Therapeutic immune cell and preparation method therefor
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- BRISTAR (BEIJING) IMMUNOTECH LTD
- Filing Date
- 2025-11-28
- Publication Date
- 2026-06-04
Smart Images

Figure PCTCN2025138387-FTAPPB-I100001 
Figure PCTCN2025138387-FTAPPB-I100002 
Figure PCTCN2025138387-FTAPPB-I100003
Abstract
Description
Therapeutic immune cells and their preparation methods Technical Field
[0001] This invention relates to the field of biomedicine, specifically to the field of cell therapy. More specifically, this invention provides a therapeutic immune cell, such as T cells, and a method for preparing the same. This invention also provides the therapeutic uses of said therapeutic immune cells. Background Technology
[0002] Tumor immunotherapy has attracted widespread attention, and autologous, patient-derived chimeric antigen receptor T-cell (CAR-T) therapy has shown promising application prospects in the treatment of some cancers (such as hematological malignancies). However, due to the need for individualized treatment and significant individual differences among patients, the treatment efficacy and safety are difficult to control, and there are also problems such as high treatment costs and long manufacturing cycles.
[0003] Allogeneic CAR-T cell therapy can overcome the problem of poor T cell quality, resulting in high product consistency. However, due to immunogenetic differences between donors and patients, when donor T cells enter the patient's body, they may mistakenly identify normal cells or tissues in the patient's body as foreign targets, thus launching an attack and triggering graft-versus-host disease (GVHD), which can be life-threatening in severe cases. At the same time, the patient's immune cells may also recognize and attack the allogeneic cells as foreign grafts, leading to the suppression or elimination of donor T cells, i.e., host-versus-graft reaction (HVGR), which greatly affects the treatment effect.
[0004] Currently, researchers have conducted extensive research and achieved some results in addressing the immune rejection problem faced by allogeneic CAR-T cells. For example, in patent PCT / EP2016 / 055332, Cellectis successfully reduced the risk of GVHD by knocking out the TCR receptor and CD52 in allogeneic T cells. However, this technology cannot effectively inhibit the production of HVGR, leaving a high safety risk in the treatment process. In patent CN201710983276.X, Precision Biotech simultaneously knocked out the TRAC, B2M, and CIITA genes in allogeneic T cells, attempting to develop universal CAR-T cells. Although this method has solved some of the immune rejection problems, it has brought new challenges such as low cell preparation efficiency, limiting its large-scale production and clinical application. In patent CN202380018871.3, the knockout of TRAC, HLA-A, HLA-B, CIITA and PD-1 genes in allogeneic T cells of Bangyao Biotechnology can effectively inhibit HVGR caused by T cells and NK cells. However, this technology not only has the problems of low cell preparation efficiency and low cell activity, but also the lentivirus used can randomly integrate into the cell genome, which may lead to insertion mutations, activate oncogenes or destroy tumor suppressor genes, thereby causing potential carcinogenic risks.
[0005] In the treatment of solid tumors, the immune escape mechanisms of solid tumors and the suppression of the tumor microenvironment can inhibit the function of CAR-T cells, making them prone to exhaustion and apoptosis. Recent studies have shown that this T cell dysfunction may be related to the signaling pathway properties of chimeric antigen receptors. WO2021135178A1 discloses that the natural T cell receptor (TCR) complex contains 10 ITAM signaling sequences, theoretically capable of transmitting stronger signals than CAR. Studies have shown that although TCR signaling is slower than CAR signaling, TCR signaling is more persistent. Therefore, utilizing the signaling function of natural TCR may allow the construction of a novel receptor to alleviate T cell dysfunction and enable it to better exert its anti-solid tumor effects. The extracellular region of the TCR is very similar to the Fab domain of an antibody. Therefore, the variable region sequence of the TCR can be replaced with the variable region sequence of the antibody to obtain a synthetic T-cell receptor antigen receptor (STAR). This STAR possesses both the specificity of the antibody and the superior signal transduction function of the natural TCR, and can mediate complete T-cell activation. Therefore, the synthetic T-cell receptor antigen receptor (STAR) can alleviate T-cell dysfunction, enabling it to better exert its anti-solid tumor effects.
