Novel nrf2 activator and use thereof

Abstract

The present invention provides: an Nrf2 activator; and a pharmaceutical composition for preventing or treating diseases related to activation of Nrf2, comprising the Nrf2 activator. Accordingly, it is possible to effectively prevent or treat oxidative stress- or mitochondrial dysfunction-related neurological diseases or oxidative stress-mediated skin diseases.

Description

Novel NRF2 Activator and Uses thereof

[0001] The present invention relates to a novel Nrf2 activator and its uses. More specifically, it relates to a compound of a novel structure that activates Nrf2 and its use in the prevention or treatment of diseases related to Nrf2 activation. This research was conducted with support from the Cheongju Bio Renaissance Project, implemented by the Osong Advanced Medical Industry Promotion Foundation with funding from Cheongju City.

[0002] Nrf2 (Nuclear factor erythroid 2-related factor 2) is a key transcription factor that regulates the cell's antioxidant defense system. Under normal conditions, Nrf2 is repressed in the cytoplasm by the Keap1 protein, but it translocates into the nucleus upon activation by oxidative stress or electrophilic substances. In the nucleus, Nrf2 binds to the Antioxidant Response Factor (ARE) to induce the expression of various cytoprotective genes, such as antioxidant enzymes, detoxification enzymes, and anti-inflammatory proteins. Activation of Nrf2 is known to play an important role in protecting cells from various pathological conditions, including oxidative stress, inflammation, and carcinogenesis.

[0003] Furthermore, Nrf2 is known to have a significant impact on mitochondrial function. Nrf2 regulates mitochondrial membrane potential, fatty acid oxidation, respiration, and ATP production, and can reduce mitochondrial oxidative stress through the expression of antioxidant enzymes. Nrf2 contributes to maintaining overall mitochondrial homeostasis by regulating mitochondrial biosynthesis and mitophagy.

[0004] Nrf2 activators can be beneficial for neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease by reducing oxidative stress and nerve damage. Additionally, they may be effective in alleviating or treating chronic inflammatory diseases such as rheumatoid arthritis and inflammatory bowel disease through the suppression of inflammation. Furthermore, through their antioxidant and anti-inflammatory activities, they are demonstrating therapeutic potential in various chronic diseases involving oxidative stress and inflammation, such as respiratory diseases like chronic obstructive pulmonary disease (COPD), asthma, and acute respiratory distress syndrome (ARDS), as well as autoimmune diseases like type 2 diabetes, multiple sclerosis, cardiovascular disease, psoriasis, and lupus.

[0005] For example, Korean Patent No. 10-1857526 discloses an Nrf2 activator comprising hot water extracts of *Scutellaria baicalensis* and *Rhubarb erythrorhizon*, but there is a need to develop a more effective therapeutic agent with Nrf2 activating efficacy.

[0006] One objective of the present invention is to provide an Nrf2 activator with a novel chemical structure.

[0007] One objective of the present invention is to provide a pharmaceutical composition for the prevention and treatment of diseases related to the activation of Nrf2.

[0008] Each description and embodiment disclosed in this specification may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this specification fall within the scope of the invention. Furthermore, the scope of the invention should not be considered limited by the specific descriptions provided below.

[0009]

[0010] compound

[0011] One aspect of the present invention provides a compound represented by the following formula I, a solvate, a stereoisomer, or a pharmaceutically acceptable salt thereof.

[0012] [Chemical Formula I]

[0013]

[0014] In the above chemical formula I,

[0015] Ring A is C 6-10 It is an aryl; or a 5- to 10-membered heteroaryl comprising 1 to 4 nitrogen atoms and optionally an oxygen atom or a sulfur atom.

[0016] Ring B is C 6-10 It is an aryl, or a 5- to 10-membered heteroaryl comprising one or more heteroatoms selected from N, O, and S.

[0017] L A -L a1 -L a2 -am.

[0018] L a1 C 1-6 It is alkylene or SO2.

[0019] L a2 is O or NR A am.

[0020] R A is H; C 1-6 Alkyl; or cyano, carboxy, (C 1-6 Alkoxy)carbonyl, carbamoyl, (C 1-6 Alkyl)carbamoyl, di(C 1-6 Alkyl)carbamoyl or C 1-6 C substituted with an alkanoyl 1-6 It is an alkyl.

[0021] R B is cyano, carboxy, (C 1-6 Alkoxy)carbonyl, carbamoyl, (C 1-6 Alkyl)carbamoyl or di(C 1-6 C substituted with alkyl)carbamoyl 1-6 It is an alkyl.

[0022] R 1 and R 2 Each independently H; hydroxy; C 1-6 Alkoxy; C 1-6 Alkyl; C 2-6 Alkenyl; C 2-6 Alkynyl; C3-8 Cycloalkyl; and C 3-8 C substituted with a cycloalkyl or a quaternary to octary heterocyclile containing 1 to 3 nitrogen atoms 1-6 Selected from the group consisting of alkyls; or R 1 and R 2 are connected to each other L M forms.

[0023] L M -L m1 -L m2 -L m3 -am.

[0024] L m1 and L m3 Each is independently a direct combination or O.

[0025] L m2 is C 2-10 Alkylene or C 2-10 It is alkenylene.

[0026] R 3 , R 4 and R 5 Each independently contains H, halo, hydroxy, and C 1-6 Alkoxy, amino, (C 1-6 alkyl)amino, di(C 1-6 Alkyl)amino, nitro, cyano, or C 1-6 It is an alkyl. The above C 1-6 Alkyl groups are halo, oxo, hydroxy, C 1-6 Alkoxy, amino, (C 1-6 alkyl)amino, di(C 1-6 It can be optionally substituted with alkyl)amino, nitro, or cyano.

[0027] o, p, and q are each independently integers from 0 to 2.

[0028] In one embodiment, ring A is C 6-10 It may be an aryl; or a 5- to 10-membered heteroaryl containing 1 to 4 nitrogen atoms.

[0029] In one embodiment, ring B is C 6-10It may be an aryl, or an 8- to 10-membered fused bicyclic heteroaryl containing one or more nitrogen atoms.

[0030] In one embodiment, R 1 and R 2 are connected to each other L M If not formed, ring A may be an 8 to 10-membered fused bicyclic heteroaryl containing 1 to 4 nitrogen atoms.

[0031] In chemical formula I, ring A is C 6-10 It is an aryl; or a pentagonal to tenagonal heteroaryl comprising 1 to 4 nitrogen atoms and optionally comprising an oxygen atom or a sulfur atom. In one embodiment, ring A is C 6-10 It may be an aryl; or a 6- to 9-membered heteroaryl comprising 1 to 3 nitrogen atoms and optionally comprising an oxygen atom or a sulfur atom. In one embodiment, ring A is C 6-10 It may be an aryl; a 5- to 7-membered monocyclic heteroaryl comprising 1 to 3 nitrogen atoms; or an 8- to 10-membered fused bicyclic heteroaryl comprising 1 to 4 nitrogen atoms. In one embodiment, ring A is C 6-10It may be an aryl; a 5- to 6-membered monocyclic heteroaryl containing 1 to 2 nitrogen atoms; an 8- to 10-membered fused bicyclic heteroaryl containing 1 to 3 nitrogen atoms; an 8- to 10-membered fused bicyclic heteroaryl containing 2 to 4 nitrogen atoms; an 8- to 10-membered fused bicyclic heteroaryl containing 2 to 3 nitrogen atoms; a 9- to 10-membered fused bicyclic heteroaryl containing 1 to 3 nitrogen atoms; a 9- to 10-membered fused bicyclic heteroaryl containing 2 to 4 nitrogen atoms; or a 9- to 10-membered fused bicyclic heteroaryl containing 2 to 3 nitrogen atoms. For example, ring A may be phenyl, naphthalenyl, pyrroleyl, pyrazolyl, imidazoleyl, triazoleyl, pyridineyl, pyridazineyl, pyrazineyl, triazineyl, indoleyl, indazoleyl, benzimidazoleyl, benzotriazoleyl, benzisoxazoleyl, benzoxazoleyl, benzisothiazolyl, or benzothiazoleyl. For example, ring A may be phenyl, pyridineyl, or benzotriazoleyl.

[0032] In chemical formula I, ring B is C 6-10 It is an aryl, or an 8- to 10-membered fused bicyclic heteroaryl containing one or more nitrogen atoms. In one embodiment, ring B is C 6-10 It may be an aryl, or an 8- to 10-membered fused bicyclic heteroaryl containing 1 to 3 nitrogen atoms. In one embodiment, ring B is C 6-10It may be an aryl, or a 9- to 10-membered fused bicyclic heteroaryl containing one or two nitrogen atoms. For example, ring B may be phenyl, naphthalenyl, pyrroleyl, pyrazolyl, imidazoleyl, triazoleyl, furanyl, thiopheneyl, isoxazoleyl, oxazoleyl, isothiazoleyl, thiazoleyl, pyridineyl, pyridazineyl, pyrazineyl, triazineyl, indoleyl, indazoleyl, benzimidazoleyl, benzotriazoleyl, benzofuranyl, benzothiopheneyl, benzisoxazoleyl, benzoxazoleyl, benzisothiazoleyl, or benzothiazoleyl. For example, ring B may be phenyl or indoleyl.

[0033] In one embodiment, R 1 and R 2 are connected to each other L M When forming, ring A may be phenyl and ring B may be phenyl; ring A may be pyridine and ring B may be phenyl; ring A may be pyridine and ring B may be indole; ring A may be benzotriazole and ring B may be phenyl; ring A may be benzotriazole and ring B may be indole.

[0034] In one embodiment, R 1 and R 2 are connected to each other L M If it does not form, ring A is benzotriazole and ring B is phenyl; or ring A may be benzotriazole and ring B may be indole.

[0035] In chemical formula I, L A -L a1 -L a2 -is. L a1 It is connected to ring A, and L a2 is connected to the naphthalene matrix. L a1 C 1-6 It is an alkylene or SO2. L a2 is O or NR A is. R A is H; C 1-6 Alkyl; or cyano, carboxy, (C 1-6Alkoxy)carbonyl, carbamoyl, (C 1-6 Alkyl)carbamoyl, di(C 1-6 Alkyl)carbamoyl or C 1-6 C substituted with an alkanoyl 1-6 It is an alkyl.

[0036] In one embodiment, L A -CH2-O-, -SO2-O-, -CH2-NR A - or -SO2-NR A -It can be. In one implementation example, R A can be H, methyl, carbamoylmethyl, or cyanomethyl. For example, L A (-R A ) can be -CH2-O-, -CH2-NH-, -CH2-N(-CH3)-, -SO2-NH-, -SO2-N(-CH2CN)-, -SO2-N(-CH2CONH2)-, -SO2-N(-CH3)-, -SO2-O-.

[0037] In chemical formula I, R B is cyano, carboxy, (C 1-6 Alkoxy)carbonyl, carbamoyl, (C 1-6 Alkyl)carbamoyl or di(C 1-6 C substituted with alkyl)carbamoyl 1-6 It is an alkyl. In one embodiment, R B is Carbamoile, (C 1-6 Alkyl)carbamoyl or di(C 1-6 C substituted with alkyl)carbamoyl 1-6 It can be alkyl. For example, R B It may be cyanomethyl or carbamoylmethyl.

[0038] In one embodiment, R A and R B may be identical or different from each other. In one embodiment, R A and R B At least one of them is carbamoyl, (C 1-6 Alkyl)carbamoyl or di(C 1-6 C substituted with alkyl)carbamoyl 1-6 It can be an alkyl.

[0039] In chemical formula I, R 1 and R 2 Each independently H; hydroxy; C 1-6 Alkoxy; C 1-6 Alkyl; C 2-6 Alkenyl; C 2-6 Alkynyl; C 3-8 Cycloalkyl; and C 3-8 C substituted with a cycloalkyl or a quaternary to octary heterocyclile containing 1 to 3 nitrogen atoms 1-6 Selected from the group consisting of alkyls; or R 1 and R 2 are connected to each other L M forms. L M -L m1 -L m2 -L m3 -is. L m1 It is connected to ring A, and L m3 It is connected to ring B. L m1 and L m3 Each is independently a direct bond or O. L m1 and L m3 They may be identical or different from each other. L m2 is C 2-10 Alkylene or C 2-10 It is alkenylene. In the first embodiment, L m2 is C 2-8 Alkylene or C 2-8 Alkenylene, or C 2-6 Alkylene or C 2-6 It could be alkenylene.

[0040] In one embodiment, R 1 and R 2 H and C are independently 1-4 Alkoxy, C 1-4 Alkyl, C 2-4 C substituted with alkenyl, a quaternary to 8-membered heterocyclile containing 1 to 2 nitrogen atoms 1-4 It may be an alkyl. In one embodiment, R 1 and R2 H and C are independently 1-4 Alkoxy, C 1-4 Alkyl, C 2-4 C substituted with alkenyls, quaternary to hexacyclic compounds containing 1 to 2 nitrogen atoms 1-4 It can be alkyl. For example, R 1 It can be methyl, methoxy, or butene. For example, R 1 can be boot-3-en-1-il. For example, R 2 can be methyl, methoxy, pyrrolidineylmethyl, or butenyl. For example, R 2 It could be boot-3-n-1 day.

[0041] In some embodiments, where ring A and ring B are fused bicyclic heteroaryls, R 1 and R 2 Each can be independently substituted into the inner ring (the ring close to the parent nucleus), the outer ring, or both rings of the fused bicyclic heteroaryl.

[0042] In one embodiment, R 1 and R 2 is L M By forming -C 2-10 Alkylene-, -C 2-10 alkenylene-, -OC 2-10 Alkylene-, -OC 2-10 alkenylene-, -C 2-10 Alkylene-O-, -C 2-10 alkenylene-O-, -OC 2-10 Alkylene-O- or -OC 2-10 They can be linked to each other as alkenylene-O-. For example, R 1 and R 2They can be connected to each other as -(CH2)6-, -(CH2)6-O-, -O-(CH2)6-, -O-(CH2)4-O-, -O-(CH2)5-O-, -O-(CH2)6-O-, -O-(CH2)7-O-, -O-(CH2)8-O-, -O-(CH2)2CH=CH(CH2)2-O-, -O-(CH2)2CH=CH(CH2)3-O-, -O-CH2CH=CHCH2-O-, -O-CH2CH=CH(CH2)3-O-.

[0043] In chemical formula I, R 3 , R 4 and R 5 Each independently contains H, halo, hydroxy, and C 1-6 Alkoxy, amino, (C 1-6 alkyl)amino, di(C 1-6 Alkyl)amino, nitro, cyano, or C 1-6 It is an alkyl. The above C 1-6 Alkyl groups are halo, oxo, hydroxy, C 1-6 Alkoxy, amino, (C 1-6 alkyl)amino, di(C 1-6 It may optionally be substituted with an alkyl)amino, nitro, or cyano group. In one embodiment, R 3 , R 4 and R 5 Each independently contains H, halo, hydroxy, and C 1-4 Alkoxy, amino, (C 1-4 alkyl)amino, di(C 1-4 Alkyl)amino, nitro, cyano, or C 1-4 It may be an alkyl. The above C 1-4 Alkyl groups are halo, oxo, hydroxy, C 1-4 Alkoxy, amino, (C 1-4 alkyl)amino, di(C 1-4 It can be optionally substituted with alkyl)amino, nitro, or cyano.

[0044] In chemical formula I, o, p, and q are each independently integers from 0 to 2.

[0045] In one embodiment, R 3 is H, C1-4 alkyl or C 1-4 It can be an alkoxy. For example, R 3 can be methyl or methoxy. In this case, o can be 1.

[0046] In one embodiment, R 4 is H, C 1-4 alkyl or C 1-4 It can be an alkoxy.

[0047] In one embodiment, R 5 can be H or halo. For example, R 5 can be F, Cl, Br, or I. For example, R 5 can be F. In this case, q can be 1.

[0048] In one embodiment, o, p, and q may each be the same or different. In one embodiment, o, p, and q may each be an integer from 0 to 1 independently. For example, o may be 1. For example, q may be 1.

[0049] In one embodiment, Is or It can be selected from.

[0050] In one embodiment, Is or It can be selected from.

[0051] In one embodiment, Is

[0052]

[0053]

[0054]

[0055] or It can be selected from.

[0056] In one embodiment, the compound of formula I may be represented by the following formulas IA, IB, or IC.

[0057] [Chemical Formula IA]

[0058]

[0059] [Chemical Formula IB]

[0060]

[0061] [Chemical formula IC]

[0062]

[0063] In the above chemical formulas IA, IB, and IC, R b1 cyano, carbamoyl, (C 1-6 Alkyl)carbamoyl or di(C 1-6 It may be an alkyl)carbamoyl. Ring A, Ring B, R A , R 1 , R 2 , R 3 , R 4 , R 5 , o, p and q are as defined for chemical formula I.

[0064] In one embodiment, the compound of formula I may be represented by formula IA-1 or formula IC-1.

[0065] [Chemical Formula IA-1]

[0066]

[0067] [Chemical Formula IC-1]

[0068]

[0069] In the above chemical formulas IA-1 and IC-1, ring A, ring B, R A , R 1 , R 2 , R 3 , R 4 , R 5 , o, p and q are as defined in paragraph 1.

[0070] In one embodiment, the compound of Formula I may be represented by the following Formula I-1 or Formula I-2.

[0071] [Chemical Formula I-1]

[0072]

[0073] In the above chemical formula I-1, L A , R A , L M , R 3 , R 4 , R 5 , o, p and q are as defined for chemical formula I.

[0074] In the above chemical formula I-1, R B is cyano, carbamoyl, (C 1-6 Alkyl)carbamoyl or di(C 1-6 C substituted with alkyl)carbamoyl 1-6 It can be an alkyl.

[0075] In the above chemical formula I-1, ring A is C 6-10 aryl; or 5 to 10-membered heteroaryl containing 1 to 4 nitrogen atoms; and ring B is C 6-10 It may be an aryl, or an 8- to 10-membered fused bicyclic heteroaryl containing one or more nitrogen atoms.

[0076] [Chemical Formula I-2]

[0077]

[0078] In the above chemical formula I-2, L A , R A , R B , R 3 , R 4 , R 5 , o, p and q are as defined for chemical formula I.

[0079] In the above chemical formula I-2, R B is cyano, carbamoyl, (C 1-6 Alkyl)carbamoyl or di(C1-6 C substituted with alkyl)carbamoyl 1-6 It can be an alkyl.

[0080] In the above chemical formula I-2, R 1a and R 2a Each independently H; hydroxy; C 1-6 Alkoxy; C 1-6 Alkyl; C 2-6 Alkenyl; C 2-6 Alkynyl; C 3-8 Cycloalkyl; and C 3-8 C substituted with a cycloalkyl or a quaternary to octary heterocyclile containing 1 to 3 nitrogen atoms 1-6 It can be selected from the group consisting of alkyl groups.

[0081] In the above chemical formula I-2, ring A is an 8 to 10-membered fused bicyclic heteroaryl containing 1 to 4 nitrogen atoms; and ring B is C 6-10 It may be an aryl, or an 8- to 10-membered fused bicyclic heteroaryl containing one or more nitrogen atoms.

[0082] In one embodiment, the compound of Formula I may be selected from the following group.

[0083]

[0084] .

[0085] In one embodiment, the compound of Formula I can be prepared according to the reaction of Reaction Scheme 1 below.

[0086] [Reaction Equation 1]

[0087]

[0088] In the above reaction scheme 1, L Aa , R 1a , R 2a , R 3a , R 4a , R 5a and R Ba are L defined for the above chemical formula I, respectively.A , R 1 , R 2 , R 3 , R 4 , R 5 and R B It may be identical to or its precursor group. The precursor group may be a residue that undergoes further reactions to form a final residue.

[0089] L a2a It can be a hydroxy, amino, or nitro.

[0090] L Ba It can be amino or nitro.

[0091] The order of Step 1 and Step 2 of the above reaction scheme 1 can be interchanged.

[0092] L a2a and L Ba The aminos of each may be independently protected by a protecting group or oxidized to a nitro group before the reaction of steps 1 and 2, and after the reaction, the protecting group may be deprotected or the nitro group may be reduced to an amino.

[0093] The above protecting group may include an acetyl group, a benzyl group, a benzyloxycarbonyl group (Cbz), a tert-butoxycarbonyl (Boc) group, a 9-fluorenylmethoxycarbonyl (Fmoc) group, a trimethylsilyl (TMS) group, a tert-butyldimethylsilyl (TBDMS) group, a methoxymethyl (MOM) group, a 2,2-dimethoxyethyl group, etc.

[0094] L a2a and L Ba At least one of them may be a hydroxy or an amino.

[0095] L a1a is C substituted with a halo or oxo 1-6 It may be an alkyl or a halosulfonyl. In one embodiment, L a1a is C 1-6 Haloalkyl, C 1-6 It may be an alkanoyl or halosulfonyl. The above C 1-6 Alkanoy is C 1-6It may be an alkyl group in which the terminal carbon atom farthest from the carbon atom bonded to the parent nucleus is substituted with an iodine. For example, L a1a It may be bromoalkyl, formyl, or chlorosulfonyl.

[0096] X can be a halo. For example, X can be F, Cl, Br, or I.

