Novel bifidobacterium strain and use thereof for treating liver diseases
The Bifidobacterium longum subsp. infantis DS2696 strain addresses the unmet need for MASH treatment by inhibiting fat accumulation and inflammation, offering therapeutic benefits for liver diseases through pharmaceutical and food compositions.
Patent Information
- Application Number
- PCT/KR2025/018645
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-15
- Filing Date
- 2025-11-12
- Publication Date
- 2026-05-21
AI Technical Summary
There is a lack of effective treatments for metabolic dysfunction-associated steatohepatitis (MASH), a condition that can progress to cirrhosis and hepatocellular carcinoma, and current therapies like Resmetirom show limited efficacy.
A pharmaceutical composition containing the novel Bifidobacterium longum subsp. infantis DS2696 strain is used to inhibit fat accumulation and inflammation-related gene expression in liver tissue, addressing MASH through various forms such as live cells, dead cells, cultures, or extracts.
The Bifidobacterium longum subsp. infantis DS2696 strain effectively inhibits fat accumulation and inflammation in liver cells, providing therapeutic benefits for conditions like liver fibrosis, cirrhosis, and metabolic disorders, including MASH, with potential applications in pharmaceutical and food compositions.
Smart Images

Figure KR2025018645_21052026_PF_FP_ABST
Abstract
Description
Novel Bifidobacterium strain and its use in the treatment of liver disease
[0001] The present invention relates to a pharmaceutical composition for the prevention or treatment of liver disease comprising a novel strain, and more specifically, to a pharmaceutical composition for the prevention or treatment of liver disease comprising the novel strain Bifidobacterium longum subsp. infantis DS2696.
[0002] The liver is a vital organ responsible for various metabolic processes, detoxification, decomposition, synthesis, and secretion in the body. Its functions can be examined in detail as follows: First, the liver manages energy metabolism, metabolizing all nutrients absorbed from food into substances capable of producing energy, which are then supplied to or stored throughout the body. Second, the liver synthesizes, stores, and distributes approximately 2,000 types of enzymes, albumin, coagulation factors, serum proteins, bile acids, phospholipids, and lipids such as cholesterol. Third, the liver excretes various metabolic byproducts into the duodenum via the bile ducts and plays a crucial role in maintaining life through its immune function. Finally, the liver performs detoxification and decomposition functions, eliminating drugs, toxic substances, and alcohol. However, this detoxification function can easily damage liver cells, potentially leading to drug-induced, toxic, or alcoholic liver diseases.
[0003] Fatty liver is a condition in which fat accumulates within liver cells. Medically, it refers to a pathological condition in which fat exceeds 5% of the total weight of the liver. Liver diseases including this are recognized as the second most serious cause of death among adults in their 40s and 50s in developed countries, after cancer.
[0004] Fatty liver can be broadly classified into alcoholic fatty liver disease caused by excessive drinking and metabolic dysfunction-associated steatotic liver disease (MASLD) caused by obesity, diabetes, hyperlipidemia, drugs, etc. Metabolic dysfunction-associated steatotic liver disease refers to a broad range of diseases, including simple fatty liver without an inflammatory response that occurs in patients who do not consume excessive amounts of alcohol, and diseases that progress through this, including inflammatory responses in hepatocytes, liver fibrosis, and cirrhosis.
[0005] Metabolic fatty liver disease can be broadly divided into hepatic steatosis (fatty liver) and metabolic dysfunction-associated steatohepatitis (MASH). Metabolic dysfunction-associated steatohepatitis is histologically defined as hepatic steatosis accompanied by lobular inflammation and hepatocyte injury (ballooning) in the presence or absence of fibrosis. Some patients with metabolic fatty liver disease progress to metabolic dysfunction-associated steatohepatitis (MASH), and there are various hypotheses regarding the mechanism of progression from simple fatty liver to steatohepatitis, including inflammation, endotoxins, and changes in the gut microbiome.
[0006] While hepatic steatosis does not progress to liver cirrhosis or liver cancer, metabolic disorder-related steatohepatitis can progress to cirrhosis and hepatocellular carcinoma (HCC); in developed countries, it is emerging as the most significant cause of liver cancer, surpassing hepatitis B and C. Although fatty liver and metabolic disorder-related steatohepatitis are easily confused by the general public due to their names and classifications, they should be regarded as distinct diseases with completely different medical and clinical causes, prognoses, and treatments.
[0007] Metabolic fatty liver disease (MASLD) is a global cause of chronic liver disease that is steadily increasing worldwide alongside the rise in obesity and metabolic syndrome. In the United States, it is estimated that approximately 24% of the population has MASLD, with about one-third of them having metabolism-related steatohepatitis. MASLD is associated with various comorbidities, including metabolic syndrome, diabetes, and cardiovascular disease (CVD). MASLD is the fastest-growing cause of hepatocellular carcinoma among major liver diseases and conditions requiring liver transplantation. While significant progress has been made in elucidating the pathogenesis of MASLD, identifying therapeutic targets, and discovering and developing novel drugs, unmet clinical needs remain for patients with metabolism-related steatohepatitis, or MASH. Recently, a thyroid hormone receptor-beta agonist (Resmetirom) developed by Madrigal Pharmaceuticals became the first MASH treatment to receive FDA approval; however, clinical trial results suggest that it is difficult to consider it a full-fledged treatment for MASH.
[0008] To date, there is no established treatment for metabolic fatty liver disease, as it is associated with various factors such as diabetes, obesity, coronary artery disease, and lifestyle habits. Consequently, only exercise and dietary therapy are currently recommended for the treatment of fatty liver.
[0009] The inventors completed the present invention by confirming a significant therapeutic effect on metabolic dysfunction-associated steatohepatitis of a composition containing a novel strain according to the present invention in a situation where there is no effective treatment for metabolic dysfunction-associated steatohepatitis (MASH).
[0010] Another object of the present invention is to provide Bifidobacterium longum subsp. infantis DS2696 KCTC15878BP.
[0011] Another object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of liver disease comprising Bifidobacterium longum subsp. infantis DS2696 KCTC15878BP.
[0012] Another objective of the present invention is to provide a food composition for the prevention or improvement of liver disease comprising Bifidobacterium longum subsp. infantis DS2696 KCTC15878BP.
[0013] Each description and embodiment disclosed in this invention may be applied to other descriptions and embodiments. That is, all combinations of the various elements disclosed in this invention fall within the scope of this invention. Furthermore, the scope of this invention cannot be considered limited by the specific descriptions provided below. In order to prevent confusion regarding redundant content, the description of redundant content will be omitted below. In other words, the content of the invention is not limited solely to the following descriptions, and the content of the invention should be interpreted in accordance with the overall context of the invention.