[0006] However, STAR-T therapy also faces the aforementioned challenges of CAR-T therapy. Developing a safe and effective allogeneic STAR-T cell technology that can effectively reduce immune rejection caused by allogeneic cell therapy, possesses high cell preparation efficiency, and exhibits good cell viability is urgently needed. This is of great significance for promoting the development of cell therapy in the fields of tumor immunology and autoimmune diseases, and improving patient treatment outcomes. Summary of the Invention
[0007] To address the issues of immune rejection and safety in allogeneic cell therapy, this invention provides an improved allogeneic STAR-T cell therapy. This therapy utilizes a combined editing strategy of CRISPR / Cas9 technology and an adeno-associated virus (AAV) vector carrying the CD19-STAR sequence to achieve simultaneous multi-gene editing and targeted sequence integration.
[0008] First, using homologous arms designed on both sides of the AAV vector, the CD19-STAR sequence is precisely inserted into the TRAC gene locus through homologous recombination. This achieves site-specific integration of the STAR sequence while simultaneously knocking out the endogenous TRAC gene, completely avoiding the risk of tumor suppressor gene inactivation caused by random insertion and significantly improving knockout and knock-in efficiency. Further, endogenous T cell genes are combined and edited, including: 1) knocking out the TCRα chain encoding gene TRAC to disrupt the formation of the functional TCR complex and eliminate the risk of GVHD; 2) knocking out the MHC-I class gene encoding HLA-A / HLA-B and the HLA-II class regulatory gene CIITA to block the HVGR pathway; and 3) selectively knocking out the immune checkpoint gene PD-1 to enhance cell killing activity.
[0009] The allogeneic STAR-T cells edited in the above manner recognize the tumor surface antigen CD19 and simultaneously knock out the triple immune rejection genes (TRAC / HLA-A / HLA-B / CIITA) to avoid the risks of GVHD and HVGR, significantly prolonging cell survival time in vivo and improving efficacy. Furthermore, the AAV-mediated site-specific integration technology ensures genomic stability, ultimately resulting in a universal cell therapy product that combines high safety, strong durability, and excellent anti-tumor activity. Attached Figure Description
[0010] Figure 1. HLA-A flow cytometry detection for screening sgRNA.
[0011] Figure 2. HLA-B flow cytometry screening of sgRNA.
[0012] Figure 3. HLA-A / B flow cytometry screening of sgRNA.
[0013] Figure 4. CIITA knockout can be reflected by HLA class II molecules. A: CIITA indel% is consistent with HLA-DP / DQ / DR KO% by flow cytometry; B: Flow cytometry detection of HLA-DP / DQ / DR expression changes in the NC group at different time points; C: Flow cytometry detection of HLA-DP / DQ / DR expression changes in T cells under different stimulation conditions.
[0014] Figure 5. CIITA sgRNA screening. A: Flow cytometry detection of HLA-DP / DQ / DR expression in cells edited with different CIITA gRNA sequences; B: Flow cytometry detection of cell viability edited with different CIITA gRNA sequences; C: Flow cytometry detection of cell expansion edited with different CIITA gRNA sequences.
[0015] Figure 6. Detection of different gene knockout efficiencies using different knockout strategies.
[0016] Figure 7. STAR knock-in efficiency, activity, and expansion of STAR-T cells.
[0017] Figure 8. Detection of different gene knockout efficiency in cells.
[0018] Figure 9. STAR knock-in efficiency, activity, and expansion of STAR-T cells.
[0019] Figure 10. Cell viability and in vitro expansion capacity of STAR-T cells under two editing strategies.
