Probe design and electrochemical biomarker detection utilizing reusable polypeptide nucleic acid (PNA) based sensors
The integration of PNA probes with AuNP-decorated TiCh-NTs in biosensors addresses enzymatic degradation and repulsion issues, enhancing sensitivity and durability for effective DNA fragment detection.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- UNIV OF UTAH RES FOUND
- Filing Date
- 2025-11-14
- Publication Date
- 2026-05-21
AI Technical Summary
Existing DNA sensing platforms face challenges such as enzymatic degradation and electrical repulsion between DNA probes and biomarkers, limiting their sensitivity and durability for detecting short DNA fragments.
Integration of peptide nucleic acid (PNA) probes with titanium dioxide nanotubes (TiCh-NTs) decorated with gold nanoparticles (AuNPs) enhances biosensor sensitivity and durability by exploiting the conductive properties of gold and structural support of TiCh-NTs, with PNA targeting a 17 bp sequence from the IS6110 region of Mycobacterium tuberculosis.
The PNA-AuNP-TiCh-NTs biosensor achieves a 15-fold enhancement in target DNA detection sensitivity and reduces nonspecific binding, providing a sensitive and durable platform for biomarker detection with improved accuracy and recyclability.
Smart Images

Figure US2025055524_21052026_PF_FP_ABST
Abstract
Description
Attorney Docket No.: 104884-201SYSTEMS AND METHODS FOR PROBE DESIGN AND ELECTROCHEMICAL BIOMARKER DETECTION UTILIZING REUSABLE POLYPEPTIDE NUCLEIC ACID(PNA) BASED SENSORSSTATEMENT REGARDING FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT
[0001] No funding claimed - no GSC.CROSS-REFERENCE TO RELATED APPLICATIONS
[0002] This PCT application claims the benefit and priority of, U.S. Provisional Patent Application Nos. 63 / 916,924, filed on November 13, 2025, and 63 / 720,960, filed on November 15, 2024. The entire contents of such applications are hereby incorporated by reference.BACKGROUND
[0003] Nucleotide detection protocols are useful tools in biology, medicine, and biotechnology. Advances in DNA detection platforms enable fast screening of disease biomarkers, facilitating early-stage treatment. However, DNA sensing platforms face challenges such as enzymatic degradation and electrical repulsion between the DNA probe and biomarkers. Peptide nucleic acid (PNA) offers enhanced sensitivity and stability, making it a suitable alternative for detecting short DNA fragments.
[0004] Peptide nucleic acid (PNA) is a synthetic polymer like a chimera mixed with nucleotide and peptide characteristics that closely mimics the structure of DNA but with differences that offer certain advantages for various applications, including drug delivery, PCR clamping for target gene detection, and biosensor platforms. PNA's backbone comprises neutral N-(2-aminoethyl)-glycine units, in contrast to DNA's negatively charged phosphodi ester linkers. The DNA backbone structure includes repeated phosphodi ester linkers between the deoxyribose (pentose sugar) with one of four types of bases linked to the deoxyribose. The peptide backbone structure has repeated peptide bonds between the alpha carbon linked to one of the amino acid groups. Unlike the DNA structure, the PNA replaces these negatively charged phosphodiester linkers in the DNA backbone with the neutral charged N-(2-aminoethyl)-glycine units in the132706801.4Attomev Docket No.: 104884-201peptide backbone. The purine nucleobases (adenine and guanine) and pyrimidine nucleobases (cytosine and thymine) are linked to the N-(2-aminoethyl)-glycine backbone through methylene carbonyl linkages on the PNA backbone. The neutral charge of the repeated N-(2-aminoethyl)-glycine backbone of PNA provides several beneficial properties, such as high affinity to other DNA biomarker fragments, resistance against degradation by restriction enzymes, increased durability of the PNA as sensing probes, and less repulsion for the penetration of the PNA into cells. While the phosphate group in the sugar-phosphate backbone of DNA has a negative charge, the PNA backbone has a neutral charge. Due to this difference, the PNA becomes a neutral charge molecule without electrostatic repulsion or attraction. Combined with PNA's ability to hybridize with DNA according to Watson-Crick base pairing, these properties make PNA a candidate for developing highly sensitive and selective biosensors.
[0005] TiCh has been widely recognized for its optical, thermal, mechanical, and electrical properties, as well as its biocompatibility and chemical stability, making it a cornerstone in the design of biosensors, chemical sensors, and other nanotechnological applications. A glucose biosensor based on covalently immobilized glucose oxidase on AuNP-modified TiCh nanotube arrays has been demonstrated, highlighting this composite structure's enhanced electron transfer and stability. Biosensors have been developed for hydrogen peroxide detection using AuNP-encapsulated TiCh nanotubes, emphasizing the role of AuNPs in facilitating direct electron transfer. The surface plasmon resonance effect of AuNPs has been utilized to provide a photoelectrochemical sensor with enhanced photocurrent response on TiCh nanotubes. This work illustrates the potential synergy between TiCh and AuNPs in enhancing biosensor performance.
[0006] However, despite the advances made with enzyme-based and photoelectrochemical biosensors, applying PNA as a probe in for detecting biomarkers such as DNA fragments remains unexplored.SUMMARY
[0007] Aspects of the present disclosure are directed to a nucleotide-based biosensor including peptide nucleic acid (PNA) probes attached to titanium dioxide nanotubes (TiCh-NTs) deposited with gold nanoparticles (AuNPs). The integration of AuNPs on TiCh-NTs can enhance the sensitivity of the biosensor by exploiting the excellent conductive properties of gold and the232706801.4Attomev Docket No.: 104884-201superior electron mobility and structural support provided by TiCh-NTs. In some embodiments, PNA as the probe molecule targets a 17 bp sequence from the IS6110 region of Mycobacterium tuberculosis. This sequence was chosen due to its high copy number in the bacterial genome, significantly increasing detection sensitivity.
[0008] Aspects of the present disclosure are directed to methods using PNA-based biosensing platforms to detect short DNA fragments as biomarkers. PNA probe was immobilized on the AuNP-calcinated TiCh-NTs electrodes and hybridized with the target DNA fragment, generating electrical signal changes. These systems and methods measure electrochemical signals, e.g., using cyclic voltammetry (CV) and differential pulse voltammetry (DPV).
[0009] As discussed above, PNA offers excellent selectivity and durability due to its neutral backbone, resistance to enzymatic degradation, thermal stability, and strong DNA binding affinity, making it beneficial for long shelf-life and recyclable biosensor systems. The experiments at 50°C demonstrated that the AuNP-decorated TiCh-NTs electrode showed notably higher signal intensity than TiCh-NTs without AuNPs, with approximately a 15-fold enhancement for target DNA detection. This result confirms that integrating AuNPs with TiCh-NTs enhances electron transfer and amplifies electrochemical signals from PNA-based biosensors, contributing to more effective detection systems. Additionally, sputtering gold for 300 seconds on the TiCh-NTs electrodes effectively reduced nonspecific binding, particularly for scDNA, and improved the system's overall accuracy. These findings demonstrate that embodiments combining PNA, TiCh-NTs, and AuNPs create a sensitive and durable biosensor platform for diverse applications with enhanced sensitivity and durability.
[0010] Methylene blue (MB) is an electrocatalyst that amplifies the intensity of the electrical detection signal at its reduction potential, -0.3 V. Interestingly, the amplified electrical signals from the MB decrease when the DNA-DNA pair has a single mismatch. The intercalation and groove binding model explains the binding mechanism between the MB and the DNA bases in the DNA-DNA pairs, and it implies that the binding mechanism is unaffected by the phosphodiester backbones. In some embodiments of the present disclosure, signal amplification from the MB in PNA-DNA hybridization system can show a similar electric signal pattern to the DNA-DNA hybridization case. From the thermodynamic viewpoint, one base-pair mismatch in332706801.4Attomev Docket No.: 104884-201PNA-DNA pairs has been reported to weaken the binding energy more than in DNA-DNA pairs. This observation indicates that at temperatures close to Tm, PNA-DNA hybridization is less likely than DNA-DNA hybridization. In other words, if the hybridization temperature increases to the proper level, the degree of PNA-DNA hybridization decreases more than that of DNA-DNA, which is expected to enhance the biosensor's relative sensitivity. In addition, the PNA has advantages in durability and selectivity. The artificial backbone structure of the PNA sequences is not sensitive to the nuclease enzymes and has high thermal stability. Thus, in harsh conditions, the single-stranded PNA probes can be expected to work longer than DNA probes as a biosensing material, so the recyclability of the PNA probes can also be utilized. Also, the signal intensity from the fewer PNA-DNA pairs that occurred at higher temperatures may be lower than that from the more PNA-DNA duplex at lower temperatures because of the hybridization temperature effect. Thus, distinct signal intensity differences can be produced depending on the PNA-DNA hybridization temperatures. With these advantages, the PNA probe-based biosensor system can be stably and accurately used continuously and repeatedly over a long period.
[0011] Aspects of the present disclosure are directed to embodiments of a biosensor apparatus including an electrode including a surface including at least one of (i) a metal; and (ii) a layer of nanotubes, and a plurality of peptide nucleic acid (PNA) probes complexed to the surface of the electrode. In some embodiments, the plurality of PNA probes are structured to bind to one or more biomarkers.
[0012] In some embodiments of the biosensor apparatus, the one or more biomarkers comprise at least one of (i) DNA; (ii) RNA; or (iii) mRNA. In some embodiments of the biosensor apparatus, the one or more biomarkers comprise DNA fragments from an IS6110 region of M. tuberculosis. In some embodiments of the biosensor apparatus, the plurality of PNA probes are complexed to the electrode via direct covalent bonding. In some embodiments of the biosensor apparatus, the electrode further comprises a layer of 6-mercapto-l -hexanol (MCH) configured to inhibit non-specific binding to a surface of the electrode. In some embodiments of the biosensor apparatus, the one or more biomarkers are at least lObp in length. In some embodiments of the biosensor apparatus, the layer of nanotubes comprises TiO2 nanotubes, and a layer of gold nanoparticles is sputter coated onto the layer of nanotubes. In some embodiments of the biosensor432706801.4Attomev Docket No.: 104884-201apparatus, a layer of gold nanoparticles is sputter coated onto the layer of nanotubes for about 300 seconds.
