Fusion protein and use thereof in targeted degradation of protein aggregate
By expressing the fusion protein X-E3TCD in plants, efficient targeted degradation of endogenous protein aggregates was achieved, solving the problems of complex operation and high cost in existing technologies and promoting the improvement of crop traits.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- WUHAN UNIV
- Filing Date
- 2025-03-19
- Publication Date
- 2026-05-15
AI Technical Summary
In the agricultural field, existing technologies for targeting the degradation of endogenous plant protein aggregates are complex and costly, limiting their widespread application and lacking direct, efficient, and economical strategies.
The fusion protein consists of the target protein gene X and the E3TCD protein, and achieves self-degradation through phase separation and aggregation. Specific implementation methods include expressing the E3TCD protein in plants and using transgenic technology to precisely regulate the degradation of endogenous proteins.
This technology enables highly efficient and targeted degradation of endogenous protein aggregates in plants, simplifies the operational process, lowers the technical threshold, promotes the targeted improvement of crop traits, and has broad application potential.
Smart Images

Figure CN2025083290_15052026_PF_FP_ABST
Abstract
Description
A fusion protein and its application in the targeted degradation of easily aggregated proteins Technical Field
[0001] This invention belongs to the field of protein targeted degradation technology, specifically relating to a fusion protein and its application in the targeted degradation of easily aggregated proteins. Technical Background
[0002] In plant biology, the dynamic regulation of protein homeostasis constitutes one of the core strategies for plants to adapt to varying growth conditions and resist biotic and abiotic stresses. This process encompasses multiple key steps, including de novo protein synthesis, post-translational modification, precise intracellular localization, and eventual degradation, all working together to maintain the balance and functional optimization of intracellular protein components. Recent studies have found that phase separation-mediated protein aggregation plays a crucial role in protein homeostasis regulation. Phase separation allows proteins to spontaneously aggregate under specific conditions to form membrane-free liquid-liquid phase separators. This process not only regulates local protein concentrations and interaction networks but may also play a key role in signal transduction, organelle formation, and functional partitioning, thus profoundly affecting plant growth, development, and stress response. Given the importance of protein homeostasis to plant physiological activities, its regulatory strategies are gradually becoming new targets for crop genetic improvement. Parallel to widely used CRISPR-Cas9 gene editing technology and RNA interference, which are based on DNA or RNA-level genetic manipulation, regulating protein homeostasis provides a new approach for directly intervening at the protein functional level and precisely regulating plant traits. This strategy not only allows for fine-tuning of the function and activity of specific proteins, but also potentially unlocks trait improvement opportunities that are difficult to access using traditional breeding methods, demonstrating its enormous potential as a future innovation in agricultural biotechnology. Therefore, in-depth research into the regulatory mechanisms of protein homeostasis and its potential applications in plants is of great significance for promoting sustainable agricultural development and improving crop resistance and yield.
[0003] In the complex network architecture of protein homeostasis regulation, the ubiquitin-proteasome system (UPS) and the autophagy system occupy an indispensable core position, jointly maintaining the dynamic homeostasis of intracellular proteins. Based on in-depth exploration of these two systems, researchers have successfully designed a variety of innovative tools, such as auxin-induced degraders (AID), autophagy-targeting chimeras (AUTAC), protein hydrolysis-targeting chimeras (PROTAC), and Trime. These tools, by precisely targeting and promoting protein degradation, have greatly enriched our fundamental understanding of life processes and demonstrated enormous application potential and valuable significance in the field of drug development. However, despite the significant progress these technologies have made in biomedical research, their promotion and application in agriculture face many challenges. The core difficulty lies in the fact that most of these technologies rely on small-molecule chemical inducers, specific antibodies, or require gene editing to integrate degrader sequences into endogenous proteins. This process is not only technically complex but also time-consuming and costly, limiting its widespread application in agricultural practice.
[0004] Therefore, developing a direct, efficient, and economical strategy for the specific modification of endogenous plant proteins has become a critical issue urgently needing to be addressed in agricultural scientific research. This strategy aims to promote the targeted improvement of crop traits by simplifying operational procedures, reducing technical barriers and costs, thereby aligning with the grand goal of sustainable agricultural development. Summary of the Invention
[0005] The purpose of this invention is to provide a fusion protein and its application in the targeted degradation of easily aggregated proteins. This invention screened five E3TCD1 proteins with aggregation ability and self-degradation properties in the model plant Arabidopsis thaliana, which can be used in the targeted aggregate protein degradation (TCD) method system. Furthermore, the effectiveness of the TCD method in targeting and degrading endogenous protein aggregates was demonstrated at the tobacco, rice, and animal levels.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] In a first aspect of the invention, a fusion protein is provided, the fusion protein being composed of a protein from a target protein gene X fused with an E3TCD protein, the structure of the fusion protein being shown in Formula I:
[0008] X is the target protein gene, i.e., the protein gene that needs to be degraded; the E3TCD protein is an E3 ligase with inherent disordered protein characteristics, which can achieve self-degradation through phase separation and aggregation; the gene encoding the E3TCD protein includes one of the following:
[0009] The E3TCD protein of Arabidopsis thaliana, abbreviated as AtE3TCD1, has the nucleotide sequence shown in SEQ ID NO.25;
[0010] The E3TCD protein of rice, abbreviated as OsE3TCD1, has the nucleotide sequence shown in SEQ ID NO.26;
[0011] The E3TCD protein of maize, abbreviated as ZmE3TCD1, has the nucleotide sequence shown in SEQ ID NO.27;
[0012] The wheat E3TCD protein, abbreviated as TaE3TCD1, has the nucleotide sequence shown in SEQ ID NO.28;
[0013] The E3TCD protein of soybean, abbreviated as GmE3TCD1, has the nucleotide sequence shown in SEQ ID NO.29;
[0014] The E3TCD2 protein of Arabidopsis thaliana, abbreviated as AtE3TCD2, has the nucleotide sequence shown in SEQ ID NO.30;
[0015] The E3TCD3 protein of Arabidopsis thaliana, abbreviated as AtE3TCD3, has the nucleotide sequence shown in SEQ ID NO.31;
[0016] The E3TCD4 protein of Arabidopsis thaliana, abbreviated as AtE3TCD4, has the nucleotide sequence shown in SEQ ID NO.32;
[0017] The E3TCD5 protein of Arabidopsis thaliana, abbreviated as AtE3TCD5, has the nucleotide sequence shown in SEQ ID NO.33.
[0018] Furthermore, the target protein gene X is directly linked to the E3TCD protein or linked through a linker.
[0019] The linker can be a flexible linker, such as amino acid GGGSSGGGS.
[0020] In one specific implementation, the nucleotide sequence of the linker is as follows:
[0021] 5'-gcacggctcttctcctcactcgaccagatctcgtacgcgtcccggggcggtggctcatctggcggaggtggatct-3' (SEQ ID NO.37), amino acid sequence: ARLFSSLDQISYASRGGGSSGGGGS (SEQ ID NO.38).
