Composite substance
A novel linking technique using nucleoside-bonded polymers addresses the challenge of controlling orientation and distance between polypeptide domains in scFv fusion proteins, enhancing production efficiency and specificity for pharmaceutical applications.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- KANSAI UNIVERSITY
- Filing Date
- 2025-11-12
- Publication Date
- 2026-05-21
AI Technical Summary
The challenge of controlling the orientation and distance between polypeptide domains in fusion proteins, particularly when expressed as single-chain variable fragments (scFv), is difficult due to variations in folding and linking techniques, leading to inefficiencies in production and cost for antibodies like IgG.
A novel linking technique using a polymer with non-amino acid monomer units linked by nucleoside bonds, such as polynucleotides, to connect polypeptide domains, allowing precise control over the orientation and distance between polypeptide domains.
This approach enables efficient production of scFv-like target-binding substances with controlled orientation and distance, reducing production costs and improving specificity, making it suitable for pharmaceutical applications.
Smart Images

Figure JPOXMLDOC01-APPB-C000001 
Figure JPOXMLDOC01-APPB-C000002 
Figure JPOXMLDOC01-APPB-C000003
Abstract
Description
Composite substance
[0001] The present invention relates to composite substances and the like.
[0002] Antibodies are being increasingly used as pharmaceutical active ingredients that have high specificity for a target and a lower risk of causing side effects. However, antibodies are macromolecules, and for example, in the case of IgG, they have a molecular weight of 150 kDa. Therefore, antibodies are usually produced by culturing mammalian cells, and the production cost is high. On the other hand, a single-chain variable fragment (scFV) formed by linking the heavy-chain variable region and the light-chain variable region of an antibody with a linker can exhibit high specificity while having a relatively low molecular weight, and can be produced by culturing bacteria such as Escherichia coli, thereby suppressing the production cost.
[0003] When linking two polypeptide domains, a peptide linker is employed. In this case, it is expressed and purified in the form of a fusion protein composed of the two polypeptide domains and the intervening peptide linker.
[0004] Japanese Patent Application Laid-Open No. 2024-056667
[0005] The present inventor has noted that when expressed as a fusion protein, the folding of the polypeptide domains constituting the fusion protein may differ from that when the polypeptide domains are expressed alone depending on the length, amino acid sequence, linking position, etc. of the peptide linker, and that it is difficult to control the orientation and / or distance of the two polypeptide domains to be fused even if the folding of the polypeptide domains constituting the fusion protein is correct.
[0006] An object of the present invention is to provide a new linking technique between polypeptide domains.
[0007] In view of the above problems, the inventors diligently conducted research and found that the above problems can be solved by using a polymer in which non-amino acid monomer units are linked by nucleoside bonds, preferably a polynucleotide such as DNA, as a linker. Based on this finding, the inventors furthered their research and completed the present invention. That is, the present invention encompasses the following aspects.
[0008] Item 1. A composite material comprising polypeptide domain A, a polymer, and polypeptide domain B, wherein the polymer is a polymer in which non-amino acid monomer units are linked by nucleoside bonds, and polypeptide domain A and polypeptide domain B are linked via the polymer.
[0009] Item 2. The composite material according to Item 1, wherein the polymer is a polynucleotide.
[0010] Item 3. The composite substance according to Item 2, wherein the polynucleotide is a double-stranded polynucleotide containing single-stranded polynucleotide A and single-stranded polynucleotide B.
[0011] Item 4. The composite substance according to Item 3, wherein the polypeptide domain A and the single-stranded polynucleotide A are linked, and the polypeptide domain B and the single-stranded polynucleotide B are linked.
[0012] Item 5. The composite material according to Item 4, wherein the polypeptide domain A is ligated to one terminal A of the double-stranded polynucleotide, and the polypeptide domain B is ligated to either terminal A or terminal B of the double-stranded polynucleotide.
[0013] Item 6. The composite substance according to item 2, wherein the polynucleotide is a single-stranded polynucleotide.
[0014] Item 7. The composite material according to item 6, wherein the polypeptide domain A is ligated to one terminal A' of the single-stranded polynucleotide, and the polypeptide domain B is ligated to the other terminal B' of the single-stranded polynucleotide.
[0015] Item 8. The composite material according to any one of items 1 to 7, wherein polypeptide domain A and polypeptide domain B are polypeptide domains having target-binding ability.
[0016] Item 9. The complex material according to item 8, wherein polypeptide domain A and polypeptide domain B comprise the CDR of an antibody.
[0017] Item 10. The complex material according to item 8 or 9, wherein polypeptide domain A and polypeptide domain B include a variable region of an antibody.
[0018] Item 11. A pharmaceutical product comprising any of the complex substances described in items 1 to 10.
[0019] Item 12. A reagent comprising any of the composite substances described in items 1 to 10.
[0020] Item 13. A method for producing a composite substance according to any one of items 1 to 10, comprising linking the polypeptide domain A and / or the polypeptide domain B to the polymer and / or the constituent molecules of the polymer.
[0021] According to the present invention, a novel linking technology between polypeptide domains can be provided.
