Reagents and methods for isothermal amplification of nucleic acids in saliva samples

Abstract

The technology described herein is directed to reagent combinations for isothermal amplification of nucleic acids in saliva samples. Also described are kits, systems, and methods using such reagent combinations.

Description

Attorney Docket No: 700355-088492WOPTREAGENTS AND METHODS FOR ISOTHERMAL AMPLIFICATION OF NUCLEIC ACIDS IN SALIVA SAMPLESCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit under 35 U.S.C. § 1 19(e) of U.S. Provisional Application No. 63 / 723,928 filed November 22, 2024, the contents of which are incorporated herein by reference in their entirety'.GOVERNMENT SUPPORT

[0002] This invention was made with government support under Grant Nos. U54EB027690 and U54EB015408 awarded by the National Institutes of Health. The government has certain rights in the invention.SEQUENCE LISTING

[0003] The instant application contains a Sequence Listing which has been submitted in XML format via Patent Center and is hereby incorporated by reference in its entirety. Said XML copy, created on November 13, 2025, is named 700355-088492WOPT_SL.xml and is 14,810 bytes in size.TECHNICAL FIELD

[0004] The technology described herein relates to reagents and assays for isothermal amplification of nucleic acids in saliva samples.BACKGROUND

[0005] In early 2020, nasopharyngeal swab collection followed by analysis using reverse transcriptase polymerase chain reaction (RT-PCR) was the gold standard method to diagnose severe acute respiratory' syndrome coronavirus 2 (SARS-CoV-2) infections. However, the resources needed to conduct these tests (e.g., sample collection swabs, consumables, personal protective equipment) were quickly depleted and clinical laboratories were drastically overburdened by' the testing demand, which consequently' caused critical, and even deadly, delays in communicating test outcomes to patients. To alleviate those challenges, many initiatives were launched to develop, improve, and implement new technologies for sample collection, sample processing, and test modality. Alternatives to nasopharyngeal swabs have several advantages over the standard of care such as (i) providing viable options whenAttorney Docket No: 700355-088492WOPT resources were limited or unavailable, (ii) improving testing comfort, especially for younger patients, by minimizing invasiveness, and (iii) introducing options for more accessible and decentralized sampling (i.e., self-collection) and testing (i.e., point-of-care (POC) tests). Some pivotal changes resulting from these efforts were the investigation and clinical evaluation of anterior nasal fluid and saliva as alternative sample matrices for diagnostics; see e.g., Hanson et al. J. Clin. Microbiol. 2020. 58, 11, e01824-20.

[0006] When considering the development of solutions for POC testing, which can include mobile clinics and other Clinical Laboratory Improvement Amendments (CLIA)- waived healthcare environments, simplicity and usability are often prioritized. For these reasons, saliva, which can be (i) sampled in modest volumes, (ii) non-invasively collected from passive drool, and (iii) shown to be a viable sample for detecting SARS-CoV-2, fell short of widespread adoption because of test complexity owing requiring sample processing (e.g., lysis, extraction) prior to analysis. Furthermore, the first demonstrations of the clinical uti 1 i ty of saliva used RT-qPCR, which can be highly demanding of testing laboratories because it additionally requires trained technicians and specialized instrumentation. In parallel to efforts to improve sampling, assays developed using isothermal-based nucleic acid amplification techniques (e.g., LAMP, RPA, NASBA) also gained significant traction throughout the Coronavirus Disease of 2019 (COVID-19) pandemic because of their (i) PCR- like specificity, (ii) rapid amplification times, and (iii) use of simpler and more ubiquitous equipment (e.g., heat blocks). Notably, loop-mediated isothermal amplification (LAMP) has shown an additional benefit by being more tolerant to matrix interferences than PCR when used directly with biological matrices (e.g., serum, plasma, urine), making LAMP particularly promising for assay development with saliva. However, in contrast to the successful commercial launch of RT-LAMP assays using anterior nasal swabs, there have been few demonstrations of RT-LAMP diagnostic tests with saliva samples because many components of saliva (e.g., proteins, mucins, and RNases) inhibit amplification. See e.g., Landry et al. J. Clin. Virol. 2020. 130, 104567; Teo et al. Sci. Rep. 2021. 11, 3134; Malci et al. ACS Synth. Biol. 2022. 11. 4, 1555-1567; Sun et al. J. Transl. Med. 2021. 19, 74; Ju et al. Biosens. Bioelectron. 2022. 196. 1 13689; Wu et al. Sci. Adv. 2021. 7, eabe5054; Kaneko et al. J. Biochem. Biophys. Methods. 2007. 70, 3, 499-501; Jiang et al. Anal. Chem. 2015. 87, 3314-3320.

[0007] Processing the saliva prior to amplification (e.g., using extraction or purification kits) can reduce or eliminate the impact of amplification inhibitors at the consequence ofAttorney Docket No: 700355-088492WOPT losing simplicity as these methods tend to be laborious and require support equipment (e.g., centrifuge) in addition to a heat block for heat-inactivation of RNases. Extraction-free approaches to inactivate matrix inhibitors can achieve suitable detection limits through a combination of physical (e.g., dilution, centrifugation), chemical (e.g., Proteinase K, Chelex- 100), or thermal (e.g., heat-inactivation) steps. For example, one extraction-free RT-LAMP test used a saliva preparation process that included (i) the addition of a lysis buffer and guanidine hydrochlonde, (ii) vortexing, and (iii) thermal incubation at 95 °C as individual steps prior to adding the sample to the amplification reaction. See e g., Azzi et al. J. Infect. 2020. 81, 1, e45-e50; Nagura-Ikeda et al. J. Clin. Microbiol. 2020. 58, 9, e01438-20; Lai et al. Trop Med Health. 2022. 50, 1, 2; Ranoa et al., “Saliva-Based Molecular Testing for SARS-CoV-2 that Bypasses RNA Extraction." BioRxiv. 2020; DeFina et al. Sci. Rep. 2022. 12, 5729. While this approach resulted in a successful assay, to support the broader adoption of saliva as a diagnostic sample matrix for upper respiratory' infections like COVID- 19, it is highly desirable to couple the simplicity of isothermal approaches with sample preparation protocols that also minimize user input.SUMMARY

[0008] Results of efforts to diagnose infections with SARS-CoV-2 using a sampling method that was less invasive than the nasopharyngeal swab led to the rapid adoption of anterior nasal swabs. Saliva was also show n to have potential as a sample matrix and, like anterior nasal swabs, could be obtained non-invasively (e g., passive drool). However, due to its inherent complexity and heterogeneity across patient populations (e.g., presence of mucins and RNases), saliva was largely disregarded as point-of-care diagnostics were being developed and broadly implemented. For molecular diagnostic approaches (e.g., RT-PCR or RT-LAMP), these matrix effects from saliva could lead to undesirable false positives or false negatives. The opportunity to address these challenges by normalizing the performance of saliva could permit applications of molecular tests, particularly at the point-of-care. Towards these goals, described herein is a one-pot RT-LAMP assay for the colorimetric detection of SARS-CoV-2 from saliva samples. As a non-limiting example, the assay can be performed in five steps: (i) a patient collects a passive saliva sample, (ii) the sample is placed on a heat block for 10 minutes at 95 °C, (iii) the undiluted sample is added to the one-pot RT-LAMP assay, (iv) the RT-LAMP reaction tube is place on a heat block for 40 minutes at 65 °C, and, (v) immediately post-amplification, the reaction tube is inverted to observe the colorimetricAttorney Docket No: 700355-088492WOPT output. The clinical performance of the described assay was demonstrated using a panel of 127 patient samples. The assay had an overall accuracy of 98%, with a sensitivity of 88% and a specificity of 100%. These results indicate excellent diagnostic agreement with the gold standard, RT-PCR, and highlight the ability to improve the clinical utility’ of saliva for point- of-care testing of SARS-CoV-2 and other respiratory7viruses.

[0009] Accordingly, in one aspect, described herein is a reagent combination for isothermal amplification and detection of a target nucleic acid in a saliva sample, the combination comprising: (a) a lysis reagent; (b) an RNase inhibitor; (c) isothermal amplification reagents comprising a DNA polymerase and a set of isothermal amplification primers, and (d) a detection reagent.

[0010] In some embodiments of any of the aspects, the lysis reagent comprises: (a) octylphenoxy poly(ethyleneoxy)ethanol (IGEPAL-630®), (b) t- Octylphenoxypolyethoxy ethanol (TRITON X-100®), (c) polysorbate 20 (TWEEN-20®), or (d) a quaternary7ammonium compound (e.g., benzethonium chloride).

[0011] In some embodiments of any of the aspects, the RNase inhibitor comprises: a solution comprising ammonium and cesium sulfate (RNAlater®). In some embodiments of any of the aspects, the RNase inhibitor comprises: (a) RNase Inhibitor®, (b) RNAsecure®, (c) SUPERase«IN®, or (d) a solution comprising ammonium and cesium sulfate (RNAlater®).

[0012] In some embodiments of any of the aspects, the isothermal amplification reagents are suitable for an isothermal amplification method selected from the group consisting of: Loop Mediated Isothermal Amplification (LAMP), Recombinase Polymerase Amplification (RPA), Rolling Circle Amplification (RCA), Helicase-dependent isothermal DNA amplification (HD A), nicking enzyme amplification reaction (NEAR), and strand displacement amplification (SDA).

[0013] In some embodiments of any7of the aspects, the set of isothermal amplification primers comprises a forw ard outer primer (F3), a backward outer primer (B3), a forward internal primer (FIP), a backward internal primer (BIP), a loop forward primer (LF), and a loop backward primer (LB) suitable for Loop Mediated Isothermal Amplification (LAMP).

[0014] In some embodiments of any7of the aspects, the set of isothermal amplification primers comprise SEQ ID NOs: 1-6.

[0015] In some embodiments of any of the aspects, the detection reagent is a fluorescent dye that specifically binds to double-stranded DNA (dsDNA).Attorney Docket No: 700355-088492WOPT

[0016] In some embodiments of any of the aspects, the detection reagent comprises N'.N'- dimethyl-N-[4-[(E)-(3-methyl-l,3-benzothiazol-2-ylidene)methyl]-l-phenylquinolin-l-ium- 2-yl]-N-propylpropane-l,3-diamine (SYBR® Green).

[0017] In some embodiments of any of the aspects, the reagent combination further comprises deoxyribonucleoside triphosphates (dNTPs).

[0018] In some embodiments of any of the aspects, the reagent combination further comprises reverse transcnption reagents comprising a reverse transcriptase and a set of reverse transcription primers.

[0019] In some embodiments of any of the aspects, the target nucleic acid comprises a gene from a pathogen.

[0020] In some embodiments of any of the aspects, the target nucleic acid comprises the nucleocapsid gene (N-gene) of severe acute respiratory syndrome coronavirus 2 (SARS-CoV- 2).

[0021] In one aspect, described herein is a reagent combination for isothermal amplification and detection of a target RNA in a saliva sample, the combination comprising: (a) a lysis reagent comprising octylphenoxy poly(ethyleneoxy)ethanol (IGEPAL-630®); (b) an RNase inhibitor (e.g., comprising RNase Inhibitor®); (c) reverse transcription reagents comprising a reverse transcriptase and a set of reverse transcription primers; (d) isothermal amplification reagents comprising a DNA polymerase and a set of isothermal amplification primers, wherein the isothermal amplification is Loop Mediated Isothermal Amplification (LAMP), and (e) a detection reagent comprising N',N'-dimethyl-N-[4-[(E)-(3-methyl-l,3- benzothiazol-2-ylidene)methyl]-l-phenylquinolin-l-ium-2-yl]-N-propylpropane-l,3-di amine (SYBR® Green).

[0022] In some embodiments of any of the aspects, the target RNA comprises the nucleocapsid gene (N-gene) of severe acute respiratory syndrome coronavirus 2 (SARS-CoV- 2), and the set of isothermal amplification primers comprise SEQ ID NOs: 1-6.

[0023] In one aspect, described herein is a kit for isothermal amplification and detection of a target nucleic acid in a saliva sample, the kit comprising: (a) a reagent container comprising a reagent combination as described herein; and (b) a sample collection container.

[0024] In some embodiments of any of the aspects, the detection reagent is separated from the remaining reagents in the reagent container.

[0025] In some embodiments of any of the aspects, the reagent container comprises a lid, and the detection reagent is located on the inner, bottom surface of the lid.Attorney Docket No: 700355-088492WOPT

[0026] In some embodiments of any of the aspects, the sample collection container is for collecting the saliva sample.

[0027] In one aspect, described herein is a system for isothermal amplification and detection of a target nucleic acid in a saliva sample, the system comprising a reagent combination as described herein or a kit as described herein, and a heat source.

[0028] In some embodiments of any of the aspects, the heat source is capable of producing temperatures of about 65 °C to about 95 °C.

[0029] In some embodiments of any of the aspects, the system further comprises the saliva sample.

[0030] In one aspect, described herein is a method for isothermally amplifying and detecting a target nucleic acid in a saliva sample, the method comprising the following steps: (a) collecting or receiving the saliva sample from the subject; (b) pre-heating the sample at a sufficient temperature and for a sufficient time to inactivate RNases in the sample and / or clarify' particulates and / or mucin in the sample; (c) adding to the pre-heated sample a reagent combination comprising: (i) a lysis reagent; (ii) an RNase inhibitor: (iii) reverse transcription reagents comprising a reverse transcriptase and a set of reverse transcription primers; and (iv) isothermal amplification reagents comprising a DNA polymerase and a set of isothermal amplification primers; (d) heating the pre-heated sample and the combination of reagents at a sufficient temperature and for a sufficient time for reverse transcribing and isothermally amplifying the target nucleic acid, if present in the sample; and (e) adding a detection reagent to detect the isothermally-amplified target nucleic acid, if present in the sample.

[0031] In some embodiments of any of the aspects, the sufficient temperature for preheating the sample is about 95 °C.

[0032] In some embodiments of any of the aspects, the sufficient time for pre-heating the sample is about 10 minutes.

[0033] In some embodiments of any of the aspects, the sufficient temperature to for reverse transcribing and isothermally amplifying the target nucleic acid is about 65 °C.

[0034] In some embodiments of any of the aspects, the sufficient time for reverse transcribing and isothermally amplifying the target nucleic acid is about 40 minutes.

[0035] In some embodiments of any of the aspects, the lysis reagent comprises: (a) octylphenoxy poly(ethyleneoxy)ethanol (IGEPAL-630®), (b) t-Octylphenoxypolyethoxy ethanol (TRITON X-100®), (c) polysorbate 20 (TWEEN-20®), or (d) a quaternary ammonium compound (e.g., benzethonium chloride).Attorney Docket No: 700355-088492WOPT

[0036] In some embodiments of any of the aspects, the RNase inhibitor comprises: a solution comprising ammonium and cesium sulfate (RNAlater®). In some embodiments of any of the aspects, the RNase inhibitor comprises: (a) RNase Inhibitor®, (b) RNAsecure®, (c) SUPERase’IN®, or (d) a solution comprising ammonium and cesium sulfate (RNAlater®).

[0037] In some embodiments of any of the aspects, the isothermal amplification reagents are suitable for an isothermal amplification method selected from the group consisting of: Loop Mediated Isothermal Amplification (LAMP), Recombinase Polymerase Amplification (RPA), Rolling Circle Amplification (RCA), Helicase-dependent isothermal DNA amplification (HD A), nicking enzy me amplification reaction (NEAR), and strand displacement amplification (SDA).

[0038] In some embodiments of any of the aspects, the set of isothermal amplification primers comprises a forward outer primer (F3), a backward outer primer (B3), a forward internal primer (FIP), a backward internal primer (BIP), a loop forward primer (LF), and a loop backward primer (LB) suitable for Loop Mediated Isothermal Amplification (LAMP).

[0039] In some embodiments of any of the aspects, the set of isothermal amplification primers comprise SEQ ID NOs: 1-6.

[0040] In some embodiments of any of the aspects, the detection reagent is a fluorescent dye that specifically binds to double-stranded DNA (dsDNA).

[0041] In some embodiments of any of the aspects, the detection reagent comprises N',N'-dimethyl-N-[4-[(E)-(3-methyl-l ,3-benzothiazol-2-ylidene)methyl]-l -phenylquinolin-1 - ium-2-yl]-N-propylpropane- 1,3 -diamine (SYBR® Green).

[0042] In some embodiments of any of the aspects, the reagent combination further comprises deoxyribonucleoside triphosphates (dNTPs).

[0043] In some embodiments of any of the aspects, the target nucleic acid comprises a gene from a pathogen.

[0044] In some embodiments of any of the aspects, the target nucleic acid comprises the nucleocapsid gene (N-gene) of severe acute respiratory syndrome coronavirus 2 (SARS-CoV- 2).

[0045] In some embodiments of any of the aspects, the target nucleic acid comprises a gene from a pathogen, and the saliva sample is from a subject, furthering comprising a step (f) administering an effective anti -pathogen treatment to the subject.Attorney Docket No: 700355-088492WOPT

[0046] In some embodiments of any of the aspects, the target nucleic acid comprises the nucleocapsid gene (N-gene) of severe acute respiratory syndrome coronavirus 2 (SARS-CoV- 2), and the saliva sample is from a subject, furthering comprising a step (f) administering an effective anti-SARS-CoV-2 treatment to the subject.

[0047] In one aspect, described herein is a method for isothermally amplifying and detecting a target RNA in a saliva sample, the method comprising the following steps: (a) collecting or receiving the saliva sample from the subject; (b) pre-heating the sample at a sufficient temperature and for a sufficient time to inactivate RNases in the sample and / or clarify particulates and / or mucin in the sample; (c) adding to the pre-heated sample a reagent combination comprising: (i) a lysis reagent comprising octylphenoxy poly(ethyleneoxy)ethanol (IGEPAL-630®); (ii) an RNase inhibitor comprising RNase Inhibitor®; (iii) reverse transcription reagents comprising a reverse transcriptase and a set of reverse transcription primers; and (iv) isothermal amplification reagents comprising a DNA polymerase and a set of isothermal amplification primers, wherein the isothermal amplification is Loop Mediated Isothermal Amplification (LAMP); (d) heating the pre-heated sample and the combination of reagents at a sufficient temperature and for a sufficient time for reverse transcribing the target RNA if present in the sample into a target cDNA and isothermally amplifying the target cDNA, if present in the sample; and (e) adding a detection reagent to detect the isothermally-amplified target cDNA. if present in the sample, wherein the detection reagent comprises N',N'-dimethyl-N-[4-[(E)-(3-methyl-l,3-benzothiazol-2- ylidenejmethyl]- 1 -phenylquinolin-1 -ium-2-yl]-N-propylpropane- 1 ,3-diamine (SYBR® Green).

[0048] In some embodiments of any of the aspects, the target RNA comprises the nucleocapsid gene (N-gene) of severe acute respiratory syndrome coronavirus 2 (SARS-CoV- 2), and the set of isothermal amplification primers comprise SEQ ID NOs: 1-6.

[0049] In embodiments where the target nucleic acid is a DNA molecule, reverse transcription does not need to be performed, and isothermal amplification can be perform directly on the sample. The RNase inhibitor can be swapped out for a DNase inhibitor. A lysis agent can still be used. The pre-heating step can still be used when saliva is the sample. Accordingly, in one aspect, described herein is a method for isothermally amplifying and detecting a target DNA in a saliva sample, the method comprising the following steps: (a) collecting or receiving the saliva sample from the subject; (b) pre-heating the sample at a sufficient temperature and for a sufficient time to clarify particulates and / or mucin in theAttorney Docket No: 700355-088492WOPT sample; (c) adding to the pre-heated sample a reagent combination comprising: (i) a lysis reagent; (ii) a DNase inhibitor; and (hi) isothermal amplification reagents comprising a DNA polymerase and a set of isothermal amplification primers; (d) heating the pre-heated sample and the combination of reagents at a sufficient temperature and for a sufficient time for isothermally amplifying the target DNA, if present in the sample; and (e) adding a detection reagent to detect the isothermally-amplified target DNA, if present in the sample.BRIEF DESCRIPTION OF THE DRAWINGS

[0050] FIG. 1. Schematic for a one-pot RT-LAMP assay using saliva. The assay container is pre-filled with (i) custom formulation of master mix (WARMSTART RTx, WARMSTART Bst 2.0, LAMP primers, dNTPs, NTPs, IGEPAL-630 lysis agent, RNase inhibitor) and (ii) the indicator dye (SYBR green) stored dried on the lid. A heat-treated sample of saliva is cooled on the bench for 5 minutes at room temperature then added into the container, which is then closed and incubated at 65 °C for 40 minutes amplify the target gene. Immediately after amplification, the tube is inverted, which rehydrates the indicator dye in the lid of the tube to yield an obvious colorimetric result: negative (orange) or positive (neon green).

[0051] FIG. 2A-2B. Results of screens to identify the colorimetric amplification indicator and viral lysis reagent used in the RT-LAMP assay. (FIG. 2A) Examples of indicators screened based on mechanism of action: changes in pH (phenol red), production of pyrophosphate (malachite green), or dsDNA intercalators (SYTO-80. Methyl green, SYBR Green). (FIG. 2B) Surfactant screen for viral lysis included: IGEPAL-630 (0.25% vol / vol), TRITON X-100 (0.25% vol / vol), and TWEEN-20 (0.25% vol / vol). Efficiency of viral lysis was evaluated against a titer of 0, 15.63, 31.25, 62.50, and 125.0 xlO3copies per milliliter (c / mL) of heat-inactivated SARS-CoV-2 in water. The average fluorescence intensify is plotted (n=3). Error bars indicate the standard error of the mean.

[0052] FIG. 3A-3B. RNase inhibitor inclusion to minimize matrix effects from saliva. (FIG. 3A) Saliva samples with and without RNase inhibitor. Saliva samples were tested with real-time RT-LAMP mixes including varying RNase inhibitor concentrations: 0 U, 20 U, and 75 U. No template control samples were naive, pooled patient saliva (-) and positive samples were 2.5xl05c / mL of heat-inactivated virus spiked into matched naive, pooled patient saliva (+). Water containing 0 U RNase inhibitor served as an assay control. (FIG. 3B) Results from pre-heating clinical saliva for 10 minutes at 95 °C in the presence of 75 U of RNaseAttorney Docket No: 700355-088492WOPT inhibitor in the real-time RT-LAMP master mix. Clinical samples 053, 054, 055, and a pool of the three samples (pool A) were analyzed on the first run. Clinical samples 056, 057, 058. and a pool of the three samples (pool B) were analyzed on the second run. Symbols indicate the average amplification time for each sample and error bars indicate the standard error of the mean (n=3).

