Ligation-free methods for chemical and topological modification of RNA
Topologically modified RNAs, produced via hybridization and genetic code expansion, address instability and efficacy issues in mRNA therapeutics, improving stability and translation efficiency for enhanced protein production.
Patent Information
- Application Number
- PCT/US2025/056713
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-25
- Filing Date
- 2025-11-21
- Publication Date
- 2026-05-28
AI Technical Summary
mRNA therapeutics face challenges of instability, toxicity, and short-term efficacy, limiting their clinical feasibility.
Topologically modified RNAs are produced through hybridization and photo-reactive moieties or genetic code expansion, forming covalent links and exonuclease-resistant modifications to enhance stability and translation efficiency.
The methods improve RNA stability and translation efficiency, enhancing protein production in cells and in vitro systems.
Smart Images

Figure IMGF000005_0001 
Figure IMGF000018_0001 
Figure IMGF000019_0001
Abstract
Description
Atty. Docket No. 114203-1101LIGATION-FREE METHODS FOR CHEMICAL AND TOPOLOGICAL MODIFICATION OF RNACROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Patent Application No. 63 / 724,695, filed November 25, 2024, the entire contents of which are incorporated herein by reference in their entireties.BACKGROUND
[0002] The following discussion is merely provided to aid the reader in understanding the disclosure and is not admitted to describe or constitute prior art thereto.
[0003] RNA, especially messenger RNA (mRNA) technology is an emerging alternative to conventional small molecule, DNA, and protein therapeutics and conventional vaccine approaches because it is potent, programmable, and capable of rapid production of mRNA with desired sequences. mRNA therapy is a rapidly developing field and has been used for the expression of therapeutic proteins, ranging from vascular regeneration factors (e.g., vascular endothelial growth factor A (VEGF-A), erythropoietin (EPO), GATA Binding Protein 4 (GATA4), Myocyte Enhancer Factor 2C (MEF2C), T-Box Transcription Factor 5 (TBX5), Myocardin (MYOCD)), to vaccines for COVID-19, influenza, and Zika virus. Despite recent clinical successes, mRNA therapy still faces challenges of instability, toxicity, short-term efficacy, and potential immunological responses. Increasing the stability and translation efficiency of mRNAs to enhance their efficiency in vivo remains an important problem that must be solved to increase the feasibility of mRNA therapeutics for clinical applications.SUMMARY
[0004] Provided herein are topologically modified RNAs (e.g., mRNAs) that have improved stability and translation efficiency in cells and in vitro translation systems, thereby enhancing protein production, as well as methods of making and using such modified RNAs.
[0005] An aspect of the disclosure is directed to a method for producing a topologically modified RNA molecule, comprising:(a) hybridizing (i) an RNA molecule comprising an acceptor base in a target location, wherein the acceptor base comprises a photo-active moiety, and (ii) an oligonucleotide comprising a14902-6740-5691.1Atty. Docket No. 114203-1101 topological modification and a corresponding photo-active moiety, thereby forming an RNA molecule-oligonucleotide complex, wherein the corresponding photo-active moiety is within a region of the oligonucleotide that is at least partially complementary to the target location in the RNA molecule; and(b) reacting the photo-active moiety of the RNA molecule with the corresponding photo-active moiety of the oligonucleotide, thereby covalently linking the photo-active moiety of the RNA molecule and the correspond photo-active moiety of the oligonucleotide, thereby producing the topologically modified RNA molecule.
[0006] In some embodiments, the acceptor base and the corresponding photo-active moiety align within ± 1 nucleotide of each other.
[0007] In some embodiments, reacting the photo-active moiety of the RNA molecule and the corresponding photo-reactive moiety of the oligonucleotide comprises exposing the RNA molecule-oligonucleotide complex to UV radiation.
[0008] In some embodiments, the acceptor base contains an activated alkene group.
[0009] In some embodiments, the acceptor base comprises U, C, m5C, or TPT3.
[0010] In some embodiments, the corresponding photo-active moiety is selected from CNVK, CNVD, n-CNVK, PCX, PCXD, psolaren, or a derivative thereof.
[0011] In some embodiments, the topological modification comprises (i) at least one 5’ cap, (ii) at least one poly-A tail, or (iii) at least one 5’ cap and at least one 3’ cap, or any combination thereof.
[0012] In some embodiments, the topologically modified RNA molecule comprises a 5’ multicapped mRNA, a 573’ multi-capped mRNA, a multi-tailed mRNA, or a capped circular RNA.
[0013] Another aspect of the disclosure is directed to method for producing a topologically modified RNA molecule comprising: incubating (i) an RNA molecule comprising at least one genetic code expansion (GCE) base at a target location, wherein the at least one GCE base comprises a click chemistry handle and (ii) an oligonucleotide comprising a topological modification, wherein the oligonucleotide comprises a24902-6740-5691.1Atty. Docket No. 114203-1101 click chemistry moiety corresponding to the click chemistry handle, thereby conjugating (i) with (ii) and producing the topologically modified RNA molecule.
[0014] In some embodiments, the at least one GCE base is selected from dNaM, dTPT3, d5SICS, dZ, dP, dDs, dPx, dIMO, dFIMO, dFEMO, dFTPT3, rNaM, rTPT3, r5SICS, rZ, rP, rDs, rPx, rIMO, rFIMO, rFEMO, rFTPT3 or an analog thereof.
[0015] In some embodiments, the topological modification comprises (i) at least one 5’ cap, (ii) at least one poly-A tail, or (iii) at least one 5’ cap and at least one 3’ cap, or a combination thereof.
[0016] In some embodiments, the topologically modified RNA molecule comprises a 5’ multicapped mRNA, a 573’ multi-capped mRNA, a multi-tailed mRNA, or a capped circular RNA.
[0017] In some embodiments, the RNA molecule is a circular RNA molecule, optionally a capped-circular mRNA (QRNA).
[0018] In some embodiments, the method further comprises circularizing the RNA molecule.
[0019] In some embodiments, the circularizing is achieved by intron back-splicing.
[0020] In some embodiments, the at least one GCE is within an untranslated region (UTR) of the RNA molecule.
[0021] In some embodiments, the RNA molecule further comprises a 3’ exonuclease-resistant modification.
[0022] In some embodiments, the 3’ exonuclease-resistant modification is selected from the group consisting of phosphorothioate (PS) linkage, 2’-O-methyl (2OMe), 2’ Fluoro, inverted deoxythymidine (dT), inverted dideoxythymidine (ddT), 3’ phosphorylation, C3 spacer, 2'-O- methoxy-ethyl (2'-MOE), G-quadruplex, and 2'-3'-dideoxy nucleotide (ddN).
[0023] In some embodiments, the RNA molecule and / or the oligonucleotide comprises at least one modified nucleotide.
[0024] In some embodiments, the at least one modified nucleotide comprises a modified sugar. In some embodiments, the modified sugar is selected from the group consisting of 2'-deoxy fluoro (2FA), Z-adenosine (LA), 2'-deoxyadenosine (dA), locked nucleic acid (LNA), 2'- methoxy (2OMe), 2'-methoxy ethoxy (2M0E), 2'-thioribose, 2', 3 '-dideoxyribose, 2'-amino-2'-34902-6740-5691.1Atty. Docket No. 114203-1101 deoxyribose, 2' deoxyribose, 2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O- methylribose, 2'-O-methyldeoxyribose, 3 '-amino-2', 3 '-dideoxyribose, 3'-azido-2',3'- dideoxyribose, 3 ’-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'- aminoribose, 5 '-thioribose, 5-nitro-l-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C- methylene-linked, 2'-O,4'-C-amino-linked ribose, 2'-O,4'-C-thio-linked ribose, and thiomorpholino oligo (TMO)-linked ribose.
[0025] In some embodiments, the modified sugar is selected from the following:
[0026] In some embodiments, the RNA molecule and / or the oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 75, between 75 and 100, between 100 and 125, between 125 and 150, or between 135 and 160 modified sugars.
[0027] In some embodiments, the RNA molecule and / or the oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, or more modified sugars.
[0028] In some embodiments, RNA molecule comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, between 100 and 200, between 200 and 300, between 400 and 500, between 600 and 700, between 800 and 900, or between 900 and 1000 modified sugars.
[0029] In some embodiments, the RNA molecule comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at44902-6740-5691.1Atty. Docket No. 114203-1101 least 300, at least 400, at least 500, at least 600, at least 750, at least 1000, or more modified sugars.
[0030] In some embodiments, the RNA molecule comprises at least one modified nucleotide comprising a peptide nucleic acid (PNA) backbone. Peptide nucleic acid (PNA) is a synthetic polymer analog to DNA and RNA in which the sugar phosphate backbone has been replaced by a unit of N-(2 aminoethyl) glycine.
[0031] In some embodiments, the at least one modified nucleotide comprises a modified phosphate.
[0032] In some embodiments, the modified phosphate is selected from the group consisting of phosphorothioate (PS), thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5'- hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphorami date, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guani di nopropyl phosphoramidate.
[0033] In some embodiments, the RNA molecule and / or the oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 75, between 75 and 100, between 100 and 125, between 125 and 150, or between 135 and 160 modified phosphates.
[0034] In some embodiments, the RNA molecule and / or the oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, or more modified phosphates.
[0035] In some embodiments, the RNA molecule comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, between 100 and 200, between 200 and 300, between 400 and 500, between 600 and 700, between 800 and 900, or between 900 and 1000 modified phosphates.
[0036] In some embodiments, the RNA molecule comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 750, at least 1000, or more modified phosphates.54902-6740-5691.1Atty. Docket No. 114203-1101
[0037] In some embodiments, the one or more modified nucleotides comprise a modified nucleobase.
[0038] In some embodiments, the modified nucleobase is selected from the group consisting of inosine, xanthine, allyaminouracil, allyaminothymidine, hypoxanthine, digoxigeninated adenine, digoxigeninated cytosine, digoxigeninated guanine, digoxigeninated uracil, 6- chloropurineriboside, N6-methyladenosine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5- methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3- Indolyl)propionamide-N-allyl]uracil, 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5- bromocytosine, 5 -carboxy cytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5 -fluorouracil, 5-formylcytosine, 5-formyluracil, 5 -hydroxy cytosine, 5-hydroxymethylcytosine, 5- hydroxymethyluracil, 5 -hydroxyuracil, 5 -iodocytosine, 5-iodouracil, 5 -methoxy cytosine, 5- methoxyuracil, 5-methylcytosine, 5-methyluracil, 5-propargylaminocytosine, 5- propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6- chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7- propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine, 8- chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, biotin- 16-aminoallylcytosine, biotin- 16- aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3-aminoallylcytosine, cyanine 3 -aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabcyl-5-3-aminoallyluracil, desthiobiotin- 16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, N1 -ethylpseudouracil, Nl- methoxymethylpseudouracil, N1 -methyladenine, N1 -methylpseudouracil, Nl- propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6- methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3 -deazaadenine, 2,6-diaminoadenine, 2,6- daminoguanine, 5-carboxamide-uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl- thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis- hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2- methylthio-N6-threonyl carbamoyladenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine64902-6740-5691.1Atty. Docket No. 114203-1101(m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A).
[0039] In some embodiments, the RNA molecule and / or the oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 75, between 75 and 100, between 100 and 125, between 125 and 150, or between 135 and 160 modified nucleobases.
[0040] In some embodiments, the RNA molecule and / or the oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, or more modified nucleobases.
[0041] In some embodiments, the topologically modified RNA molecule comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, between 100 and 200, between 200 and 300, between 400 and 500, between 600 and 700, between 800 and 900, or between 900 and 1000 modified nucleobases.
[0042] In some embodiments, the RNA molecule comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 750, at least 1000, or more modified nucleobases.
[0043] In some embodiments, the at least one modified nucleotide comprises one or more modified sugars, one or more modified phosphates, one or more modified nucleobases, or any combination thereof.
[0044] Another aspect of the disclosure is directed to a method for generating an RNA molecule comprising at least one exonuclease resistant phosphodiester modification in a site-specific manner, the method comprising: transcribing a single stranded DNA (ssDNA) template comprising at least one genetic code expansion (GCE) base at a target location, wherein the transcribing is performed using a mixture of nucleotide triphosphates comprising a modified GCE nucleotide triphosphate corresponding to the at least one GCE base, and wherein the modified GCE nucleotide triphosphate comprises an exonuclease resistant phosphodiester modification,74902-6740-5691.1Atty. Docket No. 114203-1101 thereby generating the RNA molecule comprising at least one exonuclease resistant phosphodiester modification at the target location.
[0045] In some embodiments, the target location is the 3’ end of the RNA molecule.
[0046] In some embodiments, the modified GCE triphosphate is selected from dNaM-TP, dTPT3-TP, d5SICS-TP, dZ-TP, dP-TP, dDs-TP, dPx-TP, , dIMO-TP, dFIMO-TP, dFEMO-TP, dFTPT3-TP, rNaM-TP, rTPT3-TP, r5SICS-TP, rZ-TP, rP-TP, rDs-TP, rPx-TP, rIMO-TP, rFIMO-TP, rFEMO-TP, rFTPT3-TP, or an analog thereof.
[0047] In some embodiments, the RNA molecule comprises and open reading frame (ORF).
[0048] Another aspect of the disclosure is directed to a modified RNA molecule produced by the methods of the present disclosure.
[0049] The foregoing general description and following detailed description are examples and are intended to provide further explanation of the disclosure as claimed. Other objects, advantages, and novel features will be readily apparent to those skilled in the art from the following brief description of the drawings and detailed description of the disclosure.
[0050] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below are provided as being part of the inventive subject matter disclosed herein and may be employed in any combination to achieve the benefits described herein.BRIEF DESCRIPTION OF THE DRAWINGS
[0051] FIGS. 1A-1B show generic structures of type 1 and type 2 QRNAs. FIG. 1A is a schematic showing a generic structure of a type 1 QRNA. FIG. IB is a schematic showing a generic structure of a type 2 QRNA.
[0052] FIGS. 2A-2E show schematics illustrating the application of photocrosslinking to produce modified mRNAs. FIG. 2A is a schematic showing that the hybridization-directed photo crosslinking could be directly applied to a full length mRNA prepared by IVT. The crosslinking oligo should contain a partial / full complementary sequence to the target mRNA and a photo-active moiety (cnvK, for example) within the complementary region. The cnvK group will crosslink with an acceptor base on the complementary strand -1 / 0 / +1 from it, and the acceptor base must contain an activated alkene such as U, C, m5C, or TPT3 and the reaction happen upon UV-A (-366 nm)84902-6740-5691.1Atty. Docket No. 114203-1101 irradiation for 1 ~60 seconds. FIG. 2B is a schematic showing exemplary illustrations of topologically augmented RNAs including multi-capped RNA, 375’ capped RNA, multi-tailed RNA, and capped circular RNAs, where the branched linkages were introduced by photocrosslinking. FIG. 2C is a schematic showing an exemplary illustration of a workflow for synthesizing the multi-capped mRNA using photo-crosslinking without ligation. The desired mRNA is produced by in vitro transcription and contains at least one photocrosslink acceptor base in its 5’ UTR. Synthetic oligos containing the photocrosslinking moiety (cnvK) were chemically capped, and were hybridized to the mRNA, and the two are crosslinked by UV-A to generate a 5’ multi-capped mRNA. FIG. 2D is a schematic showing an exemplary illustration of a workflow for synthesizing the multi-tailed mRNA using photo-crosslinking without ligation. The desired mRNA is produced by in vitro transcription and contains at least one photocrosslink acceptor base in its 3’ UTR. Synthetic oligos containing the photocrosslinking moiety (cnvK), partially complementary sequences to the mRNA 3’ UTR, 573’ exonuclease protections, and chemically modified synthetic poly(A) tails are hybridized to the mRNA 3’ UTR and photocrosslinked by UV-A to generate multi-tailed mRNA. FIG. 2E is a schematic showing an exemplary illustration of a workflow for synthesizing the capped circular mRNA using photo-crosslinking without ligation. The desired circular mRNA is produced by in vitro transcription and contains at least one photocrosslink acceptor base in its UTR. Synthetic oligos containing the photocrosslinking moiety (cnvK) were chemically capped, and were hybridized to the circRNA, and the two are crosslinked by UV-A to generate a capped circular RNA.
[0053] FIGS. 3A-3D show schematics illustrating the use of click chemistry handles in photocrosslinking to produce modified mRNAs. FIG. 3A is a schematic showing that click chemistry handles can be incorporated into mRNA co-transcriptionally using genetic code expansion. Exemplary workflow of mRNA 5’ topological modification by genetic code expansion and click chemistry. DNA template containing at least one genetic-code-expansion (GCE) site on the 5’ UTR is in vitro transcribed with a GCE-nucleotide triphosphate (GCE-TP) containing a click chemistry handle (TPT3-TP, for example) to generate mRNA with a click handle on the 5’ UTR. Subsequently, the mRNA is conjugated to a chemically synthesized, capped oligonucleotide with the corresponding click chemistry moiety using click chemistry to generate 5’ multi-capped mRNA FIG. 3B is a schematic showing an exemplary workflow of mRNA 3’ topological94902-6740-5691.1Atty. Docket No. 114203-1101 modification by genetic code expansion and click chemistry. DNA template containing at least one genetic-code-expansion (GCE) site on the 3’ UTR is in vitro transcribed with a GCE- nucleotide triphosphate (GCE-TP) containing a click chemistry handle (TPT3-TP, for example) to generate mRNA with a click handle on the 5’ UTR. Subsequently, the mRNA is conjugated to a chemically synthesized, capped oligonucleotide or chemically modified poly(A) oligonucleotide with the corresponding click chemistry moiety using click chemistry to generate 3’ multi -capped mRNA or 3’ multi -tailed mRNA. FIG. 3C is a schematic showing an exemplary workflow of circular RNA topological modification by genetic code expansion and click chemistry. DNA template containing at least one genetic-code-expansion (GCE) site within the UTR is in vitro transcribed with a GCE-nucleotide triphosphate (GCE-TP) containing a click chemistry handle (TPT3-TP, for example) to generate circular RNA with a click chemistry handle on the UTR. Subsequently, the circular RNA is conjugated to a chemically synthesized, capped oligonucleotide or chemically modified poly(A) oligonucleotide with the corresponding click chemistry moiety using click chemistry to generate capped circular RNA. FIG. 3D is a schematic showing an exemplary workflow for generating phosphodiester-modified mRNA without using ligation. When only phosphodiester modifications are desired, the mRNA could be generated from the corresponding DNA template with (consecutive) GCE bases on the 3’ UTR. During IVT, the alpha-thiol GCE-TP (alpha-thiol NaM triphosphate, for example, as drawn in the figure) could be added such that 3 ’-end phosphorothioate-containing mRNA is generated co-transcriptionally.
[0054] FIGS. 4A-4E show schematics and experimental data illustrating the application of photocrosslinking to produce modified mRNAs. FIG. 4A is a schematic showing a proof of concept experiments for schemes illustrated in FIGS. 3A-3D. FIG. 4B is a schematic and experimental data illustrating an evaluation of concentration of TPT3CP-TP in the IVT reaction mixture using a model sequence (ATTCTGCCTGGGGACGTCGGAGCAAGCTTGGAATTATATAATACGACTCACTATAA GCAAGC / dTPT3 / TAAAGGGAATAAACTAGTATTCTTCTGGTCCCC (SEQ ID NO: 1)). After IVT, 200 ng of RNA was incubated in 10 pl of total reaction containing IxPBS buffer, 0.5 l of Superase inhibitor, and 200 equivalents of methyl tetrazine-PEG12 at 37 °C for 1 hour and then the reaction was analyzed on 15% TBE-urea gel. FIG. 4C depicts experimental data showing an evaluation of the reaction condition for the IEDDA reaction. Reaction was set up104902-6740-5691.1Atty. Docket No. 114203-1101 similarly in b, with indicated condition using RNA generated from IVT with either 0.13 mM TPT3CP-TP or 0.06 mM TPT3CP-TP. FIG. 4D is a schematic and experimental data illustrating the generation of full-length firefly luciferase mRNA with a single TPT3CP using optimized IVT conditions, and labeled with methyl tetrazine-Cy5 dye to confirm successful incorporation of the TPT3CP moiety. RNA was characterized by gel electrophoresis on 1% agarose gel, stained with SYBR gold, and blotted with SYBR gold or Cy5. FIG. 4E is a schematic and experimental data illustrating the generation of full-length firefly luciferase mRNA with a single TPT3CP using optimized IVT conditions, and conjugated to a capped oligo with 3’ methyl tetrazine using the optimized condition. Successful incorporation of the branched cap was confirmed using RNase H assay with the RNase H probe targeting the 5’ end. Digested fragments were characterized by 15% TBE-urea gel electrophoresis.
[0055] FIG. 5 shows gel images illustrating the assessment of firefly luciferase mRNA for UV damage. U or ml'P modified Firefly luciferase mRNA having the sequence of SED ID NO: 5 was subjected to 366-nm UV treatment and reverse-transcribed with a fluorescently labeled DNA oligo having the sequence of SEQ ID NO: 4. RT product was analyzed by gel electrophoresis on 4-20% TBE gel and directly visualized by FAM fluorescence.
[0056] FIGS. 6A-6D show schematics and experimental data regarding the production and evaluation of polyA-tailed mRNA by photocrosslinking. FIG. 6A is a schematic illustrating a workflow of photo-crosslinking of chemically synthesized polyA tail to IVT’d full length mRNA by cnvK [2+2] cycloaddition to U / m I T. FIG. 6B is a gel image showing a characterization of crosslinking mixture, size exclusion purification intermedia, and oligo dT purification product by 2% e-gel. Only the polyA-crosslinked products were enriched in the final oligo dT purification. FIG. 6C is a graph showing firefly luciferase translation of IVT’d mRNA (SEQ ID NO: 5 + crosslink handle on 3’ end having the sequence of SEQ IDNO: 6) crosslinked to chemically synthesized polyA oligo having the sequence of SEQ ID NO: 7 in HEK293 cells for 24 hours. Firefly luciferase translation was normalized to co-transfected Renilla luciferase control, and the relative luminescence was normalized to the no tail control. FIG. 6D is a graph showing a comparison of firefly luciferase translation of IVT’d mRNA with no photo-tail (SEQ ID NO: 5), 1 photo-tail (SEQ ID NO: 5 + SEQ ID NO: 6), 2 photo-tail (SEQ ID NO: 5 + SEQ ID NO: 6 + additional crosslink handle on 3’ end having the sequence of SEQ ID NO: 8)), 3 photo-tail (SEQ114902-6740-5691.1Atty. Docket No. 114203-1101ID NO: 5 + SEQ ID NO: 6 + additional crosslink handle on 3’ end having the sequence of SEQ ID NO: 9).
[0057] FIGS. 7A-7B show schematics and experimental data illustrating the production and evaluation of multi-5 ’-capped mRNA by photocrosslinking. FIG. 7A shows a schematic depicting dual-capped mRNA synthesis by cvnK-mediated photocrosslinking. FIG. 7B is a schematic and graph depicting the results of evaluation of cvnK-crosslinked dual-capped mRNA with different hybridization lengths by in vitro translation in rabbit reticulocyte lysate for 30 mins. The oligo contained the sequence of SEQ ID NO: 10.DETAILED DESCRIPTION
[0058] Provided herein are ligation-free methods of making topologically modified mRNAs described herein using photochemical crosslink and genetic code expansion (GCE) or click chemistry.
[0059] In some embodiments, an RNA transcript comprising a modified 5’ cap region comprises a 5’ cap region comprising one or more modified nucleobases, phosphodiester linkages, sugar backbones, and / or 5’ caps.Equivalents
[0060] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the function and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the inventive teachings is / are used. Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents124902-6740-5691.1Atty. Docket No. 114203-1101 thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure. All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
[0061] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.Definitions
[0062] In the claims, as well as in the specification, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of’ and “consisting essentially of’ shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that embodiments described in this document using an open-ended transitional phrase (e.g., “comprising”) are also contemplated, in alternative embodiments, as “consisting of’ and “consisting essentially of’ the feature described by the open-ended transitional phrase. For example, if the disclosure describes “a composition comprising A and B,” the disclosure also contemplates the alternative embodiments “a composition consisting of A and B” and “a composition consisting essentially of A and B.”
[0063] In the claims, as well as in the specification, recitation of the phrase “between X and Y”, wherein X and Y are two separate values, it should be appreciated that these ranges include the use of these end values. For example, if a claim recites a range of between 1 and 10, this includes the values of 1, 10, and any value in between (e g., 2, 3, 4, 5, 6, 7, 8, 9, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, etc.).