[0022] This document shows the manufacturing and evaluation scheme for the composite material in Test Example 1. It also shows the evaluation results for the composite material in Test Example 1.
[0023] 1. Definitions In this specification, the terms “contains” and “includes” include the concepts of “contains,” “includes,” “substantially consist of,” and “consist solely of.”
[0024] The "identity" of amino acid sequences refers to the degree of agreement between two or more comparable amino acid sequences. Therefore, the higher the agreement between two amino acid sequences, the higher their identity or similarity. The level of amino acid sequence identity can be determined, for example, using the sequence analysis tool FASTA and its default parameters. Alternatively, it can be determined using the BLAST algorithm by Karlin and Altschul (S. Karlin, SF Altschul. "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes." Proc. Natl. Acad. Sci. USA 87, 2264-2268 (1990), S. Karlin, SF Altschul. "Applications and statistics for multiple high-scoring segments in molecular sequences." Proc. Natl. Acad. Sci. USA 90, 5873-5877 (1993)). A program called BLASTX has been developed based on this BLAST algorithm. The specific methods for these analyses are publicly known and can be found on the National Center of Biotechnology Information (NCBI) website (http: / / www.ncbi.nlm.nih.gov / ). Furthermore, the 'identity' of a nucleotide sequence is defined in accordance with the above.
[0025] In this specification, "conservative substitution" means that an amino acid residue is substituted for an amino acid residue having a similar side chain. For example, substitutions between amino acid residues having basic side chains, such as lysine, arginine, and histidine, are considered conservative substitutions. Other examples of conservative substitutions include amino acid residues with acidic side chains, such as aspartic acid and glutamic acid; amino acid residues with non-charged polar side chains, such as glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine; amino acid residues with non-polar side chains, such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan; amino acid residues with β-branched side chains, such as threonine, valine, and isoleucine; and amino acid residues with aromatic side chains, such as tyrosine, phenylalanine, tryptophan, and histidine.
[0026] 2. Composite Material In one embodiment, the present invention relates to a composite material (sometimes referred to as "the composite material of the present invention") comprising polypeptide domain A, a polymer, and polypeptide domain B, wherein the polymer is a polymer in which non-amino acid monomer units are linked by nucleoside bonds, and polypeptide domain A and polypeptide domain B are linked via the polymer. This will be described below.
[0027] Polypeptide domain A and polypeptide domain B (hereinafter sometimes collectively referred to as "the polypeptide domains of the present invention") are domains containing polypeptides, and are not particularly limited to that extent.
[0028] The number of polypeptide molecules contained in each polypeptide domain of the present invention is not particularly limited and may be, for example, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1 to 2, or 1. When a polypeptide domain contains multiple polypeptide molecules, the polypeptides may be of the same type or of different types.
[0029] The amino acid sequence of a polypeptide may be a naturally derived amino acid sequence or a non-natural amino acid sequence. Furthermore, the amino acid sequence of a polypeptide may include the entire amino acid sequence of a protein or include a partial amino acid sequence of a protein.
[0030] More specifically, proteins derived from the amino acid sequence of polypeptides include antibodies, antigen-binding fragments of antibodies, luminescent proteins, fragmented fragments of luminescent proteins, tag proteins, enzyme proteins, structural proteins, muscle proteins, hormone proteins, metal ion and / or nutrient-binding proteins, receptor proteins, and the like. Among these, proteins preferably used in the present invention include antibodies, antigen-binding fragments of antibodies, luminescent proteins, fragmented fragments of luminescent proteins, tag proteins, and the like.
[0031] Antibodies can be any isotype, such as IgG (e.g., IgG1, IgG2, IgG3, IgG4), IgA (e.g., IgA1, IgA2), IgD, IgE, IgM, IgY, etc. Other examples of antibodies include small molecule antibodies such as VHH antibodies, and artificial antibodies such as nanobodies. Antibodies may be human or non-human. Examples of non-human antibodies include, but are not limited to, mouse antibodies, rat antibodies, rabbit antibodies, monkey antibodies, chimpanzee antibodies, alpaca antibodies, and chicken antibodies. Antibodies may also be chimeric antibodies, such as mouse-human chimeric antibodies. Antibodies can be partially or fully humanized.
[0032] The antigen-binding fragment of the antibody is not particularly limited as long as it contains CDRs (preferably heavy chain CDR1-3 and light chain CDR1-3), and examples include Fab, F(ab')2, minibody, scFv-Fc, Fv, scFv, diabody, triabody, tetrabody, etc.
[0033] Fab comprises a heavy chain fragment containing a heavy chain variable region and a heavy chain constant region containing CH1, and a light chain containing a light chain variable region and a light chain constant region (CL), and has a structure in which the heavy chain variable region and the light chain variable region associate through the non-covalent intermolecular interactions described above, or are linked by disulfide bonds. In Fab, CH1 and CL may be disulfide-bonded to each other by the thiol groups of the cysteine residues present in each.
[0034] F(ab')2 is a structure that has two pairs of the above Fab groups, and the CH1 groups are disulfide-bonded to each other by the thiol groups of the cysteine residues contained in them.