[0053] FIG. 4A-4B. Limit of detection (LOD) estimation. (FIG. 4A) Amplification success rate for replicates of heat-inactivated SARS-CoV-2 spiked into saliva pooled from 1 naive patients. No template control (NTC) samples were match samples of pooled saliva lacking virus. The average time for amplification for each concentration is plotted (n=5, error bars indicate the standard error of the mean). (FIG. 4B) Images of colorimetric assay results acquired immediately post-amplification and inverting the tube to introduce the indicator: positive (neon green) or negative (orange).

[0054] FIG. 5A-5C. Clinical validation of one-pot RT-LAMP assay. (FIG. 5A) Confusion matrix summarizing the assay results from 127 clinical samples of saliva. A cycle threshold (CT) of 38 by confirmatory RT-qPCR was used as the threshold differentiating true positive and true negative samples. (FIG. 5B) Analytical performance metrics of the RT- LAMP assay calculated using Equations 1-5. (FIG. 5C) Receiver Operating Characteristic (ROC) Curve used to evaluate the diagnostic accuracy compared to the gold standard, RT- PCR. The area under the curve (AUC) was determined to be 91%.

[0055] FIG. 6A-6B. (FIG. 6A) Representative amplification curve from a real-time RT- LAMP reaction with a LAMP-specific fluorescent dye. (FIG. 6B) Gel electrophoresis of RT- LAMP products.

[0056] FIG. 7A-7C. Determining conditions to inhibit RNase activity' in saliva. Saliva samples were tested with real-time RT-LAMP mixes including varying RNase inhibitor concentrations: (FIG. 7A) 0 U, 10 U, 20 U; (FIG. 7B) 20 U of RNA secure; (FIG. 7C) 75 U SUPERase IN. A water sample was run for each experiment as an assay control with 0 U RNase inhibitor. No template control samples were naive, pooled patient saliva (-) and positive samples were 2.5xl05c / mL of heat-inactivated virus spiked into matched naive, pooled patient saliva (+). Paired positive and negative samples were also prepared in nuclease free (NF) water. The average time for amplification is indicated (n=3). Error bars indicate the standard error of the mean.

[0057] FIG. 8. Representative images of saliva during heating treatment. With increasing heating time, mucin aggregates at the bottom of the sample preparation tube.Attorney Docket No: 700355-088492WOPT

[0058] FIG. 9. Processes to clarify saliva, including heat incubation, centrifugation, and syringe fdtration. The average time for amplification is plotted (N=3). Error bars indicate the standard error of the mean.

[0059] FIG. 10. Assay performance with combination of RNAse inhibitor and heat pretreatment. For the first run, the no template control is naive saliva, and the positive sample is 2.5xl05c / mL of heat-inactivated virus spiked in naive saliva. For the second run, the no template control is naive saliva, and the positive sample is 2.5xl05c / mL of heat-inactivated virus spiked in naive saliva.

[0060] FIG. 11A-11B. Confusion matrix of pilot trial. (FIG. 11A) Expected and actual outputs of the pilot trial indicating true positives (18), false negatives (6), true negatives (23), and false positives (1). Each replicate was included in the total sample number (N = 48).(FIG. 11B) Performance metrics calculated using the confusion matrix outputs and Equations 1-5.

[0061] FIG.12. RT-qPCR thermocycler parameters to amplify and quantify SARS-CoV-2 RNA.

[0062] FIG. 13. Flow chart of the exclusion criteria for the study, as per the STARD guidelines.

[0063] FIG. 14. Images of the colorimetric outputs of RT-LAMP assay for the known positive clinical samples. Immediately post-amplification, the wells were inverted to allow for the amplification product to interact with the indicator. The scans of the wells were taken with the lid facing the scanner platform. Each clinical patient is listed with (i) original scans of all 5 replicate wells and (ii) the average CT value of confirmatory RT-qPCR and the standard error of the mean (n = 3).

[0064] FIG. 15A-15C. Images of the colorimetric outputs of RT-LAMP assay for the known negative clinical samples. Immediately post-amplification, the wells were inverted to allow- for the amplification product to interact w ith the indicator. The scans of the wells were taken with the lid facing the scanner platform. Each clinical patient is listed with (i) original scans of all 5 replicate wells and (ii) the average CT value of confirmatory RT-qPCR and the standard error of the mean (n = 3).

[0065] FIG. 16. CT cutoff evaluation for optimal analytical performance. Sensitivity and specificity are plotted with respect to CT cutoff value. Sensitivity remains unchanged while specificity increases at lower CT cutoffs. A cutoff of 38 was determined sufficient to minimize misclassifications.Attorney Docket No: 700355-088492WOPT

[0066] FIG. 17 is a schematic showing current saliva analysis (top) and the goal to develop a technology that can accomplish sample preparation and analysis in a less demanding process for the laboratory technician (bottom).

[0067] FIG. 18 is a schematic showing LAMP as a nucleic acid amplification alternative to PCR.

[0068] FIG. 19 is a schematic showing RT-LAMP with colorimetric output, which incorporates a simple readout mechanism to remove the need for fluorescent analysis. The assay components include: mastermix, primers, lysis surfactant, and a colorimetric indicator.

[0069] FIG. 20 is a schematic showing the clinical validation methodology.DETAILED DESCRIPTION

[0070] The present invention relates to, but is not limited to, new and improved devices, systems, circuits, and compounds; novel biological materials such as proteins, genes. DNA constructs, cell lines and transgenic animals; diagnostics, immunoassays, therapeutics, and new uses of known articles or substances; new methods of producing or manufacturing any articles or substances; or algorithms and softw are.

[0071] Described herein is a one-pot, RT-LAMP-based assay for detecting respiratory viruses in saliva. The one-pot RT-LAMP reaction mix comprises (i) RT-LAMP reagents and primers, (ii) surfactant for lysis (e.g., viral lysis), (iii) RNase inhibitor, and (iv) indicator dye.

[0072] Processing saliva before nucleic acid amplification (e.g., using extraction or purification kits) can reduce or eliminate the impact of amplification inhibitors. However, these methods are laborious and require support equipment (e.g., centrifuge, heat block). Extraction-free approaches to inactivating matrix inhibitors can achieve suitable detection limits through a combination of physical (e.g., dilution, centrifugation), chemical (e.g., Proteinase K, Chelex-100), or thermal (e.g., heat-inactivation) steps. To support the broader adoption of saliva as a diagnostic sample matrix for upper respiratory infections like COVID- 19, it is highly desirable to couple the simplicity of isothermal approaches with sample preparation protocols that minimize user input.

[0073] The assay described herein has been validated with clinical patient samples (e.g., 29 SARS-CoV-2 positive, 89 SARS-CoV-2 negative). The described one-pot RT-LAMP- based assay demonstrated 88% sensitivity, 100% specificity, and 97% accuracy. To further contextualize the diagnostic accuracy of the assay compared to RT-PCR, the data was analyzed using a receiver operating characteristic (ROC) curve. The resulting curve affordedAttorney Docket No: 700355-088492WOPT an area under the curve (AUC) of 91%, which reflects outstanding congruence with the gold standard method.

[0074] In some embodiments, the assay comprises a mastermix comprising a reverse transcriptase, a DNA polymerase, and dNTPs. In some embodiments, the assay comprises primers for a target nucleic acid (e.g., the N-gene of the SARS-CoV-2 genome).Reagents

[0075] In multiple aspects, described herein are reagent combinations for isothermal amplification and detection of a target nucleic acid in a saliva sample. Non-limiting examples of such reagents include: a lysis reagent, an RNase inhibitor, reverse transcription reagents (e.g.. a reverse transcriptase and / or a set of reverse transcription primers), isothermal amplification reagents (e.g., a DNA polymerase and a set of isothermal amplification primers), and / or a detection reagent, or any combination of thereof (see e.g., Table 2, below).

[0076] Table 2: Exemplary reagent combinationsAttorney Docket No: 700355-088492WOPTLysis reagents

[0077] In some embodiments, a reagent combination as described herein comprises at least one (e.g., 1, 2, 3, 4, 5, or more, which can be the same or different) lysis reagent. As used herein, the term “lysis reagent’' refers to a molecule that is capable of disrupting a lipid membrane. In some embodiments, the lysis reagent is a surfactant, which can insert itself into a lipid membrane and disrupt the normal architecture of the lipid membrane. In some embodiments, the lysis reagent is a non-ionic surfactant. In some embodiments, the lysis reagent is capable of disrupting the lipid membrane of a cell and thus releasing nucleic acids from within the cell. In some embodiments, the lysis reagent is capable of disrupting the lipid membrane of an encapsulated virus and thus releasing nucleic acids from within the virus. In some embodiments, the lysis reagent is capable of disrupting the protein-protein interactions of a viral capsid and thus releasing nucleic acids from within the viral capsid. In some embodiments, the lysis reagent comprises: (a) octylphenoxy poly(ethyleneoxy)ethanol (IGEPAL-630®. see e.g., Formula I), (b) t-Octylphenoxypolyethoxy ethanol (TRITON X- 100®, see e g., Formula II), (c) polysorbate 20 (TWEEN-20®, see e g., Formula III), or any combination thereof, and / or (d) a quaternary’ ammonium compound (e.g., benzethonium chloride, see e.g., Formula IV, which is an active compound in CAVICIDE). While TRITON X-100 has a structure similar to IGEPAL CA-630, TRITON X-100 is slightly more hydrophilic than IGEPAL CA-630.

[0078] Formula I: octylphenoxy poly(ethyleneoxy)ethanol (IGEPAL-630), where “n” is ty pically about 9, for example with an average of about 9 ethylene oxide units [- (CH2CH2O)-] per molecule:Attorney Docket No: 700355-088492WOPT

[0079] Formula II: t-Octylphenoxypoly ethoxyethanol (TRITON X-100), where “n” is typically between 9 and 10, for example with an average of about 9.5 ethylene oxide units [- (CH2CH2O)-] per molecule:

[0080] Formula III: exemplary polysorbate 20 (TWEEN-20; Polyethylene glycol sorbitan monolaurate); there are approximately twenty total ethylene oxide units [- (CH2CH2O)-] distributed across several ether-linked chains attached to the sorbitan hydroxyls, and the “20” denotes the average total number of ethoxy units per molecule:Attorney Docket No: 700355-088492WOPT

[0081] Formula IV: benzethonium chloride

[0082] In some embodiments, the lysis reagent is at a sufficient concentration in the reagent combination to lyse lipid membranes present in a saliva sample. In some embodiments of any of the aspects, the lysis reagent is provided at a concentration of about 0.25% vol / vol. In some embodiments of any of the aspects, the lysis reagent is provided at a concentration of at least 0. 1 %, at least 0. 1 1 %, at least 0.12%, at least 0. 13%, at least 0. 14%, at least 0.15%, at least 0.16%, at least 0.17%, at least 0.18%, at least 0.19%, at least 0.2%, at least 0.21%, at least 0.22%, at least 0.23%, at least 0.24%, at least 0.25%, at least 0.26%, at least 0.27%, at least 0.28%, at least 0.29%, at least 0.3%, at least 0.31%, at least 0.32%, at least 0.33%, at least 0.34%, at least 0.35%, at least 0.36%, at least 0.37%, at least 0.38%, at least 0.39%, at least 0.4%, at least 0.45%, or at least 0.5% vol / vol.

[0083] In some embodiments of any of the aspects, the lysis reagent is functional at a temperature of about 65°C. As a non-limiting example, the lysis reagent is functional at a temperature of at least 12°C, at least 13°C, at least 14°C, at least 15°C, at least 16°C, at least 17°C, at least 18°C, at least 19°C, at least 20°C, at least 21°C, at least 22°C, at least 23°C, at least 24°C, at least 25°C, at least 26°C, at least 27°C, at least 28°C, at least 29°C, at least 30°C, at least 31°C, at least 32°C, at least 33°C, at least 34°C, at least 35°C, at least 36°C, at least 37°C. at least 38°C, at least 39°C, at least 40°C, at least 41 °C. at least 42°C, at least 43°C, at least 44°C, at least 45°C, at least 46°C, at least 47°C, at least 48°C, at least 49°C, at least 50°C, at least 51°C, at least 52°C, at least 53°C, at least 54°C, at least 55°C, at least 56°C, at least 57°C, at least 58°C, at least 59°C, at least 60°C, at least 61°C, at least 62°C, at least 63°C, at least 64°C, at least 65°C, at least 66°C, at least 67°C, at least 68°C, at least 69°C, or at least 70°C.Attorney Docket No: 700355-088492WOPT

[0084] In some embodiments of any of the aspects, the lysis reagent is functional at a temperature of at most 12°C, at most 13°C, at most 14°C. at most 15°C, at most 16°C, at most 17°C, at most 18°C, at most 19°C, at most 20°C, at most 21°C, at most 22°C, at most 23°C, at most 24°C, at most 25°C, at most 26°C, at most 27°C, at most 28°C, at most 29°C, at most 30°C, at most 31°C, at most 32°C, at most 33°C, at most 34°C, at most 35°C, at most 36°C, at most 37°C, at most 38°C. at most 39°C, at most 40°C, at most 41 °C, at most 42°C, at most 43°C, at most 44°C, at most 45°C, at most 46°C, at most 47°C, at most 48°C, at most 49°C, at most 50°C, at most 51 °C, at most 52°C, at most 53°C, at most 54°C, at most 55°C, at most 56°C, at most 57°C, at most 58°C, at most 59°C, at most 60°C, at most 61°C, at most 62°C, at most 63°C, at most 64°C, at most 65°C, at most 66°C, at most 67°C, at most 68°C, at most 69°C, or at most 70°C.

[0085] In some embodiments of any of the aspects, the lysis reagent is functional at a temperature of about 60 to 70°C. In some embodiments of any of the aspects, the lysis reagent is functional on a heat source set to approximately 65°C. In some embodiments of any of the aspects, the lysis reagent is functional at room temperature (e.g., 20°C-22°C). In some embodiments of any of the aspects, the lysis reagent is functional at body temperature (e.g., 37°C).RNase inhibitors

[0086] In some embodiments, a reagent combination as described herein comprises at least one (e.g., 1, 2, 3, 4, 5, or more, which can be the same or different) RNase inhibitor. As used herein, the term “RNase inhibitor” refers to a molecule that binds to and inactivates ribonucleases (RNases) to protect RNA from degradation by the RNases. In some embodiments, the RNase inhibitor comprises: (a) RNase Inhibitor®, (b) RNAsecure®. (c) SUPERaseHN®, and / or (d) a solution comprising ammonium and cesium sulfate (RNAlater®), or any combination thereof. In some embodiments of any of the aspects, the RNase inhibitor comprises: a solution comprising ammonium and cesium sulfate (RNAlater®).

[0087] Further exemplary RNase inhibitors include, but are not limited to, mammalian ribonuclease inhibitor proteins such as porcine ribonuclease inhibitor and human ribonuclease inhibitor (e.g., human placenta ribonuclease inhibitor and recombinant human ribonuclease inhibitor), vanadyl ribonucleoside complexes, proteinase K, phenylglyoxal, p- hydroxyphenylglyoxal, polyamines, spermidine, 9-aminoacridine, iodoacetate, bentonite, poly[2'-O-(2,4-dinitrophenyl)]poly(adenyhlic acid), zinc sulfate, bromopyruvic acid,Attorney Docket No: 700355-088492WOPT formamide, dimethylformamide, copper, zinc, aurintricarboxylic acid (ATA) and salts thereof such as triammonium aurintricarboxylate (aluminon), adenosine 5 '-pyrophosphate, 2'- cytidine monophosphate free acid (2'-CMP), 5'-diphosphoadenosine 3'-phosphate (ppA-3'-p), 5'- diphosphoadenosine 2'-phosphate (ppA-2'-p), leucine, oligovinysulfonic acid, poly(aspartic acid), tyrosine-glutamic acid polymer, 5'-phospho-2'-deoxyuridine 3 '- pyrophosphate P'^5 '-ester with adenosine 3 '-phosphate (pdUppAp), and analogs, derivatives and salts thereof.

[0088] In some embodiments of any of the aspects, the RNase inhibitor is a ribonuclease inhibitor protein, such as a recombinant RNase inhibitor, e.g., a recombinant mammalian RNase inhibitor. In some embodiments of any of the aspects, the RNase inhibitor is murine RNase inhibitor or RNasin " Plus. In some embodiments of any of the aspects, the RNase inhibitor is a thermostable RNase inhibitor, e.g., RNasin® Plus.

[0089] In some embodiments of any of the aspects, the RNase inhibitor specifically inhibits RNases A, B and C, which specifically cleave ssRNA or dsRNA. RNase A and RNase B are an endoribonuclease that specifically degrades single-stranded RNA at C and U residues. RNase C recognizes dsRNA and cleaves it at specific targeted locations to transform them into mature RNAs. In some embodiments of any of the aspects, the RNase inhibitor does not specifically inhibit DNase activity, e.g., of a DNA polymerase.

[0090] In some embodiments, the RNase inhibitor is at a sufficient concentration in the reagent combination to inhibit RNases present in a saliva sample. As used herein, one unit (‘’U”) of an RNase inhibitor is defined as the amount of inhibitor required to inhibit a set amount of a specific RNase (e.g., 5 ng of RNase A). In some embodiments of any of the aspects, the RNase inhibitor is added to a final concentration of at least 0.01 U / pL, at least 0.02 U / pL. at least 0.03 U / pL. at least 0.04 U / pL. at least 0.05 U / pL. at least 0.06 U / pL. at least 0.07 U / pL, at least 0.08 U / pL, at least 0.09 U / pL, at least 0.1 U / pL, at least 0.2 U / pL, at least 0.3 U / pL, at least 0.4 U / pL, at least 0.5 U / pL, at least 0.6 U / pL, at least 0.7 U / pL, at least 0.8 U / pL, at least 0.9 U / pL, at least 1.0 U / pL, at least 1.1 U / pL, at least 1.2 U / pL, at least 1.3 U / pL. at least 1.4 U / pL, at least 1.5 U / pL, at least 1.6 U / pL. at least 1.7 U / pL, at least 1.8 U / pL, at least 1.9 U / pL, at least 2.0 U / pL, at least 2. 1 U / pL, at least 2.2 U / pL, at least 2.3 U / pL, at least 2.4 U / pL, at least 2.5 U / pL, at least 2.6 U / pL, at least 2.7 U / pL, at least 2.8 U / pL, at least 2.9 U / pL, at least 3.0 U / pL, at least 3.1 U / pL, at least 3.2 U / pL, at least 3.3 U / pL, at least 3.4 U / pL, at least 3.5 U / pL, at least 3.6 U / pL, at least 3.7 U / pL, at least 3.8 U / pL. at least 3.9 U / pL, at least 4.0 U / pL, at least 4.1 U / pL. at least 4.2 U / pL, atAttorney Docket No: 700355-088492WOPT least 4.3 U / pL, at least 4.4 U / pL, at least 4.5 U / pL, at least 4.6 U / pL, at least 4.7 U / pL, at least 4.8 U / pL. at least 4.9 U / pL, at least 5.0 U / pL, at least 5.1 U / pL. at least 5.2 U / pL, at least 5.3 U / pL, at least 5.4 U / pL, at least 5.5 U / pL, at least 5.6 U / pL, at least 5.7 U / pL, at least 5.8 U / pL, at least 5.9 U / pL, at least 6.0 U / pL, at least 6.1 U / pL, at least 6.2 U / pL, at least 6.3 U / pL, at least 6.4 U / pL, at least 6.5 U / pL, at least 6.6 U / pL, at least 6.7 U / pL, at least 6.8 U / pL. at least 6.9 U / pL, at least 7.0 U / pL, at least 7.1 U / pL. at least 7.2 U / pL, at least 7.3 U / pL, at least 7.4 U / pL, at least 7.5 U / pL. at least 7.6 U / pL, at least 7.7 U / pL, at least 7.8 U / pL, at least 7.9 U / pL, at least 8.0 U / pL, at least 8. 1 U / pL, at least 8.2 U / pL, at least 8.3 U / pL, at least 8.4 U / pL, at least 8.5 U / pL, at least 8.6 U / pL, at least 8.7 U / pL, at least 8.8 U / pL, at least 8.9 U / pL, at least 9.0 U / pL, at least 9.1 U / pL, at least 9.2 U / pL, at least 9.3 U / pL. at least 9.4 U / pL, at least 9.5 U / pL, at least 9.6 U / pL. at least 9.7 U / pL, at least 9.8 U / pL, at least 9.9 U / pL, at least 10 U / pL, at least 20 U / pL, at least 30 U / pL, at least 40 U / pL, at least 50 U / pL, at least 60 U / pL, at least 70 U / pL, at least 80 U / pL, at least 90 U / pL, at least 100 U / pL, at least 110 U / pL, at least 120 U / pL, at least 130 U / pL, at least 140U / pL, at least 150 U / pL. at least 160 U / pL, at least 170 U / pL, at least 180 U / pL. at least 190U / pL, at least 200 U / pL, at least 210 U / pL, at least 220 U / pL, at least 230 U / pL, at least 240U / pL, at least 250 U / pL, at least 260 U / pL, at least 270 U / pL, at least 280 U / pL, at least 290U / pL, at least 300 U / pL, at least 310 U / pL, at least 320 U / pL, at least 330 U / pL, at least 340U / pL, at least 350 U / pL, at least 360 U / pL, at least 370 U / pL, at least 380 U / pL, at least 390U / pL, at least 400 U / pL. at least 410 U / pL, at least 420 U / pL, at least 430 U / pL. at least 440U / pL, at least 450 U / pL, at least 460 U / pL, at least 470 U / pL, at least 480 U / pL, at least 490U / pL, or at least 500 U / |iL. In some embodiments of any of the aspects, the RNase inhibitor is provided at about 20 U. In some embodiments of any of the aspects, the RNase inhibitor is provided at about 75 U.