[0020] Figure 11. Short-term killing, continuous killing, and cytokine secretion of NALM6-LUC-GFP target cells by two types of STAR-T cells.
[0021] Figure 12. Differentiation lineages and dynamic expression of immune checkpoints of STAR-T cells under two editing strategies.
[0022] Figure 13. Two types of STAR-T cells significantly inhibited tumor progression in the NALM6-LUC-GFP mouse tumor model.
[0023] Figure 14. Mouse body weight, in vivo expansion kinetics of STAR-T cells, and CD8 during two STAR-T cell therapies. + T cell subset proportions. From top to bottom: mouse body weight change, changes in STAR-T cells in mice, changes in T cells in mice, changes in CD8+STAR-T cells in mice, changes in CD8+ T cells in mice.
[0024] Figure 15. Short-term killing of SLE B cells by two types of STAR-T cells.
[0025] Figure 16. Fluorescence intensity and positivity rate of AAV-based universal TRAC-CD19-STAR-T and lentivirus-based TRAC-CD19-STAR-T.
[0026] Figure 17. In vitro short-term and continuous killing effects of TRAC-CD19-STAR-AAV compared to TRAC-CD19-STAR-Lenti.
[0027] Figure 18. Infection efficiency and gene knockout efficiency of TRAC-CD19-STAR / CAR AAV.
[0028] Figure 19. In vitro killing effect of TRAC-CD19-STAR / CAR T cells.
[0029] Figure 20. In vitro cytokine secretion of TRAC-CD19-STAR / CAR T cells and the number of TRAC-CD19-STAR / CAR T cells detected after 7 rounds of continuous killing for 48 hours.
[0030] Figure 21. Infection efficiency of CD19-STAR-Lenti and CD19-CAR-Lenti.
[0031] Figure 22. In vitro membrane uptake efficiency and integration efficiency of TRAC-CD19-STAR-AAV, CD19-STAR-Lenti, and CD19-CAR-Lenti.
[0032] Figure 23. Sort B killing experiment. A: Flow cytometry detection of killing at E:T = 1:1; B: Flow cytometry detection of killing results of Sort B cells at different effector-to-target ratios after 15 h.
[0033] Figure 24. In vitro killing function of AAV-based TRAC-CD19-STAR-T (TRAC-CD19-STAR-AAV) and lentivirus-based CD19-STAR-T (CD19 STAR-Lenti).
[0034] Figure 25. Cytokine secretion after AAV-based allogeneic TRAC-CD19-STAR-T (TRAC-CD19-STAR-AAV) and lentivirus-based autologous CD19-STAR-T (CD19 STAR-Lenti) are stimulated by target cells.
[0035] Figure 26. Tumor suppression effects of AAV-based allogeneic TRAC-CD19-STAR-T (TRAC-CD19-STAR-AAV) and lentivirus-based autologous CD19-STAR-T (CD19 STAR-Lenti) in mouse tumor models.
[0036] Figure 27. In vivo expansion kinetics of STAR-T cells and CD8 in mice during two STAR-T cell therapies. + T cell subset ratios.
[0037] Figure 28. AAV-based allogeneic TRAC-CD19-STAR-T (TRAC-CD19-STAR-AAV) exhibits reduced recipient T cell immune rejection. A: Expression of HLA-A, HLA-B, and HLA-DP / DQ / DR in stimulating cells; B: Proportion of CFSE+ reactive cells in the MLR system.
[0038] Figure 29. Allogeneic TRAC-CD19-STAR-T (TRAC-CD19-STAR-AAV) based on AAV reduces recipient NK cell activation. A: HLA positivity rate; B: Proportion of CD107a-positive cells from different donors at different S / R ratios; C: Killing efficiency of NK cells from two donors against allogeneic STAR-T (TRAC-CD19 STAR-AAV) and B2M KO T cells at an S / R ratio of 1:1.
