Production method for protease and use thereof

By constructing the fusion expression of pfuS thermoprotease precursor peptide and Tn thermoprotease mature peptide in Bacillus host cells and performing point mutations, the problem of insufficient production of thermoprotease in Gram-positive host cells was solved, enabling efficient industrial production and application in ethanol production.

WO2026098696A1PCT designated stage Publication Date: 2026-05-15NANJING BESTZYME BIO ENG CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
NANJING BESTZYME BIO ENG CO LTD
Filing Date
2025-11-11
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently produce thermoproteases in Gram-positive host cells, especially thermoproteases from Thermococcus nautilus, which limits their application in ethanol production.

Method used

By constructing an expression vector, the pfuS thermoprotease precursor peptide was fused with the Tn thermoprotease mature peptide, and the pfuS thermoprotease precursor peptide was point-mutated. The expression was carried out using Bacillus host cells to increase the yield of the protease.

Benefits of technology

It significantly increased the yield of Tn high-temperature protease, making it suitable for industrial production and enhancing its application potential in ethanol production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025133975_15052026_PF_FP_ABST
    Figure CN2025133975_15052026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention provides an improved production method for high-temperature protease and use thereof. In the present invention, a pfuS high-temperature protease propeptide is fused with a Tn high-temperature protease mature peptide to produce a Tn high-temperature protease. Compared to a wild-type Tn high-temperature protease, the Tn high-temperature protease produced in the form of a fusion polypeptide results in a significant increase in yield. Introducing point mutations into the pfuS high-temperature protease propeptide can further improve the yield of the Tn high-temperature protease.
Need to check novelty before this filing date? Find Prior Art

Description

Production methods and applications of proteases

[0001] Cross-reference to related applications

[0002] This application claims priority to an earlier application filed on November 11, 2024, with patent application number 2024116012017, entitled "Method for producing protease and its application," entitled "Method for producing protease and its application." The entire contents of the earlier application are incorporated herein by reference. Technical Field

[0003] This invention belongs to the field of biomedicine, specifically relating to a method for producing a protease and its application. Background Technology

[0004] Proteases are a class of enzymes that specifically hydrolyze proteins. They are among the world's largest-volume and most widely marketed industrial enzyme products and are widely used in various fields such as food, detergents, and feed.

[0005] High-temperature proteases, due to their excellent thermostability, are widely used in the production of fermentation products (such as ethanol). Patent application WO2013 / 082486A1 discloses a method for producing fermentation products by liquefying starch-containing materials and then saccharifying and fermenting them using α-amylase, a wild-type high-temperature protease from *Pyrococcus furiosus* (hereinafter referred to as pfuS high-temperature protease, amino acid sequence as shown in SEQ ID NO: 1), and an enzyme optionally derived from local carbohydrate sources; patent application WO2014 / 209800A1 discloses a method for producing fermentation products by liquefying starch-containing materials using α-amylase and a high dose of pfuS high-temperature protease at a temperature higher than the initial gelatinization temperature; and patent application WO 2016 / 196202A1 discloses the application of S8 protease from *Thermococcus* in ethanol production.

[0006] In addition, an increasing number of ethanol plants are extracting oil from distillers' wastewater and / or slurry as byproducts for use in biodiesel production or other biorenewable products. Patent application WO 2011 / 126897A1 discloses the use of pfuS thermophilic protease and metalloproteinase variants from *Thermophilus aureus* in the process of extracting oil from distillers' wastewater.

[0007] Although these thermoproteases have shown promising applications in ethanol production and corn oil extraction, large-scale production via recombinant expression in preferred industrial Gram-positive expression host cells remains challenging. Research on strategies to increase the yield of these thermoproteases has primarily focused on the pfuS thermoprotease. Besides pfuS, other thermoproteases from the genus *Thermococcus* exhibit equally superior performance, but methods for increasing their yield are rarely reported. Therefore, the main objective of this invention is to provide a method for increasing the yield of thermoproteases derived from *Thermococcus nautili* in Gram-positive expression host cells and its application in ethanol production. Summary of the Invention

[0008] To address the aforementioned technical problems, this invention provides a method for producing proteases, comprising:

[0009] 1) Construct an expression vector comprising a polynucleotide encoding a mature peptide of the protease and a polynucleotide encoding a pfuS thermoprotease precursor or a mutant thereof, wherein the mature peptide of the protease has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID NO: 6; and

[0010] 2) Introduce the expression vector into the host cell.

[0011] In one embodiment, the aforementioned pfuS thermoprotease precursor includes the amino acid sequence shown in SEQ ID NO: 13, wherein the amino acid sequence of the pfuS thermoprotease precursor mutant has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID NO: 13.

[0012] In one embodiment, the amino acid sequence of the pfuS thermoprotease precursor mutant includes a mutation of at least one amino acid at positions 39, 66, 67, 68, 69, 98, 99, 101, 102, 105, 107, 108, and 109 compared to SEQ ID NO: 13.

[0013] In one embodiment, the amino acid sequence of the pfuS thermoprotease precursor mutant is mutated compared to SEQ ID NO: 13, comprising at least one amino acid from V39I, Y66F, H67N, H67K, I68V, I69L, R98K, F99V, Q101E, E102L, K105T, T107S, V108A, or S109G.

