Polynucleotide, vector, composition for treating hemophilia b, lipid nanoparticle, cell production method, and hemophilia b treatment method

A C>T mutation at the R338 site of the FIX protein using a base editing tool addresses the limitations of CRISPR-Cas9 and other genome editing technologies, enhancing FIX activity and treating a broad spectrum of hemophilia B patients effectively.

WO2026100298A1PCT designated stage Publication Date: 2026-05-15JICHI MEDICAL UNIVERSITY
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
JICHI MEDICAL UNIVERSITY
Filing Date
2025-10-14
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Current genome editing technologies for hemophilia B, such as CRISPR-Cas9, cause double-strand breaks leading to large deletions or translocations, and developing patient-specific therapies for each gene mutation is costly and time-consuming.

Method used

A polynucleotide sequence inducing a C>T mutation at the R338 site of the FIX protein, combined with a base editing tool, is used to enhance FIX activity through a universal genome editing approach.

Benefits of technology

The approach increases FIX activity significantly, offering a therapeutic effect for a wide range of hemophilia B patients, including mild, moderate, and even severe cases, with sustained efficacy and reduced side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JP2025036145_15052026_PF_FP_ABST
    Figure JP2025036145_15052026_PF_FP_ABST
Patent Text Reader

Abstract

Provided is a polynucleotide that enables genome editing to address a plurality of genetic mutations in hemophilia B. The polynucleotide includes a sequence that induces a change in the amino acid at the R338 site in a mature protein of human blood coagulation factor IX (FIX). The sequence may induce a C > T mutation. The sequence may be a guide RNA sequence for genome editing. The sequence may be any one or any combination of SEQ ID NOS: 1-3 in the Sequence Listing. In addition, a vector or a lipid nanoparticle, each containing the polynucleotide and a nucleotide editing tool, may be used. A composition for treating hemophilia B containing the vector or the lipid nanoparticle may also be provided.
Need to check novelty before this filing date? Find Prior Art

Description

Polynucleotide, vector, composition for treating hemophilia B, lipid nanoparticle, cell generation method, and method for treating hemophilia B

[0001] The present invention particularly relates to a polynucleotide, a vector, a composition for treating hemophilia B, a lipid nanoparticle, a cell generation method, and a method for treating hemophilia B.

[0002] Hemophilia B is a hemorrhagic disease caused by a genetic abnormality of blood coagulation factor IX (FIX). The incidence of hemophilia is estimated to be 1 in 1,333 male births, and the World Federation of Hemophilia estimates that there are approximately 400,000 hemophilia patients worldwide. Hemophilia is classified into mild, moderate, and severe based on FIX activity. Severe cases are those with FIX activity less than 1%, and mild or moderate cases are more common than severe cases. In recent years, the development of gene therapy for hemophilia has advanced rapidly, and some drugs have been approved in Europe and the United States. In addition, gene replacement therapy that delivers a functional coagulation factor gene to the liver has also been developed. However, this gene replacement therapy has problems such as being inapplicable to patients positive for neutralizing antibodies or inapplicable to children.

[0003] For this reason, treatment by genome editing using CRISPR-Cas9 that repairs abnormal genes possessed by patients has attracted attention. In this genome editing, Cas9 nuclease is used to recognize DNA bound to guide RNA (hereinafter referred to as "gRNA") and cleave the target gene. However, since Cas9 nuclease causes a double-strand break (hereinafter referred to as "DSB") in the target gene, there is a side effect that it may cause large deletions or translocations of chromosomes mainly by the repair mechanism of non-homologous end joining (NHEJ).

[0004] For this reason, in recent years, base editing technology has been developed as a genome editing technology that does not involve DSB. Referring to Patent Document 1, a typical genome editing technology that does not involve DSB, there is a method for modifying adenine at a target gene locus, in which (a) a Cpf1 nickase protein, (b) a guide RNA containing a guide sequence linked to a serial repeat sequence, and (c) an adenosine deaminase protein or its catalytic domain are delivered to the gene locus, and the adenosine deaminase protein or its catalytic domain deaminates adenine in the heteroduplex, thereby rewriting the point mutation.

[0005] Japanese Patent Publication No. 2023-123486

[0006] However, applying the technology described in Patent Document 1 to hemophilia B would require creating a different gRNA for each patient's gene mutation, which would be too costly and time-consuming, making it impractical.

[0007] This invention has been made in view of the above circumstances, and aims to solve the aforementioned problems and provide a polynucleotide capable of performing genome editing to address multiple gene mutations in hemophilia B.

[0008] The polynucleotide of the present invention is characterized by containing a sequence that induces an amino acid change at the R338 site of the mature protein of human blood coagulation factor IX (FIX). The polynucleotide of the present invention is characterized by the sequence inducing a C>T mutation. The polynucleotide of the present invention is characterized by the sequence in which a guide RNA sequence for genome editing is present. The polynucleotide of the present invention is characterized by the sequence in which any combination of the base sequences of SEQ ID NOs: 1 to 3 is present. The vector of the present invention is characterized by containing the polynucleotide and a base editing tool. The hemophilia B treatment composition of the present invention is characterized by containing the vector. The lipid nanoparticles of the present invention are characterized by containing the polynucleotide and a base editing tool. The hemophilia B treatment composition of the present invention is characterized by containing the lipid nanoparticles. The cell generation method of the present invention is characterized by introducing the polynucleotide and a base editing tool into selected cells taken from a hemophilia B patient outside the body to generate cells for the treatment of hemophilia B. The hemophilia B treatment method of the present invention is characterized by introducing the polynucleotide and a base editing tool.

[0009] According to the present invention, by including a sequence that induces a C>T mutation at the R338 site of the mature protein of human blood coagulation factor IX (FIX), it is possible to provide polynucleotides such as guide RNA for genome editing that correspond to multiple gene mutations in hemophilia B.