[0039] Figure 30. AAV-based allogeneic TRAC-CD19-STAR-T (TRAC-CD19-STAR-AAV) exhibits reduced GVHD. A: Mouse body weight change; B: Mouse T cell count change; C: Mouse STAR-T cell count change.
[0040] Figure 31. Infection efficiency of TRAC-GC33-STAR-AAV and GC33-STAR-Lenti.
[0041] Figure 32. Killing of target cells by allogeneic TRAC-GC33-STAR-T (TRAC-GC33-STAR-AAV) and GC33-STAR-T (GC33-STAR-Lenti). Detailed Implementation
[0042] definition
[0043] Unless otherwise indicated or defined, all terms used herein have their ordinary meaning as will be understood by those skilled in the art. References include, for example, standard manuals such as Sambrook et al., “Molecular Cloning: A Laboratory Manual” (2nd edition), Volumes 1–3, Cold Spring Harbor Laboratory Press (1989); Lewin, “Genes IV”, Oxford University Press, New York (1990); and Roitt et al., “Immunology” (2nd edition), Gower Medical Publishing, London, New York (1989), and general prior art cited herein; furthermore, unless otherwise stated, all methods, procedures, techniques, and operations not specifically detailed herein can and have been performed in a manner known per se as will be understood by those skilled in the art. Also refer to, for example, standard manuals, the aforementioned general prior art, and other references cited therein.
[0044] As used herein, the term “and / or” covers all combinations of items connected by the term and should be regarded as if each combination had been listed separately herein. For example, “A and / or B” covers “A,” “A and B,” and “B.” For example, “A, B, and / or C” covers “A,” “B,” “C,” “A and B,” “A and C,” “B and C,” and “A and B and C.”
[0045] When the term "comprising" is used herein to describe a protein or nucleic acid sequence, the protein or nucleic acid may consist of the stated sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, while still possessing the activities described in this invention. Furthermore, those skilled in the art will understand that the methionine encoded by the start codon at the N-terminus of a polypeptide may be retained in certain practical situations (e.g., when expressed in a specific expression system) without substantially affecting the polypeptide's function. Therefore, when describing a specific polypeptide amino acid sequence in this specification and claims, although it may not contain the methionine encoded by the start codon at the N-terminus, the sequence containing that methionine is still included, and correspondingly, its encoding nucleotide sequence may also contain the start codon; and vice versa.
[0046] The terms “polynucleotide,” “nucleic acid sequence,” “nucleotide sequence,” or “nucleic acid fragment” are used interchangeably and refer to single-stranded or double-stranded RNA or DNA polymers, optionally containing synthetic, non-natural, or modified nucleotide bases. Nucleotides are designated by their single-letter names as follows: “A” for adenosine or deoxyadenosine (corresponding to RNA or DNA, respectively), “C” for cytidine or deoxycytidine, “G” for guanosine or deoxyguanosine, “U” for uridine, “T” for deoxythymidine, “R” for purine (A or G), “Y” for pyrimidine (C or T), “K” for G or T, “H” for A, C, or T, “I” for inosine, and “N” for any nucleotide. Although nucleotide sequences may be represented as DNA sequences (containing T) herein, when referring to RNA, those skilled in the art can readily determine the corresponding RNA sequence (i.e., replacing T with U).
[0047] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably in this invention to refer to polymers of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers. The terms “polypeptide,” “peptide,” “amino acid sequence,” and “protein” may also include modified forms, including but not limited to glycosylation, lipid linkage, sulfation, γ-carboxylation, hydroxylation, and ADP-ribosylation of glutamate residues.
[0048] A polypeptide or nucleic acid molecule is considered "isolated" when it has been separated from at least one other component (e.g., another protein / peptide, another nucleic acid, another biological component or macromolecule, or at least one contaminant, impurity, or trace component) that is normally associated with it in that source or medium (culture medium), compared to its natural biological source and / or the reaction medium or culture medium from which the molecule is obtained. Specifically, a polypeptide or nucleic acid molecule is considered "isolated" when it has been purified at least 2-fold, particularly at least 10-fold, more particularly at least 100-fold, and up to 1000-fold or more. "Isolated" polypeptide or nucleic acid molecules are preferably substantially homogeneous, as determined by suitable techniques (e.g., suitable chromatographic techniques, such as polyacrylamide gel electrophoresis).