[0091] In some embodiments of any of the aspects, the RNase inhibitor is added to a final concentration of about 0.01 U / pL, about 0.02 U / pL, about 0.03 U / pL, about 0.04 U / pL, about 0.05 U / pL, about 0.06 U / pL, about 0.07 U / pL, about 0.08 U / pL, about 0.09 U / pL, about 0.1 U / pL, about 0.2 U / pL. about 0.3 U / pL, about 0.4 U / pL, about 0.5 U / pL, about 0.6 U / pL, about 0.7 U / pL, about 0.8 U / pL, about 0.9 U / pL, about 1.0 U / pL, about 1.1 U / pL, about 1.2 U / pL, about 1.3 U / pL, about 1.4 U / pL, about 1.5 U / pL, about 1.6 U / pL, about 1.7 U / pL, about 1.8 U / pL, about 1.9 U / pL, about 2.0 U / pL, about 2.1 U / pL, about 2.2 U / pL, about 2.3 U / pL, about 2.4 U / pL, about 2.5 U / pL, about 2.6 U / pL, about 2.7 U / pL, about 2.8 U / pL, about 2.9 U / pL. about 3.0 U / pL, about 3.1 U / pL, about 3.2 U / pL, about 3.3 U / pL,Attorney Docket No: 700355-088492WOPT about 3.4 U / pL, about 3.5 U / pL, about 3.6 U / pL, about 3.7 U / pL, about 3.8 U / pL, about 3.9 U / pL, about 4.0 U / pL. about 4.1 U / pL, about 4.2 U / pL, about 4.3 U / pL, about 4.4 U / pL, about 4.5 U / pL, about 4.6 U / pL, about 4.7 U / pL, about 4.8 U / pL, about 4.9 U / pL, about 5.0 U / pL, about 5.1 U / pL, about 5.2 U / pL, about 5.3 U / pL, about 5.4 U / pL, about 5.5 U / pL, about 5.6 U / pL, about 5.7 U / pL, about 5.8 U / pL, about 5.9 U / pL, about 6.0 U / pL, about 6.1 U / pL, about 6.2 U / pL, about 6.3 U / pL, about 6.4 U / pL, about 6.5 U / pL, about 6.6 U / pL, about 6.7 U / pL, about 6.8 U / pL, about 6.9 U / pL, about 7.0 U / pL, about 7.1 U / pL, about 7.2 U / pL, about 7.3 U / pL, about 7.4 U / pL, about 7.5 U / pL, about 7.6 U / pL, about 7.7 U / pL, about 7.8 U / pL, about 7.9 U / pL, about 8.0 U / pL, about 8.1 U / pL, about 8.2 U / pL, about 8.3 U / pL, about 8.4 U / pL, about 8.5 U / pL, about 8.6 U / pL, about 8.7 U / pL, about 8.8 U / pL, about 8.9 U / pL, about 9.0 U / pL. about 9. 1 U / pL, about 9.2 U / pL, about 9.3 U / pL. about 9.4 U / pL, about 9.5 U / pL, about 9.6 U / pL, about 9.7 U / pL, about 9.8 U / pL, about 9.9 U / pL, about 10 U / pL, about 20 U / pL, about 30 U / pL, about 40 U / pL, about 50 U / pL, about 60 U / pL, about 70 U / pL, about 80 U / pL, about 90 U / pL, about 100 U / pL, about 110 U / pL, about 120 U / pL, about 130 U / pL, about 140 U / pL, about 150 U / pL, about 160 U / pL, about 170 U / pL, about 180 U / pL, about 190 U / pL, about 200 U / pL, about 210 U / pL, about 220 U / pL, about 230 U / pL, about 240 U / pL, about 250 U / pL, about 260 U / pL, about 270 U / pL, about 280 U / pL, about 290 U / pL, about 300 U / pL, about 310 U / pL, about 320 U / pL, about 330 U / pL, about 340 U / pL, about 350 U / pL, about 360 U / pL, about 370 U / pL, about 380 U / pL, about 390 U / pL, about 400 U / pL, about 410 U / pL, about 420 U / pL. about 430 U / pL. about 440 U / pL, about 450 U / pL, about 460 U / pL, about 470 U / pL, about 480 U / pL, about 490 U / pL, or about 500 U / pL.

[0092] In some embodiments of any of the aspects, the RNase inhibitor is functional at a temperature of about 65°C. As a non-limiting example, the RNase inhibitor is functional at a temperature of at least 12°C, at least 13°C, at least 14°C, at least 15°C, at least 16°C, at least 17°C, at least 18°C, at least 19°C, at least 20°C, at least 21°C, at least 22°C, at least 23°C, at least 24°C, at least 25°C, at least 26°C, at least 27°C, at least 28°C, at least 29°C, at least 30°C, at least 31°C, at least 32°C, at least 33°C, at least 34°C, at least 35°C, at least 36°C, at least 37°C, at least 38°C, at least 39°C, at least 40°C, at least 41°C, at least 42°C, at least 43°C, at least 44°C, at least 45°C, at least 46°C, at least 47°C, at least 48°C, at least 49°C, at least 50°C, at least 51°C, at least 52°C, at least 53°C, at least 54°C, at least 55°C, at least 56°C, at least 57°C, at least 58°C, at least 59°C, at least 60°C, at least 61°C, at least 62°C, atAttorney Docket No: 700355-088492WOPT least 63°C, at least 64°C, at least 65°C, at least 66°C, at least 67°C, at least 68°C, at least 69°C, or at least 70°C.

[0093] In some embodiments of any of the aspects, the RNase inhibitor is functional at a temperature of at most 12°C, at most 13°C, at most 14°C, at most 15°C, at most 16°C, at most 17°C, at most 18°C, at most 19°C, at most 20°C, at most 21°C, at most 22°C, at most 23°C, at most 24°C, at most 25°C. at most 26°C, at most 27°C, at most 28°C, at most 29°C, at most 30°C, at most 31°C, at most 32°C, at most 33°C, at most 34°C, at most 35°C, at most 36°C, at most 37°C, at most 38°C, at most 39°C, at most 40°C, at most 41°C, at most 42°C, at most 43°C, at most 44°C, at most 45°C, at most 46°C, at most 47°C, at most 48°C, at most 49°C, at most 50°C, at most 51 °C, at most 52°C, at most 53°C, at most 54°C, at most 55°C, at most 56°C, at most 57°C, at most 58°C, at most 59°C, at most 60°C. at most 61°C, at most 62°C, at most 63°C, at most 64°C, at most 65°C, at most 66°C, at most 67°C, at most 68°C, at most 69°C, or at most 70°C.

[0094] In some embodiments of any of the aspects, the RNase inhibitor is functional at a temperature of about 60 to 70°C. In some embodiments of any of the aspects, the RNase inhibitor is functional on a heat source set to approximately 65°C. In some embodiments of any of the aspects, the RNase inhibitor is functional at room temperature (e.g., 20°C-22°C). In some embodiments of any of the aspects, the RNase inhibitor is functional at bodytemperature (e.g., 37°C).

[0095] In embodiments in which the target nucleic acid is a DNA molecule, a DNase inhibitor can be used in place of the RNase inhibitor. As used herein, the term ‘'DNase inhibitor” refers to a molecule that binds to and inactivates deoxyribonucleases (DNases) to protect DNA from degradation by the DNases. DNase inhibitors, e.g., for DNase I and / or DNase II, are known in the art. Non-limiting examples of DNase inhibitors include: chelators such as ethylene-diamine-tetraacetic acid (EDTA) or ethylene-glycol-tetraacetic acid (EGTA); aurintricarboxylic acid (ATA); G-actin (monomeric actin); neutralizing antibodies against specific DNases (e.g., anti-DNase I, anti-DNaselL3); redox / thiol-reactive or denaturing conditions (e.g., dithiothreitol (DTT), (3-mercaptoethanol, thiol-reactive reagents (e.g., p-chloromercuribenzoate)); ionic strength / pH manipulation; high salt concentrations (e.g., salt concentrations greater than 100 mM); aminoglycoside antibiotics; synthetic aminoguanidine derivatives (e.g., JR-132, IG-17); squaramates; and the like.

[0096] In some embodiments of any of the aspects, the DNase inhibitor does not specifically or is not present a sufficient concentration to inhibit DNase activity- of a DNAAttorney Docket No: 700355-088492WOPT polymerase. In some embodiments, the DNase inhibitor is at a sufficient concentration in the reagent combination to inhibit DNases present in a saliva sample. In some embodiments of any of the aspects, the DNase inhibitor is functional at a temperature of about 60 to 70°C. In some embodiments of any of the aspects, the DNase inhibitor is functional on a heat source set to approximately 65°C. In some embodiments of any of the aspects, the DNase inhibitor is functional at room temperature (e.g., 20°C-22°C). In some embodiments of any of the aspects, the DNase inhibitor is functional at body temperature (e.g.. 37°C).Reverse transcription reagents

[0097] In some embodiments, a reagent combination as described herein comprises at least one (e.g., 1. 2, 3, 4. 5, or more, which can be the same or different) reverse transcription reagent. Such a reverse transcription reagent(s) can be used when the target nucleic acid is an RNA molecule. In some embodiments, the reverse transcription reagent(s) comprises a reverse transcriptase and / or a set of reverse transcription primers.

[0098] As used herein, the term “reverse transcriptase” refers to an RNA-dependent DNA polymerase used to generate complementary DNA (cDNA) from an RNA template. In some embodiments of any of the aspects, the cDNA is single-stranded DNA (ssDNA) or doublestranded DNA (dsDNA). Reverse transcriptases are used by retroviruses to replicate their genomes, by retrotransposon mobile genetic elements to proliferate within the host genome, by eukaryotic cells to extend the telomeres at the ends of their linear chromosomes, and by some non-retroviruses such as the hepatitis B virus, a member of the Hepadnaviridae, which are dsDNA-RT viruses. Reverse transcriptases are also used in the synthesis of extrachromosomal DNA / RNA chimeric elements called multicopy single-stranded DNA (msDNA) in bacteria. Retroviral RT has three sequential biochemical activities: RNA- dependent DNA polymerase activity, ribonuclease H (RNAse H), and / or DNA-dependent DNA polymerase activity. Collectively, these activities permit the enzy me to convert singlestranded RNA into double-stranded cDNA. In some embodiments of any of the aspects, a retroviral RT is engineered to reduce or eliminate its RNaseH activity, which can result in a single stranded cDNA.

[0099] In some embodiments of any of the aspects, the reverse transcriptase can be any enzyme that can produce cDNA from an RNA transcript. In some embodiments of any of the aspects, the reverse transcriptase comprises WARMSTART® RTx reverse transcriptase (NEB®). In some embodiments of any of the aspects, the reverse transcriptase is compatible for use in a one-pot reaction that also comprises isothermal amplification reagents. In someAttorney Docket No: 700355-088492WOPT embodiments of any of the aspects, the reverse transcriptase is compatible for use in a one- pot reaction that also comprises LAMP reagents

[0100] In some embodiments of any of the aspects, the reverse transcriptase comprises a HIV-1 reverse transcriptase from human immunodeficiency virus type 1. In some embodiments of any of the aspects, the reverse transcriptase comprises M-MuLV reverse transcriptase from the Moloney murine leukemia virus (referred to as M-MuLV, M-MLV, or MMLV). In some embodiments of any of the aspects, the reverse transcriptase compnses AMV reverse transcriptase from the avian myeloblastosis virus (AVM). In some embodiments of any of the aspects, the reverse transcriptase comprises telomerase reverse transcriptase that maintains the telomeres of eukaryotic chromosomes. In some embodiments of any of the aspects, the reverse transcriptase is selected from those expressed by any Group VI or Group VII virus. In some embodiments of any of the aspects, the reverse transcriptase is a naturally occurring RT selected from the group consisting of: an M-MLV RT, an AMV RT, a retrotransposon RT, a telomerase reverse transcriptase, and an HIV-1 reverse transcriptase.

[0101] In some embodiments of any of the aspects, the reverse transcriptase is an engineered or recombinant version of an M-MuLV RT, AMV RT, or another naturally occurring RT as described herein. In some embodiments of any of the aspects, the reverse transcriptase is ProtoScript® II Reverse Transcriptase, which is also referred to herein as ProtoScript® II RT or Protoscriptase II. ProtoScript® II RT is a recombinant Moloney Murine Leukemia Virus (M-MuLV) reverse transcriptase, e.g., a fusion of the Escherichia coli trpE gene with the central region of the M-MuLV pol gene.

[0102] In some embodiments of any of the aspects, the reverse transcriptase is selected from the group consisting of: Maxima® RT (e.g., Maxima H Minus® RT). Omniscript® RT, PowerScript® RT, Sensiscript® RT (SES), SuperScript® II (SSII or SS2), SuperScript® III (SSIII or SS3), SuperScript® IV (SSIV), Accuscript® RT (ACC), a recombinant HIV RT, imProm-II® (IP2) RT, M-MLV RT (MML), Protoscript® RT (PRS), Smart MMLV (SML) RT, ThermoScript® (TSR) RT (see e.g., Levesque-Sergerie et al., BMC Molecular Biology volume 8, Article number: 93 (2007); Okello et al., PLoS One. 2010 Nov 10;5(l l):el3931). Non limiting examples of RTs derived from MMLV include PowerScript®, ACC, MML, SML, SS2, and SS3. Non limiting examples of RTs derived from AMV include PRS and TSR. Non limiting examples of RTs derived proprietary sources include IP2, SES,Attorney Docket No: 700355-088492WOPTOmniscript®. In some embodiments of any of the aspects, reverse transcriptase exhibits increased thermostability’ (e.g., up to 65°C; e.g.. up to 48°C) compared to the wild type RT.

[0103] In some embodiments of any of the aspects, the reverse transcriptase is SuperScript® IV. In some embodiments of any of the aspects, the reverse transcriptase is Maxima H Minus® RT. In some embodiments of any of the aspects, the reverse transcriptase is SuperScript® III. In some embodiments of any of the aspects, the reverse transcriptase is MuLV. In some embodiments of any of the aspects, the reverse transcriptase is not Protoscript® II.

[0104] In some embodiments of any of the aspects, the reverse transcriptase exhibits reduced RNase H activity compared to the wild-ty pe RT. For example, RT enzymes are often engineered with RNAse H minus point mutations to render them non-degrading to RNA.

[0105] In some embodiments, the reverse transcription reagents (e.g., a reverse transcriptase and / or a set of reverse transcription primers) are present at a sufficient concentration in the reagent combination to reverse transcribe RNA molecules in a saliva sample.

[0106] As used herein, one unit (“U”) of reverse transcriptase is defined as is defined as the amount of enzy me that will incorporate 1 nmol of dTTP into acid-insoluble material in a total reaction volume of 50 pl in a set time period (e.g., 20 minutes; e.g., 10 minutes) at a set temperature (e.g., 50°C; e.g., 37°C) using poly(rA)’oligo(dT)is as template. In some embodiments of any of the aspects, the reverse transcriptase is provided at a concentration of at least 1 U / pL, at least 2 U / pL, at least 3 U / pL, at least 4 U / pL, at least 5 U / pL, at least 6 U / pL, at least 7 U / pL, at least 8 U / pL, at least 9 U / pL, at least 10 U / pL, at least 20 U / pL, at least 30 U / pL, at least 40 U / pL, at least 50 U / pL, at least 60 U / pL, at least 70 U / pL, at least 80 U / pL. at least 90 U / pL. at least 100 U / pL, at least 110 U / pL, at least 120 U / pL. at least 130 U / pL, at least 140 U / pL, at least 150 U / pL, at least 160 U / pL, at least 170 U / pL, at least180 U / pL, at least 190 U / pL, at least 200 U / pL, at least 210 U / pL, at least 220 U / pL, at least230 U / pL, at least 240 U / pL, at least 250 U / pL, at least 260 U / pL, at least 270 U / pL, at least280 U / pL, at least 290 U / pL, at least 300 U / pL, at least 310 U / pL, at least 320 U / pL, at least330 U / pL, at least 340 U / pL, at least 350 U / pL, at least 360 U / pL, at least 370 U / pL, at least380 U / pL, at least 390 U / pL, at least 400 U / pL, at least 410 U / pL, at least 420 U / pL, at least430 U / pL, at least 440 U / pL, at least 450 U / pL, at least 460 U / pL, at least 470 U / pL, at least480 U / pL, at least 490 U / pL, or at least 500 U / pL. In some embodiments of any of the aspects, the reverse transcriptase is provided at a concentration of about 20 U / pL. In someAttorney Docket No: 700355-088492WOPT embodiments of any of the aspects, the reverse transcriptase is provided at a concentration of about 200 U / pL.

[0107] In some embodiments of any of the aspects, the sample is contacted with a set of reverse transcription primers. In some embodiments of any of the aspects, the set of reverse transcription primers comprises primers that bind to target RNA and non-target RNA in the sample, i.e., "‘general’' primers. In some embodiments of any of the aspects, the set of reverse transcription primers comprises random hexamers, i.e., a mixture of oligonucleotides representing all possible hexamer sequences. In some embodiments of any of the aspects, the set of reverse transcription primers comprises oligo(dT) primer, which bind to the polyA tails of mRNAs or viral transcripts.

[0108] In some embodiments of any of the aspects, the set of reverse transcription primers is specific to the target RNA. In some embodiments of any of the aspects, the set of reverse transcription primers comprises a reverse primer from the set of isothermal amplification primers. In embodiments comprising a one-pot reaction, the set of reverse transcription primers can comprise the isothermal amplification primers or a subset thereof, or the isothermal amplification primers can comprise the reverse transcription primers or a subset thereof. In some embodiments of any of the aspects, the reverse transcription comprises one round of polymerization, wherein the target RNA is reverse-transcribed into a single-stranded cDNA.

[0109] In some embodiments of any of the aspects, the set of reverse transcription primers are provided at a sufficient concentration, e g., 0.2 uM to 1 .6 uM, to be added to reaction mixture. As a non-limiting example, the reverse transcription primers are provided at a concentration of at least 0. 1 uM, at least 0.2 uM, at least 0.3 uM, at least 0.4 uM, at least 0.5 uM, at least 0.6uM, at least 0.7 uM, at least 0.8 uM. at least 0.9 uM, at least 1 uM, at least 1.1 uM, at least 1.2 uM, at least 1.3 uM, at least 1.4 uM, at least 1.5 uM, at least 1.6uM, at least 1.7 uM, at least 1.8 uM, at least 1.9 uM, at least 2 uM, at least 3 uM, at least 4 uM, at least 5 uM, at least 6uM, at least 7 uM, at least 8 uM, at least 9 uM, at least 10 uM, at least 11 uM, at least 12 uM, at least 13 uM, at least 14 uM, at least 15 uM, at least 16uM, at least 17 uM, at least 18 uM, at least 19 uM, at least 20 uM, at least 21 uM, at least 22 uM, at least 23 uM, at least 24 uM, at least 25 uM, at least 26 uM, at least 27 uM, at least 28 uM, at least 29 uM, at least 30 uM, at least 35 uM, at least 40 uM, at least 45 uM, at least or at least 50 uM.

[0110] In some embodiments of any of the aspects, the reverse transcription step comprises contacting the sample with a reverse transcriptase, a set of reverse transcriptionAttorney Docket No: 700355-088492WOPT primers, and at least one of the following: a reaction buffer, water, magnesium acetate (or another magnesium compound such as magnesium chloride) dNTPs, and / or DTT. In some embodiments of any of the aspects, the reaction buffer maintains the reaction at specific optimal pH and can include such components as Tris, KC1, MgCh, and other buffers or salts. Magnesium ions (Mg2) can function as a cofactor for polymerases, increasing their activity. Deoxynucleoside triphosphate (dNTPs) are free nucleoside triphosphates comprising deoxyribose as the sugar (e.g., dATP, dGTP, dCTP, and dTTP) that are used in the polymerization of the cDNA. Dithiothreitol (DTT) is a redox reagent used to stabilize proteins which possess free sulfhydryl groups (e.g., RT).

[0111] The reverse transcription can be performed at a temperature optimal for the activity of the reverse transcriptase used. In some embodiments of any of the aspects, the reverse transcription is performed at about 65 °C. As a non-limiting example, the reverse transcription is performed at a temperature of at least 12°C, at least 13°C, at least 14°C, at least 15°C, at least 16°C, at least 17°C, at least 18°C, at least 19°C, at least 20°C, at least 21°C, at least 22°C, at least 23°C, at least 24°C. at least 25°C, at least 26°C, at least 27°C, at least 28°C, at least 29°C, at least 30°C, at least 31 °C, at least 32°C, at least 33°C, at least 34°C, at least 35°C, at least 36°C, at least 37°C, at least 38°C, at least 39°C, at least 40°C, at least 41 °C, at least 42°C, at least 43°C, at least 44°C, at least 45°C, at least 46°C, at least 47°C, at least 48°C, at least 49°C, at least 50°C, at least 51 °C, at least 52°C, at least 53°C, at least 54°C. at least 55°C, at least 56°C, at least 57°C, at least 58°C. at least 59°C, at least 60°C, at least 61 °C, at least 62°C, at least 63°C, at least 64°C, at least 65°C, at least 66°C, at least 67°C, at least 68°C, at least 69°C, or at least 70°C.

[0112] In some embodiments of any of the aspects, the reverse transcription is performed at a temperature of at most 12°C, at most 13°C, at most 14°C, at most 15°C, at most 16°C. at most 17°C, at most 18°C, at most 19°C, at most 20°C, at most 21°C, at most 22°C, at most 23°C, at most 24°C, at most 25°C, at most 26°C, at most 27°C, at most 28°C, at most 29°C, at most 30°C, at most 31°C, at most 32°C, at most 33°C, at most 34°C, at most 35°C, at most 36°C, at most 37°C, at most 38°C. at most 39°C, at most 40°C, at most 41 °C, at most 42°C, at most 43°C, at most 44°C, at most 45°C, at most 46°C, at most 47°C, at most 48°C, at most 49°C, at most 50°C, at most 51 °C, at most 52°C, at most 53°C, at most 54°C, at most 55°C, at most 56°C, at most 57°C, at most 58°C, at most 59°C, at most 60°C, at most 61°C, at most 62°C, at most 63°C, at most 64°C, at most 65°C, at most 66°C, at most 67°C, at most 68°C, at most 69°C, or at most 70°C.Attorney Docket No: 700355-088492WOPT

[0113] In some embodiments of any of the aspects, the reverse transcription is performed at about 60 to 70°C. In some embodiments of any of the aspects, the reverse transcription is performed on a heat source set to approximately 65°C. In some embodiments of any of the aspects, the reverse transcription is performed at room temperature (e.g., 20°C-22°C). In some embodiments of any of the aspects, the reverse transcription is performed at body temperature (e.g., 37°C).

[0114] In some embodiments of any of the aspects, the reverse transcription is performed in at most about 40 minutes. As a non-limiting example, the reverse transcription is performed in at most 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, at most 6 minutes, at most 7 minutes, at most 8 minutes, at most 9 minutes, at most 10 minutes, at most 15 minutes, at most 20 minutes, at most 25 minutes, at most 30 minutes, at most 40 minutes, at most 50 minutes, at most 60 minutes, at most 70 minutes, at most 80 minutes, at most 90 minutes, or at most 100 minutes.Isothermal amplification reagents

[0115] In some embodiments, a reagent combination as described herein comprises at least one (e.g., 1, 2, 3, 4, 5, or more, which can be the same or different) isothermal amplification reagents. In some embodiments, the isothermal amplification reagent(s) comprises a DNA polymerase and a set of isothermal amplification primers.