[0014] In one embodiment, the amino acid sequence of the pfuS thermoprotease precursor mutant, compared to SEQ ID NO: 13, includes any of the following combinations of amino acid mutations:

[0015] V39I+Y66F+R98K+Q101E+T107S;

[0016] V39I+Y66F+H67N+R98K+Q101E+E102L+K105T+T107S+V108A;

[0017] V39I+Y66F+H67K+I68V+I69L+R98K+F99V+Q101E+T107S+S109G; and

[0018] V39I+Y66F+H67K+I68V+I69L+R98K+F99V+Q101E+T107S.

[0019] In one embodiment, the amino acid sequence of the pfuS thermoprotease precursor mutant comprises any one of SEQ ID NO: 16, 17, 18 and 19.

[0020] In one embodiment, the host cell is a Bacillus host cell.

[0021] In one embodiment, the host cell may be any one of the following groups: alkalophilic Bacillus, highland Bacillus, Bacillus amyloliquefaciens, Bacillus amyloliquefaciens subsp. plantarum, Bacillus brevis, Bacillus circulans, Bacillus croceae, Bacillus coagulans, Bacillus sturdier, Bacillus splenti, Bacillus licheniformis, Bacillus megaterium, methyltrophic Bacillus, Bacillus brevis, Bacillus saforticus, thermophilic steatobacterium, Bacillus subtilis, and Bacillus thuringiensis.

[0022] In one embodiment, the host cell is Bacillus licheniformis or Bacillus subtilis.

[0023] On the other hand, the present invention provides a protease produced by the aforementioned method.

[0024] On the other hand, the present invention provides a composition comprising the aforementioned protease.

[0025] In one embodiment, the aforementioned composition further includes at least one enzyme selected from the group consisting of amylase, saccharifying enzyme, pullulanase, phytase, lysozyme, catalase, cellulase, cutinase, halogenated peroxylase, lipase, mannanase, pectinase, xanthan gumase, and xyloglucanase.

[0026] On the other hand, the present invention also provides the use of the aforementioned protease or the aforementioned composition in the production of fermentation products.

[0027] On the other hand, the present invention also provides the aforementioned protease or the aforementioned composition for producing fermentation products.

[0028] On the other hand, the present invention provides a method for producing fermentation products, which includes using the aforementioned protease or the aforementioned composition.

[0029] In one embodiment, the fermentation product is ethanol, glucose, amino acids, or organic acids. Beneficial effects

[0030] The Tn thermoprotease produced by fusing pfuS thermoprotease precursor peptide with Tn thermoprotease mature peptide provided by this invention significantly increases the yield of Tn thermoprotease produced in the form of fused polypeptides compared to wild-type Tn thermoprotease. Furthermore, point mutation of pfuS thermoprotease precursor peptide can further improve the yield of Tn thermoprotease, which is of great significance for the industrial production of Tn thermoprotease. Attached Figure Description

[0031] Figure 1 is a schematic diagram of the PKS-PamyL-Tn-T-TamyL plasmid.

[0032] Figure 2 is a schematic diagram of the PKS-PamyL-propfuS-Tn-T-TamyL plasmid.

[0033] Figure 3 shows the results of the alcohol content experiment of Tn high-temperature protease.

[0034] Figure 4 shows the experimental results of total residual sugar from Tn high-temperature protease. Detailed Implementation

[0035] definition

[0036] The term "pfuS thermoprotease" refers to a protease derived from Pyrococcus furiosus, whose wild-type amino acid sequence is shown in SEQ ID NO: 1. SEQ ID NO: 1 contains the mature peptide of the protease and its N-terminal signal peptide and propeptide, the amino acid sequence of which is shown in SEQ ID NO: 13.

[0037] The term "propeptide" refers to an amino acid sequence that is joined (fused) to the amino terminus of a polypeptide in a frame-compliant manner. The resulting polypeptide is called a precursor enzyme. Precursors are inactive and can be converted into mature, active polypeptides by catalytic cleavage or self-catalytic cleavage of the precursor enzyme.

[0038] As used herein, the term "polynucleotide sequence encoding a polypeptide" includes DNA encoding a gene that expresses the polypeptide, preferably a heterologous gene.

[0039] The terms “heterologous coding sequence,” “heterologous gene sequence,” “heterologous gene,” “recombinant gene,” or “gene” are used interchangeably. These terms refer to DNA sequences that encode recombinant protein products, particularly recombinant heterologous protein products, that are expressed and harvested in host cells. The product of a gene can be a polypeptide. Heterologous gene sequences are not naturally present in host cells and originate from organisms of the same or different species and can be genetically modified.

[0040] The terms “protein” and “polypeptide” are used interchangeably to refer to a string of amino acid residues linked together by peptide bonds between adjacent α-amino and carboxyl groups.