[0022] Furthermore, the gene encoding the E3TCD protein was obtained by PCR amplification using the following primer pair:
[0023] 1) Primer pair AtP1, nucleotide sequence as shown in SEQ ID NO.1-SEQ ID NO.2; A 2001bp amplified fragment was amplified from Arabidopsis cDNA, which is the nucleic acid molecule encoding Arabidopsis E3TCD protein;
[0024] 2) Primer pair OsP1, nucleotide sequence as shown in SEQ ID NO.3-SEQ ID NO.4; a 2004bp amplified fragment can be amplified from rice cDNA, which is the nucleic acid molecule encoding the rice E3TCD protein;
[0025] 3) Primer pair ZmP1, nucleotide sequence as shown in SEQ ID NO.5-SEQ ID NO.6; a 1992bp amplified fragment can be amplified from maize cDNA, which is the nucleic acid molecule encoding the E3TCD protein of maize;
[0026] 4) Primer pair TaP1, nucleotide sequence as shown in SEQ ID NO.7-SEQ ID NO.8; a 2007bp amplified fragment can be amplified from wheat cDNA, which is the nucleic acid molecule encoding wheat E3TCD protein;
[0027] 5) Primer pair GmP1, nucleotide sequence as shown in SEQ ID NO.9-SEQ ID NO.10; a 2148bp amplified fragment can be amplified from soybean cDNA, which is the nucleic acid molecule encoding soybean E3TCD protein;
[0028] 6) Primer pair AtP2, nucleotide sequence as shown in SEQ ID NO.11-SEQ ID NO.12; A 1485bp amplified fragment was amplified from Arabidopsis cDNA, which is the nucleic acid molecule encoding the E3TCD2 protein of Arabidopsis;
[0029] 7) Primer pair AtP3, nucleotide sequence as shown in SEQ ID NO.13-SEQ ID NO.14; A 1461bp amplified fragment was amplified from Arabidopsis cDNA, which is the nucleic acid molecule encoding the E3TCD3 protein of Arabidopsis;
[0030] 8) Primer pair AtP4, nucleotide sequence as shown in SEQ ID NO.15-SEQ ID NO.16; A 1038bp amplified fragment was amplified from Arabidopsis cDNA, which is the nucleic acid molecule encoding the E3TCD4 protein of Arabidopsis;
[0031] 9) Primer pair AtP5, nucleotide sequence as shown in SEQ ID NO.17-SEQ ID NO.18; 996bp amplified fragment was amplified from Arabidopsis cDNA, which is the nucleic acid molecule encoding Arabidopsis E3TCD5 protein.
[0032] In a second aspect of the invention, a nucleic acid molecule encoding the fusion protein is provided.
[0033] In a third aspect of the invention, a recombinant vector containing the aforementioned nucleic acid molecule is provided.
[0034] In a fourth aspect of the invention, a promoter for a recombinant vector is provided.
[0035] In a fifth aspect of the invention, a transformant comprising the recombinant vector is provided.
[0036] In a sixth aspect of the present invention, a method for targeted degradation of plant endogenous protein aggregates is provided, the method comprising: transferring the nucleic acid molecule or the recombinant vector into a plant by means of transient expression or transgenic method, thereby expressing the fusion protein and achieving targeted degradation of plant endogenous protein aggregates.
[0037] In a sixth aspect of the invention, the use of the fusion protein, the nucleic acid molecule, or the recombinant vector is provided in the improvement of plant traits.
[0038] In the above applications, by expressing the fusion protein in crops, the targeted degradation of target endogenous protein aggregates can be achieved, thereby improving crop traits such as disease resistance, heading date, and seed setting rate at the protein level.
[0039] In a seventh aspect of the invention, the application of the fusion protein, the nucleic acid molecule, or the recombinant vector in the field of animal research based on protein-targeted degradation is provided.
[0040] In a seventh aspect of the invention, the application of the fusion protein, the nucleic acid molecule, or the recombinant vector in medical treatment or drug research is provided.
[0041] Furthermore, the gene sequence of the aforementioned target gene - E3TCD and its expressed fusion protein can be applied in medical treatment and drug development. The aforementioned TCD technology, as a potential gene therapy approach, can be used to treat and / or prevent any diseases or conditions related to and / or caused by protein aggregates, including but not limited to neurodegenerative diseases and metabolic diseases.
[0042] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:
[0043] This invention innovatively proposes a method based on a novel targeted degradation mechanism for easily aggregated proteins (TCD) and explores its application in fundamental protein functional research. This method utilizes transgenic technology to precisely regulate the degradation process of endogenous proteins, demonstrating advantages such as ease of operation, significant efficiency, and no adverse effects on organisms. Given the global challenges facing modern agriculture, there is an urgent need to develop crop varieties with high yields and stress resistance to achieve sustainable agricultural development. Against this backdrop, the rapid development of transgenic technology, especially when combined with the TCD strategy, along with advanced genetic engineering techniques such as DNA editing and RNA silencing, provides strong technical support for cultivating new crop varieties capable of effectively addressing these challenges. In this study, we successfully verified the degradation activity of the E3TCD1 protein in Arabidopsis thaliana in heterologous expression systems such as tobacco and rice, revealing its broad functional conservation. Furthermore, through systematic screening and identification, we discovered homologous genes of E3TCD1 in multiple plant species. This discovery not only expands the applicability of the TCD mechanism but also provides rich genetic resources for subsequent functional verification and improvement across multiple species. Most importantly, the universality and efficiency demonstrated by the TCD method in this study indicate its enormous application potential in the biomedical field. As a potential gene therapy strategy, TCD technology holds promise for providing new ideas and methods for treating genetic diseases caused by abnormal protein accumulation. Attached Figure Description
[0044] To more clearly illustrate the technical methods in the embodiments of the present invention, the accompanying drawings related to the embodiments will be introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without any creative effort.
[0045] Figure 1. Schematic diagram of TCD. The TCD system targets specific condensates formed by easily condensable protein X. These proteins typically aggregate into condensates, transitioning from a soluble phase to an ordered structure, reaching an equilibrium between condensates of different sizes (oligomers, low-order, and high-order). To remove these condensates, an E3 ligase from the ubiquitin-proteasome system (UPS) is fused with X to form X-E3. This fusion protein mimics X, facilitating its penetration into the interior of the condensate. Once inside, X-E3 triggers the degradation process. Preliminary experiments involving the transient expression of X-E3 and X-YFP in *N. benthamiana* or protoplasts are crucial before generating transgenic plants for phenotypic analysis. These experiments can assess TCD efficiency using methods such as microscopic observation or immunoblotting. Different promoters are needed to control the spatial and temporal expression and intensity of X-E3.
[0046] Figure 2. Degradation of E3TCD1 on E3TCD1-YFP and E3TCD1ΔRING-YFP aggregates in preliminary experiments via microscopic observation (a) and immunoblotting analysis (b) in *N. benthamiana*. Target protein X is labeled with YFP, while TCD is represented by X-E3TCD1. In microscopic observation, 35S::CFP serves as a control (a). Scale bar, 10 μm. CBB, Coomassie Brilliant Blue.
