart attack, and stroke), diabetes mellitus (e.g., Type-2 diabetes), insulin resistance, fatty liver disease, energy homeostasis, immune / inflammatory conditions, nausea, diarrhea, fibrogenesis, alcoholic steatohepatitis, and / or diabetic nephropathy.

[0168] Certain embodiments provide a method of reducing or inhibiting metabolic syndrome, obesity, cardiovascular disease (including high blood pressure, high cholesterol, high blood sugar, coronary artery disease, congestive heart failure, heart attack, and stroke), diabetes mellitus (e.g., Type-2 diabetes), insulin resistance, fatty liver disease, kidney disease, energy homeostasis, immune / inflammatory conditions, nausea, diarrhea, fibrogenesis, alcoholic steatohepatitis, diabetic nephropathy, or a symptom of any thereof in an individual, the method comprising administering a compound targeted to PLIN 1 to the individual, thereby reducing or inhibiting metabolic syndrome, obesity, cardiovascular disease (including high blood pressure, high cholesterol, high blood sugar, coronary artery disease, congestive heart failure, heart attack, and stroke), diabetes mellitus (e.g., Type-2 diabetes), insulin resistance, fatty liver disease, kidney disease, energy homeostasis, immune / inflammatory conditions, nausea, diarrhea, fibrogenesis, alcoholic steatohepatitis, diabetic nephropathy, or a symptom of any thereof in the individual. In certain embodiments, the compound is any of the foregoing compounds.

[0169] In certain embodiments, a compound or composition described herein is administered parenterally. In certain embodiments, a compound or composition described herein is administered subcutaneously. In certain embodiments, a compound or composition described herein is administered intravenously. In certain embodiments, a compound or composition described herein is administered intramuscularly. In certain embodiments, a compound or37#14556606vlcomposition described herein is administered intraarterially. In certain embodiments, a compound or composition described herein is administered intraperitoneally. In certain embodiments, a compound or composition described herein is administered intracranially. In certain embodiments, a compound or composition described herein is administered intrathecally. In certain embodiments, a compound or composition described herein is administered intracerebroventricularly.

[0170] Certain embodiments provide use of a compound targeted to PLIN 1 for treating, preventing, or ameliorating a disease, disorder or condition associated with PLIN1. In certain embodiments, the compound is a compound targeted to PLIN1. In certain embodiments, the compound is any of the foregoing compounds.

[0171] Certain embodiments provide use of a compound targeted to PLIN 1 in the manufacture of a medicament for treating, preventing, or ameliorating a disease, disorder or condition associated with PLIN1 In certain embodiments, the compound is a compound targeted to PLIN1. In certain embodiments, the compound is any of the foregoing compounds.Certain Indications

[0172] In certain aspects, the disclosure relates to methods of inhibiting PLIN1 expression, which can be useful for treating, preventing, or ameliorating a disease, disorder or condition associated with PLIN1 in an individual, by administration of a compound that targets PLIN1. In certain embodiments, the compound can be a PLIN 1 specific inhibitor. In certain embodiments, the compound can be an antisense oligonucleotide, an oligomeric compound, or an oligonucleotide targeted to PLIN1.

[0173] In certain aspects, the disclosure relates to treating, preventing, or ameliorating a disease, disorder or condition associated with PLIN1.

[0174] In certain embodiments, the presently described compounds may be used in: (a) a method of inhibiting PLIN 1 in an individual having, or at risk of having, a disease, disorder or condition associated with PLIN1, or a symptom thereof, (b) a method of treating, preventing, or ameliorating a disease, disorder or condition associated with PLIN1, or a symptom thereof, (c) a use of the compound for the manufacture of a medicament for the inhibition of PLIN 1 in an individual. Furthermore, in certain embodiments, the invention is drawn to the presently described compounds for use in (a) a method of inhibiting PLIN 1 in an individual having, or at risk of having, a disease, disorder or condition associated with PLIN1, or a symptom thereof, (b) a method of treating, preventing, or ameliorating a disease, disorder or condition associated with PLIN1, or a symptom thereof, (c) the manufacture of a medicament for the inhibition of PLIN 1 in an individual.38#14556606vl

[0175] In any of the foregoing methods or uses, the compound can be an oligomeric compound. In any of the foregoing methods or uses, the compound can be single-stranded or double- stranded. In any of the foregoing methods or uses, the compound can be targeted to PLIN1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. In certain embodiments, the compound comprises one or more modified oligonucleotides. In certain embodiments, the compound comprises a first modified oligonucleotide and a second modified oligonucleotide. In certain embodiments, a modified oligonucleotide is 8 to 80 linked nucleosides in length, 10 to 30 linked nucleosides in length, 14 to 30 linked nucleosides in length, 14 to 23 linked nucleosides in length, or 19 to 23 linked nucleosides in length. In certain embodiments, a modified oligonucleotide having a nucleobase sequence is at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to the nucleobase sequences recited in one or more of SEQ ID NOs: 1 or 2 over its length. In certain embodiments, a modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar and / or at least one modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate intemucleoside linkage. In certain embodiments, the modified sugar is a bicyclic sugar, 2'-MOE, 2'-F, or 2'-OMe. In certain embodiments, the modified nucleobase is a 5-methylcytosine. In any of the foregoing embodiments, each modified oligonucleotide is independently 12 to 30, 14 to 30, 14 to 25, 14 to 24, 14 to 23, 16 to 23, 17 to 23, 18 to 23, 19 to 23, 19 to 22, or 19 to 20 linked nucleosides in length. In certain embodiments, a modified oligonucleotide having a nucleobase sequence has at least 1, at least 2, or at least 3 mismatches to a region of the nucleobase sequences of one or more of SEQ ID NOs: 1 or 2.

[0176] In any of the forgoing methods or uses, the compound comprises a first and second modified oligonucleotide, wherein there is a region of complementarity between a first modified oligonucleotide and a second modified oligonucleotide. In certain embodiments, the region of complementarity between the first oligonucleotide and the second oligonucleotide is 14 to 23, 19 to 23, or 21 to 23 linked nucleosides in length. In certain embodiments, the first modified oligonucleotide is fully complementary to the second modified oligonucleotide.

[0177] In certain embodiments, the first modified oligonucleotide is partially complementary to the second modified oligonucleotide. In certain embodiments, the first modified oligonucleotide is at least at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% complementary to the second modified oligonucleotide. In certain embodiments, the first modified oligonucleotide is a sense strand having a nucleobase sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least39#14556606vl95% or 100% complementary to the second modified oligonucleotide having an antisense sequence of any one of SEQ ID NOs: 11-33. In certain embodiments, the first modified oligonucleotide is a sense strand having a nucleobase sequence that has one or more (e.g., at least 1, at least 2, at least 3) mismatches to a region of the second modified oligonucleotide having an antisense sequence of any one of SEQ ID NOs: 11-33. In certain embodiments, the one or more mismatches include one or more mismatches at positions 1-14 from the 5’-end of the first modified oligonucleotide. In certain embodiments, the one or more mismatches include a mismatch at position 6 from the 5 ’-end of the first modified oligonucleotide.

[0178] In certain embodiments, the first modified oligonucleotide is an antisense strand having a nucleobase sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to the second modified oligonucleotide having a sense sequence of any one of SEQ ID NOs: 11-33. In certain embodiments, the first modified oligonucleotide is an antisense strand having a nucleobase sequence that has one or more (e.g., at least 1, at least 2, at least 3) mismatches to a region of the second modified oligonucleotide having a sense sequence of any one of SEQ ID NOs: 11-33. In certain embodiments, the one or more mismatches include one or more mismatches at positions 1-14 from the 5 ’-end of the second modified oligonucleotide. In certain embodiments, the one or more mismatches include a mismatch at position 6 from the 5 ’-end of the second modified oligonucleotide.

[0179] In certain embodiments, the first modified oligonucleotide comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the second modified oligonucleotide comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage or a methylphosphonate internucleoside linkage. In certain embodiments, the modified intemucleoside linkage is at the 3' terminus of the first or second modified oligonucleotide or at the 5' terminus of the first or second modified oligonucleotide. In certain embodiments, the first or second modified oligonucleotide comprises one or more modified sugars. In certain embodiments, each nucleoside of the first or second modified oligonucleotide comprises a modified sugar. In certain embodiments, the modified sugar comprises a modification selected from a halogen, an alkoxy group and a bicyclic sugar. In certain embodiments, the modified sugar comprises a modification selected from 2'-MOE, 2'-F, and 2'-OMe or a combination thereof. In certain embodiments, the first or second modified oligonucleotide comprises no more than ten 2'-F40#14556606vlsugar modifications. In certain embodiments, the first or second modified oligonucleotide comprises no more than five 2'-F sugar modifications.

[0180] In any of the forgoing methods or uses, a compound comprises a conjugate group. In certain embodiments, one or more conjugate groups may be attached at one or more of the 5' end of an oligonucleotide, at the 3' end of an oligonucleotide, as part of a modified intemucleoside linkage, at the 2' position of the ribosyl ring of a terminating nucleoside of a modified nucleotide or modified intemucleoside linkage, or attached on a base of a nucleoside. In certain embodiments, the conjugate group is attached to the 5' end of a modified oligonucleotide. In certain embodiments, the conjugate group is a targeting moiety. In certain embodiments, the targeting moiety comprises a ligand of a receptor or a lipid, or multiple ligands or multiple lipids, or combinations thereof. In certain embodiments, the one or more targeting moieties is attached to the 2' or 3' position of the ribosyl ring. In certain embodiments, the one or more targeting moieties is attached to the 5' or 3' end of an oligonucleotide of the modified oligonucleotide. In certain embodiments, one or more of the targeting moieties is attached at the 5' nucleoside of a modified oligonucleotide, and is selected from or a salt, solvate, or hydrate thereof.

[0181] In any of the foregoing methods or uses, the compound comprises a first modified oligonucleotide selected from any one of SEQ ID NOs: 11-33 and 34-53, and a second modified oligonucleotide 8 to 30 linked nucleosides in length fully complementary to the first modified oligonucleotide. In certain embodiments, the compound comprises a first modified oligonucleotide selected from any one of SEQ ID NOs: 11-33 and 34-53.

[0182] In certain embodiments, the compound is in a pharmaceutically acceptable salt form. In certain embodiments, the pharmaceutically acceptable salt is a sodium salt. In certain embodiments, the pharmaceutically acceptable salt is a potassium salt. In certain embodiments, a composition comprises the compound of any one of the foregoing embodiments and a pharmaceutically acceptable carrier.

[0183] In any of the foregoing methods or uses, a compound or composition comprising a compound of any preceding embodiment is administered to an individual in a therapeutically effective amount. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual at a dosage level sufficient to deliver about 1 to 100 mg / kg of body weight of the individual. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual at a fixed dose of about 25 mg to about 1,000 mg. In certain embodiments, the composition is administered to the individual one or more times in a day up to the dosage level or fixed dose.41#14556606vl

[0184] In any of the foregoing methods or uses, a compound or composition comprising a compound of any preceding embodiment is administered to an individual daily, weekly, monthly, quarterly, or yearly. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual about once a month or once per quarter (i.e., once every three months) to about once per year. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual about once per quarter, about once every six months or about once per year.Certain Compounds

[0185] In certain aspects, the disclosure relates to a compound that comprises or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises a nucleobase sequence complementary to the nucleobase sequence or portion thereof of a target nucleic acid.

[0186] In certain aspects, the disclosure relates to a compound that comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to the nucleobase sequence or portion thereof of a target nucleic acid.

[0187] In certain aspects, the disclosure relates to a compound that comprises or consists of an antisense oligonucleotide. In certain embodiments, the antisense oligonucleotide has a nucleobase sequence complementary to the nucleobase sequence or portion thereof of a target nucleic acid.