[0041] The term "mutant" refers to a substance that may include substitutions, deletions, and / or insertions at one or more (e.g., several) positions. Substitution means replacing an amino acid occupying a position with a different amino acid; deletion means removing an amino acid occupying a position; and insertion means adding one or more (e.g., several) amino acids (e.g., 1-5 amino acids) adjacent to and immediately following the amino acid occupying the position. Examples of conserved substitutions are in the following group: basic amino acids (arginine, lysine, and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine, and valine), aromatic amino acids (phenylalanine, tryptophan, and tyrosine), and small amino acids (glycine, alanine, serine, threonine, and methionine). Amino acid substitutions that do not generally alter specific activity are known in the art and are described, for example, by H. Neurath and RL Hill, 1979, in *The Proteins*, Academic Press, New York. Common substitutes are Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Tyr / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, and Asp / Gly.

[0042] Alternatively, amino acid alterations have the property of changing the physicochemical properties of peptides. For example, amino acid alterations can improve the thermal stability of peptides, change substrate specificity, change the optimal pH, and so on.

[0043] Essential amino acids in peptides can be identified using procedures known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, a single alanine mutation is introduced at each residue in the molecule, and the enzyme activity of the resulting mutant molecule is tested to identify amino acid residues essential to the molecule's activity. See also Hilton et al., 1996, Journal of Biochemistry 271: 4699-4708. The active site of the enzyme or other biological interactions can also be determined by combining mutations of amino acids at hypothetical contact sites with physical analysis of the structure, such as by techniques like nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, Journal of Molecular Biology 224: 899-904; Wlodaver et al., 1992, FEBS Lett. 309: 59-64. Essential amino acids can also be identified by comparison with related peptides.

[0044] Single or multiple amino acid substitutions, deletions, and / or insertions can be made and tested using known methods of mutagenesis, recombination, and / or truncation, followed by relevant screening procedures, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proceedings of the National Academy of Sciences of the United States of America (Proc. Natl. Acad. Sci. USA) 86: 2152-2156; WO 95 / 17413; or WO 95 / 22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991, Biochemistry 30: 10832-10837; US Patent No. 5,223,409; WO 92 / 06204), and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145; Ner et al., 1988, DNA 7: 127).

[0045] The term "fusion polypeptide" can be a hybrid polypeptide in which a region of one polypeptide is fused at the N-terminus or C-terminus of a region of another polypeptide. The polypeptide can be a fusion polypeptide or a cleavable fusion polypeptide in which another polypeptide is fused at the N-terminus or C-terminus of the polypeptide of the present invention. Fusion polypeptides are generated by fusing a polynucleotide encoding another polypeptide to the polynucleotide of the present invention. Techniques for generating fusion polypeptides are known in the art and include linking the coding sequences of the polypeptides such that they are in a frame and that the expression of the fusion polypeptide is under the control of the same one or more promoters and terminators. Fusion polypeptides can also be constructed using integrin technology, wherein the fusion polypeptide is generated post-translational (Cooper et al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994, Science 266: 776-779).

[0046] Fusion peptides may further include a cleavage site between the two peptides. This site is cleaved upon secretion of the fusion peptide, thereby releasing both peptides. Examples of cleavage sites include, but are not limited to, those disclosed in the following literature: Martin et al., 2003, *J. Ind. Microbiol. Biotechnol.* 3: 568-576; Svetina et al., 2000, *J. Biotechnol.* 76: 245-251; Rasmussen-Wilson et al., 1997, *Appl. Environ. Microbiol.* 63: 3488-3493; Ward et al. d) et al., 1995, Biotechnology 13: 498-503; and Contreras et al., 1991, Biotechnology 9: 378-381; Eaton et al., 1986, Biochemistry 25: 505-512; Collins-Racie et al., 1995, Biotechnology 13: 982-987; Carter et al., 1989, Proteins: Structure, Function, and Genetics 6: 240-248; and Stevens, 2003, Drug Discovery World 4: 35-48.

[0047] The terms "mature peptide of a protease" or "mature protease" can be obtained alone from any genus of microorganism. For the purposes of this invention, as used herein in conjunction with the given source, the term "obtained from" shall mean that the mature protease and / or propeptide encoded by the polynucleotide is produced by that source or by a strain in which a polynucleotide from that source has been inserted. In one aspect, the mature protease and / or propeptide obtained from a given source is a non-secretory protein. In one aspect, the present invention utilizes the cleavage of a fusion polypeptide to obtain the mature peptide of the protease.

[0048] The mature protease may be an archaea mature protease. In a preferred embodiment, the mature protease is obtained from a species of the genus *Thermococcus*. More preferably, the mature protease is obtained from *Thermococcus nautiloides*. Even more preferably, the mature protease is a mature *Thermococcus nautiloides* protease or a variant thereof, having the amino acid sequence shown in SEQ ID NO: 6, or having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID NO: 6.

[0049] The mature protease and / or propeptide may also be a bacterial protease and / or propeptide. For example, the mature protease can be obtained alone from Gram-positive bacteria such as *Bacillus*, *Clostridium*, *Enterococcus*, *Geobacillus*, *Lactobacillus*, *Lactococcus*, *Oceanobacillus*, *Staphylococcus*, *Streptococcus*, or *Streptomyces* species; or from Gram-negative bacteria such as *Campylobacter*, *E. coli*, *Flavobacterium*, *Fusobacterium*, *Helicobacter*, *Ilyobacter*, *Neisseria*, *Pseudomonas*, *Salmonella*, or *Ureaplasma* species.