[0047] Figure 3.a. OsTB1 is predicted as an intrinsically disordered protein (IDP) using PLAAC and D2P2 algorithms, represented by prion-like domain (PrD) scores and disorder scores, respectively. The bottom portion shows the low-complexity region and RING domain annotated by the SMART website. b, c. Preliminary experiments demonstrating the degradation of OsTB1 by the TCD system through microscopic observation (b) and immunoblotting analysis (c). In the microscopic observation, 35S::CFP was used as a control (b). Semi-quantitative RT-PCR analysis of YFP was performed using NbUBQ as an internal control (c). Scale bar, 10 μm. d, e. Tiller number in rice plants transformed with 35S::E3TCD1 or 35S::OsTB1-E3TCD1 (ZH11). Two independent transgenic lines (#1 and #2) were used for each construct. Bar graphs show the mean ± standard deviation of tiller numbers (n = 30), and significance was determined using a two-tailed Student's t-test. Scale bar, 10 cm. f, Quantitative RT-PCR shows the relative levels of endogenous OsTB1 mRNA in the transgenic lines. The endogenous OsTB1 gene was amplified using primers that bind to the untranslated region (not included in the OsTB1-E3TCD1 transgene). Bar graphs show the mean ± standard deviation relative to ZH11 normalized values (n = 3), and significance was determined using a two-tailed Student's t-test.
[0048] Figure 4.a, b. Preliminary experiments demonstrating the degradation of OsELF3-1 and OsELF3-2 by the TCD system through microscopic observation (a) and immunoblotting analysis (b). In the microscopic observation, 35S::CFP was used as a control (a). Semi-quantitative RT-PCR analysis of YFP was performed using NbUBQ as an internal control (b). Scale bar, 10 μm. CBB, Coomassie Brilliant Blue. c, d. Flowering phenotypes of rice Zhonghua 11 (ZH11) plants transformed with 35S::E3TCD1, 35S::OsELF3-1-E3TCD1, or 35S::OsELF3-2-E3TCD1. Scale bar, 10 cm. Two independent transgenic lines (#1 and #2) were used for each construct. The bar graphs show the mean ± standard deviation (n = 15) of the number of days from sowing to heading under natural long-day (LD) conditions, and significance was determined using a two-tailed Student's t-test.
[0049] Figures 5.a and 5.b show the growth phenotypes of rice Zhonghua 11 (ZH11) plants transformed with ProHSP::OsELF3-1-E3TCD1. Two independent transgenic lines (#1 and #2) were used. Figures c, e, and f show the seed setting rate phenotypes of rice Zhonghua 11 (ZH11) plants transformed with ProHSP::OsELF3-1-E3TCD1. Figure d shows the number of days from sowing to heading under natural long-day (LD) conditions.
[0050] Figure 6. Microscopic observation of the degradation effect of the TCD system on OCT4. mCherry serves as a control. Scale bar: 10 micrometers. Detailed Implementation
[0051] The present invention will be further described below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention clearer. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.
[0052] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.
[0053] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be obtained by purchasing them from the market or by existing methods.
[0054] This invention provides a fusion protein and its application in the targeted degradation of easily aggregated proteins. The overall concept is as follows:
[0055] We explored the application of the TCD method in plants, and here we propose a novel method for targeted degradation of endogenous protein aggregates in plants. In previous studies, we screened five E3TCD1 molecules with aggregation and self-degradation properties in the model plant Arabidopsis thaliana, which can be used in the TCD method system. We further demonstrated the effectiveness of the TCD method in targeting and degrading endogenous protein aggregates in tobacco and rice.
[0056] The TCD method modifies and transforms genetic material at the protein level, and has significant potential applications in crop breeding, animal research, medical treatment, and drug development.
[0057] As a typical embodiment of the present invention, a fusion protein is provided, characterized in that the fusion protein is composed of a protein from target protein gene X fused with an E3TCD protein, and the structure of the fusion protein is shown in Formula I:
[0058] X is the target protein gene, i.e., the protein gene that needs to be degraded; the E3TCD protein is an E3 ligase with inherent disordered protein characteristics, which can achieve self-degradation through phase separation and aggregation; the gene encoding the E3TCD protein includes one of the genes obtained by PCR amplification using the following primer pairs:
[0059] 1) Primer pair AtP1, nucleotide sequences as shown in SEQ ID NO.1-SEQ ID NO.2;
[0060] 2) Primer pair OsP1, nucleotide sequences as shown in SEQ ID NO.3-SEQ ID NO.4;
[0061] 3) Primer pair ZmP1, nucleotide sequences as shown in SEQ ID NO.5-SEQ ID NO.6;
[0062] 4) Primer pair TaP1, nucleotide sequences as shown in SEQ ID NO.7-SEQ ID NO.8;
[0063] 5) Primer pair GmP1, nucleotide sequences as shown in SEQ ID NO.9-SEQ ID NO.10;
[0064] 6) Primer pair AtP2, nucleotide sequences as shown in SEQ ID NO.11-SEQ ID NO.12;
[0065] 7) Primer pair AtP3, nucleotide sequences as shown in SEQ ID NO.13-SEQ ID NO.14;
[0066] 8) Primer pair AtP4, nucleotide sequences as shown in SEQ ID NO.15-SEQ ID NO.16;
[0067] 9) Primer pair AtP5, nucleotide sequences as shown in SEQ ID NO.17-SEQ ID NO.18.
[0068] Table 1
[0069] As a specific implementation method, when the target protein gene X is OsTB1, it can be amplified using the primer pair of SEQ ID NO.39-SEQ ID NO.40.
[0070] As a specific implementation, when the target protein gene X is ELF3, the application of the ELF3-E3TCD1 nucleic acid molecule in improving the flowering time of plants using this fusion gene sequence is provided. The nucleic acid molecule encoding the ELF3 protein is selected from one of the following:
[0071] 1) AtELF3, nucleotide sequence as shown in SEQ ID NO.41; can be amplified by primer pair of SEQ ID NO.42-SEQ ID NO.43.
[0072] 2) OsELF3, nucleotide sequence as shown in SEQ ID NO.44; can be amplified by primer pair of SEQ ID NO.45-SEQ ID NO.46.
[0073] 3) ZmELF3, nucleotide sequence as shown in SEQ ID NO.47; can be amplified by primer pair of SEQ ID NO.48-SEQ ID NO.49.
[0074] 4) TaELF3, nucleotide sequence as shown in SEQ ID NO.50; can be amplified by primer pair of SEQ ID NO.51-SEQ ID NO.52.
[0075] 5) GmELF3, nucleotide sequence as shown in SEQ ID NO.53; can be amplified by primer pair of SEQ ID NO.54-SEQ ID NO.55.
[0076] The nucleic acid molecule encoding the ELF3 protein can be obtained by PCR amplification using the primer pairs shown in Table 2.