[0097] Steps 1 and 2 of the above reaction scheme 1 may each be coupling reactions of a core compound containing a naphthalene group, intermediate A containing ring A, and intermediate B containing ring B. The reactions of steps 1 and 2 may be carried out using a non-limiting solvent, such as, for example, DCM (dichloromethane) or THF (tetrahydrofuran). The reactions may be carried out at -10°C to 100°C, for example, at 0°C to 80°C.

[0098] In some embodiments, steps 1 and 2 of the above reaction scheme 1 may be performed sequentially or simultaneously. In some embodiments, step 2 of the above reaction scheme 1 may be performed before step 1.

[0099] Step 3 of the above reaction scheme 1 is L Aa , R 1a , R 2a , R 3a , R 4a , R 5a and R Ba From each L A , R 1 , R 2 , R 3 , R 4 , R 5 and R B It may include reactions that form . For example, R Ba If is H, this is cyano, carboxy, (C 1-6 Alkoxy)carbonyl, (C 1-6 Alkyl)carbamoyl, di(C 1-6 Alkyl)carbamoyl or C 1-6C substituted with an alkanoyl 1-6 React with an alkyl precursor, and through any additional reaction R B It may include reactions that form.

[0100] Step 3 of the above reaction scheme 1 is L Aa , R 1a , R 2a , R 3a , R 4a , R 5a and R Ba Depending on the, it may include one or more steps of reaction.

[0101] In some embodiments, step 3 is R 1a and R 2a are connected to each other L M It may include a reaction that forms. In this case, R 1a and R 2a L comprising functional groups capable of binding to and respectively M The precursor can be reacted. L M The precursor may include bond-forming functional groups such as halo, hydroxy, and amino groups at both ends of the molecule. L M The precursor is R 1a Reacting with and first, or R 2a React with and first, or R 1a and R 2a and can react together with each. L M The hydroxy or amino functional group of the precursor is R 1a and R 2a Depending on the reaction sequence with, it can be protected by a protector and then deprotected.

[0102] In some embodiments, L Aa , R 1a , R 2a , R 3a , R 4a , R 5a and R Ba Ga L A , R 1 , R 2 , R 3 , R4 , R 5 and R B If it is the same as, step 3 above may be omitted.

[0103] In one embodiment, the compound of Formula I can be prepared according to the reactions of Reaction Scheme 2 to Reaction Scheme 4 below.

[0104] [Reaction Equation 2]

[0105]

[0106] [Reaction Equation 3]

[0107]

[0108] [Reaction Equation 4]

[0109]

[0110] In the above reaction schemes 2 to 4, L Aa , L Ba , L a1a , L a2a , R 1a , R 2a , R 3a , R 4a , R 5a and R Ba is as defined for the above reaction scheme 1. Ring A a and L Ma is L defined for the above chemical formula I. M and may be identical to ring A or its precursor group.

[0111] In step 2 of the above reaction scheme 2, intermediate A is a cyclizing precursor L that can be covalently connected to ring B. ma1 It could be substituted into this ring A. Cyclic precursor L ma1 ring B or R at the end 2a It may include a functional group capable of binding with. The binding capable functional group is L M As defined for the precursor. In one embodiment, the cyclizing precursor L ma1It can also be substituted into ring B.

[0112] In step 3 of the above reaction scheme 2, the cyclization precursor L ma1 The combinable functional group of and ring B or R 2a can be combined.

[0113] In some embodiments, steps 1 and 2 of the above reaction scheme 2 may be performed sequentially or simultaneously. In some embodiments, step 2 of the above reaction scheme 1 may be performed before step 1.

[0114] Step 4 of the above reaction scheme 2 can be performed in the same manner as Step 3 of the above reaction scheme 1. Step 4 of the above reaction scheme 2 is L Aa , L Ma , R 3a , R 4a , R 5a and R Ba From each L A , L M , R 3 , R 4 , R 5 and R B It may include a reaction that forms. For example, Step 4 is L Ma C in the middle 2-10 C by forming unsaturated bonds from alkylene 2-10 It may include a reaction that forms alkenylene.

[0115] In some embodiments, L Aa , L Ma , R 1a , R 2a , R 3a , R 4a , R 5a and R Ba Ga L A , L M , R 1 , R 2 , R 3 , R 4 , R 5 and R B If it is the same as, step 4 above may be omitted.

[0116] Step 1 of the above reaction scheme 3 may be a coupling reaction between an intermediate AB containing ring A and ring B together and a core compound. Step 3 of the above reaction scheme 3 may be the same as Step 4 of the above reaction scheme 2.

[0117] Steps 1 and 3 of the above reaction scheme 4 may be identical to steps 1 and 2 of the above reaction scheme 1. The above reaction scheme 4 involves a reaction with intermediate B and ring A a Intermediate A containing a L in ring B between the reactions with Ma cyclizing precursor L forming ma3 It may include step 2 of substituting . Cyclic precursor L ma3 Ring A at the end a or R 1a It may include a functional group capable of binding with. The binding capable functional group is L M As defined for the precursor. In one embodiment, the cyclizing precursor L ma3 Silver ring A a It can also be substituted into.

[0118] Step 2 of the above reaction scheme 4 is cyclization precursor L ma2 It can be performed using . L ma2 The above L M It can be identical to the precursor.

[0119] The order of steps 1 to 3 of the above reaction scheme 4 may be interchangeable. In one embodiment, L ma2 is ring A a Connected to ring A a cycloidal precursor L ma3 It can be substituted.

[0120] In step 4 of the above reaction scheme 4, the cyclization precursor L ma3 The combinable functional group of ring A or R 1a can be combined.

[0121] Step 5 of the above reaction scheme 4 may be the same as Step 4 of the above reaction scheme 2. In Step 5 of the above reaction scheme 4, ring A a may be identical to or different from ring A. Ring A a If it is a monocyclic aryl or heteroaryl, ring A can be formed as a bicyclic or tricyclic heteroaryl through the cyclization reaction of 1,2-diamine and NaNO2, etc.

[0122]

[0123] definition

[0124] All technical and scientific terms used in this specification have the meanings generally understood by those skilled in the art, and unless otherwise noted, conventional measurement methods, manufacturing methods, conventional ingredients, or materials based on prior art such as pharmacology, pharmaceutical manufacturing, mass spectrometry, NMR, HPLC, and biochemistry are used.

[0125] The individual features and components of each embodiment described and illustrated in this specification may be combined with the features and components of any other embodiment without departing from the scope or spirit of this disclosure.

[0126] Unless otherwise specified, in this specification and the appended claims, “and” and “or” mean “and / or.” The terms “comprising” and “comprising” are open-ended and mean that a compound, composition, or method may include additional features or components in addition to the specific or components listed.

[0127] In this specification, a numerical range indicated by the term “to” refers to a range that includes the values ​​described before and after the term “to” as a lower limit and an upper limit, respectively.

[0128] As used herein, the terms “arbitrary” or “arbitrary” mean that an event or situation subsequently described may or may not occur, and that the description includes cases where said event or situation occurs and cases where it does not occur. For example, the term “arbitrarily substituted” means that it includes both cases where it is substituted with the specified substituent and cases where it is not substituted.

[0129] As used herein, the term “aryl” means an aromatic hydrocarbon ring group. For example, it may be monocyclic (e.g., phenyl) or bicyclic (e.g., naphthyl).

[0130] As used herein, the term “heteroaryl” means a monocyclic or bicyclic organic compound comprising one or more heteroatoms and the remaining ring atoms being carbon. The heteroaryl group may comprise, for example, 1 to 5, 1 to 3, or 1 or 2 heteroatoms, and may comprise 5 to 10 ring elements. “Heteroaryl” may be, for example, pyrroleyl, furanyl, thiopheneyl, pyrazolyl, imidazoleyl, isoxazole, oxazole, thiazoleyl, isothiazoleyl, pyridineyl, pyrimidineyl, pyrazineyl, pyridazineyl, indoleyl, benzofuranyl, benzothiopheneyl, benzopyrazolyl, benzimidazoleyl, benzoxazoleyl, benzisoxazoleyl, benzothiazoleyl, or benzisothiazoleyl.

[0131] As used herein, the term “alkyl” means a saturated straight-chain and branched-chain carbon chain having 1 to 6 carbon atoms, 1 to 4 carbon atoms, or 1 to 3 carbon atoms, including when used alone or as part of a substituent unless otherwise stated. Non-limiting examples of alkyl groups include methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, iso-butyl, and tert-butyl.

[0132] As used herein, the terms “alkenyl” and “alkynyl” refer to straight and branched carbon chains having two or more carbon atoms, preferably 2 to 20 carbon atoms, having one or more carbon-carbon double bonds (“alkenyl”) or one or more carbon-carbon triple bonds (“alkynyl”), whether used alone or as part of a substituent. As indicated, the alkenyl and alkynyl groups may optionally be substituted. Non-limiting examples of alkenyl groups include ethenyl, 3-propenyl, 1-propenyl (also 2-methylethenyl), isopropenyl (also 2-methylethene-2-yl), butene-4-yl, etc. Non-limiting examples of alkynyl groups include ethinyl, prop-2-inyl (also propargyl), propin-1-yl, and 2-methyl-hex-4-in-1-yl.

[0133] As used in this specification, the term “carboxy” means -COOH.

[0134] As used in this specification, the term “carbonyl” means -CO-.

[0135] As used in this specification, the term “carbamoyl” means -CONH-.

[0136] As used herein, the term “alkanoyle” refers to HC(O)-, alkyl-C(O)-, alkenyl-C(O)-, alkynyl-C(O)-, cycloalkyl-C(O)-, aryl-C(O)-, heteroaryl-C(O)-, and heterocyclyl-C(O)-. Non-limiting examples of acyl groups include acetyl groups.

[0137] The term “halogen” as used in this specification refers to an atom belonging to Group 17 of the periodic table. Halogen atoms include fluorine, chlorine, bromine, and iodine, and may be used interchangeably with the term “halo,” which refers to a monovalent functional group composed of a halogen.

[0138] As used in this specification, the term “hydroxy” refers to an -OH functional group (hydroxyl group).

[0139] As used herein, the term “alkoxy” refers to an alkyl group bonded to an oxygen atom. The above C 1-6 Alkoxy is C 1-5 , C 1-4 , C 1-3 , or C 1-2 It may be an alkoxy. The alkoxy may be methoxy, ethoxy, propoxy, butoxy, etc.

[0140] As used in this specification, the term “amino” means -NH2.

[0141] As used in this specification, the term “alkylamine” refers to an amine in which one of the H groups of an amino (-NH2) is substituted with an alkyl group.

[0142] As used herein, the term “di(alkyl)amine” refers to an amine in which both H groups of an amino (-NH2) are substituted with alkyl groups. The two alkyl groups in a di(alkyl)amine may be the same or different.

[0143] As used in this specification, the term “nitro” refers to -NO2.

[0144] As used in this specification, the term “cyano” refers to -CN, a functional group consisting of a triple bond between a carbon atom and a nitrogen atom.

[0145] As used herein, the term “heterocyclile” refers to a saturated or partially saturated cyclic group having 1 to 14 carbon atoms and 1 to 6 heteroatoms selected from nitrogen, sulfur, phosphorus, or oxygen, which includes fused ring systems, bridging ring systems, and spiro ring systems, comprising single ring and multi-ring systems. In multi-ring systems having aromatic and / or non-aromatic rings, the terms “heterocyclic,” “heterocycle,” “heterocycloalkyl,” or “heterocyclile” apply where at least one ring heteroatom is present and the attachment site is an atom of the non-aromatic ring (e.g., 1,2,3,4-tetrahydroquinoline-3-yl, 5,6,7,8-tetrahydroquinoline-6-yl, and decahydroquinoline-6-yl). For example, the nitrogen, phosphorus, and / or sulfur atom(s) of the heterocyclile are optionally oxidized to provide N-oxide, phosphinan oxide, sulfinyl, and sulfonyl moiety. More particularly, the heterocyclile includes, but is not limited to, tetrahydropyranyl, piperidinyl, piperazinyl, 3-pyrrolidinyl, 2-pyrrolidone-1-yl, morpholinyl, and pyrrrolidinyl. A prefix indicating the number of carbon atoms (e.g., C 3-10 ) represents the total number of carbon atoms in the portion of the heterocyclil group excluding the number of heteroatoms.

[0146] In this specification, the term “substitution” in “optionally substituted” refers to the element introduced in place of a hydrogen atom when a derivative is formed by substituting one or more hydrogen atoms in an organic compound with another atomic group, and “substituent” refers to the introduced atomic group. In this specification, a chemical structure indicated as “substituted” is predicated on satisfying the valence of the indicated substituent and the atom substituted therein, and forming a chemically stable structure through substitution.

[0147] In this specification, when a combination of substituents is referred to as a single group, e.g., arylalkyl, cycloalkyl, etc., the last mentioned group generally contains an atom attached to the matrix of the compound.

[0148] In this specification, “ ", "*", or "-" are used to indicate the position where a substituent binds to the remaining residue of the compound. For example, if a "-" is displayed at the end of a substituent, it means that the end is bound to the remaining residue of the compound. Additionally, if two or more substituents are connected by "-", it means that the substituent immediately preceding the "-" is bound to the substituent immediately following the "-".

[0149] In various places within this specification, substituents of compounds are denoted as groups or ranges. The description is specifically intended to include each and all individual subcombinations of said group and range components. For example, the term “C as used in this specification 1-6 "Alkyl" is C1, C2, C3, C4, C5, C6, C 1-6 , C 1-5 , C 1-4 , C 1-3 , C 1-2 , C 2-6 , C 2-5 , C 2-4 , C 2-3 , C 3-6 , C 3-5 , C 3-4 , C 4-6 , C 4-5 and C 5-6 It is specifically intended to represent the alkyl group individually.

[0150] As used herein, the term “compound” refers to an assembly of molecules having the same chemical structure, except that there may be isotopic variations between the constituent atoms of the molecules when referring to the compounds of the present invention. The term “compound” includes such an assembly of molecules regardless of the purity of a given sample containing the assembly of molecules. Accordingly, the term “compound” includes an assembly of molecules in a pure form, a mixture with one or more other substances (e.g., a solution, suspension, colloid, or pharmaceutical composition, or dosage form), or in the form of a hydrate, solvate, etc.

[0151] As used herein, the term "solvate" may mean a compound of the present invention or a salt thereof comprising stoichiometric or non-stoichiometric amounts of solvent bound by non-covalent intermolecular forces. Preferred solvents thereof may be any solvent that is volatile, non-toxic, and / or suitable for administration to humans. Such solvate is, for example, a hydrate. The compound of the present invention may exist in forms such as an unsolved form, a hydrate solvated with water, a solvate solvated with a pharmaceutically acceptable solvent such as ethanol, and all such forms are intended to be included within the scope of the present invention.

[0152] As used in this specification, the term “isomer” in “stereoisomer” refers to a compound that has the same molecular formula but differs in the way constituent atoms are connected or in their spatial arrangement within the molecule. Isomers include, for example, structural isomers and stereoisomers. The stereoisomers may be diastereomers or enantiomers. Enantiomers refer to isomers that do not overlap with their mirror images, much like the relationship between a left hand and a right hand, and are also called optical isomers. Enantiomers are classified as R (Rectus: clockwise) and S (Sinister: counterclockwise) when four or more substituents on the chiral center carbon differ. Diastereomers refer to stereoisomers that have two or more chiral centers and whose molecules are not mirror images of each other. The above diastereomers can be divided into cis-trans isomers and conformational isomers (or conformers).

[0153] The compound of the present invention may contain one or more asymmetric centers and may exist in the form of a racemic mixture, a single enantiomer, a mixture of enantiomers, a single diastereomer, a mixture of diastereomers, etc. Additionally, due to the nature or limited rotation of the asymmetric center, the compound of the present invention may exist in the form of an enantiomer or a diastereomer.

[0154] Various diastereomers and enantiomers of the chemical structures disclosed herein may exist, and pure isomers, separated isomers, partially pure isomers, or racemic mixtures are all intended to fall within the scope of the present invention. Where the stereochemistry of any specific chiral atom in a particular structure shown herein is not specified, all stereoisomers are included as compounds of the present invention.

[0155] In any chemical structure or formula of this specification, a solid or dotted wedge bond attached to the stereocenter of the compound (each or ) can represent the absolute stereochemistry of the stereocenter as well as the relative stereochemistry of the stereocenter with respect to other stereocenter(s) to which the wedge bond is attached.

[0156] As used herein, the term “salt” may include inorganic and organic acid addition salts or base addition salts of a parent compound. Pharmaceutically acceptable salts in this specification may be salts that do not cause severe irritation to the organism to which the compound is administered and do not impair the biological activity and physical properties of the compound. They may include, but are not limited to, mineral or organic acid salts of basic residues such as amines, alkali (earth) metal or organic salts of acid residues such as carboxylic acids, etc. The inorganic salt may be a hydrochloride, bromate, phosphate, sulfate, or disulfate. The above organic salt may be formate, acetate, propionate, lactate, oxalate, tartrate, malate, maleate, citrate, fumarate, besylate, camsylate, edicyl, trichloroacetate, trifluoroacetate, benzoate, gluconate, methanesulfonate, glycolate, succinate, 4-toluenesulfonate, galacturonate, emvonate, glutamate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, or aspartate. The above metal salt may be calcium salt, sodium salt, magnesium salt, strontium salt, or potassium salt.

[0157] The compound of the present invention may be used in the form of a pharmaceutically acceptable salt derived from an inorganic acid or an organic acid, for example, said salt may be a salt derived from hydrochloric acid, hydrobromide, sulfuric acid, phosphoric acid, nitric acid, acetic acid, glycolic acid, lactic acid, pyruvate, malonic acid, succinic acid, glutaric acid, fumaric acid, malic acid, mandelic acid, tartaric acid, citric acid, ascorbic acid, palmitic acid, maleic acid, hydroxymaleic acid, benzoic acid, hydroxybenzoic acid, phenylacetic acid, cinnamic acid, salicylic acid, methanesulfonic acid, benzenesulfonic acid, or toluenesulfonic acid, etc.

[0158] A pharmaceutically acceptable salt of the above compound can be prepared by dissolving the compound of Formula I in a water-miscible organic solvent, such as acetone, methanol, ethanol, or acetonitrile, adding an excess amount of organic acid or an aqueous solution of an inorganic acid, and then precipitating or crystallizing. Subsequently, the solvent or excess acid can be evaporated from the mixture and dried to obtain an addition salt, or the precipitated salt can be prepared by suction filtration.

[0159]

[0160] Medicinal use, pharmaceutical composition, and method of administration

[0161] The compound of Chemical Formula I above may be an activator or agonist for Nrf2. Nrf2 (Nuclear factor erythroid 2-related factor 2) is a key transcription factor that regulates the cellular antioxidant defense system. Under normal conditions, it is inhibited in the cytoplasm by the Keap1 protein, but upon activation by oxidative stress, it moves into the nucleus and binds to the Antioxidant Response Element (ARE), which can induce the expression of various cytoprotective genes, such as antioxidant enzymes, detoxification enzymes, and anti-inflammatory proteins. Therefore, various diseases related to oxidative stress, mitochondrial dysfunction, and inflammation can be treated through the activation of Nrf2. Accordingly, the compound of Chemical Formula I above may serve as a preventive or therapeutic agent for diseases associated with the activation of Nrf2.

[0162]

[0163] One aspect of the present invention provides a pharmaceutical composition comprising the compound, a stereoisomer thereof, a solvate, or a pharmaceutically acceptable salt thereof.

[0164] One aspect of the present invention provides a pharmaceutical composition for preventing or treating a disease associated with the activation of Nrf2, comprising the compound, a stereoisomer thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.

[0165] The above compounds, stereoisomers, solvates, pharmaceutically acceptable salts, and Nrf2 are as described above.

[0166] Diseases associated with the activation of the above Nrf2 may include diseases that are alleviated, improved, or treated through the activation of Nrf2.

[0167] Diseases associated with the activation of the above-mentioned Nrf2 are, without limitation, chronic obstructive pulmonary disease (COPD), asthma, acute lung injury (ALI), acute respiratory distress syndrome (ARDS), fibrosis, chronic and acute asthma, secondary lung disease due to environmental exposure, acute lung infection, chronic lung infection, α1 antitrypsin deficiency, cystic fibrosis, autoimmune diseases, diabetic nephropathy, chronic kidney disease, sepsis-induced acute kidney injury, acute kidney injury (AKI), renal disease or dysfunction occurring during kidney transplantation, pulmonary hypertension, atherosclerosis, hypertension, heart failure, acute coronary syndrome, myocardial infarction, myocardial repair, cardiac remodeling, cardiac arrhythmia, heart failure with preserved ejection fraction, heart failure with reduced ejection fraction, diabetic cardiomyopathy, sudden cardiac death (SCD), premature aging and cardiorespiratory syndrome (CRS), Parkinson's disease (PD), Alzheimer's disease (AD), Friedreich's ataxia (FA), and amyotrophic lateral sclerosis. Sclerosis (ALS), Multiple Sclerosis (MS), Huntington's Disease (HD), Spinal Cord Injury, Traumatic Brain Injury, Ischemic Stroke, Stroke, Creutzfeldt-Jakob Disease, Fatal Familial Insomnia, Gerstmann-Streusler-Scheinker Syndrome and Related Prion Diseases, Progressive Supranuclear Palsy, Chronic Traumatic Encephalopathy (CTE), Neurodegeneration, Dementia, Frontotemporal Dementia, Tauopathy, Retinitis Pigmentosa, Pick's Disease, Niemann-Pick's Disease, Amyloidosis, Cognitive Impairment, Inflammatory Bowel Disease, Colorectal Cancer, Dry and Wet Macular Degeneration (AMD), Ocular Injury, Fuchs's Corneal Endothelial Dystrophy (FECD), Uveitis or Other Inflammatory Eye Diseases, Non-Alcoholic Steatohepatitis (NASH), Toxin-Induced Liver Disease (e.g., Acetaminophen-Induced Liver Disease), Viral Hepatitis, Liver Cirrhosis, Psoriasis, Dermatitis / Local Effects of Radiation, Immunosuppression Due to Radiation Exposure, It may include preeclampsia, altitude sickness, etc.

