"guide RNA and method of detection of sickle cell disease"

A CRISPR-based assay using guide RNA and Cas12b nuclease for SCD detection addresses the limitations of conventional methods by offering rapid and accurate genotyping in low-resource settings, enabling precise differentiation of SCD genotypes.

WO2026099887A1PCT designated stage Publication Date: 2026-05-15CRISPRBITS PTE LTD
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
PCT/IN2025/051732
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-11-05
Filing Date
2025-11-04
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Conventional methods for detecting Sickle Cell Disease (SCD) are lengthy, time-consuming, require advanced equipment, and skilled personnel, and struggle to accurately differentiate genetic variations, making them unsuitable for low-resource settings.

Method used

A CRISPR-based assay using guide RNA (gRNA) specifically targeting the rs334 SNP in the HBB gene, integrated with PCR amplification and Cas12b nuclease, enables rapid and accurate differentiation between wild-type, homozygous mutant, and heterozygous genotypes through fluorescence signal amplification or lateral flow assay.

Benefits of technology

The method provides a rapid, accurate, and user-friendly diagnostic tool for SCD detection, suitable for low-resource settings, capable of distinguishing between normal, diseased, and carrier genotypes with high precision.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000013_0001
    Figure IMGF000013_0001
  • Figure IMGF000020_0001
    Figure IMGF000020_0001
  • Figure IMGF000021_0001
    Figure IMGF000021_0001
Patent Text Reader

Abstract

The invention provides a guide RNA [gRNA], a kit, a composition, and a method for detecting genetic variations such as Sickle Cell Disease (SCD) and identifying carriers through an optimized point-of-care CRISPR-based assay. The gRNA detects SCD-specific nucleotide changes using distinct mixes for Haemoglobin A (HbA) and Haemoglobin S (HbS). The guide RNA with a plurality of SNP recognition sites is constructed through the mediation of hybridization chain reaction, where a plurality of Cas12b protein is combined. The guide RNA disclosed herein is capable of determining the wildtype, homozygous or heterozygous (carrier) state of sickle cell disease.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] “GUIDE RNA AND METHOD OF DETECTION OF SICKLE CELL DISEASE”

[0002] FIELD OF THE INVENTION

[0003] The present disclosure relates to the field of allele detection. Particularly, the present invention relates to guide RNA (gRNA) for specifically targeting single nucleotide variation in genes and a method for detection of such variation employing the guide RNA in a clustered short palindromic repeat (CRISPR) system. The invention further relates to a kit or a composition comprising the gRNA along with the components for CRISPR based detection. The invention further relates to a method of detection of Sickle Cell Disease (SCD).

[0004] BACKGROUND OF THE INVENTION

[0005] Sickle cell disease is a genetic disorder caused by mutations in hemoglobin genes, leading to a faulty hemoglobin protein, called hemoglobin S. Generally, sequencing is the most definitive and confirmatory technique for detecting exact nucleic acid changes and allele frequencies. Either NGS or Sanger which actually sequences the DNA is used to detect these changes. The majority of point-of-care tests are based on solubility testing etc., such as HPLC, isoelectric focusing to compare and examine alterations.

[0006] Conventional methods used for detection of Sickle Cell Disease (SCD) are lengthy, time consuming and complex. The existing diagnostic tests include PCR followed by gel electrophoresis and qPCR-based tests. Some known methods involve HPLC, Sickle SCAN, etc. Since the conventional methods are time consuming, they lead to delays in diagnosis, thereby impacting therapy or treatment of a disease condition. Moreover, these methods also require advanced equipment and skilled personnels, which are not easily available everywhere and specifically in low-resource settings. Additionally, it is difficult to accurately interpret the findings of these tests to identify specific genetic abnormalities. On the whole, existing technologies are challenging and have difficulties in differentiating genetic variations and the associated diseases.

[0007] Therefore, there is a dire need to develop a point-of-care method / assay for the diagnosis of Sickle Cell Disease (SCD). Currently, there is no commonly known CRISPR-based test for diagnosing SCD. The present invention addresses the above limitations and provides products and methods for detecting genotype variants, thereby diagnosing Sickle Cell Disease (SCD) and identifying carriers through an optimized and low resource setting lab test. The invention provides a CRISPR-based assay which is accurate, faster and is user friendly.

[0008] SUMMARY OF THE INVENTION

[0009] The present disclosure relates to a guide RNA or a fragment thereof capable of detecting a target nucleic acid or a genotype variant in a sample. Specifically, the present disclosure provides a guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2. The present disclosure provides a guide RNA for Cast 2 nuclease.

[0010] Further, the present invention provides a guide RNA useful in detecting sickle cell disease and carrier status. Particularly, the present invention provides a guide RNA that recognizes target nucleic acid comprising the SNP encoded by rs334 gene.

[0011] In some embodiment, the present disclosure provides a kit comprising a guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2, primer or a fragment thereof comprising SEQ ID No. 7 and 8 or a sequence having at least 85% identity to the SEQ ID No. 7 and 8, Cas 12 nuclease, fluorescent agent or a lateral flow strip along with an instruction manual.

[0012] In some embodiment, the present disclosure provides a composition comprising a guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2, primer or a fragment thereof comprising SEQ ID No. 7 and 8 or a sequence having at least 85% identity to the SEQ ID No. 7 and 8 and Cas 12 nuclease.

[0013] Preferably, the present disclosure provides a CRISPR-Cas-based nucleic acid detection system comprising the guide RNA and Cas 12 nuclease wherein the guide RNA is selected from SEQ ID No’s. 1-6 capable of directing Cas 12b nuclease to the site of edit followed by trans-cleavage. The present disclosure also describes a method for detecting a target nucleic acid or a genotype variant in a biological sample. The detection method of the invention is primarily a two-step method involving PCR amplification followed by CRISPR-Casl2 based trans-cleavage assay. More specifically, the method involves: taking a PCR and CRISPR reaction mixtures comprising of room temperature stable reagents using the kit or the guide RNA for genotyping the HBB gene in a biological sample;

[0014] Addition of the PCR product with the CRISPR reaction mixture and detecting the presence of the target nucleic acid or a genotype variant and / or level of the detectable signal.

[0015] BRIEF DESCRIPTION OF ACCOMPANYING DRAWINGS

[0016] The accompanying drawings, which are incorporated in and constitute a part of this disclosure, illustrate exemplary embodiments and together with the description, serve to explain the disclosed invention.

[0017] Figure 1 shows the variants of SNP, Primers, and CRISPR Guides, in accordance with the present invention.

[0018] Figure 2A-2F shows the results obtained using the guide RNA of the invention on various samples. Results showing that guides effectively distinguish between (a) wild type (WT) (b) homozygous mutant (SCD) and (c) heterozygous (Carrier) samples with high accuracy.

[0019] Figure 3 shows the results for Cast 2b trans-cleavage distinguishing between wild type (WT) (b) homozygous mutant (SCD) and (c) heterozygous (Carrier) samples with high accuracy.

[0020] Figure 4 shows evaluation of the Cast 2b trans-cleavage assay for detecting sickle cell disease (SCD) genotypes across various sample types. The analysis included two control HapMap samples with known genotypes, 28 blinded clinical samples (TS series), and 16 clinical samples (BG series) with disclosed genotypes verified by Sanger sequencing. The assay successfully distinguished between wildtype (WT), homozygous mutant (SCD) and heterozygous (Carrier) genotypes, demonstrating its high accuracy and reliability in genotypic differentiation.

[0021] Figure 5 shows the efficient detection of SCD genotypes using lateral flow assay.

[0022] Figure 6 shows the sequencing results of multiple actual SCD clinical samples for exon 1 of the HBB gene to depict the spread of genotypes, in accordance with the present invention.

[0023] Figure 7 shows a schematic representation of the assay for detection of the Sickle Cell Disease and trait.

[0024] Figure 8 shows a workflow of the detection assay of the invention using lyophilized reagents.

[0025] Figure 9 shows data establishing efficiency of the assay of the invention with equal precision over varied sample quantities.