[0014] The present invention will be described in detail below.
[0015] The present invention provides Bifidobacterium longum subsp. infantis DS2696 (Depository: Korea Research Institute of Bioscience and Biotechnology, Deposit date: April 16, 2024, Accession number: KCTC15878BP).
[0016] The 16S rRNA sequence for the identification and classification of the Bifidobacterium longum subsp. infantis DS2696 strain of the present invention is as shown in SEQ ID NO. 1 attached to this specification. Accordingly, the Bifidobacterium longum subsp. infantis DS2696 strain of the present invention may contain the 16S rRNA of SEQ ID NO. 1.
[0017]
[0018] The strain according to the present invention may be used in various forms, such as live cells, dead cells, cultures, lysates, or extracts. The strain according to the present invention exhibits results equivalent to or greater than the aforementioned effects, regardless of whether it takes any form under conditions containing the strain.
[0019] Live cells refer to bacteria that are still alive, while dead cells refer to bacteria that have been cultured under certain conditions and then separated and extracted from effective components through methods such as heat drying, pressure treatment, or drug treatment.
[0020] The above culture refers to a product obtained by culturing lactic acid bacteria in a known liquid medium or solid medium, and is a concept that includes a strain according to the present invention. The above product may include lactic acid bacteria. The above medium may be selected from a known liquid medium or solid medium, and may be, for example, MRS liquid medium, GAM liquid medium, MRS agar medium, GAM agar medium, BL agar medium, but is not limited thereto.
[0021] The above-mentioned crushed material refers to a form obtained by separating and processing live cells, dead cells, or cultures thereof through mechanical or chemical methods. For example, the crushed form can be produced using bead mills, presses, sonicators or microfluidizers, enzymatic treatment, etc.
[0022] The above extract refers to a viable cell, a dead cell, and / or pulverized cell obtained by a commonly known extraction method (obtained by extracting with a known extraction solvent (e.g., water, C1 to C4 alcohol (e.g., methanol, ethanol, propanol, isopropanol, butanol, etc.)).
[0023] A viable cell of Bifidobacterium longumsubsp.infantisDS2696 or a culture thereof according to the present invention as a metabolite, at least Hypoxanthine, N 1 -Acetylspermidine, Uracil, S-Allylcysteine, N 1 ,N 8-Diacethlspermidine, Ornithine, O-Acetylserine, 2-Phenylethylamine, N 8 It comprises at least one selected from the group consisting of -Acethlspermidine, o-Hydroxybenzoic acid, Thiamine, N-Methylglutamic acid, Tyramine, and Xanthine. More specifically, the viable cells of Bifidobacterium longumsubsp.infantisDS2696 or a culture thereof according to the present invention contain the aforementioned metabolites in a high proportion compared to the known Bifidobacterium longumsubsp.infantis.
[0024] In particular, the viable Bifidobacterium longumsubsp.infantisDS2696 cell or culture thereof according to the present invention comprises at least one selected from the group consisting of 2-phenylethylamine, hydroxybenzoic acid, ornithine, and tyamine.
[0025] According to one embodiment of the present invention, the strain of Bifidobacterium longum subsp. infantis DS2696 of the present invention exhibits effects of inhibiting gene expression related to fat accumulation and intracellular inflammation and improving gene expression related to liver function in a metabolic disorder-associated fatty liver disease model.
[0026] According to one embodiment of the present invention, the strain of Bifidobacterium longum subsp. infantis DS2696 of the present invention exhibits the effect of inhibiting fat accumulation and inflammation-related gene expression within hepatocytes in liver tissue, and can be usefully used for the prevention or treatment of liver disease.
[0027] Accordingly, the present invention provides a pharmaceutical composition for the prevention or treatment of liver disease comprising Bifidobacterium longum subsp. infantis DS2696.
[0028] The Bifidobacterium longum subsp. infantis DS2696 strain included in the above pharmaceutical composition for the prevention or treatment of liver disease may include the 16S rRNA of SEQ ID NO. 1.
[0029] The strain of Bifidobacterium longumsubsp. infantisDS2696 included in the above-mentioned pharmaceutical composition for the prevention or treatment of liver disease may be used in various forms, such as live cells, dead cells, cultures, lysates, or extracts, and is not limited thereto. Furthermore, the pharmaceutical composition for the prevention or treatment of liver disease according to the present invention exhibits results equivalent to or greater than the aforementioned level of effect, regardless of the form in which the strain of Bifidobacterium longumsubsp. infantisDS2696 is used.
[0030] According to one embodiment of the present invention, the liver disease in the pharmaceutical composition for preventing or treating liver disease according to the present invention may be any one selected from the group consisting of liver fibrosis, cholesterolosis, cirrhosis, viral and alcoholic hepatitis, Wilson's disease, hemochromatosis, steatosis, metabolic disorder fatty liver disease (MASLD), and metabolic disorder-associated steatohepatitis (MASH).
[0031] In the present invention, “metabolic dysfunction-associated steatotic liver disease (MASLD)” refers to a disease in which fat accumulates in liver tissue regardless of significant alcohol intake. Metabolic dysfunction-associated steatotic liver is classified into primary and secondary types depending on the cause; the primary type is caused by hyperlipidemia, diabetes, or obesity, which are characteristics of metabolic syndrome, while the secondary type is caused by nutritional causes (rapid weight loss, starvation, bowel bypass surgery, etc.), various drugs, toxic substances (poisonous mushrooms, bacterial toxins, etc.), metabolic causes, and other factors. In the present invention, metabolic dysfunction-associated steatotic liver disease encompasses both primary and secondary types.
[0032] In the present invention, “simple fatty liver” is also referred to as simple hepatic steatosis and means a state of steatosis in which more than 5% of fat, which is the proportion of fat in a normal liver, is accumulated. Simple fatty liver is distinguished from steatohepatitis, which is accompanied by inflammation, because it is not accompanied by inflammation and therefore does not cause liver cell damage.
[0033] In the present invention, “metabolic dysfunction-associated steatohepatitis (MASH)” refers to an advanced type of metabolic dysfunction fatty liver disease, signifying a state in which inflammation of hepatocytes is induced by fatty liver, and exhibits tissue changes such as inflammation and necrosis, which are histologically similar pathologies to alcoholic liver disease in individuals without significant alcohol intake. Metabolic dysfunction-associated steatohepatitis may be accompanied by fibrosis due to tissue damage, along with abnormal fat accumulation or deposition (steatosis) in the liver, inflammation and necrosis of hepatocytes, and, as it is a progressive disease, it can progress from fatty liver to steatohepatitis, liver fibrosis, liver cirrhosis, and even liver cancer.