[0168] In some embodiments, the disease associated with the activation of Nrf2 may be a disease associated with oxidative stress or mitochondrial dysfunction.

[0169] The above-mentioned diseases related to oxidative stress may include, but are not limited to, Alzheimer's disease, Parkinson's disease, cancer, cardiovascular disease, atherosclerosis, hypertension, type 2 diabetes, chronic obstructive pulmonary disease (COPD), asthma, rheumatoid arthritis, multiple sclerosis, lupus, cataract, macular degeneration, non-alcoholic fatty liver disease, chronic kidney disease, Crohn's disease (inflammatory bowel disease), ulcerative colitis, amyotrophic lateral sclerosis (ALS), fibromyalgia, etc.

[0170] Diseases associated with the above-mentioned mitochondrial dysfunction may include, without limitation, mitochondrial encephalomyopathy (MELAS syndrome), chronic progressive extraocular muscle palsy (CPEO), Kerns-Sayre syndrome, Leber hereditary optic neuropathy (LHON), Leigh syndrome, myoclonic epilepsy and irregular red fiber syndrome (MERRF), neuropathy, ataxia, retinitis pigmentosa syndrome (NARP), Alpers syndrome, Barth syndrome, Pearson syndrome, mitochondrial DNA deficiency syndrome, mitochondrial neurogastrointestinal encephalopathy (MNGIE), Friedreich's ataxia, Wilson's disease, Huntington's disease, Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), diabetic neuropathy, mitochondrial cardiomyopathy, etc.

[0171] In some embodiments, the disease associated with the activation of Nrf2 may be a neurological disease associated with oxidative stress or mitochondrial dysfunction.

[0172] In some embodiments, the neurological disease associated with the oxidative stress or mitochondrial dysfunction may include Alzheimer's disease, Parkinson's disease, Huntington's disease, Lou Gehrig's disease (amyotrophic lateral sclerosis), primary lateral sclerosis, multiple sclerosis, stroke, traumatic brain injury, spinal cord injury, Friedreich's ataxia, diffuse Lewy body disease, chorea-acanthosis, Lewy body dementia, frontotemporal dementia, cerebrovascular dementia, epilepsy, mitochondrial encephalomyopathy, encephalitis, meningitis, Guillain-Barré syndrome, chronic inflammatory demyelinating polyneuropathy, myasthenia gravis, neuropathic pain, migraine, trigeminal neuralgia, polyneuropathy, autonomic neuropathy, or fibromyalgia.

[0173] The term "prevention" refers to any act of suppressing the occurrence of a disease associated with Nrf2 activation or delaying its onset by administering the above-mentioned pharmaceutical composition. The term "treatment" refers to any act of improving, alleviating, or beneficially altering the symptoms of a disease associated with Nrf2 activation by administering the above-mentioned pharmaceutical composition.

[0174] The above pharmaceutical composition may further include known Nrf2 activators other than the compound of the present invention, or active ingredients known to prevent, improve, or treat diseases related to the activation of said Nrf2, diseases related to oxidative stress, or diseases related to mitochondrial dysfunction.

[0175] The above-described Nrf2 activator may comprise a Michael addition receptor, one or more fumaric acid esters (e.g., fumaric acid mono- and / or diesters such as monomethyl hydrogen fumarate, dimethyl fumarate, monoethyl hydrogen fumarate, diethyl fumarate, etc.), ethacrinic acid, isothiocyanates such as bardoxolone methyl (methyl 2-cyano-3,12-dioxooleana-1,9(11)dien-28-oate), sulforaphane, 1,2-dithiol-3-thion such as oltipraz, 3,5-di-tert-butyl-4-hydroxytoluene, 3-hydroxycoumarin, or pharmacologically active derivatives or analogs thereof.

[0176] The above pharmaceutical composition may include a pharmaceutically acceptable carrier. The term "carrier" is used to mean including excipients, diluents, or adjuvants. The carrier may be selected from the group consisting of, for example, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, polyvinylpyrrolidone, water, physiological saline, buffer solutions such as PBS, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. The composition may include fillers, anticoagulants, lubricants, wetting agents, flavoring agents, emulsifiers, preservatives, or combinations thereof.

[0177] The above pharmaceutical composition may be prepared in any formulation according to conventional methods. The composition may be formulated, for example, into an oral formulation (e.g., powder, tablet, capsule, syrup, pill, or granule) or a parenteral formulation (e.g., injection, topical). Additionally, the composition may be prepared into a systemic formulation or a topical formulation.

[0178] In the above pharmaceutical composition, the solid dosage form for oral administration may be a tablet, pill, powder, granule, or capsule. The solid dosage form may further include an excipient. The excipient may be, for example, starch, calcium carbonate, sucrose, lactose, or gelatin. Additionally, the solid dosage form may further include a lubricant such as magnesium stearate or talc. In the above pharmaceutical composition, the liquid dosage form for oral administration may be a suspension, liquid formulation, emulsion, or syrup. The liquid dosage form may include water or liquid paraffin. The liquid dosage form may include an excipient, for example, a humectant, a sweetener, a flavoring agent, or a preservative. In the above pharmaceutical composition, the formulation for parenteral administration may be a sterile aqueous solution, a non-aqueous solvent, a suspension, an emulsion, a freeze-dried or suppository. The non-aqueous solvent or suspension may include a vegetable oil or an ester. The vegetable oil may be, for example, propylene glycol, polyethylene glycol, or olive oil. The ester may be, for example, ethyl oleate. The base of the suppository may be witepsol, macrogol, tween 61, cacao oil, laurin oil, or glycerogelatin.

[0179] The above pharmaceutical composition comprises, according to one aspect, a compound, a stereoisomer thereof, a solvate, or a pharmaceutically acceptable salt as an active ingredient of the pharmaceutical composition. "Active ingredient" refers to a physiologically active substance used to achieve pharmacological activity (e.g., treatment of a disease associated with the activation of Nrf2).

[0180] The above pharmaceutical composition may contain, in an effective amount, a compound according to one aspect, a stereoisomer thereof, a solvate, or a pharmaceutically acceptable salt. The term "effective amount" refers to an amount sufficient to produce an effect of preventing or treating a disease when administered to an individual requiring prevention or treatment. The effective amount may be appropriately selected by a person skilled in the art depending on the selected cell or individual. The preferred dosage of the above pharmaceutical composition may be appropriately selected by a person skilled in the art, although it depends on the individual's condition and body weight, the degree of the disease, the form of the drug, the route of administration, and the duration. The effective amount may be about 0.5 μg to about 2 g, about 1 μg to about 1 g, about 10 μg to about 500 mg, about 100 μg to about 100 mg, or about 1 mg to about 50 mg per pharmaceutical composition. However, the above compound, its stereoisomer, solvate, or pharmaceutically acceptable salt may be administered, for example, in amounts of about 0.0001 mg / kg to about 100 mg / kg, or about 0.001 mg / kg to about 100 mg / kg, divided into 1 to 24 doses per day, 1 to 7 doses per week from 2 days to 12 months, or 1 to 24 doses per month from 1 to 12 months. In the above pharmaceutical composition, the above compound, its stereoisomer, solvate, or pharmaceutically acceptable salt may be included in an amount of about 0.0001 weight% to about 10 weight%, or about 0.001 weight% to about 1 weight%, based on the total weight of the composition.

[0181] The method of administration of the compound according to the present invention may be oral or parenteral administration. The method of administration may be, for example, oral, transdermal, subcutaneous, rectal, intravenous, intra-arterial, intraperitoneal, intramuscular, intrasternal, topical, intranasal, intratracheal, topical application, or intradermal route. The composition may be administered systemically or topically, and may be administered alone or together with other pharmaceutically active compounds.

[0182] In some embodiments, the pharmaceutical composition may be provided as a topical skin preparation. For example, the topical preparation may be provided in the form of a powder, hydrogel, emulsion, ointment, cream, lotion, gel, foam, spray, patch, etc. In this case, the pharmaceutical composition may further include additives such as polyethylene glycol, polypropylene glycol, etc.

[0183]

[0184] One aspect of the present invention provides a method for preventing or treating a disease associated with the activation of Nrf2, comprising the step of administering the compound, its stereoisomer, solvate, or a pharmaceutically acceptable salt thereof to an individual.

[0185] The above compounds, stereoisomers, solvates, pharmaceutically acceptable salts, Nrf2, diseases associated with the activation of Nrf2, prevention, and treatment are as described above.

[0186] The above-mentioned individual may be a mammal, for example, a human, mouse, rat, cow, horse, pig, dog, monkey, sheep, goat, ape, or cat. The above-mentioned individual may be an individual that suffers from or is likely to suffer from symptoms associated with a disease related to the activation of Nrf2.

[0187] The above method may further include the step of administering to the subject a known active ingredient having the effect of preventing or treating diseases associated with the activation of Nrf2. The known active ingredient may be administered to the subject simultaneously, individually, or sequentially with a compound according to one aspect, a stereoisomer thereof, a solvate, or a pharmaceutically acceptable salt.

[0188] The method of administration may be oral or parenteral. The method of administration may be, for example, oral, transdermal, subcutaneous, rectal, intravenous, intra-arterial, intraperitoneal, intramuscular, intrasternal, topical, intranasal, intratracheal, topical, or intradermal. The pharmaceutical composition may be administered systemically or topically, and may be administered alone or in combination with other pharmaceutically active compounds.

[0189] The preferred dosage of the above pharmaceutical composition may vary depending on the patient's condition and body weight, the severity of the disease, the form of the drug, the route of administration, and the duration, but can be appropriately selected by a person skilled in the art. The dosage may be, for example, within the range of about 0.001 mg / kg to about 100 mg / kg, about 0.01 mg / kg to about 10 mg / kg, or about 0.1 mg / kg to about 1 mg / kg based on an adult. The administration may be once a day, 2 to 24 times a day, 1 to 2 times every 3 days, 1 to 6 times a week, 1 to 10 times every 2 weeks, 1 to 15 times every 3 weeks, 1 to 3 times every 4 weeks, or 1 to 12 times a year.

[0190]

[0191] One aspect of the present invention provides a compound according to one aspect, a stereoisomer thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof for use in preventing or treating diseases associated with the activation of Nrf2.

[0192] The above compounds, stereoisomers, solvates, pharmaceutically acceptable salts, Nrf2, diseases associated with the activation of Nrf2, prevention, and treatment are as described above.

[0193]

[0194] Another aspect provides the use of a compound according to one aspect, its stereoisomers, solvates, or pharmaceutically acceptable salts thereof for use in the manufacture of agents for the prevention or treatment of diseases associated with the activation of Nrf2.

[0195] The above compounds, stereoisomers, solvates, pharmaceutically acceptable salts, Nrf2, diseases associated with the activation of Nrf2, prevention, and treatment are as described above.

[0196] The compounds according to embodiments of the present invention have Nrf2 activation, antioxidant, neuroprotective, cytoprotective, and anti-inflammatory effects through the inhibition of Nrf2-Keap1 binding. Accordingly, they can be effectively used for the prevention or treatment of neurological diseases associated with oxidative stress or mitochondrial dysfunction, such as neuropathic pain and fibromyalgia, or oxidative stress-mediated skin diseases such as atopic dermatitis.

[0197] Figures 1a and 1b show the results of cell viability analysis for rat cortical astrocytes according to drug treatment (significance level relative to control group - *: p<0.05, **: p<0.01, ***: p<0.001 / significance level relative to comparison group - #: p<0.05, ##: p<0.01, ###: p<0.001).

[0198] Figure 2 is a fluorescence image of ROS in rat cortical astrocytes treated with H2O2 and the compound of the example.

[0199] Figure 3a is a fluorescence image of TMRM following drug treatment in rat cortical astrocytes.

[0200] Figure 3b is a quantification graph of TMRM according to drug treatment in rat cortical astrocytes (significance level relative to control group - *: p<0.05, **: p<0.01, ***: p<0.001 / significance level relative to comparison group - #: p<0.05, ##: p<0.01, ###: p<0.001).

[0201] Figure 4 is a graph showing the degree of Nrf2 target gene expression in rat cortical astrocytes following drug treatment (significance level relative to control group - *: p<0.05, **: p<0.01, ***: p<0.001).

[0202] Figure 5 is a schematic diagram of the experiment for the Chung neuropathic pain animal model.

[0203] Figure 6 is a graph of the degree of tactile response of the left hind foot according to drug treatment in the Chung neuropathic pain model (significance level relative to G1 - *: p<0.05, **: p<0.01, ***: p<0.001 / significance level relative to G2 - #: p<0.05, ##: p<0.01, ###: p<0.001).

[0204] Figure 7 is a graph and image of Iba-1 staining fluorescence intensity according to drug treatment in lumbar spine sections of the Chung neuropathic pain animal model (G1 significance level - *: p<0.05, **: p<0.01, ***: p<0.001 / G2 significance level - #: p<0.05, ##: p<0.01, ###: p<0.001).

[0205] Figure 8 is a schematic diagram of a reserpin-induced fibromyalgia animal model experiment.

[0206] Figure 9 shows graphs of von Frey pain sensitivity (A) and heat pain sensitivity (B) according to drug treatment in a reserpine-induced fibromyalgia model (significance level relative to G1 - *: p<0.05, **: p<0.01, ***: p<0.001 / significance level relative to G2 - #: p<0.05, ##: p<0.01, ###: p<0.001).

[0207] Figure 10 is a graph of cell viability according to drug treatment in human keratinocyte cell lines (significance level compared to untreated group - *: p<0.05, **: p<0.01, ***: p<0.001 / significance level compared to Menadion treated group - #: p<0.05, ##: p<0.01, ###: p<0.001).

[0208] Figure 11 is a schematic diagram of an efficacy evaluation experiment for an atopic dermatitis model.

[0209] Figure 12 is a graph showing the change in dermatitis scores according to drug treatment in an atopic dermatitis mouse model (significance level relative to G1 - *: 0.05>p, **: 0.01>p, ***: 0.001>p / significance level relative to G2 - #: 0.05>p, ##: 0.01>p, ###: 0.001>p).

[0210] Figure 13 is a graph showing the change in the frequency of scratching behavior according to drug treatment in an atopic dermatitis mouse model (significance level relative to G1 - *: 0.05>p, **: 0.01>p, ***: 0.001>p / significance level relative to G2 - #: 0.05>p, ##: 0.01>p, ###: 0.001>p).

[0211] Figure 14a is an H&E stained image showing changes in skin thickness according to drug treatment in an atopic dermatitis mouse model.

[0212] Figure 14b is a graph of changes in skin thickness according to drug treatment in an atopic dermatitis mouse model (significance level relative to G1 - *: 0.05>p, **: 0.01>p, ***: 0.001>p / significance level relative to G2 - #: 0.05>p, ##: 0.01>p, ###: 0.001>p).

[0213] Figure 15 is a graph of TNF-α mRNA expression levels according to drug treatment in an atopic dermatitis mouse model (significance levels relative to G1 - *: 0.05>p, **: 0.01>p, ***: 0.001>p / significance levels relative to G2 - #: 0.05>p, ##: 0.01>p, ###: 0.001>p).

[0214] Figure 16 is a graph of changes in body weight according to drug treatment in an atopic dermatitis mouse model (significance level relative to G1 - *: 0.05>p, **: 0.01>p, ***: 0.001>p / significance level relative to G2 - #: 0.05>p, ##: 0.01>p, ###: 0.001>p).

[0215] The present invention will be explained in detail below by way of examples. However, the following examples are merely illustrative of the present invention, and the scope of the present invention is not limited by the following examples.

[0216] The meanings of the abbreviations used in the following examples are as follows. Abbreviations not listed below have the meanings commonly used in the relevant field.

[0217] DCM: Dichloromethane

[0218] DMF: N,N-dimethylformamide

[0219] DMSO: Dimethyl sulfoxide

[0220] MeOH: methanol

[0221] EA: Ethyl acetate

[0222] TEA: Triethylamine

[0223] Py: Pyridin

[0224] AcCl: Acetyl chloride

[0225] Et2O: Diethyl ether

[0226] THF: Tetrahydrofuran

[0227] TBAB: Tetrabutylammonium bromide

[0228] HOAc: Acetic acid

[0229] Red-Al: Sodium bis(2-methoxyethoxy)aluminum hydride

[0230] MeCN: Acetonitrile

[0231] TFA: Trifluoroacetic acid

[0232] DIEA: N,N-Diisopropylethylamine

[0233] DDQ: 2,3-Dichloro-5,6-Dicyano-1,4-Benzoquinone

[0234] CMPB: Cyclohexylmethylphosphonic acid

[0235] DIEPA: Diethyl phosphite

[0236]

[0237] Preparation Example

[0238] Preparation Example 1: N-(4-amino-8-fluoronaphthalene-1-yl)acetamide (intermediate I-1)

[0239]

[0240] Step 1: 1H-naphtho[1,8-de][1,2,3]triazine

[0241] A solution of naphthalene-1,8-diamine (25.0 g, 158 mmol) was prepared in EtOH (250 mL) and AcOH (50 mL). The solution was cooled to 0°C. Isoamyl nitrite (21 mL, 155 mmol) was added dropwise at 0°C. After addition, the mixture was stirred at room temperature for 18 hours. This was filtered, and the filter cake was washed with EtOH to obtain a pure target compound (22.7 g, yield: 85%) as a red solid.

[0242] LCMS: [M+H] + = 170.1;

[0243] Step 2: 8-Fluoronaphthalene-1-Amine

[0244] A solution of the product from Step 1 (20.0 g, 118 mmol) was prepared in Py-HF (100 mL, 75% HF). The solution was heated at 60°C for 18 hours. The solution was quenched with NaOH (1 N aqueous solution), the pH was adjusted to 8-9, and it was extracted twice with EA. The organic phase was washed with a saturated NaCl solution, dried over Na2SO4, filtered, the filtrate concentrated under vacuum, and the residue purified using a silica gel column (PE / EA=10 / 1) to obtain a pure target compound (16.0 g, yield: 84%) as a colorless solid.

[0245] LCMS: [M+H] + = 162.1;

[0246] 1 H NMR (400 MHz, CDCl3) δ7.51 - 7.49 (m, 1H), 7.30 - 7.24 (m, 2H), 7.21 - 7.18 (m, 1H), 7.00 - 6.95 (m, 1H), 6.65 - 6.63 (m, 1H), 4.75 (s, 2H).

[0247] Step 3: N-(8-fluoronaphthalene-1-yl)acetamide

[0248] AcCl (10.6 g, 134 mmol) was added dropwise at 0°C to a solution of the Step 2 product (18.0 g, 112 mmol) in DCM (250 mL). The mixture was stirred at room temperature for 2 hours. The solution was saturated with NaHCO3 The solution was quenched and extracted with EA. The liquid phase was separated, the organic phase was dried on Na2SO4, filtered, and the filtrate was concentrated under vacuum. The residue was washed with Et2O / PE (1 / 5) to obtain a pure target compound (21.0 g, yield: 93%) as a white solid.

[0249] LCMS: [M+H] + = 204.2;

[0250] Step 4: N-(8-fluoro-4-nitronaphthalene-1-yl)acetamide

[0251] Fuming HNO3 (21.7 mL, 197 mmol) was added dropwise at 10°C to a solution of the product from Step 3 (20.0 g, 99 mmol) in AcOH (100 mL). The mixture was stirred at room temperature for 30 minutes. The solution was quenched with ice water, filtered, and the filter cake was washed twice with water. The residue was purified using a DCM / PE (0–100%) silica gel column to obtain a pure target compound (12.0 g, yield: 49%) as a yellow solid.

[0252] LCMS: [M+H] + = 249.0;

[0253] 1 H NMR (400 MHz, DMSO) δ10.21 (s, 1H), 8.38 -8.36 (d, J = 8.0 Hz, 1H), 8.22 - 8.20 (d, J = 8.0 Hz, 1H), 7.91 - 7.89 (d, J = 8.0 Hz, 1H), 7.81 -7.76 (m, 1H), 7.57 -7.51 (m, 1H), 2.18 (s, 3H).