[0026] Figure 10 shows data demonstrating analytical sensitivity of the PathCrisp Sickle-Detect assay of the invention. The figure shows robust and accurate detection of wildtype (N1-N3), homozygous SCD (Ml -M3) and heterozygous (carrier) (HT1-HT3) genotypes across multiple samples. Negative control (Det Neg) shows no detectable signal. Fluorescence intensity (RFU at 520 nm) demonstrates clear differentiation among the three genotypes across multiple samples.

[0027] Figure 11 shows data showing fold changes for representative clinical samples.

[0028] Figure 12 shows percent fluorescence signal change for HbA and HbS guides across 100 clinical samples.

[0029] Figure 13 shows a confusion matrix map comparing the detection assay of the invention with Sanger sequencing.

[0030] Figure 14 provides results showing intra-instrument precision of the detection assay of the invention when tested across different real time PCR platforms.

[0031] Figure 15 shows CRISPR Casl2b Trans-cleavage based detection of Sickle cell Genotypes.

[0032] Figure 16 shows results for detection assay performance tested across three lyophilization batches. Figure 17 shows results of stability studies of lyophilized reagents stored at 4°C and room temperature (RT).

[0033] Other embodiments, features, and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only. Since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from the detailed description, such changes and modifications are covered within the scope of the present invention.

[0034] DETAILED DESCRIPTION OF THE INVENTION

[0035] The details of one or more embodiments of the invention are set forth in the accompanying description below including specific details of the best mode contemplated by the inventors for carrying out the invention, by way of example. It will be apparent to one skilled in the art that the present invention may be practiced without limitation to these specific details.

[0036] The use of “comprise”, “comprises”, “comprising”, “contain”, “contains”, “containing”, “include”, “includes”, and “including” are not intended to be limiting. Particularly, the word “comprising” is intended to be used to cover within its ambit other possible components or ingredients or steps or features of an aspect or embodiment of the invention which are apparent to a skilled person after reading the present disclosure. The word “comprising” is intended to mean “including” but not necessarily “consisting of’ or “composed of.” It is to be understood that the description is exemplary and explanatory only, and is not restrictive.

[0037] It is noted that the examples given in the description below are intended to clarify the invention and are not intended to limit the invention to those examples per se. Except in the operating and comparative examples, or where otherwise explicitly indicated, all numbers in this description and claims indicating amounts of material or conditions of reaction, physical properties of materials and / or use are to be understood as modified by the word “about”. Numerical ranges expressed in the format "from x to y" or “between x to y” are understood to include x and y. When for a specific feature, multiple preferred ranges are described in the format "from x to y" or “between x to y”, it is understood that all ranges combining the different endpoints are also contemplated. Unless otherwise defined, scientific and technical terms used herein shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclatures utilized in connection with, and techniques of, such as cell and tissue culture, molecular biology described herein are those well-known and commonly used in the art.

[0038] The present invention aims to overcome the defects of the prior art and provides a guide RNA (gRNA), and a CRISPR-Cas based nucleic acid detection system for the detection of target nucleic acid or a genotype variant, particularly for the identification of SCD-associated mutations. The gRNA of the present invention has higher targeting efficiency, thereby resulting in detection of homozygous or heterozygous / carrier state of sickle cell disease with high accuracy. The term PathCrisp is used to refer to the components, kit, software and the assay of the invention.

[0039] The present inventors designed a guide RNA that specifically identifies rs334 SNP in HBB gene, even when rs713040 SNP is also present and distinguish between wild-type, sickle cell disease (SCD) mutant, heterozygous genotypes or a carrier state. By integrating Polymerase Chain Reaction (PCR) with CRISPR Casl2b technology, the present assay detects SCD-specific nucleotide changes using distinct mixes for Hemoglobin A (HbA) and Hemoglobin S (HbS). The present invention ensures accurate identification of normal, diseased and carrier genotypes of Sickle Cell Disease (SCD) via fluorescence signal amplification or lateral flow assay.

[0040] These and other aspects, features, and advantages of the invention will become apparent to those of ordinary skill in the art from a reading of the following detailed description and the appended claims.

[0041] In a specific embodiment, the present invention provides guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2.

[0042] In a preferred embodiment, the present invention provides guide RNA, wherein the sequence having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No’s 3- 6. The guide-RNAs of the invention are designed to achieve accurate and reliable Sickle Cell Disease (SCD) diagnosis. The inventors aimed to design a sequence which precisely identifies the target mutation (rs334) in HBB gene and where the downstream SNP mismatch will not interfere with the genotyping despite its overlap and proximity. The other SNP rs713040 is <15bp away from the rs334. Additionally, the distinction of 0, 1 and 2 alleles of the SCD SNP detection is maintained. Downstream SNP which overlaps with the guide would not interfere in the genotyping of rs334.

[0043] In a preferred embodiment, the guide RNA is capable of detecting single nucleotide polymorphism (SNP).

[0044] In another embodiment, the guide RNA is a guide for Cast 2 nuclease.

[0045] In a preferred embodiment, the guide RNA is a guide for Cast 2b nuclease.

[0046] In yet another preferred embodiment, the guide RNA finds application in detecting sickle cell disease, preferably sickle cell anemia.

[0047] In a preferred embodiment, the guide RNA is capable of determining homozygous or heterozygous or a carrier state of sickle cell disease.

[0048] In an embodiment, the guide RNA is capable of detecting sickle cell disease or Carrier status, preferably differentiating Sickle Cell Disease allele sequence from the wildtype allele sequence.

[0049] In yet another preferred embodiment, the guide RNA recognizes target nucleic acid comprising SNP and directs the Cast 2b nuclease for editing followed by trans-cleavage activity.

[0050] In a preferred embodiment, the target nucleic acid comprising the SNP is from the rs334 variant of the HBB gene.

[0051] The present invention also provides a composition comprising a guide RNA comprising SEQ ID No. 1 or SEQ ID No. 2 or a fragment thereof or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2, primer comprising SEQ ID No. 7 and 8 or a fragment thereof or a sequence having at least 85% identity to the SEQ ID No. 7 and 8, and Cas 12 nuclease. In another embodiment, components of the composition are lyophilized and stable at room temperature.

[0052] In a preferred embodiment, the sequence having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 is selected from sequences comprising SEQ ID No’s 3-6.

[0053] In a preferred embodiment, the Cast 2 nuclease is Cast 2b nuclease.

[0054] In yet another embodiment, the composition further comprises a fluorescent agent or components for colorimetric detection of nucleic acid by lateral flow assay.

[0055] The present invention also provides a kit comprising a guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2, primer or a fragment thereof comprising SEQ ID No. 7 and 8 or a sequence having at least 85% identity to the SEQ ID No. 7 and 8, Cas 12 nuclease, fluorescent agent or components for colorimetric detection of nucleic acid by a lateral flow strip along with an instruction manual.

[0056] In a preferred embodiment, the guide RNA having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No. 3- 6.

[0057] In another embodiment of the invention, the Cas 12 nuclease is Cas 12b nuclease. In yet another embodiment, the fluorescence agent is selected from a group comprising but not limiting to FAM, HEX, Cy5, Cy3 and combinations thereof.

[0058] In yet another embodiment, components of the kit are lyophilized and stable at room temperature.

[0059] In a specific embodiment, the kit comprises

[0060] Lyophilized PCR Mastermix

[0061] Lyophilized HbA Detection mix

[0062] Lyophilized HbS Detection mix

[0063] Positive control

[0064] Nuclease free water The present invention also provides a CRISPR-Cas-based nucleic acid detection system comprising the guide RNA and Cast 2 nuclease.

[0065] In an embodiment, the detection system of the invention comprises guide RNA represented by SEQ ID NO. 1 or 2 or a fragment thereof or a sequence having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2. The detection system of the invention may additionally comprise primers.

[0066] In a preferred embodiment, the CRISPR-Cas-based nucleic acid detection system comprising the guide RNA having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No’s 3 to 6.

[0067] In yet another embodiment of the invention, the Cast 2 nuclease is Cas 12b nuclease.