[0188] In certain aspects, the disclosure relates to a compound that is a single- stranded compound. In certain embodiments, the single-stranded compound comprises or consists of an oligomeric compound. In certain embodiments, such an oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugate group. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide or modified oligonucleotide of a single-stranded compound comprises a self-complementary nucleobase sequence. In certain aspects, the disclosure relates to a compound that is a doublestranded compound. In certain embodiments, the double- stranded compound comprises or consists of an oligomeric compound. In certain embodiments, the double- stranded compound comprises a first oligonucleotide and a second oligonucleotide. In certain embodiments, the first oligonucleotide has a region complementarity to a target nucleic acid and the second oligonucleotide has a region complementarity to the first modified oligonucleotide. In certain embodiments, the double- stranded compound comprises a modified oligonucleotide. In42#14556606vlcertain embodiments, the modified oligonucleotide has a region complementarity to a target nucleic acid. In certain embodiments, the double-stranded compound comprises a first modified oligonucleotide and a second modified oligonucleotide. In certain embodiments, the first modified oligonucleotide has a region complementarity to a target nucleic acid and the second modified oligonucleotide has a region complementarity to the first modified oligonucleotide. In certain embodiments, an oligonucleotide or modified oligonucleotide of a double-stranded compound is an RNA oligonucleotide. In such embodiments, the thymine nucleobase in the modified oligonucleotide is replaced by a uracil nucleobase.

[0189] In certain embodiments, a compound described herein comprises a conjugate group. In certain embodiments, the first oligonucleotide or first modified oligonucleotide of a double- stranded compound comprises a conjugate group. In certain embodiments, the second oligonucleotide or second modified oligonucleotide of a double- stranded compound comprises a conjugate group. In certain embodiments, a first oligonucleotide or first modified oligonucleotide and a second oligonucleotide or second modified oligonucleotide of a double- stranded compound each comprises a conjugate group.

[0190] In certain embodiments, a compound is 8-30 linked nucleosides in length. In certain embodiments, the first oligonucleotide or first modified oligonucleotide of a double- stranded compound is 8-30 linked nucleosides in length. In certain embodiments, the second oligonucleotide or second modified oligonucleotide is 8-30 linked nucleosides in length. In certain embodiments, the oligonucleotides or modified oligonucleotides of a double- stranded compound are blunt ended at one or both ends of the compound. In certain embodiments, the oligonucleotides or modified oligonucleotides of a double-stranded compound include non- complementary overhanging nucleosides at one or both ends of the compound.

[0191] In certain embodiments, a compound has a nucleobase sequence comprising at least 14 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-33 and 34-53. In certain embodiments, one of the oligonucleotides or modified oligonucleotides of a double-stranded compound has a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-33 and 34-53.

[0192] Examples of single-stranded and double-stranded compounds include, but are not limited to, oligonucleotides, antisense oligonucleotides, siRNAs, microRNA targeting oligonucleotides, occupancy-based compounds (e.g., mRNA processing or translation blocking compounds and splicing compounds), and single-stranded RNAi compounds (e.g., short hairpin RNAs (shRNAs), single stranded siRNAs (ssRNAs) and microRNA mimics).43#14556606vl

[0193] In certain embodiments, a compound described herein has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target region of a target nucleic acid to which it is targeted.

[0194] In certain embodiments, a compound described herein comprises an oligonucleotide 8 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 8 to 30 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 12 to 30 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 10 to 23 linked subunits in length.

[0195] In certain embodiments, the compound may further comprise an additional moiety, such as a conjugate group or delivery moiety. In certain embodiments, such compounds are oligomeric compounds, and the additional moiety is attached to an oligonucleotide. In certain embodiments, a conjugate group is attached to a nucleoside of an oligonucleotide.

[0196] In certain embodiments, compounds may be shortened or truncated. For example, one or more subunits may be deleted from the 5' end (5' truncation), or alternatively from the 3' end (3' truncation) of an oligonucleotide.

[0197] In certain embodiments, compounds may be lengthened. For example, one or more subunits may be attached to the 3' end or 5' end of an oligonucleotide. In certain embodiments, at least one subunit (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,43, 44, 45, 46, 47, 48, 49, 50, or more subunits) is attached to the 5' end of an oligonucleotide. In certain embodiments, at least one subunit (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35,36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more subunits) is attached to the 3' end of an oligonucleotide. In certain embodiments, at least one subunit may be attached to the 3' end or 5' end of an oligonucleotide of a double- stranded compound creating a 3' and / or 5' end overhang. In certain embodiments, at least one subunit (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more subunits) is attached to the 5' end of both oligonucleotides of a double-stranded compound. In certain embodiments, at least one subunit (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more subunits) is attached to the 3' end of both oligonucleotides of a doublestranded compound. In certain embodiments, subunits are attached to both oligonucleotides of a double-stranded compound at the same end (e.g., that subunits are attached to the 3' end44#14556606vlof one of the oligonucleotides and subunits are attached to the 5' end of the other oligonucleotide). In certain embodiments, when subunits are attached to both oligonucleotides of a double- stranded compound at the same end, the number of subunits attached to each oligonucleotide may be the same or may be different. In certain embodiments, when subunits are attached to both oligonucleotides of a double- stranded compound at the same end, the number of subunits attached to each oligonucleotide is the same. In certain embodiments, when subunits are attached to both oligonucleotides of a double- stranded compound at the same end, the number of subunits attached to each oligonucleotide is different. This scenario, where subunits are attached to both oligonucleotides of a double- stranded compound at the same end, may occur at one or both ends of a double- stranded compound. In certain embodiments, the subunits attached to the 3' and / or 5' end are modified.

[0198] In certain embodiments, compounds described herein are oligonucleotides. In certain embodiments, compounds described herein are modified oligonucleotides. In certain embodiments, compounds described herein are antisense oligonucleotides. In certain embodiments, compounds described herein are oligomeric compounds. In certain embodiments, compounds described herein are RNAi compounds. In certain embodiments, compounds described herein are siRNA compounds.

[0199] In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to PLIN 1 described herein. In certain embodiments, the compound can be double-stranded. In certain embodiments, the compound comprises a sense strand and an antisense strand forming a double-stranded region with the sense strand. In certain embodiments, the nucleobase sequences of the sense and antisense strands forming the double-stranded region are partially complementary. In certain embodiments, the nucleobase sequences of the sense and antisense strands forming the double- stranded region are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 70-99%, 75-95%, 80-90%, 80-95%, 85-95%, or 90-99% complementary. In certain embodiments, the nucleobase sequences of the sense and antisense strands forming the double- stranded region are fully complementary. In certain embodiments, the nucleobase sequences of the sense and antisense strands forming the double- stranded region comprise one or more mismatches. In certain embodiments, the nucleobase sequences of the sense and antisense strands forming the double-stranded region comprise 1, 2, 3, 4, 5, 6, 7, 8, or more, mismatches. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 from the 5 ’-end of the sense strand. In certain embodiments, the mismatch is at position 6 from the 5’- end of the sense strand. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7,45#14556606vl8, 9, 10, 11, or 12, 13 or 14 from the 3’-end of the sense strand. In certain embodiments, the sense strand is a modified oligonucleotide described herein. In certain embodiments, the antisense strand is a modified oligonucleotide described herein. In certain embodiments, the sense strand is a modified oligonucleotide described herein, and the antisense strand is a modified oligonucleotide described herein.

[0200] In certain embodiments, the compound comprises an oligonucleotide having a nucleobase sequence comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of any one of the nucleobase sequences of SEQ ID NOs: 11-33 and 34-53. In certain embodiments, the compound comprises an oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of Ref ID NOs: IS2463, IS2464, and IS2468. In certain embodiments, the compound comprises a second oligonucleotide. In certain embodiments, the compound comprises an oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of Ref ID NOs: IA1892, IA1893, and IA1897.

[0201] In certain embodiments, the compound comprises ribonucleotides in which the oligonucleotide has uracil (U) in place of thymine (T) for any of the sequences provided here. In certain embodiments, the compound comprises deoxyribonucleotides in which the oligonucleotide has thymine (T) in place of uracil (U) for any of the sequences provided here.Co-therapies

[0202] In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual who is receiving an additional prophylactic or therapeutic agent (e.g., as part of a co-therapy). In certain embodiments, the compound or composition comprising a compound of any preceding embodiment and the additional prophylactic or therapeutic agent are administered to the individual concurrently. In certain embodiments, the compound or composition comprising a compound of any preceding embodiment is administered to an individual who has already received an additional prophylactic or therapeutic agent. In certain embodiments, the compound or composition comprising a compound of any preceding embodiment is administered to the individual before administration of an additional prophylactic or therapeutic agent. In certain embodiments, the compound or composition comprising a compound of any preceding embodiment is administered to an individual who has not received additional prophylactic or therapeutic agent.

[0203] In certain embodiments, the additional prophylactic or therapeutic agent promotes release of a glucoregulatory hormone (e.g., glucagon, insulin, GLP-1, GIP, cortisol).46#14556606vlGlucoregulatory hormones are hormones involved in the regulation of blood glucose levels and maintenance of one or more glucose homeostasis (e.g., a fasting blood glucose level within about 70 to 100 mg / dL). Dysregulation of glucoregulatory hormones is associated with several metabolic disorders. Non-limiting examples of glucoregulatory hormones include, insulin, glucagon, glucagon-like peptide 1 (GLP-1), GLP-2, oxyntomodulin, glicentin, glicentin-related polypeptide (GRPP), major proglucagon fragment, intervening peptide 1 (IP-1), intervening peptide 2 (IP-2), incretins, glucose-dependent insulinotropic peptide (GIP), peptide tyrosine tyrosine (PYY), cholecystokinin (CCK), somatostatin, oxyntomodulin, ghrelin, cortisol, and amylin.

[0204] In certain embodiments, the additional prophylactic or therapeutic agent is a GLP-1 receptor ligand. GLP- 1 receptors are G-protein coupled receptors found on beta cells of the pancreas and neurons of the CNS. Non-limiting examples of GLP-1 receptor ligands include GLP-1, glucagon, semaglutide, dulaglutide, liraglutide, exenatide, lixisenatide, albiglutide, exendin-4, oxyntomodulin, dulaglutide, efpeglenatide, taspoglutide, ecnoglutide, trizepatide, mazdutide, survodutie, pemvidutide, cotadutide, and retatrutide.

[0205] In certain embodiments, the additional prophylactic or therapeutic agent is a sulfonylurea receptor (SUR) ligand. Sulfonylurea receptor (SUR) ligands stimulate activity of sulfonylurea receptors on pancreatic beta cells; activity of SURs induce or promote insulin secretion from pancreatic beta cells regardless of underlying blood glucose levels. Nonlimiting examples of SUR ligands include sulfonylurea, chlorpropamide, tolbutamide, glyburide (also known as glibenclamide), glipizide, glimepiride, gliclazide, meglitinide, nateglinide, repaglinide, diazoxide, 4-trans-hydroxy-glibenclamide, 3-cis-hydroxy- glibenclamide, midaglizole, LY397364, or LY389382.

[0206] In certain embodiments, the additional prophylactic or therapeutic agent is a dipeptidyl peptidase-4 inhibitor (i.e., gliptin). Dipeptidyl peptidase-4 (DPP-4) is an enzyme that degrades GLP-1 and GIP, two glucoregulatory hormones which stimulate the secretion or activity of insulin; accordingly, DPP-4 inhibitors disinhibit insulin to reduce glucose levels in the blood. Non-limiting examples of gliptins include Sitagliptin, Vildagliptin, Saxagliptin, Linagliptin, Gemigliptin, Anagliptin, Teneligliptin, Alogliptin, Trelagliptin, Omarigliptin, Evogliptin, Gosogliptin, Dutogliptin, Neogliptin, Retagliptin, Denagliptin, and Cofrogliptin.