[0010] This is a diagram of the R338Q genome editing target site and the surrounding nucleotide and amino acid sequences according to Example 1 of the present invention. This is a graph showing the FIX activity in the supernatant of HEK293 cells into which human F9 cDNA has been introduced according to Example 1 of the present invention. This is a graph showing the FIX antigen in the supernatant of HEK293 cells into which human F9 cDNA has been introduced according to Example 1 of the present invention. This is a graph showing the FIX activity in the supernatant when human F9 cDNA is introduced into HEK293 cells containing each hemophilia point mutation according to Example 1 of the present invention. This is a graph showing the FIX antigen in the supernatant when human F9 cDNA is introduced into HEK293 cells containing each hemophilia point mutation according to Example 1 of the present invention. This is a diagram showing the sequence configuration of gRNA1 and gRNA2 according to Example 1 of the present invention. This is a graph showing the measurement results of DSB efficiency by T7 endonuclease assay using gRNA1 and gRNA2 according to Example 1 of the present invention. This is a diagram showing the analysis results of off-target sites by Guide-seq according to Example 1 of the present invention. This figure shows the results of off-target site analysis by Guide-seq according to Example 1 of the present invention. This figure shows the structure of a plasmid for selecting a base editor according to Example 1 of the present invention. This graph shows the efficiency of C>T mutation by each base editor according to Example 1 of the present invention. This graph shows bystander editing by each base editor according to Example 1 of the present invention. This graph shows gRNA-independent off-target editing by each base editor according to Example 1 of the present invention. This graph shows gRNA-independent off-target editing by each base editor according to Example 1 of the present invention. This graph shows gRNA-independent off-target editing by each base editor according to Example 1 of the present invention. This graph shows gRNA-independent off-target editing by each base editor according to Example 1 of the present invention. This graph shows gRNA-independent off-target editing by each base editor according to Example 1 of the present invention. This graph shows gRNA-independent off-target editing by each base editor according to Example 1 of the present invention. This is a conceptual diagram showing the structure of the AAV vector according to Example 1 of the present invention.This graph shows the results of evaluating the induction of C>T mutations around mRNA corresponding to the target sequence by the AAV vector according to Example 1 of the present invention using next-generation sequencing (NGS). This figure shows the frequency of base conversions other than C>T mutations at the target site by the AAV vector according to Example 1 of the present invention. This graph shows the ratio of FIX activity to FIX antigen when the AAV vector according to Example 1 of the present invention is introduced into cells. This graph shows the results of evaluating the efficiency of C>T mutations in mRNA around the target site by the introduction of the AAV vector according to Example 1 of the present invention using NGS. This is a conceptual diagram showing the gene structure of a knock-in mouse of human F9 mutant cDNA according to Example 1 of the present invention. This graph shows the FIX activity in the knock-in mouse according to Example 1 of the present invention. This graph shows the FIX antigen in the knock-in mouse according to Example 1 of the present invention. This is a conceptual diagram of the structure of the AAV vector introduced into the knock-in mouse according to Example 1 of the present invention and intravenous administration. This graph shows the FIX activity and antigen in plasma when the AAV vector is injected into the knock-in mouse according to Example 1 of the present invention. This graph shows the results of evaluating the efficiency of C>T mutations around the target site by NGS when an AAV vector was introduced into a knock-in mouse according to Example 1 of the present invention. This graph shows the percentage of C>T mutations in DNA obtained from each organ when an AAV vector was introduced into a knock-in mouse according to Example 1 of the present invention. This graph shows the frequency of C>T mutations and other conversions in liver DNA when an AAV vector was introduced into a knock-in mouse according to Example 1 of the present invention. This graph shows the increase in FIX activity after R338Q induction by an AAV vector in a knock-in mouse (c.1138G>A) according to Example 1 of the present invention. This graph shows the increase in FIX activity after R338Q induction by an AAV vector in a knock-in mouse (c.1300G>A) according to Example 1 of the present invention. This graph shows the increase in FIX activity after R338Q induction by an AAV vector in a knock-in mouse (c.1334C>T) according to Example 1 of the present invention. This graph shows the increase in FIX activity after R338Q induction by the AAV vector in a knock-in mouse (c.280G>A) according to Example 2 of the present invention.This graph shows the increase in FIX activity after R338Q induction by an AAV vector in a knock-in mouse (c. 364G>A) according to Example 2 of the present invention. This graph shows the efficiency of C>T mutation after R338Q induction by an AAV vector in a knock-in mouse (c. 1138G>A) according to Example 2 of the present invention. This graph shows the efficiency of C>T mutation after R338Q induction by an AAV vector in a knock-in mouse (c. 1300G>A) according to Example 2 of the present invention. This graph shows the efficiency of C>T mutation after R338Q induction by an AAV vector in a knock-in mouse (c. 1334C>T) according to Example 2 of the present invention. This graph shows the efficiency of C>T mutation after R338Q induction by an AAV vector in a knock-in mouse (c. 280G>A) according to Example 2 of the present invention. This graph shows the efficiency of C>T mutation after R338Q induction by AAV vector in the knock-in mouse (c.364G>A) according to Example 2 of the present invention. This graph shows the recovery of activated partial thromboplastin time in each knock-in mouse after R338Q induction by AAV vector according to Example 2 of the present invention. This heatmap shows the binding of wild-type peptide to HLA class II in in silico analysis of increased immunogenicity according to Example 2 of the present invention. This heatmap shows the binding of R338Q-inducing peptide to HLA class II in in silico analysis of increased immunogenicity according to Example 2 of the present invention. This graph shows the predicted binding affinity to HLA alleles in in silico analysis of increased immunogenicity according to Example 2 of the present invention.

[0011] <Embodiment> Hemophilia B is a hemorrhagic genetic disorder caused by an abnormality in the gene for coagulation factor IX (hereinafter referred to as "FIX"). While repairing pathological mutations in a patient's FIX gene through genome editing therapy using base editing is an ideal treatment goal for genetic diseases, it has not been practical to create a therapeutic drug for each patient's specific gene mutation. Therefore, in order to develop a base editing therapy targeting a wide range of hemophilia B patients, the inventors investigated whether base editing that induces gain-of-function mutations in FIX increases FIX activity and contributes to the treatment of hemophilia B.

[0012] As shown in Figure 1, the inventors conceived that cytosine base editing could induce R338Q, a Shanghai F9 mutant known to significantly enhance FIX activity by converting G to A at c.1151 of F9. Based on this, they designed a guide RNA (hereinafter referred to as "gRNA") targeting the same site in human FIX so that inducing a C>T mutation with nickase Cas9 conjugated with a deaminationase would result in a mutation where the amino acid of R338 changes from arginine (R) to glutamine (Q) (hereinafter simply referred to as "R338Q"). They then created an AAV vector expressing this gRNA and a base editing tool that induces the C>T mutation, and introduced it into HEK293 cells expressing human FIX cDNA. As a result, they successfully achieved a C>T conversion of over 60% at the target site, and the coagulation factor concentration in the supernatant increased sixfold. Furthermore, when a knock-in mouse with a patient-derived F9 mutant was established and the AAV vector was administered to the knock-in mouse, the FIX activity / antigen ratio increased threefold. When cell lines with various hemophilia mutations were established and the AAV vector was expressed in the same way, it was confirmed that similar increases in activity were obtained for multiple gene mutations, thus completing the present invention.

[0013] The following describes in detail the polynucleotide, vector, hemophilia B treatment composition, cell generation method, and hemophilia B treatment method according to this embodiment.

[0014] [Polynucleotide, vector, and composition for the treatment of hemophilia B] The polynucleotide according to this embodiment is characterized by containing a sequence that induces an amino acid change at the R338 site of the mature protein of human blood coagulation factor IX (FIX).

[0015] In this embodiment, the "polynucleotide" may be a synthetic polymer such as DNA (Deoxyribonucleic acid) and RNA (Ribonucleic acid), as well as PNA (Peptide nucleotide). Furthermore, the nucleic acid bases constituting this polynucleotide may include adenine (A), guanine (G), cytosine (C), thymine (T), uracil (U), and other modified or altered bases. These modified or altered bases also include bases altered or altered by RNA editing, methylated or acetylated bases, etc.

[0016] Furthermore, in this embodiment, this amino acid change may be a mutation resulting from a change in the genetic code (codon) in the sequence, for example, a mutation in which the amino acid at R338 changes from arginine (R) to glutamine (Q), leucine (L), or to another amino acid. Preferably, this amino acid mutation is one that can increase the FIX activity more than arginine (R). Moreover, the codons before and after R338 may or may not change, or not only base mutations but also frameshifts and the like may be permitted, in order to similarly increase the FIX activity.

[0017] More specifically, the polynucleotide according to this embodiment may include a sequence that induces a C>T mutation. This C>T mutation, similar to the R338Q mutation described above, changes the amino acid from arginine (R) to glutamine (Q), thereby enhancing FIX activity.

[0018] More specifically, the polynucleotides according to this embodiment may include gRNA sequences used in genome editing or other techniques for altering (editing) the sequence of a patient's genomic DNA.