[0077] Table 2
[0078] As a specific implementation, when the target protein gene X is OCT4, the application of the OCT4-E3TCD1 nucleic acid molecule in the protein degradation of the HeLa cell system based on this fusion gene sequence is provided. The nucleic acid molecule encoding the OCT4 protein is as follows:
[0079] OCT4, with its nucleotide sequence shown in SEQ ID NO.57, can be amplified using the primer pair of SEQ ID NO.58-SEQ ID NO.59.
[0080] As a specific implementation method, Pro is provided. HSP The application of the ::OsELF3-1-E3TCD1 nucleic acid molecule in improving rice seed setting rate using this fusion gene sequence. Encoding Pro HSP The promoter nucleic acid molecule was obtained by PCR amplification using one of the following primer pairs:
[0081] 1) Primer pair HSP1, nucleotide sequence as shown in SEQ ID NO.19-SEQ ID NO.20; a 2043bp amplified fragment can be amplified from rice genomic DNA, namely the rice HSP1 promoter, abbreviated as Pro. HSP1 The nucleotide sequence is shown in SEQ ID NO.34;
[0082] 2) Primer pair HSP2, nucleotide sequence as shown in SEQ ID NO.21-SEQ ID NO.22; an 825bp amplified fragment can be amplified from rice genomic DNA; that is, the rice HSP2 promoter, abbreviated as Pro. HSP2 The nucleotide sequence is shown in SEQ ID NO.35;
[0083] 3) Primer pair HSP3, nucleotide sequences as shown in SEQ ID NO.23-SEQ ID NO.24; an 829 bp fragment can be amplified from rice genomic DNA; the rice HSP3 promoter, abbreviated as Pro... HSP3 The nucleotide sequence is shown in SEQ ID NO.36.
[0084] The following will provide a detailed description of a fusion protein of this application and its application in the targeted degradation of easily aggregated proteins, in conjunction with embodiments and experimental data.
[0085] Example 1: TCD method determines TB1 as a negative regulator of rice tillering.
[0086] I. Construction of the TB1-E3TCD1 vector
[0087] 1. Primer design and synthesis
[0088] The OsTB1 genome sequence was downloaded from the Rice Genome Annotation Project website. Specific amplification primers were designed, and the OsTB1 gene fragment was amplified using total cDNA from Zhonghua 11 (ZH11) as a template. Our previous research had already screened and validated E3TCD1 using the TCD method, and we successfully constructed the 35S::E3TCD1 plasmid vector. The construction method involved ligating the universal promoter 35S and E3TCD1 (nucleotide sequence shown in SEQ ID NO. 25) using enzyme digestion, specifically by double digestion with Eco1 and Sac1, and then by double digestion with Kpn1 and Bamh1, into the pCAMBIA1300 vector.
[0089] Given that our vector construction system uses the LIC ligation method, we added LIC sequence adapters CGA CGACAA GAC CGT ACC and GA GGA GAA GAG CCG TGC to the 5′ ends of the upstream and downstream primer fragments used for amplification, respectively. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., and their sequences and numbers are as follows:
[0090] Upstream primer OsTB1-F:
[0091] 5′--3′:CGA CGA CAA GAC CGT ACC ATGCTTCCTTTCTTCGATTCCC (SEQ ID NO. 39);
[0092] Downstream primer OsTB1-R:
[0093] 5′--3′:GA GGA GAA GAG CCG TGC GCAGTAGTGCCGCGAATTGGCG (SEQ ID NO. 40);
[0094] 2. PCR amplification
[0095] Using ZH11 cDNA as a template, the OsTB1 fragment was amplified by PCR using primers synthesized in step 1. The amplification reaction system and specific reaction conditions are as follows:
[0096] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: denature at 95°C for 5 min, then at 95°C for 30 sec, 56°C for 30 sec, and 72°C for 2 min for 35 cycles; then at 72°C for 5 min.
[0097] The amplified PCR products were detected by 1% agarose gel electrophoresis, and the target fragment was recovered and purified using a gel recovery kit.
[0098] 3. LIC processing of target fragment and vector
[0099] The recovered target fragment from step 2 is then subjected to LIC treatment. The specific reaction system and steps are as follows:
[0100] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: 12℃ for 30 min, 75℃ for 10 min.
[0101] The 35S::E3TCD1 vector constructed in previous studies was subjected to LIC treatment. The specific reaction system and steps are as follows:
[0102] Step 1:
[0103] Mix well and incubate at 37°C for 1 hour.
[0104] Step 2:
[0105] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: 12℃ for 40 min, 75℃ for 10 min.
[0106] Construction of the 4.35S::TB1-E3TCD1 vector
[0107] Take 1.5 μL of each of the LIC-treated vector and the target fragment described in step 3, mix them well, and place them on a PCR thermal cycler for reaction: 75 °C for 5 min, 22 °C for 5 min.
[0108] Transfer 3 μL of the ligation product to 30 μL of highly competent E. coli DN5α, tap gently with your finger 3-5 times, and then incubate on ice for 20-30 min. After incubation, heat shock at 42°C for 1 min, and immediately transfer to ice for 2 min. Add 200 μL of antibiotic-free LB and incubate at 37°C and 220 rpm for 45-60 min. Precipitate E. coli at 6000 rpm for 2 min, and spread evenly on Kana-resistant culture dishes. Incubate overnight at 37°C.
[0109] The following day, eight colonies were streaked onto a new plate, and colony PCR was performed in the afternoon. One positive colony was selected for sequencing. After confirming the sequencing results were correct, the plasmid was returned from the company for Agrobacterium transformation.
[0110] Meanwhile, the 35S::E3TCD1 and 35S::TB1-mYFP vectors were used as controls. The 35S::TB1-mYFP vector was constructed by ligating the universal promoter 35S and TB1-mYFP (nucleotide sequence as shown in SEQ ID NO.56) with enzyme digestion, using double digestion with Eco1 and Sac1, and double digestion with Kpn1 and Bamh1, respectively, into the pCAMBIA1300 vector.
[0111] The plasmid containing 35S::TB1-E3TCD1 was transformed into Agrobacterium GV3101 (for experiments such as tobacco injection) and Agrobacterium EHA105 (for obtaining transgenic rice plants).
[0112] The specific Agrobacterium transformation steps are as follows: Transfer 3 μL of the above plasmid to 30 μL of highly competent Agrobacterium GV3101 or EHA105, tap it lightly with your finger 3-5 times, and then let it stand on ice for 10 min. First, freeze it in liquid nitrogen for 1 min, then heat shock it at 42℃ for 1 min, and then immediately transfer it to an ice bath for 2 min. Add 200 μL of antibiotic-free LB and revive it in a shaker at 220 rpm and 28℃ for 45-60 min. Precipitate Agrobacterium at 6000 rpm for 2 min, and spread it evenly on a culture dish with Kana resistance, and incubate it in a 28℃ incubator for two days. Pick a single colony of Agrobacterium, shake it, and mix it with 50% glycerol at a 1:1 ratio and store it in a freezer at -80℃.
[0113] II. Heterologous expression of 35S::TB1-E3TCD1 in tobacco can effectively degrade TB1.
