Preparation method for scarless circular nucleic acid molecule and application thereof in targeted delivery

Abstract

Provided are a preparation method for a scarless circular nucleic acid molecule and an application thereof in targeted delivery. The precursor nucleic acid molecule used for preparing the circular nucleic acid molecule comprises, in the direction from 5' to 3': a. a 3' group I intron or a mutant fragment thereof, b. a first unit fragment II, comprising a recognition fragment of ribozyme II at the 5' end thereof, c. a functional unit (comprising IRES, an aptamer, a protein binding sequence, a protein coding region, a non-coding region, etc. or a combination thereof), d. a first unit fragment I, comprising a recognition fragment of ribozyme I at the 3' end thereof, and e. 5' group I intron or a mutant fragment thereof. The use of the aptamer sequence achieves scarless cyclization of RNA, and improves the targeting property of the circular nucleic acid molecule sequence.

Description

A method for preparing scarless circular nucleic acid molecules and its application in targeted delivery.

[0001] Cross-reference to related applications

[0002] This invention claims priority to the earlier application filed on November 7, 2024, with patent application number 202411584735.3 and entitled "A method for preparing a scarless circular nucleic acid molecule and its application in targeted delivery". The entire contents of that earlier application are incorporated herein by reference. Technical Field

[0003] This invention relates to the field of gene recombination technology, and in particular to a method for preparing scarless circular nucleic acid molecules based on nucleic acid aptamers and its application in preparing circular nucleic acid molecules with targeted delivery function. Background Technology

[0004] mRNA drugs, as a highly promising drug delivery method, can express proteins intracellularly for extended periods, making them ideal for vaccines and protein supplementation therapies. However, their use as drugs presents several significant challenges, including poor stability, poor cellular uptake, and difficulty in lysosomal escape. Currently, clinically approved mRNA drugs primarily deliver mRNA via lipid nanoparticles (LNPs), enabling systemic expression. The expression of mRNA in specific tissues and organs is crucial for the development of mRNA drugs. Several methods have been proposed to achieve specific mRNA expression, including tissue-specific cationic lipids and LNP surface-modified targeting molecules. While these methods can achieve widespread mRNA expression in specific tissues and organs, some unnecessary tissue distribution still exists. Therefore, developing safer targeted mRNA delivery methods is essential. mRNA itself possesses immunogenicity, and systemic expression of mRNA drugs can lead to unnecessary toxic side effects. Although lipid nanoparticles (LNPs) have achieved significant success as drug delivery carriers, especially in mRNA vaccines, they also present several adverse reactions after injection.

[0005] (1) LNP carriers are the main cause of adverse reactions such as pain and inflammation after drug injection.

[0006] (2) Temperature sensitivity: When the temperature rises, the mRNA tends to dissociate from the LNP, so this preparation must be stored at low temperature, which also limits the use of this dosage form worldwide.

[0007] (3) Immunogenicity: LNP-mRNA preparations may cause immunopathogenicity and hepatotoxicity, which may affect the safety and efficacy of treatment.

[0008] Circular RNA (RNA) is a circular nucleic acid molecule that can also be used to express proteins intracellularly. Its closed-loop structure makes RNA molecules more stable, making it a potential alternative to mRNA. Although it improves the stability of RNA molecules, in vivo delivery still faces challenges such as difficulty crossing cell membranes and targeting issues. Summary of the Invention

[0009] To address the shortcomings of existing technologies, this invention provides a method for preparing scarless circular nucleic acid molecules and their application in targeted delivery. It solves the problems of mRNA transmembrane difficulties and poor targeting in existing technologies.

[0010] In a first aspect, the present invention provides a precursor nucleic acid molecule for preparing a circular nucleic acid molecule, the precursor nucleic acid molecule comprising, along the 5' to 3' direction:

[0011] a.3'I group introns or their mutant fragments

[0012] b. Unit I fragment II, whose 5' end includes the II ribozyme recognition fragment.

[0013] c. Functional units (including IRES, nucleic acid aptamers, protein-binding sequences, protein-coding regions, non-coding regions, etc., or combinations thereof),

[0014] d. The first unit fragment I, whose 3' end includes the I ribozyme recognition fragment,

[0015] e.5'I group introns or their mutant fragments;

[0016] The first unit segment II is located at the 3' end of the first unit segment I, meaning the complete first unit sequence includes:

[0017] Unit 1 Fragment I - Unit 1 Fragment II;

[0018] The first unit is a nucleic acid aptamer, and the first unit fragment I and the first unit fragment II are nucleic acid aptamer fragment I and nucleic acid aptamer fragment II, respectively.

[0019] The 3'I group intron or its mutant fragment is located at the 3' end of the 5'I group intron or its mutant fragment, meaning the complete I group intron or its mutant sequence includes:

[0020] 5'I group introns or their mutant fragments - 3'I group introns or their mutant fragments;

[0021] The introns in group I or their mutants recognize and covalently link the first ribozyme recognition fragment and the second ribozyme recognition fragment to obtain the circular nucleic acid molecule, that is, the complete first unit sequence in the circular molecule contains the first ribozyme recognition fragment - the second ribozyme recognition fragment, hereinafter referred to as the "circular fragment";

[0022] The first unit preferably has a local stem structure, a local double-strand structure, or a local hairpin structure. The local stem structure, local double-strand structure, or local hairpin structure is adjacent to or contains the circumscribed fragment, which facilitates the interconnection of the first ribozyme recognition fragment and the second ribozyme recognition fragment during circumduction and improves the circumduction efficiency of the circular nucleic acid molecule.

[0023] The "-" symbol represents a phosphate diester bond.

[0024] In one embodiment of the present invention, the circular fragment is located in the loop of the stem-loop structure of the first unit or nucleic acid aptamer sequence, and a double-stranded structure formed by complementary pairing sequences exists within 100 bases upstream and downstream of the circular fragment; preferably, the double-stranded structure contains at least 5 consecutive complementary pairing bases; and even more preferably, the number of complementary pairing bases and non-complementary pairing bases in the stem of the stem-loop structure exceeds 20 bp.

[0025] In one embodiment of the present invention, the first ribozyme recognition fragment and the second ribozyme recognition fragment are respectively the exon fragment 1 (E1) and exon fragment 2 (E2) adjacent to the intron in group I;

[0026] The E1 is the 5' end of the exon of the group I intron, with a length of ≥3 nucleotides;

[0027] The E2 is the 3' end of the exon of the group I intron, and its length is ≥0 nucleotides.

[0028] The lengths of E1 and / or E2 are 0-51 nucleotides, preferably 0-10 nucleotides, such as 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides.

[0029] During the circularization of the circular RNA precursor, the 3' self-splicing intron fragment (e.g., the 3' I group intron fragment) and its upstream sequence (if present) at the 5' end, and the 5' self-splicing intron fragment (e.g., the 5' I class intron fragment) and its downstream sequence (if present) at the 3' end are both excised, and the 3' end of E1 and the 5' end of E2 are covalently linked to achieve RNA circularization.

[0030] In some embodiments, the self-splicing intron is a group I intron, and the 5' adjacent exon region contains or consists of one or more nucleotides that can pair with the internal guide sequence (IGS) of the corresponding group I intron (or a structure consisting of a 3' self-splicing intron fragment and a 5' self-splicing intron fragment) to form a P1 double-stranded region during cyclization.

[0031] In some embodiments, the 3' adjacent exon region is derived from the 3' natural exon of the group I intron (Ana ribozyme) of the Anabaena pre-tRNA-Leu gene. In some embodiments, the 5' adjacent exon region is derived from the 5' natural exon of the group I intron of the Anabaena pre-tRNA-Leu gene.

[0032] In some embodiments, the 3' adjacent exon region is derived from the 3' natural exon of the group I intron (T4td ribozyme) of the T4 phage td gene. In some embodiments, the 5' adjacent exon region is derived from the 5' natural exon of the group I intron of the T4 phage td gene.

[0033] In another embodiment of the present invention, the first ribozyme recognition fragment and the second ribozyme recognition fragment further include sequences that differ from the base sequences of the 3' or 5' natural exon regions but still retain cyclic activity.

[0034] In some embodiments, the group I intron is an Ana ribozyme group I intron. In some embodiments, the first ribozyme recognition fragment comprises or consists of about 1 to about 7 consecutive nucleotides from the natural 5' exon of the group I intron, starting from the 5' end nucleotide of the group I intron. In some embodiments, the first ribozyme recognition fragment comprises, for example, CTC, CTT, ACTT, CGAT, AAGT, CGTT, CCGT, ATGT, AATT, ACGT, AGTT, or consists of, or consists of, the same nucleotides. In some embodiments, the second ribozyme recognition fragment comprises or consists of 0 to about 4 consecutive nucleotides from the natural 3' exon of the group I intron, starting from the 3' end nucleotide of the group I intron. In some embodiments, the second ribozyme recognition fragment comprises, for example, AAAA, AAAC, AA, TTTT, CAAA, GAAA, AAA, AAC, AGA, AAT, CCA, TAC, or consists of, the same nucleotides. In some specific implementations, circularization can form a circular fragment having the sequences 5'-CTTAAAA-3', 5'-CTTTTTT-3', 5'-CTTAA-3', 5'-CTTGAAA-3', 5'-CTTTAAA-3', 5'-CTTCAAA-3', or 5'-CTCAAAA-3', 5'-ACTTAAAA-3', 5'-CGATAAAC-3', 5'-AAGTAAC-3', 5'-CGTTAGA-3', 5'-CCGTAAC-3', 5'-ATGTAAC-3', 5'-AATTAAT-3', 5'-ACGTCCA-3', or 5'-AGTTTAC-3'.

[0035] In some embodiments, the group I intron is a group I intron of the T4td ribozyme. In some embodiments, the first ribozyme recognition fragment comprises or consists of about 1 to about 7 consecutive nucleotides from the natural 5' exon of the group I intron, starting from the 5' end nucleotide of the group I intron. In some embodiments, the first ribozyme recognition fragment comprises, for example, TTGGGT, CCAAGT, ATTAAT, AACGGT, CCCAGT, GTGACT, or CACGAT. In some embodiments, the second ribozyme recognition fragment comprises or consists of 0 to about 4 consecutive nucleotides from the natural 3' exon of the group I intron, starting from the 3' end nucleotide of the group I intron. In some embodiments, the second ribozyme recognition fragment comprises, for example, CT, AA, GA, TA, TG, GC, or TC. In some specific implementations, circularized fragments with the sequences 5'-TTGGGTCT-3', 5'-CCAAGTAA-3', 5'-ATTAATGA-3', 5'-AACGGTTA-3', 5'-CCCAGTTG-3', 5'-GTGACTGC-3', and 5'-CACGATTC-3' can be formed after circularization.

[0036] In some alternative embodiments, the group I intron is TpaCOX2 intron, which is the intron sequence of the T. papilionaceus cytochrome xoidase subunit (cox2) gene. The nucleotide sequence of its 5' adjacent exon region is 5'-ACGTCTT-3', and the nucleotide sequence of its 3' adjacent exon region is 5'-AACCAA-3'. After circumduction, a circumscribed fragment of the sequence 5'-ACGTCTTAACCAA-3' is formed, wherein the circumscribed position is located between T and A.

[0037] In some alternative embodiments, the group I intron is a Ptu intron, where Ptu is the precursor RNA of the large chloroplast ribosomal subunit RNA (rrnL) in *pedinomonas tuberculata*. Its nucleotide sequence in the 5' region immediately adjacent to the exon is 5'-AGGGAT-3', and its nucleotide sequence in the 3' region immediately adjacent to the exon is 5'-CA-3'. Upon circularization, a circulated fragment of 5'-AGGGATCA-3' is formed, with the circularization position located between T and C.