[0019] In this embodiment, the gRNA sequence may be any one of Sequence IDs 1 to 3 of the sequence listing or any combination thereof. That is, the DNA sequence incorporated into the vector described later can be either "TAGATCGAAGACATGTGGCT" (Sequence ID 1) or "TAGATCGAAGACATGTGGTT" (Sequence ID 2) as gRNA1, or "AGATCGAAGACATGTGGTC" (Sequence ID 3) as gRNA2. In other words, a polynucleotide comprising this gRNA sequence can be used for base editing to induce the R338Q mutation for the treatment of hemophilia B, as will be described in detail later. As shown in Example 1 described later, these sequences are difficult for a person skilled in the art to select from in terms of specificity and side effects in R338Q base editing.

[0020] Furthermore, in this embodiment, genome editing can be performed using, for example, genome editing using CRISPR-Cas9 and its derivative technologies. In this case, it is preferable to use genome editing technologies that do not involve DSB, such as base editing, epigenome editing, and prime editing. In this case, it is possible to use nickas Cas9 and deaminationase (hereinafter referred to as "deaminase"), etc. By using nickas Cas9 and deaminase in this way, base editing from CoG to ToA (C>T mutation) and from AoT to GoC (A>G mutation) can be performed.

[0021] In this embodiment, the polynucleotide containing this gRNA sequence may be loaded into various plasmids or viral vectors. The viral vector may be constructed using viruses common to those skilled in the art, such as adenoviruses, adeno-associated viruses (AAVs), lentiviruses, and retroviruses. This embodiment describes an example using an AAV vector.

[0022] Furthermore, the viral vector according to this embodiment is characterized by comprising polynucleotides and a base editing tool. This base editing tool includes, for example, genes such as various enzymes and RNA used in genome editing technologies that do not involve DSBs. Specifically, it may include the above-mentioned nicasse Cas9 and deaminase genes. More specifically, as the base editing tool, for example, cytosine deaminase (hereinafter also referred to as "CBE") or adenine deaminase (hereinafter also referred to as "ABE") that performs base editing by C>T mutation can be used. For this CBE, any one or any combination of evoCDA1, YE1, BE4max, AncBE4, evoAPOBEC, TadCBED, and sdd7 can be used. Of these, as shown in Example 1 described later, evoCD1 is particularly suitable in terms of base editing efficiency, while TadCBEd is particularly suitable in terms of base editing efficiency and the low rate of off-site conversion (bystander editing, misconversion, side reactions).

[0023] Furthermore, as shown in Example 1 described later, the viral vector according to this embodiment may be provided with polynucleotides and genes constituting the base editing tool divided into any number. In other words, one or more arbitrary viral vector systems may be used. Example 1 described later describes an example using two AAV vector systems. It is also possible to use multiple different types of viral vectors.

[0024] Furthermore, the polynucleotide and base editing tool according to this embodiment may be provided using a nonviral drug delivery system (DDS). Specifically, as the DDS, it is possible to use lipid nanoparticles (LNPs) with a diameter of about 10 to 1000 nm, mainly composed of lipids, such as liposomes, especially cationic liposomes. That is, the LNP according to this embodiment may contain the polynucleotide containing the gRNA described above, and the base editing tool. This polynucleotide may be various plasmids or linear polynucleotides synthesized by PCR or the like. Also, within the LNP, the base editing tool may be contained in the form of mRNA or protein.

[0025] Furthermore, the hemophilia B therapeutic composition according to this embodiment may also contain the above-mentioned vector or LNP. That is, the hemophilia B therapeutic composition according to this embodiment may be provided containing the above-mentioned AAV vector (system) or LNP. More specifically, the hemophilia B therapeutic composition according to this embodiment may be configured to be administered to the patient's body by loading nickase Cas9, which has gRNA and a deaminationase that enables C>T mutation, onto an AAV vector or LNP.

[0026] Furthermore, the hemophilia B treatment composition according to the embodiment of the present invention may contain any formulation-acceptable carrier. This carrier may be, for example, a liposome carrier, colloidal gold particles, polypeptides, lipopolysaccharides, polysaccharides, lipid membranes, etc. Among these, it is preferable to use a carrier that improves the efficiency of genome editing and reduces side effects.

[0027] Furthermore, pharmaceutically acceptable carriers may include, for example, physiological saline, isotonic solutions containing glucose or other adjuvants, such as D-sorbitol, D-mannose, D-mannitol, sodium chloride, etc. It can also be administered with a suitable solubilizer, such as alcohol, specifically ethanol, polyalcohols, such as propylene glycol, polyethylene glycol, or nonionic surfactants, such as polysorbate 80™, HCO-50, etc. Appropriate excipients may also be included.

[0028] Furthermore, the hemophilia B treatment composition of this embodiment may contain a suitable pharmaceutically acceptable carrier in order to prepare a pharmaceutically acceptable carrier. This carrier may contain biocompatible materials such as silicone, collagen, or gelatin. The carrier may also be provided as an emulsion. In addition, it may contain any or any combination of pharmaceutical additives such as diluents, fragrances, preservatives, excipients, disintegrants, lubricants, binders, emulsifiers, and plasticizers.

[0029] The administration route of the hemophilia B treatment composition according to the present invention is not particularly limited, but may be mainly administered parenterally. Parenteral administration may include, for example, intravenous, intra-arterial, subcutaneous, intradermal, intramuscular, intraperitoneal, or direct administration to organs such as the liver. The hemophilia B treatment composition according to embodiments of the present invention may be formulated using a pharmacopoeia-acceptable carrier known in the art, as described above, in an administration form suitable for parenteral or oral administration.

[0030] When using the hemophilia B treatment composition according to the embodiment of the present invention for the above-mentioned treatment, the administration interval and dosage can be appropriately selected and changed according to various conditions such as the disease status and the condition of the subject. The single dose and number of administrations of the hemophilia B treatment composition according to the embodiment of the present invention can be appropriately selected and changed according to the purpose of administration, and further according to various conditions such as the patient's age and weight, symptoms and the severity of the disease. The number of administrations and duration may be just once, or it may be administered once to several times a day for several weeks, the condition of hemophilia B may be monitored, and depending on the condition, it may be administered again or repeatedly.

[0031] More specifically, if the hemophilia B treatment composition according to the embodiment of the present invention contains an AAV vector, an effect can be expected with a single administration. On the other hand, if it contains LNPs, transient expression of genome editing tools is possible, and repeated administration is possible. For this reason, for example, to avoid causing thrombosis due to excessively high coagulation factor activity, a low dose may be administered initially, and then a repeat dose may be administered to achieve appropriate coagulation factor activity, thereby further enhancing the effect.

[0032] In addition, the hemophilia B treatment composition according to this embodiment can be used in combination with other compositions. The composition of the present invention may be administered simultaneously with other compositions, or it may be administered at intervals, but the order of administration is not particularly limited. Furthermore, in the embodiments of the present invention, the period during which the disease is improved or alleviated is not particularly limited, but it may be a temporary improvement or alleviation, or it may be an improvement or alleviation for a certain period of time.

[0033] [Method for generating cells, method for treatment] Furthermore, the method for generating cells according to this embodiment is characterized by introducing the above-mentioned polynucleotides and base editing tools into cells extracted from a patient with hemophilia B and selected, thereby generating cells for the treatment of hemophilia B. More specifically, as regenerative medicine, in order to treat hemophilia B, including in humans, cells obtained from a patient with hemophilia B may be introduced with the polynucleotides and base editing tools according to this embodiment, and genome editing may be performed. In this case, instead of using the cells obtained from the patient as they are, other types of transformation may be performed, or cells converted into pluripotent stem cells by reprogramming may be used. Furthermore, these cells may be cells obtained from a library of pluripotent stem cells with similar HLA types.