[0116] As used herein, “isothermal amplification’7refers to amplification of nucleic acids (e.g., DNA, cDNA) that occurs at a single temperature. Isothermal amplification is an amplification process that is performed at a single temperature or where the major aspect of the amplification process is performed at a single temperature. Generally, isothermal amplification relies on the ability of a polymerase to copy the template strand being amplified to form a bound duplex. In the multi-step polymerase chain reaction (PCR), the product of the reaction is heated to separate the two strands such that a further primer can bind to the template repeating the process. Conversely, the isothermal amplification relies on a strand displacing polymerase in order to separate / displace the two strands of the duplex and re-copy the template. The key feature that differentiates the isothermal amplification is the method that is applied in order to initiate the reiterative process. Broadly isothermal amplification can be subdivided into those methods that rely on the replacement of a primer to initiate the reiterative template copying and those that rely on continued re-use or de novo synthesis of a single primer molecule.Attorney Docket No: 700355-088492WOPT

[0117] Isothermal amplification permits rapid and specific amplification of DNA at a constant temperature. In general, isothermal amplification is comprised of (i) sequencespecific hybridization of primers to specific genes or sequences within a nucleic acid sample or library, (ii) subsequent amplification involving multiple rounds of primer annealing, elongation, and strand displacement (as a non-limiting example, using a combination of recombinase, single-stranded binding proteins, and DNA polymerase), and (iii) detection of the amplification product. In some embodiments of any of the aspects, the isothermal amplification produce can be detected using a detection reagent, non-limiting examples of which are described herein. In some embodiments of any of the aspects, the isothermal amplification produce can be detected through such methods as sequencing to confirm the identity of the amplified product or general assays such as turbidity. In some types of isothermal amplification, turbidity results from pyrophosphate byproducts produced during the reaction; these byproducts form a white precipitate that increases the turbidity of the solution. The primers used in isothermal amplification are oligonucleotides of sufficient length and appropriate sequence to provide initiation of polymerization, i.e. each primer is specifically designed to be complementary to a strand of the template (e.g., target cDNA) to be amplified. In contrast to the polymerase chain reaction (PCR) technology in which the reaction is carried out with a series of alternating temperature steps or cycles, isothermal amplification is carried out at one temperature, and does not require a thermal cycler or thermostable enzymes.

[0118] Non-limiting examples of isothermal amplification include: Loop Mediated Isothermal Amplification (LAMP), Recombinase Polymerase Amplification (RPA), Helicase-dependent isothermal DNA amplification (HD A), thermophilic helicase-dependent amplification (tHDA), Rolling Circle Amplification (RCA), strand displacement amplification (SDA), ligase chain reaction (LCR), nicking enzyme amplification reaction (NEAR), polymerase Spiral Reaction (PSR), polymerase cross-linking spiral reaction (PCLSR), and transcription-based amplification systems (TAS) such as nucleic acid sequence based amplification (NASBA), Rolling Circle Amplification (RCA), “RACE” and “one-sided PCR.” See e.g., Yan et al.. Isothermal amplified detection of DNA and RNA. March 2014, Molecular BioSystems 10(5), DOI: 10.1039 / c3mb70304e, the content of which is incorporated herein by reference in its entirety.

[0119] In some embodiments of any of the aspects, the isothermal amplification is Loop Mediated Isothermal Amplification (LAMP). LAMP is a single tube technique for theAttorney Docket No: 700355-088492WOPT amplification of DNA; LAMP uses 4-6 primers, which form loop structures to facilitate subsequent rounds of amplification. Accordingly, in some embodiments of the aspects, the isothermal amplification comprises contacting the sample with a DNA polymerase and a set of primers, wherein the set of primers comprises 4, 5, or 6 loop-forming primers. In some embodiments, the set of isothermal amplification (e.g., LAMP) primers comprise SEQ ID NOs: 1-6 or any combination thereof.

[0120] In some embodiments of any of the aspects, the isothermal amplification is Recombinase Polymerase Amplification (RPA). RPA is a low temperature DNA and RNA amplification technique. The RPA process employs three core enzy mes - a recombinase, a single-stranded DNA-binding protein (SSB) and strand-displacing polymerase.Recombinases are capable of pairing oligonucleotide primers with homologous sequences in duplex DNA. SSBs bind to displaced strands of DNA and prevent the primers from being displaced. Finally, the strand displacing polymerase begins DNA synthesis where the primer has bound to the target DNA. By using two opposing primers, much like PCR, if the target sequence is indeed present, an exponential DNA amplification reaction is initiated. No other sample manipulation such as thermal or chemical melting is required to initiate amplification. At optimal temperatures (e.g., 37-42 °C), the RPA reaction progresses rapidly and results in specific DNA amplification from just a few7target copies to detectable levels, typically within 10 minutes, for rapid detection of the target nucleic acid. In some embodiments of any of the aspects, the single-stranded DNA-binding protein is a gp32 SSB protein. In some embodiments of any of the aspects, the recombinase is a uvsX recombinase. See e.g., US Patent 7,666,598, the content of which is incorporated herein by reference in its entirety. In some embodiments of any of the aspects, RPA can also be referred to as Recombinase Aided Amplification (RAA). Accordingly, in some embodiments of any of the aspects, the isothermal amplification comprises contacting the sample with a recombinase and singlestranded DNA binding protein. In some embodiments of any of the aspects, the isothermal amplification comprises contacting the sample w ith a DNA polymerase, a set of primers, a recombinase, and single-stranded DNA binding protein.

[0121] In some embodiments of any of the aspects, the isothermal amplification is Rolling Circle Amplification (RCA). RCA is a technique making use of a DNA polymerase elongating circularized oligonucleotide probes under isothermal conditions with either linear or geometric kinetics, and generating tandemly linked copies of the DNA molecule to amplify as a consequence of a complex pattern of strand displacement events. See, forAttorney Docket No: 700355-088492WOPT example, WO 94 / 03624, content of which is incorporated herein by reference in its entirety'. Generally, RCA starts from a circular DNA template and a short DNA or RNA primer to form a long single stranded molecule. Accordingly, in some embodiments of the aspects, the isothermal amplification comprises contacting the sample (e.g., a circular DNA) with a DNA polymerase and a set of primers, w hich can comprise a single primer.

[0122] In some embodiments of any of the aspects, the isothermal amplification is Helicase-dependent isothermal DNA amplification (HD A). HDA uses the double-stranded DNA unwinding activity of a helicase to separate strands for in vitro DNA amplification at constant temperature. In some embodiments of any of the aspects, the helicase is a thermostable helicase, which can improve the specificity and performance of HDA; as such, the isothermal amplification can be thermophilic helicase-dependent amplification (tHDA). As a non-limiting example, the helicase is the thermostable UvrD helicase (Tte-UvrD), which is stable and active from 45 to 65 °C. Accordingly, in some embodiments of the aspects, the isothermal amplification comprises contacting the sample with a DNA polymerase, a set of primers, and a helicase, wherein the helicase is optionally a thermostable helicase.

[0123] In some embodiments of any of the aspects, the isothermal amplification is nicking enzyme amplification reaction (NEAR), which is a similar approach to SDA. In NEAR, DNA is amplified at a constant temperature (e.g., 55 °C to 59 °C) using a polymerase and nicking enzyme. The nicking site is regenerated with each polymerase displacement step, resulting in exponential amplification. Accordingly, in some embodiments of the aspects, the isothermal amplification comprises contacting the sample with a DNA polymerase (e.g., exo- klenow), a set of primers, and a nicking enzyme (e.g., N.BstNBI).

[0124] In some embodiments of any of the aspects, the isothermal amplification is Strand Displacement Amplification (SDA). SDA is an isothermal nucleic acid amplification method which makes use of a polymerase in conjunction with an endonuclease that will cut only the polymerized strand such that the polymerase will displace such strand while generating a new ly polymerized strand. See, for example, EP 497272 and WO 96 / 23904, content of both of which is incorporated herein by reference in its entirety. Specifically, SDA is an isothermal, in vitro nucleic acid amplification technique based upon the ability of the restriction endonuclease Hindi to nick the unmodified strand of a hemiphosphorothioate form of its recognition site, and the ability' of exonuclease deficient klenow (exo-klenow) DNA polymerase to extend the 3'-end at the nick and displace the downstream DNA strand. Exponential amplification results from coupling sense and antisense reactions in whichAttorney Docket No: 700355-088492WOPT strands displaced from a sense reaction serve as target for an antisense reaction and vice versa. Accordingly, in some embodiments of the aspects, the isothermal amplification comprises contacting the sample with a DNA polymerase (e.g., exo-klenow), a set of primers, and a restriction endonuclease (e.g., Hindi).

[0125] In some embodiments of any of the aspects, the DNA polymerase used in the isothermal amplification is a strand-displacing polymerase. The term strand displacement describes the ability to displace downstream DNA encountered during synthesis. In some embodiments of any of the aspects, at least one (e.g. 1, 2, 3, or 4) strand-displacing DNA polymerase is selected from the group consisting of: Bst 2.0 WARMSTART® DNA polymerase enzyme, Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase. In some embodiments of any of the aspects, step (c) comprising contacting the sample (e.g., cDNA) with the strand-displacing DNA polymerases Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase.

[0126] In some embodiments of any of the aspects, the DNA polymerase used in the isothermal amplification is Bst 2.0 WARMSTART® DNA polymerase enzyme. In some embodiments of any of the aspects, the reverse transcriptase is compatible for use in a one- pot reaction that also comprises reverse transcription reagents. In some embodiments of any of the aspects, the reverse transcriptase is compatible for use in a LAMP reaction.

[0127] In some embodiments, the isothermal amplification reagents (e.g., a DNA polymerase and a set of isothermal amplification primers) are present at a sufficient concentration in the reagent combination to isothermally amplify the target nucleic acid (e.g., DNA, cDNA) in a saliva sample.

[0128] In some embodiments of any of the aspects, the DNA polymerase is provided (i.e., added to the reaction mixture) at a sufficient concentration to promote polymerization, e.g., 0.1 U / pL to 100 U / pL. As used herein, one unit (“U”) of DNA polymerase is defined as the amount of enz me that will incorporate 25 nmol of dNTP into acid insoluble material in a set time (e g., 30 minutes) at a set temperature (e.g., 65°C; e.g.. 37°C). In some embodiments of any of the aspects, the DNA polymerase is provided at a concentration of at least 1 U / pL, at least 2 U / pL, at least 3 U / pL, at least 4 U / pL, at least 5 U / pL, at least 6 U / pL, at least 7 U / pL, at least 8 U / pL, at least 9 U / pL, at least 10 U / pL, at least 20 U / pL, at least 30 U / pL, at least 40 U / pL, at least 50 U / pL, at least 60 U / pL, at least 70 U / pL, at least 80 U / pL, at least 90 U / pL. at least 100 U / pL, at least 110 U / pL, at least 120 U / pL. at least 130 U / pL, at leastAttorney Docket No: 700355-088492WOPT140 U / pL, at least 150 U / pL, at least 160 U / pL, at least 170 U / pL, at least 180 U / pL, at least190 U / pL, at least 200 U / pL, at least 210 U / pL. at least 220 U / pL, at least 230 U / pL, at least240 U / pL, at least 250 U / pL, at least 260 U / pL, at least 270 U / pL, at least 280 U / pL, at least290 U / pL, at least 300 U / pL, at least 310 U / pL, at least 320 U / pL, at least 330 U / pL, at least340 U / pL, at least 350 U / pL, at least 360 U / pL, at least 370 U / pL, at least 380 U / pL, at least390 U / pL, at least 400 U / pL, at least 410 U / pL, at least 420 U / pL, at least 430 U / pL, at least440 U / pL, at least 450 U / pL, at least 460 U / pL, at least 470 U / pL, at least 480 U / pL, at least490 U / pL, or at least 500 U / pL. In some embodiments of any of the aspects, the DNA polymerase is provided at a concentration of about 20 U / pL. In some embodiments of any of the aspects, the DNA polymerase is provided at a concentration of about 200 U / pL.

[0129] In some embodiments of any of the aspects, the sample is contacted with at least one set of isothermal amplification primers. In some embodiments of any of the aspects, the set of isothermal amplification primers is specific to the target nucleic acid. In some embodiments of any of the aspects, the set of isothermal amplification primers is specific (i.e., binds specifically through complementarity’) to cDNA; in other words, the DNA produced in the reverse transcription that is complementary to a target RNA. The set of isothermal amplification primers can be specific to any region of the target nucleic acid. SEQ ID NOs: 1-6 are non-limiting examples of isothermal amplification primers that are specific for SARS-CoV-2.

[0130] In some embodiments of any of the aspects, the set of isothermal amplification primers are provided at a sufficient concentration, e g., 0.2 uM to 1 .6 uM, to be added to reaction mixture. As a non-limiting example, the isothermal amplification primers are provided at a concentration of at least 0. 1 uM, at least 0.2 uM, at least 0.3 uM, at least 0.4 uM, at least 0.5 uM, at least 0.6uM, at least 0.7 uM. at least 0.8 uM, at least 0.9 uM, at least 1 uM, at least 1.1 uM, at least 1.2 uM, at least 1.3 uM, at least 1.4 uM, at least 1.5 uM, at least 1.6uM, at least 1.7 uM, at least 1.8 uM, at least 1.9 uM, at least 2 uM, at least 3 uM, at least 4 uM, at least 5 uM, at least 6uM, at least 7 uM, at least 8 uM, at least 9 uM, at least 10 uM, at least 11 uM, at least 12 uM, at least 13 uM, at least 14 uM, at least 15 uM, at least 16uM, at least 17 uM, at least 18 uM, at least 19 uM, at least 20 uM, at least 21 uM, at least 22 uM, at least 23 uM, at least 24 uM, at least 25 uM, at least 26 uM, at least 27 uM, at least 28 uM, at least 29 uM, at least 30 uM, at least 35 uM, at least 40 uM, at least 45 uM, at least or at least50 uM.Attorney Docket No: 700355-088492WOPT

[0131] In some embodiments of any of the aspects, the sample is contacted with a DNA polymerase, a set of isothermal amplification primers, and at least one of the following: dNTPs, reaction buffer (e.g., hydration buffer), water, and / or magnesium acetate.

[0132] In some embodiments of any of the aspects, the isothermal amplification is performed at about 65°C. As a non-limiting example, the isothermal amplification is performed at a temperature of at least 12°C, at least 13°C, at least 14°C, at least I5°C, at least 16°C, at least 17°C, at least 18°C, at least 19°C, at least 20°C, at least 21 °C, at least 22°C, at least 23°C, at least 24°C, at least 25°C, at least 26°C, at least 27°C, at least 28°C, at least 29°C, at least 30°C, at least 31 °C, at least 32°C, at least 33°C, at least 34°C, at least 35°C, at least 36°C, at least 37°C, at least 38°C, at least 39°C, at least 40°C, at least 41°C, at least 42°C, at least 43°C, at least 44°C, at least 45°C. at least 46°C, at least 47°C, at least 48°C, at least 49°C, at least 50°C, at least 51°C, at least 52°C, at least 53°C, at least 54°C, at least 55°C, at least 56°C, at least 57°C, at least 58°C, at least 59°C, at least 60°C, at least 61°C, at least 62°C, at least 63°C, at least 64°C, at least 65°C, at least 66°C, at least 67°C, at least 68°C, at least 69°C, or at least 70°C.

[0133] In some embodiments of any of the aspects, the isothermal amplification is performed at a temperature of at most 12°C, at most 13°C, at most 14°C, at most I5°C, at most 16°C, at most 17°C, at most 18°C, at most 19°C, at most 20°C, at most 21°C, at most 22°C, at most 23°C, at most 24°C, at most 25°C, at most 26°C, at most 27°C, at most 28°C, at most 29°C, at most 30°C, at most 31°C, at most 32°C, at most 33°C. at most 34°C, at most 35°C, at most 36°C, at most 37°C, at most 38°C, at most 39°C, at most 40°C, at most 41 °C, at most 42°C, at most 43°C, at most 44°C, at most 45°C, at most 46°C, at most 47°C, at most 48°C, at most 49°C, at most 50°C, at most 51°C, at most 52°C, at most 53°C, at most 54°C, at most 55°C, at most 56°C, at most 57°C, at most 58°C, at most 59°C. at most 60°C, at most 61°C, at most 62°C, at most 63°C, at most 64°C, at most 65°C, at most 66°C, at most 67°C, at most 68°C, at most 69°C, or at most 70°C.

[0134] In some embodiments of any of the aspects, the isothermal amplification is performed at about 60 to 70°C. In some embodiments of any of the aspects, the isothermal amplification is performed on a heat source set to approximately 65°C. In some embodiments of any of the aspects, the isothermal amplification is performed at room temperature (e.g., 20°C-22°C). In some embodiments of any of the aspects, the isothermal amplification step(s) is performed at body temperature (e.g., 37°C).Attorney Docket No: 700355-088492WOPT

[0135] In some embodiments of any of the aspects, the isothermal amplification is performed in at most 40 minutes. As a non-limiting example, the isothermal amplification is performed in at most 5 minutes, at most 6 minutes, at most 7 minutes, at most 8 minutes, at most 9 minutes, at most 10 minutes, at most 15 minutes, at most 20 minutes, at most 25 minutes, at most 30 minutes, at most 40 minutes, at most 50 minutes, at most 60 minutes, at most 70 minutes, at most 80 minutes, at most 90 minutes, or at most 100 minutes.Detection reagents

[0136] In some embodiments, a reagent combination as described herein comprises at least one (e.g., 1, 2, 3, 4, 5, or more, which can be the same or different) detection reagent. As used herein, the term '“detection reagent” refers to a molecule that is capable of indicating the occurrence of the isothermal amplification. In some embodiments, the detection reagent is specific to a product of LAMP, including but not limited to a change in pH (e.g., via Phenol Red), production of pyrophosphate (e.g., via Malachite Green), or generation of dsDNA (e.g., via SYTO-80, Methyl Green, SYBR Green). In some embodiments, the detection reagent is a fluorescent dye that specifically binds to double-stranded DNA (dsDNA). In some embodiments, the detection reagent comprises N',N'-dimethyl-N-[4-[(E)-(3-methyl-l,3- benzothiazol-2-ylidene)methyl]-l-phenylquinolin-l-ium-2-yl]-N-propylpropane-l,3-di amine (SYBR® Green, Formula V).

[0137] Formula V: SYBR® Green:Attorney Docket No: 700355-088492WOPT

[0138] In some embodiments, the detection reagent is present at a sufficient concentration in the reagent combination to detect the amplified target nucleic acid in a saliva sample. In some embodiments, the detection reagent (e.g., SYBR® Green) is present at a concentration of about IX (e.g., from a 10,000x stock). In some embodiments, the detection reagent (e.g., SYBR® Green) is present at a concentration of about O.lx, about 0.2x, about 0.3x, about 0.4x, about 0.5x, about 0.6x. about 0.7x. about 0.8x, about 0.9x, about lx, about O. lx to lx, about 0.2x to lx, about 0.5x to lx, or more (e.g., from a 10,000x stock).

[0139] In some embodiments, the detection reagent is physically separated from the remaining reagents (e.g., the lysis reagent, the RNase inhibitor, the reverse transcription reagents, and / or the isothermal amplification reagents). In some embodiments, the detection reagent is located on the inner, bottom surface of a lid of a reagent container, and the remaining reagents (e.g., the lysis reagent, the RNase inhibitor, the reverse transcription reagents, and / or the isothermal amplification reagents) are present within the reagent container, physically separated from the detection reaction (see e.g., FIG. 1). In some embodiments, the detection reagent is added or otherwise introduced to the combination of reagents after reverse transcription and / or isothermal amplification has already occurred. In some embodiments, the detection reagent is introduced to the combination of reagents by inverting a reagent container comprising the combination of reagents and with the detection reagent located on the inner, bottom surface of a lid of a reagent container (see e.g., FIG. 1).Target Nucleic A cid

[0140] Described herein are methods, kits, and systems that can be used to detect a target nucleic acid. The target nucleic acid can be any desired nucleic acid. In some embodiments of any of the aspects, the target nucleic acid is a target DNA, which can also be referred to as “an DNA of interest” or a “gene of interest.” In some embodiments of any of the aspects, the target DNA can be any DNA sequence or any gene. Exemplary target DNA include, but is not limited to, genomic DNA, viral DNA, cDNA, single-stranded DNA, double-stranded DNA, circular DNA. etc.

[0141] In some embodiments of any of the aspects, the target nucleic acid is a target RNA, which can also be referred to as “an RNA of interest.” Ribonucleic acid (RNA) is a polymeric nucleic acid molecule essential in various biological roles in coding, decoding, regulation and expression of genes. Each nucleotide in RNA contains a ribose sugar, with carbons numbered 1' through 5'. A base is attached to the 1' position, in general, adenine (A), cytosine (C), guanine (G), or uracil (U). A phosphate group is attached to the 3' position ofAttorney Docket No: 700355-088492WOPT one ribose and the 5' position of the next. The phosphate groups have a negative charge each, making RNA a charged molecule (polyanion). An important structural component of RNA that distinguishes it from DNA is the presence of a hydroxyl group at the 2' position of the ribose sugar. In some embodiments of any of the aspects, the target RNA can be any known type of RNA. In some embodiments of any of the aspects, the target RNA comprises an RNA selected from Table 3.

[0142] T able 3 : N on-limiting Examples of T arget RN AsAttorney Docket No: 700355-088492WOPT

[0143] In some embodiments, the target nucleic acid comprises a gene from a microorganism. In some embodiments, the target nucleic acid comprises a gene from a bacterium, virus, fungus, parasite, protozoa, or archaea. In some embodiments, the target nucleic acid comprises a gene from a pathogen.

[0144] In some embodiments of any of the aspects, the target RNA can be a viral RNA or RNA from an RNA virus. As used herein, the term “RNA virus"’ refers to a virus comprising an RNA genome. In some embodiments of any of the aspects, the RNA virus is a doubleAttorney Docket No: 700355-088492WOPT stranded RNA virus, a positive-sense RNA virus, a negative-sense RNA virus, or a reverse transcribing virus (e.g., retrovirus).