[0049] As used in this article, “exogenous” means a protein or nucleic acid sequence that is derived from a foreign species, or, if derived from the same species, a protein or nucleic acid sequence whose composition and / or location have been significantly altered from its natural form through deliberate human intervention.
[0050] As used in this article, the synthetic T-cell receptor antigen receptor (STAR) refers to a modified TCR in which the variable region sequence of the TCR is replaced with an antibody variable region sequence or other receptor sequences, while the constant region sequence of the TCR can also be modified.
[0051] As used herein, an "antigen-binding region" (e.g., an antigen-binding region in STAR) means that it can specifically bind to a target antigen, either alone or in combination with another antigen-binding region. The antigen-binding region can be derived from an antibody that specifically binds to the target antigen, including any commercially available antibody. An antigen-binding region can also be derived from a receptor that binds to a specific target protein.
[0052] As used herein, “antibody” refers to immunoglobulins and immunoglobulin fragments, whether natural or partially or wholly synthetic (e.g., recombinant), including any fragment that retains the binding specificity of the full-length immunoglobulin molecule, containing at least a portion of the variable region of the immunoglobulin molecule. Therefore, antibodies include any protein having a binding domain homologous or substantially homologous to an immunoglobulin antigen-binding domain (antibody binding site). Antibodies include antibody fragments. As used herein, the term antibody includes synthetic antibodies, recombinant antibodies, multispecific antibodies (e.g., bispecific antibodies), human antibodies, non-human antibodies, camel antibodies, single-domain antibodies, humanized antibodies, chimeric antibodies, intracellular antibodies, and antibody fragments, such as, but not limited to, Fab fragments, Fab' fragments, F(ab')2 fragments, Fv fragments, disulfide-linked Fv (dsFv), Fd fragments, Fd' fragments, single-chain Fv (scFv), single-chain Fab (scFab), biantibodies, anti-idiotypic (anti-Id) antibodies, or antigen-binding fragments of any of the above antibodies. The antibodies described herein include members of any immunoglobulin type (e.g., IgG, IgM, IgD, IgE, IgA, and IgY), any class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass (e.g., IgG2a and IgG2b).
[0053] As used herein, a variable domain or variable region is a specific Ig domain of the antibody heavy or light chain, containing a variable amino acid sequence that varies between different antibodies. Each light chain and each heavy chain has a variable region VL (also denoted as V). L ) and VH (or also represented as V) L Variable domains provide antigen specificity and are therefore responsible for antigen recognition. Each variable region contains a CDR and a frame region (FR), with the CDR being part of the antigen-binding site.
[0054] As used herein, “hypervariant region,” “HV,” “complementarity-determining region,” and “CDR” and “antibody CDR” are interchangeably used to refer to one of the multiple portions within each variable region that together form the antigen-binding site of an antibody. Each variable region contains three CDRs, named CDR1, CDR2, and CDR3. For example, for a conventional four-chain antibody, the light chain variable region contains three CDRs, named VL CDR1, VL CDR2, and VL CDR3 (or LCDR1, LCDR2, and LCDR3); the heavy chain variable region contains three CDRs, named VH CDR1, VH CDR2, and VH CDR3 (or HCDR1, HCDR2, and HCDR3). For camel antibodies or single-domain antibodies, since they have only one variable region, they contain only three CDRs, named CDR1, CDR2, and CDR3.