[0034] Herein, the hemophilia B treatment method according to this embodiment may involve introducing polynucleotides and base editing tools into cells extracted and selected from a patient with hemophilia B. More specifically, in the treatment of hemophilia B according to this embodiment, it is possible to perform regenerative medicine using the cells for hemophilia B treatment described above.

[0035] In this case, for example, the genome-edited pluripotent stem cells of this embodiment are differentiated, then cultured for a specific period with the addition of a cell maturation agent to mature them. The matured cells can then be injected into organs such as the liver of patients with hemophilia B or other diseases, either as isolated cells or cell aggregates, to form cell sheets, tissues, or organs (hereinafter referred to as "cell sheets, etc.") for transplantation. These cell sheets, etc. may be created as single-layer or multi-layer sheets using culture equipment used by those skilled in the art and transplanted into the liver, etc., of hemophilia B patients. Furthermore, the genome-edited cells of this embodiment may be transformed into tissue and transplanted into other organs of hemophilia B patients. Moreover, it is possible to culture them using an appropriate carrier or to layer them using a 3D printer, etc., to create more organized cultures which can then be transplanted into hemophilia B patients as bioreactors. These carriers, culture substrates, and / or culture media can be made to contain the extracellular matrix of this embodiment.

[0036] Furthermore, in this regenerative medicine, cells whose genomes have been edited in vivo using the hemophilia B treatment composition according to this embodiment may be obtained and selected to generate pluripotent stem cells. In addition, the genome-edited cells of this embodiment can be used for various therapeutic applications other than regenerative medicine, such as the manufacture of artificial organs and the creation of cloned individuals.

[0037] Alternatively, the hemophilia B treatment method according to this embodiment may involve directly introducing polynucleotides and a base editing tool into the body of a patient with hemophilia B. In this case, hemophilia B may be treated by administering the above-described hemophilia B treatment composition to the patient.

[0038] In other words, the hemophilia B treatment composition according to the embodiment of the present invention can be used to treat hemophilia B in animals. These animals are not particularly limited and include mammals that develop the disease by translating proteins similar to human FIX. That is, in addition to treating humans, the hemophilia B treatment composition according to the embodiment of the present invention can also be used to treat diseases equivalent to hemophilia B in various animals, and to promote the growth of livestock, etc.

[0039] In addition, the composition for treating hemophilia B according to the embodiment of the present invention can also be used when generating FIX corresponding to R338Q using a part of the body of an animal or organs, tissues, etc. removed or discharged from an animal. Therefore, this "treatment" means treatment in a broad sense and is also applicable to bioreactors, culturing in model animals, culturing of cultured organs similar to human transplantation, etc.

[0040] Further, when the present invention is implemented in Japan, the treatment after the provision of the genome-edited cells and cultures obtained may be performed by a doctor. Therefore, the "animal" in the treatment method of the present invention may not include humans (Homo sapiens). On the other hand, in other countries, the definitions of "animal" and "treatment method" are not limited.

[0041] By configuring as described above, the following effects can be obtained. Genome editing has attracted attention as an innovative treatment method for genetic diseases. However, genome editing involving DSB has the possibility of genome toxicity such as large-scale deletions, chromosomal translocations, rearrangements, etc. Therefore, as a genome editing technology without DSB, base editing that can rewrite point mutations such as A>G, C>T has attracted attention.

[0042] On the other hand, hemophilia is a congenital hemorrhagic disease caused by mutations in the blood coagulation factor VIII or IX (FIX) gene (F9). The most common genetic mutation in hemophilia B is a single nucleotide mutation, which is considered a particularly promising target for base editing. However, it is not realistic to create a therapeutic drug for each gene mutation, and it has been difficult to prepare a therapeutic drug tailored to the mutation of each patient.

[0043] In contrast, the polynucleotide according to the present embodiment can induce a gain-of-function mutant of F9 by base editing of G:C to A:T in vivo, and improve the phenotypes of diseases having various mutants. That is, in order to apply to many hemophilia B patients, a gain-of-function mutation can be introduced into F9 through base editing.

[0044] Specifically, the polynucleotide according to the present embodiment enables C>T base editing targeting R338Q substitution in vivo. Thereby, a point mutation occurs at the R338 site of the mature protein of human FIX, and the FIX protein itself is genome-edited to R338Q, which is a highly active form by the point mutation.

[0045] Thereby, the composition for treating hemophilia B according to the present embodiment enables base editing treatment for a wide range of hemophilia B patients having various gene mutations.

[0046] More specifically, by base editing with the polynucleotide of the present embodiment, it becomes possible to increase FIX activity and promote blood coagulation. Thereby, the coagulation factor activity of mild or moderate patients can be increased. A therapeutic effect can be expected even in severe cases, that is, severe cases accompanied by so-called cross-reacting substances where coagulation factor antigen is present even though the coagulation factor activity is low. Actually, in Example 1 described later, the effectiveness has been proven in a knock-in mouse in which FIX activity is not detected but FIX antigen is expressed. More specifically, there is a possibility of providing a therapeutic effect to 70% or more of hemophilia B patients.

[0047] As a result, it becomes possible to treat many hemophilia patients. That is, the polynucleotide according to the present embodiment may be used for treatment by universal genome editing for hemophilia B.

[0048] In addition, the composition for treating hemophilia B according to the present embodiment provides a new concept of genome editing treatment for inducing a gain-of-function protein. That is, the concept of inducing a gain-of-function variant may be applicable to the treatment of other genetic diseases in the future and may become an important technology for the therapeutic application of genome editing.

[0049] Furthermore, clinical trials of in vivo genome editing for thalassemia, sickle cell disease, transthyretin amyloidosis, hereditary angioedema, and CEP290-related retinal degenerative disease are underway as conventional genome editing treatment methods. In addition, base editing targeting the reduction of LDL cholesterol is also underway for hyperlipidemia. These are genome editing therapies aimed at inducing gene deletions. However, these treatments could be replaced by RNAi, exon skipping, and antibody drugs.

[0050] However, since many genetic disorders are caused by single nucleotide mutations, RNAi, exon skipping, and antibody drugs were sometimes ineffective as alternatives.

[0051] In contrast, the polynucleotides according to this embodiment can treat diseases caused by single nucleotide mutations that cannot be replaced by other technologies as described above, by introducing gain-of-function mutations through base editing. Furthermore, as described above, a single therapeutic composition can enable genome editing therapy for many diseases.

[0052] Furthermore, this embodiment describes examples using either a viral vector or LNP to deliver polynucleotides and base editing tools into cells. These are highly safe as they have been used for delivering base editing tools in human clinical trials.

[0053] Furthermore, when an AAV vector was created that simply expressed a functional human FIX gene along with its promoter sequence, the AAV vector existed in the nucleus as a concatemer within the cell. As the cell proliferated, the vector was diluted, resulting in a loss of efficacy. Consequently, in childhood, when hepatocytes proliferate, the effects of conventional AAV gene therapy did not last long.

[0054] In contrast, the hemophilia B treatment composition according to this embodiment induces a single nucleotide mutation in the genome, thus providing sustained effects and enabling treatment even in the neonatal period.

[0055] In the embodiments described above, examples were given of using the polynucleotides according to this embodiment for genome editing, specifically for C>T base editing. However, other genome editing techniques, such as other base editing that alter amino acids, prime editing, knock-in, and homologous recombination that insert target genes, can also be applied.