[0207] In certain embodiments, the additional prophylactic or therapeutic agent is an adrenergic receptor ligand. Adrenergic receptors are a class of G protein-coupled receptors that bind catecholamines and have widespread effects on numerous tissues (e.g., adipocytes, and pancreatic cells). In certain embodiments, the adrenergic receptor ligand is epinephrine (i.e., adrenaline), norepinephrine (i.e., noradrenaline), or an analog thereof.47#14556606vlCertain Mechanisms

[0208] In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein comprise or consist of antisense oligonucleotides. In certain embodiments, compounds comprise or consist of oligomeric compounds. In certain embodiments, compounds described herein are capable of hybridizing to a target nucleic acid. In certain embodiments, compounds described herein selectively affect one or more target nucleic acid. Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in a significant undesired activity.

[0209] In certain embodiments, hybridization of a compound described herein to a target nucleic acid results in recruitment of one or more proteins that cause the cleavage of the target nucleic acid. For example, certain compounds described herein, or a portion of the compounds, are loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of the target nucleic acid by Argonaute. Compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

[0210] In certain embodiments, hybridization of compounds described herein to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in the alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of the compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in the alteration of RNA processing. In certain such embodiments, hybridization of the compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

[0211] Activities resulting from the hybridization of a compound to a target nucleic acid may be observed directly or indirectly. In certain embodiments, observation or detection of an activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a phenotypic change in a cell or animal.48#14556606vlCertain Modifications

[0212] In certain aspects, the disclosure relates to compounds that comprise or consist of oligonucleotides. Oligonucleotides consist of linked nucleosides. In certain embodiments, oligonucleotides may be unmodified RNA or DNA or may be modified. In certain embodiments, the oligonucleotides are modified oligonucleotides. In certain embodiments, the modified oligonucleotides comprise at least one modified sugar, modified nucleobase or modified intemucleoside linkage relative to an unmodified RNA or DNA. In certain embodiments, an oligonucleotide has a modified nucleoside. A modified nucleoside may comprise a modified sugar, a modified nucleobase or both a modified sugar and a modified nucleobase. Modified oligonucleotides may also include end modifications, e.g., 5'-end modifications and 3 '-end modifications.Sugar Modifications and Motifs

[0213] In certain embodiments, a modified sugar is a substituted furanosyl sugar or non- bicyclic modified sugar. In certain embodiments, a modified sugar is a bicyclic or tricyclic modified sugar. In certain embodiments, a modified sugar is a sugar surrogate. A sugar surrogate may comprise one or more substitutions described herein.

[0214] In certain embodiments, a modified sugar is a substituted furanosyl or non-bicyclic modified sugar. In certain embodiments, the furanosyl sugar is a ribosyl sugar. In certain embodiments, the furanosyl sugar comprises one or more substituent groups, including, but not limited to, substituent groups at the 2', 3', 4', and 5' positions.

[0215] In certain embodiments, substituents at the 2' position include, but are not limited to, F and OCH3 (“OMe”, “O-methyl” or “methoxy”). In certain embodiments, substituent groups at the 2' position suitable for non-bicyclic modified sugars include, but are not limited to, halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, F, Cl, Br, SCH3, SOCH3, SO2CH3, ONO2, NO2, N3, and NH2. In certain embodiments, substituent groups at the 2' position include, but are not limited to, O-(Ci-Cio) alkoxy, alkoxyalkyl, O-alkyl, S-alkyl, N-alkyl, O- alkenyl, S-alkenyl, N-alkenyl, O-alkynyl, S-alkynyl, N-alkynyl, O-alkyl-O-alkyl, alkynyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted Ci to C10 alkyl or C2 to C10 alkenyl and alkynyl. In certain embodiments, substituent groups at the 2' position include, but are not limited to, alkaryl, aralkyl, O-alkaryl, and O-aralkyl. In certain embodiments, these 2' substituent groups can be further substituted with one or more substituent groups independently selected from hydroxyl, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. In certain embodiments, substituent groups at the 2' position include, but are not limited to, O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nCH3, O(CH2)nONH2, O(CH2)nNH2,49#14556606vlO(CH2)nSCH3, and O(CH2)nON[(CH2)nCH3)]2, where n and m are independentiy from 1 to about 10. In certain embodiments, substituent groups at the 2' position include, but are not limited to, OCH2CH2OCH3 (“MOE”), O(CH2)2ON(CH3)2 (“DMAOE”), O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”), and OCH2C(=O)-N(H)CH3(“NMA”).

[0216] In certain embodiments, substituent groups at the 4' position suitable for non-bicyclic modified sugars include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. In certain embodiments, substituent groups at the 5' position suitable for non-bicyclic modified sugars include, but are not limited to, methyl (“Me”) (R or S), vinyl, and methoxy. In certain embodiments, substituents described herein for the 2', 4' and 5' position can be added to other specific positions on the sugar. In certain embodiments, such substituents may be added to the 3' position of the sugar on the 3' terminal nucleoside or the 5' position of the 5' terminal nucleoside. In certain embodiments, a non-bicyclic modified sugar may comprise more than one non-bridging sugar substituent. In certain such embodiments, non-bicyclic modified sugars substituents include, but are not limited to, 5'-Me-2'-F, 5'-Me-2'-OMe (including both R and S isomers). In certain embodiments, modified sugar substituents include those described in Migawa et al., WO 2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0217] In certain embodiments, a modified sugar is a bicyclic sugar. A bicyclic sugar is a modified sugar comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, a bicyclic sugar comprises a bridging substituent that bridges two atoms of the furanosyl ring to form a second ring. In certain embodiments, a bicyclic sugar does not comprise a furanosyl moiety. A “bicyclic nucleoside” (“BNA”) is a nucleoside having a bicyclic sugar. In certain embodiments, the bicyclic sugar comprises a bridge between the 4' and 2' furanose ring atoms. In certain embodiments, the bicyclic sugar comprises a bridge between the 5' and 3' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. In certain embodiments, 4' to 2' bridging substituents include, but are not limited to, 4'-CH2-2', 4'-(CH2)2-2', 4'- (CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'-CH2-S-2', 4'-(CH2)2-O-2' (“ENA”), 4'-CH(CH3)-O-2' (“constrained ethyl” or “cEt” when in the S configuration), 4'- CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'- CH(CH2OCH3)-O-2' (“constrained MOE” or “cMOE”) and analogs thereof (e.g., U.S. Patent No. 7,399,845), 4'-C(CH3)(CH3)-O-2' and analogs thereof (e.g., U.S. Patent No. 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (e.g., U.S. Patent No. 8,278,425), 4'-CH2-O-N(CH3)-2' (e.g., U.S. Patent Publication No.2004 / 0171570), 4'-CH2-N(R)-O-2', wherein R is H, C1-C12 alkyl, or a protecting group (e.g., U.S. Patent No. 7,427,672), 4'-CH2-C(H)(CH3)-2' (e.g., Chattopadhyaya et al., J. Org. Chem.,50#14556606vl2009, 74, 118- 134), and 4'-CH2-C(=CH2)-2' and analogs thereof (e.g., U.S. Patent No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference. Additional representative U.S. Patents and U.S. Patent Publications that teach the preparation of bicyclic nucleic acid nucleotides include, but are not limited to, the following: U.S. Patent Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008 / 0039618; US 2009 / 0012281; US 2013 / 0190383; and WO 2013 / 036868, the entire contents of each of which are hereby incorporated herein by reference. Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L- ribofuranose and P-D-ribofuranose (see e.g., WO 99 / 14226). Specified bicyclic nucleosides herein are in the P-D configuration, unless otherwise specified.

[0218] In certain embodiments, a modified sugar is a sugar surrogate. In certain embodiments, a sugar surrogate has the oxygen atom replaced, e.g., with a sulfur, carbon, or nitrogen atom. In certain such embodiments, the sugar surrogate may also comprise bridging and / or non-bridging substituents as described herein. In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. In certain such embodiments, the sugar surrogate comprises a cyclobutyl moiety in place of the pentofuranosyl sugar. In certain embodiments, the sugar surrogate comprises a six membered ring in place of the pentofuranosyl sugar. In certain embodiments, the sugar surrogate comprises a tetrahydropyran (“THP”) in place of the pentofuranosyl sugar. In certain embodiments, the sugar surrogate comprises a morpholino in place of the pentofuranosyl sugar. Representative US patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Patent Nos. 4,981,957; 5,118,800; 5,166,315; 5,185,444; 5,319,080;5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,700,920; 7,875,733; 7,939,677, 8,088,904; 8,440,803; and 9,005,906, the entire contents of each of the foregoing are hereby incorporated herein by reference.

[0219] In certain embodiments, sugar surrogates comprise acyclic moieties. In certain embodiments, the sugar surrogate is an unlocked nucleic acid (“UNA”). A UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked “sugar” residue. In one example, UNA also encompasses a monomer where the bonds between CT-C4' have been removed (i.e., the covalent carbon-oxygen-carbon bond between the Cl' and C4' carbons). In another example, the C2'-C3' bond (i.e., the covalent carbon-carbon bond between the C2' and C3' carbons) of the sugar has been removed.51#14556606vlRepresentative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Patent No. 8,314,227; and U.S. Patent Publication Nos. 2013 / 0096289; 2013 / 0011922; and 2011 / 0313020, the entire contents of each of which are hereby incorporated herein by reference. In certain embodiments, sugar surrogates comprise peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013 / 130378, the entire contents of which is hereby incorporated herein by reference. Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.

[0220] In certain aspects, the disclosure relates to compounds comprising at least one oligonucleotide wherein the nucleosides of such oligonucleotide comprise one or more types of modified sugars and / or unmodified sugars arranged along the oligonucleotide or region thereof in a defined pattern or “sugar motif’. In certain instances, such sugar motifs include, but are not limited to, any of the patterns of sugar modifications described herein.

[0221] In certain embodiments, an oligonucleotide comprises a gapmer sugar motif. A gapmer oligonucleotide comprises or consists of a region having two external “wing” regions and a central or internal “gap” region. The gap and wing regions form a contiguous sequence of nucleosides, wherein the majority of nucleoside sugars of each of the wings differ from the majority of nucleoside sugars of the gap. In certain embodiments, the wing regions comprise a majority of modified sugars and the gap comprises a majority of unmodified sugars. In certain embodiments, the nucleosides of the gap are deoxynucleosides. Compounds with a gapmer sugar motif are described in, for example US Patent 8,790,919, the entire contents of which is hereby incorporated herein by reference.

[0222] In certain embodiments, one or both oligonucleotides of a double-stranded compound comprise a triplet sugar motif. An oligonucleotide with a triplet sugar motif comprises three identical sugar modifications on three consecutive nucleosides. In certain embodiments, the triplet is at or near the cleavage site of the oligonucleotide. In certain embodiments, an oligonucleotide of a double- stranded compound may contain more than one triplet sugar motif. In certain embodiments, the identical sugar modification of the triplet sugar motif is a 2'-F modification. Compounds with a triplet sugar motif are disclosed, for example, in U.S. Patent No. 10,668,170, the entire contents of which is incorporated herein by reference.