[0064] A “messenger RNA” (“mRNA”) as used herein refers to a nucleic acid comprising an open reading frame (ORF) encoding a gene product, such as a protein. An mRNA may comprise134902-6740-5691.1Atty. Docket No. 114203-1101 a poly-A region that is 3’ to the ORF. An mRNA may also comprise a 5’ untranslated region (5’ UTR) that is 5’ to (upstream of) the ORF, and a 3’ untranslated region (3’ UTR) that is 3’ to (downstream of) the ORF. A mRNA may also comprise a 5’ cap at the 5’ end of the mRNA.
[0065] An “open reading frame” (“ORF”), such as an ORF encoding a protein, as used herein refers to a nucleic acid sequence comprising a coding sequence that leads to the production of the protein when the ORF is translated. The nucleic acid sequence may be an RNA sequence, in which case translation of the RNA sequence produces a polypeptide with the amino acid sequence of the protein. The nucleic acid sequence may be a DNA sequence, in which case the protein is produced when an RNA polymerase uses the DNA sequence to transcribe an RNA molecule comprising an RNA sequence that is complementary to the DNA sequence, and translation of the RNA sequence produces a polypeptide with the amino acid sequence of the protein. An ORF typically begins with a START codon, such as AUG in the RNA sequence (ATG in the DNA sequence), and ends with a STOP codon, such as UAG, UAA, or UGA in the RNA sequence (TAG, TAA, or TGA in the DNA sequence), with the number of bases between the G of the start codon and the T or U of the STOP codon being a multiple of 3 (e.g., 3, 6, 9, 12, etc.).
[0066] With reference to numbering of the nucleotide positions within a nucleic acid molecule, a position of +1 refers to the first nucleotide of the nucleic acid molecule (e.g., of the RNA molecule), +2 is the second nucleotide, +3 is the third nucleotide, and so on.
[0067] In some embodiments of the modified mRNAs provided herein, the mRNA comprises a 5' untranslated region (5' UTR) and a 3' untranslated region (3' UTR). 5' and 3' UTRs are sequences within an mRNA that do not encode amino acids of the protein encoded by the mRNA, and are thus not part of the open reading frame. The 5' UTR is 5' to (upstream of) the open reading frame. The 3' UTR is 3' to (downstream of) the open reading frame. In some embodiments, the 3' UTR comprises one or more nucleotides that are 3' to the open reading frame and 5' to (upstream of) the poly-A region of the mRNA.
[0068] In some embodiments of the modified mRNAs provided herein, the mRNA comprises, in 5’-to-3’ order: 1) a 5’ cap, optionally modified; 2) a modified 5’ UTR; 3) an open reading frame (ORF); 4) a 3’ UTR; and 5) a poly-A region. In some embodiments, the first nucleotide of the 5’ UTR is 3’ to (downstream of) the 5’ cap, and the last nucleotide of the 5’ UTR is 5’ to (upstream of) the first nucleotide of the ORF. In some embodiments, the first nucleotide of the ORF is 3’ to144902-6740-5691.1Atty. Docket No. 114203-1101(downstream of) the last nucleotide of the 5’ UTR, and the last nucleotide of the ORF is 5’ to (upstream of) the first nucleotide of the 3’ UTR. In some embodiments, the ORF is between the last nucleotide of the 5’ UTR and the first nucleotide of the 3’ UTR. In some embodiments, the first nucleotide of the 3’ UTR is 3’ to (downstream of) the last nucleotide of the ORF, and the last nucleotide of the 3’ UTR is 5’ to (upstream of) the first nucleotide of the poly-A region. In some embodiments, the 5’ UTR is between the 5’ cap and the first nucleotide of the ORF. In some embodiments, the 3’ UTR is between the ORF and the poly-A region. In some embodiments, the 5’ cap is 5’ to (upstream of) the first nucleotide of the 5’ UTR. In some embodiments, the first nucleotide of the poly-A region is 3’ to (downstream of) the last nucleotide of the 3’ UTR.
[0069] In some embodiments, the RNA is a linear RNA. A linear RNA is an RNA with a 5' terminal nucleotide and a 3' terminal nucleotide. The 5' terminal nucleotide of a linear RNA is covalently bonded to only one adjacent nucleotide of the RNA, with the adjacent nucleotide occurring 3' to the 5' terminal nucleotide in the nucleic acid sequence of the RNA. The 3' terminal nucleotide of a linear RNA is covalently bonded to only one adjacent nucleotide of the RNA, with the adjacent nucleotide occurring 5' to the 3' terminal nucleotide in the nucleic acid sequence of the RNA. In a nucleic acid sequence comprising every nucleotide of a linear RNA in 5'-to-3 ' order, the 5' terminal nucleotide is the first nucleotide in the sequence, and the 3' terminal nucleotide is the last nucleotide in the sequence.
[0070] In some embodiments, the mRNA is a circular mRNA. A circular mRNA is an mRNA with no 5' terminal nucleotide or 3' terminal nucleotide. Every nucleotide in a circular mRNA is covalently bonded to both 1) a 5' adjacent nucleotide; and 2) a 3' adjacent nucleotide. In a circular mRNA with a nucleic acid sequence comprising every nucleotide of the circular mRNA in 5 '-to-3 ' order, the last nucleotide of the nucleic acid sequence is covalently bonded to the first nucleotide of the nucleic acid sequence. In some embodiments of circular mRNAs with a 5' cap region, a 5' UTR, a 3' UTR, and a poly-A region, the poly-A region is 3' to (downstream from) the 3' UTR and 5' to (upstream of) the 5' cap region.
[0071] An RNA molecule that can be translated is referred to as a messenger RNA, or mRNA. A DNA or RNA sequence encodes a gene through codons. A codon refers to a group of three nucleotides within a nucleic acid, such as DNA or RNA, sequence. An anticodon refers to a group of three nucleotides within a nucleic acid, such as a transfer RNA (tRNA), that are154902-6740-5691.1Atty. Docket No. 114203-1101 complementary to a codon, such that the codon of a first nucleic acid associates with the anticodon of a second nucleic acid through hydrogen bonding between the bases of the codon and anticodon. For example, the codon 5'-AUG-3' on an mRNA has the corresponding anticodon 3'-UAC-5' on a tRNA. During translation, a tRNA with an anticodon complementary to the codon to be translated associates with the codon on the mRNA, generally to deliver an amino acid that corresponds to the codon to be translated, or to facilitate termination of translation and release of a translated polypeptide from a ribosome.
[0072] Translation is the process in which the RNA coding sequence is used to direct the production of a polypeptide. The first step in translation is initiation, in which a ribosome associates with an mRNA, and a first transfer RNA (tRNA) carrying a first amino acid associates with the first codon, or START codon. The next phase of translation, elongation, involves three steps. First, a second tRNA with an anticodon that is complementary to codon following the START codon, or second codon, and carrying a second amino acid, associates with the mRNA. Second, the carbon atom of terminal, non-side chain carboxylic acid moiety of the first amino acid reacts with the nitrogen of the terminal, non-side chain amino moiety of the second amino acid carried, forming a peptide bond between the two amino acids, with the second amino acid being bound to the second tRNA, and the first amino acid bound to the second amino acid, but not the first tRNA. Third, the first tRNA dissociates from the mRNA, and the ribosome advances along the mRNA, such that the position at which the first tRNA associated with the ribosome is now occupied by the second tRNA, and the position previously occupied by the second tRNA is now free for an additional tRNA carrying an additional amino acid to associate with the mRNA. These three steps of 1) association of a tRNA carrying amino acid, 2) formation of a peptide bond, which adds an additional amino acid to a growing polypeptide, and 3) advancement of the ribosome along the mRNA, continue until the ribosome reaches a STOP codon, which results in termination of translation. Generally, tRNAs that associate with STOP codons do not carry an amino acid, so the association of a tRNA that does not carry an amino acid during the elongation step results in cleavage of the bond between the polypeptide and the tRNA carrying the final amino acid in the polypeptide, such that the polypeptide is released from the ribosome.Alternatively, ribosomes may dissociate from the mRNA and release the polypeptide if no tRNA associates with the STOP codon.164902-6740-5691.1Atty. Docket No. 114203-1101
[0073] A “nucleic acid,” or “polynucleotide,” as used herein, refers to an organic molecule comprising two or more covalently bonded nucleotides. A “nucleotide,” as used herein, refers to an organic molecule comprising a 1) a nucleoside comprising a sugar covalently bonded to a nitrogenous base (nucleobase); and 2) a phosphate group that is covalently bonded to the sugar of the nucleoside. Nucleotides in a polynucleotide are typically joined by a phosphodiester bond, in which the 3' carbon of the sugar of a first nucleotide is linked to the 5' carbon of the sugar of a second nucleic acid by a bridging phosphate group. Typically, the bridging phosphate comprises two non-bridging oxygen atoms, which are bonded only to a phosphorus atom of the phosphate, and two bridging oxygen atoms, each of which connects the phosphorus atom to either the 3' carbon of the first nucleotide or the 5' carbon of the second nucleotide. In a nucleic acid sequence describing the order of nucleotides in a nucleic acid, a first nucleotide is said to be 5' to (upstream of) a second nucleotide if the 3' carbon of first nucleotide is connected to the 5' carbon of the second nucleotide. Similarly, a second nucleotide is said to be 3' to (downstream of) a first nucleotide if the 5' carbon of the second nucleotide is connected to the 3' carbon of the first nucleotide. Nucleic acid sequences are typically read in 5 '->3' order, starting with the 5' nucleotide and ending with the 3' nucleotide.
[0074] A “modified nucleotide,” as used herein, refers to a nucleotide with a structure that is not the canonical structure of an adenosine nucleotide, cytidine nucleotide, guanine nucleotide, or uracil nucleotide. A canonical structure of a molecule refers to a structure that is generally known in the art to be the structure referred to by the name of the molecule. A canonical structure of an adenosine nucleotide, which comprises an adenine base, ribose sugar, and one or more phosphate groups, is shown below, in the form of adenosine monophosphate:The canonical structure of AMP also refers to structures in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, and structures in which an oxygen atom of the phosphate and / or the 3' oxygen atom of the sugar are bound to an adjacent nucleotide in a nucleic acid sequence.174902-6740-5691 .1Atty. Docket No. 114203-1101
[0075] The canonical structure of a cytosine nucleotide which comprises a cytosine base, ribose sugar, and one or more phosphate groups, is shown below, in the form of cytidine monophosphate:The canonical structure of CMP also refers to structures in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, and structures in which an oxygen atom of the phosphate and / or the 3' oxygen atom of the sugar are bound to an adjacent nucleotide in a nucleic acid sequence.
[0076] The canonical structure of a guanine nucleotide which comprises a guanine base, ribose sugar, and one or more phosphate groups, is shown below, in the form of guanosine monophosphate:The canonical structure of GMP also refers to structures in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, and structures in which an oxygen atom of the phosphate and / or the 3' oxygen atom of the sugar are bound to an adj cent nucleotide in a nucleic acid sequence.
[0077] The canonical structure of a uracil nucleotide which comprises a uracil base, ribose sugar, and one or more phosphate groups, is shown below, in the form of uridine monophosphate:The canonical structure of UMP also refers to structures in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, and structures in which an oxygen atom of the phosphate and / or the 3' oxygen atom of the sugar are bound to an adjacent nucleotide in a nucleic acid sequence.184902-6740-5691 .1Atty. Docket No. 114203-1101
[0078] The structure of a modified nucleotide may differ from the structure of a canonical nucleotide due to one or more modifications in the sugar, nitrogenous base, or phosphate of the nucleotide. In some embodiments, the modified nucleotide comprises a modified nucleoside that is not the canonical structure of an adenine nucleoside, cytosine nucleoside, guanine nucleoside, or uracil nucleoside.
[0079] An example of a canonical structure of adenosine, an adenine nucleoside, is reproduced below:(adenosine). The canonical structure of adenosine also refers to structures in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, structures in which the 5' carbon is bound to a 5' phosphate in a nucleic acid sequence, and structures in which a 3' oxygen atom is bound to a 5' phosphate group of an adjacent nucleotide in a nucleic acid sequence.
[0080] An example of a canonical structure of cytidine, a cytosine nucleoside, is reproduced below:(cytidine). The canonical structure of cytidine also refers to structures in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, structures in which the 5' carbon is bound to a 5’ phosphate in a nucleic acid sequence, and structures in which a 3' oxygen atom is bound to a 5' phosphate group of an adjacent nucleotide in a nucleic acid sequence.
[0081] An example of a canonical structure of guanosine, a guanine nucleoside, is reproduced below:4902-6740-5691 .1Atty. Docket No. 114203-1101(guanosine). The canonical structure of guanosine also refers to structures in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, structures in which the 5' carbon is bound to a 5' phosphate in a nucleic acid sequence, and structures in which a 3' oxygen atom is bound to a 5' phosphate group of an adjacent nucleotide in a nucleic acid sequence.
[0082] An example of a canonical structure of uridine, a uracil nucleoside, is reproduced below:(uridine). The canonical structure of uridine also refers to structures in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, structures in which the 5' carbon is bound to a 5' phosphate in a nucleic acid sequence, and structures in which a 3' oxygen atom is bound to a 5' phosphate group of an adjacent nucleotide in a nucleic acid sequence.
[0083] As used herein, a “genetic code expansion (GCE) base” refers to an unnatural base that makes an unnatural base pairing with a corresponding GCE base. A GCE base does not make a base pairing with natural (A, T, G, C or U) nucleotides. Nucleic acids that contain GCE bases can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. GCE bases of the present disclosure includes, but are not limited to the GCE bases and GCE base pairs, and analogs thereof, described in Feldman, Aaron W., and Floyd E.Romesberg. (Accounts of chemical research 51.2 (2018): 394-403), which is incorporated herein in its entirety.
[0084] The GCE bases of the present disclosure include GCE bases that are deoxyribonucleotides or ribonucleotides. As a naming convention, the small letter “d” in the GCE base name means that the GCE has a deoxyribose sugar; and the small letter “r” in the GCE base name means that the GCE has a ribose sugar.204902-6740-5691 .1Atty. Docket No. 114203-1101
[0085] In some embodiments, the GCE base is dNaM, or an analog thereof. In some embodiments, dNaM has the following chemical formula:
[0086] In some embodiments, the GCE base is rNaM, where the deoxyribose sugar in dNaM is replaced with a ribose sugar.
[0087] In some embodiments, dNaM or rNaM forms a base pair with dTPT3 or rTPT3, and vice versa.
[0088] In some embodiments, the GCE base is dTPT3, or an analog thereof. In some embodiments, dTPT3 has the following chemical formula:
[0089] In some embodiments, the GCE base is rTPT3, where the deoxyribose sugar in dTPT3 is replaced with a ribose sugar.
[0090] In some embodiments, the GCE base is d5SICS or r5SICS, or an analog thereof. In some embodiments, d5SICS or 5SICS has the following chemical formula:(sugar and phosphate groups omitted for clarity).
[0091] In some embodiments, dNaM or rNaM forms a base pair with d5SICS or 5SICS, and vice versa.214902-6740-5691 .1Atty. Docket No. 114203-1101
[0092] In some embodiments, the GCE base is dZ, or an analog thereof. In some embodiments, dZ has the following chemical formula:
[0093] In some embodiments, the GCE base is rZ, where the deoxyribose sugar in dZ is replaced with a ribose sugar.
[0094] In some embodiments, dZ or rZ forms a base pair with dP or rP, and vice versa.
[0095] In some embodiments, the GCE base is dP, or an analog thereof. In some embodiments, dP has the following chemical formula:
[0096] In some embodiments, the GCE base is rP, where the deoxyribose sugar in dP is replaced with a ribose sugar.
[0097] In some embodiments, the GCE base is dDs, or an analog thereof. In some embodiments, dDs has the following chemical formula:
[0098] In some embodiments, the GCE base is rDs, where the deoxyribose sugar in dDs is replaced with a ribose sugar.
[0099] In some embodiments, the GCE base is dPx, or an analog thereof. In some embodiments, dPx has the following chemical formula:4902-6740-5691.1Atty. Docket No. 114203-1101wherein, R = H or -CH(0H)-CH20H.
[0100] In some embodiments, the GCE base is rPx, where the deoxyribose sugar in dPx is replaced with a ribose sugar.
[0101] In some embodiments, the GCE bases and base pairs of the present disclosure comprise dNaM-dTPT3 like unnatural base pairs as shown below:(sugar and phosphate groups omitted for clarity).
[0102] In some embodiments, the GCE bases, and base pairs of the present disclosure include bases and base pairs as shown below:234902-6740-5691 .1Atty. Docket No. 114203-1101(sugar and phosphate groups omitted for clarity).
[0103] As used herein, an “analog of a GCE” refers to a methylated benzene analog, a naphthalene analog, an isocarbostyril analog, a heteroatom derivatized isocarbostyril analog, a furan and thiophene fused pyridone analog, a furan and thiophene fused thiopyridone analog, an azaindole analog, a bromo- substituted benzene analog, a cyano- substituted benzene analog, a fluoro- substituted benzene analog, a methoxy-substituted benzene analog, a derivatized monocyclic pyridine analog, a pyridine analog, or a substituted pyridine analog as described in Feldman, Aaron W., and Floyd E. Romesberg. (Accounts of chemical research 51.2 (2018): 394- 403), which is incorporated herein in its entirety.
[0104] A “ligase,” as used herein, refers to an enzyme that is capable of forming a covalent bond between two nucleotides, and the process of “ligation” refers to the formation of the covalent bond between the two nucleotides.
[0105] A “poly-A tail,” as used herein, refers to a nucleic acid sequence comprising adenosine nucleotides that is attached to the 3' end of a nucleic acid, such as an RNA. A poly-A tail or poly-A region may consist of nucleotides that are 25-100%, 30-100%, 40-100%, 50- 100%, 60-100%, 70-100%, 80-100%, 90-100%, 95-100%, 96-100%, 97-100%, 98-100%, or 99- 100% adenosine nucleotides. As used herein, the terms “poly-A tail” and “poly-A region” are used interchangeably. The adenosine nucleotides comprised by a poly-A tail may be canonical adenosine nucleotides or modified (non-canonical) adenosine nucleotides.
[0106] A “5' cap,” as used herein, refers to one or more nucleotides that are covalently attached to the 5' end of a nucleic acid, such as an RNA molecule. A “5' cap region,” as used244902-6740-5691 .1Atty. Docket No. 114203-1101 herein, refers to a nucleic acid comprising a 5' nucleotide cap and one or more modified nucleotides. A 5' cap may comprise a 5' capping nucleotide that is attached to the 5' end of a mRNA by a 5' to 5' triphosphate internucleotide linkage. In some embodiments, a nucleotide attached to a mRNA by a 5' to 5 ' triphosphate internucleotide linkage is referred to as a “native” 5' capping nucleotide. In some embodiments, a native 5' capping nucleotide is a 7- methylguanosine (m7G) nucleotide. In some embodiments, a 5' cap is a modified 5' cap, comprising one or more modified nucleotides, such as the 5' capping nucleotide, or one or more modified internucleotide modifications, such as modifications to the 5' to 5' triphosphate internucleotide linkage. In some embodiments, a 5' cap comprises one or more nucleotides with a sugar modification, such as 2'-O-methylation.
[0107] An example of a canonical structure of 7-methylguanosine (m7G) attached to a ribonucleic acid sequence (e.g., a mRNA) by a 5' to 5' triphosphate internucleotide linkage is reproduced below:
[0108] A “counterion” or “anionic counterion” is a negatively charged group associated with a positively charged group in order to maintain electronic neutrality. In some embodiments, an anionic counterion is monovalent (e.g., including one formal negative charge). An anionic counterion may also be multivalent (e.g., including more than one formal negative charge), such as divalent or trivalent. Exemplary counterions include halide ions (e.g., F , Cl", Br , I ), NO3 , CIO4 , OH , H2PO4 , HCO3 , HSO4 , sulfonate ions (e.g., methanesulfonate, trifluoromethanesulfonate, p-toluenesulfonate, benzenesulfonate, 10-camphor sulfonate, naphthalene-2-sulfonate, naphthalene-l-sulfonic acid-5-sulfonate, ethane-l-sulfonic acid-2- sulfonate, and the like), carboxylate ions (e.g., acetate, propanoate, benzoate, glycerate, lactate, tartrate, glycolate, gluconate, and the like), BF4 , PF 4 , PFe ", AsFe", SbFe", B[3,5-(CF3)2C6H3]4]“, B(C6FS)4", BPh4 ", A1(OC(CF3)3)4 , and carborane anions (e.g., CBi 1H12 or (HCBi iMesBre) ). Exemplary counterions which may be multivalent include CO32, HPO42, PO43, B4O72, SO42,254902-6740-5691.1Atty. Docket No. 114203-1101S2O32", carboxylate anions (e g., tartrate, citrate, fumarate, maleate, malate, malonate, gluconate, succinate, glutarate, adipate, pimelate, suberate, azelate, sebacate, salicylate, phthalates, aspartate, glutamate, and the like), and carboranes.
[0109] Use of the phrase “at least one instance” refers to 1, 2, 3, 4, or more instances, but also encompasses a range, e.g., for example, from 1 to 4, from 1 to 3, from 1 to 2, from 2 to 4, from 2 to 3, or from 3 to 4 instances, inclusive.
[0110] Existing methods for preparing capped linear mRNA do not accommodate modifications that are not tolerated by RNA polymerase or capping enzymes, nor modifications that extend beyond the first two bases, creating a screening bias due to differing cap incorporation efficiencies. To overcome these challenges, the capping process was decoupled from mRNA synthesis as described herein.
[0111] In some embodiments of the methods provided herein, the method comprises first synthesizing a 5 ’-phosphorylated RNA oligonucleotide with a specific sequence and / or desired modifications. In the methods described herein, the synthesized 5 ’-phosphorylated RNA oligonucleotide defines the 5’ UTR when ligated to an RNA transcript. Thus, as used herein, the terms “5’-phosphorylated RNA oligonucleotide,” “5 ’-phosphorylated oligonucleotide,” and “5’- phosphorylated UTR” are used interchangeably. In some embodiments, the 5 ’-phosphorylated RNA oligonucleotide comprises one or more modified nucleotides which may affect RNA translation and / or stability.
[0112] In some embodiments, the 5 ’-phosphorylated oligonucleotide comprises a modified phosphate, resulting in a modified intemucleotide linkage. Modified phosphates used in the present disclosure may be, but are not limited to, phosphorothioate (PS), thiophosphate, 5'-O- methylphosphonate, 3'-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate. In some embodiments, more than one modified phosphate is used. In some embodiments, the 5’- phosphorylated oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more modified phosphates. In some embodiments, the 5 ’-phosphorylated oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and264902-6740-5691.1Atty. Docket No. 114203-1101100, or between 100 and 200 modified phosphates. In some embodiments, the modified phosphates of the 5 ’-phosphorylated oligonucleotide comprise about 3%, about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or 100% of the total phosphates in the 5 ’-phosphorylated oligonucleotide.
[0113] In some embodiments, the 5 ’-phosphorylated oligonucleotide comprises a modified sugar. Modified sugars used in the present disclosure may be, but are not limited to, 2'- deoxy fluoro (2FA), Z-adenosine (ZA), 2'-deoxyadenosine (dA), locked nucleic acid (LNA), 2'- methoxy (20Me), 2'-methoxyethoxy (2M0E), 2'-thioribose, 2', 3 '-dideoxyribose, 2'-amino-2'- deoxyribose, 2' deoxyribose, 2 '-azi do-2 '-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O- methylribose, 2'-O-methyldeoxyribose, 3 '-amino-2', 3 '-dideoxyribose, 3'-azido-2',3'- dideoxyribose, 3 ’-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'- aminoribose, 5 '-thioribose, 5-nitro-l-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C- methylene-linked, 2'-O,4'-C-amino-linked ribose, 2'-O,4'-C-thio-linked ribose, and thiomorpholino oligo (TMO)-linked ribose. Z-adenosine (ZA) refers to the enantiomer of D- adenosine. In some embodiments, the 5 ’-phosphorylated oligonucleotide comprises a modified sugar backbone. In some embodiments, the modified sugar backbone is selected from the following:
[0114] A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2’ and 4’ carbons. This structure effectively “locks” the ribose in the 3’-endo structural conformation. In some embodiments, the 5 ’-phosphorylated oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,274902-6740-5691.1Atty. Docket No. 114203-110117, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more modified sugars. Tn some embodiments, the 5 ’-phosphorylated oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, or between 100 and 200 modified sugars. In some embodiments, the modified sugars of the 5 ’-phosphorylated oligonucleotide comprise about 3%, about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or 100% of the total sugars in the 5 ’-phosphorylated oligonucleotide.
