Methods for the generation of markerless modified cyanobacterial strains
The integration of a Cre recombinase cassette at a neutral site in cyanobacteria using Cre-lox recombination effectively generates markerless strains, addressing the limitations of existing methods and enabling broader industrial applications for cyanobacteria.
Patent Information
- Application Number
- PCT/EP2025/083528
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-25
- Filing Date
- 2025-11-19
- Publication Date
- 2026-05-28
AI Technical Summary
The lack of effective markerless cloning methods for cyanobacteria hinders their use as an expression chassis for industrial applications, and existing methods for generating markerless mutants in cyanobacteria, such as the Cre-lox recombination system, have been unsuccessful in certain strains like Synechococcus sp. PCC 11901.
A method involving the integration of a Cre recombinase cassette at a neutral site in the cyanobacterial genome, flanked by lox sites, allows for the excision of selectable markers using Cre-lox recombination, either integrated or non-integrated plasmid-based, ensuring markerless strains are generated across various cyanobacterial strains.
Successfully generates markerless modified cyanobacterial strains, particularly in Synechococcus sp. PCC 11901, by excising selectable markers, thereby overcoming previous limitations and enabling broader industrial applications.
Smart Images

Figure EP2025083528_28052026_PF_FP_ABST
Abstract
Description
[0001] Methods
[0002] Field of the Invention
[0003] The invention relates to methods for preparing modified cyanobacterial strains, reagents for such methods, and modified cyanobacterial strains prepared therefrom.
[0004] Background to the Invention
[0005] Cyanobacteria have significant potential for industrial applications due to their ability to fix carbon dioxide and express useful heterologous compounds from photosynthesis. However, the lack of available genetic toolkits including markerless cloning methods has hindered a broader adoption of cyanobacteria as an expression chassis for industrial applications. It has been a focus of researchers over the past two decades to identify synthetic biology tools to enable genetic manipulation of cyanobacteria.
[0006] Methods for introducing expression constructs into cyanobacteria rely on selective markers, such as antibiotic resistance proteins. However, selective markers available for cyanobacteria to date are limited. Furthermore, it is desirable to avoid the possibility of releasing antibiotic resistance genes into the environment. Methods for the generation of markerless modified cyanobacterial strains are therefore advantageous.
[0007] Several markerless selection systems have been developed in cyanobacteria. Free fatty acids have been used to select for markerless acts knockout mutants in both Synechococcus sp. PCC 6803 and Synechococcus elongatus PCC 7002 (Kojima et al., Appl. Microbiol. Biotechnol. 100 (2016) 10107-10113). However, recent efforts to use the common negative selection markers sacB and codA to generate markerless mutants proved unsuccessful in Synechococcus sp. PCC 11901 (Mills et al., 2022, Biomolecules 12:872).
[0008] A Cre-lox recombination system approach has been developed to generate markerless mutants in Synechococcus sp. PCC 6803 (Jones et al., ACS Synth. Biol. 10 (2021) 2371-2382). This approach involved generation of marked cyanobacterial strains via insertion of an antibiotic resistance marker (AbR) flanked by two lox sites into a target site, followed by introduction of a vector encoding Cre recombinase and a second AbR into the marked cyanobacterial strains such that it integrates into an essential locus rbcLXS or psbEFLJ) with Cre recombinase under control of the native promoter. As these genes are essential, the strains were maintained in a partially segregated state under antibiotic selection. Subsequent expression of Cre recombinase resulted in excision of the lox-AbR-lox cassette from the genome. Growth of these mutants on plates lacking the second antibiotic resulted in loss of chromosomes containing the CRE / AbR insertion and generation of markerless modified cyanobacterial strains.
[0009] However, attempts to replicate the CRE-lox recombination system approach in the recently discovered fast-growing cyanobacterium, Synechococcus sp. PCC 11901, was not successful despite repeated attempts (Victoria et al., Plant Physiology, 2004, 00, 1-17). In particular, it has not been possible to transform the vectors encoding Cre recombinase into marked cyanobacterial strains. It was suggested that Cre recombinase is either toxic or that the generation of partially segregated mutants in key essential genes is extremely challenging.
[0010] Accordingly, it is an object of the invention to develop further or improved methods for generating markerless modified cyanobacterial strains, and in particular methods that can be universally applied across cyanobacterial strains.
[0011] Summary of the Invention
[0012] The inventors developed new methods of generating modified cyanobacterial strains, which use a Cre-lox recombination system approach to remove selectable markers.
[0013] The methods may involve expressing a Cre recombinase from a cassette introduced into the cyanobacterial genome, e.g. as shown in Figure 1. The inventors demonstrated the effectiveness of this method in a fast growing strain (Synechococcus sp. PCC 11901), a strain in which a similar approach had previously failed (Victoria et al., Plant Physiology, 2004, 00, 1-17). In particular, the inventors successfully integrated a cassette encoding a Cre recombinase into the genome at the neutral site, the aqul locus, of Synechococcus sp. PCC 11901. Upon expression of Cre recombinase, a selectable marker flanked by lox sites was excised from the cyanobacterial genome. The inventors considered that neutral sites of cyanobacteria, such as at the aqul locus or at the mrr locus, are particularly amenable for stable insertion of the cassette encoding Cre recombinase. Furthermore, the inventors found that strong expression of Cre recombinase under the control of the constitutive promoter, pc560 promoter, was well tolerated in Synechococcus sp. PCC 11901.
[0014] Alternatively, the method may involve expressing a Cre recombinase from a nonintegrating plasmid that has been introduced into the cyanobacteria, e.g. as shown in Figures 4 and 6. In such embodiments, the gene encoding Cre recombinase is not integrated into the cyanobacterial genome. Upon expression of Cre recombinase, a selectable marker flanked by lox sites is excised from the cyanobacterial genome. The Cre-containing plasmid may be cured after removal of the selectable marker (Figure 4). The Cre-containing plasmid may further comprise a CRISPR-Casl2a system, e.g. as shown in Figure 6, which may target genes associated with replication of the Cre- containing plasmid and hence be able to disable replication and propagation of the Cre- containing plasmid.
[0015] The invention therefore provides a modified cyanobacterial strain comprising: (i) a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites, wherein the cassette is integrated into the cyanobacterial genome; and (ii) a cassette comprising a gene encoding a Cre recombinase capable of excising DNA in-between the lox sites, wherein the cassette is not integrated into an essential locus in the cyanobacterial genome.
[0016] The invention therefore provides a modified cyanobacterial strain comprising: (i) a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites, wherein the cassette is integrated into the cyanobacterial genome; and (ii) a cassette comprising a gene encoding a Cre recombinase capable of excising DNA in-between the lox sites, wherein the cassette is integrated into a neutral site in the cyanobacterial genome.
[0017] The invention also provides a modified cyanobacterial strain comprising a cassette comprising a gene encoding a Cre recombinase integrated at a neutral site in the cyanobacterial genome.
[0018] The invention also provides a modified cyanobacterial strain comprising a nonintegrating plasmid comprising a cassette comprising a gene encoding a Cre recombinase, a gene encoding trans-acting replication protein trfA and origin of replication oriV. The invention also provides a modified cyanobacterial strain derived from Synechococcus sp. PCC 11901, wherein the modified cyanobacterial strain comprises one or more lox72 sites in the cyanobacterial genome.
[0019] The invention also provides a plasmid comprising a cassette comprising a gene encoding a Cre recombinase and its regulatory elements, and a selectable marker, wherein the cassette is flanked by sequences homologous to the upstream and downstream, respectively, sequences of a neutral site in the genome of a cyanobacterial strain.
[0020] The invention also provides a non-integrating plasmid comprising a cassette comprising a gene encoding a Cre recombinase and its regulatory elements, a selectable marker, a gene encoding trans-acting replication protein trfA and origin of replication oriV.
[0021] The invention also provides a kit comprising: a modified cyanobacterial strain of the invention; and a plasmid comprising a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites.
[0022] The invention also provides a method of generating a modified cyanobacterial strain, comprising:
[0023] (i) introducing into a cyanobacterial strain a plasmid comprising a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites, wherein the cassette is flanked by sequences homologous to the upstream and downstream, respectively, sequences of an integration site in the cyanobacterial genome, such that the cassette is integrated into the cyanobacterial genome at the integration site by homologous recombination to generate a marked cyanobacterial strain;
[0024] (ii) isolating the marked cyanobacterial strain by selection based on expression of the selectable marker; and
[0025] (iii) eliciting excision of the cassette by Cre-lox recombination, wherein Cre recombinase is expressed from a cassette integrated in a neutral site in the genome of the modified cyanobacterial strain or is expressed from a non-integrating plasmid in the cytoplasm of the modified cyanobacterial strain.
[0026] The invention also provides a method of generating a modified cyanobacterial strain, comprising:
[0027] (i) introducing into the cyanobacterial strain a plasmid of the invention comprising a cassette comprising a gene encoding a Cre recombinase; and (ii) introducing into the cyanobacterial strain a plasmid comprising a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites, wherein the cassette is flanked by sequences homologous to the upstream and downstream, respectively, sequences of an integration site in the cyanobacterial genome, such that the cassette is integrated into the cyanobacterial genome at the integration site by homologous recombination; wherein expression of Cre recombinase elicits excision of the selectable marker cassette by Cre-lox recombination.
[0028] The invention also provides a method of generating a modified cyanobacterial strain, comprising introducing the plasmid of the invention into a cyanobacterial strain, wherein the cyanobacterial strain comprises in its genome a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites, such as the lox66 and lox71 sites as set out in SEQ ID NOs: 4 and 3, respectively.
[0029] The invention also provides a method of generating a modified cyanobacterial strain, comprising introducing into the modified cyanobacterial strain of the invention an expression construct comprising a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites, wherein the cassette is flanked by sequences homologous to the upstream and downstream, respectively, sequences of an integration site in the cyanobacterial genome, such that the cassette is integrated into the cyanobacterial genome at the integration site by homologous recombination.
[0030] The invention also provides a modified cyanobacterial strain obtained or obtainable by any of the methods of the invention.
[0031] Brief Description of the Figures
[0032] Figure l is a schematic diagram showing an exemplary method of the invention for generating a modified cyanobacterial strain.
[0033] (A) Cyanobacterial cell is transformed with a plasmid comprising a cassette comprising a first selectable marker (SI), such as an antibiotic (e.g. kanamycin) resistance gene, flanked by a pair of lox sites (referred herein as lox-marker-lox cassette or lox - SI - lox). The lox-marker-lox cassette is flanked by sequences that are homologous to the sequences upstream (LOI US) and downstream (LOI DS), respectively, of a first integration site in the cyanobacterial genome, which can be at any locus of interest (LOI). A recombination event occurs between the upstream and downstream flanking regions in the plasmid and the homologous sequence in the genome, resulting in integration of the lox-marker-lox cassette into the cyanobacterial genome at the locus of interest, and hence the generation of a marked mutant. Following selection based on the first selectable marker, such as incubation on agar plates containing an antibiotic (e.g. kanamycin), colonies in which the recombination event occurred are isolated.
[0034] (B) The marked mutant from (A) is transformed with a second plasmid comprising a cassette comprising genes encoding a Cre recombinase (Cre) and a second selectable marker (S2), such as an antibiotic (e.g. spectinomycin) resistance gene, flanked by a pair of lox sites (lox - Cre - S2 - lox). The cassette is flanked by sequences that are homologous to the sequences upstream (aqul US) and downstream (agw / DS), respectively, of a second integration site in the cyanobacterial genome. The second integration site is at a neutral site, e.g. at the aqul locus. A homologous recombination event occurs between the upstream and downstream flanking regions in the plasmid and the homologous sequence in the genome, resulting in the integration of the cassette (lox - Cre - S2 - lox) into the cyanobacterial genome at the neutral site. Following selection based on the second selectable marker, such as incubation on agar plates containing antibiotic (e.g. spectinomycin), colonies in which the recombination event occurred are isolated.
[0035] (C) Upon expression of Cre recombinase, the DNA sequence between each pair of lox sites is excised by Cre-recombination. Hence, this step removes the first selectable marker (SI), as well as the genes encoding Cre recombinase and the second selectable marker (S2) from the cyanobacterial genome to provide a modified cyanobacterial strain that does not comprise genes encoding selectable markers.