[0038] In some optional embodiments, the group I introns are group I introns of the Azoarcus sp. BH72 pre-tRNA-Ile gene, with the nucleotide sequence of the 5' exon region being 5'-CAT-3', and the nucleotide sequence of the 3' exon region being derived from 5'-AATCCGCCGGTG-3', for example, containing one, two, three or more of these introns. The circularized fragment contains 5'-CAT-3'.

[0039] In a preferred embodiment of the present invention, the introns of group I are mutants, which contain mutations in the guide regions of P1 / P10. The mutated guide regions recognize the "circular fragments" in the first unit, thereby forming "clean" circularization.

[0040] In a specific embodiment of the present invention, the group I introns are mutants of the Ana ribozyme, wherein the first ribozyme recognition fragment is 5'-N1N2N3T-3' or 5'-N2N3T-3', and the second ribozyme recognition fragment is 5'-N4N5N6-3' or 5'-N4N5-3'. The Ana ribozyme mutant contains the following mutant region N in the 5' intron fragment. 6’ N 7’ ATAAN 5’ N 4’ GN 3’ N 2’ (The original sequence is: 5'-AAATAATTGAG-3', with the underlined mutation site), where N is A, U, C, G, or T. 3’ N 2’ Pairing with N2N3 in reverse complementary direction, N 5’ N 4’ Pairing with N4N5 in reverse complementary direction, N 6’ N 7’ With N 5’ N 4’ Reverse complementary pairing, the base complementary pairing includes AU, GC, GU, AT, and GT base pairs. The corresponding cyclic fragments in the first unit are N1N2N3TN4N5N6 or N2N3TN4N5N6 or N2N3TN4N5, and the cyclic sites are N1N2N3T / N4N5N6 or N2N3T / N4N5N6 or N2N3T / N4N5 (slashes represent splice sites).

[0041] In a specific embodiment of the present invention, group I introns are mutants of the T4td ribozyme, wherein the first ribozyme recognition fragment is 5'-N1N2N3N4N5T-3' or 5'-N2N3N4N5T-3' or 5'-N3N4N5T-3', and the second ribozyme recognition fragment is 5'-N6N7-3' or N6 or absent. The T4td ribozyme mutant contains the following mutation region N in the 5' intron fragment. 8’ AATTGN 7’ N 6’ GN 5’ N 4’ N 3’ N 2’ N 1’ (The original sequence is: 5'-TAATTGAGGCCTGA-3', with the underlined mutation site), where N is A, U, C, G, or T. 5’ N 4’ N 3’ N 2’ N 1’ Pairing with N1N2N3N4N5 in reverse complementary order, or N 5’ N 4’ N 3’ N 2’ Pairing with N2N3N4N5 in reverse complementary order, or N 5’ N 4’ N 3’ Pairing with N3N4N5 in reverse complementary direction; N 7’ N 6’ Pairing with N6N7 in reverse complementary direction, or N 6’ Complementary pairing with N6, or preferably, when the second ribozyme recognition fragment N6N7 is absent, the 3' end base T of the first ribozyme recognition fragment is adjacent to the stem structure of the first unit, then the P10 guide sequence N 7’ N 6’ It can be without mutation; N 8， With N 6’ Complementary pairing, wherein the complementary base pairing includes AU, GC, GU, AT, and GT base pairs. The corresponding cyclic fragment in the first unit is N1N2N3N4N5TN6N7 or N2N3N4N5TN6 or N3N4N5T, and the cyclic site is N1N2N3N4N5T / N6N7 or N2N3N4N5T / N6 or N3N4N5T / . In a further specific embodiment, N6 is U or C, N... 6’ No mutations occur.

[0042] In one embodiment of the present invention, the guide sequence in the second ribozyme recognition fragment, the first ribozyme recognition fragment, and the corresponding group I introns or their mutants includes the following:

[0043] In one embodiment of the present invention, the "circular fragment" is selected from 5'-ACTTAAAA-3', 5'-CGATAAAC-3', 5'-TTGGGTCT-3', 5'-AACGGTTA-3', 5'-CCCAGTTG-3', 5'-GTGACTGC-3', or 5'-CACGATTC-3'.

[0044] In one specific embodiment of the present invention, the nucleic acid aptamer fragment I and nucleic acid aptamer fragment II are obtained by splitting the nucleic acid aptamer sequence.

[0045] Preferably, the nucleic acid aptamer is the transferrin receptor aptamer Waz, with the following nucleotide sequence: GCGTTACGCGGGTTCTACGATAAACGGTTAATGACCAGCTTATGGCTGGCAGTTCCCGCGAAACGC. Wherein, the sequence of aptamer fragment II is (AAACGGTTAATGACCAGCTTATGGCTGGCAGTTCCCGCGAAACGC), and the sequence of aptamer fragment I is (GCGTTACGCGGGTTCTACGAT). Alternatively, the sequence of aptamer fragment II is (TAATGACCAGCTTATGGCTGGCAGTTCCCGCGAAACGC), and the sequence of aptamer fragment I is (GCGTTACGCGGGTTCTACGATAAACGGT).

[0046] Preferably, the nucleic acid aptamer is the RNA aptamer eIF4G-Apt of the eIF4G protein, and its nucleotide sequence is as follows: ACTCACTATTTGTTTTCGCGCCCAGT / TGCAAAAAGTGTCG. Specifically, the sequence of aptamer fragment I is ACTCACTATTTGTTTTCGCGCCCAGT, and the sequence of aptamer fragment II is TGCAAAAAGTGTCG.

[0047] Preferably, the nucleic acid aptamer is serum albumin RNA aptamer Alb, with the following nucleotide sequence: GCGTTACGCGGGTGCGCCGCAACAGGTGTGACT / GCCCTAGCCTCCGCTGTACCACCCGCGAAACGC. Specifically, the sequence of aptamer fragment I is GCGTTACGCGGGTGCGCCGCAACAGGTGTGACT, and the sequence of aptamer fragment II is GCCCTAGCCTCCGCTGTACCACCCGCGAAACGC.

[0048] Preferably, the nucleic acid aptamer is the mDEC205 protein RNA aptamer min2, whose nucleotide sequence is as follows: GCGTTACGCGGGAGGTGTGTTAGCACACGAT / TCATAATCAGCTACCCTCCCGCGAAACGC. Specifically, the sequence of aptamer fragment I is GCGTTACGCGGGAGGTGTGTTAGCACACGAT, and the sequence of aptamer fragment II is TCATAATCAGCTACCCTCCCGCGAAACGC.

[0049] In one specific embodiment of the present invention, the functional unit includes an IRES sequence, an RNA coding sequence, and an RNA non-coding sequence.

[0050] In one embodiment of the present invention, the functional unit further includes one or more additional aptamer sequences.

[0051] In one specific embodiment of the present invention, the RNA coding sequence includes fluorescent molecules, therapeutic peptides, cytokines, antibodies or antigen-binding fragments, antibodies or antigen-binding fragments against tumor-specific antigens, antibodies or antigen-binding fragments against pathogen antigens, sequences of CAR-T molecules, and coding sequences of proteins with gene-editing activity.

[0052] In one specific embodiment of the present invention, the RNA coding sequence encodes an antigen peptide or an epitope peptide.

[0053] In one specific embodiment of the present invention, the RNA non-coding sequence includes miRNA sponges, nucleic acid aptamers, antisense oligonucleotides (ASO), or small interfering ribonucleic acid (siRNA).

[0054] In one specific embodiment of the present invention, the nucleic acid aptamer sequence (including the nucleic acid aptamer as the first unit and one or more other aptamer sequences included in the functional unit) includes the nucleic acid aptamer sequence of the target protein or the nucleic acid aptamer sequence of the target cell.

[0055] In one specific embodiment of the present invention, the nucleic acid aptamer sequence for the target cell includes, but is not limited to, nucleic acid aptamers targeting nerve cells, muscle cells, immune cells, tumor cells, vascular endothelial cells, stem cells, etc. Preferably, it is a nucleic acid aptamer targeting dendritic cells (DCs).

[0056] In one specific embodiment of the present invention, the nucleic acid aptamer sequence of the target protein includes, but is not limited to, a nucleic acid aptamer targeting transferrin receptor, a nucleic acid aptamer targeting nucleolin, and a nucleic acid aptamer targeting DEC205.

[0057] In one embodiment of the present invention, the nucleic acid aptamer sequence is used to improve the targeting of the RNA sequence or the protein it encodes.

[0058] In one embodiment of the present invention, the nucleic acid aptamer sequence is used to improve the expression efficiency of the RNA sequence or its encoded protein.

[0059] In one specific embodiment of the present invention, the number of nucleic acid aptamer sequences is one or more. Preferably, the number of nucleic acid aptamers is 1-12, including 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12. More preferably, the number of nucleic acid aptamers is 9.

[0060] In one specific embodiment of the present invention, the nucleic acid aptamer sequences may be the same or different.

[0061] In one specific embodiment of the present invention, the arrangement structure of the nucleic acid aptamers includes a linear arrangement structure, a branched arrangement structure, or a combination thereof. Preferably, it is a combination of branched arrangements.

[0062] In one specific embodiment of the present invention, the number of functional units is one or more. In another specific embodiment of the present invention, the RNA sequences may be the same or different.

[0063] It is understood that in the circular nucleic acid molecule of the present invention, the number of nucleic acid aptamer sequences and functional units can be one or more. For example, one nucleic acid aptamer and one functional unit can be circularized to form a circular nucleic acid molecule, or one nucleic acid aptamer and two functional units can be circularized to form a circular nucleic acid molecule, or two or more nucleic acid aptamers and one functional unit can be circularized to form a circular nucleic acid molecule, all of which are within the protection scope of the present invention.

[0064] In one specific embodiment of the present invention, the nucleic acid aptamer sequence and the RNA sequence are arranged alternately; in another specific embodiment, multiple nucleic acid aptamer sequences are linked together and then connected end-to-end with a functional unit.

[0065] In one specific embodiment of the present invention, the length of the functional unit is 6nt-10000nt. In another embodiment of the present invention, the length of the RNA sequence is 6nt, 75nt, 100nt, 500nt, 1000nt, 2000nt, 3000nt, 4000nt, 5000nt, 6000nt, 7000nt, 8000nt, 9000nt, or 10000nt.

[0066] A second aspect of the present invention provides a targeted delivery circular nucleic acid molecule, wherein the circular nucleic acid molecule comprises at least one nucleic acid aptamer sequence and a functional unit, wherein the functional unit includes an IRES, a protein-binding sequence, a protein-coding region, a non-coding region, or a combination thereof; the nucleic acid aptamer sequence is a nucleic acid aptamer sequence targeting a protein or a nucleic acid aptamer sequence targeting a cell;

[0067] Preferably, the nucleic acid aptamer targets tumor-specific antigen (TSA), tumor-associated antigen (TAA), immune cell surface antigen or receptor, tumor immune-related molecules, or autoimmune regulation-related molecules.

[0068] Preferably, the nucleic acid aptamer targets antigen-presenting cells (APCs) such as dendritic cells (DCs) or macrophages with surface receptors such as nucleolin, transferrin, DEC205, mannose receptor, CD207, DC-SIGN, Clec9a, and DCIR2.

[0069] Preferably, the functional unit includes IRES, antigen peptide coding region and Kozak sequence, polyA, polyAC and other regulatory elements;

[0070] Preferably, the antigenic peptide is a tumor antigenic peptide; more preferably, it is a combination of multiple tumor antigenic peptides.

[0071] In one embodiment of the present invention, the targeted delivery circular nucleic acid molecule is obtained from the precursor nucleic acid molecule described in the first aspect.