[0056] Furthermore, the embodiments described above and Example 1 described later describe an example in which the hemophilia B treatment composition according to this embodiment is delivered to the liver. However, with the improvement of technology for delivering genome editing tools to various organs, it is also possible to treat mutations using base editing in other organs.

[0057] Furthermore, the hemophilia B treatment composition according to this embodiment can be used in combination with other compositions. The composition of the present invention may be administered, sprayed, applied, etc., simultaneously with other compositions.

[0058] In the following, polynucleotides, vectors, hemophilia B treatment compositions, etc., according to embodiments of the present invention will be described in more detail as examples based on specific experiments. However, these examples are merely illustrative and not limiting.

[0059] [Methods] (Plasmid Construction) The cDNA of human coagulation factor IX (FIX) was inserted into a pBApo-EF1α gene expression vector (Takara Bio) to express it in HEK293 cells. Each mutant was created by site-directed mutagenesis using PCR. The pX330 plasmid (Addgene; hereinafter simply referred to as "pX330") was used to transiently express SpCas9. The SpCas9-NG sequence, provided by Professor Nureki of the University of Tokyo, was introduced into pX330. The sequences of the base editing tools and the UGI (Uracil DNA Glycosylate Inhibitor) sequences were synthesized using VectorBuilder (Vector Builder, Inc.) or Twist Bioscience (Twist Bioscience, Inc.) and introduced into pX330 containing the nickase version of SpCas9 (D10A). The gRNA sequences were inserted into the BsaI site of pX330 after oligonucleotide annealing. The gRNA1 sequence is shown as Sequence ID No. 1, or as another example of the gRNA1 sequence with the base "g" at 1138 changed to the base "a" as Sequence ID No. 2, and the gRNA2 sequence is shown as Sequence ID No. 3. In addition, the sequences of Sites 3 to 6 of the R-loop are shown as Sequence IDs No. 4 to 7, respectively.

[0060] Next, gRNA sequences driven by the U6 promoter were inserted into pEX-A2-J2 (Eurofin Genomics) and pBluescript SK- (Stratagene). SaCas9 cDNA was codon-optimized using GenScript and then inserted into pcDNA3 plasmid (Thermo Fisher). D10A and N580A mutations were introduced by site-directed mutagenesis to create dead SaCas9. The gRNA sequences driven by the U6 promoter were prepared by Integrated DNA Technologies and inserted into pCDNA3 containing dead SaCas9. An intein-mediated split SpCas9 system was used to express the base editing tool in the AAV vector used for base editing. An expression cassette consisting of a promoter, SpCas9(D10A)-N-terminus, N-inteiin, SV40 polyA, and gRNA driven by a U6 promoter, or an expression cassette consisting of a promoter, C-inteiin, SpCas9-C-terminus, two UGI sequences, and SV40 polyA was introduced into a pAAV plasmid.

[0061] (Cell culture and plasmid transfection) AAVpro 293T cells (Takara Bio) and HEK293 cells (JCRB Cell Bank, #JCRB9068 293) were maintained in DMEM (Sigma-Aldrich) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific) and GlutaMAX (Thermo Fisher Scientific). Huh-7 cells (obtained from RIKEN BRC, #RCB1366) were cultured in RPMI 1640 (Sigma-Aldrich) supplemented with 10% fetal bovine serum and GlutaMAX (Thermo Fisher Scientific). Lipofectamine 3000 Reagent (Thermo Fisher Scientific) was used to transfect HEK293 cells with the specified plasmid, according to the manufacturer's instructions. To produce stably expressing clones, 400 μg / mL of G418 (Nacalai Tesque) was added to the culture medium after transfection. Vitamin K (5 μg / mL, menatetrenone, Eisai Co., Ltd.) was added to the culture medium 24 hours prior to collection to measure the FIX in the supernatant.

[0062] (Measurement of FIX activity and antigen) FIX activity (FIX) was measured using a one-step coagulation time assay with an automated coagulation analyzer (CS-1600, Sysmex). FIX antigen (FIX) in the supernatant was measured using an ELISA kit (VisuLizet® Factor IX Antigen Kit, Affinity Biologicals, Inc., Anster, Ontario, Canada). A proprietary ELISA method was used to detect hFIX in mouse plasma. Specifically, a microplate was coated with anti-human FIX antibody (CEDARLANE), blocked with 5% casein, and then diluted plasma samples were incubated at 37°C for 1 hour. Antigen binding was detected using anti-human FIX antibody (Affinity Biologicals) conjugated to horseradish peroxidase and ABTS microwell peroxidase substrate (Seracare). FIX levels in the supernatant were expressed as a percentage (%) based on normal human plasma. Changes in FIX levels in treated mice were shown as a percentage (%) compared to knock-in mice with wild-type human F9 cDNA.

[0063] (T7 Endonuclease Assay and Amplicon Sequencing) Genomic DNA was extracted using SimplePrep reagent for DNA (Takara Bio) or DNeasy Blood and Tissue Kit (Qiagen). Total RNA was isolated using RNeasy Mini Kit (Qiagen). cDNA was synthesized using the PrimeScript Real-Time Polymerase Chain Reaction (PCR) Kit (Takara Bio). To detect DSBs at target sites, DNA fragments were amplified using ExTaq DNA polymerase (Takara Bio) and treated with T7 endonuclease (Nippon Idenshi Co., Ltd.). DNA fragments were analyzed using a microchip electrophoresis system (MCE-202 MultiNA, Shimadzu Corporation). Where specified, PCR fragments were purified and size-selected using Sera-Mag Select beads (Cytiva). Purified amplicons were barcoded using NEBNext Multiplex Oligos for Illumina and amplified using a KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems). The sequences of these primers are shown in SEQ ID NOs. 8–17, respectively. Target amplicons were subjected to 300 bp paired-end sequencing using the Illumina NovaSeq 6000 system at the Research Institute for Microbial Diseases, Osaka University. The data was analyzed using CRISPResso2 (<URL="https: / / github.com / pinellollab / CRISPResso2">).

[0064] (Guide-seq) Guide-seq analysis was performed based on methods common to those skilled in the art. Briefly, HEK293 cells were transfected with double-stranded oligonucleotides (dsODN, 100 pmol) and pX330 500 ng using Nucleofector 4-D (Lonza). Genomic DNA was isolated using the DNeasy Blood and Tissue Kit (Qiagen). In each experiment, insertion of dsODN was confirmed by cleavage with NdeI. Genomic DNA was then fragmented with Covaris E220. The i5 (P5) sequence containing the Y adapter was ligated using the GenNext NGS Library Prep Kit (Toyobo). Subsequently, two PCR reactions were performed to add the i7 (P7) sequence. The library was subjected to 300 bp paired-end sequencing using Illumina Miseq. The data were analyzed using a GitHub code for Guide-seq. The primers and oligonucleotides used in the analysis were prepared in the same manner as is common to those skilled in the art. The sequences of the primers used in this Guide-seq analysis are shown in SEQ ID NOs. 26–48, respectively.

[0065] (AAV Vector Preparation) AAV6 and AAV8 were used for in vitro and in vivo assays. The AAV gene was packaged by triple plasmid transfection of AAVpro293T cells (Takara Bio). The AAV vector was purified from the transfected cells using ultracentrifugation. The titer of the AAV vector was quantified by quantitative PCR targeting the SV40 polyadenylation signal. The forward primer for this quantitative PCR is shown in SEQ ID NO: 18, the reverse primer in SEQ ID NO: 19, and the FAM probe sequence in SEQ ID NO: 20.