[0223] In certain embodiments, one or both oligonucleotides of a double-stranded compound comprise a quadruplet sugar motif. An oligonucleotide with a quadruplet sugar motif comprises four identical sugar modifications on four consecutive nucleosides. In certain embodiments, the quadruplet is at or near the cleavage site. In certain embodiments, an52#14556606vloligonucleotide of a double- stranded compound may contain more than one quadruplet sugar motif. In certain embodiments, the identical sugar modification of the quadruplet sugar motif is a 2'-F modification. For a double- stranded compound having a duplex region of 19-23 nucleotides in length, the cleavage site of the antisense oligonucleotide is typically around the 10, 11, and 12 positions from the 5'-end. In certain embodiments, the quadruplet sugar motif is at the 8, 9, 10, 11 positions; the 9, 10, 11, 12 positions; the 10, 11, 12, 13 positions; the 11, 12, 13, 14 positions; or the 12, 13, 14, 15 positions of the sense oligonucleotide, counting from the first nucleoside of the 5 '-end of the sense oligonucleotide, or, the count starting from the first paired nucleotide within the duplex region from the 5 '-end of the sense oligonucleotide. In certain embodiments, the quadruplet sugar motif is at the 8, 9, 10, 11 positions; the 9, 10, 11, 12 positions; the 10, 11, 12, 13 positions; the 11, 12, 13, 14 positions; or the 12, 13, 14, 15 positions of the antisense oligonucleotide, counting from the first nucleoside of the 5 '-end of the antisense oligonucleotide, or, the count starting from the first paired nucleotide within the duplex region from the 5'- end of the antisense oligonucleotide. The cleavage site may change according to the length of the duplex region of the doublestranded compound and may change the position of the quadruplet accordingly.

[0224] In certain embodiments, an oligonucleotide comprises an alternating sugar motif. In certain embodiments, one or both oligonucleotides of a double-stranded compound comprise an alternating sugar motif. An oligonucleotide with an alternating sugar motif comprises at least two different sugar modifications wherein one or more consecutive nucleosides comprising a first sugar modification alternates with one or more consecutive nucleosides comprising a second sugar modification and one or more consecutive nucleosides comprising a third sugar modification, etc. For example, if A, B and C each represent one type of modification to the nucleoside, the alternating motif can be “ABABABABABAB...,” “AABBAABBAABB...,” “AABAABAABAAB “AAABAAABAAAB...,” “AAABBBAAABBB...,” or “ABCABCABCABC...” etc. In certain embodiments, the alternating sugar motif is repeated for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleobases along an oligonucleotide. In certain embodiments, the alternating sugar motif is comprised of two different sugar modifications. In certain embodiments, the alternating sugar motif comprises 2'-OMe and 2'-F sugar modifications.

[0225] In certain embodiments, each nucleoside of an oligonucleotide is independently modified with one or more sugar modifications provided herein. In certain embodiments, each oligonucleotide of a double-stranded compound independently has one or more sugar motifs provided herein. In certain embodiments, an oligonucleotide containing a sugar motif,53#14556606vlis fully modified in that each nucleoside other than the nucleosides comprising the sugar motif comprises a sugar modification.Nucleobase Modifications and Motifs

[0226] In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides that do not comprise a nucleobase, referred to as an abasic nucleoside.

[0227] In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5- hydroxymethyl cytosine, 5- methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N- methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (OC-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5- ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8- aza and other 8-substituted purines, 5-halo, particularly, 5-bromo, 5-trifluoromethyl, 5- halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2- aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N- benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as l,3-diazaphenoxazine-2-one, l,3-diazaphenothiazine-2- one, and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2- pyridone.

[0228] Further nucleobases include those disclosed in U.S. Patent 3,687,808; Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859; Kroschwitz, J.L., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, dsRNA Research and Applications, pages 289-302; Antisense Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; Antisense Drug Technology, Crooke S.T., Ed.,54#14556606vlCRC Press, 2008, 163-166 and 442-443 (Chapters 6 and 15), each of which are hereby incorporated herein by reference.

[0229] Publications that teach the preparation of certain of the above noted modified nucleobases, as well as other modified nucleobases include without limitation, U.S. Application Publication Nos. 2003 / 0158403 and 2003 / 0175906; U.S. Patent Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,434,257; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,645,985; 5,681,941; 5,811,534; 5,750,692; 5,948,903; 5,587,470; 5,457,191; 5,763,588; 5,830,653; 5,808,027; 6,005,096. 6,015,886; 6,147,200; 6,166,197; 6,166,199; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.

[0230] In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.

[0231] In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3'-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3 '-end of the oligonucleotide. In certain embodiments, the block is at the 5 '-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5 '-end of the oligonucleotide.Internucleoside Linkage Modifications and Motifs

[0232] A 3' to 5' phosphodiester linkage is the naturally occurring internucleoside linkage of RNA and DNA. In certain embodiments, compounds described herein have one or more modified, i.e., non-naturally occurring, internucleoside linkages. Certain non-naturally occurring internucleoside linkages may impart desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases. Representative phosphorus-containing modified intemucleoside linkages include, but are not limited to, phosphotriesters, alkylphosphonates (e.g., methylphosphonates), phosphoramidates, phosphoroamidites, and phosphorothioates (“P=S”), and phosphorodithioates (“HS-P=S”). Representative non-phosphorus containing55#14556606vlintemucleoside linking groups include, but are not limited to, methylenemethylimino (-CH2- N(CHS)-O-CH2), thiodiester, thionocarbamate (-O-C(=O)(NH)-S-); siloxane (-O-Sifh-O-); and N,N'-dimethylhydrazine (-CH2-N((CH3)-N((CHs)-). Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art. Neutral intemucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)- N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (see, for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.

[0233] In certain embodiments, compounds provided herein comprise at least one modified intemucleoside linkage. A modified intemucleoside linkage may be placed at any position of an oligonucleotide. For double-stranded compounds, a modified intemucleoside linkage may be placed within the sense oligonucleotide, antisense oligonucleotide, or both oligonucleotides of the double-stranded compound.

[0234] In certain embodiments, the intemucleoside linkage modification may occur on every nucleoside of an oligonucleotide. In certain embodiments, intemucleoside linkage modifications may occur in an alternating pattern along an oligonucleotide. In certain embodiments, essentially each intemucleoside linking group is a phosphate intemucleoside linkage (P=O). In certain embodiments, each intemucleoside linking group of a modified oligonucleotide is a phosphorothioate (P=S). In certain embodiments, each intemucleoside linking group of a modified oligonucleotide is independently selected from a phosphorothioate, phosphoroamidite, and phosphate intemucleoside linkage. In certain embodiments, the pattern of the intemucleoside linkage modification on each oligonucleotide of a double- stranded compound is the same. In certain embodiments, the pattern of the intemucleoside linkage modification on each oligonucleotide of a double- stranded compound is different. In certain embodiments, a double-stranded compound comprises 6-8 modified intemucleoside linkages. In certain embodiments, the 6-8 modified intemucleoside linkages are phosphorothioate intemucleoside linkages or alkylphosphonate intemucleoside linkages. In certain embodiments, the sense oligonucleotide comprises at least two modified intemucleoside linkages at either or both the 5 '-end and the 3 '-end. In certain such embodiments, the modified intemucleoside linkages are phosphorothioate intemucleoside56#14556606vllinkages or alkylphosphonate intemucleoside linkages. In certain embodiments, the antisense oligonucleotide comprises at least two modified intemucleoside linkages at either or both the 5 '-end and the 3 '-end. In certain such embodiments, the modified intemucleoside linkages are phosphorothioate intemucleoside linkages or alkylphosphonate intemucleoside linkages.

[0235] In certain embodiments, a double-stranded compound comprises an overhang region. In certain embodiments, a double-stranded compound comprises a phosphorothioate or alkylphosphonate intemucleoside linkage modification in the overhang region. In certain embodiments, a double- stranded compound comprises a phosphorothioate or alkylphosphonate internucleotide linkage linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide. For instance, there may be at least two phosphorothioate intemucleoside linkages between the terminal three nucleosides, in which two of the three nucleosides are overhang nucleosides, and the third is a paired nucleoside next to the overhang nucleoside. These terminal three nucleosides may be at the 3 '-end of the antisense oligonucleotide, the 3 '-end of the sense oligonucleotide, the 5 '-end of the antisense oligonucleotide, or the 5 '-end of the antisense oligonucleotide.

[0236] In certain embodiments, modified oligonucleotides comprise one or more intemucleoside linkages having chiral centers. Representative chiral intemucleoside linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising intemucleoside linkages having chiral centers can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of the phosphorothioate intemucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. As is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate intemucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage57#14556606vlis present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017 / 015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration.Conjugate Groups

[0237] In certain embodiments, the compounds described herein comprise or consist of one or more oligonucleotides and, optionally, one or more conjugate groups. Conjugate groups may be attached to either or both ends of an oligonucleotide and / or at any internal position. In certain embodiments, a conjugate group is attached at the 3' end of an oligonucleotide. In certain embodiments, a conjugate group is attached at the 5' end of an oligonucleotide. In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups.

[0238] In certain embodiments, conjugate groups are terminal groups attached to either or both ends of an oligonucleotide. In certain such embodiments, terminal groups are attached at the 3' end of an oligonucleotide. In certain such embodiments, terminal groups are attached at the 5' end of an oligonucleotide. In certain embodiments, terminal groups include, but are not limited to, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified, such as an overhang.

[0239] In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, activity, half-life, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugate groups enhance the affinity of a compound for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ, or region of the body, as, e.g., compared to a compound absent such a conjugate group. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.58#14556606vl

[0240] In certain embodiments, conjugate groups include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols (PEG), thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0241] In certain embodiments, conjugate groups comprise polyethylene glycol (PEG). In certain embodiments, conjugate groups comprise one or more albumin binding moieties.

[0242] In certain embodiments, conjugate groups include an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)- (+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial, or an antibiotic.

[0243] In certain embodiments, conjugate groups are targeting moieties. In certain embodiments, a targeting moiety includes, but is not limited to, a lectin, glycoprotein, lipid, protein, peptide, peptide mimetic, receptor ligand, antibody, thyrotropin, melanotropin, surfactant protein A, carbohydrate, carbohydrate derivative, modified carbohydrate, carbohydrate cluster, polysaccharide, modified polysaccharide, or polysaccharide derivative, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine (GalNAc), N-acetylglucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B 12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.

[0244] In certain embodiments, conjugate groups may include, but are not limited to, the conjugate groups described in the following references such as cholesterol (e.g., Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (e.g., Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), thioether, e.g., hexyl-S-tritylthiol (e.g., Manoharan et al., Ann. NY. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), thiocholesterol (e.g., Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), aliphatic chains, e.g., do-decan-diol or undecyl residues (e.g., Saison- Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEB S Lett., 1990, 259:327- 330; Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipids, e.g., di-hexadecyl-rac- glycerol or triethyl- ammonium l,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate (e.g., Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), polyamines or a polyethylene glycol chains (e.g., Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), adamantane acetic acid (e.g., Manoharan et59#14556606vlal., Tetrahedron Lett., 1995, 36:3651-3654), palmityl (e.g., Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), octadecylamine or hexylamino-carbonyloxychole sterol moiety (e.g., Crooke et al. J. Pharmacol. Exp. Ther., 1996, 277:923-937), tocopherol (e.g., Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220 and Nishina et al., Molecular Therapy, 2008, 16:734-740), GalNAc and other carbohydrates (e.g., Maier et al., Bioconjugate Chemistry, 2003, 14, 18-29; Rensen et al., J. Med. Chem. 2004, 47, 5798-5808; W02009 / 073809 and US Patent Nos. 8,106,022; 8,450,467 and 8,828,957; and WO20 14 / 179445; WO2014 / 179620 and US Patent Nos. 9,127,276; 9,181,549 and 10,844,379) each of which is incorporated herein by reference in its entirety.