[0072] In one embodiment of the present invention, the targeted delivery circular nucleic acid molecule contains multiple nucleic acid aptamer sequences, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0073] In a third aspect, the present invention provides a carrier containing the aforementioned precursor nucleic acid molecule.

[0074] In a fourth aspect, the present invention provides a biomaterial or composition comprising the above-described targeted delivery circular nucleic acid molecule, precursor nucleic acid molecule, or carrier. Preferably, the biomaterial comprises a host cell; the composition comprises a pharmaceutical composition.

[0075] In one specific embodiment of the present invention, the pharmaceutical composition further includes a carrier, the carrier comprising nanoliposome particles.

[0076] In a fifth aspect, the present invention provides a method for preparing a targeted delivery circular nucleic acid molecule, comprising preparing a circular nucleic acid molecule by cyclizing a precursor nucleic acid molecule or a linear nucleic acid molecule through an intron self-splicing method.

[0077] In a preferred embodiment of the present invention, a circular nucleic acid molecule is prepared by cyclizing a precursor nucleic acid molecule using an intron self-splicing method, particularly a Group I intron self-splicing method.

[0078] In a specific embodiment of the present invention, the preparation method includes the following steps:

[0079] S1 Preparation of linear plasmid template: The promoter, 3'I intron, nucleic acid aptamer fragment II, IRES, RNA coding sequence, nucleic acid aptamer fragment I, and 5'I intron are cloned into the starting plasmid and digested with enzymes to obtain the linear plasmid template;

[0080] S2 uses linear plasmid templates to prepare precursor nucleic acid molecules through in vitro transcription.

[0081] S3 yields circular nucleic acid molecules through a self-splicing reaction.

[0082] In one specific embodiment of the present invention, the promoter includes one or more exogenous promoters.

[0083] Preferably, the exogenous promoter includes one of the following: CMV promoter, EF1α promoter, PGK promoter, CAG promoter, UBC promoter, SV40 promoter, Human beta actin promoter, TEF1 promoter, GDS promoter, H1 promoter, U6 promoter, T7 promoter, TERT promoter, RSV promoter, and PGK1 promoter;

[0084] More preferably, the exogenous promoter is the T7 promoter.

[0085] In a sixth aspect, the present invention provides the use of a targeted delivery circular nucleic acid molecule, precursor nucleic acid molecule, carrier, biomaterial or composition in the preparation of mRNA drugs for the following purposes: 1) anti-tumor; 2) mRNA vaccine; 3) improving the targeting of mRNA drugs; 4) improving the presentation effect of mRNA drugs; 5) improving the expression efficiency of mRNA drugs.

[0086] Compared with the prior art, the present invention has the following beneficial effects:

[0087] In existing technologies, both coding RNA and RNA aptamers can be prepared into circular RNA using the Tornado or PIE methods, but both introduce redundant sequences into the circular RNA. Circular coding RNA is translated using IRES sequences, and then used to express target proteins. Circular nucleic acid aptamers are circularized intracellularly using the Tornado expression system or in vitro using PIE, and then used for target detection or as nucleic acid drugs. This invention improves upon existing technologies by combining coding RNA and nucleic acid aptamers for co-circularization to form circular nucleic acids, effectively removing redundant sequences to achieve scarless circularization. The inventors have found that compared to circular coding RNA and circular nucleic acid aptamers alone, the circular nucleic acid formed by co-circularization of coding RNA and nucleic acid aptamers improves the targeting of the coding RNA. Attached Figure Description

[0088] Figure 1 is a schematic diagram of circular RNA construction (left figure is a schematic diagram of control circular RNA construction, right figure is a schematic diagram of circular RNA construction of the present invention);

[0089] Figure 2 shows a schematic diagram of the construction of the first group of circular RNAs and the verification diagrams of circularization electrophoresis and sequencing.

[0090] Figure 3 shows a schematic diagram of the construction of the second group of circular RNA (1Waza) and the verification diagrams of circularization electrophoresis and sequencing;

[0091] Figure 4 shows a schematic diagram of the construction of the second group of circular RNA (1WazT) and the verification diagrams of circularization electrophoresis and sequencing;

[0092] Figure 5 shows a schematic diagram of the construction of the second group of circular RNA (1eIF4G AptT) and the verification diagrams of circularization electrophoresis and sequencing;

[0093] Figure 6 shows a schematic diagram of the construction of the second group of circular RNA (1AlbT) and the verification diagrams of circularization electrophoresis and sequencing;

[0094] Figure 7 shows a schematic diagram of the construction of the second group of circular RNA (1min2T) and the verification diagrams of circularization electrophoresis and sequencing;

[0095] Figure 8 shows the predicted structure and electrophoresis results of circular RNAs with different numbers of Waz aptamers constructed using the first group of circular RNA construction methods.

[0096] Figure 9 shows the predicted structure and electrophoresis results of circular RNAs with different numbers of Waz aptamers constructed using the second group of circular RNA construction methods.

[0097] Figure 10 shows the predicted structure and electrophoresis results of the 4Waz-1 and 4Waz-2 circular RNAs.

[0098] Figure 11 is a statistical graph of flow cytometry results of SIINFEKL antigen peptide presentation by circular RNA with different numbers of Waz aptamers;

[0099] Figure 12 shows the predicted structure of 9Waz circular RNA with different lengths, the circularization electrophoresis verification diagram, and the flow cytometry results of SIINFEKL presentation.

[0100] Figure 13 shows the predicted structure of circular RNA with different numbers of nul aptamers, the circularization electrophoresis verification diagram, and the flow cytometry results of SIINFEKL presentation.

[0101] Figure 14 shows the predicted structure of circular RNA with different numbers of min2 aptamers, the circularization electrophoresis verification diagram, and the flow cytometry results of SIINFEKL presentation.

[0102] Figure 15 shows the predicted structure of circular RNA mixed with different aptamers, the circularization electrophoresis verification diagram, and the flow cytometry results of SIINFEKL presentation.

[0103] Figure 16 shows the results of treatment with circular RNA (3Waz, 5Waz, 9Waz) with Waz aptamers in mice.

[0104] Figure 17 shows the results of treatment with circular RNA (Mix2, Mix5, 9Waz) containing Waz aptamers in mice.

[0105] Figure 18 shows the electrophoretic verification of circular RNA with different KRAS antigen peptide coding sequences;

[0106] Figure 19 shows the results of treating a mouse colon cancer model with circular RNA containing different KRAS antigen peptide coding sequences.

[0107] Figure 20 shows the results of treating a mouse pancreatic cancer model with circular RNAs containing different KRAS antigen peptide coding sequences.

[0108] Figure 21 is a schematic diagram of the method for constructing recombinant nucleic acid molecules based on the stem-loop structure of nucleic acid aptamers according to the present invention, including a schematic diagram of the matching of intron mutant guide sequences and ribozyme recognition sequences.

[0109] Figure 22 shows the results of treating different mouse models of solid tumors with circular RNA carrying multivalent neoantigens. Detailed Implementation

[0110] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanatory of the present invention, and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.

[0111] Unless otherwise stated, the raw materials and reagents used in the following examples are commercially available products or can be prepared by known methods.

[0112] In this invention, the cytokines are selected from IL-15, IL-12, GM-CSF, IFN-α2b, etc.

[0113] In this invention, the fluorescent molecules are selected from FLUC, FITC, FAM, PE, APC, PB, Cy3, Cy5, Texas Red, TRITC, GFP, RFP, CFP, and BFP, etc.

[0114] In this invention, the therapeutic polypeptide includes any polypeptide that can be used for therapeutic purposes, including but not limited to antibodies, intracellular antibodies, single-chain variable fragments (scFv), affinities, bispecific or multispecific antibodies or binders, receptors, ligands, enzymes for, for example, enzyme replacement therapy or gene editing, tumor inhibitors, viral or bacterial inhibitors, cellular component proteins, DNA and / or RNA-binding proteins, DNA repair inhibitors, nucleases, proteases, integrases, transcription factors, growth factors, apoptosis inhibitors and inducers, toxins (e.g., Pseudomonas exotoxin), structural proteins, neurotrophic factors such as NT3 / 4, brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) and their subunits such as the 2.5S β subunit, ion channels, membrane transport proteins, protein stabilizing factors, proteins involved in cell signal transduction, translation and transcription-related proteins, nucleotide-binding proteins, protein-binding proteins, lipid-binding proteins, glycosaminoglycans (GAG) and GAG-binding proteins, metabolic proteins, cellular stress-regulating proteins, inflammatory and immune system-regulating proteins, mitochondrial proteins and heat shock proteins, etc. In one embodiment of the present invention, the therapeutic polypeptide is an OVA polypeptide.

[0115] In this invention, the tumor-specific antigens include, but are not limited to, alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), carbohydrate antigen 125 (CA125), carbohydrate antigen 153 (CA153), carbohydrate antigen 19-9 (CA19-9), carbohydrate antigen 724 (CA724), carbohydrate antigen 242 (CA242), carbohydrate antigen 50 (CA50), CYFRA21-1 (Cy211), neuron-specific enolase (NSE), prostate-specific antigen (PSA), human chorionic gonadotropin (HCG), thyroglobulin (TG), ferritin (SF), β2-microglobulin (β2-MG), and squamous cell antigen (SCC).

[0116] In this invention, the pathogen antigens include, but are not limited to, tuberculosis antigen, anthrax antigen, hepatitis A virus (HAV) antigen, hepatitis B virus (HBV) antigen, hepatitis C virus (HCV) antigen, human immunodeficiency virus (HIV) antigen, influenza virus antigen, herpes simplex virus (HSV) antigen, Haemophilus influenzae type b (Hib) antigen, Neisseria meningitidis antigen, Corynebacterium diphtheria antigen, Bordetella pertussis antigen, Clostridium tetani antigen, and Varicella virus antigen. In one embodiment of this invention, the pathogen antigen is SARS-CoV-2 antigen, influenza virus antigen, herpes virus antigen, etc.

[0117] In this invention, the IRES includes, but is not limited to, the IRES sequences of the following viruses: Taura syndrome virus, stag beetle virus, Tiller's encephalomyelitis virus, simian virus 40, red imported fire ant virus 1, rice constrictor aphid virus, reticuloendotheliosis virus, human poliovirus 1, P. stollenella enterovirus, Kashmir bee virus, human rhinovirus 2, glass leafhopper virus-1, human immunodeficiency virus type 1, Himetobi virus, etc. P virus, Hepatitis C virus, Hepatitis A virus, GB hepatitis virus, Foot-and-mouth disease virus, Human enterovirus 71, Equine rhinitis virus, Tea geometrid moth microRNA virus-like virus, Encephalomyocarditis virus, Drosophila C virus, Human Coxsackievirus B3, Tobacco mosaic virus, Cricket paralysis virus, Bovine viral diarrhea virus 1, Black bee queen cell virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus, Acute bee paralysis virus, Hibiscus chlorosis and ringspot virus, Classical swine fever virus, Human FGF2, Human SFTPA1, Human AML1 / RUNX1, Drosophila antennae and legs, Human AQP4, Human AT1R, Human BAG-1, Human BCL2, Human BiP, Human c-IAPl, Human c-myc, Human eIF4G, Mouse NDST4L, Human LEF1, Mouse HIF1α, Human n.myc, mouse Gtx, human p27kipl, human PDGF2 / c-sis, human p53, human Pim-1, mouse Rbm3, Drosophila reaper, canine scamper, Drosophila ubx, human UNR, mouse UtrA, human VEGF-A, human XIAP, hairless Drosophila, Saccharomyces cerevisiae TFIID, Saccharomyces cerevisiae YAP1, tobacco etch virus, turnip shrunken virus, EMCV-A, EMCV-B, EMCV-Bf, EMCV-Cf, EMCV pEC9, small disegmented RNA virus, HCV QC64, human cosavirus E / D, human cosavirus F, human cosavirus JMY, rhinovirus NAT001, HRV14, HRV89, HRVC-02, HRV-A21, HRV-B3, Sasavirus A SH1, Sasavirus FHB, Sasavirus NG-J1, human paraenteric orphan virus 1, Crohivirus B, Yc-3, Rosavirus M-7, Shanbavirus A, Pasivirus A, Pasivirus A 2, Echovirus E14, Human Paraenterovirus 5, Aichi Virus, Hepatitis A Virus HA16, Phopivirus, CVA10, Enterovirus C, Enterovirus D, Enterovirus J, Human Hepatic Virus 2, GBV-C GT110, GBV-C K1737, GBV-C Iowa, Hepatic Virus A 1220, Pasivirus A 3, Sapellovirus, Rosavirus B, Bakunsa Virus, Tremor Virus A, Porcine Pasivirus 1, PLV-CHN, Pasivirus A, Sicinivirus, Hepatitis Virus K, Hepatitis Virus A, BVDV1, Border Disease Virus, BVDV2, CSFV-PK15C, SF573 Bicistronic Virus, Hubei MicroRNA Virus-like Virus, CRPV, Salivirus A BN5, Salivirus A BN2, Salivirus A The aptamers are 02394, Salivirus A GUT, Salivirus A CH, Salivirus A SZ1, Salivirus FHB, CVB3, CVB1, Echovirus 7, CVB5, EVA71, CVA3, CVA12, EV24, or eIF4G. In one embodiment of the present invention, the ERES sequence is IRES. MP,75 HRV-B3-Apt-eIF4G.