[0034] In the present invention, “liver fibrosis” refers to a condition in which extracellular matrix proteins, including collagen, are excessively accumulated in liver tissue. Liver fibrosis is a fibrotic phenomenon that occurs due to the continuous destruction of liver cells and damage to liver tissue caused by various factors, and is caused by an imbalance in which the production of extracellular matrix increases while its degradation is relatively reduced. If liver fibrosis persists, it can develop into liver cirrhosis.
[0035] In the present invention, “liver cirrhosis” refers to liver cirrhosis, also known as liver fibrosis, and signifies a decline in liver function as normal liver tissue is transformed into fibrotic tissue, such as regenerative nodules, due to chronic inflammation, thereby failing to perform its original functions properly. Although symptoms are not distinct in the early stages of liver cirrhosis, if liver damage progresses severely, complications such as jaundice, ascites, hepatic encephalopathy, and variceal bleeding may occur.
[0036] In the present invention, the liver disease may be any one selected from the group consisting of, for example, metabolic disorder fatty liver disease (MASLD), metabolic disorder-associated steatohepatitis (MASH), liver fibrosis, and liver cirrhosis.
[0037] In the present invention, “prevention” refers to any act of suppressing liver disease or related diseases or delaying their onset through the administration of a composition according to the present invention. Furthermore, in the present invention, “treatment” refers to clinical intervention to alter the natural processes of an individual or cell to be treated, and this may be performed during the progression of a clinical pathological condition or to prevent it. The intended therapeutic effects include preventing the onset or recurrence of the disease, alleviating symptoms, reducing all direct or indirect pathological consequences associated with the disease, preventing metastasis, reducing the rate of disease progression, alleviating or temporarily resolving the disease state, reversing the condition, or improving the prognosis. Preferably, the present invention includes any act of improving the course of liver disease through the administration of a composition according to the present invention.
[0038] The pharmaceutical composition of the present invention may be used in the form of a general pharmaceutical formulation and may additionally include a suitable carrier, excipient, diluent, or combination thereof that is commonly used in the manufacture of pharmaceutical compositions. A composition containing a pharmaceutically acceptable carrier may be formulated into various oral or parenteral dosage forms, and when formulated, it may be prepared using a diluent or excipient such as a commonly used filler, extender, binder, wetting agent, disintegrant, surfactant, etc.
[0039] The above pharmaceutically acceptable carriers include, but are not limited to, those commonly used in the art, such as lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc.
[0040] When the pharmaceutical composition of the present invention is formulated into an oral solid dosage form, it includes tablets, pills, powders, granules, capsules, etc., and such solid dosage forms may be prepared by including at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition, lubricants such as magnesium stearate, talc, etc., may be included in addition to simple excipients, but are not limited thereto.
[0041] When the pharmaceutical composition of the present invention is formulated as an oral liquid formulation, it includes suspensions, liquid formulations, emulsions, syrups, etc., and in addition to commonly used simple diluents such as water and liquid paraffin, various excipients, such as humectants, sweeteners, flavorings, and preservatives, may be included, but are not limited thereto.
[0042] When the pharmaceutical composition of the present invention is formulated as a parenteral preparation, it includes a sterile aqueous solution, a non-aqueous solvent, a suspension agent, an emulsion, a lyophilized preparation, a suppository, etc. As non-aqueous solvents and suspension agents, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used, but are not limited thereto. As bases for suppositories, witepsol, macrogol, tween 61, cacao oil, laurin oil, glycerogelatin, etc. may be used, but are not limited thereto.
[0043] The pharmaceutical composition of the present invention can be administered as a single or multiple doses in pharmaceutically effective amounts.
[0044] In the present invention, the term “pharmaceuticalally effective amount” means an amount sufficient to prevent or treat a disease with a reasonable benefit / risk ratio applicable to medical prevention or treatment, and the effective dose level may be determined based on factors including the severity of the disease, the activity of the drug, the patient’s age, weight, health, gender, the patient’s sensitivity to the drug, the time of administration of the composition used, the route of administration and elimination rate, the duration of treatment, drugs combined or used concurrently with the composition used, and other factors well known in the medical field.
[0045] The pharmaceutical composition of the present invention may be administered to mammals such as rats, mice, livestock, and humans by various routes, for example, oral administration, intradural, inner ear, abdominal cavity or vein, muscle, subcutaneous, intrauterine, dura mater, sublingual, or intracerebrovascular injection, but is not limited thereto.
[0046] The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. Additionally, the pharmaceutical composition of the present invention may be administered as a single or multiple doses. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects, taking all of the above factors into consideration, and this can be easily determined by a person skilled in the art.
[0047] In the present invention, "subject" includes an animal or human whose symptoms may be improved by the administration of the pharmaceutical composition according to the present invention. By administering the therapeutic composition according to the present invention to an individual, liver disease can be effectively prevented and treated.
[0048] In the present invention, "administration" means introducing a specific substance into a human or animal by any appropriate method, and the route of administration of the composition of the present invention may be oral or parenteral through any general route as long as it can reach the target tissue. Additionally, the composition of the present invention may be administered by any device capable of delivering the active ingredient to target cells.
[0049] In another embodiment for achieving the above objective, the present invention provides a method for preventing or treating liver disease comprising the step of administering the above-mentioned Bifidobacterium longumsubsp. infantisDS2696 KCTC15878BP to an individual in need thereof. Preferably, the present invention provides a method for preventing or treating metabolic fatty liver disease comprising the step of administering the above-mentioned Bifidobacterium longumsubsp. infantisDS2696 KCTC15878BP to an individual in need thereof.
[0050] In another embodiment for achieving the above objective, the present invention provides a method for preventing or treating liver disease comprising the step of administering the above composition to an individual in need thereof. Preferably, the present invention provides a method for preventing or treating metabolic fatty liver disease comprising the step of administering the above composition to an individual in need thereof.
[0051] In the present invention, the term “individual” refers to any animal that has developed or may develop liver disease, and typically may be an animal capable of exhibiting beneficial effects through treatment using the composition of the present invention; however, any individual having symptoms of liver disease or having the potential to have such symptoms is included without limitation. As described above, liver disease can be effectively prevented or treated by administering the pharmaceutical composition of the present invention to an individual.
[0052] The present invention provides a pharmaceutical composition comprising Bifidobacterium longum subsp. infantis DS2696 for the prevention or treatment of liver disease.
[0053] The present invention provides a use of Bifidobacterium longum subsp. infantis DS2696 in the manufacture of a drug for the prevention or treatment of liver disease.
[0054] The present invention provides a use for Bifidobacterium longum subsp. infantis DS2696 for the prevention or treatment of liver disease.