[0035] A mini-body is a structure in which two fragments, each with a CH3 group attached to a heavy chain variable region constituting the scFV described below, associate through non-covalent intermolecular interactions between the CH3 groups.
[0036] scFv-Fc is a structure in which two antibody fragments containing scFv, CH2, and CH3, respectively, associate through non-covalent intermolecular interactions between the CH3 groups, similar to the mini-body described above, and are disulfide-bonded to the thiol groups of the cysteine residues contained in each CH3.
[0037] Fv is considered the smallest structural unit of an antibody, and is a structure in which the heavy chain variable region and the light chain variable region are associated by non-covalent intermolecular interactions. In Fv, the thiol groups of cysteine residues present in the heavy chain variable region and the light chain variable region may be bonded together by disulfide bonds.
[0038] scFv refers to a structure in which the C-terminus of the heavy chain variable region and the N-terminus of the light chain variable region are linked by a linker, or a structure in which the N-terminus of the heavy chain variable region and the C-terminus of the light chain variable region are linked by a linker, and is also called a single-chain antibody.
[0039] Diabodies, triabodies, and tetrabodies are structures formed when the scFv molecules described above form dimers, trimers, and tetramers, respectively, and then associate in a structurally stable state through non-covalent intermolecular interactions between variable regions, similar to those of Fv molecules.
[0040] In this specification, "CDR" is an abbreviation of Complementarity Determining Region, also referred to as the complementarity determining region. CDR is a region present in the variable region of an immunoglobulin and is a region deeply involved in the specific binding of an antibody to an antigen. And "light chain CDR" means a CDR present in the variable region of the light chain of an immunoglobulin, and "heavy chain CDR" means a CDR present in the variable region of the heavy chain of an immunoglobulin.
[0041] In this specification, "variable region" means a region containing CDR1 to CDR3 (hereinafter simply referred to as "CDRs1-3"). The arrangement order of these CDRs1-3 is not particularly limited, but preferably, in the direction from the N-terminal side to the C-terminal side, in the order of CDR1, CDR2, and CDR3, or in the reverse order, through other amino acid sequences referred to as the framework region (FR) described later, it means a region arranged. And "heavy chain variable region" is a region where the above-mentioned heavy chain CDRs1-3 are arranged, and "light chain variable region" is a region where the above-mentioned light chain CDRs1-3 are arranged.
[0042] Regions other than the above CDR1-3 in each variable region are referred to as the framework region (FR) as described above. In particular, the region between the N-terminal of the variable region and CDR1 is defined as FR1, the region between CDR1 and CDR2 is defined as FR2, the region between CDR2 and CDR3 is defined as FR3, and the region between CDR3 and the C-terminal of the variable region is defined as FR4.
[0043] FR also has a function as a linker sequence connecting CDRs1-3, which are particularly important as the above-mentioned antigen recognition sequences, and is a region contributing to the three-dimensional structure formation of the entire variable region.
[0044] The luminescent protein is not particularly limited as long as it is a protein capable of emitting light by itself. From the viewpoint of suppressing background light and the like, a substrate-dependent luminescent protein is preferable as the luminescent protein.
[0045] Examples of substrate-dependent luminescent proteins include luciferase, β-galactosidase, lactamase, horseradish peroxidase, alkaline phosphatase, β-glucuronidase, and β-glucosidase, with luciferase being particularly preferred. Examples of luciferase include luciferase derived from the spiny lobster, sea cucumber luciferase, firefly luciferase, cnidarian luciferase, North American firefly luciferase, click beetle luciferase, railroad worm luciferase, bacterial luciferase, Gaussian luciferase, aequorin, and bioluminescent fungus luciferase. Substrate-dependent luminescent proteins can emit light in the presence of a substrate (e.g., flimazine, luciferin, calcium, coelenterazine, derivatives or analogs of coelenterazine, etc.). Substrate-dependent luminescent proteins may have mutations such as amino acid substitutions, deletions, additions, or insertions introduced, as long as their substrate-dependent luminescence ability is not significantly impaired (for example, they have luminescence ability of 50% or more, preferably 70% or more, more preferably 80% or more, and even more preferably 90% or more compared to the non-mutant type).
[0046] The fragments of a luminescent protein are not particularly limited, as long as they cannot emit light on their own and can restore their luminescence activity by associating with another fragment that is paired with them. The amino acid sequence of the fragment of the luminescent protein can be determined according to or in accordance with known information (e.g., International Publication No. 2014 / 151736) depending on the type of luminescent protein, the desired dissociation constant, etc. As such fragments, for example, LgBiT(Promega) or SmBiT(Promega), which are fragments of NanoLuc(Promega), can be used. LgBiT is a large subunit of approximately 18 kDa, and SmBiT is a small subunit of 11 amino acid residues.
[0047] A tag protein can specifically recognize a target molecular structure and bind (non-covalently or covalently) to the target, and is not particularly limited as long as it can do so. Examples of tag proteins include SNAP tag, CLIP tag, avidin tag, Halo tag, His tag, GST tag, FLAG tag, MBP tag, HA tag, Myc tag, V5 tag, PA tag, and the like.