[0118] In this invention, "Group I Intron" refers to a group of introns that have properties in GTP and Mg. 2+A self-splicing system that performs circularization under certain conditions. Existing technologies report PIE circularization systems based on group I introns, or the so-called "Clean PIE" system: the traditional PIE system's process for forming circular RNA involves the linear RNA precursor molecule comprising the following sequentially linked elements: a 3' intron, exon 2 (E2), an exogenous fragment, exon 1 (E1) (E1), and a 5' intron. When GTP and Mg are present in the environment... 2+ GTP attacks the junction of E1 and the 5' intron, creating a 5' cleavage site (5ss) and releasing the 5' intron. Then, the 3'-OH end of E1 attacks the junction of the 3' intron and E2, creating a 3' cleavage site (3ss) and releasing the 3' intron. Finally, they ligate to form the target circular RNA.

[0119] The intron fragments disclosed herein are derived from class I introns, which possess ribozyme activity capable of self-splicing and are widely distributed across various species. Examples of class I introns include, but are not limited to, the T4 phage td gene (T4td ribozyme), the Anabaena tRNALeu (Ana ribozyme), TpaCOX2, Ptu, and others.

[0120] In some embodiments, intron fragment I and intron fragment II are derived from class I introns and respectively contain partial sequences near the 5' direction and near the 3' direction that constitute the class I intron. The exon sequence (Exon 1, E1) from the 5' end of the class I intron and the exon sequence (Exon 2, E2) from the 3' end of the class I intron are used for ribozyme recognition of splice sites. The circularized RNA molecule contains the E1-E2 fragments. The advantage of this invention is that by setting the E1 and E2 fragments on the coding sequence of the nucleic acid aptamer, the circularization efficiency and targeting of the circularized RNA molecule are improved, while reducing the negative impacts of residual E1 and E2 fragments, such as immunogenicity. In some optional embodiments, the class I intron is the T4 td intron derived from the T4 phage td gene, and the E1-E2 fragment sequence in its circularized RNA molecule is "5'-TTGGGTCT-3'", where the circularization position is located between T and C.

[0121] In this paper, the technical terms “ribozyme recognition fragment I” and “ribozyme recognition fragment II” used further include sequences that differ from E1 or E2 bases but still retain cyclic activity.

[0122] In some embodiments, the “first ribozyme recognition fragment” and “second ribozyme recognition fragment” of the present invention include E1 or E2 sequences optimized or mutated by prior art, such as the first loop sequence or second loop sequence reported in WO2023046153A1.

[0123] In some implementations, the "first ribozyme recognition fragment" and the "second ribozyme recognition fragment" are the original fragments in the nucleic acid aptamer, while the guide sequences in P1 and P10 of the corresponding intron mutants have mutations that maintain base pairing or wobble pairing to maintain splice site recognition, for example:

[0124] In this invention, the 3' group I intron fragment is a continuous sequence that is at least 75% (e.g., at least 80%, at least 85%, at least 90%, at least 95%, 100%) homologous to the 3' proximal fragment of the natural group I intron. Optionally, it includes the exon sequence adjacent to the 3' splice site. For the T4td phage group I intron, its length is at least 0 nucleotides, and for the Anabaena group I intron, its length is at least 3 nucleotides.

[0125] In some embodiments, the 5' group I intron fragment is a continuous sequence that is at least 75% (e.g., at least 80%, at least 85%, at least 90%, at least 95%, 100%) homologous to the 5' proximal fragment of the natural group I intron, optionally including the exon sequence adjacent to the 5' splice site, and is at least 4 nucleotides in length for the T4td phage group I intron and at least 3 nucleotides in length for the Anabaena group I intron.

[0126] In this invention, spacer sequences are optionally included between intron fragments, aptamers, and functional units. A "spacer sequence" refers to any consecutive nucleotide sequence that: 1) predicts to avoid interference with proximal structures; 2) is at least 5 nucleotides in length; 3) is located downstream and near a 3' intron fragment and / or upstream and near a 5' intron fragment; and / or 4) contains one or more of the following: a) an unstructured region at least 5 nt long; b) a region predicted to pair with a distal (i.e., non-adjacent) sequence at least 5 nt long, which includes another spacer sequence; and / or c) a structured region at least 6 nt long, the extent of which is limited to the spacer sequence. The spacer sequence can be a polyA sequence, a polyA-C sequence, a polyC sequence, or a poly-U sequence, or the spacer sequence can be specifically modified according to the target circular RNA sequence. In some embodiments, RNA folding computer software, such as RNAFold, can be used to guide the design of various elements of the vector, including the spacer sequence.

[0127] In this invention, the functional unit may also include a Kozak sequence, a PolyA sequence, or other regulatory elements.

[0128] In this invention, a "vector" refers to a segment of DNA that is synthetic (e.g., using PCR) or extracted from viruses, plasmids, or cells of higher organisms, into which foreign DNA fragments can be inserted or have already been inserted for cloning and / or expression purposes. In some embodiments, the vector can be stably maintained in an organism. The vector may contain, for example, an origin of replication, a selection marker or reporter gene, such as antibiotic resistance or GFP, and / or a multiple cloning site (MCS). The term includes linear DNA fragments (e.g., PCR products, linear plasmid fragments), plasmid vectors, viral vectors, granules, bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), etc. In one embodiment, the vectors provided herein contain a multiple cloning site.

[0129] In this invention, "circular nucleic acid molecule" refers to a nucleic acid molecule that is in a closed circular shape. In some specific embodiments, the circular nucleic acid molecule is a circular RNA molecule. More specifically, the circular nucleic acid molecule is a circular mRNA molecule.

[0130] In this invention, "precursor nucleic acid molecule" refers to a linear nucleic acid molecule that can form a circular nucleic acid molecule through a cyclization reaction, preferably an RNA molecule, which is generally transcribed from a linear DNA molecule (e.g., a vector containing recombinant nucleic acid molecules).

[0131] In this invention, "IRES" (Internal Ribosome Entry Site) is a translation control sequence, typically located at the 5' end of the gene of interest, enabling cap-independent RNA translation. Transcribed IRES directly binds to ribosomal subunits, ensuring the proper orientation of the mRNA start codon within the ribosome for translation. The IRES sequence is usually located in the 5' UTR of the mRNA (directly upstream of the start codon). Functionally, IRES replaces the need for various protein factors that interact with eukaryotic translation mechanisms.

[0132] In this invention, the nucleic acid aptamer can target any target protein or target cell related to a disease or health condition, such as targeting tumor-specific antigen (TSA), tumor-associated antigen (TAA), immune cell surface receptors, tumor immune-related molecules, or autoimmune regulation-related molecules.

[0133] In a specific embodiment of the present invention, the tumor-specific antigen (TSA) or tumor-associated antigen (TAA) includes, but is not limited to: mesothelin (MSLN), GPA33, Her-2, EGFR, CD20, CEA, MUC16, MUC1, AFP, EPCAM, CD19, CD21, CD22, CD30, CD33, CD37, CD45, PSMA, and BCMA.

[0134] In one specific embodiment of the present invention, the nucleic acid aptamer has the activity of binding to one or more tumor immune-related molecules, including: PD-L1, CTLA4, PD-L2, PD-1, CD47, TIGIT, GITR, TIM3, LAG3, CD27, 4-1BB, and B7H4.

[0135] In one specific embodiment of the present invention, the nucleic acid aptamer targets antigen-presenting cells (APCs), such as dendritic cells (DCs) or macrophages, on the surface of receptors such as nucleolin, transferrin, DEC205, mannose receptor, CD207, DC-SIGN, Clec9a, and DCIR2, thereby enhancing antigen presentation.

[0136] Those skilled in the art can use known nucleic acid aptamers with known sequences reported in the prior art, such as the nucleic acid aptamer targeting DEC205 reported in WO2014011465A2; or they can screen for nucleic acid aptamers targeting specific proteins or cells using techniques such as SELEX or cell-SELEX.

[0137] In this invention, the "coding region" refers to the gene sequence that can transcribe messenger RNA and ultimately translate it into the target polypeptide or protein.

[0138] In one specific embodiment of the present invention, the coding region encodes an antigenic peptide. The meaning and scope of an antigenic peptide are known to those skilled in the art. It refers to a peptide fragment that binds to major histocompatibility complex (MHC) class I molecules and, in its bound state, can be recognized by T cells and generate an immune response. In this embodiment, OVA 257-264 is a class I restricted epitope peptide of ovalbumin, with the amino acid sequence SIINFEKL. This peptide sequence can be recognized by cytotoxic CD8+ T lymphocytes and generate a specific immune response. In another specific embodiment of the present invention, the coding region encodes at least one tumor antigenic peptide or a combination of multiple tumor antigenic peptides. A large number of tumor antigenic peptides have been reported in the prior art, such as partial peptides derived from KRAS protein (e.g., see WO2020253643A1), HPV16 (e.g., see WO2020253643A1), mucin MUC1, Lengsin, BJ-TSA-9, C20orf42, BUB1, C10orf3, or HIFPH3.

[0139] In this invention, "expression" includes any step involved in polypeptide production, including but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0140] In this invention, "host cell" refers to a cell into which exogenous polynucleotides have been introduced, including progeny cells of this type. Host cells include "transformers" and "transformed cells," which include primary transformed cells and their derived progeny. Host cells can be any type of cell system that can be used to produce the nucleic acid molecules or encoded proteins of this invention, including eukaryotic cells, such as mammalian cells, insect cells, and yeast cells; and prokaryotic cells, such as *E. coli* cells. Host cells include cultured cells, as well as cells within transgenic animals, transgenic plants, or cultured plant or animal tissues. The term "recombinant host cell" encompasses a host cell that differs from its parent cell after the introduction of recombinant nucleic acid molecules, recombinant expression vectors, or circular RNA, specifically achieved through transformation. The host cells of this disclosure can be prokaryotic or eukaryotic cells, as long as they are capable of introducing the recombinant nucleic acid molecules, recombinant expression vectors, circular RNA, etc., of this disclosure.