[0115] In some embodiments, the 5 ’-phosphorylated oligonucleotide comprises a modified nucleobase. Modified nucleobases used in the present disclosure may be, but are not limited to, inosine, xanthine, allyaminouracil, allyaminothymidine, hypoxanthine, digoxigeninated adenine, digoxigeninated cytosine, digoxigeninated guanine, digoxigeninated uracil, 6-chloropurineriboside, N6-methyladenosine, methylpseudouracil, 2-thiocytosine, 2- thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6- dihydrouracil, 5-[(3-Indolyl)propionamide-N-allyl]uracil, 5-aminoallylcytosine, 5- aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5- carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5- hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5- iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5- methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5- propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7- deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8- azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, biotin-16- aminoallylcytosine, biotin- 16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3- 6-propargylaminouracil, cyanine 3 -aminoallylcytosine, cyanine 3 -aminoallyluracil, cyanine 5-6- propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabcyl-5-3-aminoallyluracil, desthiobiotin- 16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, Nl- ethylpseudouracil, N1 -methoxymethylpseudouracil, N1 -methyladenine, N1 -methylpseudouracil, N1 -propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6- methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine,284902-6740-5691.1Atty. Docket No. 114203-1101 thienoguanine, thienouracil, xanthosine, 3 -deazaadenine, 2,6-diaminoadenine, 2,6- daminoguanine, 5-carboxamide-uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl- thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis- hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2- methylthio-N6-threonyl carbamoyl adenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A). In some embodiments, the 5 ’-phosphorylated oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more modified nucleobases. In some embodiments, the 5 ’-phosphorylated oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, or between 100 and 200 modified nucleobases. In some embodiments, the modified nucleobases of the 5 ’-phosphorylated oligonucleotide comprise about 3%, about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or 100% of the total nucleobases in the 5’- phosphorylated oligonucleotide.
[0116] In some embodiments, the 5 ’-phosphorylated oligonucleotide is synthesized on a solid-phase support. In some embodiments, the solid support is controlled-pore glass (CPG) or polystyrene (PS). In some embodiments, the 5 ’-phosphorylated oligonucleotide is synthesized via phosphoramidite oligonucleotide synthesis. In some embodiments, the 5 ’-phosphorylated oligonucleotide is synthesized in a solvent system comprising a nonpolar counterion. In some embodiments, the nonpolar counterion used in oligonucleotide synthesis is ammonium. In some embodiments, the nonpolar counterion used in oligonucleotide synthesis is ammonium.
[0117] In some embodiments, a 5’ cap is added to the 5 ’-phosphorylated oligonucleotide to produce a 5’-capped oligonucleotide (i.e., a 5’-capped UTR). A 5’ cap can be added to an RNA oligonucleotide via enzymatic or chemical reactions. In some embodiments, the cap is added to the 5 ’-phosphorylated oligonucleotide through chemical capping methods. Chemical capping may be performed by any method known in the art. Preferably, the chemical capping reaction is performed through an anhydrous reaction between the 5 ’-phosphorylated RNA oligonucleotide and a capping nucleotide conjugated to imidazole in the presence of 1-294902-6740-5691.1Atty. Docket No. 114203-1101 methylimidazole (see Abe et al., “Complete Chemical Synthesis of Minimal Messenger RNA by Efficient Chemical Capping Reaction” ACS Chem. Biol. 2022, 17:1308-1314). In this method, the cap of interest is first conjugated to imidazole. A chemical reaction is then performed between the imidazole-conjugated capping oligonucleotide and a 5’-phoshporylated oligonucleotide under anhydrous conditions and in the presence of 1 -methylimidazole. In some embodiments, the capping reaction is performed in dimethyl sulfoxide (DMSO). The desired product of this reaction is an oligonucleotide capped on its 5’ end with the cap of interest.
[0118] In some embodiments, the 5’ cap used in the present disclosure may be, but is not limited to, 7-methyguanosine (m7G), N7,3’-O-dimethyl-guanosine-5’-triphosphate-5’-guanosine (m7G-3 ’ m-ppp-G), N7,2’ -O-dimethyl-guanosine-5 ’ -triphosphate-5 ’ -guanosine (m7Gm-ppp-G), 7-benzylguanosine (Bn7G), chlorobenzylguanosine (ClBn7G), m7G bearing an LNA sugar (m7G-LNA), chlorobenzyl-O-ethoxyguanosine (ClBnOEt7G), 7-(4-chlorophenoxyethyl)- guanosine, 7-ethyl guanosine (e7G), 7-propyl guanosine (p7G), 7-isopropyl guanosine (ip7G), 7- butyl guanosine (b7G), 7-isobutyl guanosine (ib7G), 7-cyclopentyl guanosine (cp7G), 7- (carboxymethyl) guanosine (cm7G), 7-(2-phenylethyl) guanosine [7-(2-PhEt)G], 7-(l- phenylethyl) guanosine [7-(l-PhEt)G], m7GpppBH3G (DI and D2 stereoisomers), m7GppBH3G (DI and D2 stereoisomers), m7GpBH3G (DI and D2 stereoisomers), m7GppBH3pm7G, m27’2' ^GpppBiuG (DI and D2 stereoisomers), m27’2'^GppBiupG (DI and D2 diastereomers), m27’2’" °GppspG (Dl and D2 diastereomers), N-Arylmethyl analogs, glyceryl, 4',5'-methylene nucleotide, l-(beta-D- erythrofuranosyl) nucleotide, 4'-thio nucleotide, carbocyclic nucleotide, 1,5-anhydrohexitol nucleotide, L-nucleotides, alpha-nucleotide, modified base nucleotide, threo- pentofuranosyl nucleotide, acyclic 3',4'-seco nucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5-dihydroxypentyl nucleotide, 3'-3 '-inverted nucleotide moiety, 3 '-3 '-inverted abasic moiety, 3'-2'-inverted nucleotide moiety, 3'-2 '-inverted abasic moiety, 1,4-butanediol phosphate, 3'-phosphoramidate, hexylphosphate, aminohexyl phosphate, 3'-phosphate, 3'-phosphorothioate, phosphorodithioate, capl, cap2, cap3, cap4, ARC A, modified ARC A, inosine, Nl- methylguanosine, LNA-guanosine, 2-azido-guanosine, and a bridging or non-bridging methylphosphonate moiety.
[0119] In some embodiments, the 5 ’-phosphorylated oligonucleotide comprises a 5’ cap comprising a modified sugar backbone. In some embodiments, the 5’ cap comprising a modified304902-6740-5691.1Atty. Docket No. 114203-1101 sugar backbone is a modified m7G cap. In some embodiments, the 5’ cap comprising a modified sugar backbone comprises a modified sugar backbone selected from the following:
[0120] Thus, in some embodiments, a 5’ cap region provided herein comprises a 5’- capped oligonucleotide (i.e., a 5’-capped UTR) synthesized as described above. In some embodiments, the 5’ cap region comprises a modified 5’ cap, one or more modified phosphates, one or more modified sugars, and / or one or more modified nucleobases. The 5’ cap region may comprise any combination of modifications. In some embodiments, the 5’ cap region is between 5 and 50, between 10 and 45, between 15 and 40, between 20 and 35, between 25 and 30, or more than 30 nucleotides in length. In some embodiments, the 5’ cap region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more modified nucleotides. In some embodiments, the 5’ cap region comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, or between 100 and 200 modified nucleotides. In some embodiments, the modified nucleotides of the 5’ cap region comprise about 3%, about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or 100% of the total nucleotides in the 5’ cap region.
[0121] In some embodiments of the methods provided herein, the method comprises first synthesizing a 3 ’-phosphorylated RNA oligonucleotide with a specific sequence and / or desired modifications. In the methods described herein, the synthesized 3 ’-phosphorylated RNA oligonucleotide defines the 3’ UTR when ligated to an RNA transcript. Thus, as used herein, the terms “3 ’-phosphorylated RNA oligonucleotide,” “3 ’-phosphorylated oligonucleotide,” and “3’-314902-6740-5691.1Atty. Docket No. 114203-1101 phosphorylated UTR” are used interchangeably. In some embodiments, the 3’-phosphorylated RNA oligonucleotide comprises one or more modified nucleotides which may affect RNA translation and / or stability.
[0122] In some embodiments, the 3 ’-phosphorylated oligonucleotide comprises a modified phosphate, resulting in a modified intemucleotide linkage. Modified phosphates used in the present disclosure may be, but are not limited to, phosphorothioate (PS), thiophosphate, 5'-O- methylphosphonate, 3'-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate. In some embodiments, more than one modified phosphate is used. In some embodiments, the 3’- phosphorylated oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more modified phosphates. In some embodiments, the 3 ’-phosphorylated oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, or between 100 and 200 modified phosphates. In some embodiments, the modified phosphates of the 3 ’-phosphorylated oligonucleotide comprise about 3%, about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or 100% of the total phosphates in the 3 ’-phosphorylated oligonucleotide.
[0123] In some embodiments, the 3 ’-phosphorylated oligonucleotide comprises a modified sugar. Modified sugars used in the present disclosure may be, but are not limited to, 2'- deoxy fluoro (2FA), L-adenosine (LA), 2'-deoxyadenosine (dA), locked nucleic acid (LNA), 2'- methoxy (20Me), 2'-methoxy ethoxy (2M0E), 2'-thioribose, 2', 3 '-dideoxyribose, 2'-amino-2'- deoxyribose, 2' deoxyribose, 2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O- methylribose, 2'-O-methyldeoxyribose, 3 '-amino-2', 3 '-di deoxyribose, 3'-azido-2',3'- dideoxyribose, 3 '-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'- aminoribose, 5 '-thioribose, 5-nitro-l-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C- methylene-linked, 2'-O,4'-C-amino-linked ribose, 2'-O,4'-C-thio-linked ribose, and thiomorpholino oligo (TMO)-linked ribose. £-adenosine (LA) refers to the enantiomer of D- adenosine. In some embodiments, the 3 ’-phosphorylated oligonucleotide comprises a modified324902-6740-5691.1Atty. Docket No. 114203-1101 sugar backbone. In some embodiments, the modified sugar backbone is selected from the
[0124] A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2’ and 4’ carbons. This structure effectively “locks” the ribose in the 3’-endo structural conformation. In some embodiments, the 3 ’-phosphorylated oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more modified sugars. In some embodiments, the 3 ’-phosphorylated oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, or between 100 and 200 modified sugars. In some embodiments, the modified sugars of the 3 ’-phosphorylated oligonucleotide comprise about 3%, about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or 100% of the total sugars in the 3 ’-phosphorylated oligonucleotide.
[0125] In some embodiments, the 3 ’-phosphorylated oligonucleotide comprises a modified nucleobase. Modified nucleobases used in the present disclosure may be, but are not limited to, inosine, xanthine, allyaminouracil, allyaminothymidine, hypoxanthine, digoxigeninated adenine, digoxigeninated cytosine, digoxigeninated guanine, digoxigeninated uracil, 6-chloropurineriboside, N6-methyladenosine, methylpseudouracil, 2-thiocytosine, 2- thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6- dihydrouracil, 5-[(3-Indolyl)propionamide-N-allyl]uracil, 5-aminoallylcytosine, 5- aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5-334902-6740-5691.1Atty. Docket No. 114203-1101 carboxymethylesteruracil, 5-carboxyuracil, 5 -fluorouracil, 5-formylcytosine, 5-formyluracil, 5- hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5- iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5- methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5- propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7- deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8- azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, biotin-16- aminoallylcytosine, biotin-16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3- 6-propargylaminouracil, cyanine 3 -aminoallylcytosine, cyanine 3 -aminoallyluracil, cyanine 5-6- propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabcyl-5-3-aminoallyluracil, desthiobiotin- 16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, Nl- ethylpseudouracil, N1 -methoxymethylpseudouracil, N1 -methyladenine, N1 -methylpseudouracil, N1 -propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6- methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3 -deazaadenine, 2,6-diaminoadenine, 2,6- daminoguanine, 5-carboxamide-uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl- thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis- hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2- methylthio-N6-threonyl carbamoyl adenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A). In some embodiments, the 3 ’-phosphorylated oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more modified nucleobases. In some embodiments, the 3 ’-phosphorylated oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, or between 100 and 200 modified nucleobases. In some embodiments, the modified nucleobases of the 3 ’-phosphorylated oligonucleotide comprise about 3%, about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%,344902-6740-5691.1Atty. Docket No. 114203-1101 about 60%, about 70%, about 80%, about 90%, or 100% of the total nucleobases in the 3’- phosphorylated oligonucleotide.
[0126] In some embodiments, the 3 ’-phosphorylated oligonucleotide is synthesized on a solid-phase support. In some embodiments, the solid support is contrail ed-pore glass (CPG) or polystyrene (PS). In some embodiments, the 3 ’-phosphorylated oligonucleotide is synthesized via phosphorami di te oligonucleotide synthesis. In some embodiments, the 3 ’-phosphorylated oligonucleotide is synthesized in a solvent system comprising a nonpolar counterion. In some embodiments, the nonpolar counterion used in oligonucleotide synthesis is ammonium. In some embodiments, the nonpolar counterion used in oligonucleotide synthesis is ammonium.
[0127] In some embodiments, a 3’ cap is added to the 3 ’-phosphorylated oligonucleotide to produce a 3’-capped oligonucleotide (i.e., a 3’-capped UTR). A 3’ cap can be added to an RNA oligonucleotide via enzymatic or chemical reactions. In some embodiments, the cap is added to the 3 ’-phosphorylated oligonucleotide through chemical capping methods. Chemical capping may be performed by any method known in the art. Preferably, the chemical capping reaction is performed through an anhydrous reaction between the 3 ’-phosphorylated RNA oligonucleotide and a capping nucleotide conjugated to imidazole in the presence of 1- methylimidazole (see Abe et al., “Complete Chemical Synthesis of Minimal Messenger RNA by Efficient Chemical Capping Reaction” ACS Chem. Biol. 2022, 17:1308-1314). In this method, the cap of interest is first conjugated to imidazole. A chemical reaction is then performed between the imidazole-conjugated capping oligonucleotide and a 3’-phoshporylated oligonucleotide under anhydrous conditions and in the presence of 1 -methylimidazole. In some embodiments, the capping reaction is performed in dimethyl sulfoxide (DMSO). The desired product of this reaction is an oligonucleotide capped on its 3’ end with the cap of interest.
[0128] In some embodiments, the 3’ cap used in the present disclosure may be, but is not limited to, 7-methyguanosine (m7G), N7,3’-O-dimethyl-guanosine-5’-triphosphate-5’-guanosine (m7G-3 ’ m-ppp-G), N7,2’ -O-dimethyl-guanosine-5 ’ -triphosphate-5 ’ -guanosine (m7Gm-ppp-G), 7-benzylguanosine (Bn7G), chlorobenzylguanosine (ClBn7G), m7G bearing an LNA sugar (m7G-LNA), chlorobenzyl-O-ethoxyguanosine (ClBnOEt7G), 7-(4-chlorophenoxyethyl)- guanosine, 7-ethyl guanosine (e7G), 7-propyl guanosine (p7G), 7-isopropyl guanosine (ip7G), 7- butyl guanosine (b7G), 7-isobutyl guanosine (ib7G), 7-cyclopentyl guanosine (cp7G), 7- (carboxymethyl) guanosine (cm7G), 7-(2-phenylethyl) guanosine [7-(2-PhEt)G], 7-(l-354902-6740-5691.1Atty. Docket No. 114203-1101 phenylethyl) guanosine [7-(l-PhEt)G], m7GpppBH3G (DI and D2 stereoisomers), m7GppBH3G (DI and D2 stereoisomers), m7GpBH3G (DI and D2 stereoisomers), m7GppBH3pm7G, m272' °GpppBH3G (DI and D2 stereoisomers), m2?’2‘°GppBH3pG (DI and D2 diastereomers), m27’2’ °GppspG (DI and D2 diastereomers), N-Arylmethyl analogs, glyceryl, 4',5'-methylene nucleotide, l-(beta-D- erythrofuranosyl) nucleotide, 4'-thio nucleotide, carbocyclic nucleotide, 1,5-anhydrohexitol nucleotide, L-nucleotides, alpha-nucleotide, modified base nucleotide, threo- pentofuranosyl nucleotide, acyclic 3',4'-seco nucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3, 5 -dihydroxy pentyl nucleotide, 3'-3 '-inverted nucleotide moiety, 3 '-3 '-inverted abasic moiety, 3'-2'-inverted nucleotide moiety, 3'-2 '-inverted abasic moiety, 1,4-butanediol phosphate, 3'-phosphoramidate, hexylphosphate, aminohexyl phosphate, 3'-phosphate, 3'-phosphorothioate, phosphorodithioate, capl, cap2, cap3, cap4, ARC A, modified ARC A, inosine, Nl- methylguanosine, LNA-guanosine, 2-azido-guanosine, and a bridging or non-bridging methylphosphonate moiety.
[0129] In some embodiments, the 3 ’-phosphorylated oligonucleotide comprises a 3’ cap comprising a modified sugar backbone. In some embodiments, the 3’ cap comprising a modified sugar backbone is a modified m7G cap. In some embodiments, the 3’ cap comprising a modified sugar backbone comprises a modified sugar backbone selected from the following:
[0130] Thus, in some embodiments, a 3’ cap region provided herein comprises a 3’- capped oligonucleotide (i.e., a 3’-capped UTR) synthesized as described above. In some embodiments, the 3’ cap region comprises a modified 3’ cap, one or more modified phosphates, one or more modified sugars, and / or one or more modified nucleobases. The 3’ cap region may364902-6740-5691.1Atty. Docket No. 114203-1101 comprise any combination of modifications. Tn some embodiments, the 3’ cap region is between 5 and 50, between 10 and 45, between 15 and 40, between 20 and 35, between 25 and 30, or more than 30 nucleotides in length. In some embodiments, the 3’ cap region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more modified nucleotides. In some embodiments, the 3’ cap region comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, or between 100 and 200 modified nucleotides. In some embodiments, the modified nucleotides of the 3’ cap region comprise about 3%, about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or 100% of the total nucleotides in the 3’ cap region.
[0131] In some embodiments, a capped RNA transcript as provided herein comprises more than one 5’ cap or 5’ UTR region. In some embodiments, a capped RNA transcript as provided herein comprises more than one 3’ cap or 3’ UTR region. In some embodiments, a capped RNA transcript as provided herein comprises more than one poly-A tail. Methods of producing multi -capped RNA strands have been described in U.S. Patent Application Number 63 / 300,602, the contents of which are incorporated herein in their entirety. These methods comprise incorporating azide handles into an RNA molecule such that it is compatible with an alkyne-containing nucleotide to undergo a click chemistry reaction. The present application builds upon these techniques. In some embodiments, an azide handle is introduced into the RNA molecule through tRNA guanine transglycosylase (TGT) in combination with a pre-queuosine 1 (preQi) substrate (Ehret et al. “Site-specific covalent conjugation of modified mRNA by tRNA guanine transglycosylase.” Mol. Pharm. 15, 737-742 (2018)). In some embodiments, an azide handle is incorporated into an RNA molecule (e.g., 5 ’-phosphorylated RNA oligonucleotide or a capped RNA transcript) through during transcription, providing an azide-linked nucleotide as substrate for incorporation into a growing RNA strand (e.g., 5-Azido-PEG4-CTP). In some embodiments, more than one azide handle is introduced into an RNA molecule. In some embodiments, more than one azide handle is introduced into an RNA molecule using more than one introduction technique (e.g., both TGT and IVT). In some embodiments, a synthetic oligonucleotide can contain a photoactive alkene capable of undergoing a photochemical crosslinking reaction. Examples of photoactive alkenes include the cyanovinyl moiety in cnvK and cnvD (see cambio.co.uk / library / images / html_images / Glen_structures / GR30-2.pdf), and the374902-6740-5691.1Atty. Docket No. 114203-1101 alkene in furan or pyrone in coumarin or psoralen (See pubs.rsc.org / en / content / articlepdf / 2022 / ra / dlra05951c figure 11, 12, 13, and 14). A crosslinking acceptor can be, without limitation, a derivative of U, C (such as m5C), or TPT3. In some embodiments of a photocrosslinking reaction between two oligonucleotides, at least about at least about 1 to 10 bases 5’ (upstream) of the photocrosslinker should be complementary to the other oligonucleotide. In some embodiments of a photocrosslinking reaction between two oligonucleotides, at least about at least about 1 to 10 bases 3’ (downstream) of the photocrosslinker should be complementary to the other oligonucleotide.
[0132] As described herein, a “capped-circular mRNA” is a circular mRNA characterized by one or more covalent linkages to one or more cap structures (or a derivative thereof). The circular mRNA can contain all the canonical elements of a linear mRNA: (1) Cap, (2) 5’ UTR (untranslated region), (3) protein-coding regions (CDS), (4) 3’ UTR, and (5) poly(A) tail. By circularizing these features into a capped-circular RNA, it is intended to enhance half-life (increased nuclease resistance) of a canonical circular mRNA, while retaining the benefits of efficient cap-dependent translation, such as in linear mRNA.
[0133] Despite advances in circular RNA (circRNA) engineering, current constructs rely on IRES (Internal Ribosome Entry Site) or TEE (Translation Enhancing Element)-mediated translation, which are embodiments that enable cap-independent translation (FIG. 1A). Linear mRNAs are capable of undergoing cap-dependent translation through interaction with eIF4E and other eukaryotic translation initiation factors (FIG. IB), which is the predominant form of translation in cells (Sonenberg and Hinnebusch, 2009, Cell 136: 731-745) and is generally more efficient than cap-independent translation (Koch el al, 2020, Nat. Struct. Mol. Biol. 27: 1095- 1104).
[0134] The RNA embodiments and methods disclosed herein take advantage of the exonuclease-resistant feature of circRNA while utilizing the strong m7G-cap dependent translation initiation machinery. Such features can be achieved via chemical conjugation of a capped oligonucleotide with a circRNA through click chemistries such as copper catalyzed azide-alkyne cycloaddition (CuAAC) or tetrazine-trans cyclooctene inverse electron demand Diels-Alder reaction (IEDDA). In some embodiments, the disclosure contemplates two generic structures of capped circular messenger RNAs (QRNAs): Type 1 QRNA (FIG. 1A) and Type 2 QRNA (FIG. IB). In Type 1 QRNA, a circular poly-phosphodiester backbone is present while384902-6740-5691.1Atty. Docket No. 114203-1101 capping is achieved via chemical ligation of a short, capped oligonucleotide to an internal handle on the circular mRNA through click chemistry. The 5’ cap may comprise of a 7-methylguanylate that enables efficient translation of an mRNA or alternative common mRNA cap structures, as shown, for example, in Mccaffreyanton, 2019, Genetic Engineering & Biotechnology News. 39. In Type 2 QRNA, a continuous mRNA poly-phosphodiester backbone is present; circularization is achieved via chemical conjugation between the 3’-end and 5’-UTR of the mRNA through click chemistry.
[0135] The 5’ capping and 3’ poly (A) tailing steps are useful in producing active synthetic mRNA; these modifications prevent mRNA degradation and facilitate translation initiation in eukaryotic cells. As used herein, “capping” means modification at the 5’ end of an mRNA by an addition of a “cap” molecule such as a 7-methylguanosine (m7G) cap. Other cap structures and modifications of the cap as described below can be used to optimize the translation efficiency.
[0136] Enzymes capable of catalyzing the reaction of linking a cap molecule to the mRNA include, but are not limited to, Vaccinia capping system including 2’-O-Methyl Transferase, tRNA guanine transglycosylase (TGT), Faustovirus capping enzyme, and T4-RNA ligase. Capping can also occur during the synthesis of mRNA called co-transcriptional capping.