[0013] Aspects of the present disclosure are directed to embodiments of a diagnostic method including the steps of: (i)obtaining a sample from a human patient; (ii) providing a biosensor apparatus. In some embodiments, the biosensor apparatus includes an electrode with an electrode surface that includes at least one metal and a layer of nanotubes with a plurality of peptide nucleic acid (PNA) probes complexed to the surface of the electrode and structured to bind to one or more target biomarkers. In some embodiments, the diagnostic method further includes: (iii) contacting the sample with the surface of the electrode; (iv) binding one or more target biomarkers in the sample to the plurality of PNA probes at a predetermined hybridization temperature; (v) measuring an electrical signal generated from the biosensor apparatus; and (vi) resetting the biosensor apparatus. In some embodiments, resetting the biosensor apparatus is done by heating the biosensor apparatus to a temperature between about 90°C and about 100°C to dehybridize bound biomarker from the plurality of the PNA probes.
[0014] In some embodiments of the diagnostic method, the one or more biomarkers comprise at least one of: (i) DNA; (ii) RNA; or (iii) mRNA. Some embodiments of the diagnostic method further include repeating steps (iii)-(vi) using a new sample. In some embodiments of the diagnostic method, the temperature comprises 95°C. In some embodiments of the diagnostic method, the one or more target biomarkers comprise DNA fragments from an IS6110 region of M. tuberculosis. In some embodiments of the diagnostic method, the layer of nanotubes comprises TiO2 nanotubes, and a layer of gold nanoparticles is sputter coated onto the layer of nanotubes. In some embodiments of the diagnostic method, a layer of gold nanoparticles is sputter coated onto the layer of nanotubes for about 300 seconds. In some embodiments of the diagnostic method, measuring the electric signal is done using at least one of: (i) differential pulse voltammetry (DVP); or (ii) a cyclic voltammetry (CV) system. In some embodiments of the diagnostic method, the one or more biomarkers are at least lObp in length. In some embodiments of the diagnostic method, the predetermined hybridization temperature is between ambient temperature and a melting temperature (Tm) of the plurality of PNA probes.532706801.4Attomev Docket No.: 104884-201
[0015] Aspects of the present disclosure are directed to embodiments of a method of designing an oligonucleotide-binding probe. In some embodiments, the method includes: (i) providing a whole genome sequence of a probe target; (ii) selecting a desired length of the oligonucleotide-binding probe; (iii) selecting a minimum repetition threshold; (iv) identifying DNA sequences that comprise the selected length and meet or exceed the selected minimum repetition threshold within the whole genome sequence of the probe target; (v) determining a percentage of sequence identity with a reference whole genome; and (vi) selecting probe candidates from identified sequences having a minimum sequence identity to the reference genome. In some embodiments of the method, the oligonucleotide-binding probe is synthesized to bind to at least one of the selected probe candidates.
[0016] In some embodiments of the method, the probe target comprises M. tuberculosis. In some embodiments of the method, the reference whole genome comprises that of H. sapiens. In some embodiments of the method, the selected length is at least 17 bp. In some embodiments of the method, the minimum repetition threshold comprises 15. In some embodiments of the method, the oligonucleotide-binding probe comprises peptide nucleic acid (PNA). Some embodiments of the method further include synthesizing the oligonucleotide-binding probe to be configured to bind to a complement of at least one of the selected probe candidates.BRIEF DESCRIPTION OF THE DRAWINGS
[0017] The drawings show embodiments of the disclosed subject matter for the purpose of illustrating the invention. However, it should be understood that the present application is not limited to the precise arrangements and instrumentalities shown in the drawings.
[0018] FIG. 1A illustrates a step-by-step embodiment of a method for designing an oligonucleotide-binding probe according to aspects of the present disclosure.
[0019] FIG. IB schematically illustrates an embodiment of a system configured to carry out the method of FIG. 1A.
[0020] FIG. 1C graphically illustrates the number of repeated unique target sequence fragments (17 bp length, 20 bp length, and 23 bp length) in a whole genomic DNA during an iteration of an embodiment of the method of FIG. 1, according to aspects of the present disclosure.632706801.4Attomev Docket No.: 104884-201
[0021] FIG. ID is a table showing an embodiment of the results of candidate probe sequences analyzed according to embodiments of the method of FIG. 1.
[0022] FIG. 2A schematically illustrates an embodiment of a biosensor apparatus according to aspects of the present disclosure.
[0023] FIG. 2B schematically illustrates another embodiment of a biosensor apparatus according to aspects of the present disclosure.
[0024] FIG. 2C schematically illustrates the embodiment of a biosensor apparatus of FIG.2B hybridized with a biomarker, according to aspects of the present disclosure.
[0025] FIG. 2D schematically illustrates the embodiment of a biosensor apparatus of FIG.2A hybridized with a biomarker, according to aspects of the present disclosure.
[0026] FIG. 3 illustrates a step-by-step embodiment of a diagnostic method using an embodiment of a biosensor apparatus, according to aspects of the present disclosure.
[0027] FIG. 4A illustrates a structural formula of an embodiment of a linker used to space an oligonucleotide-binding probe away from the electrode of a biosensor apparatus, according to aspects of the present disclosure.
[0028] FIG. 4B schematically illustrates an embodiment of a biosensor apparatus with a linker, according to aspects of the present disclosure.
[0029] FIG. 5 A graphically illustrates the results of PNA probes, coDNA fragments, and PNA-coDNA hybridized samples measured by UV-Vis spectroscopy with the range of 240-300 nm, respectively, according to aspects of the present disclosure.
[0030] FIG. 5B illustrates the results of the samples from FIG. 5A visualized via the SDS-PAGE with EtBr staining, illuminated under UV light, according to aspects of the present disclosure.732706801.4Atorney Docket No.: 104884-201
[0031] FIG. 5C illustrates the results of a densitometry test from the results of FIG. 5B showing that the band intensity ratio is 15329:33512, which has 1:2.2 for the PNA-DNA duplex and the ssDNA, respectively, according to aspects of the present disclosure.
[0032] FIG. 5D shows fluorescent images confirming PNA-DNA hybridization through the cyanide labeling test to the PNA immobilized on the gold electrodes, according to aspects of the present disclosure.
[0033] FIG. 6 graphically illustrates electrochemical measurements, such as CV (-0.1V to 0.3V with a scan rate of lOOmV / s) and DPV, conducted in all five steps sequentially: bare gold electrode (Au), PNA immobilized gold electrode (Au-PNA), MCH covered electrode (Au-PNA-MCH), DNA hybridized with the PNA (Au-PNA-MCH-DNA), and MB treated (Au-PNA-MCH-DNA-MB), according to aspects of the present disclosure.
[0034] FIG. 7A shows the results of hybridization tests at 50 °C, according to aspects of the present disclosure.
[0035] FIG. 7B shows results of hybridization tests at 60°C. according to aspects of the present disclosure.
[0036] FIG. 8A shows the results of PNA-DNA hybridization tests using the 5 pM PNA and 5 pM of three DNA concentrations at 25°C, according to aspects of the present disclosure.
[0037] FIG. 8B shows the results of another hybridization test with an increased PNA probe and coDNA concentrations with readings from 25°C, 50°C, and 60°C, according to aspects of the present disclosure.
[0038] FIG. 9A shows three (3) DPV plots obtained from 5, 10, and 15 seconds of serially incubated identical PNA-DNA samples at 95°C DI water, according to aspects of the present disclosure.
[0039] FIG. 9B shows the converted bar graph from the curved plot of FIG. 9A, according to aspects of the present disclosure.832706801.4Attomev Docket No.: 104884-201
[0040] FIG. 9C graphically shows that the signals were reduced to 74.5, 83.6, 61.3, and 50.0% for 25, 75, 100, and 200 cycles of heat-treated PNA probe samples, respectively, according to aspects of the present disclosure.
[0041] FIG. 10A shows a TiO2-PNA-MCH-Cy3 electrode emitting fluorescence, according to aspects of the present disclosure.
[0042] FIG. 10B shows the center of the TiO2-PNA-MCH-Cy3 electrode image was well stained without any empty spots.
[0043] FIG. 10C shows an embodiment of the electrode without PNA probe immobilization resulting in an overall dark image, according to aspects of the present disclosure.
[0044] FIG. 10D shows an embodiment of the electrode without Cy3 labeling resulting in completely dark images, according to aspects of the present disclosure.
[0045] FIG. 10E shows an embodiment of the electrode with only TiCE-NT resulting in completely dark images, according to aspects of the present disclosure.
[0046] FIG. 10F schematically shows embodiments of the PNA probes bound to biomarkers marked with Cy3 and unmarked, according to aspects of the present disclosure.
[0047] FIG. 11A shows signal intensities for coDNA, misDNA, and scDNA with a Ti electrode at 50°C, according to aspects of the present disclosure.
[0048] FIG. 1 IB shows signal intensities for coDNA, misDNA, and scDNA with a Ti electrode at 60°C, according to aspects of the present disclosure.
[0049] FIG. 11C shows signal intensities for coDNA, misDNA, and scDNA with a TiCE-NTs electrode at 50°C, according to aspects of the present disclosure.
[0050] FIG. 1 ID shows signal intensities for coDNA, misDNA, and scDNA with a TiCE-NTs electrode at 60°C, according to aspects of the present disclosure.
[0051] FIG. 1 IE shows how the signal intensity is calculated before and after target DNA hybridization with the PNA probe, according to aspects of the present disclosure.932706801.4Attomev Docket No.: 104884-201
[0052] FIG. 12 shows an embodiment of an SEM image of the 300 s sputtered TiCh-NTs sample showed various-sized gold particle spheres on the TiCh-NTs surface, according to aspects of the present disclosure.
[0053] FIG. 13 A shows the PNA-DNA duplex signal intensities without gold nanoparticles for coDNA, misDNA, and scDNA samples, according to aspects of the present disclosure.
[0054] FIG. 13B shows the PNA-DNA duplex signal intensities for the gold-sputtered samples (60s) for coDNA, misDNA, and scDNA samples, according to aspects of the present disclosure.