[0141] In this invention, "clean circularization," or "scarless circularization," refers to the process where, during RNA circularization, the resulting circular molecule retains no additional nucleotides, sequences, or chemical modifications at the circularization junction. In other words, the circularized molecule leaves no structural "scars" or distinctive remnants; the junction is identical to the natural sequence, achieving the same continuity and integrity as the linear strand, ensuring that the molecule's original function and structure remain unaffected. This method ensures precise molecule construction while avoiding potential side effects or functional impairments caused by the introduction of additional sequences or modifications. In one embodiment of this invention, encoding RNA and nucleic acid aptamers are combined and co-circulated to form a circular nucleic acid, effectively removing redundant sequences to achieve scarless circularization.

[0142] In this invention, the diluent is a carrier containing an inactive solvent in which the compositions described herein (e.g., compositions containing circular RNA) can be diluted or dissolved. The diluent may be an RNA solubilizer, a buffer, an isotonic agent, or a mixture thereof.

[0143] The vector used in this invention for preparing circular RNA with nucleic acid aptamers, as shown in Figure 1, comprises elements arranged in the following order:

[0144] a.3'I group intronic fragment,

[0145] b. Aptamer fragment II,

[0146] c. Functional elements (including IRES, Apt, protein-binding sequences, protein-coding regions, non-coding regions, etc., or combinations thereof),

[0147] d. Nucleic acid aptamer fragment I,

[0148] e.5'I group intron fragment.

[0149] Example 1: Construction of circular RNA

[0150] 1. Construct the target plasmid

[0151] 1) Group 1: The structure of natural group I introns was simulated by extracting intron sequence elements. Considering that the remaining redundant exon sequences in the cyclization product should not be too long, the exon sequences adjacent to the group I introns were shortened. For *Anabaena globulus*, the exon at the end of the 3' group I intron (Seq ID NO: 1) was shortened to 4 bases (AAAA), and the exon at the end of the 5' group I intron (Seq ID NO: 2) was shortened to 4 bases (ACTT). For T4 bacteriophage, the exon at the end of the 3' group I intron (Seq ID NO: 3) was shortened to 2 bases (CT), and the exon at the end of the 5' group I intron (Seq ID NO: 4) was shortened to 6 bases (TTGGGT). A 5' homologous arm (Seq ID NO: 5) and a 3' homologous arm (Seq ID NO: 6) were added at the junction of the 3' group I intron and IRES, and at the junction of the 5' group I intron and the protein ORF. The internal ribosome entry site was selected as IRESMP,75, and the coding region was selected as the coding sequence for the ovalbumin antigen peptide SIINFEKL. This sequence was cloned into the pUC19 plasmid to construct a target plasmid containing the following structure (Seq ID NO: 7): T7 promoter - 3'I group intron fragment (containing shortened exons) - spacer sequence - internal ribosome entry site (IRES) - protein coding or non-coding region - spacer sequence - 5'I group intron fragment (containing shortened exons). A control circular RNA (NC) without aptamers was prepared using this recombinant nucleic acid molecule, as shown in Figure 2.

[0152] 2) Group 2: Nucleic acid aptamers (Apt) are short DNA or RNA segments, generally with stem-loop structures. By using the stem-loop structure of RNA aptamers to replace the exon sequences and spacer sequences adjacent to the splicing sites of Group I introns, the circularized RNA product can retain only the functional sequences of the aptamers, without the redundant sequences remaining from the circularization of Group I introns. The transferrin receptor RNA aptamer WAZ (Seq ID NO: 8), the eIF4G protein RNA aptamer eIF4G-Apt (Seq ID NO: 9), the serum albumin RNA aptamer Alb (Seq ID NO: 10), and the mDEC205 protein RNA aptamer min2 (Seq ID NO: 11) were selected. The secondary structures of these aptamers were predicted, and they were truncated at appropriate sites in their loop positions to form two sequences, Apt I and Apt II. The exon sequences and spacer sequences adjacent to the splicing sites of group I introns were replaced. Then, the P1 and P10 domains of group I introns were mutated accordingly to ensure the occurrence of the splicing reaction of group I introns.

[0153] The secondary structure of the transferrin receptor RNA aptamer Waz sequence was predicted using RNAFold software (GCGTTACGCGGGTTCTACGAT / AAACGGTTAATGACCAGCTTATGGCTGGCAGTTCCCGCGAAACGC). The sequence was truncated at the aforementioned slash positions to divide it into upstream Apt I and downstream Apt II. The 3' end CGAT of upstream Apt I is linked to the 5' end of the 5' I group intron of *Houttuynia cordata*, and the 5' end AAAC of downstream Apt II is linked to the 3' end of the 3' I group intron of *Houttuynia cordata*. The corresponding guide sequences of the P1 and P10 domains of the *Houttuynia cordata* introns were mutated to AAATAATTGTC, and the internal ribosome entry site IRES was selected. MP,75 The coding region was selected from the SIINFEKL coding sequence of ovalbumin antigen peptide. The above sequence was cloned into the pUC19 plasmid to construct a target plasmid containing the structure of T7 promoter-3'I intron fragment-Apt II-internal ribosome entry site (IRES)-protein coding region-Apt I-5'I intron fragment (Seq ID NO: 12). Using this recombinant nucleic acid molecule, a circular RNA (1Waza) without redundant sequences and containing one aptamer Waz was prepared, as shown in Figure 3.

[0154] The secondary structure of the transferrin receptor RNA aptamer Waz sequence was predicted using RNAFold software (GCGTTACGCGGGTTCTACGATAAACGGT / TAATGACCAGCTTATGGCTGGCAGTTCCCGCGAAACGC). The sequence was truncated at the aforementioned slash positions to divide it into upstream Apt I and downstream Apt II. The 3' end AACGGT of upstream Apt I was linked to the 5' end of the 5' I intron of T4 phage, and the 5' end TAAT of downstream Apt II was linked to the 3' end of the 3' I intron of T4 phage. The guide sequences of the corresponding P1 and P10 domains of the T4 phage introns were mutated to TAATTTTGGCCGTT, and the internal ribosome entry site IRES was selected. MP,75 The coding region was selected from the SIINFEKL coding sequence of ovalbumin antigen peptide. The above sequence was cloned into the pUC19 plasmid to construct a target plasmid containing the structure of T7 promoter-3'I intron fragment-Apt II-internal ribosome entry site (IRES)-protein coding region-Apt I-5'I intron fragment (Seq ID NO: 13). Using this recombinant nucleic acid molecule, a circular RNA (1WazT) without redundant sequences and containing one aptamer Waz was prepared, as shown in Figure 4.

[0155] The secondary structure of the eIF4G protein aptamer eIF4G-Apt sequence was predicted using RNAFold software (ACTCACTATTTGTTTTCGCGCCCAGT / TGCAAAAAGTGTCG). The sequence was truncated at the aforementioned slash positions to divide it into upstream Apt I and downstream Apt II. The 3' end CCCAGT of upstream Apt I was linked to the 5' end of the 5' I group intron of T4 phage, and the 5' end TGCA of downstream Apt II was linked to the 3' end of the 3' I group intron of T4 phage. The guide sequences of the corresponding T4 phage intron P1 and P10 domains were mutated to TAATTGCGGCTGGG. The internal ribosome entry site HRVB3 IRES was selected, and the coding region was selected from the ovalbumin antigen peptide SIINFEKL coding sequence. These sequences were cloned into the pUC19 plasmid to construct a structure containing the T7 promoter - 3' I group intron fragment - Apt II - internal ribosome entry site II - protein coding region - internal ribosome entry site I - Apt II. The target plasmid for the structure of the intron fragment in group I-5'I (Seq ID NO: 14) is shown in Figure 5.

[0156] The secondary structure of the serum albumin RNA aptamer Alb sequence was predicted using RNAFold software (GCGTTACGCGGGTGCGCCGCAACAGGTGTGACT / GCCCTAGCCTCCGCTGTACCACCCGCGAAACGC). The sequence was truncated at the aforementioned slash positions to divide it into upstream Apt I and downstream Apt II. The 3' end GTGACT of upstream Apt I was linked to the 5' end of the 5' I intron of T4 phage, and the 5' end GCCC of downstream Apt II was linked to the 3' end of the 3' I intron of T4 phage. The guide sequences of the corresponding T4 phage intron P1 and P10 domains were mutated to GAATTGGTGGTCAC, and the internal ribosome entry site IRES was selected. MP,75 The coding region was selected by tandem coding sequences of multiple tumor antigen peptides. The above sequences were cloned into the pUC19 plasmid to construct the target plasmid containing the structure of T7 promoter-3'I intron fragment-Apt II-internal ribosome entry site (IRES)-protein coding region-Apt I-5'I intron fragment (Seq ID NO: 15), as shown in Figure 6.

[0157] The secondary structure of the mDEC205 protein RNA aptamer min2 sequence was predicted using RNAFold software (GCGTTACGCGGGAGGTGTGTTAGCACACGAT / TCATAATCAGCTACCCTCCCGCGAAACGC). The sequence was truncated at the aforementioned slash position to divide it into upstream Apt I and downstream Apt II. The 3' end CACGAT of upstream Apt I is linked to the 5' end of the 5' I intron of T4 phage, and the 5' end TCAT of downstream Apt II is linked to the 3' end of the 3' I intron of T4 phage. The guide sequences of the corresponding T4 phage intron P1 and P10 domains are mutated to TAATTTGGGTCGTG, and the internal ribosome entry site IRES is selected. MP,75 The coding region was selected by tandem coding sequences of multiple tumor antigen peptides. The above sequences were cloned into the pUC19 plasmid to construct the target plasmid containing the structure of T7 promoter-3'I intron fragment-Apt II-internal ribosome entry site (IRES)-protein coding region-Apt I-5'I intron fragment (Seq ID NO: 16), as shown in Figure 7.

[0158] 2. Plasmid linearization

[0159] The plasmid was digested with XbaI (NEB, #R0145L), incubated at 37°C for 1.5 h, and then heated at 65°C for 20 min to terminate the reaction. The digested product was purified using the phenol-chloroform method.

[0160] 3. In vitro transcription (IVT)

[0161] use The T7 Quick High Yield RNA Synthesis Kit (NEB, #E2050S) was used to synthesize a circular RNA precursor from a linearized plasmid template via in vitro transduction (IVT). Following the manufacturer's instructions, nuclease-free water, NTP Buffer Mix, linearized DNA template, and T7 RNA Polymerase Mix were added, and the mixture was gently mixed and incubated at 37°C for 3 hours. After IVT, the IVT product was treated with DNase I (RNase-free) (NEB, #M0303S) for 15-20 minutes to digest the DNA template. The RNA was then purified by column purification using the Monarch RNA Cleanup Kit (NEB, #T2050L).

[0162] 4. In vitro circularization

[0163] Add 10×T4 RNA Ligase Reaction Buffer (NEB, #B0216L) to the purified RNA solution, and make up the reaction volume with nuclease-free water. Gently mix all components and heat at 65°C for 5 min. Then place on ice for 5 min. Add 1.5 μL of GTP (NEB, #N0450S) to the sample and incubate at 55°C for 30–40 min. The reaction system is shown in Table 1. Column purification of RNA was performed using the Monarch RNA Cleanup Kit (NEB, #T2050L).

[0164] Table 1 In vitro cyclization reaction system

[0165] 5. Digestion of linear RNA

[0166] RNase R (Beyotime, #R7092M) is a Mg 2+ The 3' to 5' exonucleases were used to digest and remove linear RNA. The reaction system is shown in Table 2. The reaction system was treated at 37°C for 40-50 min, and then heated at 70°C for 10 min to terminate the reaction. The RNA was purified by column purification using the Monarch RNA Cleanup Kit (NEB, #T2040L or #T2050L).