[0055] As used herein, "amino acid number reference SEQ ID NO:x" (SEQ ID NO:x being a specific sequence listed herein) refers to the position number of the described specific amino acid being the position number of the corresponding amino acid in SEQ ID NO:x. The correspondence between amino acids in different sequences can be determined using sequence alignment methods known in the art. For example, amino acid correspondence can be determined using the EMBL-EBI online alignment tool (https: / / www.ebi.ac.uk / Tools / psa / ), where two sequences can be aligned using the Needleman-Wunsch algorithm with default parameters. For example, if the alanine at position 46 from the N-terminus of a polypeptide is aligned with the 48th amino acid in SEQ ID NO:x in sequence alignment, then the alanine in that polypeptide can also be described herein as "the alanine at position 48 of the polypeptide, the position of which is referenced to SEQ ID NO:x".
[0056] The proteins / peptides mentioned in this invention may contain a signal peptide (or guide sequence) at their N-terminus. Those skilled in the art will understand that in cells, the signal peptide sequence can guide the protein / peptide to a specific location on the cell membrane, and it may itself be cleaved and not included in the final product. Exemplary signal peptides include, but are not limited to, IgE signal peptide, GM-CSF signal peptide, bovine prolactin pre-signal peptide, and natural signal peptides of the mentioned proteins / peptides such as IL-15Ra signal peptide, IL-15 signal peptide, etc. These signal peptide sequences are known in the art or can be readily identified by those skilled in the art based on existing knowledge in the art.
[0057] The "expression vector" of the present invention may be a linear nucleic acid fragment, a circular plasmid, a viral vector, or a translatable RNA (such as mRNA). In some preferred embodiments, the expression vector is a viral vector, such as an adenovirus-associated virus (AAV vector) or a lentiviral vector.
[0058] In this application, the term "lentivirus" or "Lenti" generally refers to a group (or genus) of complex retroviruses. Exemplary lentiviruses include, but are not limited to: HIV (human immunodeficiency virus; including HIV type 1 and HIV type 2); viscena-maedivirus (VMV); caprine arthritis-encephalitis virus (CAEV); equine infectious anemia virus (EIAV); feline immunodeficiency virus (FIV); bovine immunodeficiency virus (BIV); and simian immunodeficiency virus (SIV). Various lentiviral vectors are known in the art.
[0059] In this application, the term "AAV" refers to an adeno-associated virus (AAV) vector, which is a vector that can be artificially transgenic, produced by genetically engineering certain characteristics of naturally occurring adeno-associated viruses. Adeno-associated virus (AAV) is a non-replicating virus with low immunogenicity. Currently, there are approximately 10 serotypes of AAV, and different serotypes of AAV can selectively target different tissues. Preferably, the AAV vector of this invention is an AAV6 vector.
[0060] In this application, the term "T cell" or "T lymphocyte" can refer to any T cell, such as cultured T cells, e.g., primary T cells, or T cells derived from cultured T cell lines, e.g., Jurkat, SupTI, etc., or T cells derived from mammals (preferably primates, species including monkeys, dogs, or humans). If derived from mammals, the T cells can be obtained from a variety of sources, including but not limited to blood, bone marrow, lymph nodes, thymus, or other tissues or fluids. T cells can also be enriched or converted. T cells can be obtained by maturing hematopoietic stem cells into T cells in vitro or in vivo. In the exemplary aspect, the T cell is a human T cell. In the exemplary aspect, the T cell is a T cell isolated from humans. T cells can be any type of T cell, including NKT cells, and can be at any developmental stage; CDA+ helper T cells; such as Th1 and Th2 cells; CD8+ T cells (e.g., cytotoxic T cells); peripheral blood monocytes (PBMCs); peripheral blood leukocytes (PBLs); tumor-infiltrating cells (TILs); memory T cells; untreated T cells, etc. In some alternatives, the T cells are allogeneic (from different donors of the same species) to the recipient cells or the cells to be received (e.g., the cells are in the form of a therapeutic composition); in some alternatives, the T cells are autologous (the donor and recipient are the same).