[0055] FIG. 13C shows the PNA-DNA duplex signal intensities for the gold-sputtered samples (300s) for coDNA, misDNA, and scDNA samples, according to aspects of the present disclosure.DETAILED DESCRIPTION
[0056] Some aspects of the present disclosure are further directed to embodiments of designing an oligonucleotide-binding probe configured to bind to one or more biomarkers. Some embodiments of the present disclosure are directed to a biosensor apparatus configured to detect one or more biomarkers in a sample and an associated diagnostic method using the biosensor apparatus.OLIGONUCLEOTIDE-BINDING PROBE
[0057] In some embodiments, the target biomarker for the oligonucleotide-binding probe is selected based on its frequency within a target genome. Such a method of selection broadens the scope of candidate biomarkers by disregarding functional constraints and prioritizing sequence reoccurrence as the primary selection criterion. Targeting such highly repetitive sequences in biosensor design may significantly amplify detection signals compared to single- or lower-copy gene probes. Aspects of the present disclosure are further directed to a method of designing an oligonucleotide-binding probe using an algorithmic tool programmed to scan gDNA and extract high-frequency nucleotide motifs to identify these sequences systematically. By specifying the1032706801.4Attorney Docket No.: 104884-201desired fragment length and setting a minimum repetition threshold, the tool ranks repetitive sequences based on their frequency of occurrence in a whole-genome dataset. In some embodiments, the minimum repetition threshold refers to the minimum number of times the DNA fragment repeats in the whole-genome dataset. In some embodiments, the algorithmic tool comprises a Python-based script encoding instructions to scan whole-genome datasets and detect DNA motifs that meet and / or exceed the predefined minimum repetition threshold. The selected sequences may then be tested for specificity against a reference genome to exclude those with significant sequence identity. In some embodiments, the whole-genome dataset comprises a bacterial whole-genome dataset. In some embodiments, the selected sequences are tested for specificity using the Basic Local Alignment Search Tool (BLAST) analysis against the Homo sapiens genome to exclude those with significant sequence identity. Embodiments of the disclosed method of designing an oligonucleotide-binding probe may result in increased hybridization sensitivity, reduced dependence on PCR and broadened probe selection beyond annotated genes.
[0058] An example of the method 100 is described below and with reference to FIG. 1A In some embodiments, the whole-genome dataset of a target is provided at step 102. In some embodiments, the target is a bacteria. In some embodiments, the whole-genome dataset is uploaded to the algorithmic tool or otherwise made accessible to the tool. In some embodiments, the desired length (in base pairs (bp)) of the oligonucleotide-binding probe is selected at step 104 and the minimum repetition threshold is selected at step 106. In some embodiments, the minimum repetition threshold is the minimum number of repetitions of a sequence in the whole-genome dataset having the length specified in step 104. In some embodiments, the sequences in the wholegenome dataset that meet the selected length and minimum repetition threshold requirements are identified at step 108.
[0059] In some embodiments, the identified DNA sequences at step 108 are tested for specificity using the Basic Local Alignment Search Tool (BLAST) analysis against a reference genome at step 110. In some embodiments, probe candidates are selected from the identified sequences with the least sequence identity to the reference genome at step 112. In some embodiments, the oligonucleotide-binding probe is then synthesized at step 114 to be configured to bind to at least one of the selected probe candidates. In some embodiments, the oligonucleotide-binding probes are configured to bind target sequences (biomarkers) of DNA, RNA, mRNA, or1132706801.4Attomev Docket No.: 104884-201combinations thereof. Tn some embodiments, the target biomarker is an amplified and / or purified DNA fragment. In some embodiments, the target biomarker is a DNA fragment above about 10 bp in length. In some embodiments, the target biomarker is a DNA fragment above about 100 bp in length. In some embodiments, the target biomarker is a DNA fragment between about 100-300 bp in length.
[0060] In some embodiments, the tool may include a computing device 150. In some embodiments, the computing device 150 may include but is not limited to, a computer (e.g., desktop, laptop, portable, tablet, etc.), a smart phone, etc. In some embodiments, the tool includes a processor 152, a memory 154, input-output (I / O) circuitry 156, and a user interface (UI) 156. In some embodiments, the processor 152 is programmed to execute instructions to perform embodiments of the method 100 The I / O circuitry 156 may be configured to couple the computing device 150 to a network 159. In some embodiments, the UI is configured to provide a user access to computing device and, thus, the tool. In some embodiments, the UI may include user input devices (e.g., keyboard, mouse, keypad, touch sensitive display, etc.) and / or user output devices (e.g., display, monitor, screen, etc.).
[0061] An exemplary embodiment of the method 100 will now be described to identify suitable probe candidates for M. tuberculosis detection. Accordingly, in this example the wholegenome dataset is the M. tuberculosis genome, which consists of 4411541 bp, was analyzed to identify highly repetitive sequences of 17, 20 and 23 bp in length with a minimum repetition threshold of 15. In some embodiments, the complete gDNA file of AT. tuberculosis in ‘.fa’ format was uploaded into the algorithmic tool. The computational analysis performed by the tool identified 172 unique sequences of 17 bp that appeared at least 15 times within the AT. tuberculosis genome. Another iteration was performed with the probe length increased to 20 bp, which resulted in the number of unique sequences meeting the same repetition threshold decreasing to 72. Still another iteration was performed with the probe length being increased to 23 bp which resulted in the identification of only 32 unique sequences that were repeated 15 times or more. In this manner the number of unique sequences that were repeated 15 times or more may be reduced to a more manageable number to be further tested for specificity. Of course, the minimum repetition threshold value may alternatively or additionally be changed during iterations.1232706801.4Attomev Docket No.: 104884-201
[0062] The results are presented in FIG. IB as a bar graph with the x-axis representing the probe length in bp and the y-axis denoting the number of unique sequences identified. To analyze the distribution of repetitive sequences, the identified sequences were grouped into five frequency categories: 15-19, 20-24, 25-29, 30-40, and more than 40 repetitions. Without wishing to be bound by theory, the results in FIG. IB indicate that as the probe length is increased, the number of highly repetitive sequences decreases. Accordingly, it would seem that shorter sequences are more frequently repeated within the M. tuberculosis genome. Candidate sequences were selected based on their high frequency of repetition within the M. tuberculosis genome. A high frequency of repetition may enhance signal intensity in biosensor applications.
[0063] The candidate sequences then underwent BLAST analysis against the H. sapiens genome to ensure minimal cross-reactivity. In an embodiment, 10 sequences from the 23-bp probe group, each repeated over 20 times in the M. tuberculosis genome, were selected and evaluated. These sequences were analyzed using BLAST against the human genome (H. sapiens, taxid:9606) to determine their similarity and potential off-target binding. The results are summarized in the table shown in FIG. 1C. The max score represents the highest-scoring single alignment between the query sequence (M. tuberculosis sequence) and the database sequence (H. sapiens sequence). A higher max score indicates a more substantial alignment between the query sequence and the database sequence. The total score is the sum of the scores from multiple high-scoring segment pairs (HSPs) within the exact alignment. If the total score is the same as the max score, then only a single strong alignment exists. If the total score is higher than the max score, then multiple regions within the query sequence align with the database.
[0064] The Query Cover refers to the percentage of the query sequence that aligns with the database sequence. For example, the Query Cover of secO l was 78%, indicating that 18 out of 23 bp were aligned, with the remaining bases either unaligned or trimmed. The 7 value represents the probability that an observed alignment occurred by random chance. Accordingly, a lower E-value is indicative of a more statistically significant match. An E-value that is close to zero suggests high biological relevance. Still referring to FIG. 1C, the Percent Identity represents the proportion of aligned nucleotides that are an exact match between the query sequence and the database sequence. A Percent Identity of 100% indicates a perfect match, whereas lower values suggest the presence of mismatches.1332706801.4Attomev Docket No.: 104884-201
[0065] By evaluating these BLAST parameters, sequences with minimal sequence identity to human gDNA can be identified, allowing for the selection of particular probe candidates. This ensures that the final probe selection maximizes specificity to M. tuberculosis while minimizing off-target interactions with human DNA. Accordingly, the final probe design is selected from the candidates with minimal sequence identity to human DNA. In this example, the sequence, secOl, ‘TCCCCTCTCGGGGTTTTGGGTCT’ was selected for further analysis due to its high repetition within the M. tuberculosis genome. A BLAST search against the human genome revealed that this sequence exhibits a query cover of 78%, meaning that the maximum homologous region within human DNA spans only 18 bp out of the entire 23 bp query sequence, resulting in a 78.26% identity. The BLAST alignment results also indicated that secOl aligns with only two locations in the human genome. The first alignment displayed 78.26% identity (18 / 23 bp match), while the second alignment displayed 65.21% identity (15 / 23 bp match). In contrast, secOl was found to repeat 39 times with 100% sequence identity within the AL tuberculosis genome. The significant difference between 39 fully matched copies in AL tuberculosis and only two partial matches in the human genome suggests that this sequence is particular to AL. tuberculosis. This difference is expected to lead to a significant variation in biosensing signal intensity, making secOl a strong candidate for probe design. The high repeat count of secOl in AL. tuberculosis enhances the signal detection potential, while the limited human genomic matches minimize cross-reactivity, improving diagnostic specificity.
[0066] All identified probe sequences were derived from the sense strand of the AL tuberculosis genome however, complementary sequences naturally exist on the antisense strand at the exact genomic locations. This means that designing a probe to target the complementary sequence allows for the detection of the antisense strand as well, effectively doubling the number of detectable single- stranded DNA fragments in a bulk sample. Accordingly, embodiments of the disclosed method enhance detection efficiency and improve the sensitivity of diagnostic applications by increasing the probability of capturing pathogen-derived DNA in clinical samples. In some embodiments, the probe sequences are comprised of PNA and are synthesized to bind to one or more identified probe candidates.
[0067] The validated probe sequences are immobilized onto an electrode surface to serve as the biosensor’ s recognition layer. Immobilization efficiency is optimized based on the electrode1432706801.4Attomev Docket No.: 104884-201material properties, ensuring strong probe attachment and minimizing non-specific interactions. This step may involve testing different attachment chemistries including covalent bonding, thiolgold bonding for gold electrodes, silane-based modification for silicon surfaces, etc.BIOSENSOR
[0068] Referring to FIG. 2A, in some embodiments as previously mentioned, the biosensor apparatus 200 includes an electrode 210. In some embodiments, the electrode 210 includes one or more metals, nanotubes, or combinations thereof. In some embodiments, the electrode 210 includes metallic gold, metallic titanium, or combinations thereof. In some embodiments, the electrode 210 includes a layer of TiCh nanotubes (TiCh-NTs), as will be discussed in greater detail below. In some embodiments, the electrode 210 includes a concentration of gold nanoparticles (AuNPs), e.g., sputter coated on a surface 112 of the electrode 210. In some embodiments, the electrode 210 includes TiCh-NTs and AuNPs.