[0167] Table 2. Circular RNA Enrichment Reaction System

[0168] 6. Formaldehyde denaturing electrophoresis to identify RNA circularization

[0169] Circular RNA was detected by formaldehyde denaturing electrophoresis. Agarose-formaldehyde (Macklin, #F809702-500mL) gel with a concentration of 1.5%-2.0% (w / v) was prepared and electrophoresed in 1×MOPS (Sangon Biotech, #C516042-0001) for 40-60 min. The electrophoretic bands were observed using a fully automated gel imaging analysis system.

[0170] 7. Circular RNA splicing site sequencing verification

[0171] Following the instructions of the TRUEscript RT MasterMix (OneStep gDNA Removal) kit (Catalog No.: PC7002, Beijing Adley Biotechnology Co., Ltd.), the prepared circular RNA was subjected to reverse transcription PCR to obtain cDNA products, and then... The Ultra-Rapid II HotStart PCR Master Mix (Catalog No.: 10167ES03, Yisheng Bio) kit instructions state that PCR is performed on the splice site sequence, and the obtained DNA product is sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing to verify whether the circular RNA has been spliced ​​and circularized as expected.

[0172] Table 3 Primers for PCR amplification of circular RNA splicing sites

[0173] The circularization results of the first group of recombinant RNA nucleic acid molecules are shown in Figure 2. Based on the above electrophoresis results, the circularization efficiency was statistically analyzed using ImageJ software, and the circularization efficiency reached 86%. Sequencing results showed that the recombinant RNA nucleic acid molecules were circularized according to the expected splice sites. The circularization results of the second group of recombinant RNA nucleic acid molecules are shown in Figures 3-7. Based on the electrophoresis results, the circularization efficiency was statistically analyzed using ImageJ software. The Waz aptamer replaced the exon of the group I intron of Anabaena, achieving a circularization efficiency of 86%; the Waz aptamer replaced the exon of the group I intron of T4 phage, achieving a circularization efficiency of 85%; the eIF4G-Apt aptamer replaced the exon of the group I intron of T4 phage, achieving a circularization efficiency of 72%; the serum albumin RNA nucleic acid aptamer Alb replaced the exon of the group I intron of T4 phage, achieving a circularization efficiency of 75%; and the mDEC205 protein RNA aptamer min2 replaced the exon of the group I intron of T4 phage, achieving a circularization efficiency of 92%. Sequencing results showed that the above recombinant RNA nucleic acid molecules were circularized according to the expected splicing sites.

[0174] Example 2: Investigation of the ability of the number and arrangement of nucleic acid aptamers Waz to target and deliver circular RNA.

[0175] Selecting the aptamer Waz that can target the transferrin receptor, and following the construction method of the first group of recombinant nucleic acids in Example 1, using the group I introns of Anabaena, 1, 2, 4, 8, and 12 Waz were added to the circular RNA, respectively, in the order shown in Figure 8 (1Waz: Seq ID NO: 17, 2Waz: Seq ID NO: 18, 4Waz: Seq ID NO: 19, 8Waz: Seq ID NO: 20, 12Waz: Seq ID NO: 21). The products from transcription, circularization, and restriction enzyme digestion were analyzed by gel electrophoresis. Based on the electrophoresis results, the circularization efficiency was calculated using ImageJ software, with the highest circularization efficiency reaching over 90%. Following the construction method of the second group of recombinant nucleic acids in Example 1, using the group I introns of T4 phage, 3, 5, and 9 Waz were added to the circular RNA, respectively, in the order shown in Figure 9 (3Waz: Seq ID NO: 22, 5Waz: Seq ID NO: 23, 9Waz: Seq ID NO: 21). NO: 24), the products of transcription, circularization, and enzyme digestion were analyzed by gel electrophoresis. Based on the electrophoresis results, the circularization efficiency was calculated using ImageJ software, and the circularization efficiency reached over 80%. Following the construction method of the first group of recombinant nucleic acids in Example 1, four Waz introns from group I of Anabaena were added to the circular RNA in different sequences, as shown in Figure 10 (4Waz-1: Seq ID NO: 25, 4Waz-2: Seq ID NO: 26). The products of transcription, circularization, and enzyme digestion were analyzed by gel electrophoresis. Based on the electrophoresis results, the circularization efficiency was calculated using ImageJ software, and the circularization efficiency reached over 80%. The above circular RNA was dissolved in PBS, DPBS, or binding buff (1 mg / mL BSA, 25 mM glucose, 0.1 mg / mL yeast tRNA, and 5 mM MgCl2 were dissolved in DPBS solution), and incubated with DC2.4 cells for 4-5 hours. After replenishing the culture medium, the cells were cultured for another 24-48 hours. The presentation of the OVA peptide SIINFEKL (OVA(257-264)) was characterized by flow cytometry analysis. The results are shown in Figure 11. The results showed that the circular SIINFEKL-RNA with WAZ could effectively present the SIINFEKL peptide. Among them, the circular RNA with 3, 5, and 9 WAZs had a higher presentation effect than that delivered by Lipo3000.

[0176] Example 3: Investigation of RNA length delivered by the nucleic acid aptamer Waz

[0177] Taking 9Waz as an example, the length of RNA that the nucleic acid aptamer Waz can deliver was investigated. OVA polypeptide coding sequences of different lengths containing SIINFEKL(OVA(257-264)) were selected and substituted into the coding region of the 9Waz sequence, respectively, to obtain recombinant nucleic acid precursors of 179nt (Seq ID NO: 27), 255nt (Seq ID NO: 28), 542nt (Seq ID NO: 29), and 1310nt (Seq ID NO: 30). The structural prediction results are shown in Figure 12. The secondary structure of the 9Waz was not disturbed. Gel electrophoresis analysis was performed on the products from the transcription, circularization, and enzyme digestion processes. Based on the electrophoresis results, the circularization efficiency was calculated using ImageJ software, and the circularization efficiency reached over 80%. The above circular RNAs were dissolved in PBS, DPBS, or binding media. After incubating with DC2.4 cells for 4-5 hours, the culture medium was replenished, and the cells were cultured for another 24-48 hours. The presentation of the OVA peptide SIINFEKL was characterized by flow cytometry analysis, and the results are shown in Figure 12. The results showed that circular RNAs with 9 WAZs and different lengths of OVA coding sequences could effectively present the SIINFEKL peptide, indicating that the 9Waz structure can deliver RNA sequences of 1310 nt in length.

[0178] Example 4: Investigation of the ability of nucleolin aptamer (nul) to target and deliver circular RNA

[0179] The nucleoside aptamer sequence nul (Seq ID NO: 31) targeting nucleolin was selected. Following the construction method of the first group of recombinant nucleic acids in Example 1, 1, 2, 4, 8, and 12 nul were added to the circular RNA using introns from group I of Anabaena, arranged in the order shown in Figure 13 (1 nul: Seq ID NO: 32, 2 nul: Seq ID NO: 33, 4 nul: Seq ID NO: 34, 4 nul-1: Seq ID NO: 35, 8 nul: Seq ID NO: 36, 12 nul: Seq ID NO: 37). The products of transcription, circularization, and enzyme digestion were analyzed by gel electrophoresis. Based on the above electrophoresis results, the circularization efficiency was statistically analyzed using ImageJ software, and the circularization efficiency reached more than 90%. The above-mentioned circular RNA was dissolved in PBS, DPBS, or binding buff and incubated with DC2.4 cells for 4-5 hours. The culture medium was then replenished, and the cells were cultured for another 24-48 hours. The presentation of the OVA peptide SIINFEKL was characterized by flow cytometry analysis. The results are shown in Figure 13. Circular SIINFEKL-RNA with nul values ​​can effectively present the SIINFEKL peptide, with circular RNA containing 2, 8, and 12 nul values ​​showing the highest extraction efficiency, comparable to Lipo3000 delivery.

[0180] Example 5: Assessment of the ability of the DEC205 aptamer min2 to target and deliver circular RNA.

[0181] The nucleic acid aptamer sequence min2 targeting the DEC205 protein was selected. Following the construction method of the first group of recombinant nucleic acids in Example 1, 4, 8, and 12 min2 sequences were added to the circular RNA using introns from group I of Anabaena, as shown in Figure 14 (4 min2: Seq ID NO: 38, 8 min2: Seq ID NO: 39, 12 min2: Seq ID NO: 40). The products from the transcription, circularization, and enzyme digestion processes were analyzed by gel electrophoresis. Based on the electrophoresis results, the circularization efficiency was statistically analyzed using ImageJ software, and the highest circularization efficiency reached over 90%. The above-mentioned circular RNA was dissolved in PBS, DPBS, or binding buff and incubated with DC2.4 cells for 4-5 hours. After replenishing the culture medium, the cells were cultured for another 24-48 hours to characterize the presentation of SIINFEKL peptides. Flow cytometry analysis was performed, and the results are shown in Figure 14. Circular SIINFEKL-RNA with min2 values ​​can effectively present SIINFEKL peptides. Circular RNA with 4 and 12 min2 values ​​achieved the same presentation effect as Lipo3000, while circular RNA with 8 min2 values ​​showed the best presentation effect, exceeding that of Lipo300.

[0182] Example 6: Investigation of the ability of different nucleic acid aptamer combinations to target and deliver circular RNA

[0183] The following sequences were selected for combination: Waz (targeting the transferrin receptor), nucleolin (targeting nucleolin), and min2 (targeting the DEC205 protein). Following the construction method of the first group of recombinant nucleic acids in Example 1, two WAZs and two nul sequences were added to circular RNA using introns from group I of *Anabaena* (Mix1: Seq ID NO: 41). The circularized sequence is shown in Figure 15, with 4 WAZ-1 serving as the control group. Following the construction method of the first group of recombinant nucleic acids in Example 1, four WAZs and four nul sequences were added to circular RNA using introns from group I of *Anabaena* (Mix2: Seq ID NO: 42). An 8 WAZ sequence was set up as the control group. Following the construction method of the first group of recombinant nucleic acids in Example 1, six WAZs and six min2 sequences were added to circular RNA using introns from group I of *Anabaena* (Mix3: Seq ID NO: 41). NO: 43), and set up a 12 WAZ as the control group; according to the construction method of the second group of recombinant nucleic acids in Example 1, using the introns of group I of T4td phage, 5 WAZ and 4 nul were added to the circular RNA, respectively, and the arrangement order is shown in Figure 15 (Mix4: Seq ID NO: 44); according to the construction method of the second group of recombinant nucleic acids in Example 1, using the introns of group I of T4td phage, 5 WAZ and 4 min2 were added to the circular RNA, respectively, and the arrangement order is shown in Figure 15 (Mix5: Seq ID NO: 45), and set up a 9 WAZ as the control group; the products of transcription, circularization and enzyme digestion were analyzed by gel electrophoresis. According to the above electrophoresis results, the circularization efficiency was statistically analyzed by ImageJ software, and the circularization efficiency reached more than 90%.

[0184] The above-mentioned circular RNAs were dissolved in PBS, DPBS, or binding buff and incubated with DC2.4 cells for 4-5 hours. After replenishing the culture medium, the cells were cultured for another 24-48 hours to characterize the presentation of SIINFEKL peptides. Flow cytometry analysis was performed, and the results are shown in Figure 15. All of the above-mentioned circular RNAs can effectively present SIINFEKL peptides. Among them, Mix5 circular RNA showed the best presentation effect, which exceeded the delivery effect of Lipo3000.