[0050] In a preferred embodiment, the mature protease can be obtained individually from Bacillus alkalophilus, Bacillus albopictus, Bacillus amyloliquefaciens, Bacillus amyloliquefaciens subsp. plantarum, Bacillus brevis, Bacillus circulans, Bacillus croceae, Bacillus coagulans, Bacillus scleroderma, Bacillus splenicum, Bacillus stenosis, Bacillus licheniformis, Bacillus megaterium, Bacillus methyltrophicus, Bacillus brevis, Bacillus saffron, Bacillus thermophilus, Bacillus subtilis, or Bacillus thuringiensis.

[0051] In a preferred embodiment, the mature protease can be obtained alone from Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, or Streptococcus equisubsp. Zooepidemicus.

[0052] It should be understood that, for the aforementioned species, this invention covers both perfect and imperfect states, and other taxonomic equivalents, such as asexual forms, regardless of their known species names. Those skilled in the art will readily identify the appropriate equivalents.

[0053] Strains of these species are readily available to the public at many culture collections, such as the American Type Culture Collection (ATCC), the German Microbial Culture Collection (DSMZ), the Centralbureau Voor Schimmelcultures (CBS), and the Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL).

[0054] The term "polynucleotide" refers to an oligomer or polymer containing at least two linked nucleotides or nucleotide derivatives, including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) typically linked together by phosphodiester bonds. As used herein, the term "nucleic acid molecule" is intended to include both DNA and RNA molecules. Nucleic acid molecules can be single-stranded or double-stranded and can be cDNA.

[0055] As used herein, isolated nucleic acid molecules are nucleic acid molecules isolated from other nucleic acid molecules present in natural sources of nucleic acid molecules. “Isolated” nucleic acid molecules, such as cDNA molecules, may be substantially free of other cellular material or culture medium when prepared by recombinant technology, or substantially free of chemical precursors or other chemical components when chemically synthesized. Exemplary isolated nucleic acid molecules provided herein include isolated nucleic acid molecules encoding provided antibody or antigen-binding fragments.

[0056] The term "coding sequence" refers to a polynucleotide that directly specifies the amino acid sequence of a polypeptide. The boundaries of a coding sequence are typically defined by an open reading frame (ORF), which begins with a start codon (e.g., ATG, GTG, or TTG) and ends with a stop codon (e.g., TAA, TAG, or TGA). The coding sequence can be genomic DNA, cDNA, synthetic DNA, or a combination thereof.

[0057] The term "control sequence" refers to the nucleic acid sequence necessary for the expression of the polynucleotide encoding the mature polypeptide of the present invention. Each control sequence can be a native sequence (i.e., from the same gene) or a foreign sequence (i.e., from a different gene) of the polynucleotide encoding the polypeptide, or a native or foreign sequence of each other. Such control sequences include, but are not limited to, leader sequences, polyadenylated sequences, propeptide sequences, promoters, signal peptide sequences, and transcription terminators. Control sequences include at least a promoter and transcription and translation termination signals. Control sequences may be equipped with adapters to introduce specific restriction sites, thereby facilitating the linkage of the control sequence with the coding region of the polynucleotide encoding the polypeptide.

[0058] The term “expression” includes any step involved in peptide production, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0059] The term "expression vector" refers to a linear or circular DNA molecule that contains a polynucleotide encoding a polypeptide and is operatively linked to a control sequence that provides for its expression.

[0060] The term "fragment" refers to a mature polypeptide or a polypeptide whose amino and / or carboxyl terminus lacks one or more (e.g., several) amino acids; wherein the fragment has protease activity.

[0061] The term "host cell" refers to any cell type susceptible to transformation, transfection, transduction, etc. The term "host cell" also includes any offspring of a parent cell that differs from the parent cell due to mutations occurring during replication.

[0062] The term “separated” refers to a substance in a form or environment that does not exist in nature. Non-limiting examples of separated substances include (1) any substance that is not naturally occurring, (2) any substance, including but not limited to any enzyme, variant, nucleic acid, protein, peptide or cofactor, which is at least partially removed from one or more of the naturally occurring components associated with it in nature; and (3) any substance that is artificially modified relative to the substance for the purpose of aligning gaps.

[0063] The term "subsequence" refers to a polynucleotide whose 5′ and / or 3′ ends of a mature polypeptide coding sequence are missing one or more (e.g., several) nucleotides; wherein the subsequence encodes a fragment having protease activity.

[0064] For amino acid substitutions, the following nomenclature is used: original amino acid, position, substitution amino acid. Therefore, replacing threonine at position 226 with alanine is designated as "Thr226Ala" or "T226A". Multiple mutations are separated by plus signs ("+"), for example, "Gly205Arg+Ser411Phe" or "G205R+S411F", indicating the substitution of glycine (G) at positions 205 and 411 with arginine (R), and the substitution of serine (S) with phenylalanine (F), respectively.