[0036] Figure l is a schematic diagram showing integration of a lox-marker-lox cassette into the Synechococcus sp. PCC 11901 cyanobacterial genome at the mrr locus (FEK30 09380) to generate a marked mutant. The selectable marker is a kanamycin resistance (KmR) gene. The lox sites are lox66 and lox71 sites. The lox-marker-lox cassette is flanked by an upstream region comprising Synechococcus sp. PCC 11901 nucleotides 1,717,785 to 1,718,693 and a downstream region comprising Synechococcus sp. PCC 11901 nucleotides 1,719,565 to position of 1,720,504 (NCBI Reference Sequence: NZ_CP040360.1). Synechococcus sp. PCC 11901 nucleotides 1,718,694 to 1,719,554 are deleted following the integration.
[0037] Figure 3 is a schematic diagram showing integration of a cassette comprising genes encoding a Cre recombinase and a selectable marker into the Synechococcus sp. PCC 11901 cyanobacterial genome at the aqul locus (FEK30 10065). The Cre recombinase is under control of a constitutive promoter, pc560, and comprises a lux A terminator. The selectable marker is a spectinomycin resistance (SpecR) gene. The cassette is flanked by an upstream region comprising Synechococcus sp. PCC 11901 nucleotides 1,867,951 to 1,868,950 and a downstream region comprising Synechococcus sp. PCC 11901 nucleotides 1,869,905 to position of 1,870,904 (NCB I Reference Sequence: NZ_CP040360.1). Synechococcus sp. PCC 11901 nucleotides 1,868,951 to 1,869,904 are deleted following the integration.
[0038] Figure 4 is a schematic diagram showing an exemplary method of the invention for generating a modified cyanobacterial strain.
[0039] (A) A marked mutant is generated in the same way as in Figure 1(A).
[0040] (B) The marked mutant from (A) is transformed with a non-integrating plasmid comprising genes encoding Cre recombinase and a second selectable marker (S2), such as an antibiotic (e.g. spectinomycin) resistance gene. The genes remain on the non-integrating plasmid and are not integrated into the cyanobacterial genome after transformation.
[0041] (C) Upon expression of Cre recombinase, the DNA between the pair of lox sites is excised by Cre-recombination. Hence, this step removes the selectable marker 1 (SI) inbetween the pair of lox sites from the cyanobacterial genome.
[0042] (D) The non-integrating plasmid is then cured from the cyanobacteria, to provide a modified cyanobacterial strain that does not comprise genes encoding selectable markers.
[0043] Figure 5 shows a portion of an exemplary non-integrating plasmid that may be used for the method illustrated in Figure 4. The plasmid comprises a gene encoding a Cre recombinase downstream of the pc560 promoter and upstream of the luxA terminator, and a gene encoding trans-acting replication protein trfA (SEQ ID NO: 28), and origin of replication, oriV (SEQ ID NO:29), that facilitate replication of the non-integrating plasmid in cyanobacteria. Figure 6 is a schematic diagram showing an exemplary method of the invention for generating a modified cyanobacterial strain.
[0044] (A) A marked mutant is generated in the same way as in Figure 1(A).
[0045] (B) The marked mutant from (A) is transformed with a non-integrating plasmid comprising genes encoding a Cre recombinase, a second selectable marker (S2), Casl2a, and one or more single guide RNAs (sgRNAs) targeting a gene associated with replication of the non-integrating plasmid, such as RepA. The genes remain on the non-integrating plasmid and are not integrated into the cyanobacterial genome after transformation.
[0046] (C) Upon expression of Cre recombinase, the DNA between the pair of lox site is excised by Cre-recombination. Hence, this step removes the selectable marker 1 (SI) inbetween the pair of lox sites from the cyanobacterial genome.
[0047] (D) Upon expression of the sgRNAs and Cast 2a, the sgRNAs target Cast 2a to a gene associated with replication of the non-integrating plasmid, where Cast 2a cleaves the plasmid. These cuts disrupt the ability of the plasmid to replicate and remain stable within the cell, ultimately leading to its removal from the modified cyanobacterial strain.
[0048] Figure 7 shows a portion of an exemplary non-integrating plasmid that may be used for the method illustrated in Figure 6. The plasmid comprises a gene encoding a Cre recombinase downstream of the pc560 promoter and upstream of the luxA terminator, a gene encoding Cast 2a, and one or more genes encoding sgRNAs (crRNA2) targeting the gene encoding RepA in the non-integrating plasmid.
[0049] Figure 8 shows the generation of a Synechococcus sp. PCC 11901 marked mutant in which the mrr gene is replaced with a lox-kanR-lox cassette. Cyanobacterial genomes were subjected to PCR amplification using UP FLANK primer (gggaaacaatttctccccagg - SEQ ID NO: 30) and DOWN FLANK primer (gcggtttctgggaagcttc - SEQ ID NO: 31) of the mrr locus. Lane 1 shows a wildtype having a 1174 bp amplicon. Lanes 2 and 3 show marked mutants having a 1705 bp amplicon.
[0050] Figure 9 shows the schematic diagram of a plasmid for cloning Cre recombinase into the cyanobacterial genome at the aqul locus. The plasmid comprises a cassette comprising a gene encoding a Cre recombinase downstream of the pc560 promoter, wherein the cassette is flanked by upstream (US) and downstream (DS) regions that are homologous to the respective regions of the integration site at the aqul locus. Figure 10 shows successful deletion of the lox-kanR-lox cassette from the mrr locus in the cyanobacterial genome using polymerase chain reaction (PCR) and gel electrophoresis following transformation of the modified PCC 11901 from Figure 8 with the plasmid from Figure 9. The lox-kanR-lox cassette was successfully deleted from the mrr locus in colonies 1 and 3 (1274bp), but not colony 2 (2498 bp).
[0051] Figure 11 shows successful deletion of the kanamycin resistance cassette from the cyanobacterial genome using polymerase chain reaction (PCR) and gel electrophoresis following transformation of modified Synechococcus sp. PCC 11901 from Figure 8 with the plasmid from Figure 9. The kanamycin resistance cassette was successfully deleted from colonies 1 and 3, whereas the kanamycin resistance cassette was preserved in colony 2.
[0052] Figure 12 shows the successful incorporation of the cassette encoding a Cre recombinase into the cyanobacterial genome using polymerase chain reaction (PCR) and gel electrophoresis following transformation of modified Synechococcus sp. PCC 11901 from Figure 8 with the plasmid from Figure 9. Colony 4 was a positive control expressing the Cre recombinase cassette. The cassette was successfully incorporated into the genome for colonies 1 and 3 the Cre recombinase gene, but not for colony 2.
[0053] Detailed Description of the Invention
[0054] Cre-lox recombination
[0055] Cre recombinase is capable of specifically recognizing lox sites. Upon contact with Cre recombinase, the DNA sequence in-between the pair of lox sites is excised and circularised, leaving one lox site in the genome. Hence, Cre recombinase is capable of excising the DNA sequence in-between the lox sites, leaving behind a minimal genetic scar.
[0056] A Cre recombinase useful with the invention may be any Cre recombinase known in the art. For example, the Cre recombinase may be the wild type Cre recombinase from bacteriophage Pl having Uniprot ID 2777477, and the amino acid sequence is set out in SEQ ID NO: 1. Hence, a Cre recombinase useful with the invention may comprise or consist of SEQ ID NO: 1. The Cre recombinase may be a variant of the wild type Cre recombinase from bacteriophage Pl, provided that it retains its ability to excise the DNA sequence in-between a pair of lox sites. For example, the variant of Cre recombinase may have at least 80% of the activity of the Cre recombinase of SEQ ID NO: 1. The variant of Cre recombinase may comprise an amino acid sequence that has >90% (i.e. 90% or more), >95%, >97%, >98%, or >99% sequence identity with SEQ ID NO: 1. The variant of Cre recombinase may comprise modifications compared to SEQ ID NO: 1, e.g. <5 (i.e. 5 or less), <4, <3, <2, or 1 modification, e.g. deletions, insertions, or substitutions. For example, the variant of Cre recombinase may comprise a substitution at an amino acid corresponding to the amino acid at position 32 of SEQ ID NO: 1, such as R32V or R32M. The variant of Cre recombinase may comprise a duplication of amino acids corresponding to those at positions 303 to 305 of SEQ ID NO: 1, also known as 303GVSdup. These mutations have been reported to confer improvement in the accuracy of recombination (Eroshenko et al., Nat Commun. 2013; 4: 2509).
[0057] The pair of lox sites are typically spaced about 1 to 4 kb apart. For example, the pair of lox sites may be spaced about 1 to 3 kb apart, or about 1 to 2 kb apart.
[0058] Lox sites useful with the invention are provided in Table 1. The lox site is typically 34 base pairs long, consisting of two 13 bp inverted repeats flanking an 8 bp core sequence where recombination occurs.
[0059] The lox sites useful with the invention may be asymmetric. Asymmetric lox sites are advantageous as they facilitate controlled excision of DNA in a specific orientation. For the embodiments where asymmetric lox sites are used, the pair of asymmetric lox sites are arranged in cis orientation to enable excision of the DNA in-between the pair of lox sites.
[0060] The lox sites useful with the invention may be symmetric, for example, loxPsym.
[0061] Table 1. Examples of lox sites useful with the invention
[0062] Lox sites useful with the invention may be selected from loxP (SEQ ID NO: 2), lox511 (SEQ ID NO: 6), lox 66 (SEQ ID NO: 4) and lox 71 (SEQ ID NO: 3). The pair of lox sites useful with the invention is typically lox66 and lox71, having the sequences as set out in SEQ ID NOs: 4 and 3, respectively. The effectiveness of these lox sites is described in Lambert et al., Appl Environ Microbiol. 2007 Feb; 73(4): 1126-1135.
[0063] Mutants of lox66 and lox71 sites may be used, such as SEQ ID NOs: 14 and 15, respectively, where N can be any nucleotide.
[0064] Each of the inverted repeats in lox66 and lox71 contains a single mutation compared to loxP. Upon Cre-lox recombination, lox66 and lox71 recombine to create a functionally inactive double mutant lox72 site (SEQ ID NO: 5). The lack of affinity of Cre recombinase for the lox72 site allows for multiple lox reactions to occur in a genome in series, without affecting or cross reacting with each other.
[0065] Hence, the invention provides a modified cyanobacterial strain (e.g. Synechococcus sp. PCC 11901) comprising one or more lox72 sites. The lox72 sites may be present at a location proximal to a non-native sequence (e.g. a heterologous sequence) in the cyanobacterial genome and / or at a neutral site in the cyanobacterial genome. Expression constructs
[0066] The invention further provides expression constructs comprising cassettes (i.e. expression cassettes), and the cassettes comprise the genes described herein, such as a gene encoding a Cre recombinase and / or a gene encoding a selectable marker. Any expression constructs suitable to be expressed in cyanobacteria can be used with the invention. For example, the cassettes may be part of an expression construct, such as a vector, which may be a plasmid, a bacteriophage, a cosmid, a bacterial artificial chromosome, or a viral vector. The plasmid may be an integrating or a non-integrating plasmid. The bacteriophage may be a X phage and / or a M13 phage.
[0067] The genes in the cassette and / or expression construct are typically operably linked to regulatory sequences, such as one or more of a promoter, a transcription regulatory sequence, an enhancer, a polyadenylation signal, a termination signal, and an internal ribosome entry site (IRES). A transgene is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter or transcription regulatory sequence is operably linked to a gene if it affects the transcription of the transgene. The regulatory sequences typically allow expression of the protein encoded by the gene.
[0068] The expression constructs described herein can be prepared by common DNA assembly methods, such as BioBrick Assembly, Gibson Assembly, and Golden Gate Assembly. Useful platforms for designing and assembling genetic vectors for cyanobacteria include CyanoGate. For example, amplification methods that may be used include polymerase chain reaction (PCR), the ligase chain reaction (LCR), the transcription-based amplification system (TAS), the self-sustained sequence replication system (3 SR). Amplified nucleotide sequences may be fused using ligation methods. Amplified nucleotide sequences may be fused by Gibson Assembly to produce a cassette. A wide variety of cloning methods, host cells, and in vitro amplification methodologies are well known to the skilled person. Cre recombinase
[0069] The expression construct may comprise a cassette comprising a gene encoding a Cre recombinase. Such a cassette may be referred to herein as a Cre recombinase expression cassette. The 5 ’-end of the gene encoding a Cre recombinase is typically operably linked to a promoter, which drives the protein expression of Cre recombinase. The promoter may be any suitable promoter, such as any promoter listed in Table 2 below.
[0070] Table 2. Examples of promoters useful with the invention. The promoter may be a prokaryotic (e.g. bacterial) promoter or an artificial promoter. Typically the promoter is effective in cyanobacteria.
[0071] The promoter may be a constitutive or an inducible promoter. A constitutive promoter allows for stable expression of the operably linked gene in a cyanobacterial strain. An inducible promoter allows for expression of the operably linked gene in a cyanobacterial strain upon the presence of a stimulus (e.g. an inducer).