[0185] Example 7: Application of SIINFEKL-RNA with Nucleic Acid Aptamer Loop in Tumor Therapy

[0186] Subcutaneous tumors were implanted in mice according to the protocol shown in Figure 16. The NC, 3Waz, 5Waz, and 9Waz circular RNAs were dissolved in PBS or DPBS and subcutaneously injected into the mice for treatment. As shown in Figure 16, compared with the control NC, the 3Waz, 5Waz, and 9Waz circular RNAs with targeting aptamers significantly reduced tumor volume in mice, with 3Waz and 9Waz showing the best therapeutic effect. Subcutaneous tumors were implanted in mice according to the protocol shown in Figure 17. The NC, Mix2, Mix5, and 9Waz circular RNAs were dissolved in PBS or DPBS and subcutaneously injected into the mice for treatment. As shown in Figure 17, compared with the control NC, the Mix2, Mix5, and 9Waz circular RNAs with targeting aptamers significantly reduced tumor volume in mice, with Mix5 showing the best therapeutic effect.

[0187] Example 8: Application of circular RNA with aptamer and KRAS antigen peptide coding sequences in tumor therapy

[0188] Four different antigenic peptides of the KRAS protein were combined to form a polypeptide chain KR1 (amino acid sequence Seq ID NO: 46, coding sequence Seq ID NO: 47), and two different antigenic peptides of the KRAS protein were combined to form a polypeptide chain KR2 (amino acid sequence Seq ID NO: 48, coding sequence Seq ID NO: 49). The coding sequences of KR1 and KR2 were used to replace the SIINFEKL coding sequence in Mix5, respectively, to obtain KR1-Mix5 (Seq ID NO: 50) and KR2-Mix5 (Seq ID NO: 51) recombinant nucleic acid molecules. The products of transcription, circularization and enzyme digestion were analyzed by gel electrophoresis. The electrophoresis results are shown in Figure 18. The circularization efficiency was statistically analyzed using ImageJ software, and the highest circularization efficiency reached more than 90%.

[0189] The KR2 coding sequence was replaced with the SIINFEKL coding sequence in 9Waz to obtain the KR2-9Waz (Seq ID NO: 52) recombinant nucleic acid molecule. Following the construction method of the first group of recombinant nucleic acids in Example 1, a recombinant nucleic acid molecule KR2-PC (Seq ID NO: 53) without nucleic acid aptamers and expressing the KR2 antigen peptide was constructed using the introns of Anabaena I as a control. The products of transcription, circularization and enzyme digestion were analyzed by gel electrophoresis. The electrophoresis results are shown in Figure 18. The circularization efficiency was statistically analyzed using ImageJ software, and the highest circularization efficiency reached more than 90%.

[0190] Following the protocol shown in Figure 19, CT26-luc cancer cells were implanted into the peritoneal cavity of mice to construct a mouse colorectal cancer model. Since the implanted cancer cells carry FLUC (luciferase), the light intensity produced by the luciferase in mouse imaging can represent the tumor size. The KR1-Mix5 and KR2-Mix5 circular RNAs were dissolved in PBS or DPBS and subcutaneously injected into the tail root of mice for treatment. A combination therapy group was also established. As shown in Figure 19, compared with the control group, the KR2-Mix5 circular RNA combined with immunotherapy significantly reduced tumor volume in mice, demonstrating the best therapeutic effect.

[0191] KPC-luc subcutaneous tumors were implanted in mice according to the protocol shown in Figure 20. The KR2-Mix5 circular RNA was dissolved in PBS or DPBS and injected subcutaneously into the tail root of the mice for treatment. A combination therapy group was also set up. As shown in Figure 20, compared with the control group, the KR2-Mix5 circular RNA combined with immunotherapy group significantly reduced the tumor volume in mice and had the best treatment effect.

[0192] Example 9: Investigation of the application of Mix5 circular RNA encoding multivalent neoantigens in the treatment of different solid tumors

[0193] The neoantigen Adpgk from MC38 mouse colorectal tumor cells, along with the neoantigen HPV16 E7 from mouse lung epithelial cells co-transformed with the genes of HPV16E6, E7, and ras, were selected. 49-57 TRP2, a neoantigen of mouse melanoma B16F10 180-190 and gp100 23-33 and WT1 126-134 and WT1 235-243 A total of six different antigenic peptides were combined to form a polypeptide chain AETG (amino acid sequence Seq ID NO: 54). The AETG coding sequence (Seq ID NO: 55) was used to replace the SIINFEKL coding sequence in Mix5 to finally prepare Apt-circRNA circular RNA capable of expressing the AETG polypeptide chain.

[0194] Following the protocol shown in Figure 22, MC38, TC-1, and B16F10 cancer cells were subcutaneously implanted into the right shoulder of mice to construct a mouse tumor model. The Apt-circRNA circular RNA was dissolved in DPBS and subcutaneously injected into the base of the mouse tail to treat the mice. A combination therapy group was also set up. As shown in Figure 22, compared with the control group, the Apt-circRNA circular RNA group or the group treated with immunotherapy significantly reduced the tumor volume of mice and prolonged the survival time of mice, showing the best treatment effect.

[0195] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

[0196] Sequence information:

[0197] Seq ID NO: 1 Anthophyte 3'I group intron

[0198] Seq ID NO: 2 Anabaena 5'I group intron

[0199] Seq ID NO: 3T4 phage 3'I group intron

[0200] Seq ID NO: 4T4 phage 5'I group intron

[0201] Seq ID NO: 55' Homologous Arm

[0202] Seq ID NO: 63' Homologous Arm

[0203] Seq ID NO: 7(60-5a)

[0204] Seq ID NO: 8 (WAZ)

[0205] Seq ID NO: 9(eIF4G-Apt)

[0206] Seq ID NO: 10 (Alb)

[0207] Seq ID NO: 11 (min2)

[0208] Seq ID NO: 12(44SW1)

[0209] Seq ID NO: 13(50SW1)

[0210] Seq ID NO: 14(eIF4G-Apt)

[0211] Seq ID NO:15(Alb)

[0212] Seq ID NO:16(min2)

[0213] Seq ID NO:17(1Waz)

[0214] Seq ID NO:18(2Waz)

[0215] Seq ID NO:19(4Waz)

[0216] Seq ID NO:20(8Waz)

[0217] Seq ID NO:21(12Waz)

[0218] Seq ID NO:22(3Waz)

[0219] Seq ID NO:23(5Waz)

[0220] Seq ID NO:24(9Waz)

[0221] Seq ID NO:25(4Waz-1)

[0222] Seq ID NO:26(4Waz-2)

[0223] Seq ID NO:27(179nt)

[0224] Seq ID NO:28(255nt)

[0225] Seq ID NO:29(542nt)

[0226] Seq ID NO:30(1310nt)

[0227] Seq ID NO:31(nul)

[0228] Seq ID NO:32(1nul)

[0229] Seq ID NO:33(2nul)

[0230] Seq ID NO:34(4nul)

[0231] Seq ID NO:35(4nul-1)

[0232] Seq ID NO:36(8nul)

[0233] Seq ID NO:37(12nul)

[0234] Seq ID NO:38(4min2)

[0235] Seq ID NO:39(8min2)

[0236] Seq ID NO:40(12min2)

[0237] Seq ID NO:41(Mix1)

[0238] Seq ID NO:42(Mix2)

[0239] Seq ID NO:43(Mix3)

[0240] Seq ID NO:44(Mix4)

[0241] Seq ID NO:45(Mix5)

[0242] Seq ID NO:46(KR1)

[0243] Seq ID NO:47(KR1)

[0244] Seq ID NO:48(KR1)

[0245] Seq ID NO:49(KR1)

[0246] Seq ID NO:50(KR1-Mix5)

[0247] Seq ID NO:51(KR2-Mix5)

[0248] Seq ID NO:52(KR2-9Waz)

[0249] Seq ID NO:53(KR2-PC)

[0250] Seq ID NO:54(AETG)

[0251] Seq ID NO:55(AETG)

Claims

1. A precursor nucleic acid molecule for preparing circular nucleic acid molecules, characterized in that: The precursor nucleic acid molecule includes, along the 5' to 3' direction: a.3'I group introns or their mutant fragments b. Unit I fragment II, whose 5' end includes the II ribozyme recognition fragment. c. Functional units, including IRES, nucleic acid aptamers, protein-binding sequences, protein-coding regions, non-coding regions, etc., or combinations thereof. d. The first unit fragment I, whose 3' end includes the I ribozyme recognition fragment, e.5'I group introns or their mutant fragments; The first unit segment II is located at the 3' end of the first unit segment I, meaning the complete first unit sequence includes: Unit 1 Fragment I - Unit 1 Fragment II; The group I intron or its mutant fragment is located at the 3' end of the 5' group I intron or its mutant fragment, that is, the complete group I intron or its mutant sequence includes: 5'I group introns or their mutant fragments - 3'I group introns or their mutant fragments; The introns in group I or their mutants recognize and covalently link the first ribozyme recognition fragment and the second ribozyme recognition fragment to obtain a circular nucleic acid molecule, that is, the complete first unit sequence in the circular molecule contains the first ribozyme recognition fragment and the second ribozyme recognition fragment as a circular fragment; The feature is that: the first unit is a nucleic acid aptamer, the first unit fragment I and the first unit fragment II are nucleic acid aptamer fragment I and nucleic acid aptamer fragment II, and the nucleic acid aptamer fragment I and nucleic acid aptamer fragment II are obtained by splitting the nucleic acid aptamer sequence.

2. The precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 1, characterized in that: The first unit has a local stem structure, a local double-chain structure, or a local hairpin structure, wherein the local stem structure, local double-chain structure, or local hairpin structure is adjacent to or includes the looping segment; Where "-" represents a phosphodiester bond; Preferably, the cyclic fragment is located in the loop of the stem-loop structure of the first unit or nucleic acid aptamer sequence, and a double-stranded structure formed by complementary pairing sequences exists within 100 bases upstream and downstream of the cyclic fragment; preferably, the double-stranded structure contains at least 5 consecutive complementary pairing bases; and even more preferably, the number of complementary and non-complementary pairing bases in the stem of the stem-loop structure exceeds 20 bp.

3. The precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 2, characterized in that: The first ribozyme recognition fragment and the second ribozyme recognition fragment are respectively exon fragment 1 (E1) and exon fragment 2 (E2) adjacent to the introns in group I. The E1 is the 5' adjacent exon fragment of the group I intron, with a length ≥ 4 nucleotides; E2 is the 3' adjacent exon fragment of group I introns, with a length ≥ 0 nucleotides; The length of E1 and / or E2 is 0-20 nucleotides, preferably 1-10 nucleotides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides.

4. The precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 3, characterized in that: The 5' adjacent exon fragment contains one or more nucleotides or is composed of them, which can pair with the guide sequence of the corresponding group I intron to form the P1 double-stranded region during cyclization. Preferably, the first ribozyme recognition fragment comprises or consists of about 1 to about 7 consecutive nucleotides starting from the 5' end of the natural 5' adjacent exon of the group I intron. Preferably, the second ribozyme recognition fragment comprises or consists of 0 to about 4 consecutive nucleotides starting from the 5' end of the natural 3' adjacent exon of the group I intron.

5. A precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 3, characterized in that: The intron in group I is TpaCOX2 intron, with the nucleotide sequence of its 5' adjacent exon region being 5'-ACGTCTT-3' and the nucleotide sequence of its 3' adjacent exon region being 5'-AACCAA-3'.

6. The precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 3, wherein the group I intron is a Ptuintron, the nucleotide sequence of its 5' adjacent exon region is 5'-AGGGAT-3', and the nucleotide sequence of its 3' adjacent exon region is 5'-CA-3'.

7. The precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 3, wherein the group I introns are group I introns of the Azoarcus sp. BH72 pre-tRNA-Ile gene.