[0065] The term "sequence identity" refers to the degree of association between two amino acid sequences or two nucleotide sequences, described by the parameter "sequence identity". For the purposes of this invention, the sequence identity between two amino acid sequences can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) implemented in the Needleman program of the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (preferably version 5.0.0 or later). Parameters used may include, for example, a vacancy opening penalty of 10, a vacancy extension penalty of 0.5, and an EBLOSUM62 substitution matrix (the EMBOSS version of BLOSUM62). The output of "longest identity" marked by Nieder (obtained using the non-simplified (-nobrief) option) is used as the identity percentage and calculated as follows:

[0066] (Same residue x 100) / (Alignment length - total number of vacancies in alignment).

[0067] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanatory of the present invention, and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.

[0068] Unless otherwise stated, the raw materials and reagents used in the following examples are commercially available products or can be prepared by known methods.

[0069] Example 1: Construction of PKS-PamyL-Tn-T-TamyL recombinant plasmid

[0070] The amino acid sequence of the wild-type thermoprotease (hereinafter referred to as Tn) derived from Thermococcus nautili is shown in SEQ ID NO: 2. The amino acid sequence and codon-optimized nucleotide sequence of the Tn thermoprotease (hereinafter referred to as Tn-T) with 99 amino acids truncated from the C-terminal propeptide are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively. The amino acid sequence of the truncated propeptide is shown in SEQ ID NO: 5. The amino acid sequence of the mature peptide is shown in SEQ ID NO: 6.

[0071] The Tn-T gene (SEQ ID NO: 4) was expressed using the amyL gene promoter (as shown in SEQ ID NO: 7) and amyL gene terminator (as shown in SEQ ID NO: 8) of Bacillus licheniformis strain ATCC14580. The Tn-T gene was synthesized by Genscript.

[0072] The Tn-T Bacillus licheniformis integration plasmid PKS-PamyL-Tn-T-TamyL was generated using the following method:

[0073] The pYF-tsDE plasmid was constructed using this plasmid as its backbone. pYF-tsDE is a thermosensitive E. coli / B. licheniformis shuttle plasmid. This plasmid consists of a temperature-sensitive origin of replication (active at 30°C) and an erythromycin resistance gene (ErmC), which provides resistance of 300 μg / ml in E. coli and 5 μg / ml in B. licheniformis. At 37°C, the origin of replication on the plasmid was inactivated, and the plasmid was integrated into the designated site in the host bacterial genome, followed by screening using ErmC. This plasmid was constructed by Genscript, and its nucleotide sequence is shown in SEQ ID NO: 9.

[0074] The pYF-tsDE plasmid was linearized using SpeI-EcoRI, and the 3768 bp fragment was recovered by gel electrophoresis. Using genomic DNA from Bacillus licheniformis strain ATCC14580 as a template, the upstream homologous arm of amyL (abbreviated as amyL-5', its nucleotide sequence is shown in SEQ ID NO: 10) was amplified using primers amyL-5′-F and amyL-5'-R, and the PCR product size was 852 bp. The downstream homologous arm of amyL (abbreviated as amyL-3', its nucleotide sequence is shown in SEQ ID NO: 10) was amplified using primers amyL-3′-F and amyL-3'-R, and the nucleotide sequence is shown in SEQ ID NO: 10. The PCR product size was 852 bp (as shown in SEQ ID NO: 11). Using Tn-F and Tn-R as primers, the Tn-T gene fragment was amplified using the Tn-T gene synthesis plasmid as a template, resulting in a PCR product size of 1784 bp. The four fragments (3768 bp, 852 bp, 852 bp, and 1784 bp) were then recombined using CloneZ recombinase (manufactured by Genscript), resulting in a plasmid named PKS-PamyL-Tn-T-TamyL (its nucleotide sequence is shown in SEQ ID NO: 12, and the plasmid map is shown in Figure 1). The nucleotide sequences of the relevant primers are shown in Table 1. The amyL promoter is located at the end of the amyL-5' fragment and is directly linked to the Tn-T gene with the signal peptide removed. The amyL terminator is located at the beginning of the amyL-3' fragment and is linked to the terminator of the Tn-T gene.

[0075] Table 1: Primer names and sequences for constructing the PKS-PamyL-Tn-T-TamyL plasmid

[0076] Example 2: Construction of recombinant plasmid using pfuS thermoprotease propeptide to replace Tn-T thermoprotease propeptide

[0077] The Tn-T thermoprotease precursor pfuS (hereinafter referred to as propfuS, whose amino acid sequence is shown in SEQ ID NO: 13) derived from Pyrococcus furiosus was used to replace the Tn-T thermoprotease precursor and fused with the mature Tn-T peptide for expression (the amino acid sequence after fusion is shown in SEQ ID NO: 14). The construction process of the recombinant plasmid PKS-PamyL-propfuS-Tn-T-TamyL is as follows:

[0078] The pYF-tsDE plasmid was linearized using SpeI-EcoRI, and the 3768 bp fragment was recovered by gel electrophoresis. The amyL-5' homologous arm fragment and the amyL-3' homologous arm fragment were prepared using the same method as in Example 1. Using propfuS-F and Tn-R as primers, the propfuS-Tn-T gene fragment was amplified using the propfuS-Tn-T gene synthesis plasmid (manufactured by Genscript) as a template. The PCR product size was 1703 bp. The above four fragments of 3768 bp, 852 bp, 852 bp, and 1703 bp were recombined with CloneZ recombinase (manufactured by Genscript) to obtain a plasmid named PKS-PamyL-propfuS-Tn-T-TamyL (its nucleotide sequence is shown in SEQ ID NO: 15, and the plasmid map is shown in Figure 2). The relevant primer sequences are shown in Table 2.