[0072] The promoter may be a strong promoter. For example, the promoter may provide a mean expression level of a Cre recombinase at about >70%, >80%, >90%, >100%, or >200% relative to a reference promoter, e.g. a promoter of a housekeeping gene such as GAPDH, or any housekeeping gene described herein.
[0073] The gene encoding a Cre recombinase may be operably linked to a constitutive promoter, such as pc560. As shown in the Examples, placing the gene encoding a Cre recombinase under the pc560 promoter resulted in effective expression of Cre recombinase once the gene is integrated into the cyanobacterial genome.
[0074] The gene encoding a Cre recombinase may be operably linked to an inducible promoter, such as a 2,4-diacetylphloroglucinol (DAPG)-inducible promoter PphiF, a L- rhamnose-inducible promoter PrhaBAD, or a promoter consisting of a theophylline-inducible riboswitch E* fused to a trc promoter (Ptrc), VtrcE*. Hence, the method of the invention may comprise a step of inducing expression of Cre recombinase by activating the inducible promoter operably linked to the gene encoding Cre recombinase.
[0075] The PhlF transcription factor functions as a repressor to the PphiF promoter, which undergoes a conformational change upon binding to DAPG and releases the promoter leading to transcription. Hence, Cre recombinase is expressed in the presence of DAPG. Hence, the method of the invention may comprise a step of inducing expression of Cre recombinase from a cyanobacterial strain by introducing DAPG to the cyanobacterial strain.
[0076] The 3 ’-end of the gene encoding a Cre recombinase is typically operably linked to a terminator. Appropriate terminators are well known to a person skilled in the art. For example, the terminator may be a luxA terminator, e.g. SEQ ID NO: 22 (Chen et al., 2013, Nat. Methods, 10, 659-664) or a trrnB terminator, e.g. SEQ ID NO: 23 (Liu and Pakrasi, 2018, Microb Cell Fact 17: 48; Wang et al., 2018, ACS Synth Biol 7: 276-286). The cassette comprising a gene encoding a Cre recombinase may further comprise a gene encoding a selectable marker, as described herein.
[0077] The Cre recombinase expression cassette is not integrated into an essential locus in the cyanobacterial genome. Essential locus may include the rbcLXS locus (FEK30 13435) or at the psbEFL J locus (psbE EEK30_05220, psbF EEK30_05225, psbL FEK30_05230, psbJ-. FEK30 05235). An essential locus encodes one or more genes that are indispensable for the cyanobacterial strain to grow and survive, e.g. to maintain a central metabolism, replicate DNA, translate genes into proteins, maintain a basic cellular structure, and mediate transport processes into and out of the cell.
[0078] The Cre recombinase expression cassette may be integrated into the cyanobacterial genome at a site other than at an essential locus. The Cre recombinase expression cassette may be integrated into a neutral site. Alternatively, the Cre recombinase expression cassette may be present, e.g. in a non-integrating plasmid, in the cytoplasm of the cyanobacterial strain without being integrated into the genome of a cyanobacterial strain.
[0079] In embodiments where the Cre recombinase expression cassette is integrated into a cyanobacterial genome, the Cre recombinase expression cassette may be introduced to the cyanobacterial strain via any plasmid that facilitates genome integration.
[0080] The Cre recombinase expression cassette may be introduced into a cyanobacterial genome by homologous recombination at a neutral site. In an expression construct (e.g. plasmid) comprising the Cre recombinase expression cassette, the Cre recombinase expression cassette may be flanked by sequences homologous to the upstream and downstream, respectively, sequences of a neutral site in the cyanobacterial genome. In other words, the flanking regions of the Cre recombinase expression cassette may comprise an upstream sequence that is homologous to the upstream sequence of a neutral site, and a downstream sequence that is homologous to the downstream sequence of the neutral site. The upstream sequence may comprise about 5OObp to about 2kbp, e.g. about 900 bp to about 1 kbp, upstream of the neutral site. The downstream sequence may comprise about 500bp to about 2kbp, e.g. about 900 bp to about Ikbp, downstream of the neutral site.
[0081] For example, in the embodiments where the Cre recombinase expression cassette is to be integrated into the mrr locus, the expression construct (e.g. plasmid) may comprise the Cre recombinase expression cassette flanked by sequences complementary to the upstream and downstream, respectively, of the mrr locus. The upstream sequence may comprise about 900 bp to about 1 kbp upstream of the integration site at the mrr locus, such as from position 1,717,785 to position 1,718,693 in the genome ofPCC 11901. The downstream sequence may comprise about 900 bp to about 1 kbp downstream of the integration site at the mrr locus, such as from position 1,719,565 to position of 1,720,504 in the genome of PCC 11901.
[0082] In the embodiments where the Cre recombinase expression cassette is to be integrated into the aqul locus, the expression construct (e.g. plasmid) may comprise the Cre recombinase expression cassette flanked by sequences complementary to the upstream and downstream, respectively, of the aqul locus. The upstream sequence may comprise about 900 bp to about 1 kbp upstream of the integration site at the aqul locus, such as from position 1,867,951 to position 1,868,950 in the genome ofPCC 11901. The downstream sequence may comprise about 900 bp to about 1 kbp downstream of the integration site at the aqul locus, such as from position 1,869,905 to position 1,870,904 in the genome of PCC 11901.
[0083] The Cre recombinase expression cassette, having been introduced into a cyanobacterial genome, may be subsequently excised from the cyanobacterial genome. For example, the Cre recombinase expression cassette may be flanked by a pair of lox sites, such that expression of Cre recombinase would result in excision of the Cre recombinase expression cassette from the cyanobacterial genome.
[0084] The Cre recombinase expression cassette may not be introduced into the genome of a cyanobacterial strain. In such embodiments, the Cre recombinase expression cassette may be comprised in a plasmid, such as a non-integrating plasmid. Upon transformation of the non-integrating plasmid into a cyanobacterial strain, the Cre recombinase expression cassette remains in the non-integrating plasmid in the cytoplasm, without integration into the cyanobacterial genome.
[0085] The non-integrating plasmid may be a self-replicating plasmid or a shuttle plasmid. The non-integrating plasmid may be an E. coli suitable shuttle plasmid that encodes the oriV origin of replication (SEQ ID NO: 29) and trfA (SEQ ID NO: 28). The trfA-based plasmid is advantageous compared to other shuttle vector strategy because replication depends on the TrfA protein, which is essential for initiating replication by binding to and activating oriV, and this provides a tight control over the replication process.
[0086] Lox-marker -lox
[0087] An expression construct of the invention may comprise a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites, which is also referred to herein as a “lox-marker-lox” cassette. Suitable pairs of lox sites and selectable markers are described herein.
[0088] The lox-marker-lox cassette may further comprise a heterologous gene which is not flanked by the pair of lox sites. Such a cassette may be for the purpose of introducing a heterologous gene into the cyanobacterial genome. The heterologous gene may be an additional gene introduced into the cyanobacterial genome, or may replace a native gene in the cyanobacterial genome.
[0089] In the embodiment where the lox-marker-lox cassette does not comprise a further heterologous gene, the cassette may be for the purpose of deleting a native gene, or truncating a native gene and rendering it non-functional.
[0090] The lox-marker-lox cassette may be integrated into a cyanobacterial genome by homologous recombination at an integration site at a locus of interest. Hence, the invention provides an expression construct (e.g. plasmid) that comprises a lox-marker-lox cassette flanked by sequences homologous to the upstream and downstream, respectively, sequences of an integration site in a cyanobacterial genome. In other words, the expression construct (e.g. plasmid) may comprise a lox-marker-lox cassette comprising an upstream sequence that is homologous to the upstream sequence of an integration site at a locus of interest, and a downstream sequence that is homologous to the downstream sequence of the integration site at the locus of interest. The upstream sequence may comprise about 5OObp to about 2kbp, e.g. about 900 bp to about 1 kbp, upstream of the integration site at the locus of interest. The downstream sequence may comprise about 500bp to about 2kbp, e.g. about 900 bp to about Ikbp, downstream of the integration site at the locus of interest.
[0091] For example, where the lox-marker-lox cassette is to be integrated into the mrr locus, the expression construct (e.g. plasmid) may comprise the lox-marker-lox cassette flanked by sequences complementary to the upstream and downstream, respectively, of the mrr locus. The upstream sequence may comprise about 900 bp to about 1 kbp upstream of the integration site at the mrr locus, such as from position 1,717,785 to position 1,718,693 in the genome of PCC 11901. The downstream sequence may comprise about 900 bp to about 1 kbp downstream of the integration site at the mrr locus, such as from position 1,719,565 to position of 1,720,504 in the genome of PCC 11901.
[0092] In the embodiments where the lox-marker-lox cassette is to be integrated into the aqul locus, the expression construct (e.g. plasmid) may comprise the lox-marker-lox cassette flanked by sequences complementary to the upstream and downstream, respectively, of the aqul locus. The upstream sequence may comprise about 900 bp to about 1 kbp upstream of the integration site at the aqul locus, such as from position 1,867,951 to position 1,868,950 in the genome of PCC 11901. The downstream sequence may comprise about 900 bp to about 1 kbp downstream of the integration site at the aqul locus, such as from position 1,869,905 to position 1,870,904 in the genome of PCC 11901.
[0093] Casl2a
[0094] The invention also provides one or more cassettes and / or expression constructs comprising genes encoding a Casl2a, and one or more sgRNAs which are capable of specifically binding to the Cast 2a and are complementary to the gene encoding a Cre recombinase or to a gene associated with replication of a plasmid. The genes encoding a Casl2a, and one or more sgRNAs may be present in the same cassette and / or expression construct or may be present in different expression constructs.
[0095] The expression construct(s) may be introduced into the modified cyanobacterial strain of the invention, resulting in a modified cyanobacterial strain that further comprises genes encoding Cast 2a and one or more sgRNAs complementary to the gene encoding a Cre recombinase or to a gene associated with replication of a plasmid.
[0096] A Cast 2a useful with the invention may be the wild type Cast 2a, having SEQ ID NO: 40. Hence, a Casl2a useful with the invention may comprise or consist of SEQ ID NO: 40. The Casl2a may be a variant of the wild type Casl2a, provided that it retains its ability to recognise sgRNAs and cleaves DNA substrate. For example, the variant of Casl2a may be capable of recognising sgRNAs and have at least 80% of the catalytic activity of the Casl2a of SEQ ID NO: 40. The variant of Casl2a may comprise an amino acid sequence having >70% (i.e. 70% or more), >80%, >90%, >95%, >96%, >97%, >98%, or >99% sequence identity to SEQ ID NO: 40. The variant of Casl2a may comprise modifications compared to SEQ ID NO: 40, e.g. <5 (i.e. 5 or less), <4, <3, <2, or 1 modification, e.g. deletions, insertions, or substitutions.
[0097] The sgRNAs may target the Cre recombinase expression cassette, such as the gene encoding a Cre recombinase. Upon expression of sgRNAs and Casl2a, Casl2a is recruited to the target in the Cre recombinase expression cassette by the sgRNAs. This may result in cleavage of the gene encoding the Cre recombinase, rendering it nonfunctional. This may result in excision of the gene encoding the Cre recombinase from its location, e.g. from the cyanobacterial genome or from a non-integrating plasmid. The genes encoding Casl2a and one or more sgRNAs may be comprised in any plasmid that facilitate their expression.
[0098] The genes encoding Casl2a and one or more sgRNAs may be comprised in one or more non-integrating expression constructs. The expression construct may be a plasmid that also comprises a gene encoding a Cre recombinase, as illustrated in Figure 6. The sgRNAs may target the non-integrating plasmid, such as at a gene associated with replication of the non-integrating plasmid, e.g. RepA (e.g. SEQ ID NO: 42), DnaJ (e.g. SEQ ID NO: 43), DnaA (SEQ ID NO: 44), DnaB (SEQ ID NO: 45) and / or DnaG (e.g. SEQ ID NO: 46). For example, the sgRNAs may target the RepA sequence encoding PNMVAGTV (SEQ ID NO: 41).
[0099] Upon expression of sgRNAs and Casl2a, Casl2a is recruited to the target in the non-integrating plasmid by the sgRNAs, resulting in cleavage of the non-integrating plasmid. The cuts introduced by Casl2a disrupt the ability of plasmid to replicate and remain stable within the cell, ultimately leading to its removal from the modified cyanobacterial strain.