[0048] An antibody and its antigen-binding fragment have binding ability (target-binding ability) to a target (e.g., protein, sugar chain, etc.). In one aspect of the present invention, it is preferable that the polypeptide domain of the present invention has target-binding ability. In this case, it is more preferable that the polypeptide domain of the present invention includes a polypeptide containing an amino acid sequence derived from an antibody or its antigen-binding fragment. It is more preferable that the polypeptide domain of the present invention includes the CDR of an antibody (preferably heavy-chain CDR1-3 or light-chain CDR1-3), and it is even more preferable that the polypeptide domain of the present invention includes the variable region of an antibody (heavy-chain variable region or light-chain variable region). In a particularly preferred embodiment, polypeptide domain A includes one of the heavy-chain variable region and the light-chain variable region, and polypeptide domain B includes the other. In this case, the composite substance of the present invention can be used as an scFV-like target-binding substance.
[0049] When the polypeptide domain of the present invention includes a luminescent protein or its split fragment, the composite substance of the present invention can be made to emit light. For example, if it is designed so that BRET caused by the luminescent protein occurs only when polypeptide domain A and polypeptide domain B are brought close to each other, the generation of the composite substance of the present invention can be confirmed, and it is also easy to purify by fractionation means such as FACS. Also, when the polypeptide domain of the present invention includes a split fragment of a luminescent protein, the polypeptide domain of the present invention and a polymer can be linked by utilizing the binding ability between the split fragments.
[0050] When the polypeptide domain of the present invention includes a tag protein, the polypeptide domain of the present invention and a polymer can be linked by utilizing its target-binding ability.
[0051] The amino acid sequence of a polypeptide may include amino acid sequences derived from multiple proteins. For example, the amino acid sequence of a polypeptide may include an amino acid sequence derived from an antibody or its antigen-binding fragment, and an amino acid sequence used for linking with the polymer (e.g., the fragments of a luminescent protein, protein tags, etc., as described above).
[0052] The polymer is a polymer in which non-amino acid monomer units are linked by nucleoside bonds, and is not particularly limited in this respect. Preferably, the polymer is a polymer (polynucleotide) in which nucleosides are linked by nucleoside bonds.
[0053] The polymer may be linear or branched.
[0054] Non-amino acid monomer units are monomer units other than amino acids that can be linked by nucleoside bonds, and are not particularly limited in this respect. Preferably, monomer units can be monomer units formed by polymer synthesis using the phosphoramidite method with phosphoramidite monomers. Examples of monomer units include nucleosides, N-(2-aminoethyl)glycine, oligoethylene glycol chains or alkyl chains with introduced functional groups, monomer units of PNA (monomer units containing a base), monomer units of BNA, monomer units of LNA, monomer units of morpholino nucleic acids, and the like.
[0055] The nucleoside bonds are not particularly limited as long as they can be used as bonds between constituent monomers in polynucleotides (natural or artificial), and examples include phosphodiester bonds, phosphorothioate bonds (also called thiophosphate bonds), amide bonds, phosphorodithioate bonds, phosphotriester bonds, methylphosphonate bonds, methylthiophosphonate bonds, boranophosphate bonds, phosphoramidate bonds, etc.
[0056] The number of monomer units in the polymer is not particularly limited, but is, for example, 2 or more, preferably 3 or more, more preferably 5 or more, even more preferably 10 or more, and even more preferably 20 or more. The upper limit of the number of monomer units is not particularly limited, and is, for example, 2000, 1000, 500, 200, 100, or 50.
[0057] The polymer is particularly preferably a polynucleotide. By using a polynucleotide, the composite material of the present invention can be easily prepared. The polynucleotide may be either a single-stranded polynucleotide or a double-stranded polynucleotide, but from the viewpoint of ease of preparation of the composite material of the present invention, a double-stranded polynucleotide (containing single-stranded polynucleotide A and single-stranded polynucleotide B; in this case, single-stranded polynucleotide A and single-stranded polynucleotide B are partially or completely linked by complementary base pair bonds) is preferred.
[0058] In the case of a double-stranded polynucleotide, the base length of the region where complementary base pairs are bonded between single-stranded polynucleotide A and single-stranded polynucleotide B can be, for example, 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, or 100% of 100% of the longer base length of single-stranded polynucleotide A and single-stranded polynucleotide B.
[0059] In this specification, polynucleotides include both natural and artificial ones. Polynucleotides such as DNA and RNA may be subjected to known chemical modifications, as exemplified below. To prevent degradation by hydrolytic enzymes such as nucleases, the phosphate residues of each nucleotide can be replaced with chemically modified phosphate residues such as phosphorothioates (PS), methylphosphonates, and phosphorodithionates. In addition, the hydroxyl group at position 2 of the sugar (ribose) of each ribonucleotide may be replaced with -OR (where R represents, for example, CH3 (2'-O-Me), CH2CH2OCH3 (2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, CH2CH2CN, etc.). Furthermore, the base portion (pyrimidine, purine) may be chemically modified, for example, by introducing a methyl group or cationic functional group at position 5 of the pyrimidine base, or by substituting the carbonyl group at position 2 with a thiocarbonyl group. Furthermore, examples include, but are not limited to, those in which the phosphate or hydroxyl portion is modified with, for example, biotin, an amino group, a lower alkylamine group, or an acetyl group. In addition, BNA (LNA), in which the conformation of the sugar portion of the nucleotide is fixed to the N-type by cross-linking the 2' oxygen and 4' carbon atoms of the sugar portion, can also be used. Furthermore, peptide nucleic acids (e.g., PNA), morpholino nucleic acids, etc., can also be used.