[0145] In some embodiments of any of the aspects, the RNA virus is a Group III (i.e., double stranded RNA (dsRNA)) virus. In some embodiments of any of the aspects, the Group III RNA virus belongs to a viral family selected from the group consisting of: Amalgaviridae, Bimaviridae. Chrysoviridae, Cystoviridae, Endomaviridae, Hypoviridae, Megabimaviridae, Partitiviridae, Picobimaviridae, Reovindae (e.g., Rotavirus), Totiviridae, Quadriviridae. In some embodiments of any of the aspects, the Group III RNA virus belongs to the Genus Botybimavirus. In some embodiments of any of the aspects, the Group III RNA virus is an unassigned species selected from the group consisting of: Botrytis porri RNA virus 1, Circulifer tenellus virus 1, Colletotrichum camelliae filamentous virus 1, Cucurbit yellows associated virus, Sclerotinia sclerotiorum debilitation-associated virus, and Spissistilus festinus virus 1.

[0146] In some embodiments of any of the aspects, the RNA virus is a Group IV (i.e., positive-sense single stranded (ssRNA)) virus. In some embodiments of any of the aspects, the Group IV RNA virus belongs to a viral order selected from the group consisting of: Nidovirales, Picomavirales, and Tymovirales. In some embodiments of any of the aspects, the Group IV RNA virus belongs to a viral family selected from the group consisting of: Arteriviridae, Coronaviridae (e.g., Coronavirus, SARS-CoV). Mesoniviridae, Roniviridae, Dicistroviridae, Iflaviridae, Mamaviridae, Picomaviridae (e.g., Poliovirus, Rhinovirus (a common cold virus), Hepatitis A virus), Secoviridae (e.g., sub Comovirinae), Alphaflexiviridae, Betaflexiviridae, Gammaflexiviridae, Tymoviridae, Alphatetraviridae, Alvemaviridae, Astroviridae, Bamaviridae, Benyviridae, Bromoviridae, Caliciviridae (e.g., Norwalk virus), Carmotetraviridae, Closteroviridae, Flaviviridae (e.g., Yellow fever virus. West Nile virus, Hepatitis C virus, Dengue fever virus, Zika virus), Fusariviridae, Hepeviridae, Hypoviridae, Leviviridae, Luteoviridae (e.g., Barley yellow dwarf virus), Polycipiviridae, Namaviridae, Nodaviridae, Permutotetraviridae, Poty viridae. Sarthroviridae, Statovirus, Togaviridae (e.g., Rubella virus, Ross River virus. Sindbis virus, Chikungunya virus), Tombusviridae, and Virgaviridae. . In some embodiments of any of the aspects, the Group IV RNA virus belongs to a viral genus selected from the group consisting of: Bacillariomavirus, Dicipivirus, Labymavirus, Sequiviridae, Blunervirus, Cilevirus, Higrevirus. Idaeovirus, Negevirus, Ourmiavirus, Polemovirus, Sinaivirus, and Sobemovirus. In some embodiments of any of the aspects, the Group IV RNA virus is an unassignedAttorney Docket No: 700355-088492WOPT species selected from the group consisting of: Acyrthosiphon pisum virus, Bastrovirus. Blackford virus, Blueberry necrotic ring blotch virus, Cadicistrovirus, Chara australis virus, Extra small virus, Goji berry chlorosis virus, Hepelivirus, Jingmen tick virus, Le Blanc virus, Nedicistrovirus, Nesidiocoris tenuis virus 1, Niflavirus, Nylanderia fulva virus 1, Orsay virus, Osedax japonicus RNA vims 1, Picalivirus, Plasmopara halstedii virus, Rosellinia necatrix fusarivirus 1. Santeuil virus, Secalivirus, Solenopsis invicta vims 3, Wuhan large pig roundworm vims. In some embodiments of any of the aspects, the Group IV RNA virus is a satellite vims selected from the group consisting of: Family Sarthroviridae, Genus Albetovirus, Genus Aumaivims, Genus Papanivims, Genus Virtovirus, and Chronic bee paralysis virus.

[0147] In some embodiments of any of the aspects, the RNA virus is a Group V (i.e., negative-sense ssRNA) virus. In some embodiments of any of the aspects, the Group V RNA virus belongs to a viral phylum or subphylum selected from the group consisting of: Negamaviricota, Haploviricotina, and Polyploviricotina. In some embodiments of any of the aspects, the Group V RNA vims belongs to a viral class selected from the group consisting of: Chunqiuviricetes, Elhoviricetes, Insthoviricetes, Milneviricetes, Monjiviricetes, and Yunchangviricetes. In some embodiments of any of the aspects, the Group V RNA vims belongs to a viral order selected from the group consisting of: Articulavirales, Bunyavirales, Goujianvirales, Jingchuvirales, Mononegavirales, Muvirales, and Serpentovirales. In some embodiments of any of the aspects, the Group V RNA virus belongs to a viral family selected from the group consisting of: Amnoonviridae (e.g., Taastrup virus), Arenaviridae (e.g., Lassa virus), Aspiviridae, Bomaviridae (e.g., Boma disease virus), Chuviridae, Cmliviridae, Feraviridae, Filoviridae (e.g., Ebola vims, Marburg virus), Fimoviridae, Hantaviridae, Jonviridae, Mymonaviridae, Nairoviridae. Nyamiviridae, Orthomyxoviridae (e.g., Influenza viruses), Paramyxoviridae (e.g.. Measles vims, Mumps virus, Nipah virus, Hendra vims, and NDV), Peribunyaviridae, Phasmaviridae, Phenuiviridae, Pneumoviridae (e.g., RSV and Metapneumovirus), Qinviridae, Rhabdoviridae (e.g., Rabies virus), Sunviridae, Tospoviridae, and Yueviridae. In some embodiments of any of the aspects, the Group V RNA vims belongs to a viral genus selected from the group consisting of: Anphevirus, Arlivirus, Chengtivirus, Crustavirus, Tilapineviridae, Wastrivirus, and Deltavirus (e g., Hepatitis D virus).

[0148] In some embodiments of any of the aspects, the RNA virus is a Group VI RNA virus, which comprises a virally encoded reverse transcriptase. In some embodiments of any of the aspects, the Group VI RNA virus belongs to the viral order Ortervirales. In someAttorney Docket No: 700355-088492WOPT embodiments of any of the aspects, the Group VI RNA virus belongs to a viral family or subfamily selected from the group consisting of: Belpaoviridae, Caulimoviridae, Metaviridae, Pseudoviridae, Retroviridae (e.g., Retroviruses, e.g. HIV), Orthoretrovirinae, and Spumaretrovirinae. In some embodiments of any of the aspects, the Group VI RNA virus belongs to a viral genus selected from the group consisting of: Alpharetrovirus (e.g., Avian leukosis virus; Rous sarcoma virus). Betaretrovirus (e.g., Mouse mammary tumour virus), Bovispumavirus (e.g., Bovine foamy virus). Deltaretrovirus (e.g.. Bovine leukemia virus; Human T-lymphotropic virus), Epsilonretrovirus (e.g., Walleye dermal sarcoma virus), Equispumavirus (e.g., Equine foamy virus), Felispumavirus (e.g., Feline foamy virus), Gammaretrovirus (e.g., Murine leukemia virus; Feline leukemia virus), Lentivirus (e g., Human immunodeficiency virus 1; Simian immunodeficiency virus; Feline immunodeficiency virus), Prosimiispumavirus (e.g., Brown greater galago prosimian foamy virus), and Simiispumavirus (e.g., Eastern chimpanzee simian foamy virus). In some embodiments of any of the aspects, the virus is an endogenous retrovirus (ERV; e.g., endogenous retrovirus group W envelope member 1 (ERVWE1); HCP5 (HLA Complex P5); Human teratocarcinoma-derived virus), which are endogenous viral elements in the genome that closely resemble and can be derived from retroviruses.

[0149] In some embodiments of any of the aspects, the target nucleic acid comprises viral DNA or RNA produced by a virus with a DNA genome, i.e., a DNA virus. As a non-limiting example the DNA virus is a Group I (dsDNA) virus, a Group II (ssDNA) virus, or a Group VII (dsDNA-RT) virus. In some embodiments of any of the aspects, the DNA produced by a DNA virus comprises the DNA genome or fragments thereof. In some embodiments of any of the aspects, the RNA produced by a DNA virus comprises an RNA transcript of the DNA genome.

[0150] In some embodiments of any of the aspects, the DNA virus is a Group I (i.e., dsDNA) virus. In some embodiments of any of the aspects, the Group I dsDNA virus belongs to a viral order selected from the group consisting of: Caudovirales; Herpesvirales; and Ligamenvirales. In some embodiments of any of the aspects, the Group I dsDNA virus belongs to a viral family selected from the group consisting of: Adenoviridae (e.g., adenoviruses), Alloherpesviridae, Ampullaviridae, Ascoviridae, Asfarviridae (e g., African swine fever virus), Baculoviridae, Bicaudaviridae, Clavaviridae, Corticoviridae, Fuselloviridae, Globuloviridae, Guttaviridae, Herpesviridae (e.g., human herpesviruses, Varicella Zoster virus), Hytrosaviridae, Iridoviridae, Lavidaviridae. Lipothrixviridae,Attorney Docket No: 700355-088492WOPTMalacoherpesviridae, Marseilleviridae, Mimiviridae, Myoviridae (e.g., Enterobacteria phage T4), Nimaviridae, Nudiviridae, Pandoraviridae, Papillomaviridae, Phycodnaviridae, Plasmaviridae, Podoviridae (e.g., Enterobacteria phage T7), Polydnaviruses, Polyomaviridae (e.g., Simian virus 40, JC virus, BK virus), Poxviridae (e.g., Cowpox virus, smallpox), Rudiviridae, Siphoviridae (e.g., Enterobacteria phage ), Sphaerolipoviridae, Tectiviridae, Tristromaviridae, and Turriviridae. In some embodiments of any of the aspects, the Group I dsDNA virus belongs to a viral genus selected from the group consisting of: Dinodnavirus, Rhizidiovirus, and Salterprovirus. In some embodiments of any of the aspects, the Group I dsDNA vims belongs to an unassigned viral species selected from the group consisting of: Abalone shriveling syndrome-associated virus, Apis mellifera fdamentous virus, Bandicoot papillomatosis carcinomatosis virus. Cedratvirus, Kaumoebavirus, KIs-V, Lentille vims. Leptopilina boulardi filamentous virus. Megavirus, Metallosphaeraturreted icosahedral virus, Methanosarcina spherical virus, Mollivirus sibericum virus, Orpheovims IHUMI-LCC2, Phaeocystis globosa virus, and Pithovims. In some embodiments of any of the aspects, the Group I dsDNA virus is a virophage selected from the group consisting of: Organic Lake virophage, Ace Lake Mavirus virophage, Dishui Lake virophage 1, Guarani virophage, Phaeocystis globosa virus virophage, Rio Negro virophage, Sputnik virophage 2, Yellowstone Lake virophage 1, Yellowstone Lake virophage 2, Yellowstone Lake virophage 3, Yellowstone Lake virophage 4, Yellowstone Lake virophage 5, Yellowstone Lake virophage 6, Yellowstone Lake virophage 7, and Zamilon virophage 2.

[0151] In some embodiments of any of the aspects, the DNA virus is a Group II (i.e., ssDNA) virus. In some embodiments of any of the aspects, the Group II ssDNA virus belongs to a viral family selected from the group consisting of: Anelloviridae. Bacilladnaviridae, Bidnaviridae, Circoviridae, Geminiviridae, Genomoviridae. Inoviridae. Microviridae, Nanoviridae, Parvoviridae, Smacoviridae, and Spiraviridae.

[0152] In some embodiments of any of the aspects, the DNA vims is a Group VII (i.e., dsDNA-RT) vims. In some embodiments of any of the aspects, the Group VII dsDNA-RT virus belongs to the Ortervirales order. In some embodiments of any of the aspects, the Group VII dsDNA-RT virus belongs to the Caulimoviridae family or to the Hepadnaviridae family (e.g., Hepatitis B vims). In some embodiments of any of the aspects, the Group VII dsDNA-RT vims belongs to a viral genus selected from the group consisting of: Badnavirus, Caulimovirus, Cavemovirus. Petuvims, Rosadnavims, Solendovirus, Soymovirus, Tungrovims. Avihepadnavims, and Orthohepadnavirus.Attorney Docket No: 700355-088492WOPT

[0153] In some embodiments of any of the aspects, the target nucleic acid is from a coronavirus. The scientific name for coronavirus is Orthocoronavirinae or Coronavirinae. Coronaviruses belong to the family of Coronaviridae, order Nidovirales, and realm Riboviria. They are divided into alphacoronaviruses and betacoronaviruses which infect mammals, and gammacoronaviruses and deltacoronaviruses which primarily infect birds. Non limiting examples of alphacoronaviruses include: Human coronavirus 229E, Human coronavirus NL63, Miniopterus bat coronavirus 1, Mimopterus bat coronavirus HK.U8, Porcine epidemic diarrhea virus, Rhinolophus bat coronavirus HKU2, Scotophilus bat coronavirus 512, and Feline Infectious Peritonitis Virus (FIPV, also referred to as Feline Infectious Hepatitis Virus). Non limiting examples of betacoronaviruses include: Betacoronavirus 1 (e.g., Bovine Coronavirus. Human coronavirus OC43), Human coronavirus HKU1, Murine coronavirus (also known as Mouse hepatitis virus (MHV)), Pipistrellus bat coronavirus HKU5, Rousettus bat coronavirus HKU9, Severe acute respiratory' syndrome-related coronavirus (e.g., SARS- CoV, SARS-CoV-2), Tylonycteris bat coronavirus HKU4, Middle East respiratory syndrome (MERS)-related coronavirus, and Hedgehog coronavirus 1 (EriCoV). Non limiting examples of gammacoronaviruses include: Beluga whale coronavirus SW1, and Infectious bronchitis virus. Non limiting examples of deltacoronaviruses include: Bulbul coronavirus HKU11, and Porcine coronavirus HKU15.

[0154] In some embodiments of any of the aspects, the RNA virus is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which causes coronavirus disease of 2019 (COVID19 or simply COVID). In some embodiments of any of the aspects, the RNA virus is influenza virus. In some embodiments of any of the aspects, the RNA virus is immunodeficiency virus (HIV). In some embodiments of any of the aspects, the RNA virus is any known RNA virus.

[0155] In some embodiments of any of the aspects, the target nucleic acid comprises at least a portion of Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2, (see e.g., complete genome, SARS-CoV-2 Jan. 2020 / NC_045512.2 Assembly (wuhCorl); Delta B. l.617.2, GenBank: OK09I006.I; Omi cron B. 1.1.529, GenBank: OR575624.1). In some embodiments of any of the aspects, the target nucleic acid comprises SEQ ID NO: 10 (Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2, N gene) or a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. or at least 99% identical to SEQ ID NO: 10 that maintains the same function or aAttorney Docket No: 700355-088492WOPT codon-optimized version of SEQ ID NO: 10. In some embodiments of any of the aspects, the target nucleic acid comprises at least one of SEQ ID NOs: 11-14 (see e.g., Table 5) or a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to at least one of SEQ ID NOs: 11-14 that maintains the same function or a codon-optimized version of SEQ ID NOs: 11-14.

[0156] SEQ ID NO: 10, Severe acute respiratory syndrome coronavirus 2 isolate Wuhan- Hu-1, N nucleocapsid phosphoprotein, Gene ID: 43740575, 1260 bp ss-RNA, NC_045512 REGION: 28274-29533ATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTG GACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGAT CAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGC TCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGTTCC AATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTAC CAGACGAATTCGTGGTGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTA TTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGGTGCTAACAAA GACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCAC ATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAG GAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAA GCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAG GCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTG CTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGG TAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGC TTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACA AGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGGACCAGGA ACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGC CCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCT TCGGGAACGTGGTTGACCTACACAGGTGCCATCAAATTGGATGACAAAGATCCA AATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACAT TCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAA GCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTGACTCTTCTTCCTGCTGCA GATTTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTCAA CTCAGGCCTAAAttorney Docket No: 700355-088492WOPT

[0157] In some embodiments of any of the aspects, the viral RNA is an RNA produced by a virus with a DNA genome, i.e., a DNA virus. As a non-limiting example the DNA virus is a Group I (dsDNA) virus, a Group II (ssDNA) virus, or a Group VII (dsDNA-RT) virus. In some embodiments of any of the aspects, the RNA produced by a DNA virus comprises an RNA transcript of the viral DNA genome.Kits

[0158] Another aspect of the technology described herein relates to kits for detecting a target nucleic acid. Described herein are reagents or combinations thereof that can be included in one or more of the kits described herein. In one aspect, described herein is a kit for detecting a target nucleic acid in a saliva sample, the kit comprising at least one reagent container and / or at least one sample collection container. The kit may comprise any of the reagents discussed herein. Further, the reagents of the kit may be freeze dried. In some embodiments, the kit comprises at least one (e.g., 1, 2, 3, 4, 5, or more, which can be the same or different) reagent container.

[0159] Generally, the kit (e.g., the at least one reagent container) comprises one or more of the following: a lysis reagent, an RNase inhibitor, reverse transcription reagents (e.g., a reverse transcriptase and / or a set of reverse transcription primers), isothermal amplification reagents (e.g., a DNA polymerase and a set of isothermal amplification primers), and / or a detection reagent, or any combination of thereof (see e.g.. Table 2, above). It is noted that a kit can comprise any one, two, three, four, five, or more, or all of the reagents listed above.

[0160] In some embodiments, the detection reagent is physically separated from the remaining reagents (e.g., the lysis reagent, the RNase inhibitor, the reverse transcription reagents, and / or the isothermal amplification reagents) in the reagent container. In some embodiments, the reagent container comprises a lid, and the detection reagent is located on the inner, bottom surface of the lid, and the remaining reagents (e.g., the lysis reagent, the RNase inhibitor, the reverse transcription reagents, and / or the isothermal amplification reagents) are present within the reagent container, physically separated from the detection reaction (see e.g., FIG. 1).

[0161] In some embodiments, the sample collection container is for collecting a sample, including but not limited to a saliva sample from a subject. In some embodiments, the sample collection container comprises a tube. In some embodiments, the sample collection container comprises a lid, such as a cap. In some embodiments, the kit comprises at least one (e.g.. 1, 2, 3, 4, 5, or more, which can be the same or different) sample collection container.Attorney Docket No: 700355-088492WOPT

[0162] In some embodiments of any of the aspects, the kit further comprises at least one of the following: reaction buffer, diluent, water, magnesium acetate (or another magnesium compound such as magnesium chloride) dNTPs, and / or DTT, or any combination thereof.

[0163] In some embodiments of any of the aspects, the kit further comprises reagents for amplifying and / or detecting a control. Non-limiting examples of negative controls for SARS- CoV-2 include MERS. SARS, 229e. NL63, and hKul, which can be detected using specific primers.

[0164] In some embodiments, the kit comprises an effective amount of the reagents as described herein. As will be appreciated by one of skill in the art, the reagents can be supplied in a lyophilized form or a concentrated form that can diluted or suspended in liquid prior to use. The kit reagents described herein can be supplied in aliquots or in unit doses.

[0165] In some embodiments, the components described herein can be provided singularly or in any combination as a kit. Such a kit includes the components described herein and packaging materials thereof. In addition, a kit optionally comprises informational material.

[0166] In some embodiments, the compositions in a kit can be provided in a watertight or gas tight container which in some embodiments is substantially free of other components of the kit. For example, the reagents described herein can be supplied in more than one container, e.g., it can be supplied in a container having sufficient reagent for a predetermined number of applications, e.g., 1, 2, 3 or greater. One or more components as described herein can be provided in any form, e.g., liquid, dried or lyophilized form. Liquids or components for suspension or solution of the reagents can be provided in sterile form and should not contain microorganisms or other contaminants. When the components described herein are provided in a liquid solution, the liquid solution preferably is an aqueous solution.

[0167] The informational material can be descriptive, instructional, marketing or other material that relates to the methods described herein. The informational material of the kits is not limited in its form. In some embodiments, the informational material can include information about production of the reagents, concentration, date of expiration, batch or production site information, and so forth. In some embodiments, the informational material relates to methods for using or administering the components of the kit.

[0168] The kit will typically be provided with its various elements included in one package, e.g., a fiber-based, e.g., a cardboard, or polymeric, e.g., a Styrofoam box. The enclosure can be configured so as to maintain a temperature differential between the interior and theAttorney Docket No: 700355-088492WOPT exterior, e.g., it can provide insulating properties to keep the reagents at a preselected temperature for a preselected time.

[0169] In some embodiments of any of the aspects, the kit can further comprise a detection device. As a non-limiting example, a detection device can comprise a light-emitting diode (LED) light source and / or a filter (e.g., plastic filter specific for the emitting wavelength of a detectable marker). In some embodiments of any of the aspects, the kit and / or the detection device is fi eld-deployable, i.e., transportable, non-refrigerated, and / or inexpensive. In some embodiments of any of the aspects, a detection device further comprises a wireless device (e.g., a cell phone, a personal digital assistant (PDA), a tablet).Assay methods

[0170] In multiple aspects, described herein are methods of detecting a target nucleic acid in a sample. In one aspect, described herein is a method of detecting a target nucleic acid in a saliva sample. In one aspect, described herein is a method of isothermally amplifying and detecting a target nucleic acid in a saliva sample. In some embodiments, the method comprises the following steps: (a) collecting or receiving the saliva sample from the subject; (b) pre-heating the sample at a sufficient temperature and for a sufficient time (e.g., to inactivate RNases in the sample and / or clarify particulates and / or mucin in the sample); (c) adding to the pre-heated sample a reagent combination as described herein (see e.g., Table 2); (d) heating the pre-heated sample and the combination of reagents at a sufficient temperature and for a sufficient time for reverse transcribing and / or isothermally amplifying the target nucleic acid, if present in the sample; and / or (e) adding a detection reagent to detect the isothermally-amplified target nucleic acid, if present in the sample, or any combination of steps (see e.g., Table 4). In some embodiments, the reagent combination comprises: (i) a lysis reagent; (ii) an RNase inhibitor; (iii) reverse transcription reagents comprising a reverse transcriptase and a set of reverse transcription primers; and / or (iii) isothermal amplification reagents comprising a DNA polymerase and a set of isothermal amplification primers.