[0100] Selectable marker
[0101] Expression constructs and / or cassettes of the invention may comprise a gene encoding a selectable marker. A selectable marker useful with the invention is typically an antibiotic resistance gene. The antibiotic resistance gene useful with the invention may be a kanamycin resistance gene, a spectinomycin resistance gene, an ampicillin resistance gene, a chloramphenicol resistance gene, an erythromycin resistance gene, a gentamicin resistance gene, a neomycin resistance gene or a streptomycin resistance gene.
[0102] Alternatively, the selectable marker may be an auxotrophic selection marker that allow an auxotrophic organism to grow in minimal growth medium.
[0103] The gene encoding a selectable marker is typically operably linked to regulatory elements, such as a promoter in the 5 ’-end and a terminator in the 3 ’-end. Regulatory elements are commonly used in the art and appropriate regulatory elements useful with the invention are well understood for the person skilled in the art.
[0104] Neutral sites
[0105] The Cre recombinase expression cassette described herein may be integrated into a neutral site in the cyanobacterial genome. In such embodiments, it is advantageous that the gene encoding for the Cre recombinase is stably integrated into the cyanobacterial genome to achieve controlled and precise expression of Cre recombinase and to minimise any potential damage to genomic DNA. The inventors have identified that a neutral site in the cyanobacterial genome is particularly effective for integration of a gene encoding a Cre recombinase.
[0106] The lox-marker-lox cassette as described herein may be integrated into a neutral site in the cyanobacterial genome.
[0107] A neutral site useful with the invention is a genomic location where a modification causes no noticeable phenotypic change under high density growth. A neutral site useful with the invention may be identified by screening for genomic locations by analysing transcriptome sequencing (RNA-seq) data, followed by validation of the identified loci by insertion of a heterologous gene into said locus and identifying any phenotypic impact (e.g. under high density growth) due to expression of the heterologous gene, e.g. as described in Ng et. al., 2015 (Applied and Environmental Microbiology, 81(19):6857-6863) and Victoria et al., 2024. Appropriate genomic locations may or may not encode genes. For example, the genomic location may encode a redundant gene, such that modifications of the gene would cause no noticeable phenotypic change under high density growth.
[0108] Upon integration of a cassette described herein into a neutral site (e.g. anywhere within a locus as described herein), a portion of the genome may be modified, e.g. deleted, disrupted, or substituted. For example, in embodiments where the neutral site is at a locus that encodes a gene, the modification may comprise substitution, interruption, or partial or complete deletion of the gene. The modification may be in the open reading frame or regulatory elements of the gene. The modification would cause no noticeable phenotypic change to the modified cyanobacterial strain under high density growth.
[0109] A neutral site useful with the invention may be at the mrr locus (FEK30 09380), the aqul locus (FEK30 10065), desB locus (FEK 04840), glgAl locus (FEK 14880), or at a 185 intergenic region between 2 convergent predicted open reading frames encoding hypothetical proteins FEK30 11550 and FEK 11555. A cassette described herein may be integrated anywhere within any of these loci.
[0110] A neutral site useful with the invention may be at a locus encoding an endonuclease.
[0111] A neutral site useful with the invention may be at the mrr locus. The mrr locus encodes for a Type IV restriction endonuclease. As shown in the Examples, deletion of the sequences at the mrr locus resulted in no noticeable phenotypic change when the cyanobacterial strain is grown under high density. For example, a modified cyanobacterial strain (e.g. Synechococcus sp. PCC 11901) of the invention may comprise a cassette comprising a gene encoding a Cre recombinase integrated into the cyanobacterial genome at the mrr locus.
[0112] A neutral site useful with the invention may be at the aqul locus. The aqul locus encodes for a Type II site-specific deoxyribonuclease. As shown in the Examples, deletion of the sequences at the aqul locus resulted in no noticeable phenotypic change when the cyanobacterial strain is grown under high density. Furthermore, the Examples show that integration of a cassette comprising a gene encoding Cre recombinase into the aqul locus resulted in stable integration of the Cre recombinase gene into the cyanobacterial genome, and effective expression of functional Cre recombinase. For example, a modified cyanobacterial strain (e.g. PCC 11901) of the invention may comprise a cassette comprising a gene encoding a Cre recombinase integrated into the cyanobacterial genome at the aqul locus. Cyanobacteria
[0113] Any cyanobacterial strain is a suitable starting point for generating the modified cyanob acteri al strains described herein. Hence, a modified cyanobacterial strain of the invention may be derived from a cyanobacterial strain described herein.
[0114] In other words, a modified cyanobacterial strain of the invention may be a cyanobacterial strain described herein which has been modified to comprise genetic modifications.
[0115] The cyanobacterial strain useful with the invention or the modified cyanobacterial strain of the invention is typically a strain that can double in a period less than 3 hours, less than 2.5 hours or around 2 hours.
[0116] The cyanobacterial strain or the modified cyanobacterial strain may have an optimal growth condition under industrial carbon emission settings, such as light intensity mimicking outdoor natural sunlight, about 30 °C (such as from about 25 °C to about 30 °C) and about 5% CO2 (v / v) (such as from about 1% to about 10% CO2 (v / v)).
[0117] For example, the cyanobacterial strain or the modified cyanobacterial strain may be grown from about 25°C to about 50 °C. The cyanobacterial strain or the modified cyanobacterial strain may be capable of tolerating high temperatures, e.g. up to 35 °C, up to 40 °C, up to 43 °C, up to 45 °C, or up to 50°C.
[0118] The cyanobacterial strain or the modified cyanobacterial strain may be grown from about 0.04% CO2 (v / v) to up to 10% CO2 (v / v). The cyanobacterial strain or the modified cyanobacterial strain may be capable of tolerating high atmospheric carbon dioxide concentrations, e.g. up to 5% CO2 (v / v), 6% CO2 (v / v), 7% CO2 (v / v), 8% CO2 (v / v), 9% CO2 (v / v), or 10% CO2 (v / v).
[0119] The cyanobacterial strain or the modified cyanobacterial strain may be grown in artificial or natural light, e.g. ranging from 200 to 1500 micro Einsteins of solar irradiation. The cyanobacterial strain or the modified cyanobacterial strain may be capable of tolerating high light intensities, such as >700 pmol photons m'2s'2, >800 pmol photons m’2s'2, >900 pmol photons m'2s'2, or >1000 pmol photons m'2s'2.
[0120] The cyanobacterial strain or the modified cyanobacterial strain may be grown at 0 to about 3.5 % salinity. The cyanobacterial strain or the modified cyanobacterial strain may be capable of tolerating salinities over 1.5-fold, 2-fold, or 2.5-fold higher than sea water. The cyanobacterial strain or the modified cyanobacterial strain may have the capacity for sustained growth to high densities, e.g. up to 10 gL'2dry cell weight, up to 20 gL'2dry cell weight, up to 30 gL'2dry cell weight, or up to 40 gL'2dry cell weight.
[0121] The invention also provides a method of determining the optimal growth condition of a modified cyanobacterial strain of the invention, e.g. by testing a range of each growth condition described herein. The method may further comprise selecting a modified cyanobacterial strain of the invention that has a desired property, e.g. can double in a period less than 3 hours, or has the capacity for sustained growth to high densities, under the industrial carbon emission settings as describe herein.
[0122] For example, the cyanobacterial strain or the modified cyanobacterial strain may be Synechocystis sp. or Synechococcus sp. The cyanobacterial strain or the modified cyanobacterial strain may be a fresh water strain, such as Synechococcus elongatus UTEX 2973 (Yu et al., Sci Rep 2015 : 5(1) : 8132), Synechococcus elongatus PCC 11801 (Jaiswal et al., Sci Rep, 2018, 8(1): 16632), or Synechococcus elongatus PCC 11802 (Jaiswal et al., Sci Rep 2020, 10(1): 191). The cyanobacterial strain or the modified cyanobacterial strain may be a marine strain, such as PCC 7002 (Batterton and Van Baalen, Archiv Mikrobiol. 1971 :76(2): 151-165), o Synechococcus sp. PCC 11901 (Wlodarczyk et al., 2020, Commun Biol 3, 215).
[0123] The cyanobacterial strain is optionally not Synechococcus sp. PCC 7002. Hence, a modified cyanobacterial strain of the invention is optionally not derived from Synechococcus sp. PCC 7002.
[0124] The cyanobacterial strain is optionally not Synechocystis sp. PCC 6803. Hence, a modified cyanobacterial strain of the invention is optionally not derived from Synechocystis sp. PCC 6803.
[0125] The cyanobacterial strain may be Synechococcus sp. PCC 11901. Synechococcus sp. PCC 11901, also known as Picosynechococcus sp. PCC 11901, or PCC 11901, deposited at the Pasteur Cultures of Cyanobacteria (PCC) under 11901, having NCBI Taxonomy ID 2579791, and genome assembly ASM557713vl (22 May 2019). Its complete genome is set out in NCBI Reference Sequence: NZ CP040360.1. PCC 11901 is particularly useful with the invention because it is capable of doubling every ~2 hours, has the capacity for sustained growth to high densities, e.g. up to 30gL'2dry cell weight, and can tolerate high light intensities, such as >900 pmol photons m'2s'2, high temperatures, e.g. up to 43 °C, and salinities over 2-fold higher than sea water. Hence, a modified cyanob acteri al strain of the invention may be derived from Synechococcus sp. PCC 11901. In other words, a modified cyanobacterial strain of the invention may be a variant of Synechococcus sp. PCC 11901, which comprises genetic modifications, e.g. as described herein.
[0126] The cyanobacterial strain may be UTEX 3222 (Schubert et al., 2023, bioRxiv 2023.10.30.564770). Hence, a modified cyanobacterial strain of the invention may be derived from UTEX 3222. UTEX 3222 is particularly useful with the invention because it is thermotolerant and able to grow fast in a range of conditions.
[0127] For example, the cyanobacterial strain may be a variant of PCC 11901, such as UTEX 3154 (Mills et al., 2022, Biomolecules 12(7):872). UTEX 3154 has two point mutations 320 bp upstream of the start codon for the metE gene in 11901, conferring viability in the absence of vitamin B12 in the culture medium. Having reduced vitamin B12 auxotrophy is advantageous, and hence UTEX 3154 is particularly useful with the invention. Hence, a modified cyanobacterial strain of the invention may be derived from UTEX 3154.
[0128] The cyanobacterial strain or the modified cyanobacterial strain may comprise in its genome a gene encoding a 16S rRNA sequence having >95% (i.e. equal or greater than 95%), >96%, >97%, >98%, >99% or 100% sequence identity with the 16S rRNA sequence of a cyanobacterial strain described herein, such as Synechococcus sp. PCC 11901. For example, the 16S rRNA sequence of the cyanobacterial strain or the modified cyanobacterial strain may have >99.6%, >99.7%, >99.8%, >99.9% or 100% sequence identity with SEQ ID NO: 47. The 16S rRNA of the cyanobacterial strain or the modified cyanobacterial strain may differ from SEQ ID NO: 47 by <2 (i.e. equal to or less than 2), <3, <4, <5, <6 or <7 bases. In particular, the cyanobacterial strain or the modified cyanobacterial strain may comprise in its genome a gene encoding a 16S rRNA sequence having >99.6% sequence identity with SEQ ID NO: 47. The cyanobacterial strain or the modified cyanobacterial strain may comprise in its genome a gene encoding a 16S rRNA sequence having >99.8% sequence identity with SEQ ID NO: 47. The cyanobacterial strain or the modified cyanobacterial strain may comprise in its genome a gene encoding a 16S rRNA sequence that differs from SEQ ID NO: 47 by <3 bases. The 16S rRNA sequence of the cyanobacterial strain or the modified cyanobacterial strain may be identical to SEQ ID NO: 47.
[0129] The cyanobacterial strain or the modified cyanobacterial strain may comprise a genome having >90% (i.e. equal or greater than 90%), >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99%, >99.1%, >99.2%, >99.3%, >99.4%, >99.5%, >99.6%, >99.7%, >99.8%, >99.9% or 100% sequence identity with the genome sequence of a cyanobacterial strain described herein, such as Synechococcus sp. PCC 11901 having NCBI Reference Sequence: NZ CP040360.1. In particular, the cyanobacterial strain or the modified cyanobacterial strain may comprise a genome having >97 sequence identity with the genome sequence of a cyanobacterial strain described herein, such as Synechococcus sp. PCC 11901 having NCBI Reference Sequence: NZ_CP040360.1.