[0068] In another embodiment, the present invention provides a guide RNA selected from SEQ ID No’s. 1-6, wherein the guide RNA is capable of directing Cas 12b nuclease to the site of cis-cleavage.

[0069] The present invention also provides a method for detecting a target nucleic acid or a genotype variant, in a biological sample, said method comprising:

[0070] - taking CRISPR reaction mixture or the guide RNA for genotyping the HBB gene in a biological sample;

[0071] - contacting the biological sample with the CRISPR reaction mixture; and

[0072] - detecting the presence of the target SNP in the nucleic acid or a genotype variant with a detectable signal above a defined threshold.

[0073] In a specific embodiment, the invention provides an assay or a method for detection of SCD. The detection method of the invention is a two-step assay involving PCR amplification followed by CRISPR-Casl2 based trans-cleavage assay. The steps primarily comprises:

[0074] Step 1: PCR amplification - A region of the HBB gene that harbours the rs334 SNP is amplified using specific oligos. The resulting PCR amplicons are used as input template for the trans-cleavage assay Step 2: CRISPR-Casl2 based trans-cleavage assay - The PCR amplicons are subjected to trans-cleavage reactions containing two detection mixes (HbA and HbS detection mixes). HbA detection mix comprises of the HbA guide RNA that is specifically designed for the wildtype allele. HbS Detection mix comprises of the HbS guide RNA that is specifically designed for the homozygous (SCD) allele. The guide RNA’s bind to complementary target region and the Cast 2 enzyme binds to the guide RNA forming an RNP complex. Upon activation of this complex, the Cast 2 enzyme cleaves fluorescent reporter molecule producing a detectable fluorescence signal. Comparing fluorescence signals between HbA and HbS Detection mixes allows identification of wildtype, homozygous SCD and heterozygous (Carrier) genotypes.

[0075] In a specific embodiment, the detection method of the invention comprises:

[0076] (1) PCR amplification:

[0077] (i) Amplifying rs334 SNP harbouring gene using primer comprising SEQ ID No. 7 and 8 or a fragment thereof or a sequence having at least 85% identity thereof;

[0078] (2) CRISPR-Casl2 based trans-cleavage assay:

[0079] (i) Subjecting PCR amplicons to trans-cleavage reactions containing HbA and HbS detection mixes, the detection mixes comprising the guide RNA of SEQ ID No. 1 or SEQ ID No. 2 or a fragment thereof or a sequence having 85% identity thereof ; and

[0080] (ii) Comparing fluorescence signals between HbA and HbS detection mixes, allowing identification of wildtype, homozygous SCD and heterozygous (Carrier) genotypes.

[0081] In an embodiment, the assay results are analysed by a software. The software of the invention provides automated data analysis and genotype interpretation. The software classifies results as wildtype, heterozygous carrier, or homozygous (SCD) and generates standardized reports in the required format, such as in pdf format. In an exemplary embodiment, the detection assay of the invention is performed on various samples such as but not limited to buccal swab, blood, dried blood spot, extracted DNA.

[0082] In a specific exemplary embodiment, the detection assay of the method of detection of SCD of the invention comprises following steps:

[0083] Step 0: DNA Extraction from the samples such as but not limited to:

[0084] Buccal Swab: Collected swabs are resuspended in nuclease-free water, heated at 95 °C for 10 minutes, and 1 pL of the lysate is used for PCR.

[0085] Dried Blood Spot: Blood is applied to the FTA card and air-dried for 30 minutes. A 2-3 mm punch is resuspended in nuclease-free water, heated at 95 °C for 10 minutes, and 1 pL of the eluate is used for PCR.

[0086] Extracted DNA: DNA is extracted using standard kit protocols such as Qiagen, Thermo, Cambrian Biosciences etc.

[0087] Step 1 : PCR

[0088] 1. Adding 18 pL of nuclease-free water to each of the lyophilized PCR Master mix tubes.

[0089] 2. Ensuring the lyophilized cake is fully dissolved by tapping it gently.

[0090] 3. Adding 2-5 pL of template DNA to each reaction tube.

[0091] 4. Briefly vortexing and spinning down the tubes to collect the contents and ensure proper mixing.

[0092] 5. Including a Negative Test Control (NTC) by replacing the DNA template with 2-5 pL of Nuclease free water (NEW).

[0093] 6. Loading the tubes into the PCR machine and initiating the following thermal cycling program:

[0094] Step 2: CRISPR-based trans-cleavage assay:

[0095] 1. For each sample to be tested, add 48 pL of nuclease-free water (NFW) to one tube of the HbA Detection Mix and one tube of the HbS Detection Mix.

[0096] 2. Gently tapping the tubes to ensure complete dissolution of the lyophilized reagents.

[0097] 3. Adding 2 pL of PCR amplicon each to the HbA and HbS detection tube.

[0098] 4. Including a Negative Test Control (NTC) by replacing the PCR amplicon with 2 pL of NFW in a separate reaction for both HbA and HbS mixes.

[0099] 5. Vortexing briefly and spinning down the tubes to ensure proper mixing.

[0100] 6. Incubate the tubes at 60°C for 20 minutes and measure fluorescence (Excitation: 485 nm; Emission: 520 nm.)

[0101] 7. Importing the data file to the Web-based software for automated data analysis and report generation.

[0102] The assay of the invention is integrated with the web-based software for automated data analysis. The software accurately distinguishes wildtype, heterozygous carriers, and homozygous (SCD) samples, and generates customizable reports such as PDF reports per sample. With a user-friendly interface and guided workflow, users can seamlessly upload data (RFU values) from standard qPCR or fluorescence detection instruments and automatically obtain analyzed reports.

[0103] In an embodiment, the method of the present invention is the first instantiation of a CRISPR diagnostic test proposing to detect SNP with Cast 2b and clearly identifying heterozygous, homozygous and carrier state for SCD.

[0104] In yet another embodiment of the invention, the guide RNA is a guide for Cast 2 nuclease.

[0105] In a preferred embodiment of the invention, the Cas 12 nuclease is Cast 2b nuclease. In a preferred embodiment of the invention, the method is capable of detecting sickle cell disease (SCD), preferably sickle cell anaemia (SCA).

[0106] In a preferred embodiment of the invention, the method is capable of detecting sickle cell disease, preferably differentiating sickle cell anemia allele from the normal.

[0107] In yet another embodiment of the invention, the method determines the wildtype or homozygous or heterozygous (carrier) state of sickle cell disease.

[0108] In another preferred embodiment, the guide RNA recognizes target nucleic acid or a genotype variant comprising single nucleotide polymorphism [SNP] and directs the Cast 2b nuclease for editing followed by trans-cleavage activity.

[0109] In a more preferred embodiment, the guide RNA is specific for the rs334 gene.

[0110] In a specific embodiment, the present invention provides a method for detecting a target nucleic acid or a genotype variant for SCD in a biological sample, said method comprising:

[0111] > taking CRISPR Reaction Mixture by incorporating guide RNA (gRNA) specific to the HbA and HbS variants, which allows for precise target recognition by the Cast 2b enzyme; amplifying target nucleic acid containing the rs334 SNP using polymerase chain reaction (PCR) to generate adequate quantities for the CRISPR assay; and

[0112] > detecting the target nucleic acid or a genotype variant for SCD through a fluorescent signal or lateral flow strips.

[0113] In an embodiment of the present invention, the genomic DNA extracted from the biological sample is mixed with PCR reagents to produce the amplicon, which is subsequently combined with the CRISPR reaction mixture for effective target engagement.

[0114] In another embodiment of the present invention, the method effectively combines PCR with CRISPR technology, offering a rapid and accurate approach for genotyping the HBB gene variant, thereby improving the feasibility of point-of-care diagnostics. Figure 7 depicts a schematic workflow for the detection assay of the invention. The assay comprises the following steps (A) Sample collection (blood, buccal swab, saliva etc.); which is subjected to (B) Crude DNA extraction to obtain genomic DNA template; (C) PCR amplification using specific primers to amplify the HBB gene; (D) CRISPR - Cast 2b Trans- Cleavage Assay, wherein the guide RNA recognizes the DNA target; Upon activation, Cast 2b is activated to transcleave a FAM-labeled reporter molecule. (D) Detection is performed via either fluorescence readout or lateral flow assay, enabling the differentiation of wild type, SCD and Trait (Carrier).