[0114] 1. Tobacco Injection
[0115] Nicotiana benthamiana is grown in a greenhouse under the following conditions: 14 hours of light / 10 hours of darkness, temperature 25°C, and relative humidity 70%. The tobacco can be injected after about 4 to 5 weeks of cultivation.
[0116] Through the above steps, Agrobacterium GV3101 containing the vectors 35S::TB1-E3TCD1, 35S::E3TCD1, and 35S::TB1-mYFP was obtained. A portion of the Agrobacterium containing the constructed vectors was picked and transferred to 3 ml of LB medium containing Kana antibiotic, and cultured for 18 h at 200 rpm in a shaker at 28°C. (OD) 600 (Approximately 1.0-2.0)
[0117] Collect 100 μL of bacterial culture by centrifugation at 6000 rpm for 5 min at room temperature. Resuspend the bacterial cells in 2 mL of infiltration buffer (containing 10 mM MgCl2, 10 mM MES, 150 μM acetylsylgenone (AS), pH 5.6). Let it stand at room temperature for 2–3 h (at least 0.5 h, and no more than 3 h).
[0118] Using a syringe with the needle removed, aspirate the bacterial solution and co-inject 35S::TB1-E3TCD1 and 35S::TB1-mYFP into tobacco leaves, with co-injection of 35S::E3TCD1 and 35S::TB1-mYFP serving as a control. Mark the water-soaked areas on the tobacco leaves with a marker.
[0119] After the injected plants were cultured at around 21°C for 36-48 hours, the protein content of TB1 was determined by Western blotting.
[0120] 2. Western blot (protein immunoblotting)
[0121] TB1 protein expression was analyzed by Western blotting using anti-YFP as the primary antibody. Specific steps included:
[0122] 1) Sample processing
[0123] Take 0.1g of the injected tobacco leaves and grind them. Add 100ul of sample buffer (loading buffer) to each of the experimental group and the control group and mix well. Then boil in a water bath for 5 minutes and cool for later use.
[0124] 2) Separation of protein components by SDS-PAGE electrophoresis
[0125] Electrophoresis was performed using a 5% stacking gel and a 10% separating gel. The procedure was performed according to *Molecular Cloning, Laboratory Manual*. For ease of comparison, identical volumes of samples were used for each electrophoresis sample.
[0126] 3) Transfer membrane and antibody reaction
[0127] After electrophoresis, remove the gel and wash it with water. Simultaneously, soak the nitrocellulose membrane (NC) and filter paper in transfer buffer for 5 min. Lay the gel and NC membrane in the following order: cathode-sponge-filter paper-gel-NC membrane-filter paper-sponge-anodide. Place the membrane in the electrophoresis tank and electrophores at 88V for 3 h at low temperature. Remove the NC membrane and wash it with 1×TBST (% Tween-20 TBS) for 5 min. Add TBST blocking buffer containing 5% skim milk powder and incubate at 37°C for 2 h. Wash the NC membrane 3 times with TBST for 10 min each time. Add mouse anti-YFP (1:500 PBST dilution) and incubate at 37°C for 2 h. Wash the NC membrane thoroughly with TBST 3-5 times for 10 min each time. Add HRP-labeled goat anti-mouse IgG antibody (TBST 1:3000 dilution) and incubate at 37°C for 1 h. Wash the NC membrane thoroughly with TBST 3-5 times for 10 min each time. Add DAB colorimetric solution (see "Molecular Cloning, Laboratory Manual" for specific formula), incubate at room temperature in the dark for 5-10 minutes, wash the NC membrane with water, and observe and record the results.
[0128] We observed a decrease in the protein content of TB1-mYFP after co-expression of TB1-E3TCD1 and TB1-mYFP, indicating that TB1-E3TCD1 can degrade TB1. (See Figures 3b and 3c)
[0129] III. The number of tillers in 35S::TB1-E3TCD1 transgenic rice increased significantly.
[0130] 1. Obtaining genetically modified rice
[0131] The Agrobacterium tumefaciens EHA105 containing the 35S::TB1-E3TCD1 and 35S::E3TCD1 vectors obtained in step one above was sent to Wuhan Boyuan Biotechnology Co., Ltd. for rice transformation. The rice variety we used was Zhonghua 11 (ZH11). After obtaining the transgenic rice, we first screened for positive transgenic plants. After identifying the positive transgenic plants, we planted them at the Huashan Rice Experimental Base of Wuhan University.
[0132] 2. Phenotypic observation of transgenic rice
[0133] The aforementioned genetically modified rice was grown in a natural environment, with the same management measures as in open fields.
[0134] Observations revealed no significant difference in tiller number between the ZH11 and 35S::E3TCD1 control lines. This indicates that the self-degradation properties of E3TCD1 can prevent negative impacts on plant growth. Compared to the 35S::E3TCD1 transgene, the 35S::TB1-E3TCD1 transgene showed an increased tiller number, consistent with the phenotype reported in the literature for plants with the TB1 DNA mutation. (See Figures 3d and 3e)
[0135] Example 2: The TCD method can target and degrade rice ELF3-1 to delay rice flowering.
[0136] I. Construction of the OsELF3-1-E3TCD1 vector
[0137] 1. Primer design and synthesis
[0138] The OsELF3-1 genome sequence was downloaded from the Rice Genome Annotation Project website. Specific amplification primers were designed, and the OsELF3-1 gene fragment was amplified using total cDNA from Zhonghua 11 (ZH11) as a template. Our previous research had already screened and validated E3TCD1 using the TCD method, successfully constructing the 35S::E3TCD1 plasmid vector. Since our vector construction system uses the LIC ligation method, we added LIC sequence adapters CGACGACAAGACCGTACC and GAGGAGAAGAGCCGTGC to the 5′ ends of the upstream and downstream primer fragments used for amplification, respectively. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., and the sequences and numbers of each primer are as follows:
[0139] Upstream primer OLM707
[0140] 5′--3′:CGA CGA CAA GAC CGT ACC ATGGCGACGAGGGGAGGAGG (SEQ ID NO.45);
[0141] Downstream primer OLM708
[0142] 5′--3′:GA GGA GAA GAG CCG TGC ATCATCTCGTTGCCGTTCCATTTG (SEQ ID NO. 46);
[0143] 2. PCR amplification
[0144] Using ZH11 cDNA as a template, the OsELF3-1 fragment was amplified by PCR using primers synthesized in step 1. The amplification reaction system and specific reaction conditions are as follows:
[0145] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: denature at 95°C for 5 min, then at 95°C for 30 sec, 56°C for 30 sec, and 72°C for 2 min for 35 cycles; then at 72°C for 5 min.
[0146] The amplified PCR products were detected by 1% agarose gel electrophoresis, and the target fragment was recovered and purified using a gel recovery kit.
[0147] 3. LIC processing of target fragment and vector
[0148] The recovered target fragment from step 2 is then subjected to LIC treatment. The specific reaction system and steps are as follows:
[0149] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: 12℃ for 30 min, 75℃ for 10 min.