[0137] As used herein, the term “molecular handle” or “handle” refers to a chemical group that is attached to a nucleotide on mRNA and can form a covalent bond to another molecule that is separate from the mRNA to link this other molecule to the mRNA. The covalent bond can be formed via various appropriate functional crosslinking reactions. In some embodiments described herein, the crosslinking reaction is click chemistry. As used herein, the term “click handle” refers to a molecule on mRNA that can covalently bind to another molecule via click chemistry reaction. Examples of a handle include, but are not limited to, alkyne or azide (when CuAAC is used in click chemistry), or trans-cyclotene or tetrazine (when IEDDA is used in click chemistry), or hydrozone or oxime, or any equivalent structures thereof. Other crosslinking chemistries including thio-ene and tiol-yne reactions (Escorihuela et al., 2014, Bioconjug. Chem. 25:618-627), a phosphate-amine based reaction (El-Sagheer and Brown, 2017, Chem. Conimun. 53:10700-10702; Kalinowski et al., 2016, Chembiochem. 17: 1150-1155) (shown in FIG. 5A and FIG. 5B respectively), thiol-yne, amino-yne, and hydroxyl-yne reactions (Worch et al., 2021, Chem Rev. 121(12): 6744-6776), and other bioconjugation reactions394902-6740-5691.1Atty. Docket No. 114203-1101(Gassensmith, chem.libretexts.org / Bookshelves / Organic_Chemistry / Supplemental_Modules_(Organic_Chemist ry) / Reactions / Introduction to Bioconjugation, accessed June 23, 2023) have also been contemplated. In some embodiments described herein, the crosslinking reaction is a photochemical crosslinking reaction. In some embodiments, one of the synthetic oligos can contain a photoactive alkene including, but not limited to, the cyanovinyl moiety in cnvK and cnvD (see cambio.co.uk / library / images / html_images / Glen_structures / GR30-2.pdf), or the alkene in furan or pyrone in coumarin or psoralen (see pubs.rsc.org / en / content / articlepdf / 2022 / ra / dlra05951c Figures 11, 12, 13, and 14).
[0138] As used herein, the term “hairpin” or “hairpin oligonucleotide” refers to a singlestranded oligonucleotide that has a sequence of complementary base pairs at both ends capable of forming a “stem-and-loop” structure.
[0139] As used herein and understood in the art, the term “click chemistry” is intended to encompass chemical methods for linking chemical components together, including but not limited to nucleotides into polynucleotides and amino acids into peptides and polypeptides, that are “simple to perform, have high yields, require no or minimal purification, and are versatile in joining diverse structures without the prerequisite of protection steps” (see, for example, Hein et al., 2006, Pharm. Res. 10: 2216-2230). In current chemical synthetic practice four primary reactions are employed: 1) cycloadditions (including for example monovalent copper-catalyzed Huisgen 1,3-dipolar cycloadditions of azides and alkynes, the most widely used); 2) nucleophilic ring openings (including ring systems comprising strained heterocyclic electrophiles); 3) non- Aldol carbonyl chemistry (including for example hydrazone / oxime ether formation); and 4) carbon multiple bond additions (including for example certain Michael additions and formation of various three-membered rings by inter alia epoxidations). Click chemistry has been found to be particularly useful for polymeric substances such as proteins and nucleic acids as illustrated herein.
[0140] As used herein, the term “equivalent structure” means any molecule that are sufficiently structurally similar and perform the same function in a chemical reaction.
[0141] As used herein, the terms “derivatized” or “functionalized” means modification of a nucleotide that leads to some functional consequences in its chemical properties or reactivity or both. Both terms shall be understood to be equivalent to the extent that particular embodiments404902-6740-5691.1Atty. Docket No. 114203-1101 of the capped, circular RNA molecules have by benefit of derivatization thereof a function, particularly with regard to crosslink-dependent circularization embodiments provided herein. In some embodiments, a derivatized nucleotide is a nucleotide that is modified to comprise a chemical group / handle can participate in a cross-linking reaction.
[0142] As provided herein, the cap used in the RNA molecules of the disclosure can include 7-methylguanine (m7G) but in addition cap analogues as set forth, inter alia, in U.S. patent application No. 2020 / 0055891 to Walczak et al.; Holstein et al., 2016, Agnew Chem. Int. Ed. Engl. 55: 10899-10903; Walczak et al., 2017, Chem. Sci. 8: 260-267; Muttach et al., 2017, J. Org. Chem. 13: 2819-2832) can be incorporated into the circular RNA molecule precursors to create the capped RNA molecules provided herein.
[0143] Several variations of the cap structure have been contemplated here to optimize translation efficiency of the RNA molecules described herein, including QRNA. These variations include: including multiple cap structures (cap 0, 1, and 2; Shanmugasundaram et al., 2022, Chem Rec. 22(8): e202200005); including N6, 2’-O-dimethyladenosine (m6Am) as a terminal modification adjacent to the mRNA cap (Sun et al., 2021, Nat Commun. 12(1): 4778); using cap structures with modified triphosphate bridges (Sun et al., 2021, Nat Commun. 12(1): 4778;Wojtczak et al., 2018, J Am Chem Soc. 140(18): 5987-5999); incorporating Locked Nucleic Acid (LNA)-modified cap analogs (Kore et al., 2009, J Am Chem Soc. 131(18): 6364-5); introducing cap analogs with alternative functionalities such as light reactivity and click groups (Klocker et al., 2022, Nat Chem. 14(8): 905-913; Nowakowska et al., 2014, Org. biomol. Chem. 12: 4841- 4847); hydrophobic cap analogs (WO 2017066782 Al); and others (Wojcik etal., 2021, Pharmaceutics 13(11): 1941; Grudzien et al., RNA 10(9): 1479-1487; Grzela et al., 2023, RNA 29(2): 200-216).
[0144] In some embodiments, the methyl group in 7-methylguanosine (m7G) cap structure can be modified to produce 7-benzylguanosine (Bn7G), 7-chlorobenzylguanosine (ClBn7G), and chlorobenzyl-O-ethoxyguanosine (ClBnOEt7G). Introduction of one or more Locked Nucleic Acid (LNA), 2’ -methoxy (20Me), and 2 -methoxy ethoxy (2M0E) into m7G structure significantly increase mRNA translation. In some embodiments, the cap structures include, but are not limited to, m7G-LNA, LNAm7G-LNA, LNAm7G-LNAx6, LNAm7G- 2OMex6. In some embodiments, the cap structure is m7G diphosphate imidazolide (m7GDP-Im).414902-6740-5691.1Atty. Docket No. 114203-1101
[0145] Modified nucleosides. In some embodiments, as disclosed and recognized herein it is beneficial to alter the type of nucleotide / nucleotide identity, specifically incorporation of adenosine (A), guanosine (G), 6-methyladenosine (m6A), or the non-canonical inosine (I) in the mRNA, preferably, at the +1 position, increases translation efficiency. In some embodiments, substitution of some or all uridine residues to A^-methylpseudouridine (m1'P) in the mRNA also boosts the translation. The nucleotides are numbered according to their position immediately downstream of the cap structure. For example, the cap structure found at the 5' end of eukaryotic mRNAs consists of a 7-methylguanosine (m7G) moiety linked to the first nucleotide (+1 position) of the transcript via a 5 '-5' triphosphate bridge.
[0146] Other modified nucleotides include, but are not limited to, pseudouridine, 5- methylcytidine, 2-thiouridine, 5-methoxyuridine, 4-acetylcytidine, xanthine, allyaminouracil, allyaminothymidine, hypoxanthine, digoxigeninated adenine, digoxigeninated cytosine, digoxigeninated guanine, digoxigeninated uracil, 6-chloropurineriboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5 -methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-Indolyl)propionamide-N-allyl]uracil, 5- aminoallylcytosine, 5 -aminoallyluracil, 5-bromouracil, 5 -bromocytosine, 5-carboxycytosine, 5- carboxymethylesteruracil, 5-carboxyuracil, 5 -fluorouracil, 5 -formyl cytosine, 5-formyluracil, 5- hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5- iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5- methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5- propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7- deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8- azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, biotin-16- aminoallylcytosine, biotin-16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3- 6-propargylaminouracil, cyanine 3 -aminoallylcytosine, cyanine 3 -aminoallyluracil, cyanine 5-6- propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabcyl-5-3-aminoallyluracil, desthiobiotin- 16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, Nl- ethylpseudouracil, N1 -methoxymethylpseudouracil, N1 -methyladenine, N1 -methylpseudouracil, N1 -propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6-424902-6740-5691.1Atty. Docket No. 114203-1101 methyladenine, 06-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3 -deazaadenine, 2,6-diaminoadenine, 2,6- daminoguanine, 5-carboxamide-uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl- thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis- hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2- methylthio-N6-threonyl carbamoyl adenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A) have also been contemplated at +1 and other positions.
[0147] In some embodiments, the modified phosphate backbone can be phosphorothioate (PS), thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, or guanidinopropyl phosphoramidate.
[0148] In some embodiments, introduction of locked nucleic acid (LNA), 2’- methoxyribose (2-OMe), and 2-methoxyethoxy (2 -MOE) into the ribose sugar backbone increases mRNA translation. Addition of multiple 2-OMe and 2-MOE modified bases increases translation further. LNA specifically increased expression at the +1 position.
[0149] In some embodiments, the modified sugar can be 2-thioribose, 2,3 -dideoxyribose, 2-amino-2-deoxyribose, 2’ deoxyribose, 2’ -azido-2’ -deoxyribose, 2 ’-fluoro-2’ -deoxyribose, 2’- O-methylribose, 2’-O-methyldeoxyribose, 3’-amino-2’, 3 ’-dideoxyribose, 3’-azido-2,3- dideoxyribose, 3 ’-deoxyribose, 3’-O-(2-nitrobenzyl)-2’-deoxyribose, 3’-O-methylribose, 5’- aminoribose, 5 ’-thioribose, 5-nitro-l-indolyl-2’-deoxyribose, 5’-biotin-ribose, 2’-O,4’-C- methylene-linked, 2’-O,4’-C-amino-linked ribose, or 2’-O,4’-C-thio-linked ribose.
[0150] In these backbone modifications, stereoisomer structures are also considered since they have been shown to impact the RNA’s nuclease-resistance properties (Iwamoto et aL, 2017, Nat. Biotech. 35: 845-851; Jahns et a!.. 2022, Nucleic Acids Res. 50(3): 1221-1240).
[0151] As used herein, an “RNA molecule” refers to a molecule that contains ribonucleic acid (RNA). In some embodiments, the RNA molecule is at least 10, 15, 20, 25, 30, 35, 40, 45,434902-6740-5691.1Atty. Docket No. 114203-110150 nucleotides long. In some embodiments the RNA molecule is linear. In some embodiments the RNA molecule is circular. In some embodiments the RNA molecule is a coding RNA. In some embodiments the RNA molecule is a noncoding RNA.
[0152] As used herein, a “topologically modified RNA” refers to an RNA molecule that comprises at least one additional topological feature, including but not limited to, (i) at least one 5’ cap (e.g., 1, 2, 3, 4, or 5 or more additional 5’ caps), (ii) at least one poly-A tail (e.g., 1, 2, 3, 4, or 5 or more additional poly-A tails), or (iii) at least one 5’ cap and at least one 3’ cap, or any combination thereof. In some embodiments, the topologically modified RNA molecule comprises a 5’ multi-capped mRNA, a 573’ multi-capped mRNA, a multi-tailed mRNA, a circular RNA or a capped circular RNA (QRNA).
[0153] As used herein, a “chemotopological engineering” refers to modifying an RNA chemically (e.g., by adding unnatural bases or other chemical moieties) as well as topologically (e.g., by adding additional topological features such as a multi-cap, a multi-tail etc.).
[0154] As used herein, a “photo-active moiety” refers to a chemical moiety that can be crosslinked to an acceptor moiety upon light exposure, i.e., that can be “photocrossliked.” In some embodiments, a photo-active moiety undergoes [2+2] photocycloaddition with an acceptor base at -1 / 0 / +1 position from the photo-active moiety, In some instances, the acceptor base contains an activated alkene such as U / C / m5C or an unnatural base as TPT3 upon UV-A (-366 nm) irradiation, optionally for 1-60 seconds.
[0155] In some embodiments, the photo-active moiety comprises a coumarin group, and can reversible photocrosslink as shown below:4902-6740-5691 .1Atty. Docket No. 114203-1101(Light-induced reversible [2 + 2] cycloaddition of the Coumarin group. Schematic of the ICL formation upon light irradiation (k = 350 nm), and reversible reaction (X = 254 nm).).
[0156] In some embodiments, the photo-active moiety is a 3-cyanovinylcarbazole nucleoside (“CNVK” or “CNVK”), which can reversible photocrosslink as shown below:(Reversible [2 + 2] reaction in CNVK. 3-cyanovinylcarbazole nucleoside (CNVK) can undergo rapid photo-crosslinking to the complementary strand at one wavelength. Rapid reversal of the crosslink is also possible at a second wavelength.)
[0157] In some embodiments, the photo-active moiety comprises a carbazole group.
[0158] In some embodiments the photo-active moiety comprises psolaren, which has a chemical formula as shown below:
[0159] In some embodiments the photo-active moiety comprises CNVK (or “CNVK”), which has a chemical formula as shown below:
[0160] In some embodiments the photo-active moiety comprises n-CNVK (or “n-CNVK”), which has a chemical formula as shown below:4902-6740-5691 .1Atty. Docket No. 114203-1101
[0161] In some embodiments the photo-active moiety comprises CNVD (orwhich has a chemical formula as shown below:
[0162] In some embodiments the photo-active moiety comprises PCX (or “PCX”), which has a chemical formula as shown below:
[0163] In some embodiments the photo-active moiety comprises PCXD (orwhich has a chemical formula as shown below:4902-6740-5691 .1Atty. Docket No. 114203-1101
[0164] In some embodiments the photo-active moiety comprises a D-Threoninol linker, which has a chemical formula as shown below:
[0165] In some embodiments the photo-active moiety comprises a serinol nucleic acid(SNA) linker, which can be used to introducePVA andNVA to oligonucleotides. SNA,PVA andNVA have the following chemical formulas:Modes for Carrying Out the Disclosure
[0166] Protein and vaccine therapies based on RNA would benefit from an increase in translation capacity. Applicants have found that through multidimensional chemotopological engineering of RNA can significantly enhance protein production in vivo. The present disclosure provides topologically / chemotopologically modified RNA molecules with improved474902-6740-5691 .1Atty. Docket No. 114203-1101 properties, and ligation-free methods for making the same. The presently disclosed methods open possibilities to design unnatural RNA structures and topologies beyond canonical linear and circular RNAs for both basic research and therapeutic applications.Methods for producing a topologically modified RNA molecule using photolinking
[0167] An aspect of the disclosure is directed to a method for producing a topologically modified RNA molecule, comprising:(a) hybridizing (i) an RNA molecule comprising an acceptor base in a target location, wherein the acceptor base comprises a photo-active moiety, and (ii) an oligonucleotide comprising a topological modification and a corresponding photo-active moiety, thereby forming an RNA molecule-oligonucleotide complex, wherein the corresponding photo-active moiety is within a region of the oligonucleotide that is at least partially complementary to the target location in the RNA molecule; and(b) reacting the photo-active moiety of the RNA molecule with the corresponding photo-active moiety of the oligonucleotide, thereby covalently linking the photo-active moiety of the RNA molecule and the correspond photo-active moiety of the oligonucleotide, thereby producing the topologically modified RNA molecule.
[0168] In some embodiments, the acceptor base and the corresponding photo-active moiety align within ± 1 nucleotide of each other. In some embodiments, the acceptor base is -1 (one base 3’ when hybridized) with respect to the corresponding photo-active moiety. In some embodiments, the acceptor base aligns perfectly (lines up perfectly when hybridized) with the corresponding photo-active moiety. In some embodiments, the acceptor base is +1 (one base 5’ when hybridized) with respect to the corresponding photo-active moiety.
[0169] In some embodiments, reacting the photo-active moiety of the RNA molecule and the corresponding photo-reactive moiety of the oligonucleotide comprises exposing the RNA molecule-oligonucleotide complex to UV radiation.
[0170] In some embodiments, the acceptor base contains an activated alkene group. In some embodiments, the base has an activated alkene group upon UV radiation.
[0171] In some embodiments, the acceptor base comprises U, C, m5C, or TPT3.
[0172] In some embodiments, the corresponding photo-active moiety is selected fromCNVK, CNVD, n-CNVK, PCX, PCXD, psolaren, or a derivative thereof.484902-6740-5691.1Atty. Docket No. 114203-1101
[0173] In some embodiments, the topological modification comprises at least one (e.g., at least 1, 2, 3, or 4) 5’ cap. In some embodiments, the topological modification comprises at least one (e.g., at least 1, 2, 3, or 4) poly-A tail. . In some embodiments, the topological modification comprises at least one (e.g., at least 1, 2, 3, or 4) 5’ cap and at least one (e.g., at least 1, 2, 3, or 4) 3’ cap. In some embodiments, the topological modification comprises any combination of 5’ cap, 3’ cap and poly-A tail.
[0174] In some embodiments, the topologically modified RNA molecule comprises a 5’ multi-capped mRNA, a 573’ multi-capped mRNA, a multi -tailed mRNA, or a capped circular RNA (QRNA).
[0175] In some embodiments, the RNA molecule and / or the oligonucleotide comprises at least one modified nucleotide.
[0176] In some embodiments, the at least one modified nucleotide comprises a modified sugar. In some embodiments, the modified sugar is selected from the group consisting of 2'- deoxy fluoro (2FA), L-adenosine (LA), 2'-deoxyadenosine (dA), locked nucleic acid (LNA), 2'- methoxy (2OMe), 2 '-methoxy ethoxy (2M0E), 2'-thioribose, 2', 3 '-dideoxyribose, 2'-amino-2'- deoxyribose, 2' deoxyribose, 2 '-azido-2 '-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O- methylribose, 2'-O-methyldeoxyribose, 3 '-amino-2', 3 '-di deoxyribose, 3 '-azido-2', 3'- dideoxyribose, 3 '-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'- aminoribose, 5 '-thioribose, 5-nitro-l-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C- methylene-linked, 2'-O,4'-C-amino-linked ribose, 2'-O,4'-C-thio-linked ribose, and thiomorpholino oligo (TMO)-linked ribose.
[0177] In some embodiments, the RNA molecule and / or the oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 75, between 75 and 100, between 100 and 125, between 125 and 150, or between 135 and 160 modified sugars.
[0178] In some embodiments, the RNA molecule and / or the oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, or more modified sugars.
[0179] In some embodiments, RNA molecule comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and494902-6740-5691.1Atty. Docket No. 114203-1101100, between 100 and 200, between 200 and 300, between 400 and 500, between 600 and 700, between 800 and 900, or between 900 and 1000 modified sugars.
[0180] In some embodiments, the RNA molecule comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 750, at least 1000, or more modified sugars.
[0181] In some embodiments, the at least one modified nucleotide comprises a modified phosphate.
[0182] In some embodiments, the modified phosphate is selected from the group consisting of phosphorothioate (PS), thiophosphate, 5'-O-methylphosphonate, 3'-O- methylphosphonate, 5 '-hydroxyphosphonate, hydroxyphosphanate, phosphorosel enoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate.
[0183] In some embodiments, the RNA molecule and / or the oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 75, between 75 and 100, between 100 and 125, between 125 and 150, or between 135 and 160 modified phosphates.
[0184] In some embodiments, the RNA molecule and / or the oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, or more modified phosphates.
[0185] In some embodiments, the RNA molecule comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, between 100 and 200, between 200 and 300, between 400 and 500, between 600 and 700, between 800 and 900, or between 900 and 1000 modified phosphates.
[0186] In some embodiments, the RNA molecule comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least504902-6740-5691.1Atty. Docket No. 114203-1101200, at least 300, at least 400, at least 500, at least 600, at least 750, at least 1000, or more modified phosphates.
[0187] In some embodiments, the one or more modified nucleotides comprise a modified nucleobase.
[0188] In some embodiments, the modified nucleobase is selected from the group consisting of inosine, xanthine, allyaminouracil, allyaminothymidine, hypoxanthine, digoxigeninated adenine, digoxigeninated cytosine, digoxigeninated guanine, digoxigeninated uracil, 6-chloropurineriboside, N6-methyladenosine, methylpseudouracil, 2-thiocytosine, 2- thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6- dihydrouracil, 5-[(3-Indolyl)propionamide-N-allyl]uracil, 5-aminoallylcytosine, 5- aminoallyluracil, 5-bromouracil, 5 -bromocytosine, 5-carboxycytosine, 5- carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5 -formyl cytosine, 5-formyluracil, 5- hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5- iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5- methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5- propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7- deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8- azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, biotin-16- aminoallylcytosine, biotin-16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3- 6-propargylaminouracil, cyanine 3 -aminoallylcytosine, cyanine 3 -aminoallyluracil, cyanine 5-6- propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabcyl-5-3-aminoallyluracil, desthiobiotin- 16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, Nl- ethylpseudouracil, N1 -methoxymethylpseudouracil, N1 -methyladenine, N1 -methylpseudouracil, N1 -propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6- methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3 -deazaadenine, 2,6-diaminoadenine, 2,6- daminoguanine, 5-carboxamide-uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl- thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis- hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine514902-6740-5691.1Atty. Docket No. 114203-1101(ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2- methylthio-N6-threonyl carbamoyladenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A).
[0189] In some embodiments, the RNA molecule and / or the oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 75, between 75 and 100, between 100 and 125, between 125 and 150, or between 135 and 160 modified nucleobases.
[0190] In some embodiments, the RNA molecule and / or the oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, or more modified nucleobases.
[0191] In some embodiments, the topologically modified RNA molecule comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, between 100 and 200, between 200 and 300, between 400 and 500, between 600 and 700, between 800 and 900, or between 900 and 1000 modified nucleobases.
[0192] In some embodiments, the RNA molecule comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 750, at least 1000, or more modified nucleobases.
[0193] In some embodiments, the at least one modified nucleotide comprises one or more modified sugars, one or more modified phosphates, one or more modified nucleobases, or any combination thereof.
[0194] In some embodiments, the RNA molecule comprises an open reading frame (ORF).
[0195] In some embodiments, the ORF encodes a therapeutic protein. As used herein, a “therapeutic protein” refers to a protein that prevents, reduces, or alleviates one or more signs or symptoms of a disease or disorder when expressed in a subject, such as a human subject that has, for example, an essential enzyme, clotting factor, transcription factor, growth factor, cytokine,524902-6740-5691.1Atty. Docket No. 114203-1101 chemokine, antibody (or antibody fragment thereof), protein hormone, signaling protein, structural protein, or cell surface receptor encoded by a gene that is mutated in a subject. A mutation in a gene encoding such a protein may cause diminished levels of the protein to be expressed in one or more cells of the subject. For example, IPEX syndrome in humans is caused by a mutation in the F0XP3 gene, which hinders development of FOXP3+ regulatory T cells and results in increased susceptibility to autoimmune and inflammatory disorders. Expression of an essential enzyme, clotting factor, transcription factor, growth factor, cytokine, chemokine, antibody (or antibody fragment thereof), protein hormone, signaling protein, structural protein, or cell surface receptor from an RNA may therefore compensate for a mutation in the gene encoding such a protein in a subject. In some embodiments, the therapeutic protein is a protein that is expressed in one or more cells of a subject a level that is less than (e.g., significantly less than) that of a reference value, such as the level of expression of the protein that is typical in cells of one or more healthy subjects (i.e., subjects who do not have and are not at risk for developing the disease or disorder). Non-limiting examples of therapeutic proteins include base editors (e.g., adenine base editors or RNA base editors), CRISPR-associated proteins (Casl, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Casl2 [Cpfl], or Casl3 [C2c2] endonuclease), RNase proteins (e.g., RNase III), hormones (e.g., insulin, renin, parathyroid hormone, thyroid hormone), thrombin, fibrinogen, metabolic enzymes, erythropoietin (EPO), growth hormone (e.g., GSH), interferons, antibodies (e g., monoclonal antibodies), colonystimulating factors (CSFs, e.g., granulocyte colony-stimulating factor [G-CSF]), tissue plasminogen activator (tPA), Factor VIII, Factor IX, enzymes (e.g., for conditions such as Gaucher’s disease or Fabry disease), interleukins, bone morphogenic proteins (BMPs), relaxin, alpha- 1 antitrypsin, filgrastim, oxytocin, somatostatin, calcitonin, glucagon, liraglutide, vasopressin, epigenetic modulating proteins, and growth factors.
[0196] In some embodiments, the ORF encodes an antigen. As used herein, “antigen” refers to a molecule (e.g., a protein) that, when expressed in a subject, elicits the generation of antibodies in the subject that bind to the antigen. In some embodiments, the antigen is a protein derived from a pathogen, such as a pathogenic virus, bacterium, protozoan, or fungus. In some embodiments, the antigen is a protein derived from a virus (viral antigen) or a fragment thereof. In some embodiments, the antigen is a protein derived from a bacterium (bacterial antigen) or a fragment thereof. In some embodiments, the antigen is a protein derived from a protozoan534902-6740-5691.1Atty. Docket No. 114203-1101(protozoal antigen) or a fragment thereof. In some embodiments, the antigen is a protein derived from a fungus (fungal antigen) or a fragment thereof. A fragment of a full-length protein refers to a protein with an amino acid sequence that is present in, but shorter than, the amino acid sequence of the full-length protein. Thus, in some embodiments, the RNA transcripts produced by the methods provided herein may be used for prophylactic purposes, such as for vaccination of a subject.Methods for producing a topologically modified RNA molecule using click chemistry
[0197] Another aspect of the disclosure is directed to method for producing a topologically modified RNA molecule comprising: incubating (i) an RNA molecule comprising at least one genetic code expansion (GCE) base at a target location, wherein the at least one GCE base comprises a click chemistry handle and (ii) an oligonucleotide comprising a topological modification, wherein the oligonucleotide comprises a click chemistry moiety corresponding to the click chemistry handle, thereby conjugating (i) with (ii) and producing the topologically modified RNA molecule.