[0115] Figure 8 shows an exemplary workflow of the detection assay of the present invention using lyophilized reagents. PCR amplification is carried out using the lyophilized PCR mix in a thermal cycler. The resulting amplicons are subjected to trans-cleavage reactions with lyophilized detection mixes containing guides of the invention designed specifically for wildtype and mutant samples. Fluorescence signals from each of the guides provide a read out, allowing the discrimination of wildtype, SCD and carrier samples.

[0116] The detection assay of the invention has high sensitivity and specificity. In an embodiment, the assay is capable of accurately detecting gene mutation even in very small quantities of the sample such as 5 ng / pl (Figure 9).

[0117] In an embodiment, the assay of the invention is capable of providing consistent results across various instruments, thereby making its application easy and user friendly. The assay shows intrainstrument precision (Figure 14).

[0118] The assay of the invention has been validated and is found to be compatible with:

[0119] 1. QuantStudio 3 (ABI)

[0120] 2. Rotor-Gene Q (Qiagen)

[0121] 3. CFX Opus 96 Dx (Bio-Rad)

[0122] 4. isoQuarkF2 / M4 (RevoSketch)

[0123] 5. Gentier Mini (IANLONG),

[0124] 6. eGGi (Winnoz) systems,

[0125] 7. Open Chai (DSS ImageTech),

[0126] 8. Infinite Mplex (Tecan), The essence of the invention therefore resides in the design of the guide RNA, which can specifically detect SCD mutants. The guide RNA of the present invention is capable of determining the homozygous or heterozygous or carrier state of sickle cell disease. Further, the preferred use of Cast 2b in the method of the invention allows for the use of an inherent PAM site already present in the gene sequence [Figure 1], The distance from the PAM, the choice of the Cas enzyme and the design of the guides altogether contribute to the invention.

[0127] The invention thus provides products and methods that has enhanced accuracy and speed in diagnosing diseases associated with genetic variations such as Sickle Cell Disease (SCD), improving diagnosis outcomes through quicker and more precise genetic testing in resource limited settings.

[0128] It is to be understood that the foregoing description has an illustrative purpose only and is in no way limiting to the invention. While considerable emphasis has been placed herein on particular features of this disclosure, it will be appreciated that various modifications can be made, and that many changes can be made in the preferred embodiments without departing from the principles of the disclosure. Those skilled in the art will recognize that the embodiments herein can be practiced with modification within the spirit and scope of the embodiments as described herein. Similarly, additional embodiments and features of the present disclosure will be apparent to one ordinary skilled in the art based upon the description provided herein.

[0129] Descriptions of well-known / conventional methods / steps and techniques are omitted so as to not unnecessarily obscure the embodiments herein. Further, the disclosure herein provides examples illustrating the above-described embodiments. In order to illustrate the embodiments of the present disclosure, certain aspects have been employed. The examples used herein for such illustration are intended merely to facilitate an understanding of ways in which the embodiments may be practiced and to further enable those skilled in the art to practice the embodiments. Accordingly, following examples should not be construed as limiting the scope of the embodiments herein. EXAMPLES

[0130] Example 1: Methods and Materials

[0131] Methods: i) CRISPR-Enhanced PCR Assay for Genotyping Sickle Cell Disease

[0132] This assay combines polymerase chain reaction (PCR) with CRISPR-based trans-cleavage to identify genotypes associated with sickle cell disease (SCD), specifically wildtype (WT), homozygous mutant (SCD), and heterozygous (Carrier) forms. Initially, the target DNA sequence containing the rs334 mutation is amplified using the PCR Mastermix, which provides the necessary DNA polymerase, buffer, deoxynucleotide triphosphates (dNTPs), and magnesium ions along with primers targeting the SCD locus, ensures efficient PCR amplification of the targeted sequences.

[0133] After PCR, two CRISPR detection mixtures are prepared:

[0134] • HbA Detection Mix: This includes a guide RNA targeting the HbA allele, the AapCasl2b enzyme, NEBuffer 2.0 and a FAM-labeled reporter probe.

[0135] • HbS Detection Mix: This contains a guide RNA specific to the HbS allele, the AapCasl2b enzyme, NEBuffer 2.0 and a separate FAM-labeled reporter probe.

[0136] Both detection mixes are incubated at room temperature for 10 minutes, after which the PCR amplicons are introduced to allow CRISPR-based target recognition and cleavage.

[0137] For fluorescence-based detection, a fluorescent reporter is used in the reaction. When the Casl2b enzyme cleaves the target DNA, there is trans-cleavage of the reporter molecule, thus releasing fluorescence signal, which varies in intensity depending on the genotype:

[0138] • High fluorescence for HbA indicates a wildtype (WT) genotype.

[0139] • High fluorescence for HbS indicates a homozygous mutant (SCD) genotype.

[0140] • Elevated fluorescence for both HbA and HbS indicates a heterozygous (Carrier) status. This method improves diagnostic precision by clearly differentiating between wiltype (WT), homoygus mutant (SCD) and Heterozygous (Carrier), AS, and SS genotypes, enabling prompt and accurate diagnosis crucial for managing sickle cell disease in clinical settings. ii) PCR-CRISPR Lateral Flow Assay for Precise Genotyping of Sickle Cell Disease

[0141] This assay combines PCR amplification, CRISPR-Casl2b trans-cleavage, and lateral flow detection to accurately differentiate among genotypes associated with sickle cell disease (SCD): wildtype (WT), homozygous mutant (SCD), and heterozygous (Carrier). The process starts with PCR amplification using PCR Mastermix which contains thermostable DNA polymerase, primers targeting the SCD locus, dNTPs, and magnesium ions to ensure efficient DNA amplification.

[0142] Following PCR, two unique CRISPR detection mixes are prepared:

[0143] • HbA Detection Mix: Includes a guide RNA targeting the HbA allele, AapCasl2b enzyme, NEBuffer 2.0 and biotin-labeled reporter probe.

[0144] • HbS Detection Mix: Contains a guide RNA specific to the HbS allele, AapCasl2b enzyme, NEBuffer 2.0 and biotin-labeled reporter probe.

[0145] Each detection mix is incubated at room temperature for 10 minutes, after which the PCR amplicons are added to enable allele-specific target recognition and cleavage by Casl2b. Upon successful cleavage, the biotin-labeled reporter is cleaved if the target allele (HbA or HbS) is detected.

[0146] For result interpretation, lateral flow strips are immersed in each reaction. These strips have gold- labeled anti-biotin antibodies that bind to the cleaved biotinylated reporters, producing a visual result:

[0147] • Two test lines (one for each of HbA and HbS) indicate an AS genotype.

[0148] • A single test line in either the HbA or HbS detection mix confirms a wildtype (WT), and homozygous mutant (SCDS) respectively.

[0149] This method provides a fast, visual, and reliable genotyping tool, ideal for clinical and point-of- care settings due to its minimal instrumentation requirements and straightforward result interpretation. iii) Lyophilized PCR-CRISPR Assay for Sickle Cell Disease Genotyping

[0150] We have developed a lyophilized PCR mix and detection reagents for Sickle Cell Disease (SCD) genotyping, including CRISPR-Casl2 guides targeting the HbA and HbS alleles. This lyophilized format enhances stability and reduces the need for cold storage, making it well-suited for deployment in resource-limited settings where refrigeration may be inconsistent.

[0151] Lyophilized PCR Mix

[0152] The lyophilized PCR mix contains all necessary reagents for DNA amplification, including Reaction buffer, PCR Mastermix, dNTPs, Magnesium ions and primers targeting the SCD locus.

[0153] These components are freeze-dried to increase shelf life and improve stability against temperature fluctuations. When ready for use, the mix is reconstituted with NFW and is immediately suitable for amplification in a thermal cycler. This streamlines preparation and reduces setup time in field and clinical applications.