[0069] Referring to FIGS. 2A-D, in some embodiments, a plurality of oligonucleotide-binding probes 215 are complexed 214 to the surface 212 of the electrode 210. In some embodiments, the plurality of oligonucleotide-binding probes 215 are comprised of PNA or are otherwise PNA probes 216. As with DNA, the PNA probes 216 obey the hydrogen binding rule of Watson-Crick, which is applied to their complementary four bases linked with their backbone structures. The attractions from the complementary bases make it possible to hybridize the PNA-DNA. Moreover, when the target biomarker 220 Is DNA, the neutral-charged PNA and negatively charged DNA hybridization have stronger connections than the hybridization of negatively charged DNA pairs. Thus, the attenuated electrostatic repulsion in PNA-DNA hybridization leads to higher affinity and selectivity of the PNA probe as detectors of the biomarkers 220 such as complementary DNA target sequence fragments. Additionally, PNA exhibits robustness against nuclease, protease, and peptidase activity, enhancing its utility as a stable sensing probe.
[0070] In some embodiments, nanotube arrays with PNA probes 216 attached thereto boost the number of available binding sites by orders of magnitude compared to a planar substrate. In some embodiments, the PNA probes 216 are designed using embodiments of the method 100 previously discussed. In some embodiments, the PNA probes 216 are complexed 214 to the electrode, e.g., TiCh-NTs and AuNPs, via any suitable mechanism. In some embodiments, the1532706801.4Attorney Docket No.: 104884-201PNA probes are complexed 214 with the electrode via direct covalent binding, one or more linkers, etc., or combinations thereof. In some embodiments, the electrode 210 with the PNA probes 216 complexed thereto may be soaked in the 2 mM MCH in 60% ethanol in DI water solution for at least 30 minutes at room temperature. Referring to FIG. 2B, in some embodiments, treatment with MCH 218 acts to mask empty spots on the electrode 210 and inhibit nonspecific binding of impurities 219 (such as complementary DNA fragments) to the surface 212 of the electrode 210.
[0071] In some embodiments, the biosensor apparatus 200 is incorporated into a system and / or a diagnostic method that detects electrical signals generated by the biosensor apparatus 200 upon binding of target biomarker 220 by the PNA probes. In some embodiments, the diagnostic method 300 includes obtaining a sample at step 302. In some embodiments, the sample is any fluid or tissue sample obtained from an individual suspected of having a concentration of the target biomarker(s). An embodiment of the biosensor apparatus 200 is provided at step 304. In some embodiments, the electrode 210 of the biosensor apparatus 200 is positioned between and contacted to two electrical leads 250, 252 (FIG. 2A). In some embodiments, the biosensor apparatus 200 includes an electrode 210 and a plurality of oligonucleotide-binding probes 215. In some embodiments, the plurality of oligonucleotide-binding probes 215 comprise PNA probes 216. In some embodiments,
[0072] In some embodiments, the sample from a human patient is administered to the biosensor apparatus and contacted with the electrode 210 complexed with a plurality of oligonucleotide-binding probes 215 at step 306. Hybridization between the plurality of oligonucleotide-binding probes 215 and any target biomarker 220 (FIGS. 2C and 2D) in the sample is performed at step 308. In some embodiments, hybridization of the oligonucleotide-binding probes 215 and any target biomarker 220 (FIGS. 2C and 2D) is performed at a predetermined hybridization temperature. In some embodiments, the hybridization temperature is between about ambient temperature about melting temperature (Tm) of the oligonucleotide-binding probes. In some embodiments, the hybridization temperature is between about 25°C and about Tm. In some embodiments, the hybridization temperature is between about 40°C and about 60°C. In some embodiments, the hybridization temperature is about 50°C. At step 308, the electrical signal from the biosensor apparatus 200 is measured. In some embodiments, the hybridization completes an electrical circuit between the electrical leads 250, 252 and the electrode 210 such that a detectable1632706801.4Attomev Docket No.: 104884-201electrical signal is produced and measured at step 310, which indicates the presence of the target biomarker 220. In some embodiments, the presence of the target biomarker 220 may be a diagnostic indicator of the presence of a particular patient pathology, e.g., during traumatic brain injury assessment, tuberculosis screening, etc., with the specificity of the PNA-probe / biomarker binding enabling accurate diagnostics while reducing / eliminating false positives.
[0073] In some embodiments, heat is applied to the biosensor apparatus 200 at step 312 to dehybridize bound structures from the oligonucleotide-binding probes 115, e.g., biomarkers, to reset the biosensor apparatus 200. The reset biosensor apparatus 200 may then be reused to test an additional sample. In some embodiments, the biosensor apparatus is heated to a temperature between about 90°C and about 100°C. In some embodiments, the biosensor apparatus is heated to a temperature of about 95°C.
[0074] In some embodiments, the biosensor apparatus 200 is incorporated into a differential pulse voltammetry (DPV) system, a cyclic voltammetry (CV) system, etc., as discussed in greater detail below.EXAMPLES
[0075] In some embodiments, a short DNA fragment mimicking the IS6110 fragment in Mycobacterium tuberculosis genomic DNA was used to test the sensitivity and recyclability of a PNA-immobilized gold electrode biosensor apparatus. PNA probes and the related singlestranded DNA fragments were synthesized from PNABio (USA) and the Cores Lab facility at the University of Utah (USA), respectively. The PNA probe targeted the 805-821 bp region in the 16 repeated IS6110 sequences in AL tuberculosis genomic DNA. Referring to FIGS. 4A and 4B, two O-linkers (2-aminoethoxy-2-ethoxy acetic acid) were added at the N-terminal region of the PNA probe. The synthesized PNA probe and DNA fragments were dissolved in deionized (DI) water to prepare 100 pM stock solutions.
[0076] Screen-printed gold electrode was soaked in 50% ethanol containing 0.5 M NaBFL for 10 minutes, followed by sonication for 30 seconds each in DI water, a L 1 acetone-isopropanol mixture, and DI water. The electrode was cleaned by cyclic voltammetry between -0.2 V and -1.5 V vs. Ag / AgCl in a fresh 0.1 M NaOH solution for 20 cycles with 100 mV / s scan rate and then1732706801.4Atorney Docket No.: 104884-201between -0.3 V and +1.5 V vs. Ag / AgCl in a fresh 0.5 M H2SO4 solution for 20 cycles with 100 mV / s scan rate. The cyclic voltammetry measurements were conducted to confirm the clean surface of the gold electrodes using [Fe(CN)e]3 / 4‘ electrolyte since the high sensitivity of KaFefCNA / K iFe CNe) redox couple reaction.
[0077] PNA and DNA hybridization patterns were confirmed using ultraviolet-visible (UV-Vis) spectrophotometry and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The 100 p stock solution of the PNA probe and three types of DNA fragments, coDNA, misDNA, and scDNA, were mixed with a 1 : 1 ratio individually. The absorbances of the single and mixed samples were measured by the UV-Vis spectrophotometer, ranging between 200 and 400nm. Four microliters of the PNA-DNA mixed samples (1:1 ratio) were mixed with 6x DNA loading dye and adjusted with DI water for gel imaging. The mixed samples were incubated at multiple temperatures and times. The SDS-PAGE was conducted in the TAE buffer with 100 V for 30 minutes. After electrophoresis, the gel was soaked in the diluted EtBr staining solution for 20 minutes, and images were taken on the UV transilluminator.
[0078] The densitometry analysis was conducted using the ImageJ software (N1H, USA). For the fluorescence microscopy, 10 pM of the Cy3-labeled coDNA fragment was hybridized overnight with the 10 pM of the PNA probe on the gold electrodes at room temperature. The edge area of the metal sample pieces was located at the center of the microscope image to compare the PNA-DNA labeled area on the metal sample with the background area.
[0079] PNA immobilization was performed using the gold electrode (C220AT, Metrohm, USA) with a direct covalent binding method. Ten microliters of the 1 pM PNA solution were applied to the center of the gold working electrode on the commercial sensors to form the PNA self-assembled monolayer (SAM). The electrodes were placed in a humid container filled with DI overnight at room temperature. After rinsing with DI water, the PNA-decorated gold electrodes were soaked in the 2 mM MCH in 60% ethanol in DI water solution for 30 minutes at room temperature. Finally, the electrodes were gently rinsed with 60% EtOH several times.
[0080] The PNA probe immobilized gold electrode was hybridized with three different ssDNA fragments at different temperatures. First, the stock solution of the ssDNA fragment was diluted in the 0.1 M phosphate-buffered saline (PBS, pH 7.0) solution. Then, the gold electrodes1832706801.4Attomev Docket No.: 104884-201were soaked in the diluted ssDNA fragment solution tubes, which were incubated in a water bath at specific temperatures. The hybridizations were conducted at 60°C, 50°C, and 25°C for 30 minutes, followed by rinsing. Methylene blue (MB) working solution was prepared as 20 pM as the final concentration in distilled water with 20 mM NaCl to amplify the electrical signals from nucleotides of the PNA-DNA hybridization. Then, the PNA immobilized gold electrodes were immersed in the MB solution for 5 minutes, followed by a rinse with distilled water.
[0081] The electrochemical detection ability of the immobilized PNA probe to the target DNA fragment was measured by DPV using fresh 20 mM Tris-HCl and 20 mM NaCl electrolyte (pH 7.0) at room temperature. The pulse range of the DPV was between 0.1 V and -0.8 V, and the scan rate was 100 mV / s. The obtained current values were converted to the current density using the electrode area.
[0082] Still referring to FIGS, 4A-4B, gold is a popular material choice for biosensors due to its electrical conductivity, high density, efficient catalysis, and biocompatibility, beneficial characteristics of biosensor systems. The gold electrodes 410 were cleaned using piranha solution to remove impurities and create a hydrophilic surface with hydroxyl groups. As discussed above, the PNA probes 216 (FIGS. 2A-D) used in the biosensor apparatus 200 (FIGS. 2A-D) have a neutral charge, so they do not experience repulsive reactions with the negatively charged hydroxyl groups on the gold electrode surface. In an effort to address agglomeration in the solution interrupting the immobilization on the electrode surface due to the hydrophobicity of the PNA probes, two O linkers 416, 418, e.g., AEEA spacers, 2-aminoethoxy-2-ethoxy acetic acid, were attached between the gold electrode surface and the PNA probe (see FIG. 1 A). Each AEEA spacer is water soluble, about 13 A in length, and highly flexible. These O-linkers 416, 418 help increase the PNA probe's 216 solubility, followed by preventing self-aggregation of the PNA probes in the solution. Therefore, the soluble PNA probes 216 are not aggregated with each other in the solution and can be decorated on the gold electrode surface. FIG. IB shows an embodiment of the overall structure of the immobilized PNA probe 216 with two AEEA spacers 416, 418. The length of the two O linkers 416, 418 was 2.6 nm, and the theoretical 17 bp PNA length is 5.78 nm. Therefore, the total length of the immobilized PNA probe 216 is 8.38 nm. Accordingly, the PNA probes 216 are located away from the electrode surface 412 such that they are more exposed to the surrounding1932706801.4Attorney Docket No.: 104884-201environment, which may improve the chances of contacting the target biomarker 220 (DNA fragment).