[0198] In some embodiments, the at least one GCE base is selected from dNaM, dTPT3, d5SICS, dZ, dP, dDs, dPx, dIMO, dFIMO, dFEMO, dFTPT3, rNaM, rTPT3, r5SICS, rZ, rP, rDs, rPx, rIMO, rFIMO, rFEMO, rFTPT3 or an analog thereof.
[0199] In some embodiments, the topological modification comprises at least one (e.g., at least 1, 2, 3, or 4) 5’ cap. In some embodiments, the topological modification comprises at least one (e.g., at least 1, 2, 3, or 4) poly-A tail. . In some embodiments, the topological modification comprises at least one (e.g., at least 1, 2, 3, or 4) 5’ cap and at least one (e.g., at least 1, 2, 3, or 4) 3’ cap. In some embodiments, the topological modification comprises any combination of 5’ cap, 3’ cap and poly-A tail.
[0200] In some embodiments, the topologically modified RNA molecule comprises a 5’ multi-capped mRNA, a 573’ multi-capped mRNA, a multi -tailed mRNA, or a capped circular RNA.
[0201] In some embodiments, the RNA molecule is a circular RNA molecule, optionally a capped-circular mRNA (QRNA).
[0202] In some embodiments, the method further comprises circularizing the RNA molecule.544902-6740-5691.1Atty. Docket No. 114203-1101
[0203] In some embodiments, the circularizing is achieved by intron back-splicing.
[0204] In some embodiments, the at least one GCE is within an untranslated region(UTR) of the RNA molecule.
[0205] In some embodiments, the RNA molecule further comprises a 3’ exonucleaseresistant modification.
[0206] In some embodiments, the 3’ exonuclease-resistant modification is selected from the group consisting of phosphorothioate (PS) linkage, 2’-O-methyl (2OMe), 2’ Fluoro, inverted deoxythymidine (dT), inverted dideoxythymidine (ddT), 3’ phosphorylation, C3 spacer, 2'-O- methoxy-ethyl (2'-M0E), G-quadruplex, and 2'-3'-dideoxy nucleotide (ddN), or a combination thereof.
[0207] In some embodiments, the RNA molecule and / or the oligonucleotide comprises at least one modified nucleotide.
[0208] In some embodiments, the at least one modified nucleotide comprises a modified sugar. In some embodiments, the modified sugar is selected from the group consisting of 2 - deoxy fluoro (2FA), L-adenosine (LA), 2'-deoxyadenosine (dA), locked nucleic acid (LNA), 2'- methoxy (2OMe), 2'-methoxyethoxy (2M0E), 2'-thioribose, 2', 3 '-dideoxyribose, 2'-amino-2'- deoxyribose, 2' deoxyribose, 2 '-azi do-2 '-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O- methylribose, 2'-O-methyldeoxyribose, 3 '-amino-2', 3 '-dideoxyribose, 3'-azido-2',3'- dideoxyribose, 3 ’-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'- aminoribose, 5 '-thioribose, 5-nitro-l-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C- methylene-linked, 2'-O,4'-C-amino-linked ribose, 2'-O,4'-C-thio-linked ribose, and thiomorpholino oligo (TMO)-linked ribose.
[0209] In some embodiments, the RNA molecule and / or the oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 75, between 75 and 100, between 100 and 125, between 125 and 150, or between 135 and 160 modified sugars.
[0210] In some embodiments, the RNA molecule and / or the oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, or more modified sugars.554902-6740-5691.1Atty. Docket No. 114203-1101
[0211] In some embodiments, RNA molecule comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, between 100 and 200, between 200 and 300, between 400 and 500, between 600 and 700, between 800 and 900, or between 900 and 1000 modified sugars.
[0212] In some embodiments, the RNA molecule comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 750, at least 1000, or more modified sugars.
[0213] In some embodiments, the at least one modified nucleotide comprises a modified phosphate.
[0214] In some embodiments, the modified phosphate is selected from the group consisting of phosphorothioate (PS), thiophosphate, 5'-O-methylphosphonate, 3'-O- methylphosphonate, 5 '-hydroxyphosphonate, hydroxyphosphanate, phosphorosel enoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate.
[0215] In some embodiments, the RNA molecule and / or the oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 75, between 75 and 100, between 100 and 125, between 125 and 150, or between 135 and 160 modified phosphates.
[0216] In some embodiments, the RNA molecule and / or the oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, or more modified phosphates.
[0217] In some embodiments, the RNA molecule comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, between 100 and 200, between 200 and 300, between 400 and 500, between 600 and 700, between 800 and 900, or between 900 and 1000 modified phosphates.
[0218] In some embodiments, the RNA molecule comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at564902-6740-5691.1Atty. Docket No. 114203-1101 least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 750, at least 1000, or more modified phosphates.
[0219] In some embodiments, the one or more modified nucleotides comprise a modified nucleobase.
[0220] In some embodiments, the modified nucleobase is selected from the group consisting of inosine, xanthine, allyaminouracil, allyaminothymidine, hypoxanthine, digoxigeninated adenine, digoxigeninated cytosine, digoxigeninated guanine, digoxigeninated uracil, 6-chloropurineriboside, N6-methyladenosine, methylpseudouracil, 2-thiocytosine, 2- thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6- dihydrouracil, 5-[(3-Indolyl)propionamide-N-allyl]uracil, 5-aminoallylcytosine, 5- aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5- carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5- hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5- iodocytosine, 5-iodouracil, 5 -methoxy cytosine, 5-methoxyuracil, 5-methylcytosine, 5- methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5- propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7- deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8- azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin- 16-7-deaza-7-propargylaminoguanine, biotin- 16- aminoallylcytosine, biotin- 16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3- 6-propargylaminouracil, cyanine 3 -aminoallylcytosine, cyanine 3 -aminoallyluracil, cyanine 5-6- propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabcyl-5-3-aminoallyluracil, desthiobiotin- 16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, Nl- ethylpseudouracil, N1 -methoxymethylpseudouracil, N1 -methyladenine, N1 -methylpseudouracil, N1 -propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6- methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3 -deazaadenine, 2,6-diaminoadenine, 2,6- daminoguanine, 5-carboxamide-uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl- thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis-574902-6740-5691.1Atty. Docket No. 114203-1101 hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2- methylthio-N6-threonyl carbamoyl adenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A).
[0221] In some embodiments, the RNA molecule and / or the oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 75, between 75 and 100, between 100 and 125, between 125 and 150, or between 135 and 160 modified nucleobases.
[0222] In some embodiments, the RNA molecule and / or the oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, or more modified nucleobases.
[0223] In some embodiments, the topologically modified RNA molecule comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, between 100 and 200, between 200 and 300, between 400 and 500, between 600 and 700, between 800 and 900, or between 900 and 1000 modified nucleobases.
[0224] In some embodiments, the RNA molecule comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 750, at least 1000, or more modified nucleobases.
[0225] In some embodiments, the at least one modified nucleotide comprises one or more modified sugars, one or more modified phosphates, one or more modified nucleobases, or any combination thereof.
[0226] In some embodiments, the RNA molecule comprises an open reading frame (ORF).
[0227] In some embodiments, the ORF encodes a therapeutic protein. As used herein, a “therapeutic protein” refers to a protein that prevents, reduces, or alleviates one or more signs or symptoms of a disease or disorder when expressed in a subject, such as a human subject that has,584902-6740-5691.1Atty. Docket No. 114203-1101 for example, an essential enzyme, clotting factor, transcription factor, growth factor, cytokine, chemokine, antibody (or antibody fragment thereof), protein hormone, signaling protein, structural protein, or cell surface receptor encoded by a gene that is mutated in a subject. A mutation in a gene encoding such a protein may cause diminished levels of the protein to be expressed in one or more cells of the subject. For example, IPEX syndrome in humans is caused by a mutation in the F0XP3 gene, which hinders development of F0XP3+ regulatory T cells and results in increased susceptibility to autoimmune and inflammatory disorders. Expression of an essential enzyme, clotting factor, transcription factor, growth factor, cytokine, chemokine, antibody (or antibody fragment thereof), protein hormone, signaling protein, structural protein, or cell surface receptor from an RNA may therefore compensate for a mutation in the gene encoding such a protein in a subject. In some embodiments, the therapeutic protein is a protein that is expressed in one or more cells of a subject a level that is less than (e.g., significantly less than) that of a reference value, such as the level of expression of the protein that is typical in cells of one or more healthy subjects (i.e., subjects who do not have and are not at risk for developing the disease or disorder). Non-limiting examples of therapeutic proteins include base editors (e.g., adenine base editors or RNA base editors), CRISPR-associated proteins (Casl, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Casl2 [Cpfl], or Casl3 [C2c2] endonuclease), RNase proteins (e.g., RNase III), hormones (e.g., insulin, renin, parathyroid hormone, thyroid hormone), thrombin, fibrinogen, metabolic enzymes, erythropoietin (EPO), growth hormone (e g., GSH), interferons, antibodies (e.g., monoclonal antibodies), colonystimulating factors (CSFs, e.g., granulocyte colony-stimulating factor [G-CSF]), tissue plasminogen activator (tPA), Factor VIII, Factor IX, enzymes (e.g., for conditions such as Gaucher’s disease or Fabry disease), interleukins, bone morphogenic proteins (BMPs), relaxin, alpha- 1 antitrypsin, filgrastim, oxytocin, somatostatin, calcitonin, glucagon, liraglutide, vasopressin, epigenetic modulating proteins, and growth factors.
[0228] In some embodiments, the ORF encodes an antigen. As used herein, “antigen” refers to a molecule (e.g., a protein) that, when expressed in a subject, elicits the generation of antibodies in the subject that bind to the antigen. In some embodiments, the antigen is a protein derived from a pathogen, such as a pathogenic virus, bacterium, protozoan, or fungus. In some embodiments, the antigen is a protein derived from a virus (viral antigen) or a fragment thereof. In some embodiments, the antigen is a protein derived from a bacterium (bacterial antigen) or a594902-6740-5691.1Atty. Docket No. 114203-1101 fragment thereof. In some embodiments, the antigen is a protein derived from a protozoan (protozoal antigen) or a fragment thereof. In some embodiments, the antigen is a protein derived from a fungus (fungal antigen) or a fragment thereof. A fragment of a full-length protein refers to a protein with an amino acid sequence that is present in, but shorter than, the amino acid sequence of the full-length protein. Thus, in some embodiments, the RNA transcripts produced by the methods provided herein may be used for prophylactic purposes, such as for vaccination of a subject.
[0229] In another aspect, the methods disclosed herein provide an RNA precursor and / or a capped RNA transcript comprising one or more noncoding genes. In some embodiments, the noncoding heterologous genes are therapeutic nucleic acids. As used herein, a therapeutic nucleic acid is a nucleic acid or related compound that alters gene expression to prevent or treat diseases or disorders. In some embodiments, the therapeutic nucleic acid is an antisense oligonucleotide (ASO), N-acetylgalactosamine (GalNAc) ligand-modified short interfering RNA (siRNA) conjugate, DNA aptamer, RNA aptamer, ribozyme, RNA decoy, siRNA, shRNA, miRNA, gRNA, or CRISPRi molecule.Methods for generating an RNA molecule comprising at least one exonuclease resistant phosphodiester modification in a site-specific manner.
[0230] Another aspect of the disclosure is directed to a method for generating an RNA molecule comprising at least one exonuclease resistant phosphodi ester modification in a sitespecific manner, the method comprising: transcribing a single stranded DNA (ssDNA) template comprising at least one genetic code expansion (GCE) base at a target location, wherein the transcribing is performed using a mixture of nucleotide triphosphates comprising a modified GCE nucleotide triphosphate corresponding to the at least one GCE base, and wherein the modified GCE nucleotide triphosphate comprises an exonuclease resistant phosphodiester modification, thereby generating the RNA molecule comprising at least one exonuclease resistant phosphodiester modification at the target location.
[0231] In some embodiments, the target location is the 3’ end of the RNA molecule. In some embodiments, the target location is the 5’ end of the RNA molecule.604902-6740-5691.1Atty. Docket No. 114203-1101
[0232] In some embodiments, the modified GCE triphosphate is selected from dNaM-TP, dTPT3-TP, d5SICS-TP, dZ-TP, dP-TP, dDs-TP, dPx-TP, , dIMO-TP, dFIMO-TP, dFEMO-TP, dFTPT3-TP, rNaM-TP, rTPT3-TP, r5SICS-TP, rZ-TP, rP-TP, rDs-TP, rPx-TP, rIMO-TP, rFIMO-TP, rFEMO-TP, rFTPT3-TP, or an analog thereof.
[0233] In some embodiments, the RNA molecule comprises an open reading frame (ORF). In some embodiments, the ORF encodes a therapeutic protein. As used herein, a “therapeutic protein” refers to a protein that prevents, reduces, or alleviates one or more signs or symptoms of a disease or disorder when expressed in a subject, such as a human subject that has, for example, an essential enzyme, clotting factor, transcription factor, growth factor, cytokine, chemokine, antibody (or antibody fragment thereof), protein hormone, signaling protein, structural protein, or cell surface receptor encoded by a gene that is mutated in a subject. A mutation in a gene encoding such a protein may cause diminished levels of the protein to be expressed in one or more cells of the subject. For example, IPEX syndrome in humans is caused by a mutation in the FOXP3 gene, which hinders development of FOXP3+ regulatory T cells and results in increased susceptibility to autoimmune and inflammatory disorders. Expression of an essential enzyme, clotting factor, transcription factor, growth factor, cytokine, chemokine, antibody (or antibody fragment thereof), protein hormone, signaling protein, structural protein, or cell surface receptor from an RNA may therefore compensate for a mutation in the gene encoding such a protein in a subject. In some embodiments, the therapeutic protein is a protein that is expressed in one or more cells of a subject a level that is less than (e.g., significantly less than) that of a reference value, such as the level of expression of the protein that is typical in cells of one or more healthy subjects (i.e., subjects who do not have and are not at risk for developing the disease or disorder). Non-limiting examples of therapeutic proteins include base editors (e.g., adenine base editors or RNA base editors), CRISPR-associated proteins (Cast, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Casl2 [Cpfl], or Casl3 [C2c2] endonuclease), RNase proteins (e.g., RNase III), hormones (e.g., insulin, renin, parathyroid hormone, thyroid hormone), thrombin, fibrinogen, metabolic enzymes, erythropoietin (EPO), growth hormone (e.g., GSH), interferons, antibodies (e.g., monoclonal antibodies), colonystimulating factors (CSFs, e.g., granulocyte colony-stimulating factor [G-CSF]), tissue plasminogen activator (tPA), Factor VIII, Factor IX, enzymes (e.g., for conditions such as Gaucher’s disease or Fabry disease), interleukins, bone morphogenic proteins (BMPs), relaxin,614902-6740-5691.1Atty. Docket No. 114203-1101 alpha- 1 antitrypsin, filgrastim, oxytocin, somatostatin, calcitonin, glucagon, liraglutide, vasopressin, epigenetic modulating proteins, and growth factors.
[0234] In some embodiments, the ORF encodes an antigen. As used herein, “antigen” refers to a molecule (e.g., a protein) that, when expressed in a subject, elicits the generation of antibodies in the subject that bind to the antigen. In some embodiments, the antigen is a protein derived from a pathogen, such as a pathogenic virus, bacterium, protozoan, or fungus. In some embodiments, the antigen is a protein derived from a virus (viral antigen) or a fragment thereof. In some embodiments, the antigen is a protein derived from a bacterium (bacterial antigen) or a fragment thereof. In some embodiments, the antigen is a protein derived from a protozoan (protozoal antigen) or a fragment thereof. In some embodiments, the antigen is a protein derived from a fungus (fungal antigen) or a fragment thereof. A fragment of a full-length protein refers to a protein with an amino acid sequence that is present in, but shorter than, the amino acid sequence of the full-length protein. Thus, in some embodiments, the RNA transcripts produced by the methods provided herein may be used for prophylactic purposes, such as for vaccination of a subject.
[0235] In another aspect, the methods disclosed herein provide an RNA precursor and / or a capped RNA transcript comprising one or more noncoding genes. In some embodiments, the noncoding heterologous genes are therapeutic nucleic acids. As used herein, a therapeutic nucleic acid is a nucleic acid or related compound that alters gene expression to prevent or treat diseases or disorders. In some embodiments, the therapeutic nucleic acid is an antisense oligonucleotide (ASO), N-acetylgalactosamine (GalNAc) ligand-modified short interfering RNA (siRNA) conjugate, DNA aptamer, RNA aptamer, ribozyme, RNA decoy, siRNA, shRNA, miRNA, gRNA, or CRISPRi molecule.Compositions
[0236] Another aspect of the disclosure is directed to a topologically modified RNA molecule produced by the methods of the present disclosure. Another aspect of the disclosure is directed to a composition comprising topologically modified RNA molecule produced by the methods of the present disclosure.
[0237] In some embodiments, a composition provided herein e.g., a pharmaceutical composition) further comprises one or more additional agents. In some embodiments, the624902-6740-5691.1Atty. Docket No. 114203-1101 additional agent is a nucleotide, a nucleic acid, an amino acid, a peptide, a protein, a small molecule, an aptamer, a lipid, or a carbohydrate. In some embodiments, the additional agent is an agent which has a therapeutic effect when administered to a subject. In some embodiments, the additional agent is an agent that is capable of modulating expression of a gene and / or protein is a subject, such as a short hairpin RNA (shRNA), a small interfering RNA (siRNA), or an antisense oligonucleotide (ASO). In some embodiments, the additional agent is a small molecular inhibitor. In some embodiments, the additional agent is an agent that is capable of eliciting or enhancing an immune response in a subject. In some embodiments, the additional agent is an antigen (e.g., a viral antigen, a bacterial antigen). In some embodiments, the additional agent is an adjuvant, which is defined as an agent that is sufficient for enhancing an immune response in a subject when administered at an effective amount, but does not elicit an immune response in a subject when administered alone. In some embodiments, the additional agent is an enzyme, such as an enzyme that is capable of catalyzing one or more chemical reactions in a subject or in cells of a subject.Peptides and polypeptides encoded by RNA
[0238] Polypeptides encoded by the RNA molecules (linear or circularized) provided by the disclosure include any therapeutically useful polypeptide for treatment or intervention of any disease process associated with or dependent on polymorphic or mutant polypeptide species, heritable or acquired as a result of environmental insult or injury. Linear or QRNA can encode multiple polypeptides, for example, self-amplifying mRNA cassettes, or multiple therapeutic peptides or polypeptides. In some embodiments, the capped RNA molecule (circular or linear) comprises an mRNA region encoding one or a plurality of peptides or polypeptides. A plurality of polypeptides include multiple copies of the same polypeptide or multiple copies of different polypeptides.[00239J An IRES, or self-cleaving peptide such as T2A sequence, can exist between the multiple polypeptide coding sequences on the RNA (linear or QRNA). Alternatively, an RNA oligonucleotide containing a cap residue site is located before each polypeptide coding sequence, which ultimately will result in a RNA with multiple cap residue-containing RNA oligonucleotides and ensure that all coding sequences are translated efficiently.634902-6740-5691.1Atty. Docket No. 114203-1101
[0240] Peptides encoded by capped RNA molecules (linear or circular) of the disclosure can include but are not limited to therapeutic peptides or antigenic peptides, particularly antigenic peptides suitable for presentation by antigen-presenting cells to humoral (B cells) or cellular (T cells) immune system cells. In certain embodiments these antigenic peptides are adapted to and effective for use as vaccines. In other embodiments the antigenic peptides are adapted to or effective in suppressing immune responses, for example in autoimmune diseases or transplant patients. In additional embodiments the antigenic peptides are adapted to and effective for eliciting specific antitumor immune responses in tumor cells or in attracting cytotoxic native (natural killer cells) or engineered (e.g., CAR-T) cells. Therapeutic peptides encoded by capped, circularized RNA molecules of the disclosure can include but are not limited to human parathyroid hormone, filgrastim, oxytocin, somatostatin, calcitonin, glucagon, insulin, liraglutide, vasopressin, and the like (see, Fosgerau & Hoffman, 2015, Drug Discovery Today 20:122-128; al Musaimi etal., 2021, Pharmaceuticals (Basil) 14: 145; Wang et al., 2022, Signal Transduct, and Targeted Therap. 7: 1-27).
[0241] In some embodiments, peptides encoded by the capped RNA molecules (linear or circular) of the disclosure can include, but are not limited, to Cas9 or derivatives (Rothgangl et al., 2021, Nat. Biotechnol. 39: 949-957) and adenine base editors or other base editors (Gaudelli etal., 2017, Nature 551 : 464-471), or RNA base editors for delivery of genome or epigenome editing therapies.
[0242] In some embodiments, peptides encoded by the capped RNA molecules (linear or circular) of the disclosure can be selected from any of several target categories including, but not limited to, biologies, antibodies, vaccines , therapeutic proteins or peptides, cell penetrating peptides, secreted proteins, plasma membrane proteins, cytoplasmic or cytoskeletal proteins, intracellular membrane bound proteins, nuclear proteins, proteins associated with human disease, or targeting moieties.Purification of topologically modified RNA
[0243] In some embodiments, the nucleic acids / RNA molecules described herein are purified by any method known in the art to remove undesired components from IVT or associated reactions (including unincorporated rNTPs, protein enzymes, salts, metal ions, etc.). Techniques for the isolation of RNA molecules are well known in the art. Well-known644902-6740-5691.1Atty. Docket No. 114203-1101 procedures include phenol / chloroform extraction and or precipitation with alcohol (ethanol, isopropanol) in the presence of monovalent cations or lithium chloride. Additional non-limiting examples of purification procedures which can be used include size exclusion chromatography (Lukavsky, P.J. and Puglisi, J.D., 2004, Large-scale preparation and purification of polyacrylamide-free RNA oligonucleotides, RNA v.10, 889-893), silica-based affinity chromatography and polyacrylamide gel electrophoresis (Bowman, et al. in RNA in vitro transcription and RNA purification by denaturing PAGE in Recombinant and in vitro RNA syntheses Methods v. 941 Conn G.L. (ed), New York, N.Y. Humana Press, 2012). Purification can be performed using a variety of commercially available kits including, but not limited to SV Total Isolation System (Promega) and In Vitro Transcription Cleanup and Concentration Kit (Norgen Biotek). Techniques to remove contaminants, such as dsDNA, have been developed and are known in the art including but not limited to scalable HPLC purification (see, e.g., Kariko, et al., 2011, Nucl Acid Res, v. 39 el42; Weissman, et al., 2012, Synthetic Messenger RNA and Cell Metabolism Modulation v.969 (Rabinovich, P.H. Ed)). In a preferred embodiment, the capped RNA described herein is purified through HPLC, as HPLC-purified RNA has been reported to be translated at much greater levels compared to other purification methods, particularly in primary cells and in vivo.