[0154] Lyophilized Detection Reagents

[0155] After PCR amplification, the reaction proceeds to the CRISPR-Casl2b trans-cleavage detection phase. For this step, two distinct lyophilized detection mixes are prepared:

[0156] • HbA Detection Mix: Contains a CRISPR-Cas 12b enzyme, guide RNA specific to the HbA (wildtype) allele, NEBuffer 2.0 and biotin-labeled reporter probe.

[0157] • HbS Detection Mix: Contains a CRISPR-Casl2b enzyme, guide RNA specific to the HbS (mutant) allele, NEBuffer 2.0 and biotin-labeled reporter probe.

[0158] Once reconstituted, these detection mixes bind specifically to target sequences within the PCR- amplified product. The HbA and HbS mixes enable allele-specific cleavage and are capable of differentiating between wildtype, homozygous SCD (SS), and heterozygous AS carrier genotypes.

[0159] Fluorescence Readout The final step involves a fluorescence-based detection system. When Cas 12b cleaves the target DNA, the FAM-labeled reporter releases a detectable fluorescent signal, with distinct fluorescence intensities corresponding to each genotype:

[0160] • High fluorescence for HbA confirms a wildtype (WT) genotype.

[0161] • High fluorescence for HbS indicates a homozygous mutant (SCD) genotype.

[0162] • Elevated fluorescence for both HbA and HbS suggests a heterozygous (Carrier) status.

[0163] Key Benefits

[0164] This lyophilized assay format provides a rapid and accessible diagnostic solution for SCD genotyping, optimized for point-of-care use in underserved areas. It reduces cold chain dependence, enables easy transport and storage, and ensures a robust and reliable method for detecting SCD and carrier states, thus supporting timely diagnosis and disease management in resource-limited environments.

[0165] Materials:

[0166] Guide RNA and primers

[0167] SEQ ID No. 1 - 5’ TCCTCAGGAGTCAGCTGCAC 3’ (Casl2b_A3)

[0168] SEQ ID No. 2 - 5’ TCCACAGGAGTCAGCTGCAC 3’ (Casl2b_S3)

[0169] SEQ ID No. 3 - 5’ TCCTCAGGAGTCAGATGCAC 3’ (Casl2b_Al)

[0170] SEQ ID No. 4 - 5 ’ TCC AC AGGAGTC AGATGC AC 3 ’ (Cas 12b_S 1 )

[0171] SEQ ID No. 5 - 5 ’ TCCTCAGGAGAC AGATGC AC 3 ’ (Cas 12b_A2)

[0172] SEQ ID No. 6 - 5 ’ TCC AC AGGAGACAGATGCAC 3 ’ (Cas 12b_S2)

[0173] Example 2 - Detection of sickle cell disease (SCD) mutation (rs334) through Casl2b Trans¬

[0174] Cleavage Assay (fluorescence read out)

[0175] Materials and Equipment • Two control HapMap samples with known genotypes, 100 blinded clinical samples (TS series), with disclosed genotypes verified by Sanger sequencing.

[0176] • Reagents: o OneTaq HS 2X Master Mix with Standard Buffer (NEB, M0484S) / 5X Atlas GF Mastermix (DXBIDT(R2420) o Forward Primer (10 pM) o Reverse Primer (10 pM) o Template DNA (100 ng / pL) o Nuclease-Free Water (NFW) o Modified NEBuffer 2 (1 OX) o Guide RNA (HbA / HbS, 1 pM) o FAM Reporter (1 pM) o AapCas 12b Enzyme (1 pM)

[0177] • Consumables: o 1.5 mL microcentrifuge tubes o PCR tubes

[0178] • Equipment: o PCR machine o Vortex machine o Fluorescence reader

[0179] (I) Preparation of PCR master mix

[0180] • Preparing the PCR master mix for Trans-Cleavage assay, by mixing the components as given in Table 1 A and IB:

[0181] Table 1A: Components of the PCR master mix

[0182] • Aliquoting 24 pL of the mastermix into individual PCR tubes.

[0183] • Adding 1 pL of template DNA (100 ng / pL) to each tube.

[0184] • Gently vortexing the tubes and briefly centrifuging to collect the contents at the bottom.

[0185] • Loading the tubes into the PCR machine and initiating the following thermal profile as provided in Table 2.

[0186] Table IB: Components of the PCR master mix

[0187] • Aliquoting 18 pL of the mastermix into individual PCR tubes.

[0188] • Adding 2 pL of template DNA (100 ng / pL) to each tube.

[0189] • Gently vortexing the tubes and briefly centrifuging to collect the contents at the bottom.

[0190] • Loading the tubes into the PCR machine and initiating the following thermal profile as provided in Table 2A and 2B.

[0191] Table 2A

[0192] Table 2B

[0193] (II) Preparation of two detection mixes with HbA and HbS guide RNA

[0194] 1. Preparing two detection mixes: o One with HbA guide RNA o One with HbS guide RNA

[0195] The components listed in Table 3 below were used for the preparation of the detection mixes containing HbA and HbS guide RNA.

[0196] Table 3: Detection mix Composition

[0197] 2. Allowing the detection mixes to incubate at room temperature for 10 minutes to facilitate the formation of the ribonucleoprotein (RNP) complex.

[0198] 3. Transferring 48 pL of each detection mix into new PCR tubes.

[0199] 4. Adding 2 pL of the PCR amplicon to each of the two detection mixes.

[0200] 5. Briefly vortexing the tubes and spin down.

[0201] 6. Incubating the tubes for 20 minutes at 60°C to allow for the reaction to take place effectively.

[0202] (III) Fluorescence Data Acquisition

[0203] 1. After incubation, the tubes were placed in the fluorescence reader.

[0204] 2. Measured the end-point fluorescence using the following parameters: o Excitation wavelength: 485 nm o Emission wavelength: 520 nm

[0205] (IV) Results

[0206] Figure 3 highlights that Casl2b-based gRNA trans-cleavage works with high precision in distinguishing between the three genotypes i.e. homozygous wild type, homozygous mutant and heterozygous carrier. Trans-cleavage sensitivity for detecting specific genotypes was evaluated using individual genomic DNA samples representing distinct genotypes. Results in Table 4 confirm that Casl2b-based gRNA improves the quantitative assessment of allelic fraction with better precision as shown in Figure 2A- 2F. The guides were designed to ensure specific detection of the SCD SNP (rs334) without any interference from the nearby SNP (rs713040). Thorough examination of 100 blinded samples was conducted and the results indicate that the present assay was able to accurately identify all genotypes using a machine with fluorescent readout capability such as a qPCR machine. Additionally, the Cast 2b trans-cleavage assay demonstrated a high degree of reliability in distinguishing between wildtype (WT), homozygous mutant (SCD), and heterozygous (Carrier) samples with exceptional precision and high accuracy as shown in Figure 12.

[0207] Table 4: Results of the Casl2b - Trans-cleavage assay

[0208] Example 3- Detection of Sickle Cell Disease (SCD) through Casl2b Lateral Flow Assay

[0209] Materials and Equipment

[0210] Reagents:

[0211] • OneTaq HS 2X Master Mix (NEB, M0484S) / 5X Atlas GF Mastermix DXBIDT (R2420)

[0212] • Forward Primer (10 pM)

[0213] • Reverse Primer (10 pM)

[0214] • Template DNA (100 ng / pL)

[0215] • Nuclease-Free Water (NFW)

[0216] • Modified NEBuffer 2 ( 1 OX)

[0217] • Guide RNA (HbA / HbS, 1 pM)

[0218] • AapCas 12b Enzyme (1 pM)

[0219] • Reporter conjugated to gold nanoparticles (FAM-biotin)

[0220] Consumables:

[0221] • 1.5 mL microcentrifuge tubes

[0222] • PCR tubes

[0223] • Lateral flow strips (compatible with biotin-FAM detection) Equipment:

[0224] • PCR machine

[0225] • Vortex mixer

[0226] • Centrifuge

[0227] • Lateral flow strips

[0228] (I) Preparation of PCR master mix

[0229] 1. Preparing the PCR mastermix for each reaction using the following components as given in Table 5.