[0171] Table 4: Exemplary combinations of assay method stepsAttorney Docket No: 700355-088492WOPTAttorney Docket No: 700355-088492WOPT

[0172] In embodiments in which the target nucleic acid is an RNA molecule, the reagent combination can comprise: (i) a lysis reagent; (ii) an RNase inhibitor; (iii) reverse transcription reagents comprising a reverse transcriptase and a set of reverse transcription primers; and (iv) isothermal amplification reagents comprising a DNA polymerase and a set of isothermal amplification primers. In embodiments in which the target nucleic acid is an RNA molecule, the method can comprise the following steps: (a) collecting or receiving the saliva sample from the subject; (b) pre-heating the sample at a sufficient temperature and for a sufficient time (e.g., to inactivate RNases in the sample and / or clarify particulates and / or mucin in the sample); (c) adding to the pre-heated sample a reagent combination as described herein (see e.g., Table 2); (d) heating the pre-heated sample and the combination of reagents at a sufficient temperature and for a sufficient time for reverse transcribing and isothermally amplifying the target nucleic acid, if present in the sample; and (e) adding a detection reagent to detect the isothermally-amplified target nucleic acid, if present in the sample.

[0173] In embodiments in which the target nucleic acid is a DNA molecule, the reagent combination can comprise: (i) a lysis reagent; and (ii) isothermal amplification reagents comprising a DNA polymerase and a set of isothermal amplification primers. In embodiments in which the target nucleic acid is an DNA molecule, the method can comprise the following steps: (a) collecting or receiving the saliva sample from the subject; (b) preheating the sample at a sufficient temperature and for a sufficient time (e.g., to clarifyAttorney Docket No: 700355-088492WOPT particulates and / or mucin in the sample); (c) adding to the pre-heated sample a reagent combination as described herein (see e.g., Table 2); (d) heating the pre-heated sample and the combination of reagents at a sufficient temperature and for a sufficient time for isothermally amplifying the target nucleic acid, if present in the sample; and (e) adding a detection reagent to detect the isothermally-amplified target nucleic acid, if present in the sample.

[0174] In embodiments in which the target nucleic acid is an DNA molecule, the method does not include a pre-heating step and can comprise the following steps: (a) collecting or receiving the saliva sample from the subject; (c) adding to the sample a reagent combination as described herein (see e.g., Table 2); (d) heating the sample and the combination of reagents at a sufficient temperature and for a sufficient time for isothermaHy amplify ing the target nucleic acid, if present in the sample; and (e) adding a detection reagent to detect the isothermally-amplified target nucleic acid, if present in the sample.Sample collecting step

[0175] Described herein are methods, kits, and systems permitting detection of a target nucleic acid from a sample. The term ‘'sample” or “test sample” as used herein denotes a sample taken or isolated from a biological organism, e.g., a subject in need of testing. In some embodiments of any of the aspects, the technology described herein encompasses several examples of a biological sample, including but not limited to a saliva or sputum sample. In some embodiments of any of the aspects, the biological sample comprises cells, or tissue, or bodily fluid. The term also includes a mixture of the above-mentioned samples. The term “test sample” also includes untreated or pretreated (or pre-processed) biological samples. In some embodiments of any of the aspects, a test sample can comprise cells from a subject.

[0176] In some embodiments, a saliva sample is collected from a subject by the subject passively drooling into a collection tube, for example for about 0.1, about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, or more minutes. In some embodiments, a saliva sample is collected from a subject by passive drooling into a collection tube by the subject spitting into a collection tube. In some embodiments, a saliva sample is collected from a subject using a swab in the oral cavity that is then added to a sample collection tube. In some embodiments, a saliva sample is collected from a subject and then received at a separate location for further processing (e.g., pre-heating, reverse transcription, isothermal amplification, and / or detection).Attorney Docket No: 700355-088492WOPT

[0177] In some embodiments of any of the aspects, the sample is contacted with a transport media, such a viral transport media (VTM). In some embodiments of any of the aspects, transport media preserves the target nucleic acid between the time of sample collection and detection of the target nucleic acid. The constituents of suitable viral transport media are designed to provide an isotonic solution containing protective protein, antibiotics to control microbial contamination, and one or more buffers to control the pH. Isotonicity, however, is not an absolute requirement; some highly successful transport media contain hypertonic solutions of sucrose. Liquid transport media are used primarily for transporting swabs or materials released into the medium from a collection swab. Liquid media may be added to other specimens when inactivation of the viral agent is likely and when the resultant dilution is acceptable. A suitable VTM for use in collecting throat and nasal swabs from human patients is prepared as follows: (1) add 10g veal infusion broth and 2g bovine albumin fraction V to sterile distilled water (to 400 ml); (2) add 0.8 ml gentamicin sulfate solution (50 mg / ml) and 3.2 ml amphotericin B (250 pg / ml); and (3) sterilize by filtration. Additional non-limiting examples of viral transport media include COPAN Universal Transport Medium; Eagle Minimum Essential Medium (E-MEM); Transport medium 199; and PBS- Glycerol transport medium, see e.g., Johnson, Transport of Viral Specimens, CLINICAL MICROBIOLOGY REVIEWS, Apr. 1990, p. 120-131; Collecting, preserving and shipping specimens for the diagnosis of avian influenza A(H5N1) virus infection, Guide for field operations. October 2006. In some embodiments of any of the aspects, viral transport media does not inhibit the reverse transcription and / or isothermal amplification as described herein. In some embodiments of any of the aspects, the sample is not contacted with a transport media, such a viral transport media (VTM).

[0178] In some embodiments of the various aspects described herein, nucleic acid can be isolated or purified from the sample. Accordingly, in some embodiments, the method comprises a step of isolating or purifying nucleic acid from the sample. Nucleic acid, e.g., deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), molecules can be isolated from a particular biological sample using any of a number of procedures, which are known in the art, the particular isolation procedure chosen being appropriate for the particular biological sample. For example, freeze-thaw and alkaline lysis procedures can be useful for obtaining nucleic acid molecules from solid materials (Roiff, A et al. PCR: Clinical Diagnostics and Research, Springer (1994)).Attorney Docket No: 700355-088492WOPT

[0179] In some embodiments of any of the aspects, prior to reverse transcription total RNA is isolated from the sample. In some embodiments of any of the aspects, RNA isolation prior to reverse transcription can be performed using standard RNA extraction methods or kits. Methods and reagents for isolating or purifying nucleic acids from biological samples are well know n in the art. Non-limiting examples of standard RNA extraction methods include: (1) organic extraction, such as phenol-Guanidine Isothiocyanate (GITC)-based solutions (e.g., TRIZOL and TRI reagent); (2) silica-membrane based spin column technology (e g., RNeasy and its variants); (3) paramagnetic particle technology (e.g., DYNABEADS mRNA DIRECT MICRO); (4) densify gradient centrifugation using cesium chloride or cesium trifluoroacetate; (5) lithium chloride and urea isolation; (6) oligo(dt)- cellulose column chromatography; and (7) non-column poly (A)+ purification / isolation. In some embodiments of any of the aspects, DNA isolation can be performed using standard DNA extraction methods or kits. Non-limiting examples of standard DNA extraction methods include: organic extraction, CHELEX 100 extraction, and solid phase extraction. In some embodiments of any of the aspects, prior to detection, a standard RNA isolation method or kit is not used.

[0180] In some embodiments of any of the aspects, the test sample can be an untreated test sample. As used herein, the phrase “untreated test sample” refers to a test sample that has not had any prior sample pre-treatment except for dilution and / or suspension in a solution. Exemplary methods for treating a test sample include, but are not limited to, centrifugation, fdtration, sonication, homogenization, heating, freezing and thawing, and combinations thereof. In some embodiments of any of the aspects, the test sample can be a frozen test sample. The frozen sample can be thawed before employing methods, assays, and systems described herein. After thawing, a frozen sample can be centrifuged before being subjected to methods, assays and systems described herein. In some embodiments of any of the aspects, the test sample is a clarified test sample, for example, by centrifugation and collection of a supernatant comprising the clarified test sample. In some embodiments of any of the aspects, a test sample can be a pre-processed test sample, for example, supernatant or filtrate resulting from a treatment selected from the group consisting of centrifugation, homogenization, sonication, filtration, thawing, purification, and any combinations thereof. In some embodiments of any of the aspects, the test sample can be treated with a chemical and / or biological reagent. Chemical and / or biological reagents can be employed, for example, to protect and / or maintain the stability of the sample, including biomolecules (e.g..Attorney Docket No: 700355-088492WOPT nucleic acid and protein) therein, during processing. The skilled artisan is well aware of methods and processes appropriate for pre-processing of biological samples required for detection of a nucleic acid as described herein.

[0181] The test sample can be obtained by removing a sample from a subject, but can also be accomplished by using a previously isolated sample (e.g. isolated at a prior time point by the same or another person).Pre-heating step

[0182] In some embodiments, the method described herein comprises a step of preheating the sample prior to further steps, such as reverse transcription and / or isothermal amplification. In some embodiments, the sample is pre-heated at a sufficient temperature and for a sufficient time to inactivate RNases in the sample. In some embodiments, the sample is pre-heated at a sufficient temperature and for a sufficient time to clarify particulates and / or mucin in the sample. As used herein, the term “clarify’’ refers to removing suspended matter (e.g., particulates, mucin) from a liquid sample to make it more suitable for downstream reactions (e.g., reverse transcription and / or isothermal amplification). Heating a sample can inhibit RNase and / or clarify the sample by denaturing proteins and other molecules, primarily by breaking the weak bonds that hold them in their three-dimensional structure. Heating can cause the proteins to unfold, lose their shape, and often precipitate out of solution. The heating process can lead to a more transparent or clear (“clarified”) sample. In some embodiments, the sample is pre-heated at a sufficient temperature and for a sufficient time to inactivate RNases in the sample and clarify particulates and / or mucin in the sample. In addition to helping inactive some RNases and clarify the sample, the heating can also disrupt the integrity of viruses making them easier to lyse. In some embodiments, the sample is preheated at a sufficient temperature and for a sufficient time to: inactivate RNases in the sample, clarify particulates and / or mucin in the sample, and to increase the lysing of viruses in the sample.

[0183] In some embodiments of any of the aspects, prior to detection the sample is heated at 95°C for 10 minutes. The heating step can be performed to clarify a saliva sample of particulates or mucins. As a non-limiting example, the sample is at heated at a temperature of at least 90°C, at least 91 °C, at least 92°C, at least 93°C, at least 94°C, at least 95°C, at least 96°C, at least 97°C, at least 98°C, or at least 99°C for 5 minutes. As a non-limiting example, the sample is heated at 95 °C for at least 1 minute, at least 2 minutes, at least 3 minutes, at least 4 minutes, at least 5 minutes, at least 6 minutes, at least 7 minutes, at least 8 minutes, atAttorney Docket No: 700355-088492WOPT least 9 minutes, at least 10 minutes, at least 11 minutes, at least 12 minutes, at least 13 minutes, at least 14 minutes, at least 15 minutes, at least 16 minutes, at least 17 minutes, at least 18 minutes, at least 19 minutes, or at least 20 minutes. This heating step can be performed by a heat block or another implement capable of heating to about 95°C for about 10 minutes.Adding reagent combination step

[0184] In some embodiments of any of the aspects, prior to reverse transcription and / or isothermal amplification, the sample (e.g., the pre-heated sample, or non-pre-heating sample) is added to or otherwise contacted with a reagent combination as described herein (see e.g., Table 2) In some embodiments, the sample is not diluted prior to being added to or otherwise contacted with a reagent combination as described herein. In some embodiments, the reagent combination, to which the sample is added or otherwise contacted with, does not comprise a detection reagent. In some embodiments of any of the aspects, prior to reverse transcription and / or isothermal amplification, the sample is added to or otherwise contacted with a reagent combination by combining a sample collection contain comprising the sample and a reagent container comprising the combination of reagents. In some embodiments, at least a portion of the sample is moved from the sample collection container to the reagent container.

[0185] In some embodiments, e.g., after a pre-heating step and prior to being added to or otherwise contacted with the reagent combination, the sample is allowed to cool to a lower temperature (e.g., about 65°C). In some embodiments, the pre-heated sample is cooled at room temperature (e.g., at about 25 °C), in a fridge (e.g., about 4 °C), or in a freezer (e.g., at about -20°C). In some embodiments, the pre-heated sample is cooled for about 0.1, about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9. about 1, about 2. about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 1 , or more minutes. In some embodiments, e.g., when the sample is not pre-heated, a cooling step is not used.Reversing transcribing and / or isothermal amplifying steps

[0186] In some embodiments, after the sample is added to or otherwise contacted with the combination of reagents, the reaction is heated at a sufficient temperature and for a sufficient time for reverse transcribing and / or isothermally amplifying the target nucleic acid, if present in the sample. In some embodiments, e.g., when the target nucleic acid is a target RNA molecule, the pre-heated sample and combination of reagents in a one-pot reaction is heatedAttorney Docket No: 700355-088492WOPT at a sufficient temperature and for a sufficient time for reverse transcribing and isothermally amplifying the target RNA molecule, if present in the sample. In some embodiments, e.g., when the target nucleic acid is a target DNA molecule, the sample and combination of reagents in a one-pot reaction is heated at a sufficient temperature and for a sufficient time for isothermally amplifying the target DNA molecule, if present in the sample.

[0187] In some embodiments of any of the aspects, the reverse transcription and / or isothermal amplification step is performed at about 65°C. As a non-limiting example, the reverse transcription and / or isothermal amplification step is performed at a temperature of at least 12°C, at least 13°C, at least 14°C, at least 15°C, at least 16°C, at least 17°C, at least 18°C, at least 19°C, at least 20°C, at least 21 °C, at least 22°C, at least 23°C, at least 24°C, at least 25°C. at least 26°C, at least 27°C, at least 28°C, at least 29°C. at least 30°C, at least 31°C, at least 32°C, at least 33°C, at least 34°C, at least 35°C, at least 36°C, at least 37°C, at least 38°C, at least 39°C, at least 40°C, at least 41 °C, at least 42°C, at least 43°C, at least 44°C, at least 45°C, at least 46°C, at least 47°C, at least 48°C, at least 49°C, at least 50°C, at least 51 °C, at least 52°C, at least 53°C, at least 54°C, at least 55°C, at least 56°C, at least 57°C, at least 58°C, at least 59°C, at least 60°C, at least 61 °C, at least 62°C, at least 63°C, at least 64°C, at least 65°C, at least 66°C, at least 67°C, at least 68°C, at least 69°C, or at least 70°C.

[0188] In some embodiments of any of the aspects, the reverse transcription and / or isothermal amplification step is performed at a temperature of at most 12°C, at most 13°C. at most 14°C, at most 15°C, al most 16°C, at most 17°C, at most 18°C, al most 19°C, at most 20°C, at most 21°C, at most 22°C, at most 23°C, at most 24°C, at most 25°C, at most 26°C, at most 27°C, at most 28°C, at most 29°C. at most 30°C, at most 31 °C, at most 32°C, at most 33°C, at most 34°C, at most 35°C. at most 36°C, at most 37°C, at most 38°C, at most 39°C, at most 40°C, at most 41°C, at most 42°C, at most 43°C, at most 44°C, at most 45°C, at most 46°C, at most 47°C, at most 48°C, at most 49°C, at most 50°C, at most 51 °C, at most 52°C, at most 53°C, at most 54°C, at most 55°C, at most 56°C, at most 57°C, at most 58°C, at most 59°C, at most 60°C, at most 61°C. at most 62°C, at most 63°C, at most 64°C, at most 65°C, at most 66°C, at most 67°C, at most 68°C. at most 69°C, or at most 70°C.

[0189] In some embodiments of any of the aspects, the reverse transcription and / or isothermal amplification step is performed at about 60 to 70°C. In some embodiments of any of the aspects, the reverse transcription and / or isothermal amplification step is performed on a heat source set to approximately 65°C. In some embodiments of any of the aspects, theAttorney Docket No: 700355-088492WOPT reverse transcription and / or isothermal amplification step is performed at room temperature (e.g., 20°C-22°C). In some embodiments of any of the aspects, the reverse transcription and / or isothermal amplification step step(s) is performed at body temperature (e.g., 37°C).

[0190] In some embodiments of any of the aspects, the reverse transcription and / or isothermal amplification step is performed in at most 40 minutes. As a non-limiting example, the reverse transcription and / or isothermal amplification step is performed in at most 5 minutes, at most 6 minutes, at most 7 minutes, at most 8 minutes, at most 9 minutes, at most 10 minutes, at most 15 minutes, at most 20 minutes, at most 25 minutes, at most 30 minutes, at most 40 minutes, at most 50 minutes, at most 60 minutes, at most 70 minutes, at most 80 minutes, at most 90 minutes, or at most 100 minutes.Detecting steps

[0191] In some embodiments, after the sample and the combination of reagents are heated at a sufficient temperature and for a sufficient time for reverse transcribing and / or isothermally amplifying the target nucleic acid, a detection reagent is added to detect the isothermally- amplified target nucleic acid, if present in the sample.

[0192] In some embodiments of any of the aspects, the isothermal amplification product is detected using a colorimetric assay. A colorimetric assay uses a detection reagent that undergoes a measurable color change in the presence of the analyte, e.g., double-stranded DNA, pH, pyrophosphate. A colorimetric assay can be detected using a camera. A colorimetric assay can also be detected using a colorimeter, which is a device used to test the concentration of a solution by measuring its absorbance of a specific wavelength of light.

[0193] In some embodiments, the detection reagent is a colorimetric detection reagent that is specific to a product of an isothermal amplification reaction, such as LAMP, including but not limited to a change in pH (e.g., via Phenol Red), production of pyrophosphate (e.g., via Malachite Green), or generation of dsDNA (e.g., via SYTO-80, Methyl Green, SYBR Green). In some embodiments, the detection reagent is a fluorescent dye that specifically binds to double-stranded DNA (dsDNA). In some embodiments, the detection reagent comprises N',N'-dimethyl-N-[4-[(E)-(3-methyl-L3-benzothiazol-2-ylidene)methyl]-l- phenylquinolin-l-ium-2-yl]-N-propylpropane-l,3-diamine (SYBR® Green, Formula V).

[0194] For example, SYBR Green can be converted from an orange color when not bound to dsDNA to a yellow color when bound to dsDNA (see e.g., FIG. 2A, 4B, 14, 15A- 15C). As isothermal amplification reactions, such as LAMP, produce large amounts of dsDNA if the target nucleic acid, specific for the set of isothermal amplification primers, isAttorney Docket No: 700355-088492WOPT present, SYBR Green of an orange color indicates that no isothermal amplification of the target nucleic acid has occurred, whereas SYBR Green of a yellow color indicates that isothermal amplification of the target nucleic acid has occurred.

[0195] As another example, Phenol Red transitions from yellow to red over a pH range of 6.6 to 8.0 and turns a bright pink color above pH 8. 1. As isothermal amplification reactions, such as LAMP, can decrease the pH of a reaction by a 2-3 pH units, Phenol red of a pink / red color indicates that no isothermal amplification of the target nucleic acid has occurred, whereas Phenol red of a yellow / orange color indicates that isothermal amplification of the target nucleic acid has occurred (see e.g., FIG. 2A).

[0196] In some embodiments, the detection reagent is physically separated from the remaining reagents (e.g.. the lysis reagent, the RNase inhibitor, the reverse transcription reagents, and / or the isothermal amplification reagents) during the reverse transcription and / or isothermal amplification step. In some embodiments, the detection reagent is located on the inner, bottom surface of a lid of a reagent container, and the remaining reagents (e.g., the lysis reagent, the RNase inhibitor, the reverse transcription reagents, and / or the isothermal amplification reagents) are present within the reagent container, physically separated from the detection reaction during the reverse transcription and / or isothermal amplification step (see e.g., FIG. 1). In some embodiments, the detection reagent is added or otherwise introduced to the combination of reagents after the reverse transcription and / or isothermal amplification step has already occurred. In some embodiments, the detection reagent is introduced to the combination of reagents after the reverse transcription and / or isothermal amplification step by inverting a reagent container comprising the combination of reagents and wi th the detection reagent located on the inner, bottom surface of a lid of a reagent container (see e.g., FIG. 1)

[0197] In some embodiments, the detection reagent is not physically separated from the remaining reagents (e.g., the lysis reagent, the RNase inhibitor, the reverse transcription reagents, and / or the isothermal amplification reagents) during the reverse transcription and / or isothermal amplification step. In some embodiments, the detection reagent is included in the combinate of reagents (e.g., the lysis reagent, the RNase inhibitor, the reverse transcription reagents, and / or the isothermal amplification reagents) within the reagent container during the reverse transcription and / or isothermal amplification step. In some embodiments, the detection reagent is added or otherwise introduced to the combination of reagents before and / or during the reverse transcription and / or isothermal amplification step. In someAttorney Docket No: 700355-088492WOPT embodiments, the detection reagent is introduced to the combination of reagents before and / or during the reverse transcription and / or isothermal amplification step by inverting a reagent container comprising the combination of reagents and with the detection reagent located on the inner, bottom surface of a lid of a reagent container.

[0198] In some embodiments, a target nucleic acid is determined to be present in a sample by comparison to a negative control. In some embodiments of any of the aspects, the negative control can be a level of the target nucleic acid in a population of subjects who do not have or are not diagnosed as having, and / or do not exhibit signs or symptoms of a disease or disorder of interest (e.g., COVID-19). In some embodiments of any of the aspects, the negative control can comprise a pooled sample of control individuals or a numeric value or range of values based on the same. In some embodiments of any of the aspects, the negative control can be the level of a target nucleic acid in a sample obtained from the same subject at an earlier point in time, e.g., the methods described herein can be used to determine if a subject’s sensitivity' or response to a given therapy is changing over time.

[0199] In some embodiments, the negative control can be the level of the target nucleic acid in a sample of similar cell type, sample ty pe, sample processing, and / or obtained from a subject of similar age, sex and other demographic parameters as the sample / subject for which the level of the target nucleic acid is to be determined. In some embodiments, the test sample and control sample are of the same type, that is, obtained from the same biological source, and comprising the same composition, e.g. the same number and type of cells. In some embodiments, the test sample and control sample are both saliva samples.

[0200] In embodiments in which the target nucleic acid comprises a gene from a pathogen and the saliva sample is from a subject, the method can further comprise a step of administering an effective anti-pathogen treatment to the subject, if the target nucleic acid is determined to be present in the saliva sample. Non-limiting examples of anti-pathogen treatments include an antibiotic, antibacterial, antiviral, antiparasitic, and / or antifungal. The anti-pathogen treatment can be readily detected by a skilled clinician. In embodiments in which the target nucleic acid comprises a gene of SARS-CoV-2 (e.g., the nucleocapsid gene (N-gene)), and the saliva sample is from a subject, the method can further comprise a step of administering an effective anti-SARS-CoV-2 treatment to the subject, if the target SARS- CoV-2 gene is determined to be present in the saliva sample. Non-limiting examples of anti- SARS-CoV-2 treatments include an antiviral (e.g., PAXLOVID, remdesivir, andAttorney Docket No: 700355-088492WOPTMolnupiravir) and / or an anti-inflammatory (e.g., corticosteroids like dexamethasone). The anti-SARS-CoV-2 treatment can be readily detected by a skilled clinician.Definitions

[0201] For convenience, the meaning of some terms and phrases used in the specification, examples, and appended claims, are provided below. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is an apparent discrepancy between the usage of a term in the art and its definition provided herein, the definition provided within the specification shall prevail.