[0066] (Animal Experiments) All animal experiments were approved by the Animal Experiment Committee of Jichi Medical University and conducted in accordance with the committee's guidelines (permission number 23067-01). Animal care was carried out in accordance with the committee's guidelines and the ARRIVE guidelines. C57BL / 6 mice were purchased from Japan SLC (Shizuoka, Japan). The knock-in mouse expressing human F9 (hF9) cDNA with the R338L mutation (C57BL / 6-F9tm1.1(hF9_R338L)Tsuka, obtained from RIKEN BRC, #RBRC12089) was developed by gene targeting of ES cells.

[0067] Several C57BL / 6 mice expressing human F9 cDNA were created via Cas9-mediated genome editing. Initially, knock-in mice expressing wild-type human F9 (hF9) cDNA were created. The RiboNucleoProtein (RNP) complex consisted of SpCas9 protein (Alt-R S.p.HiFiCas9 Nuclease V3, Integrated DNA Technologies) and sgRNA (Integrated DNA Technologies) and ssODN donor (Alt-R HDR Donor Oligo, Integrated DNA Technologies). Technologies, Inc. was introduced into C57BL / 6-F9tm1.1(hF9_R338L)Tsuka homozygous embryos by electroporation (NEPA21, NepaGene). To produce c. 1138G>A, c. 1300G>A, and c. 1334C>T, C57BL / 6-F9tm1.1(hF9_R338L)Tsuka homozygous embryos were treated with AAV6 donor vector for homologous recombination, and then the RNP complex was introduced by electroporation. The gRNA, ssODN, and AAV vector sequences with reverse terminal repeats are shown in sequence numbers 21-25 of the sequence listing, respectively.

[0068] Mice were housed in isolators at a pathogen-free facility at Jichi Medical University, under conditions of 23°C ± 3°C and a 12-hour light-dark cycle. To collect plasma samples, mice were anesthetized with isoflurane (1%–3%), and blood was collected from the jugular vein using a 29G microsyringe (TERUMO) containing 1 / 10 (vol / vol) sodium citrate. Plasma was separated by centrifugation to remove platelets, frozen and stored at -80°C, and kept until analysis. In adult mice, the AAV vector was administered intravenously via the jugular vein. In neonatal mice, the AAV vector was administered intraperitoneally.

[0069] (Statistical Analysis) The number of independent biological samples or mice used in the experiments is detailed in the legend of the corresponding figures. Sample sizes are specified in these legends, and data are shown as mean ± SD. A two-tailed unpaised Student t-test was used for comparisons between two groups, and a one-way ANOVA with Dunnett or Tukey's multiple comparison test was used for comparisons between multiple groups. A p-value less than 0.05 was considered statistically significant. All statistical analyses were performed using GraphPad Prism version 10.3.1 (GraphPad Software).

[0070] [Results] (Increased FIX activity in hemophilia B variant by R338Q substitution) Gene therapy using adeno-associated virus (AAV) vectors was performed using the FIX Padua variant (R338L). FIX Padua was discovered in patients with familial thrombosis and exhibits eight times the activity compared to wild-type FIX. R338 is conserved in the evolutionary process of mammals, and amino acid substitutions at R338 are known to increase FIX activity. Therefore, the inventors focused on base editing at the R338 position with the aim of increasing FIX activity in in vivo base editing.

[0071] Figure 1 shows the genome editing target site in this embodiment 1, and the surrounding nucleotide and amino acid sequences.

[0072] The R338Q mutation can be induced by C>T base editing on the minus strand of c. 1151 in F9. Thus, the R338Q amino acid substitution is obtained by base editing from G to A at c. 1151. This corresponds to the FIX-Shanghai mutation, which causes thrombosis.

[0073] First, we compared the FIX activity of wild-type, R338Q, and R338L in HEK293 cells transformed with pcDNA3 expressing each human F9 cDNA.

[0074] Figure 2 shows the FIX activity (FIX:C) (%) in the supernatant of HEK293 cells transfected with pBApo-EF1α vectors expressing these FIX cDNAs. In the graph, "-" indicates the FIX activity of the comparative example Mock, "R338" indicates the wild type, "R338Q" indicates the R338Q substitution, and "R338L" indicates the R338L substitution. "***" indicates that P < 0.001 by Student's t-test.

[0075] As a result, R338Q and R338L were found to have four times and eight times the FIX activity of wild-type FIX, respectively.

[0076] Figure 3 shows the FIX antigen (FIX:Ag) (%) of the same HEK293 cells as in Figure 2. Compared to the wild type, FIX:Ag did not increase with the R338Q substitution, while it decreased with the R338L substitution. In other words, in hemophilia B with the R338Q mutation, FIX:C increased, but FIX:Ag did not.

[0077] Next, FIX mutants were created from mild and moderate forms of hemophilia B, and their FIX activity was compared in HEK293 cells with and without the introduction of R338Q. Table 1 below shows the FIX mutants used in Example 1:

[0078]

[0079] Figure 4 shows the results of measuring FIX activity (FIX:C) (%) in the supernatant when HEK293 cells containing the hemophilia point mutation shown in Table 1 were transfected with pBApo-EF1α expressing FIX cDNA. Figure 5 shows the results of measuring FIX antigen (FIX:Ag) (%) (%) in similar HEK293 cells. In both cases, the difference with and without R339Q substitution was compared. In the following graphs, asterisks indicate the results of a two-sided Student's t-test: "*" means P < 0.05, "**" means P < 0.01, "***" means P < 0.001, and ns means no significant difference.

[0080] As a result, introducing R338Q into several mutants increased FIX:C activity in the supernatant.

[0081] These data suggest that the introduction of R338Q via base editing may lead to increased FIX activity in many hemophilia B patients.

[0082] (Selection of a base editing tool for introducing R338Q) Next, in order to actually achieve base editing that results in R338Q, a suitable gRNA sequence and base editing tool were selected.

[0083] As shown in Figure 6, in this embodiment 1, two gRNA sequences (gRNA1 and gRNA2) were selected as gRNA sequences that induce the C>T mutation in human F9. Specifically, gRNAs containing NGG and NG sequences on the 3' side of the target site were selected. These NGG and NG sequences correspond to the PAM sequences of SpCas9 and SpCas9-NG, respectively. Furthermore, the target site was configured to be located on the 5' side, which is suitable for base editing from C to T by APOBEC.

[0084] To determine the gRNA sequence for introducing R338Q, the efficiency of double strand break (DSB) at the target site was compared in HEK293 cells using two gRNA sequences (gRNA1 and gRNA2) in combination with SpCas9 (Cas9-WT) or SpCas9-NG.

[0085] Figure 7 shows the results of a quantitative analysis of indel frequency, evaluated by the T7 endonuclease assay, in HEK293 cells transfected with pX330 incorporating SpCas9 or SpCas9-NG and gRNA1 or gRNA2. The vertical axis represents DSB (%).

[0086] As a result, the combination of gRNA1 and SpCas9 induced the most efficient DSB.

[0087] Next, we performed an analysis of off-target sites for SpCas9 and SpCa9-NG using Guide-seq analysis.

[0088] Figures 8A and 8B show the results of Guide-seq analysis of off-target sites in HEK293 cells transfected with pX330 containing gRNA1 along with dsODN. Results for three representative samples are shown. Figure 8A shows the results for SpCas9, and Figure 8B shows the results for SpCas9-NG. This off-target site analysis indicated that SpCas9 had fewer off-target sites compared to SpCas9-NG. Therefore, gRNA1 sequences and SpCas9 were selected for further analysis. As shown in Figure 6 above, C nucleotides were not present within the range where APOBEC reacted at the off-target sites.