[0254] Step 5: N-(4-amino-8-fluoronaphthalene-1-yl)acetamide

[0255] Pd / C (3.0 g, 20% W / W) was added to a solution of the product from Step 4 (15.0 g, 60 mmol) in MeOH (150 mL) and THF (150 mL). The mixture was stirred at room temperature for 2 hours. The solution was filtered, and the filtrate was concentrated under vacuum to obtain pure intermediate I-1 (12.6 g, yield: 96%) as a white solid.

[0256] LCMS: [M+H] + = 219.1;

[0257] Preparation Example 2: 4,4'-(hexane-1,6-diylbis(oxy))dibenzenesulfonyl chloride (intermediate I-2)

[0258]

[0259] Step 1: Sodium 4,4'-(hexane-1,6-diylbis(oxy))dibenzenesulfonate

[0260] A solution of TBAB (1.3 g, 4 mmol) and NaOH (32.0 g, 800 mmol) in H2O (100 mL) was added dropwise at room temperature to a solution of sodium 4-hydroxybenzenesulfonate (157.0 g, 800 mmol) in H2O (1.0 L). After addition, the mixture was stirred at room temperature for 10 minutes. Then, 1,6-dibromohexane (98.0 g, 400 mmol) was added, and the mixture was stirred at 100°C for 18 hours. Subsequently, H2O (1.0 L) was added, and the mixture was stirred at 100°C for 18 hours. This was filtered, the filter cake was washed with H2O (100 mL), and dried to obtain a pure target compound (150.0 g, yield: 78.9%) as a white solid.

[0261] 1 H NMR (400 MHz, DO): δ7.68 - 7.64 (m, 4H), 6.99 - 6.94 (m, 4H), 4.01 (t,J= 6.5 Hz, 4H), 1.74 - 1.65 (m, 4H), 1.40 (dd,J= 8.7, 5.5 Hz, 4H).

[0262] Step 2: 4,4'-(hexane-1,6-diylbis(oxy))dibenzenesulfonyl chloride

[0263] Anhydrous DMF (8 mL) was added to a solution of the product from Step 1 (150.0 g, 316 mmol) in SOCl2 (516 mL). The solution was heated at 75°C for 18 hours. The solution was concentrated under vacuum, and the residue was purified using a silica gel column (PE / EA=1 / 1) to obtain pure intermediate I-2 (132.0 g, yield: 89.7%) as a white solid.

[0264] 1 H NMR (400 MHz, CDCl3): δ7.96 (d,J= 9.0 Hz, 4H), 7.03 (d,J= 9.0 Hz, 4H), 4.10 (t,J= 6.3 Hz, 4H), 1.93 - 1.84 (m, 4H), 1.58 (dd,J= 8.7, 5.4 Hz, 4H).

[0265] Preparation Example 3: 5-(bromomethyl)-1-methyl-1H-benzo[d][1,2,3] (intermediate I-3)

[0266]

[0267] Step 1: Methyl 4-(methylamino)-3-nitrobenzoate

[0268] SOCl2 (37.2 mL, 510 mmol) was added to a solution of 4-(methylamino)-3-nitrobenzoic acid (50.0 g, 255 mmol) in MeOH (500 mL). The reaction mixture was stirred at 80°C for 40 hours. The reaction mixture was concentrated under vacuum to obtain the crude product, the target compound (53 g, yield: 99%), as a yellow solid.

[0269] LCMS: [M+H] + = 211.1;

[0270] Step 2: Methyl 3-amino-4-(methylamino)benzoate

[0271] Pd / C (4 g, 20% W / W) was added under H2 to a solution of the product from Step 1 (10.7 g, 50.9 mmol) in EA (120 mL) and MeOH (60 mL). The mixture was stirred overnight at room temperature. The solution was filtered, and the filtrate was concentrated to obtain the crude product, the target compound (9 g, yield: 98%), as a black solid.

[0272] LCMS: [M+H] + = 181.1

[0273] Step 3: Methyl 1-methyl-1H-benzo[d][1,2,3]triazole-5-carboxylate

[0274] Sodium nitrite (1.7 g, 24.2 mmol) was slowly added to a solution of the product from Step 2 (4 g, 22.2 mmol) in HOAc (50 mL). The solution was stirred at room temperature for 3 hours. Afterward, it was poured into water, neutralized with sodium bicarbonate, and extracted with ethyl acetate. The organic phase was washed with brine, dried over Na2SO4, and concentrated under vacuum. The residue was purified by flash chromatography to obtain a pure target compound (3.3 g, yield: 78%) as a yellow solid.

[0275] LCMS: [M+H] + = 192.1

[0276] Step 4: (1-methyl-1H-benzo[d][1,2,3]triazole-5-yl)methanol

[0277] Slowly add Red-Al (45 mL, 154 mmol) to the solution of the Step 3 yield (11.8 g, 61.8 mmol) 0 o It was added at C. The reaction mixture was stirred at room temperature for 0.5 hours. The solution was quenched with MeOH, extracted with EA, the organic phase was washed with brine, dried over Na2SO4, and concentrated. It was filtered, and the filtrate was concentrated under vacuum. The residue was purified by flash chromatography to obtain pure intermediate I-3 (8 g, yield: 74%) as a red solid.

[0278] LCMS: [M+H] + = 164.2;

[0279] Step 5: 5-(bromomethyl)-1-methyl-1H-benzo[d][1,2,3]triazole

[0280] CBr4 (12.2 g, 36.8 mmol) and PPh3 (9.6 g, 36.8 mmol) were added to a solution of the product from Step 4 (5.0 g, 30.7 mmol) in DCM (200 mL) 0 oIt was added at C. The mixture was stirred at room temperature for 3 hours. The reaction mixture was diluted with DCM and water. The organic phase was washed with brine, dried on Na2SO4, and concentrated. The residue was purified by flash chromatography to obtain a pure target compound (4.5 g, yield: 65%) as a white solid.

[0281] LCMS: [M+H] + = 226.0;

[0282]

[0283] Example 1: 2-((N-(5-fluoro-4-((1-methyl-1H-benzo[d][1,2,3]triazole)-5-sulfonamido)naphthalene-1-yl)-1-methyl-1H-indole)-5-sulfonamido)acetamide

[0284]

[0285] Step 1: N-(8-fluoro-4-((1-methyl-1H-indole)-5-sulfonamido)naphthalene-1-yl)acetamide

[0286] Py (48 mL, 596 mmol) was added to a solution of intermediate I-1 (13.0 g, 60 mmol) and 1-methyl-1H-indole-5-sulfonyl chloride (20.5 g, 89 mmol) in THF (200 mL). The mixture was stirred at 70°C for 18 hours. The solution was filtered, and the filter cake was washed with methanol to obtain a pure target compound (22.0 g, yield: 80%) as a white solid.

[0287] LCMS: [M+H] + = 412.1;

[0288] Step 2: N-(4-amino-5-fluoronaphthalene-1-yl)-1-methyl-1H-indole-5-sulfonamide

[0289] HCl (75 mL) and H2O (75 mL) were added to a solution of the product from Step 1 (5.0 g, 12.2 mmol) in methanol (250 mL). The mixture was stirred at 70°C for 6 hours. The solution was quenched with NaOH (1 N aqueous solution) and the pH was adjusted to 7-8. This was filtered, and the filter cake was obtained as the target compound (3.6 g, yield: 65%), which is a red solid.

[0290] LCMS: [M+H] + = 370.1;

[0291] Step 3: N-(4-amino-5-fluoronaphthalene-1-yl)-N-(cyanomethyl)-1-methyl-1H-indole-5-sulfonamide

[0292] K2CO3 (7.3 g, 52.8 mmol), KI (2.9 g, 17.6 mmol), and 2-bromoacetonitrile (4.2 g, 35.2 mmol) were added to a solution of the product from Step 2 (6.5 g, 17.6 mmol) in DMF (65 mL). The mixture was stirred at 50°C for 2 hours. The solution was diluted with water, filtered, and the filter cake was purified using a silica gel column (MeOH / DCM=0–5%) to obtain a pure target compound (6.3 g, yield: 88%) as a solid.

[0293] LCMS: [M+H] + = 409.1;

[0294] 1 H NMR (400 MHz, DMSO) δ8.03 (d,J= 1.2 Hz, 1H), 7.70 (t,J= 8.3 Hz, 2H), 7.57 (d, J= 3.1 Hz, 1H), 7.51 (dd,J= 8.7, 1.8 Hz, 1H), 7.44 - 7.39 (m, 1H), 7.15 (dd,J= 14.4, 7.5 Hz, 1H), 6.66 (dd, J = 5.7, 2.6 Hz, 2H), 6.49 (d,J= 8.3 Hz, 1H), 6.11 (s, 2H), 4.89 - 4.73 (m, 2H), 3.90 (s, 3H).

[0295] Step 4: N-(4-((N-(cyanomethyl)-1-methyl-1H-indole)-5-sulfonamido)-8-fluoronaphthalene-1-yl)-1-methyl-1H-benzo[d][1,2,3]triazole-5-sulfonamide

[0296] Py (6.7 g, 84.5 mmol) was added to a solution of the product from Step 3 (6.9 g, 16.9 mmol) and 1-methyl-1H-benzo[d][1,2,3]triazole-5-sulfonyl chloride (5.8 g, 25.4 mmol) in THF (100 mL). The mixture was stirred at 70°C for 18 hours. The solution was concentrated under vacuum, the residue was dissolved in DCM, and washed twice with 1N HCl. The liquid phase was separated, the organic phase was dried over Na2SO4, filtered, the filtrate was concentrated under vacuum, and the residue was washed with methanol / DCM (0–5%) to obtain a pure target compound (8.0 g, yield: 78%) as a solid.

[0297] LCMS: [M+H] + = 604.0;

[0298] 1H NMR (400 MHz, DMSO) δ10.24 (s, 1H), 8.38 (s, 1H), 8.12 - 7.96 (m, 2H), 7.89 (d,J= 7.5 Hz, 2H), 7.67 (t,J= 11.3 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.43 (dd,J= 8.7, 1.5 Hz, 1H), 7.34 (dd,J= 13.6, 7.7 Hz, 1H), 6.96 (t,J= 10.3 Hz, 1H), 6.89 (d,J= 8.1 Hz, 1H), 6.62 (dd,J= 18.3, 5.8 Hz, 1H), 4.99 - 4.75 (m, 2H), 4.36 (s, 3H), 3.88 (s, 3H).

[0299] Step 5: 2-((N-(5-fluoro-4-((1-methyl-1H-benzo[d][1,2,3]triazole)-5-sulfonamido)naphthalene-1-yl)-1-methyl-1H-indole)-5-sulfonamido)acetamide

[0300] NaOH (8.3 mL, 1N) was added to a solution of the product from Step 4 (5.0 g, 8.29 mmol) in MeOH / DMSO (50 mL / 2 mL). Subsequently, H2O2 (1.2 mL, 30% of H2O) was added dropwise. The mixture was stirred at room temperature for 1 hour. The solution was quenched with a saturated Na2SO3 solution, and the pH was adjusted to 6-7. This was filtered, and the filter cake was washed with methanol / DCM (10%) to obtain pure compound 1 (4.1 g, yield: 80%) as a white solid.

[0301] LCMS: [M+H] + = 622.1;

[0302] 1H NMR (400 MHz, DMSO-d6) δ10.13 (s, 1H), 8.34 (s, 1H), 8.02 (d,J= 8.1 Hz, 1H), 7.96 - 7.84 (m, 3H), 7.57 - 7.48 (m, 2H),7.36 - 7.32 (m, 2H), 7.20 (s, 1H), 7.13 - 7.08 (m, 1H), 6.89 (s, 1H), 6.86 - 6.84 (d,J= 8.1 Hz ,1H), 6.66 (d,J= 8.3 Hz, 1H), 6.58 (d,J= 2.9 Hz, 1H), 4.32 (s, 3H), 4.14 (dd,J= 77.1, 16.0 Hz, 2H), 3.86 (s, 3H).

[0303] Example 2: 2-((1-methyl-N-(4-((1-methyl-1H-benzo[d][1,2,3]triazole)-5-sulfonamido)naphthalene-1-yl)-1H-indole)-5-sulfonamido)acetamide

[0304]

[0305] Step 1: 1-Methyl-N-(4-Nitronaphthalene-1-yl)-1H-Indole-5-sulfonamide

[0306] 1-methyl-1H-indole-5-sulfonyl chloride (23.8 g, 104 mmol) and pyridine (32 mL, 399 mmol) were added to a solution of 4-nitronaphthalene-1-amine (15.0 g, 80 mmol) in THF (150 mL). The solution was stirred overnight at 75°C. The reaction mixture was concentrated under vacuum. The residue was diluted with aqueous solutions of EA and HCl. The organic phase was washed with brine, dried over Na2SO4, and concentrated under vacuum to obtain the crude product, the target compound (23 g, yield: 87%), as a yellow solid.

[0307] LCMS: [MH] - = 380.1;

[0308] Step 2: N-(cyanomethyl)-1-methyl-N-(4-nitronaphthalene-1-yl)-1H-indole-5-sulfonamide

[0309] K2CO3 (25.5 g, 184.1 mmol), KI (10.1 g, 60.3 mmol), and 2-bromoacetonitrile (14.5 g, 120.7 mmol) were added to a solution of the product from Step 1 (23.0 g, 60.3 mmol) in DMF (200 mL). The mixture was stirred at 60°C for 5 hours. The reaction mixture was diluted with EA and water. The organic phase was washed with brine, dried over Na2SO4, and concentrated under vacuum. The residue was ground with MeOH and filtered to obtain a pure target compound (16.5 g, yield: 66%) as a yellow solid.

[0310] LCMS: [M+Na] + = 443.1

[0311] 1 H NMR (400 MHz, DMSO) δ8.35 - 8.24 (m, 3H), 8.12 (d,J= 1.6 Hz, 1H), 7.93 - 7.80 (m, 2H), 7.73 (d,J= 8.8 Hz, 1H), 7.60 (d,J= 3.1 Hz, 1H), 7.57 - 7.53 (m, 1H), 7.22 (d,J= 8.2 Hz, 1H), 6.70 (d,J= 3.1 Hz, 1H), 5.04 (s, 2H), 3.90 (s, 3H).

[0312] Step 3: N-(4-aminonaphthalene-1-yl)-N-(cyanomethyl)-1-methyl-1H-indole-5-sulfonamide

[0313] Pd / C (1.5 g, 20% W / W) was added to a solution of the product from Step 2 (6.0 g, 14.3 mmol) in MeOH (60 mL) and EA (60 mL). The mixture was stirred overnight at room temperature. The solution was filtered, and the filtrate was concentrated under vacuum to obtain the target compound (5.6 g, yield: 100%) as a red solid.

[0314] LCMS: [M+H] + = 391.1

[0315] Step 4: N-(4-((N-(cyanomethyl)-1-methyl-1H-indole)-5-sulfonamido)naphthalene-1-yl)-1-methyl-1H-benzo[d][1,2,3]triazole-5-sulfonamide

[0316] A pure target compound (8.2 g, yield: 68%) was obtained as a yellow solid in the same manner as in Step 4 of Example 1.

[0317] LCMS: [M+H] + = 586.0;

[0318] 1 H NMR (400 MHz, DMSO) δ10.58 (s, 1H), 8.43 - 8.35 (m, 1H), 8.20 - 8.14 (m, 1H), 8.07 - 7.98 (m, 3H), 7.96 - 7.91 (m, 1H), 7.65 (d,J= 8.8 Hz, 1H), 7.62 - 7.51 (m, 3H), 7.44 - 7.40 (m, 1H), 7.03 (d,J= 8.1 Hz, 1H), 6.84 (d,J= 8.1 Hz, 1H), 6.64 (dd,J= 3.1, 0.6 Hz, 1H), 4.89 (d,J= 2.3 Hz, 2H), 4.35 (s, 3H), 3.88 (s, 3H).

[0319] Step 5: 2-((1-methyl-N-(4-((1-methyl-1H-benzo[d][1,2,3]triazole)-5-sulfonamido)naphthalene-1-yl)-1H-indole)-5-sulfonamido)acetamide

[0320] Pure compound 2 (4.1 g, yield: 78%) was obtained as a white solid in the same manner as step 5 of Example 1.

[0321] LCMS: [M+H] + = 604.0;

[0322] 1H NMR (400 MHz, DMSO) δ10.45 (s, 1H), 8.36 (d, J = 0.7 Hz, 1H), 8.31 - 8.25 (m, 1H), 8.15 - 8.09 (m, 1H), 8.03 (d, J = 8.8 Hz, 1H), 7.94 - 7.85 (m, 2H), 7.60 - 7.52 (m, 2H), 7.50 - 7.42 (m, 2H), 7.33 - 7.27 (m, 1H), 7.24 (s, 1H), 6.90 (d,J= 8.1 Hz, 2H), 6.72 (d,J= 8.1 Hz, 1H), 6.60 (d,J= 2.6 Hz, 1H), 4.34 (s, 3H), 4.31 (d,J= 16.1 Hz, 1H), 4.07 (d,J= 16.0 Hz, 1H), 3.87 (s, 3H).

[0323] Example 2-1: 2-((N-(4-(((7-methoxy-1-methyl-1H-benzo[d][1,2,3]triazole-5-yl)methyl)amino)naphthalene-1-yl)-1-methyl-1H-indole)-5-sulfonamido)acetamide

[0324]

[0325] In Example 2, compound 2-1 was synthesized by changing 1-methyl-1H-benzo[d][1,2,3]triazole-5-sulfonyl chloride to 7-methoxy-1-methyl-1H-benzo[d][1,2,3]triazole-5-carbaldehydro.

[0326] LCMS: [M+H] + = 583.20.

[0327] Example 3: 2-(5-(cyanomethyl)-2,2,6,6-tetraoxido-8,15-dioxa-2,6-dithia-3,5-diaza-4(1,4)-naphthalena-1,7(1,4)-dibenzenacyclopentadecapan-3-yl)acetamide

[0328]

[0329] Step 1: 8,15-dioxa-2,6-dithia-3,5-diaza-4(1,4)-naphthalena-1,7(1,4)-dibenzenacyclopentadecapane 2,2,6,6-tetraoxide

[0330] Naphthalene-1,4-diamine (44.6 g, 282 mmol) and pyridine (111.6 g, 1410 mmol) were added at 0°C to a solution of intermediate I-2 (132.0 g, 282 mmol) in DCM (480 mL). The mixture was stirred at room temperature for 2 hours. The solution was quenched with 2.0 M HCl and extracted with EA. The liquid phase was separated, the organic phase was dried over Na2SO4, filtered, and the filtrate was concentrated under vacuum. The residue was washed with PE / EA (1 / 1) to obtain a pure target compound (30 g, yield: 19.3%) as a brown solid.

[0331] LCMS: [M+H] + =553.1;

[0332] 1 H NMR (400 MHz, DMSO): δ 9.86 (s, 2H), 7.97 (dd,J= 6.5, 3.3 Hz, 2H), 7.41 (d,J= 8.9 Hz, 4H), 7.36 (dd,J= 6.5, 3.3 Hz, 2H), 6.93 (d,J= 8.9 Hz, 4H), 6.69 (s, 2H), 4.06 - 4.02 (m, 4H), 1.71 (d,J= 5.4 Hz, 4H), 1.48 (s, 4H).

[0333] Step 2: 2,2'-(2,2,6,6-tetraoxydo-8,15-dioxa-2,6-dithia-3,5-diaza-4(1,4)-naphthalena-1,7(1,4)-dibenzenacyclopentadecapan-3,5-diyl)diacetonitrile

[0334] K2CO3 (74.9 g, 540 mmol) and 2-bromoacetonitrile (32.6 g, 270 mmol) were added at 0°C to a solution of the product from Step 1 (30 g, 54 mmol) in DMF (300 mL). The mixture was stirred at room temperature for 2 hours. The solution was quenched with H2O and extracted with EA. The liquid phase was separated, the organic phase was dried over Na2SO4, filtered, the filtrate was concentrated under vacuum, and the residue was washed with PE / EA (1 / 1) to obtain a pure target compound (27 g, yield: 79.4%) as a brown solid.

[0335] LCMS: [M+H] + = 631.1;

[0336] 1 H NMR (400 MHz, CDCl3): δ8.34 (dd,J= 6.4, 3.3 Hz, 2H), 7.74 (dd,J= 6.5, 3.2 Hz, 2H), 7.64 (d,J= 8.8 Hz, 4H), 7.00 (d,J= 8.9 Hz, 4H), 6.40 (s, 2H), 5.13 (d,J= 17.9 Hz, 2H), 4.27 - 4.21 (m, 4H), 4.11 - 4.06 (m, 2H), 1.91 (s, 4H), 1.79 - 1.63 (m, 4H).

[0337] Step 3: 2-(5-(cyanomethyl)-2,2,6,6-tetraoxido-8,15-dioxa-2,6-dithia-3,5-diaza-4(1,4)-naphthalena-1,7(1,4)-dibenzenacyclopentadecapan-3-yl)acetamide

[0338] K2CO3 (5.9 g, 42.8 mmol) was added to a solution of the product from Step 2 (27.0 g, 42.8 mmol) in DMF (270 mL) and H2O (54 mL). Subsequently, H2O2 (4.3 mL, 30% of H2O) was added dropwise at 50°C. The mixture was stirred at 50°C for 1 hour. The solution was quenched with a saturated Na2SO3 solution, and the pH was adjusted to 6-7. This was filtered, and the filter cake was washed with methanol / DCM (10%) to obtain pure compound 3 (9.0 g, yield: 97%) as a white solid.