[0055] The present invention provides a food composition for preventing or improving liver disease comprising Bifidobacterium longum subsp. infantis DS2696.
[0056] The Bifidobacterium longum subsp. infantis DS2696 strain included in the above food composition for preventing or improving liver disease may include the 16S rRNA of SEQ ID NO. 1.
[0057] The strain of Bifidobacterium longumsubsp. infantisDS2696 included in the above-mentioned food composition for the prevention or improvement of liver disease may be used in various forms, such as live cells, dead cells, cultures, lysates, or extracts, and is not limited thereto. Furthermore, the food composition for the prevention or improvement of liver disease according to the present invention exhibits results equivalent to or greater than the aforementioned effects, regardless of the form in which the Bifidobacterium longumsubsp. infantisDS2696 strain takes on.
[0058] According to one embodiment of the present invention, the liver disease in the food composition for preventing or improving liver disease according to the present invention may be any one selected from the group consisting of liver fibrosis, cholesterolosis, cirrhosis, viral and alcoholic hepatitis, Wilson's disease, hemochromatosis, steatosis, metabolic disorder fatty liver disease (MASLD), and metabolic disorder-associated steatohepatitis (MASH).
[0059] When the food composition of the present invention is used as a food additive, the food composition may be added as is or used together with other foods or food ingredients, and may be used appropriately according to conventional methods. Generally, when manufacturing food or beverages, the food composition of the present invention may be added in an amount of 15% by weight or less, preferably 10% by weight or less, relative to the raw materials.
[0060] There are no specific restrictions on the types of the above-mentioned foods. Examples of foods to which the above-mentioned substance may be added include meat, sausage, bread, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and include all foods in the conventional sense.
[0061] The above-mentioned beverage may contain various flavoring agents or natural carbohydrates as additional ingredients. The aforementioned natural carbohydrates may include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and natural sweeteners such as dextrin and cyclodextrin, or synthetic sweeteners such as saccharin and aspartame. The proportion of the above-mentioned natural carbohydrates may be appropriately determined by the choice of a person skilled in the art.
[0062] In addition to the above, the food composition of the present invention may contain various nutritional agents, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. Furthermore, the food composition of the present invention may contain fruit pulp for the production of natural fruit juices, fruit juice beverages, and vegetable beverages. These ingredients may be used independently or in combination. The proportion of these additives may also be appropriately selected by those skilled in the art.
[0063] The food composition of the present invention may also be used as a health functional food. A health functional food is a food that emphasizes the biological regulatory function of food and is a food to which added value is imparted by utilizing physical, biochemical, or biotechnological methods to act and express for a specific purpose. The food composition of the present invention may be used as a health functional food. The components of such a health functional food are designed and processed to fully exert biological regulatory functions related to biological defense, regulation of body rhythms, and prevention and recovery of diseases on the body, and may contain food-acceptable food additives, sweeteners, or functional ingredients. When the strain of the present invention is used as a health functional food (or a health functional beverage additive), the novel strain may be added as is, used in combination with other foods or food ingredients, or used appropriately according to conventional methods. The mixing amount of the strains may be appropriately determined according to the purpose of use (prevention, health or improvement, therapeutic treatment).
[0064] According to one embodiment of the present invention, the pharmaceutical composition and food composition according to the present invention exhibit an inhibitory effect on fat accumulation and intracellular inflammation-related gene expression in a metabolic disorder-associated fatty liver disease model.
[0065] According to one embodiment of the present invention, the pharmaceutical composition and food composition according to the present invention exhibit the effect of inhibiting fat accumulation in liver tissue and inflammation-related gene expression within liver cells, and can be usefully used for the prevention or treatment of liver disease.
[0066] Embodiments of the present invention may be modified in various different forms, and the scope of the present invention is not limited to the embodiments described below. Furthermore, embodiments of the present invention are provided to more fully explain the invention to those with average knowledge in the relevant technical field. Moreover, throughout this specification, the term “comprising” any component means that, unless specifically stated otherwise, it does not exclude other components but may include additional components.
[0067] The Bifidobacterium longumsubsp. infantisDS2696 strain according to the present invention and a composition containing the same exhibit excellent efficacy in inhibiting fat accumulation in the liver and suppressing inflammation-related gene expression, and can be usefully used for the prevention or treatment of liver disease.
[0068] Figure 1a illustrates a method for inducing a three-dimensional MASLD cell model by co-culturing parenchymal stem cells and hepatic stellate cells in a 1:1 ratio. Figure 1b shows the measurement of changes in morphological cell size to confirm the intracellular ballooning effect after inducing simple steatosis and steatohepatitis (MASH) models at different progression stages of the MASLD cell model. Figure 1c is a graph quantifying the degree of lipid accumulation at different progression stages of MASLD, confirmed through fluorescent staining of intracellular lipids. Figure 1d is a graph comparing the expression levels of inflammation-related genes (IL-1β, IL-6, IL-8, MCP1), which are key characteristics of MASH, according to progression stages in the MASLD cell model using qRT-PCR with the results of a control group.
[0069] Figures 2a and 2b are graphs comparing the expression levels of genes related to triglyceride accumulation and inflammation confirmed by qRT-PCR after treatment with probiotic cultures (DS0802, DS0430, DS1038, DS2696, DS0974, DS2719, DS3249) along with the induction of a 3D structured MASH cell model, which was the technique used for initial screening. Figure 2c shows the results of selecting two strains out of seven strains, and Figure 2d shows the results of genomic analysis for the culture of Bifidobacterium longumsubsp. infantisDS2696 among the finally selected strains.
[0070] Figure 3a illustrates a method for confirming the therapeutic effects of MASH on Bifidobacterium longumsubsp. infantis DS2696 culture medium and homologous strains classified as B. infantis (DS1685, DS2699). Figures 3b and c illustrate the changes in intracellular lipid accumulation and the expression levels of inflammation marker genes and liver function marker genes (Albumin, HNF4α) confirmed by qRT-PCR after applying therapeutic treatment conditions by co-treating the basic culture medium with Bifidobacterium longumsubsp. infantis DS2696 culture medium or homologous strains following MASH induction.
[0071] Figure 4a illustrates a method for confirming the prophylactic effect of MASH on Bifidobacterium longumsubsp. infantis DS2696 culture medium and homologous strains classified as B. infantis (DS1685, DS2699). Figures 4b and 4c illustrate the results of confirming changes in intracellular lipid accumulation and the levels of inflammation and liver function-related gene expression by qRT-PCR after applying prophylactic treatment conditions by co-treating the MASH induction medium with Bifidobacterium longumsubsp. infantis DS2696 culture medium or homologous strains following MASH induction.