[0230] Table 5: Components of the PCR master mix

[0231] 2. Aliquoting 18 pL of the mastermix into PCR tubes.

[0232] 3. Adding 2 pL of template DNA (100 ng / pL) to each tube.

[0233] 4. Gently vortexing and briefly spin down the tubes.

[0234] 5. Placing the tubes in the PCR machine and using the following thermal cycling profile as provided in below Table 6:

[0235] Table 6: (II) Lateral Flow Assay Setup

[0236] 1 . Preparing two detection mixes: a. One with HbA guide RNA b. One with HbS guide RNA

[0237] Components defined in Table 7 are used to prepare the detection mixes.

[0238] Table 7: Details of the components to prepare detection mixes:

[0239] 2. Incubating the detection mixes at room temperature for 10 minutes to allow ribonucleoprotein (RNP) complex formation.

[0240] 3. Aliquoting 45 pL of each detection mix into new PCR tubes.

[0241] 4. Adding 5 pL of the PCR product (amplicon) to each detection mix.

[0242] 5. Briefly vortexing and spin down the tubes.

[0243] 6. Incubating the tubes at 60°C for 1 hour.

[0244] (Ill) Detection method by Lateral Flow Assay

[0245] 1. After the incubation, dipping the lateral flow strips directly into each reaction tube containing the trans-cleavage product.

[0246] 2. Allowing the strips to develop for 5-10 minutes at room temperature. (IV) Results

[0247] The results are provided in Figure 5 and below Table 8.

[0248] Table 8: Results of the Casllb - Lateral flow assay

[0249] The data points in the above table and figure 5 shows that the compatibility of the assay with lateral flow detection is a significant advancement, as it enables rapid visual interpretation without the need for specialized equipment. Additionally, the assay's ability to accurately differentiate between wildtype (WT), homozygous mutant (SCD), and heterozygous (Carrier) genotypes further enhances its practicality for field use. This descriptive feature highlights the effectiveness and versatility of the assay, making it a valuable tool in various settings.

[0250] Example 4 - Comparison of Genotype Concordance between Sanger Sequencing and Assay of the present invention for Sickle Cell Disease Detection

[0251] Table 9 provided below presents the genotype [Figure 6] results obtained for clinical samples using both Sanger sequencing and the assay of the present invention. The genotypes include wildtype (WT), homozygous mutant (SCD), and heterozygous (Carrier) for the HBB gene mutation (rs334), associated with sickle cell disease. Concordance indicates that both methods yielded the same genotype result, confirming the assay's reliability in accurate genotype determination.

[0252] Table 9

[0253] Example 5 - Reagents and detection assay

[0254] Table 10: Components of PCR mix.

[0255] The Detection assay of the invention is a two-step assay involving PCR amplification followed by CRISPR-Casl2 based trans-cleavage assay. Step 1: PCR amplification - A region of the HBB gene that harbours the rs334 SNP is amplified using specific oligonucleotides. The resulting PCR amplicons are used as input template for the trans-cleavage assay.

[0256] • The 5XAtlas GF Mastermix (DXBIDT) used for the PCR reaction is glycerol free and is compatible with lyophilization.

[0257] • An optimized excipient is included in the PCR master mix to preserve enzyme activity post - lyophilization. Optimized excipient can be a sugar component such as Trehalose, Sucrose and Mannitol or any other suitable excipient.

[0258] Liquid PCR Mastermix - Aliquot 18ul of the PCR mastermix to individual PCR tubes and add 2ul of genomic DNA (~100ng / pl)

[0259] Optimized PCR Thermal cycling conditions

[0260] The PCR cycling protocol takes about 50 minutes, thereby reducing the assay turnaround time.

[0261] Table 11: Optimized PCR thermal cycling conditions:

[0262] Reduction of PCR run time to 50 minutes is an improvement in assay efficiency, making the kit and the assay highly suitable for a point-of care and resource limited settings.

[0263] Step 2: CRISPR-Casl2 based trans-cleavage assay - The PCR amplicons are subjected to trans- cleavage reactions containing two detection mixes (HbA and HbS detection mixes). HbA detection mix comprises the HbA guide RNA that is specifically designed for the wildtype allele. HbS Detection mix comprises the HbS guide RNA that is specifically designed for the homozygous (SCD) allele. The guide RNA’s bind to complementary target regions and the Cast 2 enzyme binds to the guide RNA forming a RNP complex. Upon activation of this complex, the Cast 2 enzyme cleaves fluorescent reporter molecules producing a detectable fluorescence signal. Comparing fluorescence signals between HbA and HbS Detection mixes allows identification of wildtype, homozygous SCD and heterozygous (Carrier) genotypes. Detection mix composition

[0264] Table 12: Components of detection mix along with their required quantities.

[0265] The detection mixes were pre-incubated at room temperature for 10 minutes to enable ribonucleoprotein complex formation between Cast 2b and the guide RNA (HbA or HbS).

[0266] Liquid Detection (HbA / HbS) - Aliquot 48ul of the Detection mix to individual PCR tubes and add 2ul of PCR product

[0267] Lyophilized PCR Mastermix (HbA / HbS) - Resuspend the lyophilized Detection mix in 48ul NFW, add 2ul of PCR product

[0268] The tubes are incubated at 60°C for 20 minutes, thereby further reducing the assay time while retaining sensitivity of detection.

[0269] 1. Results

[0270] The assay has been validated on 100 clinical samples. As evident from the data in Table 13 below, all samples were accurately genotype called and were in concordance with Sanger sequencing data. 100% accuracy of the assay indicates the assay robustness and clinical applicability.

[0271] Table 13:

[0272] 2. Data Analysis using PathCrisp Software

[0273] After completion of the detection (trans-cleavage) reaction, fluorescence data is collected from a fluorescence plate reader or qPCR machine and uploaded into the PathCrisp software. PathCrisp software provides automated data analysis and genotype interpretation. The software classifies results as wildtype, heterozygous carrier, or homozygous (SCD) and generates standardized PDF reports.

[0274] Data Interpretation

[0275] The results are analyzed to determine the genotype of each sample using two parameters:

[0276] 1. Normalized RFU (Relative Fluorescence Units) of each probe (HbA and HbS)

[0277] 2. HbA / HbS RFU ratio per sample

[0278] For each sample, the fluorescence data is first normalized by subtracting the fluorescence value of the NTC from the fluorescence value of the test sample to eliminate background signal. The resulting values are then used to calculate the HbA / HbS ratio, which is used to assign the genotype.

[0279] Table 14: Results of genotype analysis

[0280] Example 6 - Studying the performance characteristics:

[0281] Kit Components and Required Materials:

[0282] Reagents and Consumables Supplied in the Kit

[0283] 1. Lyophilized PCR Mastermix

[0284] 2. Lyophilized HbA Detection mix

[0285] 3. Lyophilized HbS Detection mix

[0286] 4. Positive control

[0287] 5. Nuclease free water

[0288] Required Equipment

[0289] • PCR Machine

[0290] • Vortex Machine

[0291] • Mini Spin • Fluorescence reader (wavelength 485 nm excitation / 520 nm emission) including qPCR instruments

[0292] 6.1 - Limit of input for detection of genetic mutation

[0293] The detection assay of the invention using the specific guide RNAs and primers showed genotypespecific detection with genomic DNA inputs ranging from 5 ng / pl to 1000 ng / pl. NA12879 and NA16265 are human genomic DNA samples that were procured from the Corielle Institute. They are Gold-standard genomic DNA reference samples, NA12879 (wildtype; HbA / A) and NA16265 (homozygous SCD; HbS / S), obtained from the International HapMap / 1000 Genomes Project, and were used as controls for assay validation. These well-characterized samples served as benchmarks to assess the accuracy and specificity of the PathCrisp Sickle-Detect Kit.

[0294] The limit of detection for the detection assay of the invention was evaluated using serial dilutions of genomic DNA from wildtype (NA12879) and homozygous SCD (NA16265), CRISPR -Cas trans cleavage assay with HbA and HbS guides. The Fluorescence data from Cas 12b transcleavage assays using HbA guide (red) and HbS guide (blue) with serial dilutions of genomic DNA from wildtype (NA12879) and homozygous SCD (NA16265) ranging from 5ng / pl to lOOOng / ul along with no template control (Detection negative).