[0245] Conjugate groups may be attached to oligonucleotides through conjugate linkers. In certain embodiments, a conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units or combination of such repeating units. In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain embodiments, a conjugate linker comprises at least one phosphorus group. In certain embodiments, a conjugate linker comprises at least one phosphate group. In certain embodiments, a conjugate linker includes at least one neutral linking group. In certain embodiments, conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6- dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1 -carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include, but are not limited to, substituted or unsubstituted Ci-Cio alkyl, substituted or unsubstituted C2- C10 alkenyl, or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl. In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, such linker- nucleosides may be modified or unmodified nucleosides. It is typically desirable for linker- nucleosides to be cleaved from the compound after it reaches a target tissue. Accordingly, linker-nucleosides herein can be linked to one another and to the remainder of the compound through cleavable bonds. Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which a compound comprises an oligonucleotide including a specified number or range of linked nucleosides and / or a specified percent complementarity to a reference nucleic acid and the compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not60#14556606vlused in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.

[0246] In certain embodiments, conjugate groups and conjugate linkers as well as other modifications include, without limitation, those described in the following references: US 5,994,517; US 6,300,319; US 6,660,720; US 6,906,182; US 7,262,177; US 7,491,805; US 8,106,022; US 7,723,509; US 9,127,276; US 2006 / 0148740; US 2011 / 0123520;W02013 / 033230; WO2012 / 037254, Biessen et al., J. Med. Chem. 1995, 38, 1846-1852; Lee et al., Bioorganic & Medicinal Chemistry 2011,19, 2494-2500; Rensen et al., J. Biol. Chem. 2001, 276, 37577-37584; Rensen et al., J. Med. Chem. 2004, 47, 5798-5808; Sliedregt et al., J. Med. Chem. 1999, 42, 609-618; Valentijn et al., Tetrahedron, 1997, 53, 759-770; Lee, Carhohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., Int J Pep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al., J Med Chem, 1995, 38, 1538-1546; Valentijn et al., Tetrahedron, 1997, 53, 759-770; Kim et al., Tetrahedron Lett, 1997, 38, 3487-3490; Lee et al., Bioconjug Chem, 1997, 8, 762-765; Kato et al., Glycohiol, 2001, 11, 821-829; Rensen et al., J Biol Chem, 2001, 276, 37577-37584; Lee et al., Methods Enzymol, 2003, 362, 38-43; Westerlind et al., Glycoconj J, 2004, 21, 227-241; Lee et al., Bioorg Med Chem Lett, 2006, 16(19), 5132-5135; Maierhofer et al., Bioorg Med Chem, 2007, 15, 7661-7676; Khorev et al., Bioorg Med Chem, 2008, 16, 5216-5231; Lee et al., Bioorg Med Chem, 2011, 19, 2494-2500;Kornilova et al., Analyt Biochem, 2012, 425, 43-46; Pujol et al., Angew Chemie Int Ed Engl, 2012, 51, 7445-7448; Biessen et al., J Med Chem, 1995, 38, 1846-1852; Sliedregt et al., J Med Chem, 1999, 42, 609-618; Rensen et al., J Med Chem, 2004, 47, 5798-5808; Rensen et al., Arterioscler Thromh Vase Biol, 2006, 26, 169-175; van Rossenberg et al., Gene Ther, 2004, 11, 457-464; Sato et al., JAm Chem Soc, 2004, 126, 14013-14022; Lee et al., J Org Chem, 2012, 77, 7564-7571; Biessen et al., FASEB J, 2000, 14, 1784-1792; Rajur et al., Bioconjug Chem, 1997, 8, 935-940; Duff et al., Methods Enzymol, 2000, 313, 297-321; Maier et al., Bioconjug Chem, 2003, 14, 18-29; Jayaprakash et al., Org Lett, 2010, 12, 5410- 5413; Manoharan, Antisense Nucleic Acid Drug Dev, 2002, 12, 103-128; Merwin et al., Bioconjug Chem, 1994, 5, 612-620; Tomiya et al., Bioorg Med Chem, 2013, 21, 5275-5281; International Publication Nos. WO1998 / 013381; WO2011 / 038356; WO 1997 / 046098; W02008 / 098788; W02004 / 101619; WO2012 / 037254; WO2011 / 120053; WO2011 / 100131; WO201 1 / 163121; WO2012 / 177947; W02013 / 033230; W02013 / 075035; WO2012 / 083185; W02012 / 083046; W02009 / 082607; WO2009 / 134487; WO2010 / 144740; W02010 / 148013; WO 1997 / 020563; W02010 / 088537; W02002 / 043771; W02010 / 129709; WO2012 / 068187;61#14556606vlWO2009 / 126933; W02004 / 024757; WO2010 / 054406; WO2012 / 089352; W02012 / 089602; WO2013 / 166121; WO2013 / 165816; WO2022 / 076922; WO2023 / 154896; WO 2023 / 196342; WO2023 / 168296; WO2023 / 220737; International Application Nos. PCT / US2024 / 028958; PCT / US2024 / 042764; PCT / US2024 / 042772; PCT / US2024 / 042783; PCT / US2024 / 042786; U.S. Patents 4,751,219; 7,582,744; 8,552,163; 8,137,695; 6,908,903; 6,383,812; 7,262,177; 6,525,031; 5,994,517; 6,660,720; 6,300,319; 7,723,509; 8,106,022; 7,491,805; 7,491,805; 8,541,548; 8,344,125; 8,313,772; 8,349,308; 8,450,467; 8,501,930; 8,158,601; 7,262,177; 6,906,182; 6,620,916; 8,435,491; 8,404,862; 7,851,615; U.S. Patent Application Publications US2011 / 0097264; US2011 / 0097265; US2013 / 0004427; US2003 / 0119724;US2011 / 0207799; US2012 / 0035115; US2012 / 0230938; US2005 / 0164235; US2006 / 0183886; US2012 / 0136042; US2012 / 0095075; US2013 / 0109817; US2006 / 0148740; US2008 / 0206869; US2012 / 0165393; US2012 / 0101148; US2013 / 0121954; US2011 / 0123520; US2003 / 0077829; US2008 / 0108801; US2009 / 0203132; and US2024 / 0083934; each of which is incorporated herein by reference in its entirety.Target Nucleic Acids and Target Regions

[0247] In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain embodiments, the target nucleic acid is non-coding. In certain such embodiments, the target nucleic acid is selected from an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions (e.g., 5' or 3' UTR; PLIN1 in particular has a large 3' UTR of ~ 4K nucleosides). In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an exon. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron.

[0248] In certain embodiments, compounds disclosed herein hybridize with a PLIN1 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding between complementary nucleobases of the nucleic acid molecules. Hybridization can occur under varying conditions. Hybridization conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized. Methods of determining whether a sequence hybridizes specifically to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein specifically62#14556606vlhybridize with a PLIN 1 nucleic acid. In certain embodiments, the compounds provided herein specifically hybridize with a nucleic acid encoding a domain of PLIN 1.

[0249] Nucleotide sequences that encode PLIN 1 or a domain thereof include, without limitation, the following: SEQ ID NO: 1, SEQ ID NO: 2, NCBI Accession Nos.NM_001145311.2, NP_001138783.1, NM_175640.2, NM_001113471.1, andXM_011250776.3; GenBank Gene ID 5346; UniProt Accession No. 060240 and Q8N5Y6; and OMIM Entry No. 70290.Complementarity

[0250] Oligonucleotides provided herein may have a defined percent complementarity to a particular nucleic acid, target region, oligonucleotide, or portion thereof. Non-complementary nucleobases may be tolerated provided that the oligonucleotide remains able to specifically hybridize to the nucleic acid, oligonucleotide, or portion thereof. In certain embodiments, the oligonucleotides provided herein, or a specified portion thereof are at least, or are up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a target nucleic acid, a target region, an oligonucleotide or specified portion thereof. In certain embodiments, the oligonucleotides provided herein, or a specified portion thereof, are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any number in between these ranges, complementary to a target nucleic acid, a target region, an oligonucleotide or specified portion thereof. Percent complementarity of an oligonucleotide with a target nucleic acid, a target region, an oligonucleotide or specified portion thereof can be determined using routine methods (e.g., BLAST programs (basic local alignment search tools) known in the art). For example, an oligonucleotide in which 18 of 20 nucleobases of the oligonucleotide are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.

[0251] In certain embodiments, oligonucleotides described herein comprise one or more mismatched nucleobases relative to a target nucleic acid, a target region, an oligonucleotide or a specified portion thereof. In certain embodiments, oligonucleotides described herein that are, or are up to 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non- complementary nucleobase(s) relative to a target nucleic acid, or specified portion thereof. In certain embodiments, oligonucleotides described herein that are, or are up to 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more63#14556606vlthan 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, a target region, an oligonucleotide, or specified portion thereof. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 from the 5'-end of the oligonucleotide. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12, 13 or 14 from the 3 '-end of the oligonucleotide. In certain embodiments, the mismatch forms a wobble base pair with a corresponding nucleobase on the target nucleic acid. For example, in certain embodiments, the mismatch forms a wobble base pair selected from hypoxanthine (nucleobase of inosine) and uracil (I:U base pair); guanine and uracil (G:U base pair); hypoxanthine and adenine (I:A base pair); and hypoxanthine and cytosine (I:C base pair). Accordingly, in certain embodiments, a mismatched nucleobase on an oligonucleotide comprises hypoxanthine, guanine, or uracil.

[0252] In certain embodiments, oligonucleotides described herein may be complementary to a portion of a nucleic acid. As used herein, “portion” refers to a defined number of contiguous nucleobases within a region of a nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of an oligonucleotide. In certain embodiments, the oligonucleotides are complementary to at least an 8 -nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 9-nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 10-nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least an 11 -nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 12-nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 13-nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 14-nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 15-nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 16-nucleobase portion of a nucleic acid. Also contemplated are oligonucleotides that are complementary to at least a 9, 10, 17, 18, 19, 20, 21, 22, 23 or more nucleobase portion of a nucleic acid, or a range defined by any two of these values. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid. In certain embodiments, the oligonucleotide is a sense oligonucleotide. In certain embodiments,64#14556606vla portion of the sense oligonucleotide is compared to an equal length portion of an antisense oligonucleotide. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion of a sense oligonucleotide is compared to an equal length portion of an antisense oligonucleotide.Identity

[0253] The oligonucleotides provided herein may also have a defined percent identity to a particular nucleic acid, target region, oligonucleotide, or specified portion thereof. As used herein, an oligonucleotide is identical to a sequence disclosed herein if it has the same nucleobase pairing ability. For example, a DNA which contains thymidine in place of uracil in a disclosed RNA sequence would be considered identical to the RNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the compounds described herein as well as compounds having non-identical bases relative to the compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the compound. Percent identity of an oligonucleotide is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared. In certain embodiments, oligonucleotides described herein, or portions thereof, are, or are at least, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the nucleic acids, oligonucleotides, or a portion thereof, disclosed herein. In certain embodiments, oligonucleotides described herein are about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, or any percentage between such values, to a particular nucleic acid or oligonucleotide, or portion thereof.

[0254] In certain embodiments, an oligonucleotide may have one or more mismatched nucleobases. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 from the 5'-end of the oligonucleotide. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12, 13 or 14 from the 3'-end of the oligonucleotide. In certain embodiments, a portion of the oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid. In certain embodiments, the oligonucleotide is a sense oligonucleotide. In certain embodiments, a portion of the sense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.65#14556606vlPharmaceutical Compositions and Formulations

[0255] Compounds described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered. Certain embodiments provide pharmaceutical compositions comprising one or more compounds or a salt thereof. In certain embodiments, the compounds are antisense oligonucleotides. In certain embodiments, the compounds are oligomeric compounds. In certain embodiments, the compounds comprise or consist of one or more modified oligonucleotides. In certain such embodiments, the pharmaceutical composition comprises one or more compounds and a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises one or more compounds and a sterile saline solution. In certain embodiments, such pharmaceutical composition consists of one compound and a sterile saline solution. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more compounds and sterile water. In certain embodiments, a pharmaceutical composition consists of one compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more compounds and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS.