[0150] The 35S::E3TCD1 vector constructed in previous studies was subjected to LIC treatment. The specific reaction system and steps are as follows:
[0151] Step 1:
[0152] Mix well and incubate at 37°C for 1 hour.
[0153] Step 2:
[0154] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: 12℃ for 40 min, 75℃ for 10 min.
[0155] 4. Construction of the 35S::OsELF3-1-E3TCD1 vector
[0156] Take 1.5 μL of each of the LIC-treated vector and the target fragment described in step 3, mix them well, and place them on a PCR thermal cycler for reaction: 75 °C for 5 min, 22 °C for 5 min.
[0157] Transfer 3 μL of the ligation product to 30 μL of highly competent E. coli DN5α, tap gently with your finger 3-5 times, and then incubate on ice for 20-30 min. After incubation, heat shock at 42°C for 1 min, and immediately transfer to ice for 2 min. Add 200 μL of antibiotic-free LB and incubate at 37°C and 220 rpm for 45-60 min. Precipitate E. coli at 6000 rpm for 2 min, and spread evenly on Kana-resistant culture dishes. Incubate overnight at 37°C.
[0158] The following day, eight colonies were streaked onto a new plate, and colony PCR was performed in the afternoon. One positive colony was selected for sequencing. After confirming the sequencing results were correct, the plasmid was returned from the company for Agrobacterium transformation.
[0159] The plasmid containing 35S::OsELF3-1-E3TCD1 was transformed into Agrobacterium GV3101 (for experiments such as tobacco injection) and Agrobacterium EHA105 (for obtaining transgenic rice plants).
[0160] The specific Agrobacterium transformation steps are as follows: Transfer 3 μL of the above plasmid to 30 μL of highly competent Agrobacterium GV3101 or EHA105, tap it lightly with your finger 3-5 times, and then let it stand on ice for 10 min. First, freeze it in liquid nitrogen for 1 min, then heat shock it at 42°C for 1 min, and then immediately transfer it to an ice bath for 2 min. Add 200 μL of antibiotic-free LB and revive it in a shaker at 220 rpm and 28°C for 45-60 min. Precipitate Agrobacterium at 6000 rpm for 2 min, and spread it evenly on a culture dish with Kana resistance, and incubate it in a 28°C incubator for two days. Pick Agrobacterium colonies, shake them, and mix them with 50% glycerol at a 1:1 ratio and store them in a freezer at -80°C.
[0161] II. Heterologous expression of 35S::OsELF3-1-E3TCD1 in tobacco can effectively degrade OsELF3-1.
[0162] 1. Tobacco Injection
[0163] Nicotiana benthamiana is grown in a greenhouse under the following conditions: 14 hours of light / 10 hours of darkness, temperature 25°C, and relative humidity 70%. The tobacco can be injected after about 4 to 5 weeks of cultivation.
[0164] Through the above steps, Agrobacterium GV3101 containing the vectors 35S::OsELF3-1-E3TCD1, 35S::E3TCD1, and 35S::OsELF3-1-mYFP was obtained. A portion of the Agrobacterium containing the constructed vectors was picked and transferred to 3 ml of LB medium containing Kana antibiotic, and cultured for 18 h at 200 rpm in a shaker at 28°C. (oD600 approximately 1.0-2.0).
[0165] Collect 100 μL of bacterial culture by centrifugation at 6000 rpm for 5 min at room temperature. Resuspend the bacterial cells in 2 mL of infiltration buffer (containing 10 mM MgCl2, 10 mM MES, 150 μM acetylsylgenone (AS), pH 5.6). Let it stand at room temperature for 2–3 h (at least 0.5 h, and no more than 3 h).
[0166] Using a syringe with the needle removed, aspirate the bacterial solution and co-inject 35S::OsELF3-1-E3TCD1 and 35S::OsELF3-1-mYFP into tobacco leaves, using co-injection of 35S::E3TCD1 and 35S::OsELF3-1-mYFP as a control. Mark the water-soaked areas on the tobacco leaves with a marker.
[0167] After the injected plants were cultured at around 21°C for 36-48 hours, the protein content of OsELF3-1 was determined by Western blotting.
[0168] 2. Western blot (protein immunoblotting)
[0169] OsELF3-1 protein expression was analyzed by Western blotting using anti-YFP as the primary antibody. Specific steps included:
[0170] (1) Sample processing
[0171] Take 0.1g of the injected tobacco leaves and grind them. Add 100ul of sample buffer (loading buffer) to each of the experimental group and the control group and mix well. Then boil in a water bath for 5 minutes and cool for later use.
[0172] (2) Separation of protein components by SDS-PAGE electrophoresis
[0173] Electrophoresis was performed using a 5% stacking gel and a 10% separating gel. The procedure was performed according to *Molecular Cloning, Laboratory Manual*. For ease of comparison, identical volumes of samples were used for each electrophoresis sample.
[0174] (3) Transfer and antibody reaction
[0175] After electrophoresis, remove the gel and wash it with water. Simultaneously, soak the nitrocellulose membrane (NC) and filter paper in transfer buffer for 5 min. Lay the gel and NC membrane in the following order: cathode-sponge-filter paper-gel-NC membrane-filter paper-sponge-anodide. Place the membrane in the electrophoresis tank and electrophores at 88V for 3 h at low temperature. Remove the NC membrane and wash it with 1×TBST (% Tween-20 TBS) for 5 min. Add TBST blocking buffer containing 5% skim milk powder and incubate at 37°C for 2 h. Wash the NC membrane 3 times with TBST for 10 min each time. Add mouse anti-YFP (1:500 PBST dilution) and incubate at 37°C for 2 h. Wash the NC membrane thoroughly with TBST 3-5 times for 10 min each time. Add HRP-labeled goat anti-mouse IgG antibody (TBST 1:3000 dilution) and incubate at 37°C for 1 h. Wash the NC membrane thoroughly with TBST 3-5 times for 10 min each time. Add DAB colorimetric solution (see "Molecular Cloning, Laboratory Manual" for specific formula), incubate at room temperature in the dark for 5-10 minutes, wash the NC membrane with water, and observe and record the results.
[0176] We observed that co-expression of OsELF3-1-E3TCD1 and OsELF3-1-mYFP reduced the aggregation of OsELF3-1-mYFP, indicating that OsELF3-1-E3TCD1 can degrade OsELF3-1. (Fig. 4a, b)
[0177] III. Flowering Delay in 35S::OsELF3-1-E3TCD1 Transgenic Rice
[0178] 1. Obtaining genetically modified rice
[0179] Agrobacterium EHA105 containing the 35S::OsELF3-1-E3TCD1 and 35S::E3TCD1 vectors obtained in the above steps were sent to Wuhan Boyuan Biotechnology Co., Ltd. for rice transformation. The rice variety we used was Zhonghua 11 (ZH11). After obtaining the transgenic rice, we first screened for positive transgenic plants. After identifying the positive transgenic plants, we planted them at the Huashan Rice Experimental Base of Wuhan University.