[0339] LCMS: [M+H] + = 649.4;

[0340] 1 H NMR (400 MHz, DMSO): δ 8.54 (d,J= 7.6 Hz, 1H), 8.19 (d,J= 6.6 Hz, 1H), 7.70 (dd,J= 9.2, 5.8 Hz, 2H), 7.60 (d,J= 8.9 Hz, 2H), 7.53 (d,J= 8.9 Hz, 2H), 7.30 (s, 1H), 7.17 (dd,J= 16.8, 8.9 Hz, 4H), 6.97 (s, 1H), 6.34 (dd,J= 31.7, 7.9 Hz, 2H), 5.07 (d,J= 18.1 Hz, 1H), 4.91 (d,J= 18.1 Hz, 1H), 4.43 (d,J= 16.1 Hz, 1H), 4.24 (dd,J= 9.8, 4.6 Hz, 2H), 4.16 - 4.07 (m, 3H), 1.81 (s, 4H), 1.66 - 1.47 (m, 4H).

[0341] Examples 3-1 to 3-18

[0342] In Example 3, compounds 3-1 to 3-18 were synthesized by changing intermediate I-2 to a suitable intermediate.

[0343] [Table 1]

[0344]

[0345]

[0346]

[0347]

[0348] Example 4: 2-(2,2,6,6-tetraoxido-1 1 H-8-oxa-2,6-dithia-3,5-diaza-1(5,1)-benzo[d][1,2,3]triazola-4(1,4)-naphthalena-7(1,4)-benzenacyclotetradecapan-5-yl)acetamide

[0349]

[0350] Step 1: 4-Methoxy-N-(4-Nitronaphthalen-1-yl)benzenesulfonamide

[0351] 4-methoxybenzenesulfonyl chloride (26.4 g, 128.1 mmol) and pyridine (36 mL, 447.9 mmol) were added to a solution of 4-nitronaphthalene-1-amine (20.0 g, 106.3 mmol) in THF (160 mL). The solution was stirred overnight at 70°C. The reaction mixture was concentrated under vacuum. The residue was diluted with EA. The organic phase was washed with brine, dried over Na2SO4, and concentrated under vacuum to obtain the target compound (14.4 g, yield: 67%) as a yellow solid.

[0352] LCMS: [MH] + = 357.1;

[0353] Step 2: N-(4-aminonaphthalene-1-yl)-4-methoxybenzenesulfonamide

[0354] Pd / C (5.0 g, 10% W / W) was added to a solution of the product from Step 1 (14.4 g, 40.2 mmol) in MeOH (200 mL). The mixture was stirred at room temperature for two hours. The solution was filtered, and the filtrate was concentrated to obtain the target compound (12.2 g, yield: 100%) as a black solid.

[0355] LCMS: [M+H]+ = 329.1

[0356] 1 H NMR (400 MHz, DMSO): δ9.42 (s, 1H), 8.01 (dd,J= 6.8, 2.8 Hz, 1H), 7.89 (dd,J= 6.8, 2.9 Hz, 1H), 7.55 (d,J= 8.8 Hz, 2H), 7.36 - 7.29 (m, 2H), 7.00 (d,J= 8.9 Hz, 2H), 6.69 (d,J= 8.0 Hz, 1H), 6.47 (d,J= 8.0 Hz, 1H), 5.78 (s, 2H), 3.78 (s, 3H).

[0357] Step 3: N-(4-aminonaphthalene-1-yl)-N-(cyanomethyl)-4-methoxybenzenesulfonamide

[0358] K2CO3 (15.4 g, 111.6 mmol) and 2-bromoacetonitrile (8.9 g, 74.4 mmol) were added to a solution of the product from Step 2 (12.2 g, 37.2 mmol) in DMF (120 mL). The mixture was stirred overnight at room temperature. The reaction mixture was concentrated under vacuum. The residue was diluted with EA. The organic phase was washed with brine, dried over Na2SO4, concentrated under vacuum, and the residue was purified using a silica gel column (DCM / MeOH=10 / 1) to obtain a pure target compound (12.6 g, yield: 92.6%) as a black solid.

[0359] LCMS: [M+H] + = 368.1

[0360] 1H NMR (400 MHz, DMSO) δ8.11 (d,J= 8.3 Hz, 1H), 7.83 (d,J= 8.3 Hz, 1H), 7.68 (d,J= 8.9 Hz, 2H), 7.46 (dt,J= 28.2, 7.4 Hz, 2H), 7.14 (d,J= 8.9 Hz, 2H), 6.74 (d,J= 8.1 Hz, 1H), 6.51 (d,J= 8.1 Hz, 1H), 6.14 (s, 2H), 4.82 (dd,J= 49.2, 18.2 Hz, 2H), 3.87 (s, 3H).

[0361] Step 4: N-(4-aminonaphthalene-1-yl)-N-(cyanomethyl)-4-hydroxybenzenesulfonamide

[0362] BBr3 (25.8 g, 102.9 mmol) was added at -60°C to a solution of the product from Step 3 (12.6 g, 34.3 mmol) in DCM (130 mL). The reaction mixture was stirred at room temperature for 18 hours. The solution was concentrated under vacuum, and the residue was dissolved in DCM. The liquid phase was separated, the organic phase was dried over Na2SO4, filtered, and the filtrate was concentrated under vacuum. The residue was purified using a silica gel column (DCM / MeOH=10 / 1) to obtain a pure target compound (6.5 g, yield: 54%) as a yellow solid.

[0363] LCMS: [M+H] + = 354.0;

[0364] 1 H NMR (400 MHz, DMSO): δ10.61 (s, 1H), 8.11 (d,J= 8.4 Hz, 1H), 7.84 (d,J= 8.3 Hz, 1H), 7.57 (d,J= 8.7 Hz, 2H), 7.45 (ddd,J= 24.0, 12.4, 7.3 Hz, 3H), 6.93 (d,J= 8.7 Hz, 2H), 6.52 (d,J= 8.2 Hz, 1H), 6.12 (s, 2H), 4.78 (dd,J= 49.7, 18.2 Hz, 2H).

[0365] Step 5: tert-butyl(6-(4-(N-(4-aminonaphthalene-1-yl)-N-(cyanomethyl)sulfamoyl)phenoxy)hexyl)carbamate

[0366] K2CO3 (5.08 g, 36.8 mmol) and tert-butyl(6-bromohexyl)carbamate (10.3 g, 36.8 mmol) were added to a solution of the product from Step 4 (6.5 g, 18.4 mmol) in acetone (100 mL). The mixture was stirred at 60°C for 16 hours. The solution was concentrated under vacuum, and the residue was dissolved in DCM. The liquid phase was separated, the organic phase was dried over Na2SO4, filtered, and the filtrate concentrated under vacuum. The residue was purified using a silica gel column (PE / EA=1 / 1) to obtain a pure target compound (6.5 g, yield: 65%) as a yellow solid.

[0367] LCMS: [M+H] + = 553.1;

[0368] 1 H NMR (400 MHz, DMSO): δ8.12 (d,J= 8.3 Hz, 1H), 7.84 (d,J= 7.7 Hz, 1H), 7.66 (d,J= 8.9 Hz, 2H), 7.52 - 7.36 (m, 2H), 7.12 (d,J= 8.9 Hz, 2H), 6.77 (dd,J= 12.9, 6.9 Hz, 2H), 6.52 (d,J= 8.2 Hz, 1H), 6.14 (s, 2H), 4.82 (dd,J= 50.0, 18.2 Hz, 2H), 4.07 (dd,J= 5.7, 4.5 Hz, 2H), 2.92 (dd,J= 12.7, 6.5 Hz, 2H), 1.72 (dd,J= 14.1, 6.7 Hz, 2H), 1.41 (d,J= 5.8 Hz, 4H), 1.37 (s, 9H), 1.31 (d,J= 6.6 Hz, 2H).

[0369] Step 6: tert-butyl(6-(4-(N-(cyanomethyl)-N-(4-((4-fluoro-3-nitrophenyl)sulfonamido)naphthalene-1-yl)sulfamoyl)phenoxy)hexyl)carbamate

[0370] The product of Step 5 (6.5 g, 11.8 mmol) in pyridine (100 mL) was added dropwise at 0°C to a solution of 4-fluoro-3-nitrobenzenesulfonyl chloride (6.7 g, 28 mmol) in pyridine (100 mL). The mixture was stirred at 0°C for 30 minutes. The solution was quenched with HCl (2.0 M) to adjust the pH to 3-4. The solution was extracted with EA. The liquid phase was separated, the organic phase was dried over Na2SO4, filtered, and the filtrate concentrated under vacuum. The residue was purified using a silica gel column (DCM / MeOH=10 / 1) to obtain a pure target compound (4.5 g, yield: 51%) as a yellow solid.

[0371] LCMS: [MH] + = 754.1;

[0372] 1 H NMR (400 MHz, DMSO) δ10.74 (s, 1H), 8.45 (dd,J= 6.9, 2.3 Hz, 1H), 8.15 (dd,J= 6.7, 2.8 Hz, 1H), 8.10 - 8.04 (m, 1H), 8.00 (dd,J= 6.8, 2.8 Hz, 1H), 7.77 (dd,J= 10.9, 8.8 Hz, 1H), 7.67 - 7.63 (m, 3H), 7.10 (dd,J= 14.4, 8.5 Hz, 3H), 6.98 (d,J= 8.0 Hz, 1H), 6.78 (t,J= 5.3 Hz, 1H), 4.92 (q,J= 18.2 Hz, 2H), 4.09 - 4.05 (m, 2H), 2.92 (d,J= 6.2 Hz, 2H), 1.73 (dd,J= 14.0, 6.7 Hz, 2H), 1.42 (s, 2H), 1.37 (s, 12H), 1.32 (d,J= 6.6 Hz, 2H).

[0373] Step 7: N-(4-((4-((6-aminohexyl)oxy)-N-(cyanomethyl)phenyl)sulfonamido)naphthalene-1-yl)-4-fluoro-3-nitrobenzenesulfonamide

[0374] TFA (20 mL) was added to a solution of the product from Step 6 (4.5 g, 5.96 mmol) in DCM (100 mL). The mixture was stirred at room temperature for 2 hours. The solution was concentrated under vacuum. The target compound (4.5 g, yield: 100%) was obtained as a yellow oil as a residue.

[0375] LCMS: [M+H] + = 656.1;

[0376] Step 8: 2-(1 3 -nitro-2,2,6,6-tetraoxido-8-oxa-2,6-dithia-3,5,15-triaz-4(1,4)-naphthalena-1,7(1,4)-dibenzenacyclopentadecapan-5-yl)acetonitrile

[0377] DIEA (8.86 g, 68.7 mmol) was added to a solution of the product from Step 7 (4.5 g, 6.87 mmol) in DMF (100 mL). The mixture was stirred at 50°C for 2 hours. The solution was concentrated under vacuum, and the residue was dissolved in EA. The liquid phase was separated, the organic phase was dried over Na₂SO₄, filtered, and the filtrate concentrated under vacuum. The residue was purified using a silica gel column (DCM / MeOH=10 / 1) to obtain a pure target compound (1.4 g, yield: 35%) as a yellow solid.

[0378] LCMS: [MH] + = 634.1;

[0379] 1 ¹H NMR (400 MHz, DMSO) :δ10.18 (s, 1H), 8.75 (t,J= 6.0 Hz, 1H), 8.29 - 8.22 (m, 2H), 8.02 (dd,J= 6.6, 3.0 Hz, 1H), 7.73 (dd,J= 9.2, 2.1 Hz, 1H), 7.67 - 7.58 (m, 2H), 7.45 (d,J= 8.9 Hz, 2H), 7.29 (d,J= 9.3 Hz, 1H), 6.94 (d,J= 8.9 Hz, 2H), 6.52 (dd,J= 31.7, 8.0 Hz, 2H), 4.96 (q,J= 18.1 Hz, 2H), 4.18 - 4.06 (m, 2H), 3.52 (d,J= 6.1 Hz, 2H), 1.70 (ddd,J= 22.1, 12.3, 6.1 Hz, 4H), 1.45 (dd,J= 17.5, 10.5 Hz, 4H).

[0380] Step 9: 2-(1 3 -amino-2,2,6,6-tetraoxydo-8-oxa-2,6-dithia-3,5,15-triaz-4(1,4)-naphthalena-1,7(1,4)-dibenzenacyclopentadecapan-5-yl)acetonitrile

[0381] Pd / C (0.7 g, 10% W / W) was added to a solution of the product from Step 8 (1.4 g, 2.2 mmol) in MeOH / THF (20 mL / 20 mL). The mixture was stirred at room temperature for two hours. The solution was filtered, and the filtrate was concentrated under vacuum to obtain the target compound (1.0 g, yield: 77%) as a yellow solid.

[0382] LCMS: [M+H] + = 606.1

[0383] 1H NMR (400 MHz, DMSO): δ9.68 (s, 1H), 8.34 (dd,J= 6.8, 2.9 Hz, 1H), 8.11 (dd,J= 6.7, 2.9 Hz, 1H), 7.67 - 7.59 (m, 2H), 7.46 (d,J= 8.9 Hz, 2H), 7.08 (d,J= 9.0 Hz, 2H), 6.95 (dd,J= 8.4, 2.2 Hz, 1H), 6.80 (d,J= 2.2 Hz, 1H), 6.52 (d,J= 8.5 Hz, 1H), 6.42 (d,J= 8.1 Hz, 1H), 6.33 (d,J= 8.0 Hz, 1H), 4.93 (dd,J= 68.7, 18.0 Hz, 4H), 4.12 (ddd,J= 29.6, 11.7, 6.2 Hz, 2H), 1.79 - 1.68 (m, 2H), 1.61 (s, 2H), 1.48 (d,J= 12.0 Hz, 4H).

[0384] Step 10: 2-(2,2,6,6-tetraoxydo-1 1 H-8-oxa-2,6-dithia-3,5-diaza-1(5,1)-benzo[d][1,2,3]triazzola-4(1,4)-naphthalena-7(1,4)-benzenacyclotetradecapan-5-yl)acetonitrile

[0385] NaNO2 (1.0 g, 1.95 mmol) in H2O (5 mL) was added dropwise at 0°C to a solution of the product from Step 9 (1.0 g, 1.65 mmol) in HCl (10 mL). The mixture was stirred at 0°C for 30 minutes. The solution was concentrated under vacuum, and the residue was dissolved in EA. The liquid phase was separated, the organic phase was dried on Na2SO4, filtered, and the filtrate was concentrated under vacuum to obtain the target compound (0.8 g, yield: 80%) as a yellow oil.

[0386] LCMS: [M+H] + = 617.1

[0387] Step 11: 2-(2,2,6,6-tetraoxydo-1 1H-8-oxa-2,6-dithia-3,5-diaza-1(5,1)-benzo[d][1,2,3]triazola-4(1,4)-naphthalena-7(1,4)-benzenacyclotetradecapan-5-yl)acetamide

[0388] NaOH (1.6 mL, 1.0 M) and H2O2 (0.2 mL, 9.79 M) were added to a solution of the product from Step 10 (0.8 g, 1.3 mmol) in MeOH / DMSO (10 mL / 0.4 mL). The mixture was stirred at room temperature for 30 minutes. The solution was quenched with a saturated Na2SO3 solution, and the pH was adjusted to 6-7. This was filtered, the filter cake was diluted with DMF, and purified by preparative HPLC to obtain pure compound 4 (0.36 g, yield: 45%) as a white solid.

[0389] LCMS: [M+H] + = 635.1

[0390] 1 H NMR (400 MHz, DMSO): δ10.31 (s, 1H), 8.27 (s, 1H), 8.15 (dd,J= 25.3, 8.9 Hz, 3H), 7.91 - 7.86 (m, 1H), 7.50 - 7.42 (m, 2H), 7.33 (d,J= 8.7 Hz, 2H), 7.26 (s, 1H), 6.96 (s, 1H), 6.76 (d, J = 8.8 Hz, 2H), 6.45 (d,J= 7.9 Hz, 1H), 6.38 (d,J= 8.0 Hz, 1H), 4.85 (t,J= 5.9 Hz, 2H), 4.28 (d,J= 16.0 Hz, 1H), 4.13 - 3.92 (m, 3H), 2.02 - 1.94 (m, 2H), 1.68 - 1.59 (m, 2H), 1.51 - 1.34 (m, 2H), 1.24 (s, 4H).

[0391] Example 5: 2-(6,6-dioxido-1 1 H,7 1H-3-oxa-6-thia-5-aza-1(5,1)-benzo[d][1,2,3]triazola-7(5,1)-indola-4(1,4)-naphthalenacyclotridecapan-5-yl)acetamide

[0392]

[0393] Step 1: 1-acetyl-N-(4-hydroxynaphthalene-1-yl)indoline-5-sulfonamide

[0394] Pyridine (50 ml) and 1-acetylindoline-5-sulfonyl chloride (6.64 g, 25.51 mmol) were added in an ice-water bath to a solution of 4-aminonaphthalene-1-ol hydrochloride (5.0 g, 25.51 mmol) in DMF (50 mL). The mixture was stirred at room temperature for 11 hours. This was poured into a 2 N HCl aqueous solution (500 ml), the suspension was evaporated, the cake was washed with Et2O, and dried to obtain the target compound (9.6 g, yield: 98%) as a brown solid.

[0395] MS: [MH] + = 381.1;

[0396] Step 2: 1-acetyl-N-(4-((4-fluoro-3-nitrobenzyl)oxy)naphthalene-1-yl)indolin-5-sulfonamide

[0397] 60% NaH (314 mg, 7.85 mmol) and 4-(bromomethyl)-1-fluoro-2-nitrobenzene (1.83 g, 7.85 mmol) were added in an ice-water bath to a solution of the product from Step 1 (3.0 g, 7.85 mmol) in DMF (30 mL). The mixture was stirred in an ice-water bath for 30 minutes. The solution was quenched with water (150 ml), extracted with EA (100 ml), the organic phase was dried over Na2SO4, filtered, the filtrate was concentrated under vacuum, and the residue was purified using a silica gel column (PE:EA=1:1, DCM:MeOH=100:1) to obtain the target compound (2.5 g, yield: 59%) as a brown solid.

[0398] MS: [M+H] + = 536.2

[0399] Step 3: 1-Acetyl-N-(cyanomethyl)-N-(4-((4-fluoro-3-nitrobenzyl)oxy)naphthalene-1-yl)indolin-5-sulfonamide

[0400] 2-bromoacetonitrile (3.18 g, 26.54 mmol), K2CO3 (5.49 g, 39.81 mmol), and potassium iodide (1.88 g, 13.27 mmol) were added to a solution of the product from Step 2 (7.1 g, 13.27 mmol) in DMF (71 mL). The mixture was 60 o The mixture was stirred at C for 4 hours. The mixture was poured into 350 ml of water and extracted with EA (200 ml). The organic phase was dried on Na2SO4, filtered, the filtrate concentrated under vacuum, and the residue purified using a silica gel column (PE:EA=1:1) to obtain the target compound (6.4 g, yield: 84%) as a brown solid.

[0401] MS: [M+H] + = 575.2

[0402] Step 4: N-(cyanomethyl)-N-(4-((4-fluoro-3-nitrobenzyl)oxy)naphthalene-1-yl)indolin-5-sulfonamide

[0403] Water (20 ml) and concentrated aqueous HCl solution (20 ml) were added to a solution of the product from Step 3 (2 g, 3.48 mmol) in ethanol (200 ml). The mixture was heated for 1 hour at 80°C o The mixture was stirred at C. The solution was adjusted to pH=8 with an aqueous NaHCO3 solution and extracted with EA (200 ml). The organic phase was dried on a Na2SO4 phase, filtered, the filtrate concentrated under vacuum, and the residue purified using a silica gel column (PE:EA=1:1) to obtain the target compound (1.32 g, purity: 71%) as a yellow solid.

[0404] MS: [M+H] + = 533.0

[0405] Step 5: N-(cyanomethyl)-N-(4-((4-fluoro-3-nitrobenzyl)oxy)naphthalene-1-yl)-1H-indole-5-sulfonamide

[0406] DDQ (836 mg, 3.68 mmol) was added to a solution of the product from Step 4 (1.96 g, 3.68 mmol) in DCM (200 ml). The mixture was stirred at room temperature for 18 hours. This was filtered, the filtrate was concentrated under vacuum, and the residue was purified using a silica gel column (PE:EA=1:1) to obtain the target compound (1.6 g, yield: 81%) as a yellow solid.

[0407] MS: [MH] + = 529.2

[0408] Step 6: tert-butyl (6-(5-(N-(cyanomethyl)-N-(4-((4-fluoro-3-nitrobenzyl)oxy)naphthalene-1-yl)sulfamoyl)-1H-indole-1-yl)hexyl)carbamate

[0409] CMPB (137 mg, 0.567 mmol) was added to a solution of the product from Step 5 (100 mg, 0.189 mmol) and tert-butyl(6-hydroxyhexyl)carbamate (82 mg, 0.378 mmol) in toluene (20 ml). The mixture was left at 90°C for 18 hours. o The mixture was stirred at C. The solvent was evaporated, and the residue was purified using a silica gel column (PE:EA=1:1) to obtain the target compound (60 mg, yield: 43%) as a yellow oil.