[0060] The bases that make up nucleosides / nucleotides include not only typical bases found in natural nucleic acids such as RNA and DNA (adenine (A), thymine (T), uracil (U), guanine (G), cytosine (C), etc.), but also other bases, such as hypoxanthine (I) and modified bases. Examples of modified bases include pseudouracil, 3-methyluracil, dihydrouracil, 5-alkylcytosine (e.g., 5-methylcytosine), 5-alkyluracil (e.g., 5-ethyluracil), 5-halouracil (5-bromouracil), 6-azapyrimidine, 6-alkylpyrimidine (6-methyluracil), 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5'-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, 1-methyladenine, and 1-methylhypoxane. Examples include tin, 2,2-dimethylguanine, 3-methylcytosine, 2-methyladenine, 2-methylguanine, N6-methyladenine, 7-methylguanine, 5-methoxyaminomethyl-2-thiouracil, 5-methylaminomethyluracil, 5-methylcarbonylmethyluracil, 5-methyloxyuracil, 5-methyl-2-thiouracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid, 2-thiocytosine, purine, 2-aminopurine, isoguanine, indole, imidazole, xanthine, cyanuric acid, etc.
[0061] The polymer may be in a flexible linker state, in a state that has formed a higher-order structure, or in a state in which multiple states coexist.
[0062] If the polymer is a polynucleotide, all or part of the polymer may be an aptamer. The aptamer sequence is not particularly limited as long as it is a nucleic acid sequence that can bind (preferably specifically) to a certain substance (recognition substance). The recognition substance is not particularly limited as long as it can bind to the nucleic acid aptamer, and examples include nucleic acids, proteins, peptides, small molecule compounds, physiologically active substances, metal ions, etc. In one embodiment of the present invention, the recognition substance is preferably a biomolecule. If the recognition substance is a nucleic acid, the nucleic acid aptamer sequence includes a complementary sequence to the nucleic acid that is the recognition substance. As the nucleic acid aptamer sequence, a nucleic acid aptamer sequence known for a certain substance may be used, or a sequence obtained by screening by a known method (e.g., the SELEX method) may be used. The number of bases in the nucleic acid aptamer sequence is not particularly limited, but is, for example, 5 to 500, preferably 10 to 250, and more preferably 20 to 100.
[0063] When the polymer is a polynucleotide, all or part of the polymer may be a nucleic acid enzyme. The nucleic acid enzyme is not particularly limited, as long as it is a nucleic acid that possesses enzymatic activity itself or can exert enzymatic activity by binding to other substances such as cofactors. Preferably, nucleic acid enzymes include those containing two or more G quartets. A G quartet is a planar structure formed by four guanine bases through Hoogsteen-type hydrogen bonds. Two or more of these stack to form a higher-order structure called a guanine quadruple chain. This higher-order structure can exert peroxidase activity in the presence of heme.
[0064] In the composite material of the present invention, polypeptide domain A and polypeptide domain B are linked via a polymer. That is, polypeptide domain A is linked to any site on the polymer, and polypeptide domain B is linked to another site on the polymer. In one embodiment of the present invention, polypeptide domain A and polypeptide domain B are both linked to the ends of the polymer (for example, a terminal monomer unit and two to five, two to three, or two adjacent monomer units, preferably the terminal monomer unit). In this case, for example, polypeptide domain A is linked to one end A of the polymer, and polypeptide domain B is linked to either the end A or the other end B of the polymer.
[0065] The polypeptide domain of the present invention may be directly linked to the polymer or indirectly linked to the polymer (for example, via a linker).
[0066] The linker is not particularly limited, as long as it has a flexible and movable structure. The linker may consist solely of a chain structure, or it may include both a chain structure and a ring structure. Furthermore, the chain structure may be linear or branched.
[0067] More specifically, the linker is preferably a hydrocarbon chain in which at least one carbon atom constituting the main chain may be replaced by a heteroatom and / or a linking structure. When at least one carbon atom constituting the main chain is replaced by a heteroatom and / or a linking structure, the number of carbon atoms replaced by linking structures is, for example, 1 to 5, preferably 1 to 3, and more preferably 1 to 2.
[0068] Preferably, the hydrocarbon chain is an alkylene group. The alkylene group can be either linear or branched, but is preferably linear. The number of carbon atoms constituting the main chain of the alkylene group is, for example, 6 to 40, 8 to 30, or 10 to 30.