[0072] Figure 5 is a figure showing the expression levels of inflammation-related proteins after treatment with a culture medium of Bifidobacterium longum subsp. infantis DS2696.
[0073] Figure 6 shows the morphological changes in liver tissue and liver function indicators after administering Bifidobacterium longumsubsp. infantisDS2696 culture medium and live bacteria to confirm the improvement effect on metabolic dyslipidemia induced by a Methionine / Choline Deficient (MCD) diet. Figure 6a shows the degree of lesions and fat accumulation within the liver tissue by H&E staining and Oil Red O staining. Figure 6b shows the reduction in triglyceride accumulation within the liver tissue and changes in the expression of liver function-related markers in the serum.
[0074] Figure 7 is a figure showing the results of identifying metabolites of the culture medium of Bifidobacterium longum subsp. infantis DS2696.
[0075] Figure 8 is a graph showing the reduction of triglyceride accumulation in fatty liver disease with metabolites specific to probiotic culture medium (Bifidobacterium longum subsp. infantis DS2696), and is a figure showing the results of 2-Phenylethylamine, Hydroxybenzoic acid, Ornithine, and Tyramine by expressing the gene expression levels involved in inflammation and liver function as a heatmap.
[0076] The present invention will be explained in more detail below through experimental examples and embodiments. However, the following experimental examples and embodiments are provided merely to facilitate a better understanding of the present invention, and the scope of the present invention is not limited by the experimental examples and embodiments.
[0077] Experimental Example 1. Isolation of Probiotics and Preparation of Culture Medium
[0078] Probiotics were isolated from feces, kimchi, and fermented pork. Each sample was serially diluted in Man, Rogosa, and Sharpe (MRS) medium, plated onto agar plates, and incubated at 37°C. A library was constructed by isolating 336 single colonies from the cultured agar plates and identifying them via 16S rRNA sequencing. Each probiotic was inoculated into MRS medium and cultured at 37°C for 24 to 36 hours, until the stationary phase was reached. The culture medium was centrifuged at 3,000 xg for 10 minutes. For pasteurization, the samples were stored at 65°C for 30 minutes, passed through a 0.22 µm filter, and stored at -80°C for use in the experiment.
[0079] Experimental Example 2. Cell culture of parenchymal stem cell lines and hepatic stellate cell lines
[0080] HepaRG (parenchymal hepatocyte cell line) was cultured and hepatocyte differentiation induced according to the guidelines of BioPredic International. LX-2 (hepatic stellate cell line) was cultured according to the guidelines of Merk Millipore.
[0081] Experimental Example 3. Induction of a 3D MASH cell model through co-culture of parenchymal stem cells and hepatic stellate cells
[0082] A three-dimensional cell model structured through HepaRG and LX-2 co-culture was prepared using a micro-mold on an agarose gel (UltraPure) according to MicroTissues guidelines TM 3D Petri Dish solidified with Agarose and Invitrogen ® Each cell line was counted to 2,500 cells and inoculated at a 1:1 ratio, and cultured in LX-2 culture medium (DMEM (Lonza Ltd., Basel, Switzerland), 2% bovine serum (FBS, Gibco), 1% penicillin-streptomycin (PS, Gibco)) for 3 days to create a cell model with a three-dimensional structure.
[0083] The specific preparation method is shown in Fig. 1(a). To induce a 3D MASH cell model, the cells were cultured for a total of 10 days in MASH induction medium (DMEM (Lonza Ltd., Basel, Switzerland), 2% bovine serum (FBS, Gibco), 1% Penicillin-Streptomycin (PS, Gibco), 1 mM BSA (Sigma-Aldrich)-conjugated Oleic Acid (OA, Sigma-Aldrich), 1 ng / ml TNFα (Sigma-Aldrich)). As a result of analyzing the characteristics of the induced 3D MASH cell model, it was confirmed that the cell model possessing MASH characteristics was realized by observing an increase in the cell ballooning effect, increased triglycerides, and increased expression of inflammatory markers, which are the major morphological characteristics of the 3D MASH model.
[0084] Experimental Example 4. Establishment of therapeutic and preventive treatment conditions for probiotic culture solutions
[0085] To verify the MASH improvement effect of the probiotic culture solution under therapeutic and preventive treatment conditions, the experimental schematics of Figure 3a and Figure 4a were used.
[0086] Under therapeutic treatment conditions, after inducing a 3D MASH model, the therapeutic effect of probiotic culture was confirmed by treating the basal medium (DMEM / 2% FBS / 1% PS) from which lipids (OA) and inflammatory factors (TNFα) had been removed for 4 days.
[0087] Under prophylactic treatment conditions, after inducing a 3D MASH model, the probiotic culture was treated with MASH induction medium (DMEM / 2% FBS / 1% PS / 1 mM OA / 1 ng / ml TNFα) for 4 days to confirm the preventive effect against MASH.
[0088] To verify the MASH-improving effects of probiotic cultures under therapeutic and prophylactic treatment conditions, the efficacy of the probiotic cultures was evaluated by treating with obeticholic acid (OCA), which is being developed as a clinical candidate drug for MASH, as a positive control.
[0089] Experimental Example 5. Measurement of triglyceride accumulation in a MASH cell model through treatment with probiotic culture medium
[0090] Measurement of triglyceride accumulation in the MASH cell model was performed using Promega's Triglyceride-Glo TMExperiments were performed according to guidelines using the Assay (Promega, Madison, WI, USA) technique. Fat measurement quantitatively measured the amount of fat accumulation in a MASH cell model based on the principle that glycerol, converted from triglyceride by lipase enzymes, binds to luciferase after oxidation to produce light.
[0091] After inducing a 3D MASH cell model, the cells were treated for 4 days with a negative control (MRS medium, microbial culture medium) and 1% probiotic culture solution. After 4 days, spheroids were separated from the 3D Petri dishes, washed with PBS, and one spheroid was transferred per well of a 96-well plate. Then, Triglyceride-Glo according to the instructions TM The plate, after the luminescence was completed through the assay reaction, was measured using a luminescence plate reader to quantify the degree of fat accumulation. The values for each microbial culture treatment group were calculated relative to 100% of the values for the negative control (MRS medium) treatment group and are shown as in Figures 3 and 4.