[0244] In some aspects, the topologically modified RNA oligonucleotides provided herein (e.g., comprising one or more modified oligonucleotides) are purified by high- performance liquid chromatography (HPLC). In some embodiments, the topologically modified RNA oligonucleotide is purified by reverse-phase HPLC (RP-HPLC). The addition of a counterion to the mobile phase of a HPLC setup can improve separation of the desired product from unwanted products. In some embodiments, HPLC gradients used to isolate the capped RNA oligonucleotides comprise hydrophobic hexylammonium ions. In some embodiments, the gradient is chosen from ethyl ammonium, diethyl ammonium, triethyl ammonium, propyl ammonium, dipropyl ammonium, hexyl ammonium, dihexyl ammonium, octyl ammonium, dioctyl ammonium, etc. The number and lengths of carbon chains may be altered based on the lengths of the oligonucleotide to be captured and the desired feature for separation. In some embodiments, the concentration of hydrophobic ions (e.g., hexylammonium ions) used for HPLC purification of RNA oligonucleotides is between 10 mM to 200 mM. In some embodiments, the concentration of hydrophobic ions is between 10 mM and 20 mM, between 20 mM and 30 mM,654902-6740-5691.1Atty. Docket No. 114203-1101 between 30 mM and 40 mM, between 40 mM and 50 mM, between 50 mM and 60 mM, between 60 mM and 70 mM, between 70 mM and 80 mM, between 80 mM and 90 mM, between 90 mM and 100 mM, between 100 mM and 110 mM, between 110 mM and 120 mM, between 120 mM and 130 mM, between 130 mM and 140 mM, between 140 mM and 150 mM, between 150 mM and 160 mM, between 160 mM and 170 mM, between 170 mM and 180 mM, between 180 mM and 190 mM, or between 190 mM and 200 mM. In some embodiments, the concentration of hydrophobic ions is greater than 200 mM.Compositions comprising topologically modified RNA transcripts
[0245] In some aspects, the present disclosure provides a delivery reagent comprising any of the capped RNA transcripts provided herein. In some embodiments, any of the capped RNA transcripts provided herein are conjugated to a delivery agent. Any of the capped RNA transcripts provided herein may be conjugated to a delivery agent that includes, for example, to a lipid, a peptide, a protein, an antibody, or a carbohydrate. Lipids used in the conjugation and delivery of modified mRNAs are generally known in the art, and include, for example, cholesterol. Peptides, proteins, antibodies, and carbohydrates used in the conjugation and delivery of modified mRNAs are generally known in the art and include, for example, any peptide, protein, antibody, or carbohydrate known to bind specifically to a moiety (e.g., a protein) on the surface of a target cell type. Methods for conjugating a lipid, peptide, protein, antibody, or carbohydrate to a capped RNA transcript include, for example, methods of conjugating a lipid, peptide, protein, antibody, or carbohydrate to a capped RNA transcript at a 5’ or 3’ terminus, and are generally known in the art.
[0246] In some embodiments, any of the topologically modified RNA transcripts provided herein are conjugated to or encapsulated by a delivery agent that includes, for example, a nanoparticle, a microparticle, or an exosome. A nanoparticle refers to a particle having a diameter between approximately 10 nm and 1000 nm. A microparticle is defines as a particle having a diameter greater than 1000 nm (1 pm), such as a particle having a diameter between approximately 1 pm and 100 pm. In some embodiments, a nanoparticle or microparticle is approximately spherical. In some embodiments, a nanoparticle or microparticle is hollow, comprising an internal core. In some embodiments, a nanoparticle or microparticle is a lipid nanoparticle or lipid microparticle, respectively. A lipid nanoparticle or lipid microparticle refers to a composition comprising one or more lipids that form an aggregate of lipids, or an enclosed664902-6740-5691.1Atty. Docket No. 114203-1101 structure with an interior surface and an exterior surface. Tn some embodiments, a lipid nanoparticle or lipid microparticle comprises a lipid bilayer that encloses an aqueous core. Lipids used in the formulation of lipid nanoparticles and lipid microparticles for delivering RNAs are generally known in the art, and include, but are not limited to, ionizable amino lipids, noncationic lipids, sterols, and polyethylene glycol-modified lipids. See, e.g., Buschmann et al. Vaccines. 2021. 9( 1):65. In some embodiments, the topologically modified RNA transcript is surrounded by the lipids of the lipid nanoparticle or the lipid microparticle and are present in the interior of the lipid nanoparticle or lipid microparticle. In some embodiments, the topologically modified RNA transcript is dispersed throughout the lipids of the lipid nanoparticle or lipid microparticle. In some embodiments, the lipid nanoparticle or lipid microparticle comprises an ionizable amino lipid, a non-cationic lipid, a sterol, and / or a polyethylene glycol (PEG)-modified lipid. Lipid nanoparticles and lipid microparticles comprising modified mRNAs may be prepared by any means generally known in the art, such as, for example, detergent dialysis, emulsion, centrifugation, evaporation, thin film hydration, or ethanol dilution. See, e.g., Barba et al. Pharmaceutics. 2019. 11(8):360. An exosome refers to a type of lipid nanoparticle produced by eukaryotic cells as a result of the inward budding of vesicles within multivesicular bodies and are generally between 30 nm and 150 nm in diameter. Exosomes comprise a heterogenous mixture of endogenous lipids, such as phospholipids, membrane-anchored proteins, and carbohydrates present in eukaryotic cells, and enclose an aqueous core. Exosomes may have beneficial features that are difficult to achieve with synthetically produced lipid nanoparticles, such as, for example, the ability to pass through the blood brain barrier and deliver topologically modified RNA transcripts to tissues within the brain. Exosomes comprising topologically modified RNA transcripts may be produced by any means generally known in the art, such as, for example, by sonicating or electroporating isolated exosomes in the presence of a topologically modified RNA transcript, or mixing exosomes with a lipid-conjugated topologically modified RNA transcript, such as, for example, a topologically modified RNA transcript that has been conjugated to cholesterol. See, e.g., Roberts et al. Nat Rev Drug Discov. 2020. 19( 10) :673 -694.
[0247] In some embodiments, a nanoparticle or microparticle is a polymeric nanoparticle or polymeric microparticle, respectively. A polymeric nanoparticle or polymeric microparticle refers to a nanoparticle or microparticle composition, respectively, comprising one or more polymers that form an aggregate of polymers, or an enclosed structure with an interior surface674902-6740-5691.1Atty. Docket No. 114203-1101 and an exterior surface. In some embodiments, a polymeric nanoparticle or polymeric microparticle comprises a polymeric layer that encloses an aqueous core. Polymers used in the formulation of polymeric nanoparticles and polymeric microparticles for delivering RNA are generally known in the art, and include cationic polymers such as, but are not limited to, polyethylenimine (PEI), poly-amido-amine (PAA), poly-beta amino-esters (PBAEs), polylysine (PLL), spermine, chitosan, polyurethane, and derivatives thereof (e.g., PEI stearic acid (PSA) copolymer). See, e.g., Liu et al. Front Bioeng Biotechnol. 2021. 9:718753. In some embodiments, the topologically modified RNA transcript is surrounded by the polymers of the polymeric nanoparticle or the polymeric microparticle and are present in the interior of the polymeric nanoparticle or polymeric microparticle. In some embodiments, the topologically modified RNA transcript is dispersed throughout the polymers of the polymeric nanoparticle or polymeric microparticle.
[0248] In some embodiments, a nanoparticle or microparticle is a protein nanoparticle or protein microparticle, respectively. A protein nanoparticle or protein microparticle refers to a nanoparticle or microparticle composition, respectively, comprising one or more proteins that form an aggregate of proteins, or an enclosed structure with an interior surface and an exterior surface. In some embodiments, a protein nanoparticle or protein microparticle comprises a protein layer that encloses an aqueous core. Proteins used in the formulation of protein nanoparticles and protein microparticles for delivering RNA are generally known in the art, and include but are not limited to, viral coat proteins and ferritin. See, e.g., Wang et al. Nat Nanotechnol. 2020. 15(5):406-416. In some embodiments, the topologically modified RNA transcript is surrounded by the proteins of the protein nanoparticle or the protein microparticle and are present in the interior of the protein nanoparticle or protein microparticle. In some embodiments, the topologically modified RNA transcript is external to the proteins of the protein nanoparticle or the protein microparticle and are attached to the exterior surface of the protein nanoparticle or protein microparticle. In some embodiments, the topologically modified RNA transcript is conjugated to proteins of the protein nanoparticle or protein microparticle through a covalent linkage, such as, for example, that formed by a click chemistry reaction, or by fusing the topologically modified RNA transcript and protein each to a protein or peptide of a protein / peptide pair known to react to form a covalent linkage.684902-6740-5691.1Atty. Docket No. 114203-1101
[0249] In some embodiments, a nanoparticle or microparticle is a solid nanoparticle or solid microparticle. A solid nanoparticle or solid microparticle refers to a nanoparticle or microparticle composition, respectively, comprising one or more materials that form a solid structure, which has an external surface and may or may not comprise an internal surface. A solid nanoparticle or solid microparticle may comprise any suitable material that is generally known in the art, such as, for example, gold, silver, or silicon dioxide (silica). In some embodiments, a topologically modified RNA transcript is conjugated to the external surface of a solid nanoparticle or solid microparticle. Solid nanoparticles and solid microparticles comprising topologically modified RNA transcripts may be produced by any means generally known in the art, such as, for example, by linking the topologically modified RNA transcripts to the surface of the solid nanoparticle or solid microparticle through thiol linkages (e.g., modifying the DNA to comprise cyclic disulfide-anchoring groups), or by modifying the external surface of the solid nanoparticle or solid microparticle with one or more cationic materials (e g., PEI) within which topologically modified RNA transcripts are present. See, e.g., Roberts et al. Nat Rev Drug Discov. 2020. 19(10):673-694, Lee et al. Nano Lett. 2007, 7(7):2112-2115, and Paris and Vallet- Regi. Pharmaceutics. 2020, 12(6):526.
[0250] In some aspects, the present disclosure provides cells comprising any of the topologically modified RNA transcripts provided herein. In some embodiments, the cell is a human cell comprising any one of the topologically modified RNA transcripts provided herein. A “cell” is the basic structural and functional unit of all known independently living organisms. It is the smallest unit of life that is classified as a living thing. Some organisms, such as most bacteria, are unicellular (consist of a single cell). Other organisms, such as plants, fungi, and animals, including cattle, horses, chickens, turkeys, sheep, swine, dogs, cats, and humans, are multicellular. In some embodiments, the half-life of the topologically modified RNA transcript in the cell is 15-900 minutes. In some embodiments, the half-life of the topologically modified RNA transcript in the cell is 30-600 minutes. In some embodiments, the half-life of the topologically modified RNA transcript in the cell is 60-300 minutes. In some embodiments, the half-life of the topologically modified RNA transcript is at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60 minutes. In some embodiments, the half-life of the topologically modified RNA transcript in the cell is at least 30, at least 60, at least 90, at least 120, at least 150, at least 180, at least 210, at least 240, at least694902-6740-5691.1Atty. Docket No. 114203-1101270, at least 300, at least 330, at least 360, at least 390, at least 420, at least 450, at least 480, at least 510, at least 540, at least 570, at least 600, at least 630, at least 660, at least 690, at least 720, at least 750, at least 780, at least 810, at least 840, or at least 870 minutes. In some aspects, the present disclosure provides compositions comprising any of the modified mRNAs, delivery agents, or cells provided herein. In some embodiments, the composition further comprises one or more additional agents, such as a nucleotide, a nucleic acid, an amino acid, a peptide, a protein, a small molecule, an aptamer, a lipid, or a carbohydrate. In some embodiments, the additional agent has a therapeutic effect when administered to a subject. In some embodiments, the additional agent is an agent for use in modulating the expression and / or activity of one or more gene products (e.g., proteins) in a subject. In some embodiments, the additional agent is a nucleic acid for use in decreasing the expression and / or activity of one or more gene products (e.g., proteins), such as a short hairpin RNA (shRNA), small interfering RNA (siRNA), or an antisense oligonucleotide (ASO). In some embodiments, the additional agent is an inhibitor for decreasing the activity of one or more gene products (e.g., proteins). In some embodiments, the agent is a small molecular inhibitor. In some embodiments, the additional agent is an agent for enhancing an immune response in a subject. In some embodiments, the additional agent is an antigen, such as a nucleic acid antigen, a protein antigen, or a phospholipid antigen. In some embodiments, the additional agent is an adjuvant, such as, for example, aluminum hydroxide or potassium aluminum sulfate (alum), monophosphoryl lipid A (MPL), an oil-in-water emulsion (e.g., a squalene emulsion), a cytosine phosphoguanine (CpG) oligodeoxynucleotide, or another adjuvant that is known in the art. See, e.g., Di Pasquale, A et al. Vaccines. 2015. 3(2):320-343. In some embodiments, the composition is a pharmaceutical composition comprising any one of the topologically modified RNA transcripts, delivery agents, or cells provided herein, and a pharmaceutically acceptable excipient. Pharmaceutically acceptable excipients, carriers, buffers, stabilizers, isotonicising agents, preservatives or antioxidants, or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may depend on the route of administration, e.g., parenteral, intramuscular, intradermal, sublingual, buccal, ocular, intranasal, subcutaneous, intrathecal, intratumoral, oral, vaginal, or rectal.
[0251] In some aspects, the present disclosure provides a method of administering to a subject any of the topologically modified RNA transcripts, delivery agents, cells, compositions,704902-6740-5691.1Atty. Docket No. 114203-1101 or pharmaceutical compositions provided herein. In some embodiments, the subject is a human. In some embodiments, the administration is parenteral, intramuscular, intradermal, sublingual, buccal, ocular, intranasal, subcutaneous, intrathecal, intratumoral, oral, vaginal, or rectal. In some embodiments, the composition is to be stored below 50°C, below 40 °C, below 30 °C, below 20 °C, below 10 °C, below 0 °C, below -10 °C, below -20 °C, below -30 °C, below -40 °C, below -50 °C, below -60°C, below -70 °C, or below -80 °C, such that the nucleic acids are relatively stable over time. In some embodiments, the topologically modified RNA transcript is introduced into a cell in a subject by in vivo electroporation. In vivo electroporation is the process of introducing nucleic acids or other molecules into a cell of a subject using a pulse of electricity, which promote passage of the nucleic acids or other molecules through the cell membrane and / or cell wall. See, e.g., Somiari et al. Molecular Therapy., 2000. 2(3): 178-187. The topologically modified RNA transcript to be delivered is administered to the subject, such as by injection, and a pulse of electricity is applied to the injection site, whereby the electricity promotes entry of the nucleic acid into cells at the site of administration. In some embodiments, the topologically modified RNA transcript is delivered to and taken up by cells of the subject (e g., cells local to the site of administration or throughout the subject) via a delivery agent that is associated with (e.g., conjugated to) the topologically modified RNA transcript. In some embodiments, the topologically modified RNA transcript is administered with other elements, such as buffers and / or excipients, that increase the efficiency of electroporation.
[0252] In some aspects, the present disclosure provides a kit comprising any of the topologically modified RNA oligonucleotides, RNA precursors, or topologically modified RNA transcripts provided herein. The topologically modified RNA oligonucleotide and RNA precursor can be combined in the presence of an RNA ligase to produce a topologically modified RNA transcript, such as one of the topologically modified RNA transcripts provided herein. In some embodiments, the kit comprises a ligase. In some embodiments, the kit comprises an RNA ligase. In some embodiments, the kit comprises a T4 RNA ligase. In some embodiments, a kit comprises a T4 RNA ligase 1. In some embodiments, a kit comprises a T4 RNA ligase 2. In some embodiments, the kit comprises an RtcB RNA ligase. In some embodiments, the kit further comprises a buffer for carrying out the ligation. In some embodiments, the kit further comprises a nucleotide triphosphate, such as ATP, to provide energy required by the ligase. In some embodiments, the kit is to be stored below 50 °C, below 40 °C, below 30 °C, below 20 °C, below714902-6740-5691.1Atty. Docket No. 114203-110110 °C, below 0 °C, below -10 °C, below -20 °C, below -30 °C, below -40 °C, below -50 °C, below -60°C, below -70 °C, or below -80 °C, such that the nucleic acids are relatively stable over time.
[0253] In some aspects, the present disclosure provides a kit comprising any of the pharmaceutical compositions provided herein and a delivery device. A delivery device refers to machine or apparatus suitable for administering a composition to a subject, such as a syringe or needle. In some embodiments, the kit is to be stored below 50 °C, below 40 °C, below 30 °C, below 20 °C, below 10 °C, below 0 °C, below -10 °C, below -20 °C, below -30 °C, below -40 °C, below -50 °C, below -60°C, below -70 °C, or below -80 °C, such that the nucleic acids of the pharmaceutical composition are relatively stable over time. In some embodiments, the kit further comprises instructions for administering any of the pharmaceutical compositions provided herein to a subject.Modified mRNAs
[0254] In some aspects, the present disclosure provides modified mRNAs comprising a 5’ cap region, wherein the 5’ cap region comprises a 5’ nucleotide cap and one or more modified nucleotides. In some embodiments, a modified mRNA is a modified linear mRNA. In some embodiments, a modified mRNA is a modified circular mRNA.
[0255] The “5' cap region”, as used herein, refers to a region of an mRNA that is 5' to (upstream of) the ORF. In some embodiments, the 5’ cap region comprises a 5’ untranslated region (5’ UTR). In some embodiments, the 5’ cap region comprises a 5’ cap. In eukaryotic cells, mRNAs possess a cap structure in which an N7-methylguanine (m7G) moiety is linked to the first transcribed nucleotide by a 5 ’-5 ’-triphosphate bridge. The 5' cap plays multiple roles in pre-mRNA splicing, mRNA export, RNA stability through blocking degradation by the 5 ’-3’ exoribonuclease (ExoN), escaping recognition of the cellular innate immune system, and the production of proteins encoded by mRNAs. The presence of a 5' cap in an mRNA facilitates the initiation of translation (see, e.g., Gallie. Genes & Dev. 1991. 5:2108-2116, and Munroe et al. Mol Cell Biol. 1990. 10(7) :3441—3455). The 5' cap is added by a 5' capping enzyme, such as mRNA guanylyltransferase. Translation initiation is a rate-limiting step of mRNA translation and heavily depends on the 5’ N7-methylguanosine (m7G) cap and its interaction with eukaryotic translation initiation factors (elFs), including the cap-binding eIF4E protein. Chemical modification on or near the 5’ cap influence binding of elFs and decapping enzymes, which724902-6740-5691.1Atty. Docket No. 114203-1101 subsequently impact downstream mRNA translation and stability. For example, the presence of 2’ O-methyl (2’0Me) groups on the first and second transcribed nucleotides (known as Cap- 0 / 1 / 2, referring to zero, one, or two 2’0Me groups) reduces mRNA immunogenicity and increases protein expression. Additionally, N6-methyladenosine (m6A) on the first base controls mRNA stability through increased resistance to decapping by Dcp2. Furthermore, the 5' cap stabilizes the mRNA by protecting the ORF from the activity of exonucleases, such as polynucleotide phosphorylase (PNPase), which can remove 3' and 5' nucleotides from an mRNA. As an exonuclease removes nucleotides, the mRNA becomes progressively shorter, and once all the nucleotides downstream of the open reading frame are removed, the nucleotides removed by the exonuclease will be nucleotides of the ORF. Removal of nucleotides from the ORF prevents translation of the encoded protein. Additionally, the association of an exonuclease with the mRNA near the ORF can inhibit translation by sterically hindering ribosomes and tRNAs from associating with the mRNA. The composition of a 5' cap typically comprises a 5' m7G attached to the mRNA by a 5' to 5 ' triphosphate intemucleotide linkage.
[0256] In some embodiments of the modified mRNAs provided herein, the modified mRNA comprises one or more modified nucleotides in the 5' cap region of the mRNA. In some embodiments, the 5' cap region includes one or more nucleotides that are not canonical adenosine, cytidine, guanosine, or uridine nucleotides. In some embodiments, the 5' cap region comprises between 1 and 3, between 3 and 5, between 5 and 7, or between 7 and 10 5' caps. In some embodiments, the 5' cap region comprises between 10-500 nucleotides. In some embodiments, the 5' cap region comprises between 10 and 15, between 15 and 20, between 20 and 25, between 25 and 50, between 50 and 100, between 100 and 150, between 150 and 200, between 200 and 300, between 300 and 400, or between 400 and 500 nucleotides.Pharmaceutical compositions for delivery and methods therefore
[0257] This disclosure provides pharmaceutical compositions comprising RNA molecules of the present disclosure, including linear and circularized mRNA molecules. In certain embodiments pharmaceutical compositions of the disclosure further comprise pharmaceutically acceptable excipients and in certain other embodiments comprise one or more additional therapeutics agents.
[0258] In some embodiments, the compositions are suitable to be administered to a human subject in need thereof. In the context of the present disclosure, “active ingredient” refers generally734902-6740-5691.1Atty. Docket No. 114203-1101 to the topologically modified RNA molecules described herein, particularly linear and circularized mRNA molecules as well as any additional therapeutic agents provided therewith.
[0259] It is generally understood by a person of ordinary skill in the art that the compositions described herein are also suitable for administration to any non-human subjects as well. A person of ordinary skill in the veterinary arts will understand that pharmaceutical compositions described herein can be suitable for administration to mammals including but not limited to primates, cattle, pigs, horses, sheep, goats, cats, dogs, mice, rats, whales, and other mammals. A person of ordinary skill in the veterinary arts also will understand that pharmaceutical compositions described herein can be suitable for administration to birds including by not limited to chickens, ducks, geese, turkey, and other domesticated birds, as well as wild birds particularly endangered species of such birds. Additionally, a person of ordinary skill in the veterinary arts will understand that pharmaceutical compositions described herein can be suitable for administration to a wide variety of fish including commercial or wild salmon, tuna, cod, sardine, zebra fish, shark, or the like.
[0260] Pharmacological compositions described herein can be prepared by any method known or developed in the art of pharmacology, immunology, virology, or in biotechnology in general.
[0261] In some embodiments, the formulations of a pharmacological composition described herein can comprise a unit dose of at least one RNA, in addition to at least one other pharmaceutically acceptable excipient. Such excipients can include but are not limited to, solvents, dispersions, buffers, diluents, surfactants, emulsifiers, isotonic agents, preservatives, thickeners, lubricating agents, oils, or the like.
[0262] In some embodiments, the pharmacological composition can comprise a delivery mechanism further comprising a lipid nanoparticle. The size of the lipid nanoparticle can be altered to counteract immunogenic response from the subject, or to allow for increased potency and pharmacological activity.
[0263] In other embodiments, the pharmacological composition can comprise a delivery mechanism further comprising a lipidoid as previously described in the art. See Akinc etal., 2008, Nat Biotechnol. 26:561-596; Frank-Kamenetsky etal., Proc Natl Acad Sci USA. 2008 105: 11915- 11920; Akinc et al., 2009, Mol Ther. 17:872-879; Love et al., 2010. Proc Natl Acad Sci USA 107: 1864-1869; Leuschner etal., 2011 , Nat Biotechnol. 29: 1005-1010, all of which is incorporated744902-6740-5691.1Atty. Docket No. 114203-1101 herein in their entirety. Lipidoids refers broadly to lipid nanoparticles, liposomes, lipid emulsions, lipid micelles and the like. Lipidoids containing the pharmacological composition comprising the derivatized RNA can be administered parenterally by means including but not limited to, intravenous injection, intramuscular injection, subcutaneous injection, via dialysate, intrathecal injection, or intracranial injection.
[0264] A person of ordinary skill in the art would also recognize that other nucleotide delivery mechanisms exist such as the use of viral like, or viral derived particles. See Rohovie et al., 2016, Bioengineering & Translational Med. 2(1): 43-57. Virus like particles can include coat proteins or viral capsids of a virus. Such particles can be PEGylated or further annealed to compounds that avoid phagocytotic clearance. Additionally, the surface of the virus like particle can be further functionalized to provide cellular specific targeting, facilitate extravasation, facilitate radio labeling, improve permeability across cellular boundaries, or to transcytose the blood-brain barrier. The virus like particles can be derived for animal viruses, bacteriophages, or plant viruses. Examples of suitable virus for derivation of a virus like particle delivery mechanism include but are not limited to cowpea chlorotic mottle virus, cowpea mosaic virus, hepatitis B virus (core), enterobacteria phage MS2, Salmonella typhimurium P22, enterobacteria phage QP amongst other suitable viruses. Derivatized RNA payloads can be loaded into the virus like particles by electrostatic adsorption or any other suitable method known to a person of ordinary skill in the art.
[0265] Various exemplary embodiments of compositions and methods according to this disclosure are now described in the following non-limiting Examples. The Examples are offered for illustrative purposes only and are not intended to limit the scope of the invention in any way. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and the following examples and fall within the scope of the appended claims.EXAMPLES OF EMBODIMENTS
[0266] The following examples are given to illustrate the present disclosure. It should be understood, however, that the disclosure is not to be limited to the specific conditions or details described in these examples.
[0267] Embodiment 1 : A method for producing a topologically modified RNA molecule, comprising:754902-6740-5691.1Atty. Docket No. 114203-1101(a) hybridizing (i) an RNA molecule comprising an acceptor base in a target location, wherein the acceptor base comprises a photo-active moiety, and (ii) an oligonucleotide comprising a topological modification and a corresponding photo-active moiety, thereby forming an RNA molecule-oligonucleotide complex, wherein the corresponding photo-active moiety is within a region of the oligonucleotide that is at least partially complementary to the target location in the RNA molecule; and(b) reacting the photo-active moiety of the RNA molecule with the corresponding photo-active moiety of the oligonucleotide, thereby covalently linking the photo-active moiety of the RNA molecule and the correspond photo-active moiety of the oligonucleotide, thereby producing the topologically modified RNA molecule.