[0202] The terms ‘‘decrease'’, “reduced’', “reduction”, or “inhibit” are all used herein to mean a decrease by a statistically significant amount. In some embodiments, “reduce,” “reduction" or “decrease" or “inhibit” typically means a decrease by at least 10% as compared to a reference level (e.g. the absence of a given treatment or agent) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%. at least about 35%, at least about 40%, at least about 45%, at least about 50%. at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% , or more. As used herein, “reduction” or “inhibition” does not encompass a complete inhibition or reduction as compared to a reference level. “Complete inhibition” is a 100% inhibition as compared to a reference level. A decrease can be preferably down to a level accepted as within the range of normal, e.g., for an individual without a given disorder.

[0203] The terms “increased”, “increase”, “enhance”, or “activate” are all used herein to mean an increase by a statistically significant amount. In some embodiments, the terms “increased”, “increase”, “enhance”, or “activate” can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about aAttorney Docket No: 700355-088492WOPT10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. In the context of a marker or symptom, an "increase” is a statistically significant increase in such level.

[0204] As used herein, a "subject" means a human or animal. Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters. Domestic and game animals include cows, horses, pigs, deer, bison, buffalo, feline species, e g., domestic cat, canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon. In some embodiments, the subject is a mammal, e.g., a primate, e.g., a human. The terms, "individual,” "patient” and "subject” are used interchangeably herein.

[0205] Preferably, the subject is a mammal. The mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but is not limited to these examples. Mammals other than humans can be advantageously used as subjects that represent animal models of a specific disease or disorder. A subject can be male or female.

[0206] A subject can be one who has been previously diagnosed with or identified as suffering from or having a condition in need of treatment for a disease or disorder of interest (e.g., COVID-19) or one or more complications related to such a condition, and optionally, have already undergone treatment for a disease or disorder of interest (e.g., COVID-19) or the one or more complications related to a disease or disorder of interest (e.g., COVID-19). Alternatively, a subject can also be one who has not been previously diagnosed as having a disease or disorder of interest (e.g., COVID-19) or one or more complications related to a disease or disorder of interest (e.g., COVID-19). For example, a subject can be one who exhibits one or more risk factors for a disease or disorder of interest (e.g., COVID-19) or one or more complications related to a disease or disorder of interest (e.g., COVID-19) or a subject who does not exhibit risk factors.

[0207] A “subject in need” of treatment for a particular condition can be a subject having that condition, diagnosed as having that condition, or at risk of developing that condition, for example using the reagent combinations, kits, and / or methods described herein.

[0208] A variant amino acid or nucleic acid sequence can be at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, identical to a native or reference sequence. The degree of homology (percent identity) between a native and a mutant sequence can beAttorney Docket No: 700355-088492WOPT determined, for example, by comparing the two sequences using freely available computer programs commonly employed for this purpose on the world wide web (e.g. BLASTp or BLASTn with default settings). In some embodiments, percent sequence identity for an amino acid or nucleic sequence is calculated by dividing the number of identical amino acids or nucleotides, respectively, by the total length of the alignment (including gaps). In some embodiments, the variant amino acid or nucleic acid sequence maintains at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more of the function of the native or reference sequence.

[0209] The skilled person will be aware of various computer programs, using different mathematical algorithms, that are available to determine the identity between two sequences. For instance, use can be made of a computer program employing the Needleman and Wunsch algorithm (Needleman et al. (1970)); the GAP program in the Accelrys GCG software package (Accelerys Inc., San Diego U.S.A.); the algorithm of E. Meyers and W. Miller (Meyers et al. (1989)) which has been incorporated into the ALIGN program (version 2.0); or more preferably the BLAST (Basic Local Alignment Tool using default parameters); see e.g., US Patent 10,023,890, the content of which is incorporated by reference herein in its entirety.

[0210] As used herein, the terms “hybridize” or “hybridizing” or “hybridization” refer to the process by which single strands of polynucleotides form a double-stranded structure through hydrogen bonding between constituent bases. The ability of two polynucleotides to hybridize with each other is based on the degree of complementarity of the two polynucleotides, which in turn is based on the fraction of matched complementary nucleotide pairs. In some embodiments, the two polynucleotides that can hybridize to each other comprise at least 80%. at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more matched complementary nucleotide pairs. The more nucleotides in a given polynucleotide that are complementary' to another polynucleotide, the more stringent the conditions can be for hybridization and the more specific will be the binding between the two polynucleotides. Increased stringency can be achieved, e.g., in vitro, by elevating the temperature, increasing the ratio of co-solvents, lowering the salt concentration, and combinations thereof.

[0211] As used herein, the terms “complementary ,” “complement,” and “complementary' nucleic acid sequence” refer to the nucleic acid strand that is related to the base sequence in another nucleic acid strand by the Watson-Crick base-pairing rules. In general, twoAttorney Docket No: 700355-088492WOPT polynucleotides are complementary when one polynucleotide can bind another polynucleotide in an anti-parallel sense wherein the 3'-end of each polynucleotide binds to or is aligned with the 5'-end of the other polynucleotide and each A, T(U), G, and C of one polynucleotide is then aligned with a T(U), A, C, and G, respectively, of the other polynucleotide. Polynucleotides that comprise RNA bases can also include complementary' G / U or U / G basepairs. Two complementary strands can comprise complementary’ regions comprising all or one or more portions of one or both strands.

[0212] As used herein, the terms "treat,’’ "treatment," "treating,” or “amelioration” refer to therapeutic treatments, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a condition associated with a disease or disorder, e.g. COVID-19. The term “treating" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder. Treatment is generally “effective" if one or more symptoms or clinical markers are reduced. Alternatively, treatment is “effective" if the progression of a disease is reduced or halted. That is, “treatment" includes not just the improvement of symptoms or markers, but also a cessation of, or at least slowing of, progress or worsening of symptoms compared to what would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, remission (whether partial or total), and / or decreased mortality, whether detectable or undetectable. The term "treatment" of a disease also includes providing relief from the symptoms or side-effects of the disease (including palliative treatment).

[0213] As used herein, the term "administering," refers to the placement of a treatment into a subject by a method or route which results in at least partial delivery of the treatment at a desired site. Pharmaceutical compositions comprising a treatment can be administered by any appropriate route which results in an effective treatment in the subject. In some embodiments, administration comprises physical human activity7, e.g., an injection, act of ingestion, an act of application, and / or manipulation of a delivery device or machine. Such activity can be performed, e.g., by a medical professional and / or the subject being treated.

[0214] As used herein, the term “specific binding” refers to a chemical or physical interaction between two molecules, compounds, cells and / or particles wherein the first entity7binds to the second, target entity with greater specificity7and affinity than it binds to a third entity which is a non-target. In some embodiments, specific binding can refer to an affinityAttorney Docket No: 700355-088492WOPT of the first entity for the second target entity which is at least 10 times, at least 50 times, at least 100 times, at least 500 times, at least 1000 times or greater than the affinity for the third non-target entity. A reagent specific for a given target is one that exhibits specific binding for that target under the conditions of the assay being utilized.

[0215] The term “statistically significant" or “significantly" refers to statistical significance and generally means a two standard deviation (2SD) or greater difference or a p- value of less than 0.05.

[0216] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term “about."’ The term “about” when used in connection with percentages can mean ±1%.

[0217] As used herein, the term “comprising” means that other elements can also be present in addition to the defined elements presented. The use of “comprising” indicates inclusion rather than limitation.

[0218] The term "consisting of' refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.

[0219] As used herein the term "consisting essentially of' refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.

[0220] The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The abbreviation, "e.g." is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation "e.g." is synonymous with the term "for example."

[0221] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience and / or patentability. When any such inclusion or deletionAttorney Docket No: 700355-088492WOPT occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.

[0222] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art to which this disclosure belongs. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims. Definitions of common terms in cell biology, immunology, and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 20th Edition, published by Merck Sharp & Dohme Corp.. 2018 (ISBN 0911910190, 978-0911910421); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology' and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081- 569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), W. W. Norton & Company, 2016 (ISBN 0815345054, 978-0815345053); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN-1449659055); Michael Richard Green and Joseph Sambrook. Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzy mology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB).Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005; and Current Protocols in Immunology7(CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies. Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc.. 2003 (ISBN 0471142735, 9780471142737). the contents of which are all incorporated by reference herein in their entireties.

[0223] Other terms are defined herein within the description of the various aspects of the invention.Attorney Docket No: 700355-088492WOPT

[0224] All patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.

[0225] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.

[0226] Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessanly exhibit such advantages to fall within the scope of the disclosure.

[0227] Some embodiments of the technology described herein can be defined according to any of the following numbered paragraphs:1. A reagent combination for isothermal amplification and detection of a target nucleic acid in a saliva sample, the combination comprising:Attorney Docket No: 700355-088492WOPT(a) a lysis reagent;(b) an RNase inhibitor;(c) isothermal amplification reagents comprising a DNA polymerase and a set of isothermal amplification primers, and(d) a detection reagent. The reagent combination of paragraph 1. wherein the lysis reagent comprises:(a) octylphenoxy poly(ethyleneoxy)ethanol (IGEPAL-630®),(b) t-Octy I phenoxy polyethoxy ethanol (TRITON X-100®),(c) polysorbate 20 (TWEEN-20®), or(d) a quaternary ammonium compound (e.g., benzethonium chloride). The reagent combination of paragraph 1. wherein the RNase inhibitor comprises: a solution comprising ammonium and cesium sulfate (RNAlater®). The reagent combination of paragraph 1, wherein the isothermal amplification reagents are suitable for Loop Mediated Isothermal Amplification (LAMP). The reagent combination of paragraph 1. wherein the detection reagent comprises N'.N'- dimethyl-N-[4-[(E)-(3-methyl-l,3-benzothiazol-2-ylidene)methyl]-l-phenylquinolin-l- ium-2-yl]-N-propylpropane-l,3-diamine (SYBR® Green). The reagent combination of paragraph 1, further comprising reverse transcription reagents comprising a reverse transcriptase and a set of reverse transcription primers. The reagent combination of paragraph 1, wherein the target nucleic acid comprises the nucleocapsid gene (N-gene) of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and the set of isothermal amplification primers comprise SEQ ID NOs: 1-6. A kit for isothermal amplification and detection of a target nucleic acid in a saliva sample, the kit comprising:(a) a reagent container comprising the reagent combination of paragraph 1 ; and(b) a sample collection container. The kit of paragraph 8, wherein the detection reagent is separated from the remaining reagents in the reagent container, wherein the reagent container comprises a lid, and the detection reagent is located on the inner, bottom surface of the lid.Attorney Docket No: 700355-088492WOPT A system for isothermal amplification and detection of a target nucleic acid in a saliva sample, the system comprising the reagent combination of paragraph 1, and a heat source capable of producing temperatures of about 65 °C to about 95 °C. A method for isothermally amplifying and detecting a target nucleic acid in a saliva sample, the method comprising the following steps:(a) collecting or receiving the saliva sample from the subject;(b) pre-heating the sample at a sufficient temperature and for a sufficient time to inactivate RNases in the sample and / or clarify particulates and / or mucin in the sample;(c) adding to the pre-heated sample a reagent combination comprising:(i) a lysis reagent;(ii) an RNase inhibitor;(iii) reverse transcription reagents comprising a reverse transcriptase and a set of reverse transcription primers; and(iv) isothermal amplification reagents comprising a DNA polymerase and a set of isothermal amplification primers;(d) heating the pre-heated sample and the combination of reagents at a sufficient temperature and for a sufficient time for reverse transcribing and isothermally amplifying the target nucleic acid, if present in the sample; and(e) adding a detection reagent to detect the isothermally-amplified target nucleic acid, if present in the sample. The method of paragraph 11, wherein the sufficient temperature for pre-heating the sample is about 95 °C, and the sufficient time for pre-heating the sample is about 10 minutes. The method of paragraph 1 1, wherein the sufficient temperature to for reverse transcribing and isothermally amplifying the target nucleic acid is about 65 °C, and the sufficient time for reverse transcribing and isothermally amplifying the target nucleic acid is about 40 minutes. The method of paragraph 1 1, wherein the lysis reagent comprises:(a) octylphenoxy poly(ethyleneoxy)ethanol (IGEPAL-630®),(b) t-Octylphenoxy poly ethoxy ethanol (TRITON X-100®),(c) polysorbate 20 (TWEEN-20®), or(d) a quaternary ammonium compound (e.g., benzethonium chloride).Attorney Docket No: 700355-088492WOPT The method of paragraph 11, wherein the RNase inhibitor comprises: a solution comprising ammonium and cesium sulfate (RNAlater®). The method of paragraph 1 1, wherein the isothermal amplification reagents are suitable for Loop Mediated Isothermal Amplification (LAMP). The method of paragraph 11, wherein the detection reagent comprises N',N'-dimethyl- N-[4-[(E)-(3-methyl-1.3-benzothiazol-2-ylidene)methyl]-l -phenylquinolin- l-ium-2-yl]- N-propylpropane-L3-diamine (SYBR® Green). The method of paragraph 11, wherein the target nucleic acid comprises the nucleocapsid gene (N-gene) of severe acute respiratory' syndrome coronavirus 2 (SARS-CoV-2), and the set of isothermal amplification primers comprise SEQ ID NOs: 1-6. The method of paragraph 1 1, wherein the target nucleic acid comprises the nucleocapsid gene (N-gene) of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and the saliva sample is from a subject, and the method further comprises a step (f) of administering an effective anti-SARS-CoV-2 treatment to the subject. A method for isothermally amplifying and detecting a target RNA in a saliva sample, the method comprising the following steps:(a) collecting or receiving the saliva sample from the subject;(b) pre-heating the sample at a sufficient temperature and for a sufficient time to inactivate RNases in the sample and / or clarify particulates and / or mucin in the sample;(c) adding to the pre-heated sample a reagent combination comprising:(i) a lysis reagent comprising octylphenoxy poly(ethyleneoxy)ethanol (IGEPAL-630®):(ii) an RNase inhibitor;(iii) reverse transcription reagents comprising a reverse transcriptase and a set of reverse transcription primers; and(iv) isothermal amplification reagents comprising a DNA polymerase and a set of isothermal amplification primers, wherein the isothermal amplification is Loop Mediated Isothermal Amplification (LAMP);(d) heating the pre-heated sample and the combination of reagents at a sufficient temperature and for a sufficient time for reverse transcribing the target RNA if present in the sample into a target cDNA and isothermally amplifying the target cDNA, if present in the sample: andAttorney Docket No: 700355-088492WOPT(e) adding a detection reagent to detect the isothermally-amplified target cDNA, if present in the sample, wherein the detection reagent comprises N',N'-dimethyl-N-[4-[(E)-(3-methyl-l,3-benzothiazol-2-ylidene)methyl]-l- phenylquinolin-1 -ium-2-yl] -N-propylpropane-1 ,3-diamine (SYBR® Green).

[0228] The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting.EXAMPLESExample 1: A one-pot RT-LAMP diagnostic assay for SARS-CoV-2 from saliva samples

[0229] Described herein is a one-pot, colorimetric RT-LAMP assay designed to detect SARS-CoV-2 in saliva. The custom master mix for this assay comprises (i) RT-LAMP reagents and primers, (ii) surfactant for viral lysis, (iii) RNase inhibitor, and (iv) indicator dye (see e.g., FIG. 1). The one-pot assay only requires a single heating step prior to amplification and can be interpreted by naked eye. The performance of the assay was validated using a panel of 127 clinical samples collected from dental patients with a specificity of 100%, sensitivity of 88%, and overall accuracy of 98% when compared to RT-qPCR. These results indicate that the assay can be a tool to improve the convenience of salivary diagnostics for respiratory illnesses.1. Materials and methods1. 1 Reagents and materials

[0230] All primers and probes were obtained from INTEGRATED DNA TECHNOLOGIES (IDT). LAMP primers were selected from Zhang et al. “Rapid Molecular Detection of SARS-CoV-2 (COVID-19) Virus RNA Using Colorimetric LAMP.” MedRxiv. 2020 and were obtained with standard desalting purification. The final concentrations of the F3, B3, FIP, BIP, LF, and LB primers (see e.g., Table 1 below) were 1.6 pM, 1.6 pM, 0.2 pM, 0.2 pM, 0.4 pM, and 0.4 pM, respectively. PCR primers and TaqMan probes were selected from the CDC 2019-nCoV real-time RT-PCR diagnostic panel (available on the world wide web at stacks.cdc.gov / view / cdc / 84525). The primers were obtained with standard desalting purification, and the probe was obtained with High-Performance Liquid Chromatography (HPLC purification). The final concentrations used for the forward primer (5’ TTA CAA ACA TTG GCC GCA AA-3’; SEQ ID NO: 7), reverse primer (5’ GCGAttorney Docket No: 700355-088492WOPTCGA CAT TCC GAA GAA-3’; SEQ ID NO: 8), and probe (5 - / 56-FAM / AC A ATT TGC CCC CAG CGC TTC AG / 3BHQ 1 / - 3'; SEQ ID NO: 9) were 2.0 pM, 2.0 pM. and 0.5 pM, respectively.

[0231] ACCUPLEX RNaseP (5000 c / rnL) was obtained from LGC CLINICAL DIAGNOSTICS INC. Heat-inactivated SARS-CoV-2 (2019-nCoV / USA / WA-l / 2020) was obtained from ATCC. The PURELINK Viral RNA / DNA Mini Kit and the TAQPATH l-step RT-qPCR master mix (4X) were obtained from THERMOFISHER SCIENTIFIC. All RT- qPCR and RT-LAMP reactions were performed using an APPLIED BIOSYSTEMS QUANTSTUDIO 3 RT-qPCR system. The thermal incubation for the saliva samples was performed using a THERMOFISHER heat block. The fluorescence intensity measurements were obtained using a THERMOFISHER VARIOSKAN LUX multimode microplate reader. CAVICIDE was obtained from AMAZON, and RNASEZAP was obtained from THERMOFISHER SCIENTIFIC.

[0232] The LAMP primer sequences for the SARS-CoV N2 target (SEQ ID NOs: 1-6) are shown in Table 1 below.

[0233] Table 1. LAMP primer sequences for the SARS-CoV N2 target1.2 RT-LAMP reaction workflow

[0234] All reactions were performed using a unidirectional workflow. The RT-LAMP assay tube was prepared in a PCR workstation that was decontaminated daily with CAVICIDE, RNASEZAP, and UV sterilization. The negative samples (i.e., no template) were added in a biosafety cabinet that was decontaminated daily with CAVICIDE, RNASEZAP, and UV sterilization. The positive samples were added in a second biosafety cabinet that was decontaminated daily with CAVICIDE, RNASEZAP, and UV sterilization.Attorney Docket No: 700355-088492WOPTPost-amplification, closed reaction tubes were inverted on a lab bench as to not carry over amplicons to any stations.1.3 RT-qPCR

[0235] Samples for PCR were extracted according to the PURELINK Viral RNA / DNA Mini Kit protocol. Every reaction included 8.5 pL of nuclease-free water, 1.5 pL of combined primers / probe mix, 5.0 pL of TAQPATH 1-step RT-qPCR master mix (4X), and 5.0 pL of extracted sample. The RT-qPCR protocol was set on the instrument as follows: (i) initial step 25 °C for 2 minutes, (ii) reverse transcription at 50 °C for 15 minutes, (iii) initial denaturation at 95 °C for 2 minutes, and (iv) thermal cycling for 40 cycles at 95 °C for 3 seconds and 55 °C for 30 seconds.1.4 Sample collection and processing with clinical samples

[0236] All research was approved an Institutional Biosafety Committee. Samples of saliva (confirmed negative and positive for SARS-CoV-2) were obtained from a School of Dental Medicine. Consented subjects were asked to drool into a SALIMETRICS Saliva Collection Aid tube, which was then placed into a sealed biohazard bag. All samples were stored frozen (-80 °C) until testing. Results of the standard-of-care SARS-CoV-2 testing were matched with the patient samples. Once 30 positives were identified by RT-PCR, the study was concluded, and all samples were transported to a lab for testing. The initial sample size was based upon FDA guidance regarding Emergency Use Authorization (EUA) clinical validation procedures: N = 30 positive (at limit of detection (LOD)) and N = 30 negative clinical samples provide the abi 1 i ty to generate statistical confidence around assay performance and determine assay clinical sensitivity. Since the FDA EUA guidelines were removed for COVID-19 diagnostic assay development, it was decided to follow general guidance for diagnostic test validation. These guidelines recommend testing N positives and at least 3N negatives in a study population for a disease with a prevalence between 5 and 50% to ensure precise and reliable specificity data; see e.g.. Bujang et al. J. Clin. Diagn. Res. 2016. 10, 10, YE01-YE06. There was a 7% positive rate in the population (Boston, MA) at the time of collection (October to December 2021). After accounting for exclusion criteria, the final study comprised 29 positives and 98 negatives.1.5 Saliva pre-treatment screenAttorney Docket No: 700355-088492WOPT

[0237] Processes were investigated to clarify saliva of particulates or mucins that could interfere with the assay using (i) heat incubation via heat block, (ii) centrifugation via mini centrifuge, and (iii) syringe filtration. Contrived samples were prepared containing 2.5x105copies per milliliter (c / mL) of heat-inactivated virus in water and in pooled saliva prepared from a set of healthy patients. For the heat incubation step, the naive saliva samples was placed on a heat block for 95 °C for 10 minutes. For the centrifugation step, saliva samples were placed in the mini centrifuge for 5 seconds, until the mucin aggregated at the bottom of the sample tube. For the syringe filtration step, saliva samples were filtered through a 0.2 pm pore size glass microfiber filter. Each processed sample was analyzed via the RT-LAMP assay, and only the heat step amplified all replicates of the positive sample (see e.g., FIG. 9).1.6 Clinical validation data analysis

[0238] A diagram to describe the flow of participants through the study is illustrated in FIG. 10, as recommended by the Standards for Reporting of Diagnostic Accuracy Studies (STARD) guidelines. 29 COVID-positive saliva samples and 98 COVID-negative saliva samples were tested. Three positive samples (determined positive by another institution) did not amplify- by the in-lab gold standard, RT-qPCR, and were thus recategorized as true negatives. The parameters used to estimate the sensitivity, specificity, accuracy, positive predictive value (PPV), and negative predictive value (NPV) of each collection type are presented in FIG. 11, and their respective equations are presented in Equations 1-5. In Equations 1-5, TP is the number of true positives, TN is the number of true negatives, FP is the number of false positives, and FN is the number of false negatives.TP(Equation 1) Sensitivity =TP + FNTN(Equation 2) Specificity =TN + FPTP(Equation 3) PPV = -TP + FPTN(Equation 4) NPV = -FN + TNAttorney Docket No: 700355-088492WOPT

[0239] Table 5: Conservation of the target sequence from the original strain (i.e.,Wuhan-1, NCBI reference sequence: NC_045512.2) to variants of concern (i.e., Delta B. l.617.2, GenBank: OK091006.1, and Omicron B. l.1.529, GenBank: OR575624.1).Sequences were aligned using Clustal Omega version 1.2.4.2. Results and Discussion2. 1 Selection of reagents for one-pot RT-LAMP reaction

[0240] To minimize the number of pre-analytical steps required to analyze a sample and streamline the workflow for a user, the goal was to design an assay that encompassed all elements required for amplification in a single reaction tube. Ideally, the one-pot reaction comprises (i) an amplification method that does not require thermal cycling instrumentation, (ii) primers that target a conserved region of the SARS-CoV-2 genome, (iii) a lysis reagent that can be integrated in the master mix without interfering with assay enzymes, and (iv) an indicator that can facilitate readout without additional equipment or steps that could result in contamination. An RT-LAMP-based method was pursued because the technique can rapidly generate amplicons with only a heat block and is highly specific by design (i.e., 6 sequencespecific primers). After a search for regions of interest within the SARS-CoV-2 genome (e.g. ORF1, N gene, S gene), a region of the N gene was selected as the target because the geneAttorney Docket No: 700355-088492WOPT has remained mostly conserved across multiple variants, ranging from alpha (common in Spring 2020) to omicron (common in Fall 2024); see e.g.. Dutta et al. J. Virol. 2020. 94, 13. Ultimately, a primer set was selected to target the N gene (see e.g.. Table S), and they were validated them experimentally by performing real time RT-LAMP (65 °C for 30 minutes) with confirmatory gel electrophoresis (see e.g., FIG. 6A-6B). For initial assay development, amplification was tested under ideal conditions (i.e., nuclease free water as the sample matrix) in order to establish a baseline for assay performance and better understand the effects of the saliva matrix.