[0130] The cyanobacterial strain or the modified cyanobacterial strain may comprise >1 (i.e. one or more), >2, >3, >4, >5, >6, >7, >8 or >9 reference genes or variants thereof from a cyanobacterial strain described herein, such as PCC 11901. Each of the reference gene variant may have >98% (i.e. equal or greater than 98%), >99% or 100% sequence identity with the corresponding reference gene. The reference gene may be a housekeeping gene in a cyanobacterial strain described herein, such as PCC 11901, such as a gene encoding ppc (e.g. SEQ ID NO: 32), petB (e g. SEQ ID NO: 33), mpB (e g. SEQ ID NO: 34), rpoA (SEQ ID NO: 35), or secA (SEQ ID NO: 36). The reference gene may be a gene that confers a fast growth rate phenotype in a cyanobacterial strain described herein, such as PCC 11901, such as rpaA (e.g. SEQ ID NO: 37), atpA (e.g. SEQ ID NO: 38) or ppnK (e.g. SEQ ID NO: 39). For example, reference gene may be rpaA (e.g. having a DNA sequence as set out in SEQ ID NO: 48).
[0131] The cyanobacteria strain or the modified cyanobacterial strain may contain genetic modifications relative to a cyanobacterial strain described herein (e.g. Synechococcus sp. PCC 11901). The genetic modification may comprise deletions, insertions, inversions, repeats and substitutions in the genome of the bacteria. Hence, a modified cyanobacterial strain of the invention may be derived from any cyanobacterial strain described herein.
[0132] Using known methods in the art, variants may be generated to improve or alter the characteristics of the cyanobacterial strains or the modified cyanobacterial strain described herein. Such variants include deletions, insertions, inversions, repeats and substitutions in the genome of the bacteria selected according to general rules known in the art. For example, the variants may contain modified genes with codon optimisation, modified genes with increased or reduced expression levels and / or activities, deletion of native genes, or addition of heterologous genes. These modifications may allow for improved growth rates, improved carbon dioxide fixation, and / or improve production of carbon-rich compounds (such as aromatic amino acids). For example, modifications to modify the expression of a bacterial gene may include one or more mutations in the open reading frame of the gene, one or more mutations in the coding sequence of the gene, one or more mutations in the promoter that controls the gene. The modification may comprise increasing or decreasing the copy number of a gene.
[0133] Alternatively, the modifications optionally do not substantially alter the biological activity of the cyanobacterial strain or the modified cyanobacterial strain. For example, a protein variant may contain conservative amino acid changes which are least likely to perturb the structure and / or function of the polypeptide. For example, the cyanobacterial strain or the modified cyanobacterial strain may comprise a gene encoding a protein having one or more conservative amino acid changes to the wild-type sequence. Conservative amino acid changes generally involve substitution of one amino acid with another that is similar in structure and / or function (e.g. amino acids with side chains similar in size, charge and shape). Amino acid residues having similar side chains are known in the art. These include amino acids with basic side , chains (e.g. lysine, arginine, histidine), acidic side chains (e.g. aspartic acid, glutamic acid), uncharged polar side chains (e.g. glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g. alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), betabranched side chains (e.g. threonine, valine, isoleucine) and aromatic side chains (e.g. tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino acid residue within a protein can be replaced with other amino acid residues having similar side chains and the altered protein can be tested for retained function using the functional assays described herein. Modifications can be introduced by standard techniques known in the art, such as site-specific mutagenesis and PCR-mediated mutagenesis, provided that activity of the protein is retained. Composition and kits
[0134] The invention provides a composition comprising one or more of the modified cyanob acteri al strains described herein.
[0135] The invention also provides a kit comprising: (i) a modified cyanobacterial strain of the invention comprising a Cre recombinase cassette described herein integrated into a neutral site in the cyanobacterial genome, and (ii) an expression construct (e.g. plasmid) comprising a cassette comprising a lox-marker-lox as described herein.
[0136] The kit may further comprise a set of primers for introducing sequences upstream of the pair of lox sites. The set of primers may comprise the sequences as set out in SEQ ID NO: 24 and 25, respectively.
[0137] The kit may further comprise a set of primers for introducing sequences downstream of the pair of lox sites. The set of primers may comprise the sequences as set out in SEQ ID NO: 26 and 27, respectively.
[0138] Methods and Uses
[0139] The methods of the invention aim to remove one or more genes encoding selectable markers from a modified cyanobacterial strain using a Cre-lox recombination system approach. In particular, the methods aim to remove all genes encoding selectable markers from a modified cyanobacterial strain. Hence, a method of the invention may be a method of generating a modified cyanobacterial strain that does not comprise a gene encoding a selectable marker, such as an antibiotic resistance gene. The resulting modified cyanobacterial strain may have one or more genes encoding selectable markers removed. The resulting modified cyanobacterial strain optionally does not comprise any genes encoding selectable markers.
[0140] The methods of the invention comprise modifying a modified cyanobacterial strain comprising one or more genes encoding selectable markers, such as an antibiotic resistance gene as described herein, wherein each of the one or more genes is flanked by a pair of lox sites. Such a modified cyanobacterial strain is referred to herein as “a marked cyanobacterial strain”. A method of the invention may comprise introducing an expression construct (e.g. plasmid) or a cassette comprising a Cre recombinase expression cassette as described herein into a cyanobacterial strain.
[0141] Cre recombinase may be expressed from the cyanobacterial genome. In this embodiment, the expression construct (e.g. plasmid) or a cassette comprises a Cre recombinase expression cassette flanked by sequences homologous to the upstream and downstream, respectively, sequences of a neutral site of the cyanobacterial genome, as described herein. Upon introduction of the expression construct into the cyanobacterial strain, the Cre recombinase expression cassette is introduced into the cyanobacterial genome by homologous recombination at the neutral site.
[0142] Cre recombinase may be expressed from the cytoplasm of the modified cyanobacterial strain. In this embodiment, the expression construct is a non-integrating plasmid comprising a Cre recombinase expression cassette, as described herein. Upon introduction of the expression construct into the cyanobacterial strain, the non-integrating plasmid remains in the cytoplasm, without integration into the cyanobacterial genome.
[0143] A method of the invention may comprise introducing an expression construct (e.g. plasmid) comprising a lox-marker-lox cassette as described herein into a cyanobacterial strain. Upon introducing the expression construct into the cyanobacterial strain, the lox- marker-lox cassette may be integrated into the cyanobacterial genome at an integration site at a locus of interest by homologous recombination to generate a marked cyanobacterial strain.
[0144] A method of the invention may comprise introducing into a cyanobacterial strain: (i) an expression construct (e.g. plasmid) comprising a lox-marker-lox cassette and (ii) an expression construct (e.g. plasmid) comprising a Cre recombinase expression cassette. The method may comprise introducing the two expression constructs into the cyanobacterial strain simultaneously or sequentially. The method may comprise introducing the expression construct (e.g. plasmid) comprising a Cre recombinase expression cassette prior to introducing the expression construct (e.g. plasmid) comprising a lox-marker-lox cassette. The method may comprise introducing the expression construct (e.g. plasmid) comprising a lox-marker-lox cassette prior to introducing the expression construct (e.g. plasmid) comprising a Cre recombinase expression cassette. For example, the cyanobacterial strain into which the expression construct (e.g. plasmid) comprising a lox-marker-lox cassette as described herein is introduced may already comprise a gene encoding a Cre recombinase. In which case, expression of Cre recombinase would elicit excision of the lox-marker-lox cassette by Cre-lox recombination. For example, the cyanobacterial strain may be a modified cyanobacterial strain comprising a Cre recombinase expression cassette as described herein integrated into a neutral site in the cyanobacterial genome. Alternatively, the cyanobacterial strain may be a modified cyanobacterial strain comprising in its cytoplasm a non-integrating plasmid comprising Cre recombination cassette as described herein.
[0145] The cyanobacterial strain into which the expression construct (e.g. plasmid) comprising a lox-marker-lox cassette as described herein is introduced optionally does not comprise a gene encoding a Cre recombinase. In which case, the method of the invention may further comprise introducing an expression construct (e.g. plasmid) comprising a Cre recombinase expression cassette as described herein into the marked cyanobacterial strain, such that expression of Cre recombinase would elicit excision of the lox-marker-lox cassette by Cre-lox recombination.
[0146] In another example, the cyanobacterial strain into which the expression construct (e.g. plasmid) comprising a Cre recombinase cassette as described herein is introduced may already comprise a lox-marker-lox cassette as described herein in its genome. In which case, expression of Cre recombinase would elicit excision of the lox-marker-lox cassette by Cre-lox recombination.
[0147] The cyanobacterial strain into which the expression construct (e.g. plasmid) comprising a Cre recombinase cassette as described herein is introduced optionally does not comprise a lox-marker-lox cassette as described herein in its genome. In which case, the method may further comprise introducing an expression construct (e.g. plasmid) comprising a lox-marker-lox cassette as described herein into the cyanobacterial strain, such that the lox-marker-lox cassette is integrated into the cyanobacterial genome. Upon expression of Cre recombinase, the lox-marker-lox cassette would be excised by Cre-lox recombination.
[0148] The gene encoding a Cre recombinase may be operably linked to an inducible promoter for inducible expression of Cre recombinase, as described herein. The expression constructs described herein is delivered into the cyanobacterial strain by methods known in the art.
[0149] For cyanobacterial strains that are naturally competent, such as PCC 7002, PCC 11901 or PCC 6803, or strains derived therefrom), the expression construct may be introduced by natural transformation.
[0150] For cyanobacterial strains that are not naturally competent, the expression construct may be introduced by facilitated transformation methods, such as conjugation (e.g. for UTEX 2973 or PCC 7210, or strains derived therefrom) or electroporation (e.g. for PCC 7120, or strains derived therefrom). These methods are well known in the art, e.g. as shown in the Examples, and as reviewed in Gale et al., Journal of Visualized Experiments, 2019, no. 152, e60451 and Lea- Smith et al., J Vis Exp. 2016; (111): 54001.
[0151] In embodiments where a cassette is integrated into the cyanobacterial genome, the integration is typically a permanent, stable integration.
[0152] In embodiments where the expression construct is a non-integrating plasmid, the non-integrating plasmid remains in the cytoplasm of the cyanobacterial host, without integration into the cyanobacterial genome.
[0153] A method of the invention may further comprise isolating a modified cyanobacterial strain into which an expression construct (e.g. plasmid) has been introduced. This is typically achieved by selection based on expression of the selectable marker encoded by the expression construct. For example, in the embodiment where the selectable marker is a protein that confers resistance to an antibiotic, the method may comprise incubating cyanobacteria cells on agar plates containing the antibiotic and the surviving cyanobacteria cells are isolated. This step may be repeated to generate a uniform population of cyanobacteria cells.
[0154] A method of the invention may further comprise curing expression constructs (e.g. plasmids) from the modified cyanobacterial strain, resulting in subsequent elimination of the expression constructs (e.g. plasmids) from the host after several replication cycles. Methods of curing are well known in the art, including chemical treatments, physical treatments, or other treatments that interfere with plasmid replication or partitioning. For example, the method of the invention may further comprise curing an expression construct (e.g. plasmid) comprising genes encoding Casl2a and one or more sgRNAs capable of specifically binding to Casl2a as described herein.
[0155] A cyanobacterial strain described herein may be subjected to multiple rounds of genetic modifications using the methods described herein. Hence, the invention also provides the use of a modified cyanobacterial strain described herein for further genetic modifications. For example, some of the steps of the methods of the invention described herein may be repeated multiple times to generate a modified cyanobacterial strain having had multiple rounds of genetic modifications. For example, a method of the invention may further comprise making further modifications to the genome of the modified cyanobacterial strain, for example using further steps of Cre-lox recombination.
[0156] The methods of the invention may further comprise increasing the population of the resulting modified cyanobacterial strain by culturing under appropriate conditions as described herein. For example, a method of the invention may further comprise propagating the modified cyanobacterial strain, e.g. under appropriate conditions as described herein.
[0157] The invention also provides a modified cyanobacterial strain obtained or obtainable by a methods of the invention.
[0158] Embodiments of the invention
[0159] 1. A modified cyanobacterial strain comprising:
[0160] (i) a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites, wherein the cassette is integrated into the cyanobacterial genome; and
[0161] (ii) a cassette comprising a gene encoding a Cre recombinase capable of excising DNA in-between the lox sites, wherein the cassette is not integrated into an essential locus in the cyanobacterial genome.
[0162] 2. The modified cyanobacterial strain of embodiment 1, wherein the cassette comprising the gene encoding the Cre recombinase is integrated into a neutral site in the cyanobacterial genome, such as at the mrr locus or at the aqul locus.
[0163] 3. The modified cyanobacterial strain of embodiment 1, wherein the cassette comprising the gene encoding the Cre recombinase is in a non-integrating plasmid in the cytoplasm of the modified cyanobacterial strain, wherein the non-integrating plasmid further comprises a gene encoding trans-acting replication protein trfA and origin of replication oriV.