[0083] The single-stranded DNA fragments 220 were hybridized with PNA probes 216 immobilized on the electrode 410. The hybridization temperature was calculated using the Tmvalues of each probe. For example, the Tmvalue of the probe sequence (TAGCAGACCTCACCTAT) was 59°C when the hybridized sequence is DNA-DNA, not PNA-DNA. However, the PNA has about 1°C higher Tmthan DNA per base pair because of the lack of repulsive force between the phosphate backbones. Thus, the Tmrange for PNA-PNA hybridization was around 76°C. Without wishing to be bound by theory, the estimated Tmfor PNA-DNA hybridization can be 67.5° C since the increase of Tmper base pair can be expected to be 0.5°C instead of 1°C between one PNA strand and one DNA strand. Similarly, the Tmor the 1 -mismatched DNA hybridization was calculated as 56°C for the DNA-DNA, 72°C for the PNA-PNA, and 66°C for PNA-DNA hybridization. The Tmfor the scrambled DNA probe was calculated based on the four matched base pairs of PNA-DNA. Thus, the Tmof scrambled DNA to PNA was negligibly low.
[0084] The PNA probe in DI water (2 pL of 100 pM stock) was hybridized with three types of target DNA fragments (coDNA, misDNA, and scDNA, 2 pL of 100 pM stock each) dissolved in 0.1 M phosphate-buffered saline (PBS) with a 1 : 1 ratio. Due to the hydrophobicity of the PNA probe, it has a risk of forming an un-linearized form which limits the target DNA hybridization. Thus, the PNA probe stock solution was incubated at 90°C DI water for 3 minutes to linearize before use, and all the PNA-containing electrode samples were stored in DI water.
[0085] Referring now to FIGS. 5A-5D, PNA probes, coDNA fragments, and PNA-coDNA hybridized samples were measured by UV-Vis spectroscopy with the range of 240-300 nm, respectively (see FIG. 5A). As expected, the purine and pyrimidine bases from the PNA and coDNA molecules absorbed the 260 nm wavelength from the soluble samples. Then, these samples were visualized via the SDS-PAGE with EtBr staining, illuminated under UV light (see FIG. 5B). Since the PNA backbone is a neutral charge, the positively charged ethidium bromide is hard to stay between the bases in the single-stranded PNA probe. On the other hand, the negatively charged DNA fragment can attract the positively charged EtBr molecules by the2032706801.4Attomev Docket No.: 104884-201electric attraction reaction and hold them between the bases of the DNA. Therefore, unlike the DNA fragments, the ssPNA was not visualized under the EtBr staining on the gel. However, the 17 bp single-stranded DNA fragments generated single bands on the gel with a reliable size range. The PNA-coDNA and PNA-misDNA hybridized samples showed two bands. The upper bands are supposed to be the double-stranded PNA-DNA hybridized duplex. However, the upper band size was slightly less than the 80 bp band, indicated by the black right arrow from the DNA ladder (M), even though the theoretical size of hybridized PNA-DNA is 34 bp. Without wishing to be bound by theory, this is thought to be caused by the neutral charge of the PNA backbone. In other words, the net negative charge of the PNA-DNA pair was reduced to half of the DNA-DNA pair, and the force for the PNA-DNA pairs to migrate was also reduced, leading to slower migration than the DNA ladder marker bands on the gel. Accordingly, the 34 bp PNA-DNA bands were located with the nearly 80 bp DNA ladder marker band. Moreover, two bands were still observed from the 1 : 1 molar ratio hybridization of the PNA and DNA. Temperature and ionic strength can affect the complete hybridization between the PNA and DNA fragments. Thus, the buffer parameter was not configured for complete hybridization, which was considered the reason the two bands were observed from the PNA-DNA pairs.
[0086] The densitometry test revealed that the band intensity ratio is 15329:33512, which has 1 :2.2 for the PNA-DNA duplex and the ssDNA, respectively (see FIG. 5C). This implies that about 31 % of coDNA was paired, and 69% of coDNA was unpaired with the PNA. In other words, the binding ratio of the PNA-DNA could be assumed as 3 : 1. Since the PNA probe was not stained, the ratio represents the coDNA content except the PNA. The additional test with the PNA:DNA with a 3: 1 molar ratio showed a single band from the gel (most right side well of the gel), meaning all the ssDNA fragments were paired with the PNA probes. This result represents that roughly 3 : 1 of the PNA:DNA molar ratio can hybridize all DNA with the PNA at the ionic strength of 0.1 M PBS, pH 7.0, and room temperature conditions. As expected, the PNA-scDNA sample showed a single band representing only the ssDNA.
[0087] PNA-DNA hybridization was confirmed through the cyanide labeling test to the PNA immobilized on the gold electrodes (FIG. 5D). Cyanide 3 (Cy3) dye is a traditional label that illuminates red color with 550 nm excitation and 570 nm emission. The Cy3 was tagged at the 5' region of the coDNA fragments. The composition of the target sample was Au- PNA-MCH-2132706801.4Atorney Docket No.: 104884-201Cy3coDNA, and the composition of the negative control samples was Au-MCH-Cy3coDNA, Au-PNA-Cy3coDNA, and Au only. The fluorescence intensity of the target samples was well visualized compared to the background. However, the weaker intensities from the negative control samples were almost indistinguishable from the sample and background. Thus, the bright field (BF) images were inserted at the left-bottom of the fluorescence images to understand the sample location better. Firstly, the PNA-DNA hybridization on the gold electrode was quite well stained. The glass area (left side) was dark, and the Au-PNA-MCH-Cy3 labeled area (right side) was red fluorescent. In contrast, the negative control sample images showed darkness from both areas. A faint reddish color was shown in the metal area from some negative control images, but it is assumed that the color was from the self-fluorescence of the gold, which has an absorbance peak against 520-570 nm wavelength.
[0088] Referring now to FIG. 6, the electrochemical measurements, such as CV (-0.1V to 0.3V with a scan rate of lOOmV / s) and DPV, were conducted in all five steps sequentially: bare gold electrode (Au), PNA immobilized gold electrode (Au-PNA), MCH covered electrode (Au-PNA-MCH), DNA hybridized with the PNA (Au-PNA-MCH-DNA), and MB treated (Au-PNA-MCH-DNA-MB). FIG. 6 shows all the cyclic voltammetry curves from each step of the PNA-decorated gold electrode in 1 mM [Fe(CN)6]3' / 4‘ (1:1) containing 0.1 M KC1 electrolyte (pH 7.0) at room temperature. Each plot shape indicates the electron transfer status from the electrode to the environment. The bare gold electrode (solid line) shows 80 mV and 170 mV of the cathodic and anodic peak potential (Epc and Epa), respectively. The PNA immobilized gold electrode (round dotted line) slightly decreased the Epc and Epa to 160 mV and 70 mV, which indicates that the PNA probes interfere with the electron transfer from the gold surface to the environment. The maximum and minimum peaks of plots (a) and (b) are 320.29 / -371.3 pA / cm2and 313.4 / -354.2 pA / cm2, respectively, indicating a slight decrease in the plot (b). This data represents that the amount of PNA concentration immobilized on the gold electrode was not dramatically dense.
[0089] The plot for the MCH treatment on the PNA-gold electrode surface ((c) dashed line) decreased the Epc and Epa to 130 mM and 40 mM and the cathodic and anodic currents to 265.2 and -309.5 pA / cm2, respectively. Without wishing to be bound by theory, this means that the chance of electron transfer was reduced because of the gold surface masking by the MCH. The difference between the plot of the PNA decoration (b) and the MCH treatment (c) can be controlled2232706801.4Attomev Docket No.: 104884-201if it modifies the treated PNA concentration. In other words, the higher concentration of PNA treatment in a unit gold surface area may lead to increased Epc / Epa changes and lesser change from the following MCH treatment.
[0090] The DNA hybridization plot (d) shows a decrease in the redox peak (Max-Min current=474pA / cm2) level and an increase in the plot's peak-to-peak separation (Epc-Epa = 230 mV). Without wishing to be bound by theory, the hybridized DNA fragment leads to less electron transfer because the negatively charged DNA molecules cover the gold electrode surface, working as inhibitors for transferring the electrons to the negatively charged ferrocyanide ions.
[0091] Plot (e) shows the increased redox peaks (Max-Min current = 596.4 pA / cm2). The MB is an electrocatalyst and a reporter that increases the electron transfer and electrochemical signal, such as redox peaks. The MB molecules are covalently attached in the space between the paired bases in the double-helical structure of the hybridized PNA-DNA and increase the sensitivity of the DNA detections by reaction with the ferrocyanide components. In addition, the MB treatment to the complementary DNA-DNA pairs and one-mismatched DNA-DNA pairs produced 60% signal attenuation in CV measurements. Without wishing to be bound by theory, post-treatment of MB to the hybridized DNA samples to the PNA probes can acquire a significant signal detection level from the low-concentration target DNAs in the sample obtained from patients in clinical tests.
[0092] The coDNA, misDNA, and scDNA fragments were hybridized with the immobilized PNA probe on the gold electrodes by soaking the electrode in the 1 pM DNA fragment solution. The molar ratio between the PNA probe and DNA fragments for the hybridization was designed as 1:1. Thus, when it is assumed that all the PNA probe was immobilized on the gold electrode, the hybridized DNA level to the PNA probes was considered 30-40% (300-400 nM) based on the gel image data.
[0093] The empirical results represent that a slightly lower temperature than the theoretical Tmvalues can be used in detecting the correct target DNA fragments. Thus, the PNA immobilized on the gold electrode (Au-PNA-MCH) samples were hybridized with three DNA fragments at 50°C and 60°C for 30 minutes. The DPV measurements were performed at pre- and post-DNA hybridizations, and the MB was treated after the hybridization processes, followed by2332706801.4Atorney Docket No.: 104884-201normalization of all the plots to obtain the distinct peaks. Then, the measured current changes were calculated by subtracting the pre-hybridization from the post-hybridization data. All measured currents were converted as pA per unit area (cm2). Here, the higher pA / cm2 represents the more increased signal change, which means a more amount of DNA fragments coupled with the PNA probes. These differences were plotted, and the standard error (SE) bars were added. The SE was calculated as the population standard deviation (stdev.p) divided by the square root of the samples.