[0410] 1H NMR (400 MHz, DMSO-d6): δ8.06-7.85(m,4H), 7.72-7.62(m,3H), 7.52-7.36(m,4H), 7.02-6.97(m,2H), 6.74(s,1H), 6.65(d,J=2.8Hz,1H), 5.35(s,2H), 5.10(d,J=15.2Hz,1H), 4.75(d,J=14.4Hz,1H), 4.28-4.24 (m, 2H), 2.88(d,J=3.6Hz,1H), 1.78(d,J=4.0Hz,1H), 1.35 (s,9H), 1.27 (s, 3H).

[0411] Step 7: 1-(6-aminohexyl)-N-(cyanomethyl)-N-(4-((4-fluoro-3-nitrobenzyl)oxy)naphthalene-1-yl)-1H-indole-5-sulfonamide TFA salt

[0412] TFA (1 ml) was added to a solution of the product of step 6 (600 mg, 0.823 mmol) in DCM (6 ml). The mixture was stirred at room temperature for 1 hour. The solvent was evaporated to provide the target compound (765 mg, yield: 100%) as a yellow solid.

[0413] MS: [M+H] + = 630.2

[0414] Step 8: 2-(7 3 -nitro-2,2-dioxido-1 1 H-5-oxa-2-thia-3,8-diaza-1(5,1)-indola-4(1,4)-naphthalena-7(1,4)-benzenacyclotetradecapan-3-yl)acetonitrile

[0415] DIEPA (1.57 g, 12.16 mmol) was added to a solution of the product from Step 7 (765 mg, 1.216 mmol) in DMF (15 ml). The mixture was left at 80°C for 2 hours. oIt was stirred at C. This was poured into 50 ml of water, extracted with EA (50 ml), the organic phase was dried on Na2SO4, filtered, the filtrate was concentrated under vacuum, and the residue was purified using a silica gel column (PE:EA=2:1) ​​to obtain the target compound (235 mg, yield: 45%) as a brown solid.

[0416] MS: [M+H] + = 632.2

[0417] Step 9: 2-(7 3 -amino-2,2-dioxido-1 1 H-5-oxa-2-thia-3,8-diaza-1(5,1)-indola-4(1,4)-naphthalena-7(1,4)-benzenacyclotetradecapan-3-yl)acetonitrile

[0418] Zn powder (480 mg, 7.39 mmol) and an aqueous NH4Cl solution (5 ml, 14.78 mmol) were added to a solution of the product from Step 8 (900 mg, 1.478 mmol) in THF (20 ml) and methanol (2 ml). The mixture was heated for 1 hour at 50 o It was stirred at C. The mixture was filtered, the solvent was evaporated, and the residue was purified using a silica gel column (DCM:MeOH=100:3) to obtain the target compound (564 mg, yield: 66%) as a brown solid.

[0419] MS: [M+H] + = 580.0

[0420] Step 10: 2-(8-methyl-6,6-dioxido-1 1 H-3-oxa-6-thia-5,8-diaza-1(5,1)-benzo[d][1,2,3]triazzolla-4(1,4)-naphthalena-7(1,4)-benzenacyclotetradecapan-5-yl)acetonitrile

[0421] NaNO2 (73 mg, 0.918 mmol) was added at room temperature to a solution of the product from Step 9 (443 mg, 0.765 mmol) in AcOH (8.8 ml). The mixture was stirred at room temperature for 1 hour. The mixture was adjusted to pH 8 with an aqueous NaHCO3 solution, extracted with EA (30 ml), the organic phase was dried on Na2SO4, filtered, the filtrate was concentrated under vacuum, and the residue was purified using a silica gel column (DCM:MeOH=50:1) to obtain the target compound (359 mg, yield: 78%) as a brown solid.

[0422] MS: [M+H] + = 591.2

[0423] Step 11: 2-(6,6-dioxido-1 1 H,7 1 H-3-oxa-6-thia-5-aza-1(5,1)-benzo[d][1,2,3]triazola-7(5,1)-indola-4(1,4)-naphthalenacyclotridecapan-5-yl)acetamide

[0424] 1N NaOH aqueous solution (0.72 ml, 0.72 mmol) and 30% H2O2 (0.09 ml, 0.84 mmol) were added to a suspension of the product of step 10 (356 mg, 0.603 mmol) in MeOH (17.5 ml) and DMSO (1.75 ml). The mixture was stirred at room temperature for 1 hour. It was quenched with Na2SO3 aqueous solution (7 ml) and 1N HCl aqueous solution (0.7 ml). The solvent was evaporated, and the residue was purified by preparative HPLC to yield compound 5 (88 mg, yield: 23%).

[0425] MS: [M+H] + = 609.3

[0426] 1H NMR (400 MHz, DMSO-d6): δ8.52(d,J=8.4Hz,1H), 8.29(d,J=8.4Hz,1H), 7.94(s,1H), 7.84-7.80(m,2H), 7.75-7.60(m,2H), 7.51-7.49(m,2H), 7.40(d,J=3.2Hz,1H), 7.20-7.01(m,5H), 6.42(d,J=2.8Hz,1H), 5.26(d,J=15.2Hz,1H), 4.74(s,2H), 4.64-4.48(m,3H), 4.10-3.97(m,2H), 1.80(s,2H), 1.70(s,2H), 0.84(d,J=5.6Hz,3H), 0.58 (s, 1H).

[0427] Examples 5-1 to 5-5

[0428] In Example 5, the following compounds were synthesized by replacing 1-acetylindoline-5-sulfonyl chloride, 4-(bromomethyl)-1-fluoro-2-nitrobenzene, and tert-butyl (6-hydroxyhexyl)carbamate with suitable compounds.

[0429] [Table 2]

[0430]

[0431] Example 6: 2-((1-methyl-N-(4-((1-methyl-1H-benzo[d][1,2,3]triazole)-5-sulfonamido)naphthalene-1-yl)-1H-indole)-5-sulfonamido)acetamide

[0432]

[0433] Step 1: 1-methyl-5-(((4-nitronaphthalene-1-yl)oxy)methyl)-1H-benzo[d][1,2,3]triazole

[0434] 4-nitronaphthalene-1-ol (1.2 g, 5.3 mmol) and K2CO3 (3.6 g, 26.4 mmol) were added to a solution of intermediate I-3 (1.0 g, 5.3 mmol) in DMF (15 mL). The solution was stirred at 80°C for 5 hours. The reaction mixture was diluted with EA and water. The organic phase was washed with brine, dried over Na2SO4, and concentrated under vacuum. The residue was purified by flash to obtain a pure target compound (840 mg, yield: 47%) as a yellow solid.

[0435] LCMS: [MH] - = 335.1;

[0436] Step 2: 4-((1-methyl-1H-benzo[d][1,2,3]triazole-5-yl)methoxy)naphthalene-1-amine

[0437] Pd / C (0.7 g, 20% W / W) was added to a solution of the product from Step 1 (1.5 g, 4.5 mmol) in MeOH (50 mL). The mixture was stirred at room temperature for 2 hours. The solution was filtered, and the filtrate was concentrated. The residue was purified by flash to obtain a pure target compound (1.1 g, yield: 84%) as a brown solid.

[0438] LCMS: [M+H] + = 305.1

[0439] Step 3: 4-Formyl-N-(4-((1-methyl-1H-benzo[d][1,2,3]triazole-5-yl)methoxy)naphthalene-1-yl)benzenesulfonamide

[0440] Pyridine (2.6 g, 32.8 mmol) was added to a solution of the product from Step 2 (1.0 g, 3.2 mmol) in DMF (90 mL). o Added at C, and 0 o The mixture was stirred at C for 20 minutes. 4-Formylbenzenesulfonyl chloride (1.0 g, 4.9 mmol) was added. The reaction mixture was 0 oThe mixture was stirred at C for 30 minutes. The reaction mixture was diluted with HCl (1M) and EA. The organic phase was washed with water and brine, dried on Na2SO4, and concentrated under vacuum. The residue was purified by flash chromatography to obtain a pure target compound (0.55 g, yield: 35%) as a yellow solid.

[0441] LCMS: [M+H] + = 473.0

[0442] 1 H NMR (400 MHz, DMSO) δ10.22 (s, 1H), 10.06 (s, 1H), 8.23 ​​- 8.14 (m, 2H), 8.01 (d,J= 8.4 Hz, 2H), 7.92 - 7.79 (m, 4H), 7.76 - 7.67 (m, 1H), 7.56 - 7.37 (m, 2H), 7.09 - 6.94 (m, 2H), 5.43 (s, 2H), 4.32 (s, 3H).

[0443] Step 4: N-(4-((1-methyl-1H-benzo[d][1,2,3]triazole-5-yl)methoxy)naphthalene-1-yl)-4-(pyrrolidine-1-ylmethyl)benzenesulfonamide

[0444] Solutions of the product from Step 3 (0.55 g, 1.1 mmol) and pyrrolidine (0.17 g, 2.3 mmol) were prepared in DCM (10 mL) and DMF (2 mL). The reaction mixture was stirred at room temperature for 18 hours. NaBH3CN (0.22 g, 3.5 mmol) was added and stirred at room temperature for 1 hour. The reaction mixture was diluted with an aqueous solution of NaHCO3 and DCM. The organic phase was washed with brine, dried on a Na2SO4 phase, and concentrated under vacuum. The residue was purified by flash chromatography to obtain a pure target compound (0.45 g, yield: 73%) as a yellow solid.

[0445] LCMS: [M+H] + = 528.0;

[0446] Step 5: 2-((N-(4-((1-methyl-1H-benzo[d][1,2,3]triazole-5-yl)methoxy)naphthalene-1-yl)-4-(pyrrolidine-1-ylmethyl)phenyl)sulfonamido)acetamide

[0447] K2CO3 (0.15 g, 1.1 mmol) and 2-bromoacetamide (0.07 g, 0.56 mmol) were added to a solution of the product from Step 4 (0.3 g, 0.56 mmol) in DMF (6 mL). The mixture was stirred at room temperature for 4 hours. The reaction mixture was diluted with DCM and water. The organic phase was washed with brine, dried over Na2SO4, and concentrated under vacuum. The residue was purified by preparative HPLC to obtain Compound 6 (0.12 g, yield: 36%) as a white solid.

[0448] LCMS: [M+H] + = 585.0;

[0449] 1 H NMR (400 MHz, DMSO) δ8.23 - 8.16 (m, 2H), 7.99 - 7.94 (m, 1H), 7.91 (d,J= 8.6 Hz, 1H), 7.77 - 7.70 (m, 1H), 7.61 (d,J= 8.3 Hz, 2H), 7.52 - 7.45 (m, 3H), 7.26 (s, 1H), 7.11 (d,J= 8.3 Hz, 1H), 7.04 (d,J= 8.4 Hz, 1H), 6.95 (s, 1H), 5.53 - 5.40 (m, 2H), 4.38 - 4.26 (m, 4H), 4.17 (d,J= 16.3 Hz, 1H), 3.65 (s, 2H), 2.43 (s, 4H), 1.72 (s, 4H).

[0450] Examples 6-1 to 6-4

[0451] In Example 6, compounds 6-1 to 6-7 were synthesized by appropriately modifying the intermediates I-3 and 4-formylbenzenesulfonyl chloride with reference to Example 2.

[0452] [Table 3]

[0453]

[0454]

[0455] Example 7: 2-(2,2-dioxido-1 1 H-8-oxa-2-thia-3,5-diaza-1(5,1)-indola-7(2,5)-pyridina-4(1,4)-naphthalenacyclotetradecapan-3-yl)acetamide

[0456]

[0457] Step 1: 1-acetyl-N-(4-nitronaphthalene-1-yl)indolin-5-sulfonamide

[0458] A solution of 4-nitronaphthalene-1-amine (20.0 g, 106.4 mmol) and 1-acetylindoline-5-sulfonyl chloride (33.0 g, 127.7 mmol) in pyridine (400 mL) was prepared. The solution was stirred at 70°C for 18 hours. It was concentrated under vacuum, and the residue was purified using a silica gel column to obtain a pure target compound (8.0 g, yield: 18%) as a red solid.

[0459] LCMS: [M+H] + = 412.1;

[0460] 1 H NMR (400 MHz, DMSO) δ10.86 (s, 1H), 8.40 (d,J= 8.7 Hz, 1H), 8.35 (d,J= 8.6 Hz, 1H), 8.27 (d,J= 8.5 Hz, 1H), 8.09 (d,J= 8.5 Hz, 1H), 7.83 - 7.76 (m, 1H), 7.72 - 7.65 (m, 3H), 7.42 (d,J= 8.5 Hz, 1H), 4.11 (t,J= 8.4 Hz, 2H), 3.13 (t,J= 8.5 Hz, 2H), 2.15 (s, 3H).

[0461] Step 2: N-(4-nitronaphthalene-1-yl)indolin-5-sulfonamide

[0462] Concentrated HCl (20 mL) and water (20 mL) were added to a solution of the product from Step 1 (2.0 g, 4.9 mmol) in EtOH (60 mL). The solution was heated to 100°C for 2 hours. The solution was concentrated to 40 mL under vacuum to form a solid, and filtered to obtain a pure target compound (1.6 g, yield: 89%) as a red solid.

[0463] LCMS: [M+H] + = 470.1;

[0464] Step 3: N-(4-nitronaphthalene-1-yl)-1H-indole-5-sulfonamide

[0465] MnO2 (11.8 g, 135.1 mmol) was added to a solution of the product from Step 2 (5.0 g, 13.51 mmol) in DMF (120 mL). The mixture was stirred at room temperature for 6 hours. This was filtered, the filtrate was washed with water and extracted three times with EA, the organic phase was dried over Na2SO4, filtered, and the filtrate was concentrated under vacuum to obtain the target compound of the crude product (4.0 g, yield: 81%) as a red solid.

[0466] LCMS: [M+H] + = 368.1;

[0467] 1 H NMR (400 MHz, DMSO) δ11.58 (s, 1H), 10.78 (s, 1H), 8.45 -8.38 (m, 2H), 8.26 (d,J= 17.3, 8.7 Hz, 1H), 8.11 (s, 1H), 7.74 (t,J= 7.3 Hz, 1H), 7.67 - 7.54 (m, 2H), 7.52 -7.48 (m, 2H), 7.42 (d,J= 8.6 Hz, 1H), 6.62 - 6.53 (m, 1H).

[0468] Step 4: N-(4-aminonaphthalene-1-yl)-1H-indole-5-sulfonamide

[0469] Pd-C (410 mg) was added to a solution of the product from Step 3 (4.1 g, 11.1 mmol) in MeOH (50 mL) / EA (50 mL). The mixture was stirred at room temperature for 2 hours under an H2 atmosphere. The solution was filtered, and the filtrate was concentrated under vacuum to obtain a pure target compound (12.0 g, yield: 49%) as a red solid.

[0470] LCMS: [MH] - = 336.0;

[0471] Step 5: N-(4-aminonaphthalene-1-yl)-N-(cyanomethyl)-1H-indole-5-sulfonamide

[0472] A solution of the product from Step 4 (2.7 g, 8.0 mmol), 2-bromoacetonitrile (1.9 g, 16.0 mmol), and K2CO3 (3.3 g, 24.0 mmol) was prepared in DMF (40 mL). The mixture was stirred at room temperature for 16 hours. The solution was washed with water and extracted with EA, the organic phase was concentrated under vacuum, and the residue was purified using a silica gel column (DCM in MeOH: 0–5%) to obtain a pure target compound (2.4 g, yield: 80%) as a yellow solid.

[0473] LCMS: [M+H] + = 377.0;

[0474] 1 H NMR (400 MHz, DMSO) δ11.69 (s, 1H), 8.10 (d,J= 6.7 Hz, 1H), 8.03 (d,J= 1.7 Hz, 1H), 7.90 (d,J= 8.4, 0.8 Hz, 1H), 7.62 - 7.57 (m, 2H), 7.50 - 7.39 (m, 3H), 6.70 - 6.57 (m, 2H), 6.46 (d,J= 8.2 Hz, 1H), 6.10 (s, 2H), 4.84 (dt,J= 37.2, 17.6 Hz, 2H).

[0475] Step 6: N-(4-(((5-((6-bromohexyl)oxy)pyridine-2-yl)methyl)amino)naphthalene-1-yl)-N-(cyanomethyl)-1H-indole-5-sulfonamide

[0476] AcOH (32 mg, 0.53 mmol) was added to a solution of the product from Step 5 (2.0 g, 5.32 mmol) and 5-((6-bromohexyl)oxy)picolinealdehyde (2.3 g, 7.98 mmol) in DCM (50 mL) and DMF (5 mL). The mixture was stirred at room temperature for 18 hours. NaBH₄(OAC)₃ (3.4 g, 16.0 mmol) was added to the mixture. The mixture was stirred at room temperature for 6 hours. The solution was quenched with water, extracted with EA, the organic phase concentrated under vacuum, and the residue purified using a silica gel column (DCM in MeOH: 0–5%) to obtain a pure target compound (2.4 g, yield: 70%) as a yellow solid.

[0477] LCMS: [M+H] + = 646.0;

[0478] 1 H NMR (400 MHz, DMSO) δ11.68 (s, 1H), 8.30 - 8.26 (m, 1H), 8.23 ​​- 8.21 (m, 1H), 8.00 (d,J= 1.6 Hz, 1H), 7.92 - 7.89 (m, 1H), 7.59 -7.56 (m 2H), 7.53 -7.49 (m, 2H), 7.46 - 7.42 (m, 1H), 7.36 -7.33 (m, 1H), 7.32 -7.29 (m, 2H), 6.70 - 6.67 (m, 1H), 6.62 - 6.60 (m, 1H), 6.21 (d,J=8.4 Hz, 1H), 4.94 - 4.67 (m, 2H), 4.55 - 4.37 (m, 2H), 4.00 (t,J= 6.4 Hz, 2H), 3.52 (t,J= 6.7 Hz, 2H), 1.84 -1.66 (m, 4H), 1.48 - 1.35 (m, 4H).

[0479] Step 7: 2-(2,2-dioxido-1 1 H-8-oxa-2-thia-3,5-diaza-1(5,1)-indola-7(2,5)-pyridina-4(1,4)naphthalenacyclotetradecapan-3-yl)acetonitrile

[0480] K2CO3 (43 mg, 0.31 mmol) and KI (26 mg, 0.16 mmol) were added to a solution of the product from Step 6 (100 mg, 0.16 mmol) in DMF (20 mL). The mixture was stirred at 100°C for 1 hour. The solution was quenched with water, extracted with EA, the organic phase concentrated under vacuum, and the residue purified using a silica gel column (DCM in MeOH: 0–5%) to obtain a pure target compound (21 mg, yield: 23%) as a yellow solid.

[0481] LCMS: [M+H] + = 566.3;

[0482] 1 H NMR (400 MHz, DMSO) δ8.33 - 8.18 (m, 4H), 7.67 - 7.49 (m, 4H), 7.36 (dd,J= 8.7, 2.9 Hz, 1H), 7.22 (dd,J= 12.7, 8.7 Hz, 2H), 6.82 (dd,J= 8.7, 1.8 Hz, 1H), 6.68 (d,J= 3.0 Hz, 1H), 6.17 (d,J= 8.4 Hz, 1H), 5.78 (d,J= 8.5 Hz, 1H), 5.08 - 4.79 (m, 2H), 4.63 (dd,J= 16.6, 6.5 Hz, 1H), 4.33 - 4.00 (m, 5H), 1.75 - 1.55 (m, 4H), 1.54 - 1.30 (m, 4H).

[0483] Step 8: 2-(2,2-dioxido-1 1 H-8-oxa-2-thia-3,5-diaza-1(5,1)-indola-7(2,5)-pyridina-4(1,4)-naphthalenacyclotetradecapan-3-yl)acetamide

[0484] To a solution of the product from Step 7 (100 mg, 0.18 mmol) in MeOH (20 mL) and DMSO (2 mL), a solution of NaOH (7 mg) in H2O (0.5 mL) and H2O2 (30 mg, 0.27 mmol) were added. The mixture was stirred at room temperature for 4 hours. The solution was diluted with water, filtered, and the filter cake was purified using a silica gel column (MeOH / DCM = 0–5%) to obtain a pure target compound (80 mg, yield: 79%) as a solid.

[0485] LCMS: [M+H] + = 584.2;

[0486] 1 H NMR (400 MHz, DMSO) δ8.48 (dd,J= 8.4, 1.0 Hz, 1H), 8.31 (d,J= 1.7 Hz, 1H), 8.25 - 8.14 (m, 2H), 7.61 - 7.42 (m, 3H), 7.42 - 7.29 (m, 2H), 7.22 (s, 1H), 7.17 (dd,J= 8.6, 6.9 Hz, 2H), 6.94 (s, 1H), 6.78 (dd,J= 8.7, 1.8 Hz, 1H), 6.65 (d,J= 3.0 Hz, 1H), 6.17 (d,J= 8.4 Hz, 1H), 5.74 (t,J= 7.8 Hz, 1H), 4.60 (dd,J= 16.6, 6.4 Hz, 1H), 4.41 - 4.05 (m, 7H), 1.79 - 1.55 (m, 4H), 1.55 - 1.29 (m, 4H).