[0092] Experimental Example 6. Quantitative real-time RT-PCR (qRT-PCR) of mRNA expression in a MASH cell model via probiotic culture treatment
[0093] Real-time RT-PCR (qRT-PCR) was performed to measure the degree of inhibition of inflammation expression in a 3D MASH cell model by treatment with probiotic culture medium. RNA from the negative control (MRS medium) and 3D MASH cell models treated with probiotic culture medium was obtained from PureLink according to the manufacturer's instructions. TMRNA was extracted using the RNA Mini Kit (Invitrogen, Carlsbad, CA, USA). Reverse transcriptase-based cDNA synthesis and amplification were performed using the High-Capacity cDNA Reverse Transcription Kit (Invitrogen, Carlsbad, CA, USA) and the SYBR Green PCR Master Mix (Applied Biosystems, Foster City, USA). Real-time PCR was performed using the StepOnePlus TM The tests were performed using an instrument (Applied Biosystems). The cycling conditions for Real-Time PCR were as follows: to activate the DNA polymerase, the sample was heated at 95°C for 10 minutes; for PCR amplification, the reaction was repeated 40 times, consisting of denaturation at 95°C for 15 seconds, annealing at 60°C for 1 minute, and a chain reaction at 72°C for 30 seconds. SYBR Green technology was used to quantify the results. Expression levels were normalized to 18S rRNA. All experiments were repeated three times, and the CT values for each target gene were calculated using software provided by the manufacturer. The nucleotide sequences of the primers used are shown in Table 1.
[0094] Gene Primer (Forward) (5'-3') Primer (Reverse) (5'-3') 18S rRNA ACCCGTTGAACCCCATTCGTGA(SEQ No. 2) GCCTCACTAAACCATCCAATCGG(SEQ No. 3) IL-1βCCACAGACCTTCCAGGAGAATG(SEQ No. 4) GTGCAGTTCAGTGATCGTACAGG(SEQ No. 5) IL-6AGACAGCCACTCACCTCTTCAG(SEQ No. 6) TTCTGCCAGTGCCTCTTTGCTG(SEQ No. 7) IL-8GAGAGTGATTGAGAGTGGACCAC(SEQ No. 8) CACAACCCTCTGCACCCAGTTT(SEQ No. 9) MCP1AGAATCACCAGCAGCAAGTGTCC(SEQ No. 10) TCCTGAACCCACTTCTGCTTGG(SEQ No. 11)ALBGATGAGATGCCTGCTGACTTGC(Sequence No. 12)CACGACAGAGTAATCAGGATGCC(Sequence No. 13)HNF4aGGTGTCCATACGCATCCTTGAC(Sequence No. 14)AGCCGCTTGATCTTCCCTGGAT(Sequence No. 15)
[0095] Experimental Example 7. Quantitative Analysis of Changes in Protein Expression in a MASH Cell Model via Probiotic Culture Treatment
[0096] To measure the inflammation-related inhibitory effect, a key characteristic of MASH, under therapeutic treatment conditions involving probiotic culture, the protein concentration in the samples was quantified using the ELISA (Enzyme-Linked Immunosorbent Assay) method. Under therapeutic treatment conditions, the protein-level anti-inflammatory effects of the negative control (MRS) and the 3D MASH cell model treated with probiotic culture were measured using the SimpleStep® ELISA kit (Abcam, Cambridge, UK) for IL-1β, IL-6, IL-8, and MCP1 according to the instructions of the ELISA kit manufacturer. After inducing a 3D MASH cell model, the cell culture medium treated with a negative control (MRS medium) and a probiotic culture medium (Bifidobacterium longumsubsp.infantisDS2696) for 4 days was recovered and added to a blocking plate to bind antigen proteins at room temperature for 1 hour, then washed with PBS, and the absorbance was measured to quantify the degree of inflammation expression of IL-1β, IL-6, IL-8, and MCP1 factors.
[0097] Experimental Example 8. Confirmation of the effects of probiotic culture medium and live bacteria on reducing intrahepatic triglycerides and improving liver function in an animal model of metabolic disorder fatty liver disease.
[0098] To confirm the triglyceride-reducing and liver function-improving effects of probiotic culture solutions on metabolic fatty liver disease, the following experiment was conducted. Metabolic fatty liver disease was induced in 8-week-old male mice weighing 20–25 kg via an MCD (Methionine / Choline deficient) diet, and the experimental group was fed the MCD diet along with DS2696 culture solution (0.01 ml / g / d) and live bacteria (2×10⁶ 8CFU / mouse) was orally administered once daily for 6 weeks. Hepatic triglyceride levels and serum liver function markers AST, ALT, and ALP were quantified in orally administered mice.
[0099] Example 1. Method for manufacturing a 3D MASH disease model and characterization analysis
[0100] Figure 1 shows the method for manufacturing a three-dimensional MASH disease model and the results of the characterization analysis prepared according to the method of Experimental Example 3. Figure 1 is a figure showing the characterization analysis of the MASH disease cell model by fabricating a three-dimensional fatty liver disease model to establish a metabolic disorder fatty liver disease cell model, and confirming morphological changes showing a ballooning effect, increased triglyceride accumulation, and increased expression of inflammatory markers.
[0101] Specifically, Figure 1a is an experimental schematic diagram showing the method for preparing a three-dimensional structured MASH disease model for a total of 10 days from day 3 to day 13, after co-culturing HepaRG and LX-2 on day 0. In addition, it shows the morphological changes exhibiting a balloon effect in the three-dimensional structured MASH disease model according to the experiment.
[0102] Figure 1b shows the measured diameters (μm) of normal cells (Control), simple fatty liver cells (Steatosis), and a MASH disease model (MASH). Since the diameter increased in the 3D structure of the MASH disease model, it was confirmed that a cell model possessing MASH characteristics was realized due to the balloon effect.
[0103] Figure 1c shows the morphological examination of changes in triglyceride accumulation at each stage of MASLD progression using the BODIPY staining technique to confirm the degree of intracellular triglyceride accumulation, and for quantitative values, Triglyceride-Glo TMUsing the assay (Promega, Madison, WI, USA), the change in the ratio of triglyceride accumulation (TG accumulation) relative to the control group was measured. Since the triglyceride accumulation increased by approximately three times in the 3D structured MASH disease model, it was confirmed that a cell model possessing MASH characteristics was realized (CON: control group, Steatosis: simple fatty liver cells, MASH: 3D structured MASH disease model).
[0104] Figure 1d shows the relative mRNA expression levels of IL-1β, IL-6, IL-8, and MCP1 measured using quantitative real-time RT-PCR (qRT-PCR). The increased relative mRNA expression levels in the 3D structural MASH disease model confirmed that a cell model possessing MASH characteristics was realized (CON: control, Steatosis: simple fatty liver cells, MASH: 3D structural MASH disease model).