[0180] 2. Phenotypic observation of transgenic rice
[0181] The aforementioned genetically modified rice was grown in a natural environment, with the same management measures as in open fields.
[0182] We observed that, compared with the 35S::E3TCD1 control line, the flowering of the 35S::OsELF3-1-E3TCD1 transgenic rice was significantly delayed (Fig. 4c, d).
[0183] Example 3: Temperature-responsive promoter-regulated targeted degradation of rice ELF3-1 can improve rice seed setting rate.
[0184] I. Building Pro HSP1 ::OsELF3-1-E3TCD1 vector
[0185] 1. Primer design and synthesis
[0186] The HSP1 promoter sequence was downloaded from the Rice Genome Annotation Project website. Specific amplification primers were designed, and the HSP1 promoter fragment was amplified using the genome of Zhonghua 11 (ZH11) as a template. Previous studies have successfully constructed the 35S::OsELF3-1-E3TCD1 plasmid vector (see Example 1). Since our vector construction system uses the LIC ligation method, we replaced the 35S sequence with the LIC sequence tcgacgacaagaccgggcccggctcttctcctca using double digestion with Eco1 and Kpn1. We added LIC sequence adapters CGACGACAAGACCGT and GAGGAGAAGAGCCGT to the 5′ ends of the upstream and downstream primer fragments used for amplification, respectively. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., and the sequences and numbers of each primer are as follows:
[0187] Upstream primer HSP1-F
[0188] 5′--3′:CGA CGA CAA GAC CGT GGTGGCAAAGAAAGAGGTTGGTTTA (SEQ ID NO. 19);
[0189] Downstream primer HSP1-R
[0190] 5′--3′:GA GGA GAA GAG CCGT GCTCGGTGGGAGGAGGGGTTTAAAT (SEQ ID NO. 20);
[0191] 2. PCR amplification
[0192] Using ZH11 genomic DNA as a template, the HSP promoter fragment was amplified by PCR using the primers synthesized in step 1. The amplification reaction system and specific reaction conditions are as follows:
[0193] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: denature at 95°C for 5 min, then at 95°C for 30 sec, 56°C for 30 sec, and 72°C for 2 min for 35 cycles; then at 72°C for 5 min.
[0194] The amplified PCR products were detected by 1% agarose gel electrophoresis, and the target fragment was recovered and purified using a gel recovery kit.
[0195] 3. LIC processing of target fragment and vector
[0196] The recovered target fragment from step 2 is then subjected to LIC treatment. The specific reaction system and steps are as follows:
[0197] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: 12℃ for 30 min, 75℃ for 10 min.
[0198] The Pro::OsELF3-1-E3TCD1 vector constructed in previous studies was subjected to LIC treatment. The specific reaction system and steps are as follows:
[0199] Step 1:
[0200] Mix well and incubate at 37°C for 1 hour.
[0201] Step 2:
[0202] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: 12℃ for 40 min, 75℃ for 10 min.
[0203] 4. Pro HSP Construction of the ::OsELF3-1-E3TCD1 vector
[0204] Take 1.5 μL of each of the LIC-treated vector and the target fragment described in step 3, mix them well, and place them on a PCR thermal cycler for reaction: 75 °C for 5 min, 22 °C for 5 min.
[0205] Transfer 3 μL of the ligation product to 30 μL of highly competent E. coli DH5α, tap gently with your finger 3-5 times, and then incubate on ice for 20-30 min. After incubation, heat shock at 42°C for 1 min, and immediately transfer to ice for 2 min. Add 200 μL of antibiotic-free LB and incubate at 37°C and 220 rpm for 45-60 min. Precipitate E. coli at 6000 rpm for 2 min, and spread evenly on Kana-resistant culture dishes. Incubate overnight at 37°C.
[0206] The following day, eight colonies were streaked onto a new plate, and colony PCR was performed in the afternoon. One positive colony was selected for sequencing. After confirming the sequencing results were correct, the plasmid was returned from the company for Agrobacterium transformation.
[0207] Will contain Pro HSP The plasmid ::OsELF3-1-E3TCD1 was transferred into Agrobacterium tumefaciens EHA105 (to obtain transgenic rice plants).
[0208] The specific Agrobacterium transformation steps are as follows: Transfer 3 μL of the above plasmid to 30 μL of highly competent Agrobacterium GV3101 or EHA105, tap it lightly with your finger 3-5 times, and then let it stand on ice for 10 min. First, freeze it in liquid nitrogen for 1 min, then heat shock it at 42°C for 1 min, and then immediately transfer it to an ice bath for 2 min. Add 200 μL of antibiotic-free LB and revive it in a shaker at 220 rpm and 28°C for 45-60 min. Precipitate Agrobacterium at 6000 rpm for 2 min, and spread it evenly on a culture dish with Kana resistance, and incubate it in a 28°C incubator for two days. Pick Agrobacterium colonies, shake them, and mix them with 50% glycerol at a 1:1 ratio and store them in a freezer at -80°C.
[0209] II. Pro HSP ::OsELF3-1-E3TCD1 transgenic rice with delayed flowering
[0210] 1. Obtaining genetically modified rice
[0211] The Pro obtained from the above steps HSP Agrobacterium tumefaciens EHA105 with the ::OsELF3-1-E3TCD1 vector was sent to Wuhan Boyuan Biotechnology Co., Ltd. for rice transformation. The rice variety we used was Zhonghua 11 (ZH11). After obtaining the transgenic rice, we first screened for positive transgenic plants. After identifying the positive transgenic plants, we planted them at the Huashan Rice Experimental Base of Wuhan University.
[0212] 2. Phenotypic observation of transgenic rice
[0213] The aforementioned genetically modified rice was grown in a natural environment, with the same management measures as in open fields.
[0214] We observed that, compared to the ZH11 control line, Pro HSP The flowering of the ::OsELF3-1-E3TCD1 transgenic rice was significantly delayed, and the seed setting rate was significantly increased (Fig. 5c, e, f).
[0215] Example 4: The TCD method can target and degrade OCT4 protein in HeLa cells.
[0216] I. Construction of OCT4-EGFP and OCT4-E3TCD1 vectors
[0217] 1. Primer design and synthesis
[0218] The OCT4 genome sequence was downloaded from the NCBI website. Specific amplification primers were designed, and the OCT4 gene fragment was amplified using total cDNA from HeLa cells as a template. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., and their sequences and numbers are as follows:
[0219] Upstream primer OLM1132:
[0220] 5′--3′:CGA CGA CAA GAC CGT ACC ATGGCGGGACACCTGGCTTC (SEQ ID NO.58);
[0221] Downstream primer OLM1133:
[0222] 5′--3′:gaggagaagagccgtagaccctccgcc GTTTGAATGCATGGGAGAGCC (SEQ ID NO. 59);
[0223] 2. PCR amplification
[0224] Using total cDNA from HeLa cells as a template, the OCT4 fragment was amplified by PCR using primers synthesized in step 1. The amplification reaction system and specific reaction conditions are as follows:
[0225] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: denature at 95°C for 5 min, then at 95°C for 30 sec, 56°C for 30 sec, and 72°C for 2 min for 35 cycles; then at 72°C for 5 min.