[0487] Example 7-1: 2-(5-methyl-2,2-dioxido-8,13-dioxa-2-thi-3,5-diaza-4(1,4)-naphthalena-1,7(1,4)-dibenzenacyclotridecapan-3-yl)acetamide

[0488]

[0489] In Example 7, compound 7-1 was synthesized by changing 1-acetylindoline-5-sulfonyl chloride to (4-hydroxyphenyl)sulfonyl chloride and changing 5-((6-bromohexyl)oxy)picolinealdehyde to 4-(4-bromobutoxy)benzaldehyde.

[0490] LCMS: [M+H] + = 545.2.

[0491]

[0492] Experimental Example 1: Evaluation of Neuroprotective and Antioxidant Efficacy

[0493] Experimental Example 1.1: Nrf2 activation efficacy (IC 50 and EC 50 ) evaluation

[0494] The Nrf2 activating efficacy was evaluated from the PPI (protein-protein interaction) inhibitory action of Nrf2 / Keap1. Test drugs were prepared by dissolving the compounds of Examples 1, 2, and 3 in a mixture of DMSO and PEG400 (1:1 volume ratio). 0.5% solutions of DMSO and PEG400, respectively, were used as vehicles.

[0495] Time-resolved fluorescence energy assay (TR-FRET assay) was performed to confirm the function of the compound in the example in inhibiting the binding of the Keap1 Kelch domain to the Nrf2 peptide. OptiPlate TMAfter adding the test drug to a final volume of 20 μL to a -384 (PerkinElmer, #6007290), 2 nM of pre-reacted Europium-fluorescently labeled streptavidin (PerkinElmer, USA) and 20 nM of purified Bio-Kelch protein (GenScript, USA) were added to each well and incubated at room temperature for 10 minutes. Subsequently, 300 nM Cy5-9-mer (GenScript, USA) was added and incubated at room temperature for 1 hour. The reaction products were measured at wavelengths of 615 nm and 665 nm using a multi-labeled microplate reader (PerkinElmer, USA), and IC was analyzed using GraphPad Prism 10 software. 50 The value was derived.

[0496] Subsequently, all experimental values ​​were expressed as the mean ± standard error (SEM), and statistical analysis was performed using IBM SPSS. TM The study was performed using Statistics 26 software. The statistical significance of the results was analyzed using LSD post-hoc analysis following one-way ANOVA.

[0497] When Nrf2 is activated, it moves from the cytoplasm to the nucleus, binds to the ARE (antioxidant response element) binding element on DNA, and induces target gene expression. Nrf2 transcriptional activity according to drug concentration was confirmed using the ARE-Luc reporter stable cell line (HepG2).

[0498] ARE-luciferase reporter HepG2 cell lines (BPS Bioscience, #60513) were cultured in Advanced-MEM (ThermoFisher, #12492013) medium containing 10% FBS (ThermoFisher, #16000044), 1% penicillin / streptomycin (ThermoFisher, #15070063), and 600 μg / mL of geneticin (ThermoFisher, #10131-035). Cells were placed in T-75 flasks (SPL, #70075) at a concentration of 4 x 10⁶ 6 Cells were cultured at a cell / well density in an incubator at 37°C and 5% CO2, and the medium was changed once a week. ARE-Luc HepG2 was cultured at 4 x 10⁶ in a 96-well plate (SPL, #30096). 4 Cells were cultured at a cell / well density for 24 hours. After 24 hours, the test drug and delivery agent were treated for 18 hours. After 18 hours, the cells were Bright-Glo TM The reaction was carried out using a Luciferase analysis system (Promega, #E2620), transferred to a White 96-well plate (ThermoFisher, #236105), and measured using a multi-labeled microplate reader. The experiment was repeated three times, and EC 50 The values ​​were derived using GraphPad Prism 10 software.

[0499] IC 50 and EC 50 Values ​​were indicated according to the following criteria.

[0500] IC 50 - +++: 100 nM or less / ++: Over 100 nM, 1,000 nM or less / +: Over 1,000 nM

[0501] EC 50- +++: 1,000 nM or less / ++: Over 1,000 nM, 10,000 nM or less / +: Over 10,000

[0502] Example IC 50 (nM)EC 50 (nM) Example IC 50 (nM)EC 50 (nM)1++++++3-12++++2++++++3-13+++++2-1+++-3-14+++-3++++++3-15++++3-1++++3-16++++3-2+++++4++++++3-3+++++5+++++3-4+ +++++5-1++++3-5+++++6+++3-6++++++6-1++++++3-7++++++6-2+++++3-8++++++6-3++++3-9+++++6-4++-3-10++++++7++++3-11+++++

[0503] Experimental Example 1.2: Evaluation of cytotoxicity, cytoprotection, and antioxidant capacity following drug treatment in rat cortical astrocytes

[0504] Rat cortical astrocytes were obtained from P0 rats. The brains were obtained by dissecting the heads of P0 rats and dissecting them in DPBS (Dulbecco phosphate-buffered saline) on ice to isolate only the cortex. The tissue was thawed by treatment with 0.25% Trypsin / EDTA (ThermoFisher, #25200114) for 15 minutes, and cells were obtained by centrifugation. The cells were placed in a T-75 flask coated with 50 μg / mL of Poly-D-Lysine (PDL; ThermoFisher, #A3890401) at a volume of 2.0 x 10⁶ 7 The cells were cultured at a cell / well density for one week, and half of the medium was replaced with fresh medium every three days. After one week, the cells were cultured at 37°C and 220 rpm for 18 hours to remove microglia, and the cells were separated from T-75 flasks using 0.25% Trypsin / EDTA and used for experiments evaluating cell viability and antioxidant capacity.

[0505] Cortical astrocytes were treated with the compounds of the examples, and cell viability was analyzed using a CCK-8 assay. Test drugs were prepared by dissolving the compounds of Examples 1, 2, and 3, respectively, in a mixture of DMSO and PEG400 (1:1 volume ratio) to final concentrations of 0.01 μM, 0.1 μM, 1 μM, and 10 μM, respectively, and a delivery vehicle containing 0.05% each of DMSO and PEG400 was prepared. Primary cortical astrocytes were placed in 8 x 10⁶ PDL-coated 96-well plates. 4 Cells were cultured for two days at a cell / well density. After two days, the test drug and delivery vehicle were pretreated for 24 hours. After 24 hours, 200 μM H2O2 was added and the cells were cultured for 18 hours to observe changes in drug-induced accumulated ROS (reactive oxygen species) and cell viability. Subsequently, the drug-treated medium was replaced with fresh medium, and 10 μL of Cell Counting Kit-8 (Enzo, #ALX-850-039-KI01) was added per well, followed by 4 hours of incubation. After 4 hours, measurements were taken at a wavelength of 450 nm using a SpectraMax 340 (Molecular Devices). The experiment was repeated three times, and each result was normalized to the delivery vehicle treatment group.

[0506] Figures 1a and 1b show the results of the analysis of cell viability in rat cortical astrocytes following drug treatment. Referring to Figures 1a and 1b, it was confirmed that there was no significant difference in cell viability between the group not treated with the drug (control group) and all groups treated with the drug. This indicates that all drugs have no intracellular toxicity. In addition, it was confirmed that the cell viability reduced by H2O2 (comparison group) recovered as the concentration of the drug increased.

[0507] Experimental Example 1.3: Evaluation of ROS protective efficacy

[0508] To confirm the cytoprotective and neuroprotective efficacy of the compounds in the examples, changes in drug-induced ROS (reactive oxygen species) and TMRM (tetramethylrhodamine methyl ester) accumulation were observed after treatment with H2O2. Total ROS was measured using CellROX Green Reagent (ThermoFisher, #C10444). After H2O2 treatment, 5 μM CellROX was applied for 1 hour, followed by washing twice with DPBS. Subsequently, cells were fixed by treating with 4% paraformaldehyde for 15 minutes. The nuclei of the fixed cells were stained by treating with 1 μM Hoechst 33342 for 10 minutes, followed by washing three times with DPBS. Fluorescence images were captured using THUNDER Imaging Systems (CellROX ex / em: 485 / 520, Hoechst 33342 ex / em: 350 / 461, exposure: 1.5 sec).

[0509] Figure 2 is a fluorescence image of ROS in rat cortical astrocytes treated with H2O2 and the compounds of the examples. Referring to Figure 2, it was confirmed that the ROS increased by H2O2 in primary astrocytes was reduced in a concentration-dependent manner by the compounds of Examples 1, 2, and 3.

[0510] Experimental Example 1.4: Measurement of Mitochondrial Membrane Potential

[0511] Primary cortical astrocytes were placed in 8 x 10⁶ PDL-coated 96-well Black glass plates (SPL, #33196). 4Cells were cultured for two days at a cell / well density. The test drugs and delivery systems were pretreated for 24 hours. After 24 hours, 200 μM H2O2 was added, and the cells were cultured for 18 hours. Mitochondrial membrane potential was measured using TMRM perchlorate (Invitrogen, #T668). After H2O2 treatment, 250 nM TMRM and 1 μM Hoechst 33342 (ThernoFisher, H3570) were added for 30 minutes, followed by washing three times with DBPS. Fluorescence images were captured using THUNDER Imaging Systems (Leica) (TMRM ex / em: 550 / 570, Hoechst 33341 ex / em: 350 / 461, exposure: 1.5 sec). Image intensity was measured using Image J, and the results were normalized using a control group.

[0512] Figure 3a is a fluorescence image of TMRM following drug treatment in rat cortical astrocytes. Figure 3b is a quantification graph of TMRM following drug treatment in rat cortical astrocytes. TMRM is a cell-permeable dye that accumulates in active mitochondria with intact membrane potential, and it was confirmed that the membrane potential reduced by H2O2 increased in a concentration-dependent manner by the compounds of Examples 1, 2, and 3.

[0513] Experimental Example 1.5: Evaluation of Nrf2 target gene expression in primary astrocytes

[0514] After treating cortical astrocytes with the compounds of Examples 1, 2, and 3, total RNA was extracted, and qRT-PCR was performed to confirm the expression of the Nrf2 target gene. RNA was extracted from primary cortical astrocytes using an RNA extraction kit (Genolution, #RE001) and quantified using a Nanodrop 2000 (ThermoFisher). 1 μg of RNA from each sample was extracted using a high-dose cDNA reverse transcription kit (Applied Biosystems TMcDNA was synthesized on a T100 Thermal Cycler (Bio-rad, cat no. 1861096) using (cat no. 4368814). RT-PCR (Real-time Polymerase Chain Reaction) was performed using PowerUp TM SYBR TM Using Green Master Mix for qPCR (ThermoFisher, #A25777) in QuantStudio TM 3 Real-Time PCR System (Applied Biosystems TM It was performed in , cat no. A28567). The result is △△C t The values ​​were expressed as fold change values ​​relative to the control group. The primer information corresponding to each gene is as follows.

[0515] Gene nameForward Primer (5' -> 3')Reverse Primer (5' -> 3')AOX1GTCCAGAAGCTTCCAGAGATGTTCACTGAGACCAAGASRX1AATCCCCAACCCCTGACTTTTGAACTGACCAGTGGGACACACAGTGSTP1GCTCAAGTCCACTTGTCTGTCAAGATGGCAT TAGATTGGTGSTA3AACCGTTACTTTCCTGCCTTTGGCCCTGCTCAGCCTATTGCOSGINGCAGCAGATGATGCGTGACGGAGCCGATGAGGACGAGHO1ATACCCGCTACCTGGGTGACTGTCACCCT GTGCTTTGACCTNQO1GCCATGAAGGAGGCTGCTGTATCACCAGGTCTGCAGCTTCxCTACCTTTTGCAAGCTCACAGCAAAGCAGGAGAGGGCAACAAAGATTNF-αAAATGGGCTCCCTCTCATCAG TTCTCTGCTTGGTGGTTTGCTACGACβ-actinCCGTAAAGACCTCTATGCCAACACTAGGAGCCAGGGCAGTAATCTCGAPDHGTGAAGCTCATTTCCTGGTATGAACTGAGGGCCTCTCTCTTG18s rRNACGGCTACCACATCCAAGGAAAGCTGGAATTACCGCGGC

[0516] Figure 4 is a graph showing the level of Nrf2 target gene expression following drug treatment in rat cortical astrocytes. Referring to Figure 4, increased expression of the known Nrf2 target genes, HO1, NQO1, GSTA3, GSTP1, SRX1, AOX1, xCT, and OSGIN was confirmed by the compounds of Examples 1, 2, and 3. Since TNF-α, which is not a target gene, was not expressed in the drug group, it was confirmed that the drugs selectively activate Nrf2 and do not induce the expression of inflammatory cytokines. Experimental Example 2: Evaluation of Efficacy in Improving Neuropathic Pain

[0517] Experimental Example 2.1: Experimental Preparation

[0518] All animal experiments were conducted in accordance with the Ministry of Food and Drug Safety's guidelines on the management and use of laboratory animals and were approved by the Institutional Animal Care and Use Committee (IACUC). Male 8-week-old Sprague-Dawley (SD) rats were purchased from Coatec (Korea). The rats were grouped into up to 3 individuals per cage and housed in a standard light-dark cycle (08:00–20:00) in an environment where temperature (22±1°C) and humidity (30–50%) were controlled, and food and water were provided on an ad libitum basis.

[0519] For the test drugs, 50% PEG 400 and 50% DW were used as carriers in Example 2, and 100% PEG 400 was used in Example 3.

[0520] To create an L5 spinal nerve ligation (SNL; Chung) model, 9-week-old rats were anesthetized and their paravertebral muscles were exposed. The L6 transverse process was removed, and the L4 and L5 ventral rami were exposed. The L5 spinal nerve was carefully ligated with 6.0 black silk thread. Experiments were performed on the groups in Table 6 below according to the schematic diagram in Figure 5.

[0521] Group Population Model Treatment Substance Treatment Method Treatment Concentration G1 8WT---G2 8Chung Carrier--G3 8Chung Example 2 SC, QD 100 mg / kg G4 8Chung Example 3 SC, QD 50 mg / kg G5 8Chung Gabapentin IP, QD 50 mg / kg

[0522] Experimental Example 2.2: Evaluation of Pain Improvement Efficacy for the Chung Neuropathic Pain Model

[0523] The von Frey test was performed three times (on days 6, 8, and 14 after model creation) before drug administration and at 1, 3, and 5 hours after administration. Before all behavioral tests, rats were allowed to acclimate to the environment for 30 minutes, and all researchers conducting the tests were kept unaware of the dosage administered to the animals in the group. Rats were placed on wire mesh and placed in a transparent plastic box (20 cm x 20 cm x 14 cm), and to evaluate mechanical allodynia, von Frey filaments (ascending weights; 0.4 g, 0.6 g, 1.4 g, 2 g, 4 g, 6 g, 8 g, and 15 g, North Coast, USA) were applied to the center of the left hind paw to measure the paw withdrawal threshold.

[0524] Figure 6 is a graph showing the degree of tactile response of the left hind foot according to drug treatment in the Chung neuropathic pain model. Referring to Figure 6, the pain model group (G2) showed higher pain sensitivity compared to the control group (G1). After the model was created, it was confirmed that the Gabapentin treatment group (G5) and the groups treated with the compounds of Example 2 and Example 3 (G3, G4) showed significant pain improvement efficacy as sensitivity gradually improved over time.

[0525] Experimental Example 2.3: Evaluation of Microglia Reduction Efficacy

[0526] Rats were euthanized by administration of Zolletil for the collection of tissue samples for histological sectioning, staining, and analysis. The spinal cord was dissected and fixed in 4% paraformaldehyde at 4°C for 24 hours, then 30% sucrose was added and stored at 4°C for 3 days. Immunohistochemical sectioning was performed on the spinal cord samples embedded with OCT compounds. The lumbar vertebrae were sectioned to a thickness of 20 μm using a Leica CM1950 (Leica Microsystems, Germany), mounted on microscope slides, and stored at -80°C until staining.

[0527] Three slices per lumbar vertebra were mounted on microscope slides, stained with Iba-1, and analyzed by immunohistochemistry (IHC). Each slide was washed with PBS (phosphate-buffered saline) solution and blocked for 1 hour at room temperature in a solution containing PBS, 5% normal goat serum, and 0.3% Triton X-100. The sections were incubated overnight at 4°C with the Iba1 primary antibody listed in Table 7 below, after which the sections were washed with PBS solution and incubated with the secondary antibody for 1 hour at room temperature. Finally, the sections were washed with PBS solution, completely dried, and mounted with a mounting solution containing 4',6-diamino-2-phenylindole (DAPI). Stained images were visualized using a ZEISS slide scanner (ZEISS, Axioscan7). The intensity of fluorescence in the ventral horns of the lumbar vertebrae was analyzed using Image J software.

[0528] Antibody Manufacturer# cat dilution anti-Iba1WAKO019-197411 / 1000

[0529] Figure 7 is a graph and image of the Iba-1 staining fluorescence intensity according to drug treatment in lumbar vertebrae of the Chung neuropathic pain animal model. The immunomarker Iba1 (microglia) is a neuroinflammatory marker, and its expression increased in the lumbar ventral / dorsal horns of the pain model group (G2) compared to the control group (G1). A decrease in Iba1 was confirmed in the gabapentin (G5) and drug administration groups (G3, G4), and a significant decrease was confirmed particularly in the compound administration group of Example 2 (G3).

[0530] Experimental Example 3: Evaluation of Efficacy in Improving Fibromyalgia

[0531] Experimental Example 3.1: Experimental Preparation

[0532] Mice identical to those in Experimental Example 2.1 were prepared, except that they were 6 weeks old. 100% PEG 400 was used as the carrier for the test drug.

[0533] Figure 8 is a schematic diagram of the reserpine-induced fibromyalgia animal model experiment. The creation of the reserpine-induced fibromyalgia model and drug administration were carried out by dividing 6-week-old male SD rats into 6 groups as shown in Table 8 below. To create the rat fibromyalgia model, reserpine (Sigma-Aldrich, 1 mg / kg) dissolved in 0.5% acetic acid was administered subcutaneously as a single dose for 3 days (Day 2 to Day 0). In all groups except the control group, the carrier, gabapentin, and the compound of Example 3 were administered intraperitoneally (IP) or subcutaneously (SC) once daily (QD) starting from Day 1, 2 hours prior to the experiment.

[0534] Group Population Size Model Treatment Drug Treatment Method Treatment Concentration G16 Saline --- G26 Reserpine Delivery Agent SC, QD - G36 Reserpine Gabapentin IP, QD 50 mg / kg G46 Reserpine Example 3 SC, QD 3 mg / kg G56 Reserpine Example 3 SC, QD 10 mg / kg G66 Reserpine Example 3 SC, QD 30 mg / kg

[0535] Experimental Example 3.2: Evaluation of Pain Relief Efficacy in a Reserpin-Induced Fibromyalgia Model

[0536] The von Frey test was performed five times (before the creation of the fibromyalgia model, from day 1 to before drug administration after model creation, and on days 2, 4, and 6). Before all behavioral tests, rats were allowed to acclimate to the environment for 30 minutes, and all researchers conducting the behavioral tests were kept unaware of the dosage administered to the animals in the group. A baseline was measured by performing the von Frey test on all animals before the creation of the model. Rats were placed on a wire mesh and placed in a transparent plastic box (20 cm x 20 cm x 14 cm), and to evaluate mechanical allodynia, von Frey filaments (ascending weights; 0.4 g, 0.6 g, 1.4 g, 2 g, 4 g, 6 g, 8 g, and 15 g, North Coast, USA) were applied to the center of the right hind paw to measure the paw withdrawal threshold.

[0537] The surface of the hot plate device (Columbus Instruments, USA) was maintained at 55 ± 0.5 °C, and the time was measured using the built-in timer from the start, when the mouse's four paws touched the plate surface, until the end, when the mouse licked, shook, or jumped its hind paws (the experiment was terminated immediately if any of the three reactions occurred). The experiment was terminated immediately after 25 seconds without any reaction. Additionally, after each attempt, both paws were cooled using gauze soaked in alcohol to prevent tissue damage. The results were calculated as the average of a total of three attempts.

[0538] Figure 9 is a graph showing von Frey pain sensitivity (A) and heat pain sensitivity (B) according to drug treatment in a reserpin-induced fibromyalgia model. Referring to Figure 9, the reserpin treatment group (G2) showed high pain sensitivity in the von Frey test compared to the control group (G1), and after the model was created, the gabapentin treatment group (G3) and the groups treated with the compound of Example 3 (G4 to G6) showed gradual improvement in sensitivity over time. In particular, treatment with the compound of Example 3 showed a tendency for dose-dependent recovery, and significant efficacy was confirmed for the von Frey test and heat pain test.