[0105] Example 2. Verification of reduction in MASH fat accumulation by probiotic culture medium
[0106] Figure 2 shows the selection of strains effective in improving MASH by treating with probiotic cultures in combination with the induction of a MASH cell model to primarily screen probiotic cultures that affect the improvement effect of MASH. Figure 2a shows the reduction effect of seven types of probiotic cultures (DS0802, DS0430, DS1038, DS2696, DS0974, DS2719, DS3249) on fat accumulation in MASH cells. Figure 2b shows the results of confirming changes in inflammation-related gene expression, a major characteristic of MASH, for seven types of probiotic cultures through qPCR analysis, and confirming that inflammation-related gene expression was significantly reduced in the treatment groups of two strains, Bifidobacterium longum subsp. infantis DS2696 and Enterococcus faecalis DS2719. Consequently, the two strains DS2696 and DS2719 were finally selected as strains that influence the improvement of MASH (Figure 2c). Figure 2d shows that through genomic analysis results, Bifidobacterium longumsubsp. infantis DS2696 was confirmed to be a novel strain, as it showed high genomic similarity to Bifidobacterium longumsubsp. infantis JCM7010 but an Average Nucleotide Identity (ANI) value of 98.52%.
[0107] Table 2 shows the nucleotide-level genomic similarity between species of the same taxonomic group measured through ANI analysis between species of the same taxonomic group provided in the NCBI database, commissioned to MACROGEN Inc. To identify species or strain information, ANI analysis was performed using BLASTN on taxa of reference sequences matching contig1.
[0108]
[0109] Ranking is in order of highest ANI value, similar genome is the name of the species with the highest ANI value, ANI(%) is the percentage of association at the whole genome level, and Aln.Cov(%) is alignment coverage, representing the percentage of coverage by assembly sequence alignment relative to the comparison genome.
[0110] Table 3 shows the results of predicting the locations of protein genes after the whole genome was assembled using Prokka. The numbers in Table 3 indicate the number of each item.
[0111]
[0112] Example 3. Verification of reduction in MASH lipid accumulation and improvement in inflammation and liver function-related expressions by probiotic culture medium under therapeutic treatment conditions
[0113] Figure 3 shows the results of confirming the therapeutic effect of probiotics on MASH by treating a basic medium from which lipids (OA) and inflammatory factors (TNFα) were removed after inducing a MASH cell model. In this case, the MRS treatment group was used as the negative control, and the OCA treatment group was used as the positive control for comparative analysis. Figure 3b confirms the efficacy of reducing lipid accumulation in the negative control (MRS medium), the probiotic culture treatment group (Bifidobacterium longumsubsp. infantisDS2696), and the OCA treatment group under therapeutic treatment conditions. Furthermore, qPCR analysis was performed to confirm the expression of inflammation-related genes and liver function-related genes, which are key characteristics of MASH. The results showed a significant decrease in the expression of inflammation-related genes and a significant increase in the expression of liver function-related genes in the negative control (MRS medium), the probiotic culture treatment group (Bifidobacterium longumsubsp. infantisDS2696), and the OCA treatment group. Figure 3c shows that a comparative analysis was performed on a homologous strain of Bifidobacterium longumsubsp. infantis, and it was verified that Bifidobacterium longumsubsp. infantisDS2696 showed reduced triglyceride accumulation and inflammatory marker expression compared to the homologous strain.
[0114] Example 4. Verification of reduction in lipid accumulation of MASH and improvement in inflammation and liver function-related expressions by probiotic culture medium under preventive treatment conditions
[0115] Figure 4 illustrates the MASH-improving effect of probiotics under prophylactic treatment conditions by co-treatment with a probiotic culture medium and a MASH-inducing medium. In this case, the MRS treatment group was used as the negative control, and the OCA treatment group was used as the positive control for comparative analysis. Figure 4a confirms the efficacy of reducing lipid accumulation in the negative control (MRS medium), the probiotic culture treatment group (Bifidobacterium longumsubsp. infantisDS2696), and the OCA treatment group under prophylactic treatment conditions. Quantitative analysis of intracellular triglyceride accumulation revealed that even under prophylactic treatment conditions, a significant reduction in lipids was observed only in the Bifidobacterium longumsubsp. infantisDS2696 treatment group. Figure 4b illustrates the expression of genes related to inflammation and liver function, which are key characteristics of MASH, under prophylactic treatment conditions. Through qPCR analysis, significant decreases and increases in the expression of inflammation and liver function-related genes were confirmed in the negative control group (MRS medium), the probiotic culture treatment group (Bifidobacterium longumsubsp. infantisDS2696), and the OCA treatment group. Figure 4c shows a comparative analysis performed on a homologous strain of Bifidobacterium longumsubsp. infantis, and verified that Bifidobacterium longumsubsp. infantis DS2696 showed reduced triglyceride accumulation and inflammation marker expression compared to the homologous strain.
[0116] Example 5. Confirmation of reduction in inflammation-related protein expression by probiotic culture medium
[0117] Figure 5 shows the expression of inflammation-related proteins under conditions where a MASH cell model was induced by applying therapeutic treatment conditions, followed by treatment with a probiotic culture medium (Bifidobacterium longumsubsp. infantisDS2696) in a basic medium from which lipids (OA) and inflammatory factors (TNFα) were removed. Through ELISA analysis, it was confirmed that the protein expression of inflammation-related markers IL-1βIL-6, IL-8, and MCP1 was reduced in the probiotic culture-treated group (Bifidobacterium longumsubsp. infantisDS2696).
[0118] Example 6. Verification of triglyceride reduction and liver function improvement by DS2696 culture medium and live bacteria in an animal model of metabolic disorder and fatty liver disease.
[0119] Figure 6 illustrates the results of confirming the reduction in hepatic triglycerides and improvement in liver function by orally administering probiotic culture medium and live bacteria for 6 weeks using an animal model of metabolic dyslipidemia induced with fatty liver disease. Metabolic dyslipidemia was induced in 8-week-old male mice via an MCD (Methionine / Choline deficient) diet, and in the experimental group, DS2696 culture medium (0.01 ml / g) or live bacteria (2×10⁶) were administered along with the MCD diet. 8 CFU / mouse) was orally administered once daily for 6 weeks. The amount of hepatic triglyceride accumulation and blood AST, ALT, and ALP levels in orally administered mice were quantified.
[0120] As a result, it was confirmed that hepatic triglycerides and blood AST, ALT, and ALP levels elevated by the MCD diet were significantly reduced in the experimental group administered probiotic culture medium and live bacteria. In other words, it was confirmed that Bifidobacterium longumsubsp.infantisDS2696 according to the present invention can exhibit excellent efficacy as both live bacteria and culture medium.
[0121] Example 7. Comparative analysis of probiotic culture metabolites of homologous strains
[0122] To analyze the factors contributing to the effects of probiotic cultures on reducing triglycerides and improving inflammation in fatty liver disease, metabolite analysis was performed using probiotic cultures of homologous strains (DS1685, DS2699).