[0256] A compound described herein targeted to PLIN 1 can be utilized in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising a compound targeted to PLIN1 and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of one or more modified oligonucleotide provided herein.

[0257] Pharmaceutical compositions comprising compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. In certain embodiments, the compounds are antisense oligonucleotides. In certain embodiments, the compounds are66#14556606vloligomeric compounds. In certain embodiments, the compound comprises or consists of one or more modified oligonucleotide. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. A prodrug can include the incorporation of additional nucleosides at one or both ends of a compound which are cleaved by endogenous nucleases within the body, to form the active compound. In certain embodiments, the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.

[0258] It is understood that the examples and embodiments described herein are for illustrative purposes and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.EXAMPLES

[0259] The following examples describe the process to identify lead compounds targeted to PLIN1. Certain compounds are distinguished as having high potency and tolerability.

[0260] The following examples serve only to illustrate the compounds described herein and are not intended to limit the same. The following examples and related sequence listing accompanying this filing may identify sequence as either “RNA” or “DNA”; however, as disclosed herein, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that the designation of a sequence as “RNA” or “DNA” is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2'-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2'-OH for the natural 2'-H of DNA) or as an RNA having a modified base (methylated uracil for natural uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to, those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including, but not limited to, such nucleic acids having modified nucleobases.

[0261] Each of the references recited in the present application is incorporated herein by reference in its entirety.67#14556606vlTable 1. Chemical Nomenclature

[0262] The newly designed double- stranded compounds in Tables 2 and 3 below were designed as unmodified (Table 2) and modified (Table 3) compounds. Abbreviations for68#14556606vlchemical modifications used in Table 3 are provided in Table 1 above. IA and IS in a Ref ID NO, identifies it as an antisense strand or sense strand of a compound, respectively. It is understood that the sequence set forth in each SEQ ID NO contained herein is independent of any modification to a sugar moiety, an intemucleoside linkage, or a nucleobase even if shown in context with a modified compound. Oligomeric compounds referenced by Compound Number (“Cmpd. No.”) or Ref ID NO indicate a combination of nucleobase sequence and chemical modifications. “Start site” indicates the 5 '-most nucleotide to which the compound is targeted in the human gene sequence (opposite to the 3'- most nucleoside of an antisense oligonucleotide). “Stop site” indicates the 3 '-most nucleotide to which the compound is targeted in the human gene sequence opposite to the 5 '-most nucleoside of an antisense oligonucleotide). Each compound listed in Tables 2 and 3 is targeted to the human PLIN1 mRNA.Table 2. Compound Sequence and Targeting Position on SEQ ID NO: 169#14556606vlTable 3. Compound Chemistry70#14556606vl71#14556606vlExample 1: Inhibition ofPLINl in Primary Human AdipocytesA. mRNA Levels

[0263] Human primary visceral adipocytes were differentiated from human visceral preadipocyte cells (Lonza, catalog #: PT-5005). siRNAs corresponding to listed unmodified compounds in Table 2 were added to the cells at 100 nM concentrations. Cells were harvested 72 hours after the siRNA treatment.

[0264] RNA isolation was performed using the RNeasy 96 Kit (Qiagen, catalog number: 74181). Levels of human PLIN1 mRNA, GAPDH mRNA, or 18S rRNA were measured using TaqMan RNA-to-CT 1-Step Kit (ThermoFisher Scientific, catalog number: 4392938). Primer- probe sets of human PLIN1, GAPDH, 18S were purchased from ThermoFisher Scientific (Human GAPDH: Hs02786624_gl; Human PLIN1: Hs_01106925_ml; 18S: Hs03003631_gl). qPCR was performed using a QuantStudio 5 Real-Time PCR system.Human PLIN1 expression was normalized to the expression of a housekeeping gene GAPDH or 18S).72#14556606vlTable EL PLIN1 siRNA free uptake in differentiated human primary adipocytes

[0265] As shown by Table El, most of the compounds (RD6165-RD6178) showed robust inhibition of human PLIN1 with mRNA knockdown ranging from 74-93%. Further, viability of the cell populations was measured and showed no loss for any of the compounds (data not shown).

[0266] In a similar dose response experiment, primary human adipocytes differentiated from pre-adipocytes were treated with 0.064 nM, 0.32 nM, 1.6 nm, 8 nM, 40 nM, and 200 nM of the same siRNA for a period of 72 hours. The IC50 was plotted and the maximal human PLIN 1 mRNA knockdown was measured. Table E2. PLIN1 siRNA dose-response in differentiated human adipocytes73#14556606vl

[0267] As shown in Table E2, potent dose-dependent effects were observed for each tested compound, with several compounds knocking PLIN1 mRNA down by more than 90%.B. Protein Levels

[0268] Cells were treated on days 0, 4, and 7, as discussed above, with the listed compounds. PLIN1 protein levels and lipid accumulation were measured in vitro on day 10. Protein isolation was performed using RIPA Lysis supplemental with protease inhibitor cocktail. Western analysis was performed using a Jess Automated Western Blot System (ProteinSimple, catalog number: 004-650). Primary antibodies used for detecting human PLIN 1 and GAPDH were purchased from Cell Signaling and Sigma, respectively.

[0269] Intracellular lipid quantification was performed using AdipoRed Assay Reagent (Lonza, catalog number: PT-7009), according to manufacturer’s protocol.Table E3. Human PLTN1 Protein Knockdown

[0270] As shown in Table E3 and FIG. 1, the compounds demonstrated robust PLIN1 protein knock down. Further lipid content was significantly decreased in the treated cells compared to differentiated, untreated adipocytes.Example 2: Effect of Compounds Targeting Human PLIN1 in Mice in vivo

[0271] Compounds as modified in Table 3 were evaluated in BALB / c mice.

[0272] Female BALB / c mice were obtained from Charles River Laboratories and randomly assigned to each group. Male C57BL / 6J and C57BL / 6J diet-induced obese (DIO) mice were obtained from The Jackson Laboratory and randomly assigned to each group. All animals were treated in accordance with IACUC protocols. Mice were dosed intravenously at the74#14556606vlindicated dose with indicated modified compounds or phosphate buffered saline (PBS) control on Day 1. All dosing solutions were stored at 4°C until 1 h before the time of injection, when they were removed from storage and allowed to reach room temperature. Animals were sacrificed on the study day specified. Tissues were harvested and snap frozen for downstream analysis. Mouse body weight was normalized to individual animal pre-dose.

[0273] For RNA expression analysis, mouse adipose tissues were homogenized using Precellys Evolution Homogenizer in QIAzol Lysis Reagent (Qiagen, catalog number: 79306). RNA isolation was performed using the RNeasy Lipid Tissue Kit (Qiagen, catalog number: 74804). mRNA levels of the target gene and a house keeping gene were measured using TaqMan RNA-to-C 1-Step Kit (ThermoFisher Scientific, catalog number: 4392938). Primerprobe sets were purchased from ThermoFisher Scientific (Plinl: Mm00558672_ml; Gapdh: Mm99999915_gl). qPCR was performed using a QuantStudio 5 Real-Time PCR system. mRNA expression of Plinl was normalized to the mRNA expression Gapdh. Additionally, leptin and UCP1 RNA levels were evaluated in white adipose tissue (WAT), and markers for basal lipolysis were measured. Further, triglycerides in heart and quadriceps were evaluated as an indicator of lean muscle mass (data not shown).Table E4. PETN1 mRNA KD in WAT and BAT of female BALB / C mice (no ligand / modifier)Table E5. PLIN1 mRNA KD in WAT and BAT of male C57BE / 6J mice (no ligand / modifier)75#14556606vl

[0274] Strong PLIN 1 mRNA knockdown was demonstrated by all compounds in each of the white adipose tissues tested at days 15 (Table E4-E5) and 29 (Table E4).

[0275] Further, the knockdown was consistent with a variety of targeting moieties, including both ligands and lipids, as shown in Table E6.Table E6. PLTN1 mRNA KD in WAT and BAT of female BALB / C mice (with ligand / modifier)

[0276] At week 4, with robust PLIN 1 lowering and fat pad reduction, no significant increase in lipolytic genes was observed, indicating minimal (if any) increases in basal lipolysis at this time point. Tissue triglyceride levels were also measured (data not shown) and no signs of triglyceride increase in cardiac and skeletal muscles were observed in animals receiving PLIN 1 siRNAs. A macroscopic evaluation of the liver was performed to determine if there was evidence of a fatty liver, and fatty liver was not seen (data not shown).76#14556606vlExample 3: Effect in the Diet Induced Obesity Model, Pre-obese and Obese animalsA. Pre-Obese

[0277] The effect of certain compounds on body weight in pre-obese and obese animals was also evaluated. 11 -week-old C57BL / 6J (B6) male “pre-obese” mice that had been fed a high fat diet (60% fat) for 5 weeks (beginning at 6 weeks of age) were dosed with a compound at 15 mg / kg, intravenously (IV) at Week 0. Animals were re-dosed at Week 4 and Week 8. Animals continued to be fed a high fat diet while on study.

[0278] The following read outs were obtained (data not shown): body weight, leptin ELISA, leptin qPCR (for an estimate of fat loss), UCP1 qPCR (as a measurement of fat browning), macroscopic observation and H&E staining for fat browning, NEFA / glycerol / lipolysis RNA markers, peripheral tissue organ weight and H&E staining (for ectopic lipid accumulation), serum and tissue triglycerides, and blood chemistry.

[0279] Body weight, shown in Table E7 or E8 below, was reported as a straight group average at each time point or as a normalized group average (body weight at each time point normalized against the pre-dose [Week 0] weight of each individual animal), respectively.Table E7. Average body weights of pre-obese mice treated with RD6166 and RD6170Table E8. Normalized body weights of pre-obese mice treated with RD6166 and RD617077#14556606vl

[0280] As shown by Tables E7-E8 and FIG. 2A, treated pre-obese mice were slower to gain weight on a high fat diet than untreated pre-obese mice, and within 9 weeks demonstrated between -14% and 28% normalized lower body weight than untreated mice offered the same diet.B. Obese

[0281] 20-week-old C57BL / 6J (B6) male “obese” mice that had been fed a high fat diet (60% fat) for 14 weeks (beginning at 6 weeks of age) were dosed at 15 mg / kg, intravenously on Week 0. Animals were re-dosed at Week 23. Animals continued to be fed a high fat diet while on study.

[0282] The following read outs were obtained (data not shown): body weight, leptin ELISA, leptin qPCR (for an estimate of fat loss), UCP1 qPCR (as a measurement of fat browning), macroscopic observation and H&E staining for fat browning, NEFA / glycerol / lipolysis RNA markers were tested, peripheral tissue organ weight and H&E staining (for ectopic lipid accumulation), serum and tissue triglycerides, and blood chemistry.Table E9. Average body weights of obese mice treated with RD6166 and RD6170Table E10. Normalized body weights of obese mice treated with RD6166 and RD617078#14556606vl

[0283] As shown by Tables E9-E10 and FIG. 2B, mice who had already stabilized into an obese phenotype lost significant weight after treatment with the compounds.Example 4: Compound Chemistry Examples

[0284] Provided below are example structures depicting linkage groups of compounds RD6165-RD6179 and RD7385-RD7396.

[0285] Provided below are example structures depicting linkage groups of compounds RD7459, RD7461, RD7463, RD7465, RD7466, RD7468, RD7469, RD7471-RD7473, RD7518-RD7521, and RD7523-RD7524.