[0295] The wildtype sample yielded strong fluorescence signals with HbA guide and homozygous SCD sample yielded strong fluorescence signals with HbS guide across all ranges of input genomic DNA starting from 5 ng / pl to 1000 ng / pl (Figure 9). The data in Figure 9 makes it evident that the assay of the invention can reliably detect the mutation with input genomic DNA as low as 5 ng per reaction.

[0296] 6.2 - Analytical Sensitivity

[0297] The Detection assay of the invention demonstrated robust and accurate detection of wildtype, homozygous (SCD) and heterozygous (carrier) genotypes across multiple samples that were extracted from human blood. The differential fluorescence signals enable clear genotype discrimination at the DNA level, indicating robust analytical sensitivity The assay of the invention demonstrated robust detection of all three genotypes using genomic DNA as a template. Differential fluorescence signals were observed with HbA and HbS detection mixes, thus enabling accurate identification of wildtype, homozygous (SCD) and heterozygous samples (Carrier) (Figure 8). Figure 10 also shows data demonstrating analytical sensitivity of the assay of the invention. Detection of the genotypes was consistent across 100 samples, thus highlighting the assay’s analytical sensitivity and reliability.

[0298] 6.3 - Fold change analysis to classify the SCD genotype

[0299] To analyse fold change for each sample, the fluorescence data was first normalized by subtracting the fluorescence value of the NTC from the fluorescence value of the test sample to eliminate background signal (Figure 11). Three wildtype (Nl, N2, N3), three homozygous SCD (Ml, M2, M3) and three heterozygous carrier (HT1, HT2. HT3) samples were used to determine the fold change values (HbA / HbS). The resulting values are then used to calculate the HbA / HbS ratio, which is used to assign the genotype. Samples with HbA / HbS ratio greater than 2.0 were classified as wildtype, showing a strong fluorescence HbA signal and minimal signal for the HbS guide. Samples with ratios in the range 0.5-2.0 were classified as heterozygous carriers, where strong signals were observed in both HbA and HbS guides. And samples with a HbA / HbS ratio less than 0.5 were classified as homozygous SCD, and they had strong HbS signal and minimal signal with HbA guide. This HbA / HbS ratio based analysis enabled clear discrimination of all three genotypes accurately. Fold change analysis (HbA / HbS ratio) confirms genotypic specific detection.

[0300] 6.4 - Analytical Specificity:

[0301] The detection assay of the present invention demonstrates high specificity, thereby accurately distinguishing wildtype, homozygous (SCD) and heterozygous samples (Carrier). Tests on 100 clinical samples showed 100% concordance with Sanger sequencing.

[0302] A total of 100 clinical samples were tested, and 100% of the genotype data was in concordance with sanger sequencing results (Figure 12). Each bar in Figure 12 depicts the percent change in fluorescence signal for wildtype guide (HbA-red) and the mutant guide (HbS -blue) in individual clinical samples. The relative fluorescence change in the wildtype and mutant guides enables the discrimination between wildtype, homozygous (SCD) and heterozygous (carrier) samples. The results are provided in Table 15 below. Table 15:

[0303] The assay demonstrated high analytical specificity by accurately distinguishing wildtype, homozygous (SCD) and heterozygous samples (Carrier). The detection mix with the wildtype guide (HbA) showed strong fluorescence signals exclusively with wildtype samples, while the detection mix with mutant guide (HbS) showed strong fluorescence signals with homozygous (SCD) samples only. There was no cross reactivity across genotypes.

[0304] 6.5 - Clinical Sensitivity:

[0305] The detection assay of the invention demonstrates high clinical sensitivity, confirming its ability to reliably detect both homozygous and heterozygous sickle cell genotypes in patient samples.

[0306] Clinical sensitivity was tested using 100 clinical samples (36 wildtype, 25 heterozygous (carriers), and 39 homozygous mutant (SCD) and compared with sanger sequencing data, which is the gold standard. Of the 39 confirmed homozygous mutant (SCD) samples, 39 were correctly identified and hence the clinical Sensitivity for SS detection = 100%. All 25 heterozygous (carrier) samples were correctly identified and hence clinical Sensitivity for AS detection = 100%. Table 16 below provides the results of the assay.

[0307] Table 16:

[0308] The confusion matrix (Figure 13) illustrates the genotype calling of the detection assay compared with Sanger sequencing data. All 36 wildtype and 24 carrier samples and 40 SCD samples were accurately identified. This corresponds to the 100% sensitivity for wildtype and heterozygous (carrier) detection and 100% sensitivity for homozygous (SCD) detection, and an overall concordance of 100% with sanger sequencing data.

[0309] 6.6 Clinical Specificity:

[0310] The data in figure 13 also indicates that the detection assay of the invention accurately identifies wildtype samples as negative for sickle cell mutation, showing 100% concordance with sanger sequencing data.

[0311] False positive signals were not observed in wildtype samples, demonstrating that the assay reliably distinguishes unaffected individuals from carriers and SCD patients.

[0312] Example 7 - Precision / Reproducibility

[0313] 7.1 Testing the Intra- instrument precision:

[0314] The detection assay of the invention demonstrates intra instrument precision when tested across different real time PCR platforms (Gentier Mini, Tecan, Biorad, Agilent, Rotagene, and Quantstudio 3). The fold change (HbA / HbS) fell within the genotype ranges that were defined for wildtype, homozygous (SCD), and heterozygous (carrier) samples. This grouping of the genotypes based on fold change has been consistent and hence our assay is capable of generating stable and repeatable data under routine testing conditions (Figure 14).

[0315] 7.2 Inter Personnel Precision and Reproducibility:

[0316] The assay is assessed for the inter-personnel and reproducibility by having different operators independently perform the assay on the same clinical samples. Two operators were employed. Both the operators were able to call out all genotypes accurately.

[0317] 7.3 Reproducibility of Genotype calling using lyophilized reagents:

[0318] The same set of control samples were tested repeatedly with different batches of lyophilized reagents for PCR and Trans-cleavage. In all cases, the fluorescence signals for these control samples are consistently aligned with the expected fold change ranges for wildtype, homozygous (SCD) and heterozygous (carrier) genotypes (Figure 16). Figure 16 shows that the fluorescence signals for HbA (red) and HbS guides (blue) for wildtype, homozygous (SCD) and heterozygous (carrier) samples across three lyophilization batches showed consistent genotype differentiation and reproducibility. No variability in genotype calling was observed, confirming that the assay is stable across lyophilized batches. These observations also demonstrate that the lyophilization is robust and reproducible, delivering consistent results. These further support the suitability of the lyophilized format for routine clinical application, ensuring long term reagent stability without compromising on accuracy

[0319] The above data demonstrates robustness of the detection assay of the invention and its reproducibility across multiple experimental conditions. The assay was able to distinguish wildtype, homozygous (SCD) and heterozygous (carrier) samples accurately and consistently. The results were reproducible across different operators. Lyophilized reagents ensured long term stability while minimizing cold storage requirements. The results thus confirm that the assay is accurate, reliable and robust.

[0320] The assay also showed concordance with the gold standard, which is Sanger sequencing with clinical samples. The assay achieved 100% accuracy in identifying wildtype, homozygous (SCD) and heterozygous (carrier) samples. No false positives were detected indicating the specificity of the assay. The assay has a simple workflow, reagents are room temperature stable, compatible with multiple qPCR and fluorescence detection platforms. The assay can be deployed in both

[0321] 31 centralized laboratories and also at resource limited point of care settings. Hence, the assay is clinically relevant and is a confirmatory test to detect Sickle Cell Disease and the carrier status.