[0069] Examples of heteroatoms include oxygen atoms, sulfur atoms, nitrogen atoms, etc. When at least one carbon atom constituting the main chain of the alkylene group is replaced with an oxygen atom, specifically, the -CH2- in the main chain of the alkylene group is replaced with, for example, -O-. When at least one carbon atom constituting the main chain of the alkylene group is replaced with a sulfur atom, specifically, the -CH2- in the main chain of the alkylene group is replaced with, for example, -S-, -S(=O)2-, -S(=O)-, etc. When at least one carbon atom constituting the main chain of the alkylene group is replaced with a nitrogen atom, specifically, the -CH2- in the main chain of the alkylene group is replaced with, for example, -NR- (where R represents a hydrogen atom or a hydrocarbon group (preferably an alkyl group, more preferably an alkyl group having 1 to 8 carbon atoms)).
[0070] The linkage structure is not particularly limited as long as it is a divalent group, which is a bond structure formed by the reaction of two identical or different reactive groups. Examples of reactive groups include amino groups, carboxyl groups, hydroxyl groups, ketone groups, ethynyl groups, vinyl groups, azide groups, epoxy groups, aldehyde groups, oxylamino groups, thiol groups, isocyanate groups, and isothiocyanate groups.
[0071] Examples of reactions between reactive groups are as follows: Amino groups are known to react with carboxyl groups (or groups formed by esterifying a carboxyl group with N-hydroxysuccinimide (NHS)) to form amide bonds. Ethynyl groups are known to form a 1,2,3-triazole ring through 1,3-dipolar cycloaddition with azide groups. Cyclooctyne is known to form a 1,2,3-triazole ring through 1,3-dipolar cycloaddition with azide groups. Amino groups react with carboxyl groups to form amide bonds. Carboxylic groups are known to react with hydroxyl groups to form ester bonds. Carboxylic groups are known to react with thiol groups to form thioester bonds. Phosphate groups are known to react with hydroxyl groups to form phosphodiester bonds. Vinyl groups react with thiol groups to form bonds. Epoxy groups react with amino and thiol groups to form bonds. Aldehyde groups react with amino groups to form Schiff bases, which are then reduced to form bonds. The oxylamino group reacts with ketone groups and aldehyde groups to form oximes.
[0072] In one embodiment of the present invention, the linking structure may include at least one linking structure selected from the group consisting of a linking structure containing a triazole ring, a linking structure containing an amide bond, a linking structure containing (3-thio)succinimide, a disulfide bond, a phosphate diester bond, and an intracellular cleavage type peptide linking bond. In one embodiment of the present invention, the linking structure may include a linking structure containing a triazole ring and / or a linking structure containing an amide bond. More specifically, the linking structure containing a triazole ring may be, for example, a 1,2,3-triazole ring, or a fused ring (e.g., a 2- or 3-ring) of a 1,2,3-triazole ring and another ring (e.g., a 3- to 8-membered ring, or a fused ring). The linking structure containing an amide bond may specifically be, for example, an amide bond (-CO-NR-), or -O-CO-NR- (where R is the same as above).
[0073] When a polynucleotide is used as the polymer, and the polynucleotide is a double-stranded polynucleotide containing a single-stranded polynucleotide A and a single-stranded polynucleotide B, it is preferable that polypeptide domain A is linked to single-stranded polynucleotide A, and polypeptide domain B is linked to single-stranded polynucleotide B. In this case, it is preferable that polypeptide domain A is linked to one end A of the double-stranded polynucleotide, and polypeptide domain B is linked to either the end A or the other end B of the double-stranded polynucleotide. In this case, if polypeptide domain B is linked to the end A of the double-stranded polynucleotide, polypeptide domain A and polypeptide domain B are linked to the same side (end A side) of the double-stranded polynucleotide, allowing them to be brought into natural proximity, and their orientation and distance can be easily controlled. For this reason, the above embodiment is particularly suitable when, for example, the orientation and distance between polypeptide domain A and polypeptide domain B are important for the expression of their function (for example, when polypeptide domain A and polypeptide domain B contain the CDR of an antibody, preferably the variable region of an antibody).
[0074] When a polynucleotide is used as the polymer, and the polynucleotide is a single-stranded polynucleotide, it is preferable that polypeptide domain A is ligated to one end A' of the single-stranded polynucleotide, and polypeptide domain B is ligated to the other end B' of the single-stranded polynucleotide.
[0075] The composite material of the present invention can be produced, for example, by a method that includes linking polypeptide domain A and / or polypeptide domain B to a polymer and / or constituent molecules of the polymer.
[0076] A constituent molecule of a polymer is one of the constituent molecules when the polymer is composed of multiple molecules (for example, a double-stranded polynucleotide) (for example, a single-stranded polynucleotide when the polymer is a double-stranded polynucleotide).
[0077] The linkage of polypeptide domain A and / or polypeptide domain B to polymers and / or constituent molecules of polymers can be carried out in two or more steps if there are two or more constituent molecules of polypeptide domain A and polypeptide domain B. For example, one molecule constituting the polypeptide domain of the present invention (e.g., a fragment of a luminescent protein) can be linked to the polymer and / or constituent molecules of polymers, and then a protein containing a protein that can bind to that molecule (e.g., the other fragment of a luminescent protein) can be brought into contact with the polymer, thereby ultimately obtaining a substance in which the polypeptide domain of the present invention is linked to the polymer and / or constituent molecules of polymers.