[0094] Referring now to FIGS. 7A-7B, at 50°C, hybridization tests showed 153, 82, and 80 pA / cm2signal intensities, increasing by 1.75, 1.74, and 1.14 times for the coDNA, misDNA, and scDNA, respectively, relative to 60°C (compare FIG. 7A and 7B). The strength difference between the coDNA and other DNA samples supports that the MB-applied PNA biosensor system can distinguish the target DNA fragment with meaningful differences. Similarly, at 60°C hybridization conditions, the 87, 47, and 70 pA / cm2of current change were obtained for the coDNA, misDNA, and scDNA, respectively (see FIG. 7B). The PNA-misDNA pairs caused a 54% reduction of the signal intensity compared with the PNA-coDNA duplex from both temperatures. The signal from PNA-scDNA was 80% decreased from the PNA-coDNA, which is higher than the misDNA. This unexpected result was slightly higher than the initial expectation that the PNA-scDNA would have the least sensing signal from the least binding affinity. Consequently, 1.75 times increased signal intensity was shown at a lower hybridization temperature. Thus, stable hybridization can be available at a lower temperature than Tm. The thermal energy difference of the hybridization process can explain these observations. At 60°C conditions, for example, when the hybridization temperature is high enough to be close to the Tm, fewer DNA fragments have a chance to pair with the PNA probes due to the high thermal energy that can break the hydrogen bond. Less DNA binding leads to less MB accumulation and less electron transfer between the electrodes and the environment. Thus, the hybridization at higher temperatures only slightly increases the Al between before and after the DNA hybridization. Conversely, PNA-DNA pairing at a lower temperature than Tm, such as 50°C, is feasible to increase, which causes more MB stacking in the PNA-DNA pairs and higher Al between before and after the DNA hybridization.2432706801.4Attomev Docket No.: 104884-201
[0095] Referring now to FIGS. 8A-8B, PNA-DNA hybridization tests using the 5 pM PNA and 5 pM of three DNA concentrations at 25°C showed that the complementary, mismatched, and scrambled DNA signal intensities fit (see FIG. 8A). The signal intensities were 334, 247, and 86 pA / cm2for coDNA, misDNA, and scDNA, respectively. These values were 2.17 and 3.82 times higher than the coDNA data at 50°C and 60°C, respectively. However, the difference between the coDNA and scDNA at the 25°C condition was reduced by about 74%, higher than the 54% and 53% reduction at 60°C and 50°C cases. Thus, the expected data from the scDNA hybridization was well applied at 25°C instead of 50°C or 60°C. Moreover, while the three individual types of DNA signal intensities at the 25°C test were higher than 50°C and 60°C, the relative difference between the PNA-coDNA and PNA-misDNA was 74%, and it was less than the decreased level of 55% from 50°C. Thus, without wishing to be bound by theory, the sensitivity for the target DNA is better at 50°C than at room temperature.
[0096] Another test was conducted to hybridize the increased PNA probe and coDNA concentrations. As a result, 334, 253, and 201 pA / cm2signal intensities were observed from 25°C, 50°C, and 60°C (see FIG. 8B). This data shows that the signal intensities increased 1.76-fold when the temperature was decreased from 60°C to 50°C and 2.2-fold from 50°C to 25°C. Without wishing to be bound by theory, the hybridization temperature affects the change in the sensing signal intensity.
[0097] Referring now to FIGS. 9A-9C, the recyclability of the PNA sensor was tested. As discussed above, one of the benefits of PNA probes consistent with embodiments of the present disclosure is the higher mechanical strength compared with the DNA structures. This advantage raised the question of how many times the PNA biosensor system could be recycled. The used electrodes were cleaned in DI water to remove the electrolytes for the measurements. Then, the electrodes were soaked in 95°C DI water for 2 minutes to disassemble the PNA-DNA complex, followed by a gentle rinse in warm DI water to remove the free-DNA fragment from the PNA on the electrode surface. To prove the practical result of the high-temperature method to dehybridize the PNA-DNA binding, three DPV plots obtained from 5, 10, and 15 seconds serially incubated identical PNA-DNA samples at 95°C DI water are shown (see FIG. 9A). FIG. 9B shows the converted bar graph from the curved plot. The trendline represents that the signal intensities were linearly decreased depending on the length of incubation.2532706801.4Attomev Docket No.: 104884-201
[0098] Dissolved PNA probes in DI water were used for heat-cold shock tests instead of the PNA immobilized electrodes to avoid any unexpected effects of the electrode materials. The repeated thermal shock procedure included 95°C for 30 seconds and 25°C for 30 seconds incubations as one cycle. The 10 pM of dissolved PNA probes were tested for 25, 75, 100, and 200 cycles of thermal shocks, respectively. Then, the heat-treated PNA probes were immobilized on the gold electrodes, followed by 1 pM coDNA hybridization at room temperature to maximize the detection signals. The results show that the signals were reduced to 74.5, 83.6, 61.3, and 50.0% for 25, 75, 100, and 200 cycles of heat-treated PNA probe samples, respectively (see FIG. 9C). Without wishing to be bound by theory, this indicates that about 60% of the detection ability can be reproduced using PNA electrodes consistent with embodiments of the present disclosure that have been 100 times recycled.
[0099] Referring now to FIGS. 10A-10F, exemplary embodiments of the PNA probes were immobilized by a covalent bond between the amine groups at the N-terminus of the PNA probes and the hydroxyl (OH) groups on a surface of TiO2-NTs. To confirm the stable immobilization of PNA on the electrode surface, visually distinguishable Cy3 dye was used as the labeling marker. Cy3-labeled target DNA fragments were hybridized to the PNA probes to confirm the PNA-DNA hybridization. The fluorescence signal from Cy3 validated the immobilization of the PNA probes on the electrode surface, indicating the formation of an appropriate self-assembled monolayer (SAM). FIGS. 10A-10F shows the fluorescent image of PNA-DNA hybridization. Four types of electrodes were prepared for comparison. The complete electrode sample was the TiO2-PNA-MCH-Cy3 (see FIGS. 10A-10B), and three types of negative controls missed one or more components (see FIGS. 10C-10E). The edge regions of the electrode sample were positioned at the center of the microscope lens for comparison with the background regions. As a result, distinct orange-red fluorescence was observed from the TiCh-PNA-MCH-Cy3 electrode (see FIG. 10A). The red-colored region on the right side shows the PNA probe immobilized on the TiCh-NT electrode surface. The regions where the nanotube layers at the edge area of the TiCh-NTs electrode sample were physically detached and where the PNA probes were absent were not stained with Cy3 and appeared black. The TiCh-NTs layer, with a depth of about 2-4 pm and a fluorine-rich layer at the bottom, can separate easily from the titanium base metal during cutting. Therefore, the edge region of the electrode sample tended to break into small2632706801.4Attomev Docket No.: 104884-201pieces, creating unstained regions in the Cy3 labeling. In contrast, the center of the electrode image was well stained without any empty spots (see FIG. 10B).
[0100] As negative controls, the bright field (BF) images of the electrode combinations without PNA or MCH treatment were included in the lower left to easily identify the morphology of the electrodes placed on the microscope. The electrode without PNA probe immobilization showed an overall dark image (see FIG. 10C). However, minor fluorescence were observed in the upper edge area of the electrode, likely due to the non-specific binding of Cy3-coDNA fragments to the TiOz-NT surface. The electrode without Cy3 labeling and the sample with only TiCh-NT showed completely dark images (see FIGs. 10D-10E). An image of Cy3 labeled coDNA bound PNA probe on AuNPs-TiOz-NTs electrode structure consistent with embodiments of the present disclosure is shown in FIG. 7F.
[0101] Using Ti and TiCh-NT electrode samples on which PNA probes were successfully immobilized, the signal intensity differences of PNA-DNA hybridization samples at 25 °C and 50°C were measured. In PNA-DNA hybridization, binding affinity varies depending on temperature and the completeness of binding. Binding enthalpy (AH°) is a factor in predicting this change. In this study, the enthalpy change (AH°_co) from ssPNA-coDNA and the enthalpy change (AH°_mis) from ssPNA-misDNA was compared, and the conditions for reducing non-specific binding at 25°C and 50°C was calculated using the Van't Hoff equation (Equation 1):(Equation 1)where Ki and K2 are the binding constants at temperatures Ti (25°C) and T2 (50°C), respectively, and AH° is the enthalpy change. The effect of temperature on the stability of PNA-DNA hybridization can be predicted. In general, AH°_co has a more negative value, i.e., a larger absolute value, than AH°_mis, which means that a perfectly matched binding is more stable than a mismatched binding. The Van't Hoff equation predicts that the binding constant K decreases as temperature rises. When AH0is negative, the temperature increase makes the binding less stable and the binding affinity lower. Since the absolute value of AH°_mis is smaller than that of AH°_co, the binding constant of AH°_mis can show a relatively larger decrease as the temperature increases. This causes a large decrease in the binding affinity of mismatch binding at 2732706801.4Atomev Docket No.: 104884-20150°C, which in turn reduces nonspecific binding to the PNA probe. On the other hand, at 25°C, since the absolute value of AH°_mis is relatively more significant, mismatch binding is likely to be more stable, and nonspecific binding can occur more easily. Without wishing to be bound by theory, nonspecific binding can be minimized and accuracy improved when performing the PNA-DNA hybridization test at 50°C; the smaller the absolute value of AH°_mis, i.e., the less negative AH°_mis, the more likely it is that nonspecific binding decreases with increasing temperature, and the experimental conditions at 50°C are more favorable for reducing nonspecific binding.
[0102] Titanium metal has a hexagonal close-packed (HCP) crystal structure at room temperature, transitioning to a body-centered cubic (BCC) structure at high temperatures. It has relatively low electrical conductivity compared to other metals, partly due to its electron configuration [Ar]3d24s2, which results in fewer free electrons available for conduction. In addition, the oxide film on the surface can hinder electron transfer. Due to these characteristics, the signal intensity is relatively low on the Ti electrode and the TiCh-NTs electrode.
[0103] The effect of temperature on the PNA-DNA hybridization signal intensity using Ti and TiCh-NTs electrodes was investigated. The Tmof the PNA-coDNA complex was calculated to be 67.5°C. Since hybridization stability typically decreases near the Tm, temperatures below this value were tested. Specifically, 50°C and 60°C were selected as test temperatures to assess how the signal varies with decreasing proximity to the Tm, ensuring that hybridization could still occur without complete strand dissociation.