8. A precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 3, characterized in that: The 3' adjacent exon fragment is derived from the 3' natural exon of the group I intron (Ana ribozyme) of the Anabaena pre-tRNA-Leu gene; the 5' adjacent exon fragment is derived from the 5' natural exon of the group I intron of the Anabaena pre-tRNA-Leu gene; preferably, the first ribozyme recognition fragment comprises CTC, CTT, ACTT, CGAT, AAGT, CGTT, CCGT, ATGT, AATT, ACGT, AGTT, or composed thereof; the second ribozyme recognition fragment comprises AAAA, AAAC, AA, TTTT, CAAA, GAAA, AAA, AAC, AGA, AAT, CCA, TAC, or composed thereof.

9. A precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 3, characterized in that: The 3' immediately adjacent exon fragment is derived from the 3' natural exon of the group I intron (T4td ribozyme) of the T4 phage td gene; the 5' immediately adjacent exon fragment is derived from the 5' natural exon of the group I intron of the T4 phage td gene; preferably, the first ribozyme recognition fragment comprises TTGGGT, CCAAGT, ATTAAT, AACGGT, CCCAGT, GTGACT, CACGAT or composed thereof; the second ribozyme recognition fragment comprises CT, AA, GA, TA, TG, GC, TC or composed thereof.

10. A precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 3, characterized in that: The first and second ribozyme recognition fragments also contain sequences that differ from the base sequences of the 3' or 5' natural exon regions but still retain cyclic activity.

11. A precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 10, characterized in that: The introns in group I are Ana ribozymes or their mutants, T4td ribozymes or their mutants, TpaCOX2 introns or their mutants, and Ptu introns or their mutants. The mutants include mutations in the guide regions of P1 / P10.

12. A precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 11, characterized in that: The introns in group I are mutants of the Ana ribozyme. The recognition fragment of the first ribozyme is 5'-N1N2N3T-3' or 5'-N2N3T-3', and the recognition fragment of the second ribozyme is 5'-N4N5N6-3' or 5'-N4N5-3'. The mutant Ana ribozyme contains the following mutant regions in the 5' intron fragment: N6, N7, ATAAN5, N4, GN3, N2, where N is A, U, C, G, or T. N3, N2, and N2 are anticomplementary to N2N3, N5, N4, and N4N5, and N6, N7, and N5, N4 are anticomplementary to each other. The base pairings include AU, GC, GU, AT, and GT base pairs. The corresponding looping segments in the first unit are N1N2N3TN4N5N6 or N2N3TN4N5N6 or N2N3TN4N5, and the looping sites are N1N2N3T / N4N5N6 or N2N3T / N4N5N6 or N2N3T / N4N5 (the slashes represent splice sites).

13. A precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 11, characterized in that: The group I introns are mutants of the T4td ribozyme. The first ribozyme recognition fragment is 5'-N1N2N3N4N5T-3' or 5'-N2N3N4N5T-3' or 5'-N3N4N5T-3', and the second ribozyme recognition fragment is 5'-N6N7-3' or N6 or absent. The T4td ribozyme mutant contains the following mutant regions in the 5' intron fragment: N8, AATTGN7, N6, GN5, N4, N3, N2'N1, where N is A, U, C, G or T, and N... 5’ N 4’ N 3’ N 2’ N 1’ Pairing with N1N2N3N4N5 in reverse complementary order, or N 5’ N 4’ N 3’ N 2’ Pairing with N2N3N4N5 in reverse complementary order, or N 5’ N 4’ N 3’ Pairing with N3N4N5 in reverse complementary direction; N 7’ N 6’ Pairing with N6N7 in reverse complementary direction, or N 6’ Pairing with N6 complementary to N, N 8’ With N 6’ Complementary pairing, wherein the complementary base pairing includes AU, GC, GU, AT, GT base pairs; the corresponding cyclic fragments in the first unit are N1N2N3N4N5TN6N7 or N2N3N4N5TN6 or N3N4N5T, and the cyclic sites are N1N2N3N4N5T / N6N7 or N2N3N4N5T / N6 or N3N4N5T / ; Preferably, when N6N7 is absent, the 3' end base T of the first ribozyme recognition fragment is adjacent to the stem structure of the first unit, then the P10 guide sequence N 7’ N 6’ Mutation is not required; more preferably, N6 is U or C, N 6’ No mutations occur.

14. A precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 1, characterized in that: The functional unit contains additional aptamer sequences; Preferably, the number of additional nucleic acid aptamer sequences is one or more; more preferably, the number of nucleic acid aptamers is 1-12, including 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12; even more preferably, the number of nucleic acid aptamers is 9. Preferably, all nucleic acid aptamer sequences contained in the precursor molecule (including the nucleic acid aptamer as the first unit and one or more additional aptamer sequences contained in the functional unit) may be the same or different. Preferably, all nucleic acid aptamer sequences contained in the precursor molecule are linked together; Preferably, the arrangement of all nucleic acid aptamer sequences contained in the precursor molecule includes a linear arrangement, a branched arrangement, or a combination thereof; more preferably, it is a combination of branched arrangements.

15. A precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 14, characterized in that: All nucleic acid aptamer sequences contained in the precursor molecule are selected from nucleic acid aptamer sequences of the target protein or nucleic acid aptamer sequences of the target cell.

16. A precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 15, characterized in that: The nucleic acid aptamer sequence for the target cells includes, but is not limited to, nucleic acid aptamers targeting nerve cells, muscle cells, immune cells, tumor cells, vascular endothelial cells, stem cells, etc.; preferably, nucleic acid aptamers targeting antigen-presenting cells (APCs) such as dendritic cells or macrophages. The nucleic acid aptamer sequence of the target protein is selected from the nucleic acid aptamers of target transferrin, DEC205, eIF4G protein, serum albumin, nucleolin, mannose receptor, CD207, DC-SIGN, Clec9a, and DCIR2.

17. A precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 16, wherein all nucleic acid aptamer sequences contained in the precursor molecule target different receptors on the same cell; preferably, they target different receptors on antigen-presenting cells.

18. A precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 1, characterized in that: The length of the functional unit is 6nt-10000nt.

19. A precursor nucleic acid molecule for preparing a circular nucleic acid molecule as described in claim 18, wherein the functional unit includes one or more additional aptamer sequences, IRES, a protein-coding region, and a non-coding region; Preferably, the protein-coding region includes one or more coding sequences; Preferably, the coding sequence includes an antigenic peptide, a sequence encoding a fluorescent molecule, a therapeutic polypeptide, a cytokine, an antibody or antigen-binding fragment, an antibody or antigen-binding fragment against a tumor-specific antigen, an antibody or antigen-binding fragment against a pathogen antigen, a CAR-T molecule sequence, or a sequence encoding a protein with gene-editing activity. Preferably, the non-coding region includes one or more non-coding sequences; Preferably, the non-coding sequence includes miRNA sponges, nucleic acid aptamers, antisense oligonucleotides (ASO), or small interfering ribonucleic acid (siRNA).

20. A circular nucleic acid molecule obtained based on a precursor nucleic acid molecule for preparing a circular nucleic acid molecule according to any one of claims 1-19.

21. A targeted delivery circular nucleic acid molecule, characterized in that: The circular nucleic acid molecule contains one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) nucleic acid aptamer sequences and functional units. The functional units include IRES, protein binding sequences, protein coding regions, non-coding regions, nucleic acid aptamers, etc., or combinations thereof. The nucleic acid aptamers include nucleic acid aptamer sequences targeting proteins or nucleic acid aptamer sequences targeting cells. Preferably, the nucleic acid aptamer sequences targeting cells include, but are not limited to, nucleic acid aptamers targeting nerve cells, muscle cells, immune cells, tumor cells, vascular endothelial cells, stem cells, etc.; preferably, nucleic acid aptamers targeting antigen-presenting cells (APCs) such as dendritic cells (DCs) or macrophages; preferably, the multiple nucleic acid aptamer sequences target different receptors on antigen-presenting cells; more preferably, they target at least two different receptors. Preferably, the nucleic acid aptamer targets tumor-specific antigen (TSA), tumor-associated antigen (TAA), immune cell surface antigen or receptor, tumor immune-related molecules, or autoimmune regulation-related molecules; preferably, the nucleic acid aptamer sequence of the target protein is selected from nucleic acid aptamers targeting transferrin, DEC205, eIF4G protein, serum albumin, nucleolin, mannose receptor, CD207, DC-SIGN, Clec9a, and DCIR2.

22. The targeted delivery circular nucleic acid molecule as described in claim 21, characterized in that: The functional units include IRES and protein-coding regions; Preferably, the protein-coding region includes one or more coding sequences; Preferably, the coding sequence includes the coding sequence of an antigenic peptide, a fluorescent molecule, a therapeutic polypeptide, a cytokine, an antibody such as an antibody against a tumor-specific antigen and an antibody against a pathogen antigen, a CAR-T molecule, or a protein with gene-editing activity. Preferably, the antigenic peptide is a tumor antigenic peptide; more preferably, it is a combination of multiple tumor antigenic peptides. Preferably, the functional unit further includes a Kozak sequence, polyA, polyAC, or other control elements; Or the functional unit may include a non-coded area; Preferably, the non-coding region includes one or more non-coding sequences; Preferably, the non-coding sequence includes miRNA sponges, nucleic acid aptamers, antisense oligonucleotides (ASO), or small interfering ribonucleic acid (siRNA).

23. The targeted delivery circular nucleic acid molecule as described in claim 21 or 22, characterized in that: It is obtained based on the precursor nucleic acid molecule according to any one of claims 1-20.

24. A vector containing the precursor nucleic acid molecule as described in any one of claims 1-19.

25. A biomaterial or composition, characterized in that: Includes the precursor nucleic acid molecule according to any one of claims 1-19, the targeted delivery circular nucleic acid molecule according to any one of claims 21-23, and the vector according to claim 24; Preferably, the biological material comprises a host cell; the composition comprises a pharmaceutical composition.

26. A biomaterial or composition as described in claim 25, characterized in that: The pharmaceutical composition also includes a diluent, and the composition may or may not include a carrier such as nanoliposome particles.

27. A method for preparing a circular nucleic acid molecule, characterized in that: This includes preparing cyclic nucleic acid molecules by cyclizing the precursor nucleic acid molecules described in any one of claims 1-19 using an intron self-splicing method; Preferably, cyclic nucleic acid molecules are prepared by cyclizing the precursor nucleic acid molecules using an intron self-splicing method, particularly a group I intron self-splicing method.

28. A method for preparing a circular nucleic acid molecule, characterized in that: Includes the following steps: S1 Preparation of linear plasmid template: The promoter, 3'I intron, nucleic acid aptamer fragment II, IRES, RNA coding sequence, nucleic acid aptamer fragment I, and 5'I intron are cloned into the starting plasmid and digested with enzymes to obtain the linear plasmid template; S2 prepares the precursor nucleic acid molecule according to any one of claims 1-19 by in vitro transcription of a linear plasmid template; S3 cyclizes precursor nucleic acid molecules to obtain circular nucleic acid molecules through a self-splicing reaction; Preferably, the promoter comprises one or more exogenous promoters; Preferably, the exogenous promoter includes one of the following: CMV promoter, EF1α promoter, PGK promoter, CAG promoter, UBC promoter, SV40 promoter, Human beta actin promoter, TEF1 promoter, GDS promoter, H1 promoter, U6 promoter, T7 promoter, TERT promoter, RSV promoter, and PGK1 promoter; more preferably, the exogenous promoter is the T7 promoter.

29. The use of the precursor nucleic acid molecule of any one of claims 1-19, the circular nucleic acid molecule of any one of claims 20-23, the carrier of claim 24, or the biomaterial or composition of claim 25 or 26 in the preparation of mRNA drugs for the following purposes: 1) anti-tumor; 2) mRNA vaccine; 3) improving the targeting of mRNA drugs; 4) improving the presentation effect of mRNA drugs; 5) improving the expression efficiency of mRNA drugs.

Images