[0241] Next, variables were investigated that are independent of matrix processing such as the amplification indicator and viral lysis reagent. For the indicator, a colorimetric output was used because the signal mechanism allows for interpretation to be performed by eye, eliminating the need for readers, reducing costs, and simplifying the final format for users. Various colorimetric indicators were explored that detect different LAMP products such as changes in pH (e.g., via Phenol Red), production of pyrophosphate (e.g., via Malachite Green), and generation of dsDNA (e.g., via SYTO-80, Methyl Green, SYBR Green; 0.5 pL of 2,000x SYBR Green in DMSO was used (diluted from a stock of 10,000x SYBR Green ). Incorporating indicators directly into the LAMP master mix was initially evaluated, as they have been shown to be used either in real-time or end-point LAMP assays; SYBR Green, however, completely inhibited amplification and required addition after the reaction ended. See e.g., Saifuddinet al. J. Microbio. Methods. 2024. 223, 106981; Quyen et al. Front. Microbiol., 2019. 10, 2234. Phenol Red and SYBR Green presented the greatest visible changes in colorimetric signal between negative (0 c / mL) and positive (2.5 x 105c / mL) samples of heat inactivated virus in water (see e.g., FIG. 2A). Even though it is the most common indicator for LAMP and a component of many commercial kits. Phenol Red was excluded from further consideration due to potential matrix effects w hen using undiluted saliva — the expected range of pH for human saliva is 6.2-7.6, and its buffer capacity is highly variable based on variances in composition (e.g., phosphates, carbonates, proteins). As a result, relying on changes in pH as a readout is known to impact both specificity and sensitivity. See e.g., Chiappin et al. Clin. Chim. Acta. 2007. 383, 1-2, 30-40; Uribe-Alvarez et al. PLoS One. 2021. 16, 5, e0250202. Therefore, SYBR Green was chosen as the colorimetric amplification indicator.

[0242] To circumvent the user step needed to introduce SYBR Green to the RT-LAMP product post-amplification, SYBR Green was spatially separated from the reaction by storingAttorney Docket No: 700355-088492WOPT it on the lid of the reaction tube. Immediately after amplification is completed, (i) the reaction tube is inverted, (ii) LAMP amplicons rehydrate and interact with the stored indicator, and (iii) a change in color is produced if dsDNA has been produced. The resulting visible output is either a distinct neon green color to indicate the presence of SARS-CoV-2 (a positive) or an orange color to indicate the absence of SARS-CoV-2 (a negative). The signal output can be determined qualitatively by the naked eye (see e.g., FIG. 2A) or quantitatively by fluorescence intensity (see e.g., FIG. 6A-6B).

[0243] Finally, incorporating surfactants into the master mix was investigated with the goals of improving assay performance by increasing lysis efficiency of the SARS-CoV-2 virion while also not inhibiting the RT-LAMP reaction (e g., via denaturation of WARMSTART reverse transcriptase or Bst 2.0 WARMSTART DNA polymerase enzymes). A panel of non-ionic surfactants (e.g., IGEPAL-630, TRITON X-100, TWEEN-20) was evaluated against a titer (0-1.25 xlO3c / rnL) of heat-inactivated SARS-CoV-2 spiked in water (see e.g., FIG. 2B). In the absence of a surfactant, amplification failed for the lower concentrations of virus (1.56 and 3.13 xlO4c / mL). However, when a surfactant is present, amplification improved for all concentrations of SARS-CoV-2. IGEPAL-630 had the most reproducible and accurate amplification, and it was therefore selected for further assay development with saliva.2.2 Clinical study design

[0244] The research in this study was approved by an Institutional Biosafety Committee. Deidentified liquid saliva was obtained from consenting patients with known COVID-19 status (SARS-CoV-2 negative and positive, as determined clinically by RT-PCR) a school of dental medicine and a medical center. At the collection site, patients were given a SALIVABIO Saliva Collection Aid and instructed to collect unstimulated drool in 2 mL cryovial for 5 minutes. The saliva samples were placed in storage at -80 °C until they were used for analysis.2.3 Saliva processing for one-pot amplification

[0245] Because the SARS-CoV-2 genome is a positive-sense, single-strand of RNA and detection by LAMP relies on a reverse transcription step, it was anticipated that RNases present in saliva could result in false negatives or impact detection limits in comparison to simpler matrices. To suppress these effects, various RNA protecting agents and RNase inhibitors such as RNA SECURE, SUPER ASE«IN. RNALATER, and RNase Inhibitor™Attorney Docket No: 700355-088492WOPT were screened in the reaction master mix using samples of 2.5 xlO5c / mL of heat-inactivated virus spiked into naive, patient-derived saliva as the positive control paired with the naive saliva as the negative control (see e.g., FIG. 7). Amplification was slower in saliva than water, even though the sample accounts for only 20% of the reaction volume (5 pL of 25 pL). To account for this lag while still limiting false positives, the amplification time was increased from 30 minutes to 40 minutes. The overall results demonstrated that the RT- LAMP assay containing an RNase inhibitor improves amplification. Increasing the concentration of RNase inhibitor to 75 U, which was the maximum amount possible that could be added to the reaction based on its stock concentration and overall requirements for the master mix composition, improved the reproducibility of amplification and also reduced false negatives (see e.g., FIG. 3A).

[0246] In parallel, quick, POC-friendly pre-treatment processes were investigated to clarify saliva of particulates or mucins by (i) thermal treatment using a heat block (see e.g., FIG. 8), (ii) centrifugation via portable, mini centrifuge, and (iii) syringe filtration. Contrived samples were prepared containing 2.5xl05c / mL of heat-inactivated virus in water and in pooled naive saliva prepared from a set of 3 healthy patients. Each sample was analyzed via the RT-LAMP assay using conditions that lacked RNase inhibitor, and using a heating step resulted in successful amplification of all replicates of the positive sample and at amplification times consistent with the positive control (see e.g., FIG. 9). However, due to the anticipated patient-to-patient variability of saliva, both approaches were integrated — a heating step followed by incorporating an RNase inhibitor into the master mix — to support reproducible amplification across a larger patient population. To optimize this process, the RT-LAMP master mix was tested with RNase inhibitor (75 U) at vary ing times of heat pretreatment (0-15 minutes) using contrived samples containing 2.5xl05c / mL of heat- inactivated virus in naive saliva from healthy patients (N = 3). A 10-minute incubation resulted in the best assay performance (see e.g., FIG. 10). As a result of these experiments, the assay protocol was finalized to include five total steps: (i) collect, (ii) heat, and (iii) add saliva to master mix. and then (iv) amplify, and (v) invert to read.2.4 Saliva testing with naive saliva samples

[0247] Prior to conducting the larger, planned validation study with clinical samples, the preliminary performance of the assay was evaluated using both individual and pooled patient samples. Samples of saliva from six patients who were confirmed negative (053. 054, 055. 056, 057, and 058) were thawed and used to prepare contrived positive samples containingAttorney Docket No: 700355-088492WOPT2.5xlO5c / mL of heat-inactivated virus. From these individual samples, two contrived samples of pooled saliva were also created (A: 053, 054, and 055; B: 056, 057. and 058). Each sample was analyzed via the RT-LAMP assay, and the observed results were consistent with what would be expected for saliva samples from individual patients: matrix effects leading to false negatives could be diluted by pooling (see e.g., FIG. 3B). A confusion matrix was prepared based on the results from this trial (see e.g., FIG. 11A), and the following was determined: preliminary assay sensitivity (75%), specificity (96%), and accuracy (85%). Additionally, the positive predictive value (PPV) of the assay, measuring the likelihood that a patient with a positive result is truly positive for COVID-19, was 94% and the negative predictive value (NPV) of the assay, measuring the likelihood that a patient with a negative result is truly negative for COVID-19, was 79% (see e.g.. FIG. 11B). These results provided assurance in satisfactory saliva matrix suppression and reliable amplification results, thereby providing the confidence to evaluate a larger cohort of patient-derived — and not contrived — samples.2.5 Limit of detection (LOD) estimation

[0248] The salivary viral load of SARS-CoV-2 is known to rise >105copies / mL during infection. While viral loads from anterior nasal samples are often greater than found in saliva, saliva is the more sensitive matrix, making it an attractive sample choice for early detection of SARS-CoV-2. With the finalized assay conditions, the limit of detection of the assay was investigated by pooling saliva from 10 confirmed-negative patients (patients 059- 068) and preparing contrived samples containing heat-inactivated virus using a series of tw o- fold dilutions (1.0xl06-6.25xl04c / mL). Five (5) technical replicates were conducted for each concentration, and a result was categorized based on a majority rule (agreement of 3 of 5 replicates determines the categorized outcome). For the intended qualitative interpretation of amplification, the limit of detection w as defined to be the concentration at w hich an observer no longer obser es a color change that satisfies the majority rule criterion. In other words, the LOD was defined as the highest average concentration that the majority’ of sample replicates do not amplify (e.g., 3 of 5 replicates). Samples containing l.OxlO6c / mL of SARS-CoV-2 amplified reproducibly (5 / 5), and amplification agreement decreased with decreasing concentration of virus (see e.g., FIG. 4). The limit of detection of the assay w as approximately 2.5xl05c / mL. While a 2.5xl05c / mL was used as the positive control concentration for previous experiments, this minor disagreement in amplification success can be attributed to the intrinsic variability in patient saliva. Nevertheless, the assay has sufficientAttorney Docket No: 700355-088492WOPT sensitivity to correctly identify SARS-CoV-2 positive samples because the limit of detection was within the expected clinical range (i.e., > 1.0x105c / mL ).2.6 Clinical validation of one-pot assay

[0249] The clinical performance of the method was evaluated using saliva collected from subjects presenting for SARS-CoV-2 screening at a school of dental medicine or a medical center. The sample size was initially defined using FDA guidance regarding Emergency Use Authorization (EUA) clinical validation procedures (i.e., N = 30 positive and 30 negative clinical samples) to generate statistical confidence around assay performance. Sample collection was concluded when 30 positive patients were identified by gold-standard RT-PCR testing of anterior nasal swabs (The Broad Institute. Cambridge, MA). In total. 238 clinical saliva samples were collected, comprising 31 positive and 207 negative samples.

[0250] Inclusion criteria dictated if a sample was appropriate for the study. Samples were excluded due to (i) contamination (e.g., discoloration, food), (ii) collection error (e.g., insufficient saliva volume to process), or (iii) lack of concordance between in-lab RT-qPCR conducted at the time of analysis with the gold standard RT-PCR conducted at the time of collection (e.g., positive sample presenting as negative). A detailed flow chart of the exclusion criteria for the study, per the STARD guidelines, can be found in FIG. 13. 29 positive and 98 negative samples were used in the final study.

[0251] Each patient sample was assayed in sets of 5 technical replicates for RT-LAMP to determine the amplification result by majority rule. Images of results from every patient and replicate, alongside the CT values measured by RT-qPCR, are shown in FIG. 14-15. To optimize the clinical utility of the test, the sensitivity and specificity was evaluated with respect to a CT cutoff (see e.g., FIG. 16). The plot demonstrates that a CT cutoff of 38 is sufficient to minimize misclassification of results (i.e., false negatives, false positives). A confusion matrix of the assay results summarizes its clinical performance (see e.g., FIG. 5A) including key analytical figures of merit: sensitivity (88%), specificity (100%), accuracy (98%), PPV (100%). and NPV (97%). These results demonstrated no false positives and only 3 false negatives, indicating that the assay is highly indicative of true COVID- 19 status (see e.g., FIG. 5B). To further contextualize the diagnostic accuracy of the assay compared to RT- PCR, the data was analyzed using a receiver operating characteristic (ROC) curve (see e.g., FIG. 5C) The resulting curve afforded an area under the curve (AUC) of 91%, which reflects outstanding congruence with the gold standard method.Attorney Docket No: 700355-088492WOPT3. Conclusions

[0252] Described herein is a one-pot, RT-LAMP-based assay to detect SARS-CoV-2 RNA from saliva samples. This assay was designed specifically to address known challenges with saliva, which has limited success to date in molecular diagnostic tests performed at the point-of-care or outside of a clinical laboratory owing to its complexity and heterogeneity across patients. The assay master mix includes a non-ionic surfactant (IGEPAL-630) to improve viral lysis and an RNase inhibitor to protect the integrity of genomic RNA; the assay consumable also includes a colorimetric indicator dye stored in the lid to facilitate unambiguous, visual test results without requiring the user to open the container and potentially introduce contaminants. The assay is performed in five steps, from collection to readout: (i) the patient collects a sample of liquid saliva by drooling for 5 minutes, (ii) places the sample on a heat block for 10 minutes at 95 °C, (iii) adds undiluted sample to the one-pot RT-LAMP assay reagent, (iv) conducts RT-LAMP by placing the sample on a heat block for 40 minutes at 65 °C, and, (v) immediately post-amplification, inverts the tube to observe an instantaneous colorimetric output. While two separate heating steps are needed (first at 95 °C and the second at 65° C), no thermal cycling is required, and these steps can be performed with inexpensive heat blocks. That simplicity indicates the ability’ to operationalize the assay in resource-limited settings using two heat blocks each set to a single temperature. The limit of detection of the assay was 2.5xl05c / mL, which is within the range used for current POC immunoassays developed for anterior nasal swabs (e.g.. < 5.0 x io2pfu / mL, or 1.0 x 106c / mL), thus this threshold is appropriate for clinical uses of saliva where similar viral loads of SARS-CoV-2 are expected. The successful clinical validation of the assay was demonstrated using a panel of 127 clinical samples. The assay had an overall accuracy of 98% with a sensitivity of 88% and a specificity of 100%, indicating excellent diagnostic agreement with the gold standard RT-PCR conducted by CLIA-certified laboratories. While SARS-CoV-2 was used to demonstrate the performance of the assay and methodology, the assay and methodology' can be adapted readily through the use of target-specific primers to detect other respiratory viruses to expand the clinical application of saliva in point-of-care diagnostics.

Claims

Attorney Docket No: 700355-088492WOPTCLAIMSWhat is claimed herein is:

1. A reagent combination for isothermal amplification and detection of a target nucleic acid in a saliva sample, the combination comprising:(a) a lysis reagent;(b) an RNase inhibitor;(c) isothermal amplification reagents comprising a DNA polymerase and a set of isothermal amplification primers, and(d) a detection reagent.

2. The reagent combination of claim 1, wherein the lysis reagent comprises:(a) octylphenoxy poly(ethyleneoxy)ethanol (IGEPAL-630®),(b) t-Octylphenoxypolyethoxy ethanol (TRITON X-100®),(c) polysorbate 20 (TWEEN-20®), or(d) a quaternary ammonium compound (e.g., benzethonium chloride).

3. The reagent combination of claim 1, wherein the RNase inhibitor comprises a solution comprising ammonium and cesium sulfate (RNAlater®).

4. The reagent combination of claim 1, wherein the isothermal amplification reagents are suitable for Loop Mediated Isothermal Amplification (LAMP).

5. The reagent combination of claim 1, wherein the detection reagent comprises N',N'- dimethyl-N-[4-[(E)-(3-methyl-l,3-benzothiazol-2-ylidene)methyl]-l-phenylquinolin-l- ium-2-yl]-N-propylpropane-1.3-diamine (SYBR® Green).

6. The reagent combination of claim 1 , further comprising reverse transcription reagents comprising a reverse transcriptase and a set of reverse transcription primers.

7. The reagent combination of claim 1, wherein the target nucleic acid comprises the nucleocapsid gene (N-gene) of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and the set of isothermal amplification primers comprise SEQ ID NOs: 1-6.

8. A kit for isothermal amplification and detection of a target nucleic acid in a saliva sample, the kit comprising:(a) a reagent container comprising the reagent combination of claim 1 ; and(b) a sample collection container.Attorney Docket No: 700355-088492WOPT9. The kit of claim 8, wherein the detection reagent is separated from the remaining reagents in the reagent container, wherein the reagent container comprises a lid, and the detection reagent is located on the inner, bottom surface of the lid.

10. A system for isothermal amplification and detection of a target nucleic acid in a saliva sample, the system comprising the reagent combination of claim 1, and a heat source capable of producing temperatures of about 65 °C to about 95 °C.

11. A method for isothermally amplifying and detecting a target nucleic acid in a saliva sample, the method comprising the following steps:(a) collecting or receiving the saliva sample from the subject;(b) pre-heating the sample at a sufficient temperature and for a sufficient time to inactivate RNases in the sample and / or clarify particulates and / or mucin in the sample;(c) adding to the pre-heated sample a reagent combination comprising:(i) a lysis reagent;(ii) an RNase inhibitor;(iii) reverse transcription reagents comprising a reverse transcriptase and a set of reverse transcription primers; and(iv) isothermal amplification reagents comprising a DNA polymerase and a set of isothermal amplification primers;(d) heating the pre-heated sample and the combination of reagents at a sufficient temperature and for a sufficient time for reverse transcribing and isothermally amplifying the target nucleic acid, if present in the sample; and(e) adding a detection reagent to detect the isothermally-amplified target nucleic acid, if present in the sample.

12. The method of claim 11, wherein the sufficient temperature for pre-heating the sample is about 95 °C, and the sufficient time for pre-heating the sample is about 10 minutes.

13. The method of claim 11, wherein the sufficient temperature to for reverse transcribing and isothermally amplify ing the target nucleic acid is about 65 °C, and the sufficient time for reverse transcribing and isothermally amplifying the target nucleic acid is about 40 minutes.

14. The method of claim 11. wherein the lysis reagent comprises:Attorney Docket No: 700355-088492WOPT(a) octylphenoxy poly(ethyleneoxy)ethanol (IGEPAL-630®),(b) t-Octylphenoxypolyethoxy ethanol (TRITON X-100®),(c) polysorbate 20 (TWEEN-20®), or(d) a quaternary ammonium compound (e.g., benzethonium chloride).

15. The method of claim 11, wherein the RNase inhibitor comprises: a solution comprising ammonium and cesium sulfate (RNAlater®).

16. The method of claim 11, wherein the isothermal amplification reagents are suitable for Loop Mediated Isothermal Amplification (LAMP).

17. The method of claim 11, wherein the detection reagent comprises N',N'-dimethyl-N-[4- [(E)-(3-methyl- 1 ,3-benzothiazol-2-ylidene)methy 1] -1 -phenylquinolin- 1 -ium-2-yl] -N- propylpropane- 1.3 -diamine (SYBR® Green).

18. The method of claim 1 1 , wherein the target nucleic acid comprises the nucleocapsid gene (N-gene) of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and the set of isothermal amplification primers comprise SEQ ID NOs: 1-6.

19. The method of claim 11, wherein the target nucleic acid comprises the nucleocapsid gene (N-gene) of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and the saliva sample is from a subject, and the method further comprises a step (f) of administering an effective anti-SARS-CoV-2 treatment to the subject.

20. A method for isothermally amplify ing and detecting a target RNA in a saliva sample, the method comprising the following steps:(a) collecting or receiving the saliva sample from the subject;(b) pre-heating the sample at a sufficient temperature and for a sufficient time to inactivate RNases in the sample and / or clarify particulates and / or mucin in the sample;(c) adding to the pre-heated sample a reagent combination comprising:(i) a lysis reagent comprising octylphenoxy poly(ethyleneoxy)ethanol (IGEPAL-630®):(ii) an RNase inhibitor;(iii) reverse transcription reagents comprising a reverse transcriptase and a set of reverse transcription primers; andAttorney Docket No: 700355-088492WOPT(iv) isothermal amplification reagents comprising a DNA polymerase and a set of isothermal amplification primers, wherein the isothermal amplification is Loop Mediated Isothermal Amplification (LAMP);(d) heating the pre-heated sample and the combination of reagents at a sufficient temperature and for a sufficient time for reverse transcribing the target RNA if present in the sample into a target cDNA and isothermally amplifying the target cDNA, if present in the sample; and(e) adding a detection reagent to detect the isothermally -amplified target cDNA, if present in the sample, wherein the detection reagent comprises N',N'-dimethyl-N-[4-[(E)-(3-methyl-l,3-benzothiazol-2-ylidene)methyl]-l- phenylquinolin-l-ium-2-yl]-N-propylpropane-1.3-diamine (SYBR® Green).

Images