[0322] Example 8 - Stability study of Lyophilized reagents for detection assay

[0323] Lyophilized PCR and trans-cleavage reagents were stored at 4°C (top panel) and room temperature (RT) (bottom panel) for a period of 120 days (Figure 17) and tested at 14 days, 28 days, 63 days, 107 days and 120 days using control genomic DNA samples representing wildtype (NA12879, red), homozygous SCD (NA16265, blue) and heterozygous carrier (HT12, green) samples. Fluorescence readouts (emission at 520nm) was measured using HbA and HbS guides with genomic DNA samples representing wildtype (NA12879, red), homozygous SCD (NA16265, blue) and heterozygous carrier (HT12, green) genotypes.

[0324] The fluorescence signals remained within the expected range for each genotype across all time points that was tested. The results confirm that the lyophilized reagents are stable at both 4°C and room temperature (RT). This ensures that the performance of the assay is consistent and can be used for routine diagnostics and point of care applications without the need for cold chain storage (Figure 17).

[0325] The present invention has been particularly shown and described with reference to exemplary embodiments thereof. It is evident that many alternatives, modifications, and variations will be apparent to those skilled in the art in light of the above teachings. Accordingly, the spirit of the present invention should be understood in accordance with the claims set forth below, and all of its equivalents fall within the scope of the present invention.

[0326] Advantages of the invention:

[0327] 1. Precision and Specificity: The CRISPR-based assay of the present invention targets specific nucleotide changes with high precision, addressing effectively the variability and specificity issues faced by conventional methods. By integrating Polymerase Chain Reaction (PCR) with CRISPR Cast 2b technology, the present invention provides an assay that detects SCD-specific nucleotide changes using distinct mixes for Hemoglobin A (HbA) and Hemoglobin S (HbS). The assay of the present invention ensures accurate identification of normal, diseased, and carrier genotypes. Hence, the assay is clinically relevant and is a confirmatory test to detect Sickle Cell Disease and the carrier status. Turnaround Time: By combining PCR with CRISPR Casl2b and stable reagents stored at room temperature due to lyophilization, the assay of the present invention streamlines the diagnostic process, substantially leading to a possibility of testing in Primary Health Care units and closer to the point of need. This offers faster results compared to the traditional, multi-step methods in central labs which are difficult to scale up. Simplified Interpretation: The fluorescence-based readout of the present assay provides clear and easily interpretable results, simplifying result interpretation, reducing potential errors, and streamlining the diagnostic process compared to the more complex traditional methods. Point of care Application: The Present invention addresses the critical need of diagnosing Sickle Cell Disease (SCD) and identifying carriers through an optimized point-of-care assay which is accurate, faster and easier to understand. The present assay is optimized for point-of-care use in low-resource environments, making it more practical and accessible where resources are limited. Simple and Cost-effective: The synthesized guide RNA is simple, sensitive, and provides cost-effective detection of SCD. Precise detection of carrier genotypes: The method using specific guide RNA identifying the specific SNP is capable of precisely detecting carrier genotypes. Room temperature application of the detection assay: The detection assay or the method of the invention uses lyophilized PCR and trans-cleavage reagents, thus enabling operational and stability advantages. Lyophilization eliminates cold-chain transport, allows long term storage of the reagents and also reduces the risk of contamination. This lyophilized format helps in conducting the detection at room temperature and ensures the consistent performance of the detection assay across runs and also facilitates easy deployment in centralized laboratories and at resource limited point of care settings. Lyophilized reagents stable at room temperature: Room temperature stable lyophilized reagents makes the application of the assay user friendly and economically viable. It also provides that the assay can be deployed in both centralized laboratories and also at resource limited point of care settings.

Claims

Claims:

1. A guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2.

2. The guide RNA as claimed in claim 1 , wherein the sequence having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No’s 3- 6.

3. The guide RNA as claimed in claim 1, wherein the guide RNA is capable of detecting and differentiating single nucleotide polymorphism (SNP).

4. The guide RNA as claimed in claim 1, wherein the guide RNA is a guide for Cast 2 nuclease.

5. The guide RNA as claimed in claim 4, wherein the guide RNA is a guide for Cast 2b nuclease.

6. The guide RNA as claimed in claim 1, wherein the guide RNA is capable of detecting sickle cell disease or carrier status, preferably differentiating Sickle Cell Disease allele sequence from the wildtype allele sequence.

7. The guide RNA as claimed in claim 6, wherein the guide RNA pair is capable of determining homozygous or heterozygous / carrier state of sickle cell disease.

8. The guide RNA as claimed in claim 7, wherein the guide RNA recognizes target nucleic acid comprising SNP and directs the Cast 2b nuclease for editing.

9. The guide RNA as claimed in claim 8, wherein the target nucleic acid comprising the SNP rs334 .

10. A composition comprising a guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2, primer or a fragment thereof comprising SEQ ID No. 7 and 8 or a sequence having at least 85% identity to the SEQ ID No. 7 and 8 and Cas 12 nuclease.

11. The composition as claimed in claim 10, wherein components of the composition are lyophilized and stable at room temperature12. The composition as claimed in claim 10, wherein the sequence having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No’s 3-6.

13. The composition as claimed in claim 10, wherein the Cas 12 nuclease is Cas 12b nuclease.

14. The composition as claimed in claim 10, wherein the composition further comprises a fluorescent agent or components for colorimetric detection of nucleic acid by lateral flow assay.

15. A kit comprising a guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2, primer or a fragment thereof comprising SEQ ID No. 7 and 8 or a sequence having at least 85% identity to the SEQ ID No. 7 and 8, Cas 12 nuclease, PCR Mastermix, fluorescent agent or colorimetric detection of nucleic acid by a lateral flow strip along with an instruction manual.

16. The kit as claimed in claim 15, wherein the guide RNA having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No’s 3- 6.

17. The kit as claimed in claim 16, wherein the Cas 12 nuclease is Cas 12b nuclease and the fluorescence agent is selected from a group comprising FAM, HEX, Cy5, Cy3 and combination thereof.

18. The kit as claimed in claim 15, wherein components of the kit are lyophilized and stable at room temperature.

19. The kit as claimed in claim 18, wherein the kit comprises a sugar component such as Trehalose, Sucrose and Mannitol or any other suitable excipient.

20. A CRISPR-Cas-based nucleic acid detection system comprising the guide RNA as claimed in claim 1 and Cas 12 nuclease.

21. The CRISPR-Cas-based nucleic acid detection system as claimed in claim 20, wherein the guide RNA of claim 1 having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No’s 3- 6.

22. The CRISPR-Cas-based nucleic acid detection system as claimed in claim 20, wherein the Cas 12 nuclease is Cas 12b nuclease.

23. A guide RNA selected from SEQ ID No’s. 1-6, wherein the guide RNA is capable of directing Cas 12b nuclease to the site of cis-cleavage.

24. A method for detecting a target nucleic acid or a genotype variant to detect Sickle Cell Disease in a biological sample, said method comprising:(1) PCR amplification:(i) Amplifying rs334 SNP harbouring gene using primer comprising SEQ ID No. 7 and 8 or a fragment thereof or a sequence having at least 85% identity thereof;(2) CRISPR-Casl2 based trans-cleavage assay:(i) Subjecting PCR amplicons to trans-cleavage reactions containing HbA and HbS detection mixes, the detection mixes comprising the guide RNA of SEQ ID No. 1 or SEQ ID No. 2 or a fragment thereof or a sequence having 85% identity thereof; and(ii) Comparing fluorescence signals between HbA and HbS detection mixes, allowing identification of wildtype, homozygous SCD and heterozygous (Carrier) genotypes.

25. The method as claimed in claim 24, wherein the guide RNA is a guide for Cast 2 nuclease.

26. The method as claimed in claim 25, wherein the Cast 2 nuclease is Cast 2b nuclease.

27. The method as claimed in claim 24, wherein the method is capable of detecting sickle cell disease, preferably differentiating sickle cell anemia allele from the normal.

28. The method as claimed in claim 27, wherein the method determines wildtype, homozygous or heterozygous (carrier) state of sickle cell disease.

29. The method as claimed in claim 24, wherein the guide RNA recognizes target nucleic acid or a genotype variant comprising single nucleotide polymorphism [SNP] and directs the Cast 2b nuclease for cis - cleavage of the target.

30. The method as claimed in claim 29, wherein the guide RNA is specific for rs334 SNP.