[0286] General structure:79#14556606vl

[0287] General Procedure I: 5 ’-conjugated sense strand

[0288] Step 1: To an aqueous solution of 5 ’-amine functionalized sense strand (I) was added 10% V / V IM Sodium Phosphate buffer (pH=7) and 20% -50% V / V CH3CN. A solution of DBCO-NHS (II) (1.5-3 eq) in DMSO or CH3CN was added to the reaction. The reaction is monitored by LCMS and HPLC. Upon completion, precipitate was removed using centrifugation and the aqueous solution was purified by reverse phase HPLC. The product fractions were combined and dried by lyophilization. The dried N-DBCO modified sense strand (HI) was reconstituted in RNase free water for step 2.

[0289] Step 2: To a solution of 5’-DBCO modified sense strand (III) (1 eq) was added a solution of ligand-A-Na (2 eq) in DMSO or THF. The reaction was monitored by HPLC and LCMS. Upon completion, the 5’-conjugated sense strand (IV) was purified by reverse phase HPLC or molecular weight cut-off with Amicon® Ultra-15 Centrifugal filter (3K, 5 times).

[0290] Example: RD7459 (BA-119):

[0291] Exemplary CB1 ligands may include the following with or without additional linkers:80#14556606vl

[0292] Exemplary integrin ligands may include the following with or without additional linkers:81#14556606vl

[0293] Provided below are example structures depicting linkage groups of compounds RD7573-RD7576.X as shown above may include any chemically acceptable group, including -H, -OH, or -(CH2)6-NH2.

[0294] Provided below is an example structure depicting linkage groups of compounds RD7653 and RD7654.

[0295] General procedure for the conjugation of RD7653 and RD7654:

[0296] To an aqueous solution of 5 ’-amine functionalized sense strand (I) was added 10% V / V IM Sodium Phosphate buffer (pH=7) and 20-50% V / V CH3CN. A solution of NHS- ester functionalized ligand (II) (3-10 eq) solubilized in 1:1 Water: CI hCN was added to the reaction. The reaction was monitored by LCMS and HPLC. Upon completion, the 5’-Ligand modified sense strand (III) was purified by reverse phase HPLC. The product fractions were collected and dried by centrifugal evaporation and lyophilization. The dried sense strand (III) was reconstituted in RNase free water and desalted by Amicon® Ultra- 15 Centrifugal filter (3K, 5 times).82#14556606vl

[0297] Provided below are example structures depicting linkage groups of compounds RD7674 and RD7675.

[0298] General structure:

[0299] Example: RD7674(BA-153):83#14556606vlSEQ ID NO: 1ACUCUGCAGCCUGGGCUCUGUGAGACUGAGGUGGCGGUCAGCCGGAGUGAGUGUUGGGGUCCUGGGGCACCUGCCUUACAUGGCUUGUUUAUGAACAUUAAAGGGAAGAAGUUGAAGCUUGAGGAGCGAGGAUGGCAGUCAACAAAGGCCUCACCUUGCUGGAUGGAGACCUCCCUGAGCAGGAGAAUGUGCUGCAGCGGGUCCUGCAGCUGCCGGUGGUGAGUGGCACCUGCGAAUGCUUCCAGAAGACCUACACCAGCACUAAGGAAGCCCACCCCCUGGUGGCCUCUGUGUGCAAUGCCUAUGAGAAGGGCGUGCAGAGCGCCAGUAGCUUGGCUGCCUGGAGCAUGGAGCCGGUGGUCCGCAGGCUGUCCACCCAGUUCACAGCUGCCAAUGAGCUGGCCUGCCGAGGCUUGGACCACCUGGAGGAAAAGAUCCCCGCCCUCCAGUACCCCCCUGAAAAGAUUGCUUCUGAGCUGAAGGACACCAUCUCCACCCGCCUCCGCAGUGCCAGAAACAGCAUCAGCGUUCCCAUCGCGAGCACUUCAGACAAGGUCCUGGGGGCCGCUUUGGCCGGGUGCGAGCUUGCCUGGGGGGUGGCCAGAGACACUGCGGAAUUUGCUGCCAACACUCGAGCUGGCCGACUGGCUUCUGGAGGGGCCGACUUGGCCUUGGGCAGCAUUGAGAAGGUGGUGGAGUACCUCCUCCCUCCAGACAAGGAAGAGUCAGCCCCUGCUCCUGGACACCAGCAAGCCCAGAAGUCUCCCAAGGCCAAGCCAAGCCUCUUGAGCAGGGUUGGGGCUCUGACCAACACCCUCUCUCGAUACACCGUGCAGACCAUGGCCCGGGCCCUGGAGCAGGGCCACACCGUGGCCAUGUGGAUCCCAGGCGUGGUGCCCCUGAGCAGCCUGGCCCAGUGGGGUGCCUCAGUGGCCAUGCAGGCGGUGUCCCGGCGGAGGAGCGAAGUGCGGGUACCCUGGCUGCACAGCCUCGCAGCCGCCCAGGAGGAGGAUCAUGAGGACCAGACAGACACGGAGGGAGAGGACACGGAGGAGGAGGAAGAAUUGGAGACUGAGGAGAACAAGUUCAGUGAGGUAGCAGCCCUGCCAGGCCCUCGAGGCCUCCUGGGUGGUGUGGCACAUACCCUGCAGAAGACCCUCCAGACCACCAUCUCGGCUGUGACAUGGGCACCUGCAGCUGUGCUGGGCAUGGCAGGGAGGGUGCUGCACCUCACACCAGCCCCUGCUGUCUCCUCAACCAAGGGGAGGGCCAUGUCCCUAUCAGAUGCCCUGAAGGGCGUUACUGACAACGUGGUGGACACAGUGGUGCAUUACGUGCCGCUCCCCAGGCUGUCGCUGAUGGAGCCCGAGAGCGAAUUCCGGGACAUCGACAACCCACCAGCCGAGGUCGAGCGCCGGGAGGCGGAGCGCAGAGCGUCUGGGGCGCCGUCCGCCGGCCCGGAGCCCGCCCCGCGUCUCGCACAGCCCCGCCGCAGCCUGCGCAGCGCGCAGAGCCCCGGCGCGCCCCCCGGCCCGGGCCUGGAGGACGAAGUCGCCACGCCCGCAGCGCCGCGCCCGGGCUUCCCGGCCGUGCCCCGCGAGAAGCCAAAGCGCAGGGUCAGCGACAGCUUCUUCCGGCCCAGCGUCAUGGAGCCCAUCCUGGGCCGCACGCAUUACAGCCAGCUGCGCAAGAAGAGCUGAGUCGCCGCACCAGCCGCCGCGCCCCGGGCCGGCGGGUUUCUCUAACAAAUAAACAGAACCCGCACUGCCCAGGCGAGCGUUGCCACUUUCAAAGUGGUCCCCUGGGGAGCUCAGCCUCAUCCUGAUGAUGCUGCCAAGGCGCACUUUUUAUUUUUAUUUUAUUUUUAUUUUUUUUUUAGCAUCCUUUUGGGGCUUCACUCUCAGAGCCAGUUUUUAAGGGACACCAGAGCCGCAGCCUGCUCUGAUUCUAUGGCUUGGUUGUUACUAUAAGAGUAAUUGCCUAACUUGAUUUUUCAUCUCUUUAACCAAACUUGUGGCCAAAAGAUAUUUGACCGUUUCCAAAAUU84#14556606vlCAGAUUCUGCCUCUGCGGAUAAAUAUUUGCCACGAAUGAGUAACUCCUGUCACCACUCUGAAGGUCCAGACAGAAGGUUUUGACACAUUCUUAGCACUGAACUCCUCUGUGAUCUAGGAUGAUCUGUUCCCCCUCUGAUGAACAUCCUCUGAUGAUCUAGGCUCCCAGCAGGCUACUUUGAAGGGAACAAUCAGAUGCAAAAGCUCUUGGGUGUUUAUUUAAAAUACUAGUGUCACUUUCUGAGUACCCGCCGCUUCACAGGCUGAGUCCAGGCCUGUGUGCUUUGUAGAGCCAGCUGCUUGCUCACAGCCACAUUUCCAUUUGCAUCAUUACUGCCUUCACCUGCAUAGUCACUCUUUUGAUGCUGGGGAACCAAAAUGGUGAUGAUAUAUAGACUUUAUGUAUAGCCACAGUUCAUCCCCAACCCUAGUCUUCGAAAUGUUAAUAUUUGAUAAAUCUAGAAAAUGCAUUCAUACAAUUACAGAAUUCAAAUAUUGCAAAAGGAUGUGUGUCUUUCUCCCCGAGCUCCCCUGUUCCCCUUCAUUGAAAACCACCACGGUGCCAUCUCUUGUGUAUGCAGGGCUAUGCACCUGCAGGCACGUGUGUAUGCACUCCCCGCUUGUGUUUACACAAGCUGUGGGGUGUUACGCAUGCCUGCUUUUUUCACUUAAUAAUACAGCUUGGAGAGAUUUUUGUAUCACAUUAUAAAUCCCACUCGCUCUUUUUGAUGGCCACAUAAUAACUACUGCAUAAUAUGGAUACGCCUUAUUUGAUUUAACUAGUUCCCUAAUGAUGGACUUUUAAGUUGUUUCCUUUUUUUUUCUUUUUUGCUACUGCAAACGAUGCUAUAAUAAAUGUCCUUAUCAAA AAEQUIVALENTS AND SCOPE

[0301] It is to be understood that this disclosure is not limited to any or all of the particular embodiments described expressly herein, and as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0302] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described. As will be readily apparent to the skilled artisan, and should be understood from the terms used herein, where words or terms are defined herein, their applicability should not be limited to the embodiments immediately preceding or following the definition and should be used where context permits throughout the disclosure.

[0303] All publications and patents cited in this specification are cited to disclose and describe the methods and / or materials in connection with which the publications are cited. All such publications and patents are herein incorporated by references as if each individual publication or patent were specifically and individually indicated to be incorporated by reference. Such incorporation by reference is expressly limited to the methods and / or materials described in the cited publications and patents and does not extend to any lexicographical definitions from the cited publications and patents (i.e., any lexicographical definition in the publications and patents cited that is not also expressly repeated in the disclosure should not be treated as such and should not be read as defining any terms appearing in the accompanying claims). If there is a conflict between any of the incorporated85#14556606vlreferences and this disclosure, this disclosure shall control. In addition, any particular embodiment of this disclosure that falls within the prior art may be explicitly excluded from any one or more of the claims. Because such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the disclosure can be excluded from any claim, for any reason, whether or not related to the existence of prior art.

[0304] The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present disclosure is not entitled to antedate such publication by virtue of prior disclosure. Further, the dates of publication provided could be different from the actual publication dates that may need to be independently confirmed.

[0305] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.

[0306] In the claims, articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Wherever used herein, a pronoun in a gender (e.g., masculine, feminine, neuter, other, etc.) the pronoun shall be construed as gender neutral (e.g., construed to refer to all genders equally) regardless of the implied gender unless the context clearly indicates or requires otherwise. Wherever used herein, words used in the singular include the plural, and words used in the plural includes the singular, unless the context clearly indicates or requires otherwise. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The disclosure includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The disclosure includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.

[0307] Furthermore, the disclosure encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim. Where elements are presented as86#14556606vllists (e.g., in Markush group format), each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should it be understood that, in general, where the disclosure, or aspects of the disclosure, is / are referred to as comprising particular elements and / or features, certain embodiments of the disclosure or aspects of the disclosure consist, or consist essentially of, such elements and / or features. For purposes of simplicity, those embodiments have not been specifically set forth in haec verba herein. It is also noted that the terms “comprising” and “containing” are intended to be open and permits the inclusion of additional elements or steps. Where ranges are given, endpoints are included in such ranges unless otherwise specified. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

[0308] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments described herein. The scope of the present embodiments described herein is not intended to be limited to the above Description, but rather is as set forth in the appended claims. Those of ordinary skill in the art will appreciate that various changes and modifications to this description may be made without departing from the spirit or scope of the disclosure, as defined in the following claims.87#14556606vl

Claims

CLAIMSWhat is claimed is:

1. A compound comprising a modified oligonucleotide 8 to 30 linked nucleosides in length having a nucleobase sequence comprising at least 8 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence of one or more of SEQ ID NOs: 1 or 2.