[0079] Table 2: Primer sequences related to the construction of PKS-PamyL-propfuS-Tn-T-TamyL plasmid

[0080] Example 3: Construction of recombinant plasmid using propfuS mutant to replace Tn-T thermoprotease propeptide

[0081] The construction process of the propfuS mutant recombinant plasmids PKS-PamyL-propfuSM1-Tn-T-TamyL, PKS-PamyL-propfuSM2-Tn-T-TamyL, PKS-PamyL-propfuSM3-Tn-T-TamyL, and PKS-PamyL-propfuSM4-Tn-T-TamyL is similar to that of the PKS-PamyL-propfuS-Tn-T-TamyL plasmid. The gene synthesis plasmids for the propfuSM1-Tn-T, propfuSM2-Tn-T, propfuSM3-Tn-T, and propfuSM4-Tn-T fragments were all produced by Genscript. Using pfuS-F and Tn-R as primers, PCR was performed with propfuSM1-Tn-T, propfuSM2-Tn-T, propfuSM3-Tn-T, and propfuSM4-Tn-T as templates to obtain mutant gene fragments of M1, M2, M3, and M4, each 1703 bp in size. The M1-M4 fragments were then recombined with the aforementioned 3768 bp, 852 bp, and 852 bp fragments to obtain recombinant plasmids PKS-PamyL-propfuSM1-Tn-T-TamyL, PKS-PamyL-propfuSM2-Tn-T-TamyL, PKS-PamyL-propfuSM3-Tn-T-TamyL, and PKS-PamyL-propfuSM4-Tn-T-TamyL.

[0082] Table 3 shows the mutation site information of the propfuSM1-propfuSM4 mutant (whose amino acid sequences are shown in SEQ ID NO: 16-19) relative to the amino acid sequence of the wild-type propeptide of *Streptococcus viridissicae* pfuS thermoprotease (SEQ ID NO: 13).

[0083] Table 3: PropfuSM1-PropfuSM4 mutant site information

[0084] Example 4: Construction of Bacillus licheniformis expression strain

[0085] The experimental host bacterium was *Bacillus licheniformis* strain ATCC-14580A3 (with two protease genes and one sporulation-related gene deleted). Six plasmids (PKS-PamyL-Tn-T-TamyL, PKS-PamyL-propfuS-Tn-T-TamyL, PKS-PamyL-propfuSM1-Tn-T-TamyL, PKS-PamyL-propfuSM2-Tn-T-TamyL, PKS-PamyL-propfuSM2, PKS-PamyL-propfuSM1, PKS-PamyL-propfuSM2 ... SM3-Tn-T-TamyL and PKS-PamyL-propfuSM4-Tn-T-TamyL were transformed into ATCC14580Δ3 competent cells by electroporation. The electroporated bacterial cultures were plated on LB agar plates containing erythromycin (5 μg / ml) (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 20 g / L agar) and cultured at 30°C for 2 days. The positive clones that grew on the plates were then transferred to 37°C for culture to allow the temperature-sensitive plasmid to integrate into the host genome. To ensure gene substitution at the designated sites, several clones were simultaneously inoculated into LB liquid medium and cultured continuously for 24 hours before being subcultured again. This process was repeated 4-5 times. Transformants that grew normally on LB plates at 37°C but not on LB + erythromycin (5 μg / ml) plates were then verified by PCR and sequencing. Finally, the following strains were obtained: Tn-T, propfuS-Tn, propfuSM1-Tn, propfuSM2-Tn, propfuSM3-Tn, and propfuSM4-Tn.

[0086] Example 5: Shake-flask fermentation

[0087] The Tn-T strain, propfuS-Tn strain, propfuSM1-Tn strain, propfuSM2-Tn strain, propfuSM3-Tn strain, and propfuSM4-Tn strain obtained in Example 4 above were subjected to shake-flask fermentation. The experimental method is as follows: An appropriate amount of bacterial cells was picked and inoculated into a 250ml Erlenmeyer flask containing 50ml of LB liquid seed medium (formulation: 1% Tryptone, 0.5% Yeast extract, 1% NaCl), and cultured overnight at 37℃ and 220rpm. Then, 1% of the inoculum was inoculated into a 250ml Erlenmeyer flask containing 50ml of AKP fermentation medium (formulation: 10% glucose, 6% soybean meal, 1% anhydrous disodium hydrogen phosphate), and cultured at 37℃ and 220rpm for 144h. The fermentation broth was collected, centrifuged at 12000rpm for 10min, and the supernatant was collected. After sterilization by filtration through a 0.22μm filter membrane, the high-temperature protease activity of the filtrate was detected, and the filtrate was stored in a refrigerator at 4℃ for later use.