[0104] Referring now to FIGS. 11A-11E, for the Ti electrode, the signal intensities for coDNA, misDNA, and scDNA were 3.3, 3.0, and 2.6 pA cm'2, respectively, at 50°C, but increased to 17, 10, and 9.2 pA cm'2, respectively, at 60°C (see FIGS. 11 A and 1 IB). The signal intensity of PNA-coDNA increased by 5.15-fold when the hybridization temperature was raised from 50°C to 60°C. This result contradicted the prediction that binding affinity should decrease according to the Van't Hoff equation and showed that the signal intensity increased with increasing temperature. Without wishing to be bound by theory, the Ti electrode was not highly affected by the change in binding affinity with temperature change and thus the signal intensity at high temperatures can increase due to non-specific binding or other physical factors.2832706801.4Attorney Docket No.: 104884-201
[0105] For the TiCE-NTs electrode, the signal intensity measured at 50°C was higher than at 60°C (see FIGS. 11C and 11D). Specifically, the signal intensities for coDNA, misDNA, and scDNA at 50°C were 59, 52, and 35 pA cm-2, respectively, and decreased to 44, 39, and 31 pA cm’2at 60°C, respectively. This result was consistent with the prediction of the Van't Hoff equation, and the higher signal intensity was observed at 50°C due to the maintenance of higher binding affinity and reduced nonspecific binding. FIG. HE shows how the signal intensity is calculated before and after target DNA hybridization with the PNA probe. Signal A refers to the current response measured for the PNA-only sample, while Signal B represents the current for the PNA-DNA hybridized sample. The signal intensity was calculated as the difference between the baseline (horizontal dotted line) and the peak signal in the raw plot.
[0106] Without wishing to be bound by theory, the increased PNA-DNA signal intensity of the TiCE-NTs electrode compared to the Ti foil electrode can be the increased surface area of the nanotubes. The increased surface area ratio “R inc” due to the nanotube structure of TiCE-NTs can be calculated as follows (Equation 2):(Equation 2)where r is the diameter of the nanotube and h is the length of the nanotube. To simplify the calculation, only the inner wall area of the nanotube is considered, neglecting other factors such as the outer wall area and the small area between the walls. For example, if the diameter of the nanotube is 40 nm and the length is 2 pm, the surface area of TiCE-NT is increased by about 200 times compared to that of a Ti foil. Even though it is difficult for the PNA probe to reach deep into the nanotube, TiCE-NT provides sufficient surface area to immobilize a higher concentration of the PNA probe relative to Ti foils.
[0107] Unlike TiCE-NTs with low electrical conductivity, AuNPs have high electrical conductivity, which act as an effective electron transfer mediator between TiO2-NTs and PNA probes, increasing the electron density and promoting electron transfer. AuNPs suppress electronhole recombination and amplify the electrochemical signal generated from PNA-DNA binding by rapidly supplying more electrons to PNA. For this reason, AuNPs decorated on the surface of2932706801.4Attomev Docket No.: 104884-201TiCh-NT structures were tested in an effort to enhance the detection signal intensity from the PNA probes interacting with target DNA fragments.
[0108] Referring now to FIG. 12, a gold layer was deposited on the surface of TiCh-NTs by sputtering for 60 and 300 seconds. Then, the deposited gold layer was converted into AuNPs through a calcination process. As the calcination temperature increased, AuNPs became more active, promoting particle growth and aggregation. This can be explained by the Ostwald ripening process in which tiny particles coalesce and grow to form larger particles. In this embodiment, calcination was performed at 350°C for 3 hours to obtain small-sized AuNPs. An SEM image of the 300 s sputtered TiO2-NTs sample showed various-sized gold particle spheres on the TiO2-NTs surface. Most particles had a diameter of about 10-120 nm, while some larger particles, with 1-2 pm diameters, were also observed. The non-uniform size is likely due to the aggregation of small particles during the Ostwald maturation process. The tube entrances of the TiO2-NTs were observed in the area where gold nanoparticles were not deposited.
[0109] Referring now to FIGS. 13A-13C, the AuNPs-TiO2-NTs electrode samples sputtered with gold for 60 s and 300 s showed an increase in electrochemical signal intensity compared to the TiO2-NTs electrode sample without AuNPs. In FIG. 13 A, the PNA-DNA duplex signal intensities without gold nanoparticles were 23, 9.5, and 9.4 pA cm'2for coDNA, misDNA, and scDNA samples, respectively. However, for the gold- sputtered samples (AuNPs-60 s and AuNPs-300 s), the signal intensities increased to 346, 186, and 203 pA cm'2(see FIG. 13B) and 355, 248, and 66 pA cm'2(see FIG. 13C), respectively. Specifically, the coDNA signal intensity increased 15-fold and 15.4-fold for the 60 and 300-s sputtered samples, respectively, compared to the unsputtered sample. Notably, in the 300 s sputtered sample, the signal intensity for scDNA was reduced, showing a clear distinction from the misDNA signal. This suggests that increasing the gold sputtering time reduces non-specific signals such as PNA-scDNA hybridization.
[0110] Without wishing to be bound by theory, the reduction in scDNA signal after 300 s of sputtering may be attributed to the increased concentration and size of the AuNPs. During the extended sputtering time, particle aggregation likely occurred through the Ostwald ripening process, leading to larger AuNPs. These larger particles enhance electron transfer efficiency and help suppress non-specific interactions by strengthening electrostatic barriers, which can be3032706801.4Attomev Docket No.: 104884-201explained by the electric double-layer theory. In brief, an electric double layer forms around the surface of the abundantly negatively charged AuNPs. This layer attracts positive ions from the surrounding solution, forming a thin Helmholtz layer near the surface. This layer includes closely packed positive ions that neutralize the negative charge on the gold surface. Beyond the Helmholtz layer lies the diffuse layer, where positive and negative ions are distributed more freely. Again, without wishing to be bound by theory, the binding of PNA and target DNA fragments occurs within the diffuse layer, and the local concentration of positive charges in this region can affect the approach of DNA to the PNA probe. When the amount of AuNPs increases due to 300 s sputtering, the higher density of positive charges in the diffuse layer leads to a more substantial electrostatic barrier, making it more difficult for scDNA to approach the PNA probe than the 60 s sputtering sample. Additionally, since the binding energy between scDNA and PNA is relatively low, the enhanced electrostatic repulsion further reduces the likelihood of non-specific binding. Consequently, the scDNA signal is expected to be lower in the 300 s sputtering sample.[OlH] These results show that AuNPs formed on the TiCE-NTs surface play a role in amplifying the electrochemical signal, e.g., by more than 10-fold. It can be assumed that the PNA probes were saturated and immobilized on both 60-s and 300-s gold- sputtered electrode surfaces. Thus, PNA-coDNA hybridization can be effectively achieved with, e.g., 60 seconds of gold sputtering, as this was sufficient to generate a detectable signal. Nonetheless, the effective reduction of PNA-scDNA non-specific signals in the 300-s sputtering samples shows that more AuNPs can enhance the sensor's sensitivity compared to the 60-s sputtering. The TiCE-NTs structure coated with AuNPs provides a stable platform for biosensor development.
[0112] In some embodiments, the PNA probes targeted the 805-821 bp region within the 16 repeated IS6110 sequences found in the genomic DNA of M. tuberculosis. Additionally, in some embodiments, two AEEA (2-aminoethoxy-2-ethoxy acetic acid) spacers were introduced at the N-terminal region of the PNA probe. The theoretical length of an AEEA spacer is about 1.3 nm each, leading to at least 2.6 nm of total length. Table 1 provides the sequence information of the PNA probe and three target DNA fragments used in exemplary embodiments of the present disclosure described above. The PNA probe began at N-terminal, and two O linkers were inserted upstream of the PNA sequences. The mismatched DNA (misDNA) sequence was identical to the coDNA, except the 10th guanine was replaced with adenine. The scrambled DNA (scDNA) was3132706801.4Atomev Docket No.: 104884-201designed with no matched base pairs to the PNA probe. To prepare the PNA stock solution (100 pM), the fifty nanomoles lyophilized synthesized PNA probe was dissolved in 500 microliters of distilled water and then incubated in distilled water at 90°C for 10 minutes. The resulting stock solution was stored at -20°C. Similarly, the lyophilized ssDNA fragments were prepared as 100 pM stock solutions using distilled water and stored at -20°C until needed.&Table 1. The sequence information of the PNA probe and three target DNA fragments.
[0113] Titanium dioxide nanotubes were anodized using a fluoride-containing ethylene glycol (EG) electrolyte anodization method. In brief, the electrolyte included of NaF (0.5 w / v%) dissolved in water (3 wt%) and EG (96.5 wt%). The electrolyte was mixed for 3 hours on a stirring plate and then for 2 hours in an ultrasonic bath. Titanium foils were cut into 12 mm * 12 mm sizes and polished for 3 minutes using 1000 grit sandpaper. The polished foils were immersed in Piranha solution for 30 minutes in a hood and rinsed with deionized water. Subsequently, the Ti samples were subjected to ultrasonication for 30 minutes in a solution containing a 1:1 mixture of isopropanol and acetone. The anodization of the TiCh nanostructure was conducted at 30 volts for 1 hour. After the anodization process, the samples were rinsed ultrasonically in deionized water and an acetone-isopropanol solution for 5 seconds each to remove EG and then dried in a 110°C chamber for at least 1 day.
[0114] The as-anodized samples possessed an amorphous structure, so annealing under oxygen-rich conditions was used to induce the crystallization of anatase. For the annealing process, the samples were placed in an oxygen-rich tube furnace with a ramp rate of 1.5°C min1and heated to 500°C for 2 hours. Oxygen gas was supplied directly from a gas tank into the tube furnace, and the exhaust was vented through a gas flowmeter in the fume hood. The prepared TiO2-NTs electrodes were cut to a proper size for further tests.3232706801.4Attomev Docket No.: 104884-201
[0115] The Piranha solution-treated Ti foils and the anodized TiCh-NTs samples were soaked in ethanol (50%) containing NaBFE (0.5 M) solution for 10 minutes, followed by sonication in distilled water, 1 : 1 acetone-isopropanol, and distilled water for 30 seconds each. The electrodes were cleaned by cyclic voltammetry between -0.2 V and -1.5 V vs. Ag / AgCl in NaOH (0.1 M) solution and then between -0.3 V and +1.5 V vs. Ag / AgCl in H2SO4 (0.5 M) solution for 20 cycles with 100 mV s'1scan rate.