[0078] 3. Applications: The composite substance of the present invention can be used as a pharmaceutical or reagent (hereinafter, these may be collectively referred to as "the agent of the present invention").
[0079] Pharmaceuticals are intended for use in administration to animals and are not particularly limited in this respect. Pharmaceuticals may be pharmaceutical compositions containing other components described below. Reagents are intended for use in experiments (in particular, in this invention, for introduction into cells) and are not particularly limited in this respect. Reagents may be reagent compositions containing other components described below.
[0080] The agent of the present invention is not particularly limited as long as it contains the composite substance of the present invention, and may further contain other components as needed. Other components are not particularly limited as long as they are pharmaceutically acceptable, but examples include bases, carriers, solvents, dispersants, emulsifiers, buffers, stabilizers, excipients, binders, disintegrants, lubricants, thickeners, humectants, colorants, fragrances, chelating agents, and the like.
[0081] The manner in which the agent of the present invention is used is not particularly limited, and an appropriate manner of use can be adopted depending on the type of agent. The agent of the present invention can be used, for example, in vitro (e.g., by adding it to the culture medium of cultured cells) or in vivo (e.g., by administering it to animals (preferably animals with cancer)).
[0082] The agents of the present invention are not particularly limited in their application to various mammals such as humans, monkeys, mice, rats, dogs, cats, and rabbits; and animal cells. The types of cells are also not particularly limited, and include, for example, blood cells, hematopoietic stem cells / progenitor cells, gametes (sperm, egg cells), fibroblasts, epithelial cells, vascular endothelial cells, nerve cells, hepatocytes, keratin-producing cells, muscle cells, epidermal cells, endocrine cells, ES cells, iPS cells, tissue stem cells, cancer cells, and the like.
[0083] The dosage form of the agent of the present invention is not particularly limited, and an appropriate dosage form can be adopted depending on the manner of use. For example, when administered to animals, examples include injectable preparations such as intravenous infusion, intramuscular injection, subcutaneous injection, and intradermal injection; oral preparations such as tablets, capsules, granules, powders, fine granules, syrups, enteric-coated preparations, sustained-release capsules, chewable tablets, drops, pills, oral solutions, confectionery tablets, sustained-release preparations, and sustained-release granules; and external preparations such as nasal drops, inhalants, suppositories, inserts, enemas, and jellies. Furthermore, the agent of the present invention may be a solid, semi-solid, or liquid preparation.
[0084] The content of the composite substance of the present invention in the agent of the present invention depends on the mode of use, the target of application, the condition of the target of application, etc., and is not limited, but can be, for example, 0.0001 to 100% by weight, preferably 0.001 to 50% by weight.
[0085] The dosage of the agent of the present invention when administered to animals is not particularly limited as long as it is an effective amount that produces the therapeutic effect, and is usually 0.1 to 1000 mg / kg body weight per day as the weight of the active ingredient, the composite substance of the present invention. The above dosage is preferably administered once a day or divided into two to three doses, and can be increased or decreased as appropriate depending on age, condition, and symptoms.
[0086] Another or more specific application of the composite material of the present invention is its use in detecting target analytes in biological samples. This is known as use in clinical diagnostic reagents. Examples include chemiluminescent immunoassays, fluorescence immunoassays, bioluminescent immunoassays, and enzyme immunoassays. Any suitable signal detection method can also be applied, such as electrochemical signals, oxidative chromogenic agents, and reducing chromogenic agents. The measurement method can be either a sandwich method or a competitive method. Furthermore, it can be applied to ligand-receptor assays, and if the polymer is polynucleotide, application to immunoPCR is also conceivable, which is considered advantageous in terms of antibody specificity and PCR amplification.
[0087] Another or more specific application of the composite material of the present invention is its use as a chaperone. As a chaperone, it can be used in fields that are not particularly limited, such as pharmaceuticals and crystal structure analysis. In particular, it can be used as a so-called "crystallization chaperone" that promotes the crystallization of target molecules in the crystal structure analysis of proteins.
[0088] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.
[0089] Test Example 1. Manufacturing and Evaluation of Composite Materials. Composite materials were manufactured and evaluated according to the scheme shown in Figure 1. Specifically, the following procedures were followed.
[0090] <Test Example 1-1. Production of HiBiT-modified DNA> First, a C-terminal azed peptide was produced by linking an azed ornithine side chain to the C-terminal amino acid (S) of the 11-residue peptide chain (sequence number 1) of NanoLuc (luminescent protein) (HiBit: exhibits luminescence activity by associating with the remaining fragment (LgBit)) via a peptide bond. This peptide was produced using commercially available Fmoc-L-Orn(N3)-OH (manufactured by Iris Biotech, structural formula shown below) via the Fmoc solid-phase synthesis method.