[0089] Next, we selected a base editing tool suitable for introducing R338Q in F9.

[0090] First, we created pX330 (plasmids) expressing SpCas9 (D10A), which encodes evoCDA1, YE1, BE4max, AncBE4, evoAPOBEC, TadCBEd, and sdd7, respectively, which are base editing tools that convert G:C to A:T.

[0091] Figure 9 shows the gene structure of each plasmid. "CBE" indicates the location of the base editing tool.

[0092] Then, each plasmid containing the created base editing tool and the plasmid expressing gRNA1 was transfected into HEK293 cells that stably express wild-type human F9 (hFIX cDNA).

[0093] Furthermore, the efficiency of C to T conversion in mRNA around the F9 target site was evaluated using next-generation sequencing (NGS).

[0094] Figure 10 shows the percentage of C to T conversion efficiency (R338Q loci) for each base editing tool.

[0095] Figure 11 visualizes the editing of nucleotides other than the target nucleotide within the editable region (bystander editing).

[0096] As a result, evoCDA1 showed the most efficient base editing effect, but it was also found to have the most bystander editing in addition to the target.

[0097] Next, to further evaluate gRNA-independent off-target effects by base editors, an R-loop assay was used. Plasmids containing dead SaCas9 (D10A and H840A) and gRNA sequences (sites 3, 4, 5, and 6), and SpCas9 (D10A) conjugated with gRNA1 and base editing tools (TadCBEd, BE4max, evoCDA1) were introduced into HEK293 cells to induce R338Q.

[0098] Figures 12A to 12F show the results of evaluating gRNA-independent off-target effects. Figures 12A, 12B, and 12C show the percentage (%) of C>T editing induction of mRNA around the target site, as evaluated by NGS, for each base editing tool. In each figure, the horizontal axis represents the position from the target site. Figures 12D, 12E, and 12F show the frequency (%) of gRNA-independent off-target effects at sites 3, 4, 5, and 6 for each base editing tool. The horizontal axis represents the relative position of each site. As a result, TadCBE showed the least amount of gRNA-dependent off-target effects.

[0099] (Introduction of R338Q into cells) Next, the increase in FIX activity by base editing tools was investigated in vitro. Specifically, the gRNA1 sequence was introduced into HEK293 cells that stably express human F9 cDNA using a system of SpCas9 (D10A), the TadCBEd base editing tool or BE4max, and a double AAV6 vector expressing a UGI sequence.

[0100] Figure 13 shows a system consisting of two AAV vectors expressing BE4max or TadCBEd bound to SpCas9 (D10A) via intein-mediated protein splicing.

[0101] Figure 14 shows the results of evaluating the induction of C>T mutations around the mRNA corresponding to the target sequence using NGS in HEK293 cells expressing wild-type human F9 cDNA. The horizontal axis represents the position of the "C" base, and the vertical axis represents the C>T editing (conversion) rate (%).

[0102] As a result, when HEK293 cells expressing hFIX cDNA were transduced with the AAV6 vector, we successfully performed concentration-dependent base editing on the target site.

[0103] The base editing efficiency at the target site using TadCBEd was significantly higher than that using BE4max. With BE4max, some bystander editing was observed around the target site.

[0104] Figure 15 shows the frequency of base conversions other than C>T mutations at the target site. The average percentage of "no change," i.e., the unconverted state (amino acid "R"), was 17%, the percentage of C>T mutations (amino acid "Q") was 66%, and the percentage of C>G conversion (amino acid "P") was 14%. In other words, unexpected base editing (side reactions) was minimal.

[0105] Furthermore, we evaluated the increase in FIX activity and base editing efficiency in HEK293 cells expressing human F9 mutants derived from hemophilia B patients. First, we evaluated the increase in FIX activity by transducing SpCas9 (D10A) and AAV vectors expressing BE4max or TadCBed into HEK293 cells expressing wild-type human F9 cDNA and hemophilia B mutant F9 cDNA.

[0106] Figure 16 shows the increase in the ratio of FIX activity (FIX:C) to FIX antigen (FIX:Ag) (FIX:C / Ag) when the above-mentioned AAV vector was introduced into HEK293 cells expressing each human F9 mutant. The horizontal axis represents each mutant, and the vertical axis represents the increase in the ratio. Squares indicate results from BE4max, and triangles indicate results from TadCBEd.

[0107] Figure 17 shows the results of evaluating the efficiency of C>T mutations in mRNA around the target site using NGS. The horizontal axis represents each mutant, and the vertical axis represents the conversion rate of C>T. Squares represent results from BE4max, and triangles represent results from TadCBEd.

[0108] These results indicated that in each mutant, the conversion from C to T occurred, and FIX activity increased 2-3 times. This efficiency was higher with TadCBEd than with BE4max. Therefore, because TadCBEd was effective and had a lower bystander editing rate, we used TadCBEd for further in vivo experiments.

[0109] (Introduction of R338Q into mouse organisms) Next, to investigate the increase in FIX activity by a base editing tool in vivo, a knock-in mouse was created in which the cDNA of a human F9 mutant was expressed at the first codon of mouse F9. Specifically, an AAV8 vector was created and SpCas9 (D10A) and TadCBed were expressed, driven by the HCRhAAT chimeric promoter (enhancer element of the liver regulatory region of the Apo E / C1 gene and human antitrypsin promoter).

[0110] Figure 18 shows the genome structure when the F9 gene is knocked in for the establishment of a human F9 mutant cDNA knock-in mouse.

[0111] Figure 19 shows the FIX activity (FIX:C) (%) in knock-in mice. The results are shown for the wild-type comparative example (Wild), mice with the "1138G>A" mutation introduced, mice with the "1300G>A" mutation introduced, and mice with the "1334C>T" mutation introduced.

[0112] Figure 20 shows the percentage of FIX antigen (FIX:Ag).

[0113] Next, we measured the increase in FIX activity in neonatal mice using AAV vectors equipped with a base editing tool.

[0114] In these knock-in mice, we measured the increase in FIX activity by AAV vectors equipped with base editing tools. Specifically, knock-in mice expressing human F9 mutant cDNA were intravenously administered (1 × 10¹⁶) two AAV8 vectors expressing SpCas9 (D10A), TadCBEd, UGI sequence, and gRNA1. 12 The drug was administered intravenously (μg / body). Intravenous administration resulted in efficient and specific in vivo expression of the target gene. FIX activity and antigen were examined after injection.

[0115] Specifically, knock-in neonatal mice expressing the aforementioned human hemophilia B mutant F9 cDNA were administered intraperitoneally (3 × 10¹⁶) two AAV8 vectors expressing SpCas9 (D10A), TadCBEd, and UGI sequences. 11 (μg / body) was used to introduce the gRNA1 sequence.

[0116] Figure 21 shows the structure of this AAV8 vector system and the concept of intravenous administration. Figure 22 shows the FIX activity (FIX:C) and antigen (FIX:Ag) (%) in the plasma of adult knock-in mice after vector injection.

[0117] As a result, plasma FIX activity increased 5 to 6 times, but antigen levels remained unchanged.

[0118] Figure 23 shows the results of evaluating C>T mutations around the target site using NGS after obtaining DNA from the liver. The horizontal axis represents the position with the target site set to 0, and the vertical axis represents the percentage of C>T conversion.

[0119] As a result, approximately 60% of the base editing from C to T was observed in the liver of mice.