[0268] Embodiment 2. The method of embodiment 1, wherein the acceptor base and the corresponding photo-active moiety align within ± 1 nucleotide of each other.
[0269] Embodiment 3. The method of embodiment 1 or embodiment 2, wherein reacting the photo-active moiety of the RNA molecule and the corresponding photo-reactive moiety of the oligonucleotide comprises exposing the RNA molecule-oligonucleotide complex to UV radiation.
[0270] Embodiment 4. The method of any one of embodiments 1-3, wherein the acceptor base contains an activated alkene group.
[0271] Embodiment 5. The method of any one of embodiments 1-4, wherein the acceptor base comprises U, C, m5C, or TPT3.
[0272] Embodiment 6. The method of any one of embodiments 1-5, wherein the corresponding photo-active moiety is selected from CNVK, CNVD, n-CNVK, PCX, PCXD, psolaren, or a derivative thereof.
[0273] Embodiment 7. The method of any one of embodiments 1-6, wherein the topological modification comprises (i) at least one 5’ cap, (ii) at least one poly-A tail, or (iii) at least one 5’ cap and at least one 3’ cap, or any combination thereof.
[0274] Embodiment 8. The method of any one of embodiments 1-7, wherein the topologically modified RNA molecule comprises a 5’ multi-capped mRNA, a 573’ multi-capped mRNA, a multi-tailed mRNA, or a capped circular RNA.
[0275] Embodiment 9. A method for producing a topologically modified RNA molecule comprising:764902-6740-5691.1Atty. Docket No. 114203-1101 incubating (i) an RNA molecule comprising at least one genetic code expansion (GCE) base at a target location, wherein the at least one GCE base comprises a click chemistry handle and (ii) an oligonucleotide comprising a topological modification, wherein the oligonucleotide comprises a click chemistry moiety corresponding to the click chemistry handle, thereby conjugating (i) with (ii) and producing the topologically modified RNA molecule.
[0276] Embodiment 10. The method of embodiment 9, wherein the at least one GCE base is selected from dNaM, dTPT3, d5SICS, dZ, dP, dDs, dPx, dIMO, dFIMO, dFEMO, dFTPT3, rNaM, rTPT3, r5SICS, rZ, rP, rDs, rPx, rIMO, rFIMO, rFEMO, rFTPT3 or an analog thereof.
[0277] Embodiment 11. The method of claim 9 or claim 10, wherein the topological modification comprises (i) at least one 5’ cap, (ii) at least one poly-A tail, or (iii) at least one 5’ cap and at least one 3’ cap, or a combination thereof
[0278] Embodiment 12. The method of any one of embodiments 9-11, wherein the topologically modified RNA molecule comprises a 5’ multi-capped mRNA, a 573’ multi-capped mRNA, a multi-tailed mRNA, or a capped circular RNA.
[0279] Embodiment 13. The method of any one of embodiments 9-12, further comprising circularizing the RNA molecule.
[0280] Embodiment 14. The method of embodiment 13, wherein the circularizing is performed by intron back-splicing.
[0281] Embodiment 15. The method of any one of embodiments 9-14, wherein the at least one GCE is within an untranslated region (UTR) of the RNA molecule.
[0282] Embodiment 16. The method of any one of embodiments 1-15, wherein theRNA molecule further comprises a 3’ exonuclease-resistant modification.
[0283] Embodiment 17. The method of any one of embodiments 1-16, wherein the3’ exonuclease-resistant modification is selected from the group consisting of phosphorothioate (PS) linkage, 2’-O-methyl (2OMe), 2’ Fluoro, inverted deoxythymidine (dT), inverted dideoxythymidine (ddT), 3’ phosphorylation, C3 spacer, 2'-O-methoxy-ethyl (2'-M0E), G- quadruplex, and 2'-3'-dideoxy nucleotide (ddN).
[0284] Embodiment 18. The method of any one of embodiments 1-17, wherein the RNA molecule and / or the oligonucleotide comprises at least one modified nucleotide.774902-6740-5691.1Atty. Docket No. 114203-1101
[0285] Embodiment 19. The method of embodiment 18, wherein the at least one modified nucleotide comprises a modified sugar.
[0286] Embodiment 20. The method of embodiment 19, wherein the modified sugar is selected from the group consisting of 2'-deoxy fluoro (2FA), L-adenosine (LA), 2'- deoxyadenosine (dA), locked nucleic acid (LNA), 2'-methoxy (2OMe), 2'-methoxyethoxy (2M0E), 2 '-thioribose, 2', 3 '-dideoxyribose, 2'-amino-2'-deoxyribose, 2' deoxyribose, 2'-azido-2'- deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, 3'-amino- 2', 3 '-dideoxyribose, 3 '-azido-2', 3 '-dideoxyribose, 3 '-deoxyribose, 3'-O-(2-nitrobenzyl)-2'- deoxyribose, 3'-O-methylribose, 5 '-aminoribose, 5 '-thioribose, 5-nitro-l-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C-methylene-linked, 2'-O,4'-C-amino-linked ribose, 2'-O,4'-C-thio- linked ribose, and thiomorpholino oligo (TMO)-linked ribose.
[0287] Embodiment 21. The method of embodiment 19 or embodiment 20, wherein the modified sugar is selected from the following:
[0288] Embodiment 22. The method of any one of embodiments 18-21, wherein the RNA molecule and / or the oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 75, between 75 and 100, between 100 and 125, between 125 and 150, or between 135 and 160 modified sugars.
[0289] Embodiment 23. The method of any one of embodiments 18-22, wherein the RNA molecule and / or the oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least784902-6740-5691.1Atty. Docket No. 114203-110145, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, or more modified sugars.[002901 Embodiment 24. The method of any one of embodiments 18-22, wherein RNA molecule comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, between 100 and 200, between 200 and 300, between 400 and 500, between 600 and 700, between 800 and 900, or between 900 and 1000 modified sugars.
[0291] Embodiment 25. The method of any one of embodiments 18-22, wherein the RNA molecule comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 750, at least 1000, or more modified sugars.
[0292] Embodiment 26. The method of any one of embodiments 18-25, wherein the at least one modified nucleotide comprises a modified phosphate.
[0293] Embodiment 27. The method of embodiment 26, wherein the modified phosphate is selected from the group consisting of phosphorothioate (PS), thiophosphate, 5'-O- methylphosphonate, 3'-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate.
[0294] Embodiment 28. The method of embodiment 26 or embodiment 27, wherein the RNA molecule and / or the oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 75, between 75 and 100, between 100 and 125, between 125 and 150, or between 135 and 160 modified phosphates.
[0295] Embodiment 29. The method of embodiment 26 or embodiment 27, wherein the RNA molecule and / or the oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, or more modified phosphates.794902-6740-5691.1Atty. Docket No. 114203-1101
[0296] Embodiment 30. The method of embodiment 26 or embodiment 27, wherein the RNA molecule comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, between 100 and 200, between 200 and 300, between 400 and 500, between 600 and 700, between 800 and 900, or between 900 and 1000 modified phosphates.
[0297] Embodiment 31. The method of embodiment 26 or embodiment 27, wherein the RNA molecule comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 750, at least 1000, or more modified phosphates.
[0298] Embodiment 32. The method of any one of embodiments 18-31, wherein the one or more modified nucleotides comprise a modified nucleobase.
[0299] Embodiment 33. The method of embodiment 32, wherein the modified nucleobase is selected from the group consisting of inosine, xanthine, allyaminouracil, allyaminothymidine, hypoxanthine, digoxigeninated adenine, digoxigeninated cytosine, digoxigeninated guanine, digoxigeninated uracil, 6-chloropurineriboside, N6-methyladenosine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5 -methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-Indolyl)propionamide-N-allyl]uracil, 5- aminoallylcytosine, 5 -aminoallyluracil, 5-bromouracil, 5 -bromocytosine, 5-carboxycytosine, 5- carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5 -formyl cytosine, 5-formyluracil, 5- hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5- iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5- methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5- propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7- deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8- azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, biotin-16- aminoallylcytosine, biotin-16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3- 6-propargylaminouracil, cyanine 3 -aminoallylcytosine, cyanine 3 -aminoallyluracil, cyanine 5-6- propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabcyl-5-3-aminoallyluracil,804902-6740-5691.1Atty. Docket No. 114203-1101 desthiobiotin-16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, Nl- ethylpseudouracil, Nl-m ethoxymethylpseudouracil, N1 -methyladenine, N1 -methylpseudouracil, N1 -propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6- methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3 -deazaadenine, 2,6-diaminoadenine, 2,6- daminoguanine, 5-carboxamide-uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl- thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis- hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2- methylthio-N6-threonyl carbamoyladenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A).
[0300] Embodiment 34. The method of embodiment 32 or embodiment 33, wherein the RNA molecule and / or the oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 75, between 75 and 100, between 100 and 125, between 125 and 150, or between 135 and 160 modified nucleobases.
[0301] Embodiment 35. The method of embodiment 32 or embodiment 33, wherein the RNA molecule and / or the oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, or more modified nucleobases.
[0302] Embodiment 36. The method of embodiment 32 or embodiment 33, wherein the RNA molecule comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, between 100 and 200, between 200 and 300, between 400 and 500, between 600 and 700, between 800 and 900, or between 900 and 1000 modified nucleobases.
[0303] Embodiment 37. The method of embodiment 32 or embodiment 33, wherein the RNA molecule comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least814902-6740-5691.1Atty. Docket No. 114203-110160, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 750, at least 1000, or more modified nucleobases.[003041 Embodiment 38. The method of any one of embodiments 18-37, wherein the at least one modified nucleotide comprises one or more modified sugars, one or more modified phosphates, one or more modified nucleobases, or any combination thereof.
[0305] Embodiment 39. A method for generating an RNA molecule comprising at least one exonuclease resistant phosphodiester modification in a site-specific manner, the method comprising: transcribing a single stranded DNA (ssDNA) template comprising at least one genetic code expansion (GCE) base at a target location, wherein the transcribing is performed using a mixture of nucleotide triphosphates comprising a modified GCE nucleotide triphosphate corresponding to the at least one GCE base, and wherein the modified GCE nucleotide triphosphate comprises an exonuclease resistant phosphodiester modification, thereby generating the RNA molecule comprising at least one exonuclease resistant phosphodiester modification at the target location.
[0306] Embodiment 40. The method of embodiment 39, wherein the target location is the 3’ end of the RNA molecule.
[0307] Embodiment 4E The method of embodiment 39 or embodiment 40, wherein the modified GCE triphosphate is selected from dNaM-TP, dTPT3-TP, d5SICS-TP, dZ-TP, dP- TP, dDs-TP, dPx-TP, , dIMO-TP, dFIMO-TP, dFEMO-TP, dFTPT3-TP, rNaM-TP, rTPT3-TP, r5SICS-TP, rZ-TP, rP-TP, rDs-TP, rPx-TP, rIMO-TP, rFIMO-TP, rFEMO-TP, rFTPT3-TP, or an analog thereof.
[0308] Embodiment 42. The method of any one of embodiments 1-41, wherein theRNA molecule comprises an open reading frame (ORF).
[0309] Embodiment 43. A modified RNA molecule produced by the method of any one of embodiments 1-42.4902-6740-5691.1Atty. Docket No. 114203-1101EXAMPLESExample 1: Ligation-free methods for chemical and topological modification of mRNA by photochemical crosslink
[0310] Applicants designed ligation-free methods for producing chemically / topologically modified mRNA.
[0311] Instead of using ligation to expand the mRNA topology, the photochemical crosslinking reaction, where the site specificity is dictated by hybridization of the chemically synthesized oligo to the mRNA (FIG. 2A). The crosslinking oligo contains a partial / full complementary sequence to the target mRNA and a photo-active moiety (cnvK, for example) within the complementary region. The cnvK group will crosslink with an acceptor base on the complementary strand -1 / 0 / +1 from it, and the acceptor base must contain an activated alkene such as U, C, m5C, or TPT3 and the reaction happen upon UV-A (-366 nm for cnvK) irradiation for 1-60 seconds. Such workflow allow topological modifications of the mRNA post IVT without using RNA ligases to generate 5’ multi-capped mRNA, 573’ multi-capped mRNA, multi-tailed mRNA, multi-tailed mRNA, and capped circular RNA (FIGS. 2B-2E).Example 2: Ligation-free methods for chemical and topological modification of mRNA by genetic code expansion + click chemistry
[0312] Alternatively, Applicant used click chemistry handles that are incorporated co- transcriptionally using genetic code expansion (GCE) to make chemical / topological modified RNA. To generate 5’ topologically modified mRNA, DNA template containing at least one GCE site in the 5’ UTR is in vitro transcribed with a GCE-nucleotide triphosphate (GCE-TP) bearing a click chemistry handle, in addition to the standard NTPs (A / G / C / mly). Subsequently, the mRNA is conjugated to a chemically synthesized, capped oligonucleotide with the corresponding click chemistry moiety using click chemistry to generate 5’ multi-capped mRNA (FIG. 3A). To generate 3’ topologically modified mRNA, the GCE site is placed on the 3’ UTR, and the multi-tailed mRNA or 573’ capped mRNA could be generated similarly by click chemistry conjugation post IVT (FIG. 3C). To generate topologically modified circular RNA, the GCE site is placed within the UTR, and the RNA is circularized by intron backsplicing, and834902-6740-5691.1Atty. Docket No. 114203-1101 the capped / modified oligo could be conjugated using click chemistry (FIG. 3D). Tn addition to topological modifications, the GCE bases could also be used for incorporation of exonuclease resistant phosphodiester modification in a site-specific manner without relying on ligation. 3’- end phosphorothioate modifications, for example, could be incorporated co-transcriptionally by using a DNA template with consecutive TPT3 bases. During IVT, the alpha-thiol GCE-TP (alpha-thiol NaM triphosphate, for example, as drawn in FIG. 3E) could be added such that 3’- end phosphorothioate-containing mRNA is generated co-transcriptionally (analogues to the 3’ end modified mocRNA).
[0313] As a proof-of-concept experiment for using GCE and click chemistry to enable ligation-free chemical / topological modifications of mRNA, Applicants employed the scheme outlined in FIG. 4A for 5’ topological modification to generate 5’ multi-capped mRNA. For GCE-TP with click chemistry handle, Applicants synthesized TPT3-TP with a cyclopropene moiety (TPT3CP-TP) that could react with tetrazines via strain promoted inverse electron demand Deils- Alder reaction (IEDDA). Synthesis of TPT3CP-TP was performed following the literature report described in: rsc.org / suppdata / c6 / cc / c6cc02321e / c6cc02321el.pdf supporting information, page S2-S6. To first titrate the concentration of TPT3CP-TP needed for accurate incorporation during IVT, Applicants performed IVT at different TPT3CP-TP concentrations using a model sequence (ATTCTGCCTGGGGACGTCGGAGCAAGCTTGGAATTATATAATACGACTCACTATAA GCAAGC / dTPT3 / TAAAGGGAATAAACTAGTATTCTTCTGGTCCCC (SEQ ID NO: 1)) containing a single TPT3 site.
[0314] In vitro transcription (IVT) reaction was performed by using HiScribe T7 High Yield RNA Synthesis Kit (NEB, E2040S), following the protocol from the manufacturer with some modifications. For a 20 pl reaction, 200 ng of DNA template was used and TPT3CP-TP was added into the reaction according to the indicated concentration. The reaction was incubated for 5 hrs, and TURBO DNase was added to digest the DNA template for 30 min. Subsequently, the product was purified with Monarch RNA Cleanup kit and quantified with Qubit BR Kit. After IVT, the RNA product is labeled with methyl tetrazine-peg 12 and labeled / unlabeled / over- labeled RNA were analyzed by gel electrophoresis (FIG. 4C).844902-6740-5691.1Atty. Docket No. 114203-1101
[0315] Applicants found using 0.13 mM TPT3CP-TP in the IVT reaction gave the highest incorporation without over labeling. Subsequently, Applicants optimized the IEDDA reaction with various organic additives, concentrations of tetrazine-peg 12, and temperatures, where 37 °C, 10% DMSO, and at least 90 equivalents of the methyl tetrazine-peg 12 gave the highest labeling yield for mRNA produced from IVT with 0.13 mM TPT3CP-TP (FIG. 4C). Using the optimized conditions, Applicants next generated DNA template encoding a full length firefly luciferase, with a single TPT3 site in its 5’ UTR (sequence:AGCAAGCAT / dTPT3 / AAGGGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAG AGAACCCGCCACCATGGAAGATGCCAAAAACATTAAGAAGGGCCCAGCGCCATTCT ACCCACTCGAAGACGGGACCGCCGGCGAGCAGCTGCACAAAGCCATGAAGCGCTAC GCCCTGGTGCCCGGCACCATCGCCTTTACCGACGCACATATCGAGGTGGACATTACC TACGCCGAGTACTTCGAGATGAGCGTTCGGCTGGCAGAAGCTATGAAGCGCTATGG GCTGAATACAAACCATCGGATCGTGGTGTGCAGCGAGAATAGCTTGCAGTTCTTCAT GCCCGTGTTGGGTGCCCTGTTCATCGGTGTGGCTGTGGCCCCAGCTAACGACATCTA CAACGAGCGCGAGCTGCTGAACAGCATGGGCATCAGCCAGCCCACCGTCGTATTCG TGAGCAAGAAAGGGCTGCAAAAGATCCTCAACGTGCAAAAGAAGCTACCGATCATA CAAAAGATCATCATCATGGATAGCAAGACCGACTACCAGGGCTTCCAAAGCATGTA CACCTTCGTGACTTCCCATTTGCCACCCGGCTTCAACGAGTACGACTTCGTGCCCGA GAGCTTCGACCGGGACAAAACCATCGCCCTGATCATGAACAGTAGTGGCAGTACCG GATTGCCCAAGGGCGTAGCCCTACCGCACCGCACCGCTTGTGTCCGATTCAGTCATG CCCGCGACCCCATCTTCGGCAACCAGATCATCCCCGACACCGCTATCCTCAGCGTGG TGCCATTTCACCACGGCTTCGGCATGTTCACCACGCTGGGCTACTTGATCTGCGGCTT TCGGGTCGTGCTCATGTACCGCTTCGAGGAGGAGCTATTCTTGCGCAGCTTGCAAGA CTATAAGATTCAATCTGCCCTGCTGGTGCCCACACTATTTAGCTTCTTCGCTAAGAGCACTCTCATCGACAAGTACGACCTAAGCAACTTGCACGAGATCGCCAGCGGCGGGGC GCCGCTCAGCAAGGAGGTAGGTGAGGCCGTGGCCAAACGCTTCCACCTACCAGGCA TCCGCCAGGGCTACGGCCTGACAGAAACAACCAGCGCCATTCTGATCACCCCCGAA GGGGACGACAAGCCTGGCGCAGTAGGCAAGGTGGTGCCCTTCTTCGAGGCTAAGGT GGTGGACTTGGACACCGGTAAGACACTGGGTGTGAACCAGCGCGGCGAGCTGTGCG TCCGTGGCCCCATGATCATGAGCGGCTACGTTAACAACCCCGAGGCTACAAACGCTC TCATCGACAAGGACGGCTGGCTGCACAGCGGCGACATCGCCTACTGGGACGAGGAC854902-6740-5691.1Atty. Docket No. 114203-1101GAGCACTTCTTCATCGTGGACCGGCTGAAGAGCCTGATCAAATACAAGGGCTACCA GGTAGCCCCAGCCGAACTGGAGAGCATCCTGCTGCAACACCCCAACATCTTCGACG CCGGGGTCGCCGGCCTGCCCGACGACGATGCCGGCGAGCTGCCCGCCGCAGTCGTC GTGCTGGAACACGGTAAAACCATGACCGAGAAGGAGATCGTGGACTATGTGGCCAG CCAGGTTACAACCGCCAAGAAGCTGCGCGGTGGTGTTGTGTTCGTGGACGAGGTGC CTAAAGGACTGACCGGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAG GCCAAGAAGGGCGGCAAGATCGCCGTGTGATAATAGCTCGAGGCTGGAGCCTCGGT GGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCG TACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCACAATTGAAAAAAAAAAA AAAAAAAAAAAAAAGCATATGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 2)). To confirm successful incorporation of the cyclopropene handle, Applicants first labeled the luciferase mRNA with a tetrazine-conjugated Cy5 dye, and successful labeling was confirmed by gel electrophoresis and Cy5 blot (FIG. 4D). Furthermore, Applicants react the TPT3 CP-labeled luciferase mRNA with a 5 ’-chemically-capped, 3 ’-methyl tetrazine oligonucleotide. Successful introduction of an additional branched cap with confirmed by RNase H assay to be >80% (RNase H probe =ATCTTCCATGGTGGCGGGTTCTCTCTGAGTCTG (SEQ ID NO: 3)) (FIG. 4E).Example 3. cvnK-mediated photo-crosslinking can effectively introduce a functional polyA tail onto mRNA
[0316] Applicants designed ligation-free methods for introducing a polyA tail onto an mRNA.
[0317] To first bench mark the photo-crosslinking condition would cause damage to mRNA, in vitro transcribed full length firefly luciferase mRNA with 100% wild-type uridine (U) or 100% nl-methyl-pseudouridine (m l'P) were subjected to UV light (366 nm) treatment for indicated amounts of time in crosslinking buffer (10 mM Tris-HCl pH 7.4, 20 mM NaCl). The most common UV damage to RNA is known to be U-U dimerization or other intramolecular crosslinking; such damages could be detected by pause of reverse-transcription as the reverse transcriptase will be halted by damage sites. A fluorescently labeled RT -primer ( / 56- FAM / caattgtgccgcccactc; SEQ ID NO: 4) was used to reverse transcribe the firefly luciferase mRNA from the 3’ end and detect UV damage. No observable UV damage was detected for864902-6740-5691.1Atty. Docket No. 114203-1101 either U or mlT modified mRNA (FIG. 5) The U or m l modified Firefly luciferase mRNA comprised the sequence set forth in SEQ ID NO: 5. agggaataaactagtattcttctggtccccacagactcagagagaacccgccaccatggaagatgccaaaaacattaagaagggcccagc gccattctacccactcgaagacgggaccgccggcgagcagctgcacaaagccatgaagcgctacgccctggtgcccggcaccatcgcc tttaccgacgcacatatcgaggtggacattacctacgccgagtacttcgagatgagcgttcggctggcagaagctatgaagcgctatgggct gaatacaaaccatcggatcgtggtgtgcagcgagaatagcttgcagttcttcatgcccgtgttgggtgccctgttcatcggtgtggctgtggc cccagctaacgacatctacaacgagcgcgagctgctgaacagcatgggcatcagccagcccaccgtcgtattcgtgagcaagaaagggc tgcaaaagatcctcaacgtgcaaaagaagctaccgatcatacaaaagatcatcatcatggatagcaagaccgactaccagggcttccaaag catgtacaccttcgtgacttcccatttgccacccggcttcaacgagtacgacttcgtgcccgagagcttcgaccgggacaaaaccatcgccc tgatcatgaacagtagtggcagtaccggattgcccaagggcgtagccctaccgcaccgcaccgcttgtgtccgattcagtcatgcccgcga ccccatcttcggcaaccagatcatccccgacaccgctatcctcagcgtggtgccatttcaccacggcttcggcatgttcaccacgctgggct acttgatctgcggctttcgggtcgtgctcatgtaccgcttcgaggaggagctattcttgcgcagcttgcaagactataagattcaatctgccctg ctggtgcccacactatttagcttcttcgctaagagcactctcatcgacaagtacgacctaagcaacttgcacgagatcgccagcggcggggc gccgctcagcaaggaggtaggtgaggccgtggccaaacgcttccacctaccaggcatccgccagggctacggcctgacagaaacaacc agcgccattctgatcacccccgaaggggacgacaagcctggcgcagtaggcaaggtggtgcccttcttcgaggctaaggtggtggacttg gacaccggtaagacactgggtgtgaaccagcgcggcgagctgtgcgtccgtggccccatgatcatgagcggctacgttaacaaccccga ggctacaaacgctctcatcgacaaggacggctggctgcacagcggcgacatcgcctactgggacgaggacgagcacttcttcatcgtgga ccggctgaagagcctgatcaaatacaagggctaccaggtagccccagccgaactggagagcatcctgctgcaacaccccaacatcttcga cgccggggtcgccggcctgcccgacgacgatgccggcgagctgcccgccgcagtcgtcgtgctggaacacggtaaaaccatgaccga gaaggagatcgtggactatgtggccagccaggttacaaccgccaagaagctgcgcggtggtgttgtgttcgtggacgaggtgcctaaagg actgaccggcaagttggacgcccgcaagatccgcgagattctcattaaggccaagaagggcggcaagatcgccgtgtgataatagctcga ggctggagcctcggtggccatgcttcttgccccttgggcctccccccagcccctcctccccttcctgcacccgtacccccgtggtctttgaat aaagtctgagtgggcggcacaattg (SEQ ID NO: 5)
[0318] Next, a workflow for polyA tail photo-crosslinking was established. A synthetic oligonucleotide (containing hybridization handle + polyA stretch) was designed to hybridize to the 3’ UTR of the IVT’d mRNA, such that the cvnK moiety can then be crosslinked to the +1 U / ml'P site by 366 nm irradiation for 10 minutes. The IVT’d mRNA contained the sequence of SEQ ID NO: 5, with a crosslink handle on the 3’, which contained the sequenceTTAACTAGTAATC (SEQ ID NO: 6). The synthetic polyA oligonucleotide contained the sequence set forth in SEQ ID NO: 7.874902-6740-5691.1Atty. Docket No. 114203-1101[rG] * [rA] * [rU] * [rU] * [r A] * [rC] [rU] [r A] [cnvK] [rU] [rU] [r A][r A] [r A] [r A][r A] [r A] [r A] [r A] [r A] [r A] [rA] [r A] [r A] [rA] [rA] [rA] [r A] [r A] [rA] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [rA] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [rA] [r A] [r A] [rA] [rA] [rA] [r A] [rA] [rA] [r A] [r A] [r A] [r A] [r A] [rA] [rA] [r A] [r A] [rA] [r A] [r A] [r A] [r A] [r A] [r A] [r A] * [mA] * [mA] * [mA] * [mA ]*[mA]*[mA] (SEQ ID NO: 7).