[0164] 4. The modified cyanobacterial strain of any one of the preceding embodiments, wherein the gene encoding the Cre recombinase is operably linked to a promoter.
[0165] 5. The modified cyanobacterial strain of any one of embodiment 4, wherein the promoter is a constitutive promoter.
[0166] 6. The modified cyanobacterial strain of embodiment 5, wherein the constitutive promoter is selected from any of the constitutive promoters listed in Table 2.
[0167] 7. The modified cyanobacterial strain of embodiment 5, wherein the constitutive promoter is pc560.
[0168] 8. The modified cyanobacterial strain of any one of embodiment 4, wherein the promoter is an inducible promoter.
[0169] 9. The modified cyanobacterial strain of embodiment 8, wherein the inducible promoter is a 2,4-diacetylphloroglucinol (DAPG)-inducible promoter PphiF, a L-rhamnose- inducible promoter PrhaBAD, or a promoter consisting of a theophylline-inducible riboswitch E* fused to a trc promoter (Ptrc), VtrcE*.
[0170] 10. The modified cyanobacterial strain of embodiment 8, wherein the inducible promoter is a 2,4-diacetylphloroglucinol (DAPG)-inducible promoter PphiF.
[0171] 11. The modified cyanobacterial strain of any one of the preceding embodiments, wherein the cassette comprising the gene encoding the Cre recombinase further comprises a selectable marker.
[0172] 12. The modified cyanobacterial strain of any one of the preceding embodiments, wherein the cassette comprising the gene encoding the Cre recombinase is flanked by a pair of lox sites.
[0173] 13. The modified cyanobacterial strain of embodiment 12, wherein the pair of lox sites is selected from any of the lox sites listed in Table 1.
[0174] 14. The modified cyanobacterial strain of embodiment 12 or 13, wherein the lox sites are the lox66 and lox71 sites as set out in SEQ ID NOs: 4 and 3, respectively.
[0175] 15. The modified cyanobacterial strain of any one of embodiments 1 to 14, wherein the modified cyanobacterial strain further comprises genes encoding Casl2a and one or more sgRNAs complementary to the gene encoding a Cre recombinase or to a gene associated with replication of the non-integrating plasmid.
[0176] 16. The modified cyanobacterial strain of any one of the preceding embodiments, wherein the cassette comprising the gene encoding the selectable marker flanked by a pair of lox sites is integrated in a locus encoding a target gene.
[0177] 17. The modified cyanobacterial strain of any one of the preceding embodiments, which is capable of doubling every approximately 2 hours.
[0178] 18. The modified cyanobacterial strain of any one of the preceding embodiments, which has the capacity for sustained growth to high densities, e.g. up to 30gL'2dry cell weight.
[0179] 19. The modified cyanobacterial strain of any one of the preceding embodiments, which can tolerate high light intensities, such as >900 pmol photons m'2s'2, high temperatures, e.g. up to 43 °C, and / or salinities over 2-fold higher than sea water.
[0180] 20. The modified cyanobacterial strain of any one of the preceding embodiments, which is derived from Synechococcus sp. PCC 11901, optionally wherein the modified cyanobacterial strain comprises a gene encoding a 16S rRNA having >99.6% sequence identity with SEQ ID NO: 47.
[0181] 21. The modified cyanobacterial strain of any one of the preceding embodiments, which is not derived from Synechococcus sp. PCC 7002 or Synechocystis sp. PCC 6803.
[0182] 22. A modified cyanobacterial strain comprising a cassette comprising a gene encoding a Cre recombinase integrated at a neutral site in the cyanobacterial genome.
[0183] 23. The modified cyanobacterial strain of embodiment 22, wherein the neutral site is at the mrr locus or at the aqul locus.
[0184] 24. A modified cyanobacterial strain comprising a non-integrating plasmid comprising a cassette comprising a gene encoding a Cre recombinase, a gene encoding trans-acting replication protein trfA and origin of replication oriV.
[0185] 25. The modified cyanobacterial strain of embodiment 24, wherein the modified cyanobacterial strain further comprises genes encoding Casl2a and one or more sgRNAs complementary to a gene associated with replication of the non-integrating plasmid. 26. The modified cyanobacterial strain of any one of embodiments 22 to 25, wherein the modified cyanobacterial strain further comprises in its genome a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites.
[0186] 27. The modified cyanobacterial strain of any one of embodiments 22 to 26, wherein the gene encoding the Cre recombinase is operably linked to a constitutive promoter in cyanobacteria.
[0187] 28. The modified cyanobacterial strain of embodiment 27, wherein the constitutive promoter is selected from any of the constitutive promoters listed in Table 2.
[0188] 29. The modified cyanobacterial strain of embodiment 28, wherein the constitutive promoter is pc560.
[0189] 30. The modified cyanobacterial strain of any one of embodiments 22 to 26, wherein the gene encoding the Cre recombinase is operably linked to an inducible promoter.
[0190] 31. The modified cyanobacterial strain of embodiment 30, wherein the inducible promoter is a 2,4-diacetylphloroglucinol (DAPG)-inducible promoter PphiF, a L-rhamnose- inducible promoter PrhaBAD, or a promoter consisting of theophylline-inducible riboswitch E* fused to a trc promoter (Ptrc), VtrcE*.
[0191] 32. The modified cyanobacterial strain of embodiment 31, wherein the inducible promoter is a 2,4-diacetylphloroglucinol (DAPG)-inducible promoter PphiF.
[0192] 33. The modified cyanobacterial strain of any one of embodiments 22 to 32, wherein the gene encoding the Cre recombinase is flanked by a pair of lox sites.
[0193] 34. The modified cyanobacterial strain of any one of embodiments 26 to 33, wherein the pair of lox sites is selected from any of the lox sites listed in Table 1, optionally wherein the lox sites are asymmetric lox sites, such as the lox66 and lox71 sites as set out in SEQ ID NOs: 4 and 3, respectively.
[0194] 35. The modified cyanobacterial strain of any one of embodiments 22 to 34, wherein the modified cyanobacterial strain further comprises genes encoding a Casl2a and one or more sgRNAs complementary to the gene encoding the Cre recombinase.
[0195] 36. The modified cyanobacterial strain of any one of embodiments 22 to 35, which is capable of doubling every approximately 2 hours.
[0196] 37. The modified cyanobacterial strain of any one of embodiments 22 to 36, which has the capacity for sustained growth to high densities, e.g. up to 30gL'2dry cell weight. 38. The modified cyanobacterial strain of any one of embodiments 22 to 37, which can tolerate high light intensities, such as >900 pmol photons m'2s'2, high temperatures, e.g. up to 43 °C, and / or salinities over 2-fold higher than sea water.
[0197] 39. The modified cyanobacterial strain of any one of embodiments 22 to 38, which is derived from Synechococcus sp. PCC 11901, optionally wherein the modified cyanobacterial strain comprises a gene encoding a 16S rRNA having >99.6% sequence identity with SEQ ID NO: 47.
[0198] 40. The modified cyanobacterial strain of any one of embodiments 22 to 39, which is not derived from Synechococcus sp. PCC 7002 or Synechocystis sp. PCC 6803.
[0199] 41. A modified cyanobacterial strain derived from Synechococcus sp. PCC 11901, wherein the modified cyanobacterial strain comprises one or more lox72 sites in the cyanobacterial genome, optionally wherein the modified cyanobacterial strain comprises a gene encoding a 16S rRNA having >99.6% sequence identity with SEQ ID NO: 47.
[0200] 42. The modified cyanobacterial strain of embodiment 41, wherein the lox72 site is present at a location proximal to a non-native sequence.
[0201] 43. The modified cyanobacterial strain of embodiment 41 or 42, wherein a further lox72 site is present at a neutral site in the cyanobacterial genome.
[0202] 44. The modified cyanobacterial strain of embodiment 43, wherein the neutral site is at the mrr locus or at the aqul locus.
[0203] 45. The modified cyanobacterial strain of any one of embodiments 41 to 44, which does not comprise a gene encoding a selectable marker, such as an antibiotic resistance gene.
[0204] 46. The modified cyanobacterial strain of any one of embodiments 41 to 45, which is capable of doubling every approximately 2 hours.
[0205] 47. The modified cyanobacterial strain of any one of embodiments 41 to 46, which has the capacity for sustained growth to high densities, e.g. up to 30gL'2dry cell weight.
[0206] 48. The modified cyanobacterial strain of any one of embodiments 41 to 47, which can tolerate high light intensities, such as >900 pmol photons m'2s'2, high temperatures, e.g. up to 43 °C, and / or salinities over 2-fold higher than sea water.
[0207] 49. A plasmid comprising a cassette comprising a gene encoding a Cre recombinase, and a selectable marker, wherein the cassette is flanked by sequences homologous to the upstream and downstream, respectively, sequences of a neutral site in the genome of a cyanob acteri al strain.
[0208] 50. The plasmid of embodiment 49, wherein the cyanobacterial strain is derived from Synechococcus sp. PCC 11901, optionally wherein the cyanobacterial strain comprises a gene encoding a 16S rRNA having >99.6% sequence identity with SEQ ID NO: 47.
[0209] 51. The plasmid of embodiment 49 or embodiment 50, wherein the neutral site is at the mrr locus.
[0210] 52. The plasmid of embodiment 51, wherein the upstream sequence comprises about 900 bp to about 1 kbp upstream of the integration site at the mrr locus, such as from position 1,717,785 to position 1,718,693 in the genome of Synechococcus sp. PCC 11901, and wherein the downstream sequence comprises about 900 bp to about 1 kb downstream of the integration site at the mrr locus, such as from position 1,719,565 to position of 1,720,504 in the genome of Synechococcus sp. PCC 11901.
[0211] 53. The plasmid of embodiment 49 or embodiment 50, wherein the neutral site is at the aqul locus.
[0212] 54. The plasmid of embodiment 53, wherein the upstream sequence comprises about 900 bp to about 1 kbp upstream of the integration site at the aqul locus, such as from position 1,867,951 to position 1,868,950 in the genome of Synechococcus sp. PCC 11901, and wherein the downstream sequence comprises about 900 bp to about 1 kbp downstream of the integration site at the aqul locus, such as from position 1,869,905 to position 1,870,904 in the genome of Synechococcus sp. PCC 11901.
[0213] 55. The plasmid of any one of embodiments 49 to 54, wherein the gene encoding the Cre recombinase is operably linked to a promoter.
[0214] 56. The plasmid of any one of embodiments 49 to 55, wherein the promoter is a constitutive promoter, optionally wherein the constitutive promoter is selected from any of the constitutive promoters listed in Table 2, and optionally wherein the constitutive promoter is pc560.
[0215] 57. The plasmid of embodiment 55, wherein the gene encoding the Cre recombinase is operably linked to an inducible promoter, optionally wherein the inducible promoter is a 2,4-diacetylphloroglucinol (DAPG)-inducible promoter PphiF, a L-rhamnose-inducible promoter PrhaBAD, or a promoter consisting of theophylline-inducible riboswitch E* fused to a trc promoter (Ptrc), PtrcE*, and optionally wherein the inducible promoter is a 2,4- diacetylphloroglucinol (DAPG)-inducible promoter PphiF.
[0216] 58. The plasmid of any one of embodiments 49 to 57, wherein the cassette is flanked by a pair of lox sites, optionally wherein the pair of lox sites is selected from any of the lox sites listed in Table 1, optionally wherein the lox sites are asymmetric lox sites, such as the lox66 and lox71 sites as set out in SEQ ID NOs: 4 and 3, respectively.
[0217] 59. The plasmid of any one of embodiments 49 to 58, wherein the cassette further comprises a Casl2a and a crRNA complementary to the gene encoding the Cre recombinase.
[0218] 60. A non-integrating plasmid comprising a cassette comprising a gene encoding a Cre recombinase and its regulatory elements, a selectable marker, a gene encoding trans-acting replication protein trfA and origin of replication oriV.
[0219] 61. The plasmid of embodiment 60, wherein the gene encoding the Cre recombinase is operably linked to a constitutive promoter in cyanobacteria.
[0220] 62. The plasmid of embodiment 61, wherein the constitutive promoter is selected from any of the constitutive promoters listed in Table 2, and optionally wherein the constitutive promoter is pc560.
[0221] 63. The plasmid of embodiment 60, wherein the gene encoding the Cre recombinase is operably linked to an inducible promoter.