[0091]
[0092] Next, DBCO (dibenzocyclooctin group) modified DNA was chemically synthesized. The DNA sequence is TAAGAGGCTGGGTTTTGCTC (SEQ ID NO: 2). In the reaction using an automated DNA synthesizer via the phosphoramidite method, a DBCO group was introduced at the 5'-end using commercially available 5'-DBCO-TEG Phosphoramidite (Glen Research, structural formula shown below). After processing with a simple DNA purification column, preparative purification was performed by reverse-phase HPLC, and the formation of the target product was confirmed by MALDI-TOF / MS.
[0093]
[0094] Next, the C-terminal azide peptide and DBCO-modified DNA were ligated using a Cu-ion free click reaction. Specifically, 2.5 nmol of the C-terminal azide peptide and 2.5 nmol of DBCO-modified DNA were mixed in 50 μL of 1X PBS(-) and reacted at room temperature for 16 hours, after which the mixture was purified by reverse-phase HPLC. The obtained product was confirmed to be the target product (HiBiT-modified DNA) by MALDI-TOF / MS.
[0095] <Test Example 1-2. Production of Biotin-Modified DNA> Biotin-modified DNA was synthesized by the phosphoramidite method, in which a biotin TEG residue (structural formula shown below) was linked to the 3' nucleotide (A) of GAGCAAAACCCAGCCTCTTA (Sequence ID 3: the complete complementary sequence of Sequence ID 2) by a phosphodiester bond. After processing with a DNA simple purification column, preparative purification was performed by reverse-phase HPLC, and the production of the target product was confirmed by MALDI-TOF / MS.
[0096]
[0097] <Test Example 1-3. Production and Evaluation of Luminescent Protein / Streptavidin Complex> HiBiT-modified DNA and biotin-modified DNA were hybridized. Specifically, 3 pmol of HiBiT-modified DNA and 3.3 pmol of biotin-modified DNA or control DNA were mixed in 17.6 μL of 1X PBS(-), heated to 90°C in an aluminum bath, and then slowly cooled to room temperature to obtain HiBiT-modified DNA and biotin-modified DNA.
[0098] To the double-stranded DNA obtained from the HiBiT-modified DNA and biotin-modified DNA, 1.36 μL (1.17 mg / ml, 30 pmol) of FITC-labeled streptavidin (Sigma-Aldrich, S3762) was added at room temperature. Subsequently, 1 μL of LgBiT Protein solution (Promega, Nano-Glo HiBiT Blotting System) was added and left at room temperature for 15 minutes. Then, 10 μL of a 50-fold dilution of Nano-Glo Luciferase Assay Substrate (Flimazine) was added, and the emission spectrum was measured using a multimode plate reader (Molecular Devices Spectramax iD5).
[0099] <Results> The results are shown in Figure 2. In the system using control DNA without biotin (dotted line), the dominant emission was the blue light at 460 nm inherent to NanoLuc, with only a very small amount of green fluorescence at 522 nm originating from FITC. In contrast, in the system where biotin was introduced into the complementary strand and NanoLuc was complexed with FITC-labeled streptavidin via DNA (solid line), the green fluorescence at 522 nm was about 10% stronger than the blue light at 460 nm. This indicates that energy is efficiently transferred from NanoLuc to FITC on streptavidin within the complex. The green fluorescence in the system using control DNA without biotin is thought to be due to the non-specific adsorption of a small amount of streptavidin to NanoLuc.
Claims
1. A composite material comprising polypeptide domain A, a polymer, and polypeptide domain B, wherein the polymer is a polymer in which non-amino acid monomer units are linked by nucleoside bonds, and polypeptide domain A and polypeptide domain B are linked via the polymer.
2. The composite material according to claim 1, wherein the polymer is a polynucleotide.
3. The composite material according to claim 2, wherein the polynucleotide is a double-stranded polynucleotide comprising single-stranded polynucleotide A and single-stranded polynucleotide B.
4. The composite material according to claim 3, wherein the polypeptide domain A and the single-stranded polynucleotide A are linked, and the polypeptide domain B and the single-stranded polynucleotide B are linked.
5. The composite material according to claim 4, wherein the polypeptide domain A is ligated to one terminal A of the double-stranded polynucleotide, and the polypeptide domain B is ligated to either terminal A or terminal B of the double-stranded polynucleotide.
6. The composite material according to claim 2, wherein the polynucleotide is a single-stranded polynucleotide.
7. The composite material according to claim 6, wherein the polypeptide domain A is ligated to one terminal A' of the single-stranded polynucleotide, and the polypeptide domain B is ligated to the other terminal B' of the single-stranded polynucleotide.
8. The composite material according to claim 1, wherein polypeptide domain A and polypeptide domain B are polypeptide domains having target-binding ability.
9. The composite substance according to claim 8, wherein polypeptide domain A and polypeptide domain B contain the CDR of an antibody.
10. The composite material according to claim 8, wherein polypeptide domain A and polypeptide domain B include a variable region of an antibody.
11. A pharmaceutical product comprising a composite substance according to any one of claims 1 to 10.
12. A reagent comprising the composite substance according to any one of claims 1 to 10.
13. A method for producing a composite substance according to any one of claims 1 to 10, comprising linking the polypeptide domain A and / or the polypeptide domain B to the polymer and / or the constituent molecules of the polymer.