[0539] Experimental Example 4: Evaluation of Antioxidant Efficacy in Human Keratinocyte HaCaT

[0540] Human keratinocyte cell line HaCaT cells (Cytion, #300493) were seeded into a 96-well plate at a density of 3 × 10³ cells per well. After seeding, the cells were cultured for 24 hours to allow for stable attachment. Subsequently, the compounds of Examples 1, 2, and 3, respectively, were treated at concentrations of 0.01 μM and 1 μM for 24 hours. After drug treatment, 40 μM of Menadione (Sigma, M5625) was added to the cells to induce oxidative stress, and the cells were cultured for 4 hours. Cell viability after Menadione treatment was measured using the CCK-8 (Cell Counting Kit-8) assay. After adding the CCK-8 reagent to each well and allowing the reaction to occur, the absorbance was measured at a wavelength of 450 nm to obtain the cell viability graph shown in Fig. 10.

[0541] Figure 10 is a graph of cell viability following drug treatment in human keratinocyte cell lines. Referring to Figure 10, the cell viability of the Menadione (40 μM) treatment group was significantly reduced to approximately 40% compared to the control group, indicating that damage caused by oxidative stress was induced. It was confirmed that the cell viability reduced by Menadione was significantly restored in all treatment groups of Examples 1, 2, and 3.

[0542] Experimental Example 5: Evaluation of Efficacy in MC903-Induced Atopic Dermatitis (AD)

[0543] Experimental Example 5.1: Experimental Preparation

[0544] 8-week-old female BALB / c mice were prepared. All animals underwent a 1-week acclimatization period prior to the start of the experiment and were housed in an environment where temperature, humidity, and a photoperiod (12 h light / dark) were maintained. The MC903 application site was depilated 1 day prior to the start of the experiment.

[0545] 70% PEG400 (Sigma, #P3265) and 10% (v / v) propylene glycol (Sigma, #P4347) were vortex-mixed in a tube. The compounds of Example 2 and Example 3 were added to the PEG400 + PG mixture and completely dissolved to prepare concentrations of 10% and 5%, respectively. The mixture containing the dissolved test substances was vortex-mixed while slowly adding it to 20% PEG3350 (Sigma, #P4338), which had been completely liquefied in a 55°C water bath, and the mixture was maintained in the 55°C water bath for an additional 5 minutes to ensure complete homogenization. The final mixture was slowly cooled to room temperature to prepare the test™ substance in gel form.

[0546] Figure 11 is a schematic diagram of the efficacy evaluation experiment for an atopic dermatitis model. Atopic dermatitis was induced using MC903 (Calcipotriol, Sigma, #C4369). MC903 was prepared by dissolving it in EtOH at a dosage of 2 nmol / application dose, and the solution was applied topically to the dorsal skin of mice once a day (QD) for a total of 15 days. Repeated application induced atopic dermatitis-like lesions, such as erythema, keratinization, edema, and abrasions. The drug was applied once a day (QD) to the same site, one hour after application, starting from day 4 of MC903 treatment, for a total of 12 days. On day 15, mouse behavior was videotaped, and the frequency of scratching bouts was quantitatively analyzed.

[0547] Group population model treatment material treatment method treatment concentration G14WTV vehicle application, QD-G28AD MC903 application, QD2 nmol G38AD Example 2 application, QD10% G48AD Example 3 application, QD5%

[0548] Experimental Example 5.2: Evaluation of Dermatitis Severity

[0549] Skin lesions were evaluated on a scale of 0 to 3 points (0 points: none, 1 point: mild, 2 points: moderate, 3 points: severe, total score range: 0 to 12 points) based on the following four clinical items. A higher total score was judged to indicate a higher severity of dermatitis.

[0550] 1) Erythema / Hemorrhage, 2) Scale / Dryness, 3) Edema, 4) Excoriation / Erosion

[0551] Figure 12 is a graph showing the change in dermatitis scores according to drug treatment in an atopic dermatitis mouse model. Referring to Figure 12, distinct dermatitis lesions were induced compared to the control group following repeated application of MC903, and the dermatitis score increased from Day 2, reaching a peak on Day 8. The group treated with MC903 alone recorded the highest score on Day 8, and a high level of inflammation was maintained thereafter until Day 12. On the other hand, in the treatment groups that applied the compounds of Examples 2 and 3 starting from Day 4, the dermatitis score decreased significantly compared to the group treated with MC903 alone. In particular, a strong symptom-inhibiting effect approaching the level of the control group was confirmed on Day 8, and from this, it was confirmed that the compounds of the examples inhibited the onset and progression of MC903-induced dermatitis and promoted the recovery process of dermatitis.

[0552] Experimental Example 5.3: Evaluation of Scratching Bouts

[0553] To evaluate pruritus behavior associated with atopic dermatitis in mice, an analysis of scratching frequency was performed. Scratching behavior was defined based on the movement of the forefoot and hindfoot to the lesion site where MC903 was applied. Video footage recorded on day 15 was analyzed at 5-minute intervals, and the adaptation time (10 minutes) was excluded from the analysis.

[0554] The following behavior was recorded once.

[0555] 1) Continuously scratching the MC903-treated lesion site using hind legs, 2) Sweeping or scratching the MC903-treated site with forelegs

[0556] The following behaviors were not recognized as scratching behaviors and were all excluded from the count.

[0557] 1) Grooming the whiskers or around the face with the forepaws, 2) Touching or touching the ears with the forepaws, 3) Scratching the flanks, back, or other areas not affected by lesions with the hind paws, 4) Any act of touching or scratching other body parts not affected by lesions.

[0558] By applying these criteria, the number of scratchings by each mouse was quantified, and the effect of itching improvement was compared between groups.

[0559] Figure 13 is a graph showing the change in the frequency of scratching behavior according to drug treatment in an atopic dermatitis mouse model. Referring to Figure 13, repeated application of MC903 induced characteristic pruritus behavior, and a significant increase in scratching behavior was observed in the group treated with MC903 alone. The frequency of scratching in the MC903 treatment group increased significantly compared to the control group, confirming typical itching symptoms associated with the exacerbation of dermatitis. On the other hand, in the drug treatment groups (Examples 2 and 3), itching behavior was clearly suppressed. In the Example 2 treatment group, the frequency of scratching behavior was completely suppressed to the level of the control group compared to the MC903 treatment group, confirming a strong itching-inhibiting effect. The Example 3 treatment group also showed a decrease in the degree of scratching behavior compared to MC903, confirming that it possessed a significant level of itching-inhibiting effect.

[0560] Experimental Example 5.4: Evaluation of Epidermal Thickness

[0561] Dorsal skin tissues were collected and immediately fixed in 10% neutral buffered formalin (NBF). The fixed tissues were embedded in paraffin following standard tissue processing and sliced ​​to a thickness of 5 μm using a Leica Histocore AUTOCUT R (Leica Microsystems). The sections were attached to silane-coated slides, dried, and used for staining. The slides were deparaffinized with xylene and rehydrated stepwise at a series of alcohol concentrations. After rehydration, the tissue sections were stained with hematoxylin and eosin (H&E), followed by dehydration and clearing using alcohol and xylene before mounting. Digital images of the stained slides were acquired using an Axioscan 7 slide scanner (Zeiss). Epidermal thickness analysis was performed using ImageJ software (NIH). Epidermal thickness was measured at a total of five selected points per individual, and the average of the measurements was calculated as the final epidermal thickness.

[0562] Figure 14a is an H&E stained image showing changes in skin thickness following drug treatment in an atopic dermatitis mouse model. Figure 14b is a graph showing changes in skin thickness following drug treatment in an atopic dermatitis mouse model. Referring to Figures 14a and 14b, repeated application of MC903 induced epidermal hyperplasia, which is characteristically observed in atopic dermatitis models, and in the group treated with MC903 alone, a significant increase in epidermal thickness was observed compared to the control group due to inflammatory stimulation and promotion of keratinocyte proliferation. In the experimental substance treatment groups (Examples 2 and 3), epidermal hyperplasia was significantly alleviated. It was confirmed that the epidermal thickness of the treatment groups in Examples 2 and 3 was significantly reduced compared to MC903.

[0563] Experimental Example 5.5: Evaluation of Anti-inflammatory Efficacy

[0564] Mouse dorsal skin tissue was rapidly frozen with liquid nitrogen immediately after collection and stored at -80°C. The frozen tissue was removed, immediately homogenized to extract RNA, and RT-qPCR analysis was performed. Total RNA was isolated using TRIzol reagent (Thermo Fisher, #15596-018) according to the manufacturer's protocol and quantified using a Nanodrop 2000 (ThermoFisher). cDNA was extracted from 1 μg of RNA in each sample using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems TM Synthesis was performed on a T100 Thermal Cycler (Bio-rad, cat no. 1861096) using PowerUp (cat no. 4368814). RT-PCR was performed. TM Using SYBR™Green Master Mix for qPCR (ThermoFisher, #A25777) QuantStudio TM 3 Real-Time PCR System (Applied Biosystems TM Performed in , cat no. A28567). The result is △△C t It was expressed as a value and derived as a multiple change value based on the control sample.

[0565] Figure 15 is a graph showing the level of TNF-α mRNA expression according to drug treatment in an atopic dermatitis mouse model. Referring to Figure 15, repeated application of MC903 induced the expression of inflammatory cytokines, significantly increasing TNF-α mRNA expression within dermatitis lesions. In the group treated with MC903 alone, TNF-α expression levels were significantly higher compared to the control group, confirming the exacerbation of inflammation in atopic dermatitis. In the treatment groups of Example 2 and Example 3, the increase in the expression of the inflammatory cytokine TNF-α was clearly suppressed, confirming the efficacy of alleviating skin inflammation.

[0566] Experimental Example 5.6: Evaluation of Body Weight Change

[0567] Changes in body weight of each group were observed during the process of inducing atopic dermatitis through repeated application of MC903. In the control group and the drug-treated groups (Examples 2 and 3), no significant weight loss was observed during the experimental period, and relatively stable body weight was maintained throughout the entire period. On the other hand, in the group treated with MC903 alone, a significant weight loss was confirmed compared to the control group on day 16. This confirmed that the exacerbation of dermatitis and systemic stress caused by the repeated application of MC903 influenced weight loss. Conversely, unlike the group administered with MC903, no weight loss was observed in the treatment groups of Examples 2 and 3; instead, body weight was maintained at a level similar to that of the control group. This confirmed that the drug treatment mitigated the systemic stress and dermatitis exacerbation effects induced by MC903.

[0568] Figure 16 is a graph showing changes in body weight following drug treatment in an atopic dermatitis mouse model. Referring to Figure 16, no significant weight loss was observed in the control group and the drug-treated groups (Examples 2 and 3) during the experimental period, and a relatively stable body weight was maintained throughout the entire period. On the other hand, a significant weight loss was observed in the MC903-alone treatment group compared to the control group on day 16. This confirmed that the exacerbation of dermatitis and systemic stress caused by repeated application of MC903 influenced the weight loss. Conversely, unlike the MC903 administration group, no weight loss was observed in the treatment groups of Examples 2 and 3; instead, body weight was maintained at a level similar to the control group. This confirmed that the drug treatment alleviated the systemic stress and dermatitis exacerbation effects induced by MC903.

Claims

1. Compounds represented by the following chemical formula I, their solvates, stereoisomers, or pharmaceutically acceptable salts: [Chemical Formula I] In the above chemical formula I, Ring A is C 6-10 aryl; or 5 to 10 heteroaryl comprising 1 to 4 nitrogen atoms; Ring B is C 6-10 It is an aryl, or an 8- to 10-membered fused bicyclic heteroaryl comprising one or more nitrogen atoms; L A is -L a1 -L a2 - and; L a1 C 1-6 It is an alkylene or SO2, and L a2 is O or NR A And; R A is H; C 1-6 Alkyl; or cyano, carboxy, (C 1-6 Alkoxy)carbonyl, carbamoyl, (C 1-6 Alkyl)carbamoyl or di(C 1-6 C substituted with alkyl)carbamoyl 1-6 It is alkyl; R B is cyano, carboxy, (C 1-6 Alkoxy)carbonyl, (C 1-6 Alkyl)carbamoyl or di(C 1-6 C substituted with alkyl)carbamoyl 1-6 It is alkyl; R 1 and R 2 Each independently H; hydroxy; C 1-6 Alkoxy; C 1-6 Alkyl; C 2-6 Alkenyl; C 2-6 Alkynyl; C 3-8 Cycloalkyl; and C 3-8 C substituted with a cycloalkyl or a quaternary to octary heterocyclile containing 1 to 3 nitrogen atoms 1-6 Selected from the group consisting of alkyls; or R 1 and R 2 are connected to each other L M Forming; L M is -L m1 -L m2 -L m3 - and; L m1 and L m3 Each is independently a direct combination or O, and L m2 is C 2-10 Alkylene or C 2-10 It is alkenylene; R 1 and R 2 are connected to each other L M If not formed, ring A is an 8 to 10-membered fused bicyclic heteroaryl containing 1 to 4 nitrogen atoms; R 3 , R 4 and R 5 Each independently contains H, halo, hydroxy, and C 1-6 Alkoxy, amino, (C 1-6 alkyl)amino, di(C 1-6 Alkyl)amino, nitro, cyano, or C 1-6 It is an alkyl, and the above C 1-6 Alkyl groups are halo, oxo, hydroxy, C 1-6 Alkoxy, amino, (C 1-6 alkyl)amino, di(C 1-6 It can be optionally substituted with alkyl)amino, nitro, or cyano groups; o, p, and q are each independently integers from 0 to 2.

2. In Paragraph 1, Ring A is C 6-10 A compound, solvate, stereoisomer, or pharmaceutically acceptable salt thereof, wherein it is an aryl; a quinary to hyphatic monocyclic heteroaryl comprising 1 to 3 nitrogen atoms; or an 8 to 10-membered fused bicyclic heteroaryl comprising 1 to 4 nitrogen atoms.

3. In Paragraph 1, Ring B is C 6-10 A compound, solvate, stereoisomer, or pharmaceutically acceptable salt thereof, which is an aryl; or an 8- to 10-membered fused bicyclic heteroaryl comprising one or more nitrogen atoms.

4. In Paragraph 1, Ring A is phenyl, pyridinyl, or benzotriazoleyl, and A compound, its solvate, stereoisomer, or pharmaceutically acceptable salt, wherein ring B is a phenyl or indoleyl.

5. In Paragraph 1, R 1 and R 2 are connected to each other L M If it forms, Ring A is phenyl, and ring B is phenyl or; Ring A is a pyridine, and ring B is a phenyl or; Ring A is a pyridine day, and ring B is an indole day; Ring A is benzotriazoleyl, and ring B is phenyl; or Ring A is a benzotriazole ring, and ring B is an indole ring; R 1 and R 2 are connected to each other L M If it does not form, Ring A is benzotriazoleyl, and ring B is phenyl; or A compound, solvate, stereoisomer, or pharmaceutically acceptable salt thereof, wherein ring A is benzotriazoleyl and ring B is indoleyl.

6. In Paragraph 1, R 1 is methyl, methoxy, or butenyl, and R 2 is methyl, methoxy, pyrrolidineylmethyl, or butenyl; or R 1 and R 2 Compounds, solvates, stereoisomers, or pharmaceutically acceptable salts linked together as -(CH2)6-, -(CH2)6-O-, -O-(CH2)6-, -O-(CH2)4-O-, -O-(CH2)5-O-, -O-(CH2)6-O-, -O-(CH2)7-O-, -O-(CH2)8-O-, -O-(CH2)2CH=CH(CH2)2-O-, -O-(CH2)2CH=CH(CH2)3-O-, -O-CH2CH=CHCH2-O-, and -O-CH2CH=CH(CH2)3-O-.

7. In Paragraph 1, L A -CH2-O-, -SO2-O-, -CH2-NR A - or -SO2-NR A - and, R A is a compound, its solvate, stereoisomer, or pharmaceutically acceptable salt, which is H, methyl, carbamoylmethyl, or cyanomethyl.

8. In Paragraph 1, L A (-R A ) is a compound, its solvate, stereoisomer, or pharmaceutically acceptable salt of -CH2-O-, -CH2-NH-, -CH2-N(-CH3)-, -SO2-NH-, -SO2-N(-CH2CN)-, -SO2-N(-CH2CONH2)-, -SO2-N(-CH3)-, or -SO2-O-.

9. In Paragraph 1, R B is a compound, solvate, stereoisomer, or pharmaceutically acceptable salt thereof, which is cyanomethyl or carbamoylmethyl.

10. In Paragraph 1, R 3 is a methyl or methoxyin, a compound, its solvate, stereoisomer, or pharmaceutically acceptable salt.

11. In Paragraph 1, R 5 is a compound, its solvate, stereoisomer, or pharmaceutically acceptable salt of F.

12. In Paragraph 1, Among the above chemical formula I Is or Selected from, Is or Selected from; or Is or A compound, its solvate, stereoisomer, or pharmaceutically acceptable salt selected from.

13. In Paragraph 1, The above compound is a compound represented by the chemical formula IA, the chemical formula IB, or the chemical formula IC, its solvate, stereoisomer, or pharmaceutically acceptable salt: [Chemical Formula IA] [Chemical Formula IB] [Chemical formula IC] In the above chemical formulas IA, IB, and IC, R b1 cyano, carbamoyl, (C 1-6 Alkyl)carbamoyl or di(C 1-6 Alkyl)carbamoyl; ring A, ring B, R A , R 1 , R 2 , R 3 , R 4 , R 5 , o, p and q are as defined in paragraph 1.

14. In Paragraph 1, The compound of the above formula I is a compound, its solvate, stereoisomer, or pharmaceutically acceptable salt represented by the following formula I-1: [Chemical Formula I-1] In the above chemical formula I-1, L A , R A , L M , R 3 , R 4 , R 5 , o, p and q are as defined in paragraph 1, and In the above chemical formula I-1, R B is cyano, carbamoyl, (C 1-6 Alkyl)carbamoyl or di(C 1-6 C substituted with alkyl)carbamoyl 1-6 It is alkyl; In the above chemical formula I-1, ring A is C 6-10 aryl; or 5 to 10-membered heteroaryl containing 1 to 4 nitrogen atoms; and ring B is C 6-10 It is an aryl, or an 8- to 10-membered fused bicyclic heteroaryl containing one or more nitrogen atoms.

15. In Paragraph 1, The compound of the above formula I is a compound, its solvate, stereoisomer, or pharmaceutically acceptable salt represented by the following formula I-2: [Chemical Formula I-2] In the above chemical formula I-2, L A , R A , R B , R 3 , R 4 , R 5 , o, p and q are as defined in paragraph 1, and In the above chemical formula I-2, R B is cyano, carbamoyl, (C 1-6 Alkyl)carbamoyl or di(C 1-6 C substituted with alkyl)carbamoyl 1-6 It is alkyl; In the above chemical formula I-2, R 1a and R 2a Each independently H; hydroxy; C 1-6 Alkoxy; C 1-6 Alkyl; C 2-6 Alkenyl; C 2-6 Alkynyl; C 3-8 Cycloalkyl; and C 3-8 C substituted with a cycloalkyl or a quaternary to octary heterocyclile containing 1 to 3 nitrogen atoms 1-6 Selected from the group consisting of alkyls; In the above chemical formula I-2, ring A is an 8 to 10-membered fused bicyclic heteroaryl containing 1 to 4 nitrogen atoms; and ring B is C 6-10 It is an aryl, or an 8- to 10-membered fused bicyclic heteroaryl containing one or more nitrogen atoms.

16. In Paragraph 1, Compounds, solvates, stereoisomers, or pharmaceutically acceptable salts selected from the following group: .

17. A pharmaceutical composition for the prevention and treatment of diseases associated with the activation of Nrf2, comprising as an active ingredient the compound of claim 1, a solvate, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.

18. In Paragraph 17, A pharmaceutical composition for the prevention and treatment of diseases associated with the activation of Nrf2, wherein the diseases associated with the activation of Nrf2 include neurological diseases associated with oxidative stress or mitochondrial dysfunction or oxidative stress-mediated skin diseases.

19. In Paragraph 18, A pharmaceutical composition for the prevention and treatment of diseases associated with the activation of Nrf2, wherein neurological diseases associated with the above-mentioned oxidative stress or mitochondrial dysfunction include Alzheimer's disease, Parkinson's disease, Huntington's disease, Lou Gehrig's disease (amyotrophic lateral sclerosis), primary lateral sclerosis, multiple sclerosis, stroke, traumatic brain injury, spinal cord injury, Friedreich's ataxia, diffuse Lewy body disease, chorea-acanthosis, Lewy body dementia, frontotemporal dementia, cerebrovascular dementia, epilepsy, mitochondrial encephalomyopathy, encephalitis, meningitis, Guillain-Barré syndrome, chronic inflammatory demyelinating polyneuropathy, myasthenia gravis, neuropathic pain, migraine, trigeminal neuralgia, polyneuropathy, autonomic neuropathy, or fibromyalgia.

20. In Paragraph 18, A pharmaceutical composition for the prevention and treatment of diseases associated with the activation of Nrf2, wherein the above-mentioned oxidative stress-mediated skin diseases include atopic dermatitis, contact dermatitis, seborrheic dermatitis, allergic contact dermatitis, neurodermatitis, psoriasis, pruritus, rosacea, xerosis, chronic spontaneous urticaria, nodular prurigo, eczema, or vitiligo.

Images