[0319] Subsequently, the free synthetic oligo was removed by size exclusion column purification, and then the polyA-crosslinked mRNA was enriched by oligo-dT capturing (FIG. 6A-6B). The photo-tailed mRNA harbored significantly enhanced translation as indicated by transfection to HEK293 cells as compared to the non-tailed control (FIG. 6C). Furthermore, attachment of multiple polyA tails by cvnK crosslinking led to enhanced and extended translation over time in HEK293 cells (FIG. 6D). Increasing the number of crosslink handles resulted in enhanced translation. The no photo-tail condition involved the use of FLuc mRNA having the sequence of SEQ ID NO: 5; 1 photo-tail (SEQ ID NO: 5 + SEQ ID NO: 6), 2 phototail (SEQ ID NO: 5 + SEQ ID NO: 6 + additional crosslink handle on 3’ end:AAAAAAAAAATTAACTAGTAATC (SEQ ID NO: 8)), 3 photo-tail (SEQ ID NO: 5 + SEQ ID NO: 6 + additional crosslink handles on 3’ end:AAAAAAAAAATTAACTAGTAATCAAAAAAAAAATTAACTAGTAATC (SEQ ID NO: 9))-
[0320] In additional experiments, a capped oligo was crosslinked to IVT-transcribed capped mRNA similarly to generate mRNA with two caps. Multiple constructs were generated in which the crosslinked cap was placed at varying distances from the 5’ end of the mRNA, as shown in FIG. 7 (i.e., 10 nt, 20 nt, 30 nt, and 40 nt). The cap-crosslinked mRNAs were then evaluated by in vitro translation in rabbit reticulocyte lysate for 30 mins. (FIG. 7) In all distances of hybridization sequence tested, the crosslinked capped oligo failed to enhance translation, and rather significantly reduced mRNA translation. This was potentially due to presence of RNA duplex (required for cvnK crosslinking), which is known to inhibit mRNA translation when present in the 5’ UTR. The capped oligo contained the sequence[m7Gcap] [+A] [mG] [mA] [mG] [mA] [mA] [rA] [rC] [rG] [r A] [rU] [rU] [r A] [rC] [rU] [rA] [cnvK] [rU] [ rU][rA][rA][rA][Ps][mA][Ps][mA][Ps][mA][Ps][mA][Ps][mA][Ps][mA] (SEQ ID NO: 10).884902-6740-5691.1Atty. Docket No. 114203-1101SEQUENCES
[0321] The following sequences of oligonucleotides were used in the experiments described in the Examples. Nucleotide modifications are denoted as follows: r = ribose sugar m = 2OMe-modified sugar* = phosphorothioate (PS) linkage+ = locked nucleic acid (LNA) dTPT3 = unnatural base deoxyribo-TPT3SEQ ID NO: 1 , DNA, Artificial SequenceATTCTGCCTGGGGACGTCGGAGCAAGCTTGGAATTATATAATACGACTCACTATAAGCAAGC / dTPT3 / TAAAGGGAATAAACTAGTATTCTTCTGGTCCCC(dTPT3 = unnatural base deoxyribo-TPT3)SEQ ID NO: 2, DNA, firefly luciferase - Artificial SequenceAGCAAGCAT / dTPT3 / AAGGGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACCATGGAAGATGCCAAAAACATTAAGAAGGGCCCAGCGCCATTCTACCCACTCGAAGACGGGACCGCCGGCGAGCAGCTGCACAAAGCCATGAAGCGCTACGCCCTGGTGCCCGGCACCATCGCCTTTACCGACGCACATATCGAGGTGGACATTACCTACGCCGAGTACTTCGAGATGAGCGTTCGGCTGGCAGAAGCTATGAAGCGCTATGGGCTGAATACAAACCATCGGATCGTGGTGTGCAGCGAGAATAGCTTGCAGTTCTTCATGCCCGTGTTGGGTGCCCTGTTCATCGGTGTGGCTGTGGCCCCAGCTAACGACATCTACAACGAGCGCGAGCTGCTGAACAGCATGGGCATCAGCCAGCCCACCGTCGTATTCGTGAGCAAGAAAGGGCTGCAAAAGATCCTCAACGTGCAAAAGAAGCTACCGATCATACAAAAGATCATCATCATGGATAGCAAGACCGACTACCAGGGCTTCCAAAGCATGTACACCTTCGTGACTTCCCATTTGCCACCCGGCTTCAACGAGTACGACTTCGTGCCCGAGAGCTTCGACCGGGACAAAACCATCGCCCTGATCATGAACAGTAGTGGCAGTACCGGATTGCCCAAGGGCGTAGCCCTACCGCACCGCACCGCTTGTGTCCGATTCAGTCATGCCCGCGACCCCATCTTCGGCAACCAGATCATCCCCGACACCGCTATCCTCAGCGTGGTGCCATTTCACCACGGCTTCGGCATGTTCACCACGCTGGGCTACTTGATCTGCGGCTTTCGGGTCGTGCTCATGTACCGCTTCGAGGAGGAGCTATTCTTGCGCAGCTTGCAAGACTATAAGATTCAATCTGCCCTGCTGGTGCCCACACTATTTAGCTTCTTCGCTAAGAGCACTCTCATCGACAAGTACGACCTAAGCAACTTGCACGAGATCGCCAGCGGCGGGGCGCCGCTCAGCAAGGAGGTAGGTGAGGCCGTGGCCAAACGCTTCCACCTACCAGGCATCCGCCAGGGCTACGGCCTGACAGAAACAACCAGCGCCATTCTGATCACCCCCGAAGGGGACGACAAGCCTGGCGCAGTAGGCAAGGTGGTGCCCTTCTTCGAGGCTAAGGTGGTGGACTTGGACACCGGTAAGACACTGGGTGTGAACCAGCGCGGCGAGCTGTGCGTCCGTGGCCCCATGATCATGAGCGGCTACGTTAACAACCCCGAGGCTACAAACGCTCTCATCGACAAGGACGGCTGGCTGCACAGCGGCGACATCGCCTACTGGGACGAGGAC894902-6740-5691.1Atty. Docket No. 114203-1101GAGCACTTCTTCATCGTGGACCGGCTGAAGAGCCTGATCAAATACAAGGGCTACCA GGTAGCCCCAGCCGAACTGGAGAGCATCCTGCTGCAACACCCCAACATCTTCGACG CCGGGGTCGCCGGCCTGCCCGACGACGATGCCGGCGAGCTGCCCGCCGCAGTCGTC GTGCTGGAACACGGTAAAACCATGACCGAGAAGGAGATCGTGGACTATGTGGCCAG CCAGGTTACAACCGCCAAGAAGCTGCGCGGTGGTGTTGTGTTCGTGGACGAGGTGC CTAAAGGACTGACCGGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAG GCCAAGAAGGGCGGCAAGATCGCCGTGTGATAATAGCTCGAGGCTGGAGCCTCGGT GGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCG TACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCACAATTGAAAAAAAAAAA AAAAAAAAAAAAAAGCATATGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAASEQ ID NO: 3, DNA, RNase H probe - Artificial sequenceATCTTCCATGGTGGCGGGTTCTCTCTGAGTCTGSEQ ID NO: 4, DNA, Fluorescently labeled RT-primer - Artificial Sequence / 56-F AM / caattgtgccgcccactcSEQ ID NO: 5, DNA, firefly luciferase - Artificial Sequence agggaataaactagtattcttctggtccccacagactcagagagaacccgccaccatggaagatgccaaaaacattaagaagggcccagc gccattctacccactcgaagacgggaccgccggcgagcagctgcacaaagccatgaagcgctacgccctggtgcccggcaccatcgcc tttaccgacgcacatatcgaggtggacattacctacgccgagtacttcgagatgagcgttcggctggcagaagctatgaagcgctatgggct gaatacaaaccatcggatcgtggtgtgcagcgagaatagcttgcagttcttcatgcccgtgttgggtgccctgttcatcggtgtggctgtggc cccagctaacgacatctacaacgagcgcgagctgctgaacagcatgggcatcagccagcccaccgtcgtattcgtgagcaagaaagggc tgcaaaagatcctcaacgtgcaaaagaagctaccgatcatacaaaagatcatcatcatggatagcaagaccgactaccagggcttccaaag catgtacaccttcgtgacttcccatttgccacccggcttcaacgagtacgacttcgtgcccgagagcttcgaccgggacaaaaccatcgccc tgatcatgaacagtagtggcagtaccggattgcccaagggcgtagccctaccgcaccgcaccgcttgtgtccgattcagtcatgcccgcga ccccatcttcggcaaccagatcatccccgacaccgctatcctcagcgtggtgccatttcaccacggcttcggcatgttcaccacgctgggct acttgatctgcggctttcgggtcgtgctcatgtaccgcttcgaggaggagctattcttgcgcagcttgcaagactataagattcaatctgccctg ctggtgcccacactatttagcttcttcgctaagagcactctcatcgacaagtacgacctaagcaacttgcacgagatcgccagcggcggggc gccgctcagcaaggaggtaggtgaggccgtggccaaacgcttccacctaccaggcatccgccagggctacggcctgacagaaacaacc agcgccattctgatcacccccgaaggggacgacaagcctggcgcagtaggcaaggtggtgcccttcttcgaggctaaggtggtggacttg gacaccggtaagacactgggtgtgaaccagcgcggcgagctgtgcgtccgtggccccatgatcatgagcggctacgttaacaaccccga ggctacaaacgctctcatcgacaaggacggctggctgcacagcggcgacatcgcctactgggacgaggacgagcacttcttcatcgtgga ccggctgaagagcctgatcaaatacaagggctaccaggtagccccagccgaactggagagcatcctgctgcaacaccccaacatcttcga cgccggggtcgccggcctgcccgacgacgatgccggcgagctgcccgccgcagtcgtcgtgctggaacacggtaaaaccatgaccga gaaggagatcgtggactatgtggccagccaggttacaaccgccaagaagctgcgcggtggtgttgtgttcgtggacgaggtgcctaaagg actgaccggcaagttggacgcccgcaagatccgcgagattctcattaaggccaagaagggcggcaagatcgccgtgtgataatagctcga ggctggagcctcggtggccatgcttcttgccccttgggcctccccccagcccctcctccccttcctgcacccgtacccccgtggtctttgaat aaagtctgagtgggcggcacaattgSEQ ID NO: 6, DNA, 3’ crosslink handle - Artificial SequenceTTAACTAGTAATCSEQ ID NO: 7, RNA, synthetic polyA oligonucleotide - Artificial Sequence904902-6740-5691.1Atty. Docket No. 114203-1101[rG] * [rA] * [rU] * [rU] * [r A] * [rC] [rU] [r A] [cnvK] [rU] [rU] [r A][r A] [r A] [r A][r A] [r A] [r A] [r A] [r A] [r A] [rA] [r A] [r A] [rA] [rA] [rA] [r A] [r A] [rA] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [rA] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [r A] [rA] [r A] [r A] [rA] [rA] [rA] [r A] [rA] [rA] [r A] [r A] [r A] [r A] [r A] [rA] [rA] [r A] [r A] [rA] [r A] [r A] [r A] [r A] [r A] [r A] [r A] * [mA] * [mA] * [mA] * [mA ]*[mA]*[mA]SEQ ID NO: 8, DNA, 3’ crosslink handle - Artificial Sequence AAAAAAAAAATTAACTAGTAATCSEQ ID NO: 9, DNA, 3’ crosslink handle - Artificial SequenceAAAAAAAAAATTAACTAGTAATCAAAAAAAAAATTAACTAGTAATCSEQ ID NO: 10, RNA, synthetic capped oligonucleotide - Artificial Sequence[m7Gcap] [+A] [mG] [mA] [mG] [mA] [mA] [rA] [rC] [rG] [r A] [rU] [rU] [r A] [rC] [rU] [rA] [cnvK] [rU] [ rU] [rA] [rA] [r A] [Ps] [mA][Ps] [mA][Ps] [mA] [Ps] [mA] [Ps] [mA] [Ps] [mA]914902-6740-5691.1
Claims
Atty. Docket No. 114203-1101CLAIMSWhat is claimed is:
1. A method for producing a topologically modified RNA molecule, comprising:(a) hybridizing (i) an RNA molecule comprising an acceptor base in a target location, wherein the acceptor base comprises a photo-active moiety, and (ii) an oligonucleotide comprising a topological modification and a corresponding photo-active moiety, thereby forming an RNA molecule-oligonucleotide complex, wherein the corresponding photo-active moiety is within a region of the oligonucleotide that is at least partially complementary to the target location in the RNA molecule; and(b) reacting the photo-active moiety of the RNA molecule with the corresponding photoactive moiety of the oligonucleotide, thereby covalently linking the photo-active moiety of the RNA molecule and the correspond photo-active moiety of the oligonucleotide, thereby producing the topologically modified RNA molecule.
2. The method of claim 1, wherein the acceptor base and the corresponding photo-active moiety align within ± 1 nucleotide of each other.
3. The method of claim 1 or 2, wherein reacting the photo-active moiety of the RNA molecule and the corresponding photo-reactive moiety of the oligonucleotide comprises exposing the RNA molecule-oligonucleotide complex to UV radiation.
4. The method of any one of claims 1-3, wherein the acceptor base contains an activated alkene group.
5. The method of any one of claims 1-4, wherein the acceptor base comprises U, C, m5C, or TPT3.924902-6740-5691.1Atty. Docket No. 114203-11016. The method of any one of claims 1-5, wherein the corresponding photo-active moiety is selected from CNVK, CNVD, n-CNVK, PCX, PCXD, psolaren, or a derivative thereof.
7. The method of any one of claims 1-6, wherein the topological modification comprises (i) at least one 5’ cap, (ii) at least one poly-A tail, or (iii) at least one 5’ cap and at least one 3’ cap, or any combination thereof.
8. The method of any one of claims 1-7, wherein the topologically modified RNA molecule comprises a 5’ multi-capped mRNA, a 573’ multi-capped mRNA, a multi-tailed mRNA, or a capped circular RNA.
9. A method for producing a topologically modified RNA molecule comprising: incubating (i) an RNA molecule comprising at least one genetic code expansion (GCE) base at a target location, wherein the at least one GCE base comprises a click chemistry handle and (ii) an oligonucleotide comprising a topological modification, wherein the oligonucleotide comprises a click chemistry moiety corresponding to the click chemistry handle, thereby conjugating (i) with (ii) and producing the topologically modified RNA molecule.
10. The method of claim 9, wherein the at least one GCE base is selected from dNaM, dTPT3, d5SICS, dZ, dP, dDs, dPx, dIMO, dFIMO, dFEMO, dFTPT3, rNaM, rTPT3, r5SICS, rZ, rP, rDs, rPx, rIMO, rFIMO, rFEMO, rFTPT3 or an analog thereof.
11. The method of claim 9 or claim 10, wherein the topological modification comprises (i) at least one 5’ cap, (ii) at least one poly-A tail, or (iii) at least one 5’ cap and at least one 3’ cap, or a combination thereof.934902-6740-5691.1Atty. Docket No. 114203-110112. The method of any one of claims 9-11 , wherein the topologically modified RNA molecule comprises a 5’ multi-capped mRNA, a 573’ multi -capped mRNA, a multi-tailed mRNA, or a capped circular RNA.
13. The method of any one of claims 9-12, further comprising circularizing the RNA molecule.
14. The method of claim 13, wherein the circularizing is performed by intron back-splicing.
15. The method of any one of claims 9-14, wherein the at least one GCE is within an untranslated region (UTR) of the RNA molecule.
16. The method of any one of claims 1-15, wherein the RNA molecule further comprises a 3’ exonuclease-resistant modification.
17. The method of any one of claims 1-16, wherein the 3’ exonuclease-resistant modification is selected from the group consisting of phosphorothioate (PS) linkage, 2’-O-methyl (20Me), 2’ Fluoro, inverted deoxythymidine (dT), inverted dideoxythymidine (ddT), 3’ phosphorylation, C3 spacer, 2'-O-methoxy-ethyl (2'-M0E), G-quadruplex, and 2'-3'-dideoxy nucleotide (ddN).
18. The method of any one of claims 1-17, wherein the RNA molecule and / or the oligonucleotide comprises at least one modified nucleotide.
19. The method of claim 18, wherein the at least one modified nucleotide comprises a modified sugar.944902-6740-5691.1Atty. Docket No. 114203-110120. The method of claim 19, wherein the modified sugar is selected from the group consisting of 2'-deoxy fluoro (2FA), L-adenosine ( / A), 2 '-deoxy adenosine (dA), locked nucleic acid (LNA), 2'-methoxy (2OMe), 2 '-methoxy ethoxy (2M0E), 2'-thioribose, 2', 3 '-dideoxyribose, 2'-amino-2'-deoxyribose, 2' deoxyribose, 2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'- O-methylribose, 2'-O-methyldeoxyribose, 3 '-amino-2', 3 '-di deoxyribose, 3'-azido-2',3'- dideoxyribose, 3 ’-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'- aminoribose, 5 '-thioribose, 5-nitro-l-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C- methylene-linked, 2'-O,4'-C-amino-linked ribose, 2'-O,4'-C-thio-linked ribose, and thiomorpholino oligo (TMO)-linked ribose.
21. The method of claim 19 or 20, wherein the modified sugar is selected from the following:
22. The method of any one of claims 18-21, wherein the RNA molecule and / or the oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 75, between 75 and 100, between 100 and 125, between 125 and 150, or between 135 and 160 modified sugars.
23. The method of any one of claims 18-22, wherein the RNA molecule and / or the oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, or more modified sugars.954902-6740-5691.1Atty. Docket No. 114203-110124. The method of any one of claims 18-22, wherein RNA molecule comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, between 100 and 200, between 200 and 300, between 400 and 500, between 600 and 700, between 800 and 900, or between 900 and 1000 modified sugars.
25. The method of any one of claims 18-22, wherein the RNA molecule comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 750, at least 1000, or more modified sugars.
26. The method of any one of claims 18-25, wherein the at least one modified nucleotide comprises a modified phosphate.
27. The method of claim 26, wherein the modified phosphate is selected from the group consisting of phosphorothioate (PS), thiophosphate, 5'-O-methylphosphonate, 3'-O- methylphosphonate, 5 '-hydroxyphosphonate, hydroxyphosphanate, phosphorosel enoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate.
28. The method of claim 26 or claim 27, wherein the RNA molecule and / or the oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 75, between 75 and 100, between 100 and 125, between 125 and 150, or between 135 and 160 modified phosphates.
29. The method of claim 26 or claim 27, wherein the RNA molecule and / or the oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at964902-6740-5691.1Atty. Docket No. 114203-1101 least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, or more modified phosphates.
30. The method of claim 26 or claim 27, wherein the RNA molecule comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, between 100 and 200, between 200 and 300, between 400 and 500, between 600 and 700, between 800 and 900, or between 900 and 1000 modified phosphates.
31. The method of claim 26 or claim 27, wherein the RNA molecule comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 750, at least 1000, or more modified phosphates.
32. The method of any one of claims 18-31, wherein the one or more modified nucleotides comprise a modified nucleobase.
33. The method of claim 32, wherein the modified nucleobase is selected from the group consisting of inosine, xanthine, allyaminouracil, allyaminothymidine, hypoxanthine, digoxigeninated adenine, digoxigeninated cytosine, digoxigeninated guanine, digoxigeninated uracil, 6-chloropurineriboside, N6-methyladenosine, methylpseudouracil, 2-thiocytosine, 2- thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6- dihydrouracil, 5-[(3-Indolyl)propionamide-N-allyl]uracil, 5-aminoallylcytosine, 5- aminoallyluracil, 5-bromouracil, 5 -bromocytosine, 5-carboxycytosine, 5- carboxymethylesteruracil, 5-carboxyuracil, 5 -fluorouracil, 5 -formyl cytosine, 5-formyluracil, 5- hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5- iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5- methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5- propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7- deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8- azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine,974902-6740-5691.1Atty. Docket No. 114203-1101 aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, biotin-16- aminoallylcytosine, biotin- 16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3- 6-propargylaminouracil, cyanine 3 -aminoallylcytosine, cyanine 3 -aminoallyluracil, cyanine 5-6- propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5 -aminoallyl cytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabcyl-5-3-aminoallyluracil, desthiobiotin- 16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, Nl- ethylpseudouracil, N1 -methoxymethylpseudouracil, N1 -methyladenine, N1 -methylpseudouracil, N1 -propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6- methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3 -deazaadenine, 2,6-diaminoadenine, 2,6- daminoguanine, 5-carboxamide-uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl- thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis- hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2- methylthio-N6-threonyl carbamoyl adenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A).
34. The method of claim 32 or claim 33, wherein the RNA molecule and / or the oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 75, between 75 and 100, between 100 and 125, between 125 and 150, or between 135 and 160 modified nucleobases.
35. The method of claim 32 or claim 33, wherein the RNA molecule and / or the oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, or more modified nucleobases.
36. The method of claim 32 or claim 33, wherein the RNA molecule comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30984902-6740-5691.1Atty. Docket No. 114203-1101 and 50, between 50 and 100, between 100 and 200, between 200 and 300, between 400 and 500, between 600 and 700, between 800 and 900, or between 900 and 1000 modified nucleobases.
37. The method of claim 32 or claim 33, wherein the RNA molecule comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 750, at least 1000, or more modified nucleobases.
38. The method of any one of claims 18-37, wherein the at least one modified nucleotide comprises one or more modified sugars, one or more modified phosphates, one or more modified nucleobases, or any combination thereof.
39. A method for generating an RNA molecule comprising at least one exonuclease resistant phosphodiester modification in a site-specific manner, the method comprising: transcribing a single stranded DNA (ssDNA) template comprising at least one genetic code expansion (GCE) base at a target location, wherein the transcribing is performed using a mixture of nucleotide triphosphates comprising a modified GCE nucleotide triphosphate corresponding to the at least one GCE base, and wherein the modified GCE nucleotide triphosphate comprises an exonuclease resistant phosphodiester modification, thereby generating the RNA molecule comprising at least one exonuclease resistant phosphodiester modification at the target location.
40. The method of claim 39, wherein the target location is the 3’ end of the RNA molecule.
41. The method of claim 39 or claim 40, wherein the modified GCE triphosphate is selected from dNaM-TP, dTPT3-TP, d5SICS-TP, dZ-TP, dP-TP, dDs-TP, dPx-TP, , dIMO-TP, dFIMO- TP, dFEMO-TP, dFTPT3-TP, rNaM-TP, rTPT3-TP, r5SICS-TP, rZ-TP, rP-TP, rDs-TP, rPx-TP, rIMO-TP, rFIMO-TP, rFEMO-TP, rFTPT3-TP, or an analog thereof.994902-6740-5691.1Atty. Docket No. 114203-110142. The method of any one of claims 1 -41 , wherein the RNA molecule comprises an open reading frame (ORF).
43. A modified RNA molecule produced by the method of any one of claims 1-42.1004902-6740-5691.1