[0088] The activity of a high-temperature protease is defined as the amount of protease required to hydrolyze casein to produce 1 μg of tyrosine in 1 minute under conditions of pH 6.0 and 70℃, which is one unit of enzyme activity, denoted by "U".

[0089] The high-temperature protease activity was tested according to the alkaline protease preparation test method in GB 1886.174-2016 "National Food Safety Standard for Food Additives and Enzyme Preparations for Food Industry", with the reaction temperature adjusted to 70℃ and the pH adjusted to 6.0, while the rest remained unchanged.

[0090] Relative enzyme activity: The shake-flask fermentation activity value of the propfuS-Tn strain was defined as 100%. The relative enzyme activity of other strains refers to the ratio of the shake-flask enzyme activity of the strain to that of the propfuS-Tn strain, expressed as a percentage. The shake-flask fermentation results are shown in Table 4.

[0091] Table 4: Results of shake-flask fermentation

[0092] As shown in Table 4, the shake-flask results indicate that the Tn-T strains transformed with both the propeptide and mature peptide of the Tn-T thermoprotease could not express the Tn thermoprotease normally in Bacillus licheniformis. However, the propfuS-Tn strain, which uses a fusion expression of the pfuS thermoprotease propeptide and the mature Tn peptide, could successfully express the Tn thermoprotease in Bacillus licheniformis. Furthermore, point mutation of the pfuS propeptide further increased the Tn protease yield in the propfuSM1-Tn, propfuSM3-Tn, and propfuSM4-Tn strains. This is extremely significant for the commercial production of the Tn protease.

[0093] Example 6: Performance Test of Tn High-Temperature Protease

[0094] Corn flour and water were mixed in a certain proportion (dry matter concentration 32%), and the pH of the corn flour solution was adjusted to 4.8-5.2 with dilute sulfuric acid. One group was treated with 12 U / g amylase and 1 U / g pfuS thermoprotease, while the other group was treated with 12 U / g amylase and 1 U / g Tn thermoprotease. Both groups were mixed thoroughly and reacted in a 90℃ shaker water bath for 150 min. The liquefied solution was then cooled to room temperature, and the pH was adjusted to 4.0-4.5. Next, 150 U / g saccharifying enzyme, 320 ppm yeast, and 400 ppm urea were added to both groups, and the mixtures were reacted in a 32℃ water bath for 64-72 h. After the reaction, the alcohol content and residual total sugar of the fermented mash were measured. The alcohol content results are shown in Figure 3, and the residual total sugar results are shown in Figure 4.

[0095] As can be seen from the experimental results in Figures 3 and 4, the alcohol content and residual total sugar data of Tn high-temperature protease are comparable to those of pfuS high-temperature protease, which is commonly used in modern technology. This indicates that the two have similar application effects in ethanol production.

[0096] The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiments. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

[0097] The sequence information involved in this invention is as follows:

[0098] >SEQ ID NO: 1 (amino acid sequence of wild-type thermoprotein pfuS derived from *Cyclophorus virulentis*)

[0099] >SEQ ID NO: 2 (Tn amino acid sequence of wild-type thermoproteinase derived from Thermococcus nautilus)

[0100] (Italicized text represents the signal peptide sequence, underlined text represents the propeptide sequence, bold text represents the mature amino acid sequence, and the last part represents the C-terminal propeptide.)

[0101] >SEQ ID NO: 3 (C-terminally truncated Tn-T amino acid sequence of wild-type thermoprotease derived from Thermococcus nautiloides)

[0102] >SEQ ID NO: 4 (nucleotide sequence of wild-type thermoprotein Tn-T codon optimized by truncation at the C end)

[0103] >SEQ ID NO: 5 (Amino acid sequence of Tn precursor peptide of wild-type thermoprotease derived from Thermococcus nautilus)

[0104] >SEQ ID NO: 6 (Amino acid sequence of mature peptide Tn, a wild-type thermoprotease derived from Thermococcus nautilus)

[0105] >SEQ ID NO: 7 (DNA sequence of the amyL gene promoter in Bacillus licheniformis)

[0106] >SEQ ID NO: 8 (DNA sequence of the amyL gene terminator in Bacillus licheniformis)

[0107] >SEQ ID NO: 9 (pYF tsDE plasmid DNA sequence)

[0108] >SEQ ID NO: 10 (DNA sequence of amyL-5' upstream homologous arm of Bacillus licheniformis amyL)

[0109] >SEQ ID NO: 11 (DNA sequence of amyL-3' downstream homologous arm of Bacillus licheniformis amyL)

[0110] >SEQ ID NO: 12 PKS-PamyL-Tn-T-TamyL plasmid DNA sequence

[0111] >SEQ ID NO: 13 (Acid sequence of wild-type propeptide of *P. fusella fasciata* pfuS thermoprotease)

[0112] >SEQ ID NO: 14 (fusion amino acid sequence of pfuS thermoprotease precursor and Tn-T thermoprotease mature peptide)