[0222] 64. The plasmid of embodiment 63, wherein the inducible promoter is a 2,4- diacetylphloroglucinol (DAPG)-inducible promoter PphiF, a L-rhamnose-inducible promoter PrhaBAD, or a promoter consisting of theophylline-inducible riboswitch E* fused to a trc promoter (Ptrc), VtrcE*.
[0223] 65. The plasmid of embodiment 63, wherein the inducible promoter is a 2,4- diacetylphloroglucinol (DAPG)-inducible promoter PphiF.
[0224] 66. The plasmid of any one of embodiments 60 to 64, wherein the cassette further comprises a Casl2a and one or more sgRNAs complementary to a gene associated with replication of the plasmid, e.g. RepA.
[0225] 67. A kit comprising: the modified cyanobacterial strain of any one of embodiments 22 to 40; and a plasmid comprising a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites.
[0226] 68. The kit of embodiment 67, further comprising a set of primers for introducing sequences upstream of the pair of lox sites, and / or a set of primers for introducing sequences downstream of the pair of lox sites.
[0227] 69. The kit of embodiment 67 or 68, further comprising the plasmid of any one of embodiments 49 to 66.
[0228] 70. A method of generating a modified cyanobacterial strain, comprising:
[0229] (i) introducing into a cyanobacterial strain the plasmid of any one of embodiments 49 to 59 or embodiments 60 to 66; and
[0230] (ii) introducing into the cyanobacterial strain a plasmid comprising a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites, wherein the cassette is flanked by sequences homologous to the upstream and downstream, respectively, sequences of an integration site in the cyanobacterial genome, such that the cassette is integrated into the cyanobacterial genome at the integration site by homologous recombination; wherein expression of the Cre recombinase elicits excision of the selectable marker cassette by Cre-lox recombination.
[0231] 71. The method of embodiment 70, wherein step (i) is carried out before step (ii).
[0232] 72. The method of embodiment 70, wherein step (ii) is carried out before step (i).
[0233] 73. The method of any one of embodiments 70 to 72, wherein the method is a method of generating a modified cyanobacterial strain that does not comprise a gene encoding a selectable marker, such as an antibiotic resistance gene.
[0234] 74. A method of generating a modified cyanobacterial strain, comprising introducing the plasmid of any one of embodiments 49 to 59 or embodiments 60 to 66 into a cyanobacterial strain, wherein the cyanobacterial strain comprises in its genome a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites, such as the lox66 and lox71 sites as set out in SEQ ID NOs: 4 and 3, respectively.
[0235] 75. A method of generating a modified cyanobacterial strain, comprising introducing into the modified cyanobacterial strain of any one of embodiments 22 to 40 an expression construct comprising a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites, wherein the cassette is flanked by sequences homologous to the upstream and downstream, respectively, sequences of an integration site in the cyanob acteri al genome, such that the cassette is integrated into the cyanobacterial genome at the integration site by homologous recombination.
[0236] 76. The method of any one of embodiments 70 to 75, wherein the modified cyanobacterial strain is capable of doubling every approximately 2 hours.
[0237] 77. The method of any one of embodiments 70 to 76, wherein the modified cyanobacterial strain has the capacity for sustained growth to high densities, e.g. up to 30gL'2dry cell weight.
[0238] 78. The method of any one of embodiments 70 to 77, wherein the modified cyanobacterial strain can tolerate high light intensities, such as >900 pmol photons m'2s'2, high temperatures, e.g. up to 43 °C, and / or salinities over 2-fold higher than sea water.
[0239] 79. The method of any one of embodiments 70 to 78, wherein the modified cyanobacterial strain is derived from Synechococcus sp. PCC 11901, optionally wherein the modified cyanobacterial strain comprises a gene encoding a 16S rRNA having >99.6% sequence identity with SEQ ID NO: 47.
[0240] 80. The method of any one of embodiments 70 to 79, wherein the modified cyanobacterial strain is not derived from Synechococcus sp. PCC 7002 or Synechocystis sp. PCC 6803.
[0241] 81. The method of any one of embodiments 70 to 80, wherein the method further comprises making further modifications to the genome of the modified cyanobacterial strain, for example using further steps of Cre-lox recombination.
[0242] 82 The method of any one of embodiments 70 to 81, wherein the method further comprises propagating the modified cyanobacterial strain.
[0243] 82. A modified cyanobacterial strain obtained or obtainable by the method of any one of embodiments 70 to 82. Other
[0244] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by a person skilled in the art to which this invention belongs.
[0245] It is to be understood that different applications of the modified cyanobacterial strains described herein may be tailored to the specific needs in the art. It is also to be understood that the terminology used herein is for the purpose of describing the particular embodiments of the invention only, and is not intended to be limiting.
[0246] In general, the term “comprising ' is intended to mean including but not limited to. For example, the phrase “an amino acid sequence comprising SEQ ID NO: X” should be interpreted to mean that the amino acid sequence comprises SEQ ID NO: X, but the amino acid sequence may comprise further sequences.
[0247] In some embodiments of the invention, the word “ comprising" may be replaced with the phrase “consisting of . The term “consisting of is intended to be limiting. For example, the phrase “an amino acid sequence consisting of SEQ ID NO: X” should be understood to mean that the amino acid sequence has SEQ ID NO: X and no further sequences.
[0248] In some embodiments of the invention, the word “comprising may be replaced with the phrase “consisting essentially o . The term “consisting essentially of means that specific further components can be present, namely those not materially affecting the essential characteristics of the subject matter.
[0249] The term “about" or “around" when referring to a value refers to that value but within a reasonable degree of scientific error. Optionally, a value is “about x" or “around x" if it is within 10%, within 5%, or within 1% of x.
[0250] In addition, as used in this specification and the appended claims, the singular forms “a", “an", and “the" include plural references unless the content clearly dictates otherwise. Thus, for example, reference to “a modified cyanobacterial strain" includes two or more modified cyanobacterial strains.
[0251] Furthermore, when referring to “>x" herein, this means equal to or greater than x. When referring to “<y" herein, this means equal to or less than y. For the purpose of this invention, in order to determine the percent identity of two sequences (such as two polynucleotide or two polypeptide sequences), the sequences are aligned for optimal comparison purposes (e.g. gaps can be introduced in a first sequence for optimal alignment with a second sequence). The nucleotides at each position are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the nucleotides are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (z.e., % identity = number of identical positions / total number of positions in the reference sequence x 100).
[0252] Typically the sequence comparison is carried out over the length of the reference sequence. For example, if the user wished to determine whether a given (“test”) sequence is 95% identical to SEQ ID NO: 2, SEQ ID NO: 2 would be the reference sequence. To assess whether a sequence is at least 95% identical to SEQ ID NO: 2 (an example of a reference sequence), the skilled person would carry out an alignment over the length of SEQ ID NO: 2, and identify how many positions in the test sequence were identical to those of SEQ ID NO: 2. If at least 95% of the positions are identical, the test sequence is at least 95% identical to SEQ ID NO: 2. If the sequence is shorter than SEQ ID NO: 2, the gaps or missing positions should be considered to be non-identical positions.
[0253] The skilled person is aware of different computer programs that are available to align two sequences. For instance, a comparison of sequences can be accomplished using a mathematical algorithm. In an embodiment, the alignment is performed using the Needleman and Wunsch (1970) algorithm which has been incorporated into the GAP program in the Accelrys GCG software package (available at http: / / www.accelrys.com / products / gcg / ), using either a Blosum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. In another embodiment, the percent identity between two amino acid or nucleic acid sequences is determined by the Smith-Waterman homology search algorithm as implemented in the MPSRCH program (Oxford Molecular), using an affine gap search with parameters gap open penalty = 12 and gap extension penalty = 2.
[0254] All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety. The following examples illustrate the invention.
[0255] The aim of these Examples is to develop a reliable method for generating markerless modified cyanobacterial strains in using the Cre-lox system.
[0256] This Example aims to identify a method to achieve stable genomic integration of a gene encoding Cre recombinase into a modified Synechococcus sp. PCC 11901 strain which has been genetically modified to comprise a selectable marker flanked by lox sites (also referred to herein as “marked cyanobacterial strains”).
[0257] 1 : Creation of marked PCC 11901 mutant strains
[0258] A plasmid for the purpose of inserting a heterologous sequence into a first integration site in the cyanobacterial genome was generated. In more detail, level 0 plasmids for lox71 (pICH41276) and lox66 (pICH41295) were generated. Lox71 has the sequence as set out in SEQ ID NO: 3 (5’- ATAACTTCGTATAATGTATGCTATACGAACGGTA-3’). Lox66 has the sequence as set out in SEQ ID NO: 4 (5’-TACCGTTCGTATAATGTATGCTATACGAAGTTAT-3’). A Level 1 plasmid was then constructed using Golden Gate assembly (Gale et al., 2019) to assemble the lox sites on either side of the kanamycin resistance cassette.
[0259] The sequences of the regions upstream and downstream of the cyanobacterial integration site, mrr, were then cloned into the Level 2 (Level T) acceptor Plasmid (Level T Part name: pCAT.015, pUC19A-T, modified pUC19 vector, Yanisch -Perron et. al. 1985), flanking the lox sites and kanamycin resistance cassette.
[0260] PCC 11901 cells were transformed with the resulting plasmid. Following incubation on agar plates containing kanamycin, colonies in which a recombination event occurs between the 5' and 3' flanking regions and the homologous sequence in the chromosome are isolated. Following segregation by repeated streaking marked cyanobacterial strains (mrr KO) were generated (Figure 8; lanes 2 and 3). Figure 2 shows the insertion of the cassette comprising the kanamycin resistance gene flanked by lox sites into the mrr gene of mrr KO transformants. The mrr gene locus for wildtype cyanobacteria is also shown for reference.
[0261] Step 2: Integration of a Cre recombinase gene into the genome of mrr KO mutants
[0262] Plasmids for the purpose of integrating a gene encoding Cre recombinase into a second integration site in the cyanobacterial genome were generated. The integration sites tested were: the essential gene loci: rbcLXS and psbEFLJ, and a neutral site at the aqul locus.
[0263] Each plasmid contains a cassette comprising the Cre recombinase gene and a spectinomycin resistance cassette. The Cre recombinase gene was placed under the control of a constitutive promoter, pc560 promoter, which was known for its strong constitutive expression in cyanobacteria (Zhou et al., 2014).
[0264] The sequences of the regions upstream and downstream of the aqul integration site, were then cloned into the plasmid, flanking the Cre recombinase gene and spectinomycin resistance cassette. Figure 3 shows insertion of the cassette comprising the pc560 promotor, the Cre recombinase gene, and the spectinomycin resistance gene into the aqul gene to generate aqul knockout (aqul KO) transformants. The aqul gene locus for wildtype cyanobacteria is also shown for reference.
[0265] The forward and reverse primers, SEQ ID Nos: 24 and 25 respectively, were also used to introduce sequences upstream of the upstream lox site. The forward and reverse primers, SEQ ID Nos: 26 and 27 respectively, were used to introduce sequences downstream of the downstream lox site.
[0266] The marked mrr KO mutants were transformed with the plasmid. Transformations were conducted using natural transformation techniques, followed by selection on AD7 / MAD agar plates containing spectinomycin (20 pg / mL). Upon uptake of the plasmid, a second homologous recombination event would occur between the 5' and 3' flanking the integration site and the homologous regions in the genome.
[0267] Cells were incubated on agar plates containing spectinomycin with the surviving mutants expressing Cre recombinase which excises the DNA region between the Lox66 and Lox71 sites. This step therefore removed the kanamycin resistance cassette from the cyanob acteri al genome.
[0268] Successful integration of the Cre recombinase cassette and successful excision of the kanamycin resistance cassette were confirmed through PCR and sequencing as discussed below.
[0269] Results
[0270] When the integration sites were essential gene loci (rbcLXS and psbEFLJ), no spectinomycin-resistant colonies were obtained, indicating essential loci incompatibility (results not shown). These results were consistent with those in Victoria et al.
[0271] Interestingly, when the integration site was the neutral site at the aqul locus, the gene encoding Cre recombinase was successfully integrated into the cyanobacterial genome, as confirmed by sequencing (Figure 12). Furthermore, successful deletion of the kanamycin resistance cassette between lox sites was confirmed by sequencing (Figure 10) and PCR (Figure 11, lanes 1 and 3)
[0272] Conclusion
[0273] This Example demonstrates a novel and effective method for generating markerless mutants in Synechococcus sp. PCC 11901 using the Cre-lox recombination system. In particular, this Example shows that neutral site integration of the Cre expression cassette using the pc560 promoter is effective for generating markerless mutants in Synechococcus sp. PCC 11901.