[0120] Figure 24 shows the percentage of C>T mutations in DNA obtained from each organ. The graph shows the percentage of C>T conversion in the brain, heart, lungs, liver, kidneys, testes, muscles, small intestines, and bone marrow.

[0121] As a result, no C>T editing was observed in organs other than the liver.

[0122] Figure 25 shows the frequency of C>T mutations and other conversions in liver DNA. The average percentage of unconverted DNA at the target site (amino acid "R") was 38%, while the percentage of C>T mutations (amino acid "Q") was 62%. A small A>G conversion was detected in the two nucleotides upstream of the 5' (from "TCT" to "TCC" on the 3' side in the figure), but this did not involve a change in amino acids.

[0123] Figures 26A to 26E show the increase in FIX activity after R338Q induction by AAV vector in mice expressing each hemophilia B mutant F9 cDNA. In each graph, the horizontal axis represents the elapsed time (weeks) from intravenous administration ("0"), and the vertical axis represents the ratio of FIX activity (FIX:C) (%) and antigen (FIX:Ag). Figure 26A shows the results for c. 1138G>A, Figure 26B shows the results for c. 1330G>A, and Figure 26C shows the results for c. 1334G>A knock-in mice, respectively.

[0124] The increase in plasma FIX activity induced by R338Q was also observed in knock-in mice expressing hemophilia B mutants (c.1138G>A, c.1300G>A, c.1334C>T).

[0125] (Mouse Generation) Several other C57BL / 6 mice expressing human F9 mutant cDNA were generated by Cas9-mediated genome editing. In this example, the c.280G>A mutation and the c.364G>A mutation located in the EGF domain were generated. In this case, the Cas9 ribonucleoprotein complex and single-stranded oligonucleotide (ssODN) donor were electroporated into the embryos of knock-in mice expressing wild-type hF9 cDNA using the same method as in Example 1 described above. The gRNA and ssODN of the c.280G>A mutation and c.364G>A mutation in this example are described in Sequence IDs 49-52, respectively.

[0126] Details of the preparation and in silico analysis of the mice used in Example 1 and Example 2 will be described later.

[0127] Figures 26D to 26E show the increase in FIX activity after R338Q induction by AAV vector. (1 × 10 per mouse) 12 The plasma FIX:C and FIX:Ag values ​​in hemophilia B variant F9 cDNA-expressing mice (vg) are shown as mean ± standard deviation (n=5-6). In each graph, the horizontal axis represents the elapsed time (weeks) from intravenous administration ("0"), and the vertical axis represents the ratio of FIX activity (FIX:C) (%) and antigen (FIX:Ag). Figure 26D shows the results for c. 280G>A knock-in mice, and Figure 26E shows the results for c. 364G>A knock-in mice, respectively.

[0128] As a result, the increase in plasma FIX activity induced by R338Q was also observed in c. 280G > A and c. 364G > A.

[0129] Figures 27A to 27E show the evaluation of C>T DNA editing induction at target sites by NGS after R338Q induction by AAV vector. The horizontal axis represents the position with the gRNA tip set to 1, and the vertical axis shows the C>T conversion rate (%) as mean ± standard deviation (n=3 to 5). Figure 27A shows the results for c. 1138 G>A, Figure 27B shows the results for c. 1300 G>A, Figure 27C shows the results for c. 1334 C>T, Figure 27D shows the results for c. 280 G>A, and Figure 27E shows the results for c. 364 G>A.

[0130] In addition, the shortening (recovery) of the activated partial thromboplastin time (APTT) after R338Q induction by AAV vectors was measured. Specifically, as described above, two AAV8 vectors encoding TadCBEd and SpCas9 (D10A) with a UGI sequence and gRNA1 sequence linked were intravenously injected into knock-in mice expressing human F9 cDNA. Subsequently, the plasma FIX:C and FIX:Ag measurements described above were performed simultaneously using an automated coagulation analyzer (CA-510, Sysmex).

[0131] Figure 28 shows the plasma APTT (1 × 10⁶ per mouse) of adult knock-in mice with and without vector injection. 12 The results for vg) are shown. The horizontal axis represents each mutant and control (wild type), and the vertical axis represents APTT (seconds), with the mean ± standard deviation (n = 3 to 7). Statistical analysis was performed using a two-tailed t-test.

[0132] As a result, the shortening (recovery) of clotting time (APTT) induced by R338Q was confirmed in all hemophilia B variants (c.1138G>A, c.1300G>A, c.1334C>T, c.280G>A, and c.364G>A).

[0133] (In silico analysis of increased immunogenicity) Next, we will explain the results of the in silico analysis of the increased immunogenicity induced by R338Q.

[0134] Figures 29A and 29B show the results of this in silico analysis quantifying the affinity of the human F9 R338Q peptide to human leukocyte antigen (HLA) class II. Figure 29A shows the results for the 9-mer peptide containing the R338 residue of wild-type FIX, and Figure 29B shows the results for each R338Q-inducible peptide. In both cases, the normalized T-score (Δ / SD) is shown as a heatmap. Here, the concentration is plotted so that it is higher for positive or negative T-scores. These results were derived from the 20-mer region covering V328 to M348. Predictions were performed for 20 representative HLA-DR, -DP, and -DQ alleles. Positive scores indicate an increase in predicted immunogenicity, and negative scores indicate a decrease in immunogenicity relative to the average of the entire peptide.

[0135] Figure 29C is a bar graph evaluating the predicted binding affinity (nM) of peptides derived from the R338Q-corrected counterpart peptide for FIX variants reported in patients, against the most immunogenic HLA allele in each case. Known immunodominant epitopes PADRE and HA_306_318 are shown as positive controls. The dashed lines represent the thresholds for strong binding (<50 nM) and weak binding (>500 nM), and the binding affinity of the wild-type FIX peptide, respectively.

[0136] As a result, in silico analysis predicted that the R338Q substitution within the 20-nucleotide peptide of the surrounding sequence would not increase HLA class II binding affinity and would not show increased immunogenicity, even when combined with the adjacent F9 mutant.

[0137] It goes without saying that the configuration and operation of the above embodiment are examples and can be modified as appropriate without departing from the spirit of the present invention.

[0138] According to the present invention, a hemophilia B therapeutic composition can be provided that treats hemophilia B using genome editing or the like, and is industrially applicable.

Claims

1. A polynucleotide characterized by containing a sequence that induces an amino acid change at the R338 site of the mature protein of human blood coagulation factor IX (FIX).

2. The polynucleotide according to claim 1, characterized in that the sequence induces a C>T mutation.

3. The polynucleotide according to claim 2, characterized in that the sequence is a guide RNA sequence for genome editing.

4. The polynucleotide according to claim 3, characterized in that the sequence is any one or any combination of the base sequences of SEQ ID NOs: 1 to 3.

5. A vector comprising a polynucleotide and a base editing tool according to any one of claims 1 to 4.

6. A composition for the treatment of hemophilia B, characterized by comprising the vector described in claim 5.

7. Lipid nanoparticles characterized by comprising a polynucleotide and a base editing tool according to any one of claims 1 to 4.

8. A composition for the treatment of hemophilia B, characterized by comprising the lipid nanoparticles described in claim 7.

9. A method for generating cells for the treatment of hemophilia B, characterized by introducing a polynucleotide and a base editing tool according to any one of claims 1 to 3 into selected cells extracted from the body of a patient with hemophilia B.

10. A method for treating hemophilia B, characterized by introducing a polynucleotide and a base editing tool according to any one of claims 1 to 4.