[0226] The amplified PCR products were detected by 1% agarose gel electrophoresis, and the target fragment was recovered and purified using a gel recovery kit.
[0227] 3. LIC processing of target fragment and vector
[0228] The recovered target fragment from step 2 is then subjected to LIC treatment. The specific reaction system and steps are as follows:
[0229] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: 12℃ for 30 min, 75℃ for 10 min.
[0230] The CMV promoter::EGF and PGK promoter::E3TCD1 vectors were subjected to LIC treatment. The specific reaction system and steps are as follows:
[0231] Step 1:
[0232] Mix well and incubate at 37°C for 1 hour.
[0233] Step 2:
[0234] Then add
[0235] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: 12℃ for 40 min, 75℃ for 10 min.
[0236] Transfer 3 μL of the ligation product to 30 μL of highly competent E. coli DH5α, tap gently with your finger 3-5 times, and then incubate on ice for 20-30 min. After incubation, heat shock at 42°C for 1 min, and immediately transfer to ice for 2 min. Add 200 μL of antibiotic-free LB and incubate at 37°C and 220 rpm for 45-60 min. Precipitate E. coli at 6000 rpm for 2 min, and spread evenly on Kana-resistant culture dishes. Incubate overnight at 37°C.
[0237] The following day, eight colonies were streaked onto a new plate, and colony PCR was performed in the afternoon. One positive colony was selected for sequencing, and after confirming the sequencing results were correct, the plasmid was extracted.
[0238] II. Expression of OCT4-E3TCD1 in HeLa cells can effectively degrade OCT4-EGFP.
[0239] Transfected with OCT4-EGFP and OCT4-E3TCD1 plasmids
[0240] One microgram of OCT4-EGFP plasmid and one microgram of OCT4-E3TCD1 plasmid were mixed and added to prepared HeLa cells, followed by invasion staining. The cells were then cultured for 48 hours. HeLa cells transformed with one microgram of OCT4-EGFP plasmid alone served as the control group. The fluorescence intensity of OCT4-EGFP protein was observed using laser confocal microscopy. It was found that the protein content of OCT4-EGFP decreased after co-expression of OCT4-E3TCD1 and OCT4-EGFP, indicating that OCT4-E3TCD1 can degrade OCT4 (see Figure 6).
[0241] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.
[0242] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.
[0243] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. A fusion protein, characterized in that, The fusion protein is composed of the protein of target protein gene X fused with the E3TCD protein, and the structure of the fusion protein is shown in Formula I: X is the target protein gene, i.e., the protein gene that needs to be degraded; the E3TCD protein is an E3 ligase with inherent disordered protein characteristics, which can achieve self-degradation through phase separation and aggregation; the gene encoding the E3TCD protein includes one of the following: The E3TCD protein of Arabidopsis thaliana, abbreviated as AtE3TCD1, has the nucleotide sequence shown in SEQ ID NO.25; The E3TCD protein of rice, abbreviated as OsE3TCD1, has the nucleotide sequence shown in SEQ ID NO.26; The E3TCD protein of maize, abbreviated as ZmE3TCD1, has the nucleotide sequence shown in SEQ ID NO.27; The wheat E3TCD protein, abbreviated as TaE3TCD1, has the nucleotide sequence shown in SEQ ID NO.28; The E3TCD protein of soybean, abbreviated as GmE3TCD1, has the nucleotide sequence shown in SEQ ID NO.29; The E3TCD2 protein of Arabidopsis thaliana, abbreviated as AtE3TCD2, has the nucleotide sequence shown in SEQ ID NO.30; The E3TCD3 protein of Arabidopsis thaliana, abbreviated as AtE3TCD3, has the nucleotide sequence shown in SEQ ID NO.31; The E3TCD4 protein of Arabidopsis thaliana, abbreviated as AtE3TCD4, has the nucleotide sequence shown in SEQ ID NO.32; The E3TCD5 protein of Arabidopsis thaliana, abbreviated as AtE3TCD5, has the nucleotide sequence shown in SEQ ID NO.
33.
2. The fusion protein according to claim 1, characterized in that, The gene encoding the E3TCD protein was obtained by PCR amplification using the following primer pair: 1) Primer pair AtP1, nucleotide sequences as shown in SEQ ID NO.1-SEQ ID NO.2; a 2001 bp amplified fragment was amplified from Arabidopsis cDNA; 2) Primer pair OsP1, nucleotide sequence as shown in SEQ ID NO.3-SEQ ID NO.4; a 2004bp amplified fragment can be amplified from rice cDNA; 3) Primer pair ZmP1, nucleotide sequence as shown in SEQ ID NO.5-SEQ ID NO.6; a 1992bp amplified fragment can be amplified from maize cDNA; 4) Primer pair TaP1, nucleotide sequence as shown in SEQ ID NO.7-SEQ ID NO.8; a 2007bp amplified fragment can be amplified from wheat cDNA; 5) Primer pair GmP1, nucleotide sequence as shown in SEQ ID NO.9-SEQ ID NO.10; a 2148bp amplified fragment can be amplified from soybean cDNA; 6) Primer pair AtP2, nucleotide sequence as shown in SEQ ID NO.11-SEQ ID NO.12; a 1485bp amplified fragment was amplified from Arabidopsis cDNA; 7) Primer pair AtP3, nucleotide sequence as shown in SEQ ID NO.13-SEQ ID NO.14; a 1461bp amplified fragment was amplified from Arabidopsis cDNA; 8) Primer pair AtP4, nucleotide sequence as shown in SEQ ID NO.15-SEQ ID NO.16; a 1038 bp amplified fragment was amplified from Arabidopsis cDNA; 9) Primer pair AtP5, nucleotide sequence as shown in SEQ ID NO.17-SEQ ID NO.18; 996bp amplified fragment was amplified from Arabidopsis cDNA.
3. The fusion protein according to claim 1, characterized in that, The target protein gene X is directly linked to the E3TCD protein or linked through a linker.
4. A nucleic acid molecule encoding the fusion protein of any one of claims 1-3.
5. A recombinant vector containing the nucleic acid molecule of claim 4.
6. A transformant comprising the recombinant vector of claim 5.
7. A method for targeted degradation of plant endogenous protein aggregates, characterized in that, The method includes: transferring the nucleic acid molecule of claim 4 or the recombinant vector of claim 5 into a plant through transient expression or transgenic methods, thereby expressing the fusion protein of any one of claims 1-3, and achieving targeted degradation of plant endogenous protein aggregates.
8. The use of the fusion protein of any one of claims 1-3, the nucleic acid molecule of claim 4, or the recombinant vector of claim 5 in improving plant traits.
9. The use of the fusion protein of any one of claims 1-3, the nucleic acid molecule of claim 4, or the recombinant vector of claim 5 in the preparation of protein-targeted degradation-based products.
10. The use of the fusion protein of any one of claims 1-3, the nucleic acid molecule of claim 4, or the recombinant vector of claim 5 in drug screening.