[0274] Example 2
[0275] This Example relates to methods of removing the Cre-recombinase cassette once it has been introduced into a neutral site (e.g. at the aqul locus) of the cyanobacterial genome as described in Example 1.
[0276] In one method, the plasmid containing the Cre recombinase cassette for integration into a neutral site (e.g. at the aqul locus) as described in Example 1 further comprises lox sites flanking the Cre recombinase cassette (comprising the Cre recombinase gene and the spectinomycin resistance cassette), such that the Cre recombinase cassette flanked by lox sites can be integrated into the neutral site in a cyanobacteria. Furthermore, the Cre recombinase gene is placed under the control of an inducible promoter, 2,4- diacetylphloroglucinol (DAPG)-inducible PhlF repressor system, which allows for regulated expression. Upon transformation of this plasmid into the mrr KO mutant from Example 1, the Cre recombinase cassette flanked by lox sites is successfully integrated into the cyanobacterial genome at a neutral site, such as the aqul locus. When Cre recombinase expression is induced by the addition of DAPG, the kanamycin resistance cassette between the lox sites and the Cre recombinase cassette between the lox sites are both excised by Cre-lox recombination. This results in the generation of markerless PCC 11901 mutants in which both the kanamycin resistance cassette and the Cre recombinase cassette have been removed from the cyanobacterial genome.
[0277] In a further method, the CRISPR-Casl2a system is used to excise the Cre recombinase cassette. This method uses a non-integrating plasmid that comprises genes encoding Cast 2a and one or more single guide RNAs (sgRNAs) designed to be complementary to a region within the gene encoding Cre recombinase. Upon transformation of the non-integrating plasmid comprising genes encoding Casl2a and one or more sgRNAs into the mrr KO mutants in which the kanamycin resistance cassette has been excised from Example 1, the resulting cyanobacterial strain expresses Casl2a and the sgRNAs from the non-integrating plasmid. Expression of Cast 2a and the sgRNAs results in recruitment of Cast 2a to the Cre recombinase gene and cleavage of the Cre recombinase gene, rendering it non-functional and / or excision from the cyanobacterial genome. This results in the generation of markerless PCC 11901 mutants in which both the kanamycin resistance cassette and the Cre recombinase cassette have been removed from the cyanobacterial genome.
[0278] Example 3
[0279] This Example relates to a further method of generating markerless PCC 11901 strains (see Figure 4).
[0280] In this method, a mrr KO mutant is generated in the same way as in Example 1. A non-integrating plasmid expressing genes encoding a Cre recombinase and spectinomycin resistance protein is introduced into the marked mutant. The non-integrating plasmid contains trans-acting replication protein (trfA) (SEQ ID NO: 28) and the origin of replication (oriV) (SEQ ID NO: 29) (Figure 5). The Cre recombinase gene is placed under the control of the constitutive promoter, pc560. Upon transformation of this plasmid into the mrr KO mutant from Example 1, Cre recombinase is constitutively expressed. This initiates Cre-lox recombination, which causes the kanamycin resistance cassette between the lox sites to be excised from the cyanobacterial genome. The Cre-containing plasmid is then cured from the cyanobacteria. This results in the generation of markerless PCC 11901 mutants in which the kanamycin resistance cassette has been removed from the cyanobacterial genome, and the non-integrating plasmid containing the Cre recombinase gene and the spectinomycin resistance cassette has been removed from the cyanobacteria.
[0281] Example 4
[0282] This Example relates to a further method of generating markerless PCC 11901 strains (see Figure 6). This method is similar to the method described in Example 3, except that the non-integrating plasmid containing the Cre recombinase gene and the spectinomycin resistance cassette further expresses the CRISPR-Casl2a system to degrade the non-integrating plasmid. In particular, the non-integrating plasmid encodes a single guide RNA (sgRNA) designed to be complementary to replication origin A (Rep A). The plasmid may further comprise additional regulatory components to facilitate plasmid replication (Figure 7). Furthermore, the Cre recombinase gene is placed under the control of an inducible promoter, 2,4-diacetylphloroglucinol (DAPG)-inducible Ph IF repressor system, which allows for regulated expression.
[0283] A mrr KO mutant is generated in the same way as in Example 1. Following transformation of the non-integrating plasmid into the mrr KO mutant, the addition of DAPG induces Cre recombinase expression, which causes excision of the kanamycin resistance cassette at the mrr locus from the cyanobacterial genome. Upon expression of the sgRNA and Cast 2a, the sgRNA targets Cast 2a to Rep A in the non-integrating plasmid, where Casl2a cleaves the plasmid. This results in the generation of markerless PCC 11901 mutants in which the kanamycin resistance cassette has been removed from the cyanobacterial genome, and the non-integrating plasmid is no longer present in the cyanobacterial strain. References
[0284] Batterton and Van Baalen, Archiv Mikrobiol. (1971), 76(2), 151-165.
[0285] Chen et al. (2013), Nat. Methods, 10, 659-664.
[0286] Eroshenko et al. (2013), Nat Commun, 4, 2509.
[0287] Gale et al. (2019), J Vis Exp, 152, e60451.
[0288] Jaiswal et al. (2020), Sci Rep, 10(1), 191.
[0289] Jaiswal et al. (2018), Sci Rep, 8(1), 16632.
[0290] Jones et al. (2021), ACS Synth Biol, 10(9), 2371-82.
[0291] Kojima et al. (2016), Appl. Microbiol. Biotechnol, 100, 10107-10113.
[0292] Lambert et al. (2007), Applied and Environmental Microbiology, 73(4), 1126-1135.
[0293] Lindberg et al. (2010), Metabolic Engineering, 12(1).
[0294] Liu and Pakrasi. (2018), Microb Cell Fact, 17, 48.
[0295] Lea-Smith et al. (2016), J Vis Exp, (111), 54001.
[0296] Lea-Smith et al. (2016), JoVE, 1-11.
[0297] Lea-Smith et al. (2014), Plant Physiology, 165(2), 705-14.
[0298] Markley et al. (2014), ACS Synthetic Biology, 4(5), 595-603.
[0299] Markley et al. (2015), ACS Synth. Biol, 4, 595-603.
[0300] Mills et al. (2022), Biomolecules, 12(7), 872.
[0301] Ng et. al. (2015), Applied and Environmental Microbiology, 81(19), 6857-6863.
[0302] Schubert et al. (2023), bioRxiv 2023, 10(30), 564770.
[0303] Victoria et al. (2004), Plant Physiology, 00, 1-17.
[0304] Victoria et al. (2024), Plant Physiology. 2024. kiae261, 10, 1093.
[0305] Wang et al. (2018), ACS Synth Biol, 7, 276-286.
[0306] Wlodarczyk et al. (2020), Commun Biol, 3, 215.
[0307] Yanisch-Perron et al. (1985), Gene, 33(1), 103-19.
[0308] Yu et al. (2015), Sci Rep, 5(1), 8132.
[0309] Zhou et al. (2014), Sci Rep, 4, 4500. Sequence listing
[0310]
[0311]
Claims
Claims1. A modified cyanobacterial strain comprising:(i) a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites, wherein the cassette is integrated into the cyanobacterial genome; and(ii) a cassette comprising a gene encoding a Cre recombinase capable of excising DNA in-between the lox sites, wherein the cassette is integrated into a neutral site in the cyanobacterial genome.
2. A modified cyanobacterial strain comprising a cassette comprising a gene encoding a Cre recombinase integrated at a neutral site in the cyanobacterial genome.
3. The modified cyanobacterial strain of claim 2, wherein the modified cyanobacterial strain further comprises in its genome a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites.
4. The modified cyanobacterial strain of any one of claims 1 to 3, wherein the neutral site is at the mrr locus or at the aqul locus.
5. The modified cyanobacterial strain of any one of claims 1 to 4, wherein the gene encoding the Cre recombinase is operably linked to a constitutive promoter, such as pc560.
6. The modified cyanobacterial strain of any one of claims 1 to 4, wherein the gene encoding the Cre recombinase is operably linked to an inducible promoter, such as a 2,4- diacetylphloroglucinol (DAPG)-inducible promoter PphiF.
7. The modified cyanobacterial strain of any one of the preceding claims, wherein the cassette comprising the gene encoding the Cre recombinase is flanked by a pair of lox sites.
598. The modified cyanobacterial strain of any one of the preceding claims, wherein the pair of lox sites are the lox66 and lox71 sites, as set out in SEQ ID NOs: 4 and 3, respectively.
9. The modified cyanobacterial strain of any one of the preceding claims, which:(a) is capable of doubling every approximately 2 hours;(b) has the capacity for sustained growth to high densities, e.g. up to 30gL'2dry cell weight; and / or(c) can tolerate high light intensities, such as >900 pmol photons m'2s'2, high temperatures, e.g. up to 43 °C, and / or salinities over 2-fold higher than sea water.
10. The modified cyanobacterial strain of any one of the preceding claims, which is derived from Synechococcus sp. PCC 11901.
11. The modified cyanobacterial strain of any one of the preceding claims, which is not derived from Synechococcus sp. PCC 7002 or Synechocystis sp. PCC 6803.
12. A modified cyanobacterial strain derived from Synechococcus sp. PCC 11901, wherein the modified cyanobacterial strain comprises one or more lox72 sites in the cyanobacterial genome.
13. The modified cyanobacterial strain of claim 12, wherein the modified cyanobacterial strain does not comprise a gene encoding a selectable marker, such as an antibiotic resistance gene.
14. A plasmid comprising a cassette comprising a gene encoding a Cre recombinase, wherein the cassette is flanked by sequences homologous to the upstream and downstream, respectively, sequences of a neutral site in the genome of a cyanobacterial strain, optionally wherein the neutral site is at the mrr locus or at the aqul locus.
15. The plasmid of claim 14, wherein the cyanobacterial strain is derived from Synechococcus sp. PCC 11901.
16. The plasmid of claim 14 or claim 15, wherein the gene encoding the Cre recombinase is operably linked to a constitutive promoter, such as pc560.
17. The plasmid of claim 14 or claim 15, wherein the gene encoding the Cre recombinase is operably linked to an inducible promoter, such as a 2,4- diacetylphloroglucinol (DAPG)-inducible promoter PphiF.
18. The plasmid of any one of claims 14 to 17, wherein the cassette comprising the gene encoding the Cre recombinase is flanked by a pair of lox sites, such as the lox66 and lox71 sites as set out in SEQ ID NOs: 4 and 3, respectively.
19. A kit compri sing : the modified cyanobacterial strain of any one of claims 1 to 11; and a plasmid comprising a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites, such as the lox66 and lox71 sites as set out in SEQ ID NOs: 4 and 3, respectively.
20. A method of generating a modified cyanobacterial strain, comprising:(i) introducing into a cyanobacterial strain the plasmid of any one of claims 14 to 18; and(ii) introducing into the cyanobacterial strain a plasmid comprising a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites, wherein the cassette is flanked by sequences homologous to the upstream and downstream, respectively, sequences of an integration site in the cyanobacterial genome, such that the cassette is integrated into the cyanobacterial genome at the integration site by homologous recombination; wherein expression of Cre recombinase elicits excision of the selectable marker cassette by Cre-lox recombination.
21. The method of claim 20, wherein step (i) is carried out before step (ii), or wherein step (ii) is carried out before step (i).
22. A method of generating a modified cyanobacterial strain, comprising introducing the plasmid of any one of claims 14 to 19 into a cyanobacterial strain, wherein the cyanobacterial strain comprises in its genome a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites, such as the lox66 and lox71 sites as set out in SEQ ID NOs: 4 and 3, respectively.
23. A method of generating a modified cyanobacterial strain, comprising introducing into the cyanobacterial strain of any one of claims 2 to 11 a plasmid comprising a cassette comprising a gene encoding a selectable marker flanked by a pair of lox sites, wherein the cassette is flanked by sequences homologous to the upstream and downstream, respectively, sequences of an integration site in the cyanobacterial genome, such that the cassette is integrated into the cyanobacterial genome at the integration site by homologous recombination.
24. The method of any one of claims 20 to 23, wherein the modified cyanobacterial strain:(a) is capable of doubling every approximately 2 hours;(b) has the capacity for sustained growth to high densities, e.g. up to 30gL'2dry cell weight;(c) can tolerate high light intensities, such as >900 pmol photons m'2s'2, high temperatures, e.g. up to 43 °C, and / or salinities over 2-fold higher than sea water.(d) is derived from Synechococcus sp. PCC 11901; and / or(e) is not derived from Synechococcus sp. PCC 7002 or Synechocystis sp. PCC 6803.
25. A modified cyanobacterial strain obtained or obtainable by the method of any one of claims 20 to 24.