[0113] >SEQ ID NO: 15 PKS-PamyL-propfuS-Tn-T-TamyL plasmid DNA sequence

[0114] >SEQ ID NO: 16 (Amino acid sequence of M1, a mutant of the thermoprotease propeptide from *P. fusella violaceum* pfuS)

[0115] >SEQ ID NO: 17 (Amino acid sequence of M2, a mutant of the thermoprotease propeptide from *P. fusella virosa* pfuS)

[0116] >SEQ ID NO: 18 (Amino acid sequence of M3, precursor peptide mutant of pfuS thermoprotease from *Streptococcus viridans*)

[0117] >SEQ ID NO: 19 (Amino acid sequence of M4 amino acid sequence of the thermoprotease precursor mutant of *P. fusella virosa* pfuS)

[0118] SEQ ID NO: 20 (primer amyL-5′-F)

[0119] >SEQ ID NO: 21 (Primer amyL-5′-R) gattctcctcccctttcaatgtgaaac

[0120] >SEQ ID NO: 22 (amyL-3′-F) aagagcagagaggacggatttcc

[0121] >SEQ ID NO: 23 (Primer amyL-3′-R)

[0122] >SEQ ID NO: 24 (Primer Tn-F) tacaatatcatatgtttcacattgaaaggggaggagaatcatgaaaaaatggggcatggttgttg

[0123] >SEQ ID NO: 25 (Primer Tn-R) aaaacggatttccttcaggaaatccgtcctctctgctcttttaaactgtaggttgaggttcaggttg

[0124] >SEQ ID NO: 26 (Primer propfuS-F) tacaatatcatatgtttcacattgaaaggggaggagaatcatggcacctgagaagaaagttgag

Claims

1. Methods for producing proteases, including: 1) Construct an expression vector comprising a polynucleotide encoding a mature peptide of the protease and a polynucleotide encoding a pfuS thermoprotease precursor or a mutant thereof, wherein the mature peptide of the protease has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID NO: 6; and 2) Introduce the expression vector into the host cell.

2. The method according to claim 1, wherein the pfuS thermoprotease precursor comprises the amino acid sequence shown in SEQ ID NO: 13, and the amino acid sequence of the pfuS thermoprotease precursor mutant has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID NO:

13.

3. The method according to claim 1 or 2, wherein the amino acid sequence of the pfuS thermoprotease precursor mutant comprises a mutation of at least one amino acid at positions 39, 66, 67, 68, 69, 98, 99, 101, 102, 105, 107, 108, and 109 compared to SEQ ID NO:

13.

4. The method according to any one of claims 1-3, wherein the amino acid sequence of the pfuS thermoprotease precursor mutant comprises at least one amino acid selected from V39I, Y66F, H67N, H67K, I68V, I69L, R98K, F99V, Q101E, E102L, K105T, T107S, V108A or S109G compared to SEQ ID NO:

13.

5. The method according to any one of claims 1-4, wherein the amino acid sequence of the pfuS thermoprotease precursor mutant, compared to SEQ ID NO: 13, comprises a mutant combination of any of the following amino acids: V39I+Y66F+R98K+Q101E+T107S; V39I+Y66F+H67N+R98K+Q101E+E102L+K105T+T107S+V108A; V39I+Y66F+H67K+I68V+I69L+R98K+F99V+Q101E+T107S+S109G; and V39I+Y66F+H67K+I68V+I69L+R98K+F99V+Q101E+T107S.

6. The method according to any one of claims 1-5, wherein the amino acid sequence of the pfuS thermoprotease precursor mutant comprises any one of SEQ ID NO: 16, 17, 18 and 19.

7. The method according to any one of claims 1-6, wherein the host cell is a Bacillus host cell.

8. The method according to any one of claims 1-7, wherein the host cell is selected from any one of the following groups: alkalophilic Bacillus, highland Bacillus, Bacillus amyloliquefaciens, Bacillus amyloliquefaciens subsp. plantarum, Bacillus brevis, Bacillus circulans, Bacillus clausti, Bacillus coagulans, Bacillus sturdier, Bacillus splendidus, Bacillus stenosis, Bacillus licheniformis, Bacillus megaterium, methyltrophic Bacillus, Bacillus brevis, Bacillus saforticus, thermophilic steatobacterium, Bacillus subtilis, and Bacillus thuringiensis.

9. The method according to any one of claims 1-8, wherein the host cell is Bacillus licheniformis or Bacillus subtilis.

10. The protease produced by the method of any one of claims 1-9.

11. A composition comprising the protease of claim 10.

12. The composition according to claim 11, further comprising at least one enzyme selected from the group consisting of amylase, saccharifying enzyme, pullulanase, phytase, lysozyme, catalase, cellulase, cutinase, halogenated peroxylase, lipase, mannanase, pectinase, xanthan gumase, and xyloglucanase.

13. The use of the protease of claim 10 or the composition of any one of claims 11-12 in the production of fermentation products.

14. The application according to claim 13, wherein the fermentation product is ethanol, glucose, amino acids or organic acids.

15. A method for producing a fermentation product, comprising obtaining the fermentation product using the protease of claim 10 or the composition of any one of claims 11-12; Preferably, the fermentation product is ethanol, glucose, amino acids, or organic acids.