[0123] Figure 7 shows that metabolite analysis was performed on culture samples of B. infantis allogeneic strains (DS2696, DS2699, DS1685) using CE-TOFMS in two modes for cationic and anionic metabolites, commissioned to Human Metabolome Technologies, Inc. Peaks detected in the CE-TOFMS analysis were extracted using the automated integration software MasterHands (Keio University, Japan) to obtain peak information including m / z, migration time (MT), and peak area. Here, DS2699 and DS1685 are strains isolated from the feces of newborns, similar to DS2696.
[0124] Analysis results showed that 14 types of metabolites (Hypoxanthine, N) were present in high amounts in Bifidobacterium longumsubsp.infantisDS2696 compared to homologous strains. 1 -Acetylspermidine, Uracil, S-Allylcysteine, N 1 ,N 8 -Diacethlspermidine, Ornithine, O-Acetylserine, 2-Phenylethylamine, N 8 -Acethlspermidine, o-Hydroxybenzoic acid, Thiamine, N-Methylglutamic acid, Tyramine, Xanthine) were identified.
[0125] Example 8. Confirmation of the effects of probiotic culture metabolites on reducing triglyceride accumulation in MASH and improving inflammation and liver function.
[0126] Figure 8 shows the results for 2-Phenylethylamine, Hydroxybenzoic acid, Ornithine, and Tyramine, which exhibited excellent efficacy as metabolites specific to probiotic culture medium (Bifidobacterium longumsubsp.infantisDS2696). As a result of confirming the effects of triglyceride reduction, inhibition of inflammation expression, and improvement of liver function under therapeutic treatment conditions, 2-Phenylethylamine, Hydroxybenzoic acid, Ornithine, and Tyramine showed a reduction in triglycerides, inhibition of major inflammation-related gene expression, and an increase in liver function-related gene expression, confirming that they contain various metabolites capable of exhibiting therapeutic efficacy.
[0127] [Consignment Number]
[0128] Depository: Korea Research Institute of Bioscience and Biotechnology
[0129] Trustee Number: KCTC15878BP
[0130] Date of Trust: 20240416
[0131]
[0132]
Claims
1. Bifidobacterium longum subsp. infantis DS2696 (Bifidobacterium longumsubsp.infantisDS2696) KCTC15878BP.
2. In claim 1, Bifidobacterium longumsubsp.infantisDS2696 KCTC15878BP comprises the 16S rRNA of SEQ ID NO.
1.
3. A pharmaceutical composition for the prevention or treatment of liver disease comprising Bifidobacterium longum subsp. infantis DS2696 (Bifidobacterium longumsubsp. infantisDS2696) KCTC15878BP.
4. A pharmaceutical composition according to claim 3, wherein Bifidobacterium longumsubsp. infantisDS2696 (Bifidobacterium longumsubsp. infantisDS2696) KCTC15878BP comprises the 16S rRNA of SEQ ID NO.
1.
5. A pharmaceutical composition according to claim 3, wherein the above Bifidobacterium longumsubsp. infantisDS2696 (Bifidobacterium longumsubsp. infantisDS2696) KCTC15878BP is one or more selected from the group consisting of its live cells, dead cells, cultures, lysates, and extracts.
6. A pharmaceutical composition according to paragraph 3, wherein the liver disease is any one selected from the group consisting of liver fibrosis, cholesterolosis, cirrhosis, viral and alcoholic hepatitis, Wilson's disease, hemochromatosis, steatosis, metabolic disorder fatty liver disease (MASLD), and metabolic disorder-associated steatohepatitis (MASH).
7. A pharmaceutical composition according to claim 6, wherein the liver disease is any one selected from the group consisting of metabolic disorder fatty liver disease (MASLD), metabolic disorder-associated steatohepatitis (MASH), liver fibrosis, and liver cirrhosis.
8. A food composition for the prevention or improvement of liver disease containing Bifidobacterium longum subsp. infantis DS2696 (Bifidobacterium longumsubsp. infantisDS2696) KCTC15878BP.
9. A food composition according to claim 8, wherein the above Bifidobacterium longumsubsp. infantisDS2696 (Bifidobacterium longumsubsp. infantisDS2696) KCTC15878BP comprises the 16S rRNA of SEQ ID NO.
1.
10. A food composition according to claim 8, wherein the above Bifidobacterium longumsubsp. infantisDS2696 (Bifidobacterium longumsubsp. infantisDS2696) KCTC15878BP is one or more selected from the group consisting of its live cells, dead cells, cultures, lysates, and extracts.
11. A food composition according to claim 8, wherein the liver disease is any one selected from the group consisting of liver fibrosis, cholesterolosis, cirrhosis, viral and alcoholic hepatitis, Wilson's disease, hemochromatosis, steatosis, metabolic disorder fatty liver disease (MASLD), and metabolic disorder-associated steatohepatitis (MASH).
12. A food composition according to claim 11, wherein the liver disease is any one selected from the group consisting of metabolic disorder fatty liver disease (MASLD), metabolic disorder-associated steatohepatitis (MASH), liver fibrosis, and liver cirrhosis.
13. A method for the prevention or treatment of liver disease comprising the step of administering Bifidobacterium longumsubsp. infantisDS2696 (Bifidobacterium longumsubsp. infantisDS2696) KCTC15878BP to an individual in need thereof.
14. A method according to claim 13, wherein the liver disease is any one selected from the group consisting of liver fibrosis, cholesterolosis, cirrhosis, viral and alcoholic hepatitis, Wilson's disease, hemochromatosis, steatosis, metabolic disorder fatty liver disease (MASLD), and metabolic disorder-associated steatohepatitis (MASH).
15. A method according to claim 13, wherein the liver disease is any one selected from the group consisting of metabolic disorder fatty liver disease (MASLD), metabolic disorder-associated steatohepatitis (MASH), liver fibrosis, and liver cirrhosis.
16. Use of Bifidobacterium longumsubsp. infantisDS2696 in the manufacture of drugs for the prevention or treatment of liver disease.
17. In paragraph 16, the liver disease is any one selected from the group consisting of liver fibrosis, cholesterolosis, cirrhosis, viral and alcoholic hepatitis, Wilson's disease, hemochromatosis, steatosis, metabolic disorder fatty liver disease (MASLD), and metabolic disorder-associated steatohepatitis (MASH).
18. In paragraph 16, the above liver disease is any one selected from the group consisting of metabolic disorder fatty liver disease (MASLD), metabolic disorder-associated steatohepatitis (MASH), liver fibrosis, and liver cirrhosis.
19. A pharmaceutical composition comprising Bifidobacterium longumsubsp. infantisDS2696 for the prevention or treatment of liver disease.