[0116] Gold sputtering was conducted using Denton Vacuum Desk V at the Crus Center with 60 seconds and 300 seconds sputtering time for completely dried Ti foil and TiCh-NTs samples. Then, the sputtered samples were calcinated at 350°C for 3 hours, and SEM images were taken.
[0117] In exemplary embodiments of the present disclosure described above, the PNA probes were immobilized on the electrode surface through direct covalent binding. A PNA probe solution (1 pM) was prepared by diluting a stock solution (100 pM) in DI water. Then, PNA solution (10 pl, 1 pM) was applied to one side of the titanium electrode, forming a PNA SAM. The electrodes were then placed in a humid container filled with DI water and kept overnight at room temperature. The following day, the electrodes were rinsed with distilled water to remove any unbound PNA from the surface. From this point onwards, all PNA-immobilized electrodes were stored in distilled water to prevent drying. To prevent non-specific binding of unwanted DNA fragments, the PNA-decorated titanium electrodes were immersed in a solution of MCH (2 mM) in ethanol (60%) and DI water for 30 minutes at room temperature to cover the PNA-free areas. Finally, the electrodes were gently rinsed with ethanol (60%) several times to ensure proper cleaning.
[0118] PNA and DNA hybridization patterns were confirmed using Cyanine 3 (Cy3) fluorescence-labeled images. For fluorescence microscopy, a Cy3-labeled coDNA fragment (10 pM) was hybridized overnight with PNA probes (10 pM) immobilized on TiCh-NTs electrodes at room temperature. The microscope image focused on the edge area of the metal sample pieces, allowing for a comparison between the PNA-DNA labeled area on the metal sample and the background area.3332706801.4Atomev Docket No.: 104884-201
[0119] PNA-immobilized titanium electrodes were hybridized with three different ssDNA fragments at 50°C and 60°C for 30 minutes. The ssDNA fragment stock solution was diluted in PBS (0.1 M, pH 7.0), and the titanium electrodes were soaked in the diluted ssDNA solution during incubation. The PNA-DNA hybridized samples were immersed in a methylene blue solution (20 pM) in NaCl (20 mM) to amplify the electrical signals. Electrochemical detection of the PNA-DNA interaction was performed using DPV at room temperature, employing an electrolyte composed of Tris-HCl (20 mM) and NaCl (20 mM, pH 7.0). DPV measurements were carried out with a pulse range of 0.1 V to -0.8 V, and a scan rate of 100 mV s'1, and the resulting current values were converted to current density based on the electrode area. The plot was automatically normalized using PSTrace5 software, with the baseline established based on the plot lines from both sides of the peak, near -0.3 V, to remove background signals. For data analysis, the peak current was converted to current density using the electrode area and calculated by subtracting the baseline value from the raw peak value. Signal intensities were then determined by calculating the difference between the peak current densities of the PNA-DNA hybridized samples and the PNA-only samples to isolate specific hybridization signals.
[0120] Systems and methods of the present disclosure advantageously provide PNA-probe biosensors which overcome limitations of traditional DNA-based biosensors, such as short storage periods, heat instability, and enzymatic degradation of DNA probes. These PNA-based biosensors offer a longer shelflife at room temperature or in high-temperature environments and can be stored for extended periods without enzymatic decomposition.
[0121] PNA is an artificial material known for its thermal stability, resistance to enzymatic digestion, and high affinity to complementary base pair sequences due to its neutrally charged backbone structure. Embodiments of the present disclosure include a biosensor that immobilizes a 1 pM PNA probe on a gold or AuNP-decorated TiCE-NTs electrode to detect short DNA fragments, e.g., which mimic a part of M. tuberculosis genomic DNA, the pathogen responsible for TB.
[0122] Exemplary sensors were electrochemically tested using CV and DPV at 50°C and 60°C hybridization temperatures, slightly below the Tmvalue of the mimic DNA fragments. This 10°C difference resulted in a 1.74-fold increase in signal intensity for the 1 pM coDNA3432706801.4Attomev Docket No.: 104884-201samples. These findings indicate that the PNA probe systems according to embodiments of the present disclosure can produce distinguishable signals even for target DNA sequences with a single base-pair mismatch at 50°C. This temperature-dependent hybridization provides additional specificity. The recyclability of the PNA sensing platform using a single electrode was also tested. The PNA-coDNA sensor maintained about 60% of its signal intensity after 100 cycles of dehybridization and rehybridization, demonstrating the potential for multiple reuses.
[0123] Short DNA fragments, such as cell-free DNA (cfDNA), can naturally occur and be released from host cells through processes like cell death or necrosis. These cfDNA fragments can be obtained from various body fluids, including saliva, sputum, urine, and blood. In the context of TB, cfDNA from AT. tuberculosis in patients' body fluids can serve as a potential biomarker for detecting TB infections. Rapid detection of TB biomarkers in body fluids allows for early-stage screening and prevention of TB.
[0124] Systems and methods of the present disclosure are advantageous to provide a realtime, reusable, highly selective, and highly sensitive cfDNA system utilizing an electrochemical PNA biosensing platform. The system has numerous advantages over traditional planar DNA probe sensing systems, including: high surface area functionalized titanium dioxide nanotube arrays with PNA probes attached to boost the number of available binding sites by orders of magnitude compared to a planar substrate, resulting in lower limits of detection for target DNA; PNAs with high thermal stability and resistance to nuclease attacks making it suitable for reusability; label free, i.e., no tags or dyes are needed due to the electrochemical read out used in the system nucleotide-based biosensor. Current methods for DNA detection are single use, use fluorescent labels for detection, and have long term stability issues.
[0125] Although the invention has been described and illustrated with respect to exemplary embodiments thereof, it should be understood by those skilled in the art that the foregoing and various other changes, omissions and additions may be made therein and thereto, without parting from the spirit and scope of the present invention.3532706801.4
Claims
Attomev Docket No.: 104884-201CLAIMS1. A biosensor apparatus comprising:an electrode comprising a surface including at least one of: (i) a metal; and (ii) a layer of nanotubes; anda plurality of peptide nucleic acid (PNA) probes complexed to the surface of the electrode,wherein the plurality of PNA probes are configured to bind to one or more biomarkers.
2. The biosensor apparatus according to claim 1, wherein the one or more biomarkers comprise at least one of: (i) DNA; (ii) RNA; or (iii) mRNA.
3. The biosensor apparatus according to claim 1, wherein the one or more biomarkers comprise DNA fragments from an IS6110 region of AL tuberculosis.
4. The biosensor apparatus according to claim 1, wherein the plurality of PNA probes are complexed to the electrode via direct covalent bonding.
5. The biosensor apparatus according to claim 1, wherein the electrode further comprises a layer of 6-mercapto-l -hexanol (MCH) configured to inhibit non-specific binding to a surface of the electrode.
6. The biosensor apparatus of claim 2, wherein the one or more biomarkers are at least lObp in length.
7. The biosensor apparatus of claim 1, comprising a layer of nanotubes comprised of TiCh, and wherein a layer of gold nanoparticles is sputter coated onto the layer of nanotubes.
8. The biosensor apparatus of claim 1, wherein a layer of gold nanoparticles is sputter coated onto the layer of nanotubes for about 300 seconds.
9. A diagnostic method comprising:3732706801.4Attorney Docket No.: 104884-201(i) obtaining a sample from a human patient;(ii) providing a biosensor apparatus including,an electrode comprising a surface including at least one metal and a layer of nanotubes, anda plurality of peptide nucleic acid (PNA) probes complexed to the surface of the electrode and configured to bind to one or more target biomarkers;(iii) contacting the sample with the surface of the electrode;(iv) binding one or more target biomarkers in the sample to the plurality of PNA probes at a predetermined hybridization temperature;(v) measuring an electrical signal generated from the biosensor apparatus; and (vi) resetting the biosensor apparatus by heating the biosensor apparatus to a temperature between about 90°C and about 100°C to dehybridize bound biomarker from the plurality of the PNA probes.
10. The diagnostic method according to claim 9, wherein the one or more biomarkers comprise at least one of: (i) DNA; (ii) RNA; or (iii) mRNA.
11. The diagnostic method according to claim 9, further comprising repeating steps (iii)-(vi) using a new sample.
12. The diagnostic method according to claim 9, wherein the temperature comprises 95°C.
13. The diagnostic method according to claim 9, wherein the one or more target biomarkers comprise DNA fragments from an IS6110 region of AT. tuberculosis.
14. The diagnostic method of claim 9, wherein the layer of nanotubes comprises TiCh nanotubes, and wherein a layer of gold nanoparticles is sputter coated onto the layer of nanotubes.3832706801.4Attomev Docket No.: 104884-20115. The diagnostic method of claim 9, wherein a layer of gold nanoparticles is sputter coated onto the layer of nanotubes for about 300 seconds.
16. The diagnostic method according to claim 9, wherein the measuring the electric signal is done using at least one of: (i) differential pulse voltammetry (DVP); or (ii) a cyclic voltammetry (CV) system.
17. The diagnostic method according to claim 10, wherein the one or more biomarkers are at least lObp in length.
18. The diagnostic method of claim 9, wherein the predetermined hybridization temperature is between ambient temperature and a melting temperature (Tm) of the plurality of PNA probes.
19. A method of designing an oligonucleotide-binding probe, comprising:providing a whole genome sequence of a probe targetselecting a length of the oligonucleotide-binding probe;selecting a minimum repetition threshold;identifying DNA sequences that comprise the selected length and meet or exceed the selected minimum repetition threshold within the whole genome sequence of the probe target; determining a percentage of sequence identity with a reference whole genome; selecting probe candidates from identified sequences having a least sequence identity to the reference genome; andsynthesizing the oligonucleotide-binding probe to be configured to bind to at least one of the selected probe candidates.
20. The method of claim 19, wherein the probe target comprises AT. tuberculosis.
21. The method of claim 19, wherein the reference whole genome comprises that of H. sapiens.
22. The method of claim 19, wherein the selected length is at least 17 bp.3932706801.4Attorney Docket No.: 104884-20123. The method of claim 19, wherein the minimum repetition threshold comprises 15.
24. The method of claim 19, wherein the oligonucleotide-binding probe comprises peptide nucleic acid (PNA).
25. The method of claim 19, further comprising synthesizing the oligonucleotide-binding probe to be configured to bind to a complement of at least one of the selected probe candidates.4032706801.4