2. The compound of claim 1, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8 contiguous nucleobases of a nucleobase sequence of any one of SEQ ID NOs: 34-53.

3. The compound of claim 1 or 2, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8 contiguous nucleobases of a nucleobase sequence of any one of SEQ ID NOs: 34, 35, and 39.

4. A compound comprising a modified oligonucleotide 8 to 30 linked nucleosides in length having a nucleobase sequence comprising at least 8 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence that is fully complementary to an equal length portion of one or more of SEQ ID NOs: 1 or 2.

5. The compound of claim 4, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8 contiguous nucleobases of a nucleobase sequence of any one of SEQ ID NOs: 11-33.

6. The compound of claim 4 or 5, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8 contiguous nucleobases of a nucleobase sequence of any one of SEQ ID NOs: 11, 12, and 16.

7. The compound of any one of claims 1-6, wherein the modified oligonucleotide is 14 to 23 linked nucleosides in length.

8. The compound of any one of claims 1-7, wherein the modified oligonucleotide comprises a conjugate group.88#14556606vl9. The compound of claim 8, wherein the conjugate group comprises a targeting moiety.

10. The compound of claim 9, wherein the targeting moiety is attached to one or more internal positions in the modified oligonucleotide.

11. The compound of claim 9 or 10, wherein the targeting moiety is attached to the 5’ end and / or the 3’ end of the modified oligonucleotide.

12. The compound of any one of claims 9-11, wherein the targeting moiety comprises one or more ligands selected from the group consisting of a Tropomyosin receptor B (TrkB) ligand, a cannabinoid receptor type 1 (CBi) ligand, a.4 1 / 7 integrin ligand, an iV-methyl-D- aspartate receptor (NMD A) ligand, a glutamate transporter- 1 (GLT-1) ligand, and an N- acetyl-galactosamine (GalNAc) moiety.

13. The compound of any one of claims 9-12, wherein the targeting moiety promotes localization of the compound to a target cell or tissue relative to a non-target cell or tissue.14 The compound of claim 13, wherein the target cell or tissue is an adipocyte or adipose tissue, optionally wherein the targeting moiety is a ligand for a receptor selectively expressed on adipocytes.

15. The compound of any one of claims 8-14, wherein the conjugate group comprises a lipid.

16. The compound of claim 15, wherein the lipid is attached to an internucleoside linkage of the modified oligonucleotide.

17. The compound of claim 15 or 16, wherein the lipid comprises a substituted or unsubstituted alkyl or alkenyl.

18. The compound of claim 17, wherein the substituted or unsubstituted alkyl or alkenyl comprises a saturated or unsaturated Cs-C o hydrocarbon chain.89#14556606vl19. The compound of any one of claims 1-18, wherein the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified nucleobase, a modified intemucleoside linkage, and a modified sugar.

20. A compound comprising: a sense strand comprising at least 8 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence of one or more of SEQ ID NOs: 1 or 2; and an antisense strand forming a double-stranded region with the sense strand, wherein the compound comprises at least one modification selected from the group consisting of a modified nucleobase, a modified internucleoside linkage, and a modified sugar.

21. The compound of claim 20, wherein the sense and / or antisense strand is 8 to 23 linked nucleosides in length.

22. The compound of claim 20 or 21, wherein the sense and / or antisense strand is 14 to 23 linked nucleosides in length.

23. The compound of any one of claims 20-22, wherein the antisense strand comprises at least 8 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence that is fully complementary to SEQ ID NO: 2.

24. The compound of any one of claims 20-23, wherein the antisense strand comprises at least 8 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence that is fully complementary to nucleosides 284-306, 285-307, 286-307, 286-308, 287-307, 287-309, 288-310, 289-311, 290-311, 291-311, 291-313, 292-314, 293-315, 376- 398, 377-399, 378-400, 415-437, 414-437, 413-434, 412-433, 411-432, 410-431, 409-430, 408-428, 415-436, 500-521, 501-521, 539-560, 1356-1378, 1357-1379, 1486-1507, or 1486- 1508 of SEQ ID NO: 1.

25. The compound of any one of claims 20-24, wherein the antisense strand comprises a sequence that is at least 80% complementary to the sense strand in the double- stranded region.90#14556606vl26. The compound of any one of claims 20-25, wherein the antisense strand is fully complementary to the sense strand in the double-stranded region.

27. The compound of any one of claims 20-26, wherein the antisense strand comprises at least 14 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence that is fully complementary to an equal length portion of one or more of SEQ ID NOs: 1 or 2.

28. The compound of any one of claims 20-27, wherein the antisense strand comprises at least 14 contiguous nucleobases differing by no more than 3 nucleobases from any one of the antisense sequences in Table 2 or Table 3.

29. The compound of any one of claims 20-28, wherein the antisense strand comprises at least 14 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence of an antisense strand selected from the group consisting of Ref ID NOs: IA1892, IA1893, and IA1897.

30. The compound of any one of claims 20-29, wherein the sense strand comprises at least 14 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence of a sense strand selected from the group consisting of Ref ID NOs: IS2463, IS2464, and IS2468.

31. The compound of any one of claims 20-30, wherein the nucleobase sequences of the sense and antisense strands comprise any one of the sense and antisense sequences in Table 2 or Table 3.

32. The compound of any one of claims 20-31, wherein the compound comprises a conjugate group.

33. The compound of claim 32, wherein the conjugate group comprises a targeting moiety.

34. The compound of claim 33, wherein the sense and / or antisense strand is attached to one or more targeting moieties.91#14556606vl35. The compound of claim 33 or 34, wherein the targeting moiety is attached to one or more internal positions in the double-stranded region of the compound.

36. The compound of any one of claims 33-35, wherein the targeting moiety is attached to the 5’ end and / or the 3’ end of the sense strand.

37. The compound of any one of claims 33-36, wherein the targeting moiety is attached to the 5’ end and / or the 3’ end of the antisense strand.

38. The compound of any one of claims 33-37, wherein the targeting moiety is attached to the compound through a conjugate linker.

39. The compound of any one of claims 33-38, wherein the targeting moiety comprises one or more ligands selected from the group consisting of a Tropomyosin receptor B (TrkB) ligand, a cannabinoid receptor type 1 (CBi) ligand, a.4 1 / 7 integrin ligand, an / V-methyl-D- aspartate receptor (NMD A) ligand, a glutamate transporter- 1 (GLT-1) ligand, and an N- acetyl-galactosamine (GalNAc) moiety.

40. The compound of any one of claims 33-39, wherein the targeting moiety promotes localization of the compound to a target cell or tissue relative to a non-target cell or tissue.

41. The compound of any one of claims 32-40, wherein the conjugate group comprises a lipid.

42. The compound of claim 41, wherein the sense and / or antisense strand comprises one or more lipids.

43. The compound of claim 41 or 42, wherein the lipid is attached to an intemucleoside linkage of the compound.

44. The compound of any one of claims 41-43, wherein the lipid comprises a substituted or unsubstituted alkyl or alkenyl.

45. The compound of claim 44, wherein the substituted or unsubstituted alkyl or alkenyl comprises a saturated or unsaturated Cs-C o hydrocarbon chain.92#14556606vl46. The compound of any one of claims 21-45, wherein the sense and / or antisense strand comprises at least one modified intemucleoside linkage.

47. The compound of claim 46, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage or a methylphosphonate internucleoside linkage.

48. The compound of any one of claims 21-47, wherein the sense and / or antisense strand comprises at least one modified sugar.

49. The compound of claim 48, wherein the modified sugar comprises a modification selected from the group consisting of a halogen, an alkoxy group, and a bicyclic sugar.

50. The compound of claim 48 or 49, wherein the modified sugar comprises a modification selected from group consisting of LNA, cEt, 2’-MOE, 2’-F, 2’-OMe, and 2’- deoxy, or a combination thereof.

51. The compound of claim 50, wherein the antisense strand comprises no more than ten 2’-F sugar modifications.

52. The compound of claim 50 or 51, wherein the sense strand comprises no more than five 2’-F sugar modifications.

53. The compound of any one of claims 21-52, wherein the sense and / or antisense strand comprises at least one modified nucleobase.

54. A compound comprising: a sense strand comprising a modified oligonucleotide; and an antisense strand forming a double- stranded region with the sense strand, wherein the antisense strand comprises a region of complementarity to an mRNA encoding PLIN1, and wherein the region of complementarity comprises at least 8 contiguous nucleobases differing by no more than 3 nucleobases from a nucleobase sequence that is fully complementary to the applicable region of SEQ ID NO: 1.93#14556606vl55. A compound comprising: a sense strand comprising a modified oligonucleotide; and an antisense strand forming a double- stranded region with the sense strand, wherein the antisense strand comprises a region of complementarity to an mRNA encoding PLIN1, and wherein the region of complementarity comprises at least 8 contiguous nucleobases differing by no more than 3 nucleobases from any one of the antisense sequences in Table 2 or Table 3.

56. A cell containing the compound of any one of claims 1-55.

57. A pharmaceutical composition for inhibiting expression of a gene encoding PLIN1, comprising the compound of any one of claims 1-55.

58. The pharmaceutical composition of claim 57, wherein the compound is in a pharmaceutically acceptable salt form.

59. The pharmaceutical composition of claim 58, wherein the pharmaceutically acceptable salt is a sodium salt or a potassium salt.

60. The pharmaceutical composition of any one of claims 57-59, further comprising a pharmaceutically acceptable carrier.

61. A method of inhibiting expression of a PLIN 1 gene in a cell, the method comprising contacting the cell with the compound of any one of claims 1-55 or the pharmaceutical composition of any one of claims 57-60, thereby inhibiting expression of the PLIN1 gene in the cell.

62. A method of treating, alleviating, preventing, or slowing the progression of a PLIN1- associated disorder in a subject comprising administering to the subject the compound of any one of claims 1-55 or the pharmaceutical composition of any one of claims 57-60, thereby treating, alleviating, preventing, or slowing the progression of the PLIN 1 associated disorder.

63. The method of claim 62, wherein the PLIN 1 -associated disorder is metabolic syndrome, obesity, cardiovascular disease, diabetes mellitus, insulin resistance, fatty liver94#14556606vldisease, kidney disease, energy homeostasis, immune / inflammatory conditions, nausea, diarrhea, fibrogenesis, alcoholic steatohepatitis, or diabetic nephropathy.

64. The method of claim 62, wherein the PLIN 1 -associated disorder is diabetes mellitus, obesity, insulin resistance, high blood sugar, or cardiovascular disease.

65. A method of reducing body mass index (BMI), excess amounts of abdominal fat, waist circumference, sweating, tiredness, joint and back pain, difficulty breathing, sleep problems, high blood pressure, or mental conditions associated with obesity in a subject, the method comprising administering to the subject the compound of any one of claims 1-55 or the pharmaceutical composition of any one of claims 57-60.

66. The method of any one of claims 62-65, further comprising administering to the subject a treatment for obesity.

67. A container comprising the compound of any one of claims 1-55 or the pharmaceutical composition of any one of claims 57-60.

68. The container of claim 67, wherein the container is a vial, a test tube, a flask, a bottle, or a syringe.

69. A kit comprising the container of claim 67 or 68.95#14556606vl

Images