[0061] The therapeutic immune cells of this application can be autologous / autogenetic (“own”) or non-autologous (“non-own”, such as allogeneic, syngeneic, or allogeneic). In this application, the term “autologous” generally refers to cells from the same subject. “Allogeneic” generally refers to cells of the same species as the comparison but genetically different. “Syngeneic” generally refers to cells from a different subject that are genetically identical to the comparison cells. “Allogeneic” generally refers to cells of a different species than the comparison cells. In some embodiments, the cells of this application are autologous or allogeneic.
[0062] In this application, the term "TRAC" generally refers to the T cell receptor alpha constant. In humans, the gene encoding the alpha chain (TRA, e.g., information shown in HGNC:12027) is located on chromosome 14 and consists of multiple gene segments, including a variable segment (V), a linker segment (J), and a constant region (C). The TRAC gene generally refers to the gene sequence encoding the T cell receptor alpha constant region (C) (e.g., information shown in HGNC:12029), located on chromosome 14 (14q11.2; 14:22,547,505-22,552,131). Typically, one gene in the variable segment (V) encoding the N-segment antigen recognition domain rearranges with one gene in the linker segment (J) to produce a functional V region exon, which is transcribed and spliced to the constant region (C) to form the T cell receptor alpha chain coding sequence.
[0063] In this application, "HLA-A" and "HLA-B" generally refer to the polypeptide chains of human leukocyte antigens. HLA-A, HLA-B (both class I MHC) and HLA-DR (class II MHC) are the three major HLAs that should be matched between donor and recipient. HLA-A is encoded by the HLA-A gene located on human chromosome 6p21.3 (e.g., information shown in HGNC:4931). The HLA-B gene is located on cell band 21.3 of the short (p) arm of chromosome 6, from base pairs 31,353,871 to 31,357,211. In this application, HLA-A and HLA-B alleles may include sequence information of different HLA-A alleles named by the WHO HLA Factor Nomenclature Committee, as contained in IMGT / HLA database version 3.38.0 (https: / / www.ebi.ac.uk / ipd / imgt / hla / ).
[0064] In this application, the term "CIITA" generally refers to a trans-activator of the major histocompatibility complex (MHC II). The trans-activator may be a protein having an acidic transcriptional activation domain, four LRR (leucine-rich repeat sequences), and a GTP-binding domain. The protein may be located in the cell nucleus and act as a positive regulator of MHC II gene transcription. In humans, the protein is encoded by a gene located at 16p13.13 (e.g., information shown in HGNC:7067) capable of producing several transcript variants encoding different isoforms.
[0065] PD-1 (programmed death receptor 1), also known as CD279, can modulate the immune system's response to human cells by downregulating it, and by suppressing T-cell inflammatory activity, thus promoting self-tolerance. Blocking PD-1 can activate the immune system.
[0066] As used herein, the term "operably linked" refers to the linking of an expression regulatory element (e.g., but not limited to, promoter sequences, transcription termination sequences, etc.) to a nucleic acid sequence (e.g., coding sequences or open reading frames) such that transcription of the nucleotide sequence is controlled and regulated by the transcription regulatory element. Techniques for operably linking regulatory element regions to nucleic acid molecules are known in the art. The terms "regulatory sequence" and "regulatory element" are used interchangeably, referring to a nucleotide sequence located upstream (5' non-coding sequence), midway, or downstream (3' non-coding sequence) of a coding sequence and influencing transcription, RNA processing, or stability or translation of the relevant coding sequence. An expression regulatory element refers to a nucleotide sequence capable of controlling transcription, RNA processing, or stability or translation of a nucleotide sequence of interest. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, enhancers, and polyadenylation recognition sequences. Suitable promoters include, but are not limited to, the PGK promoter, hEF1a promoter, HTLV promoter, and MND promoter.
[0067] As used herein, “object” refers to an organism that suffers from or is susceptible to a disease (such as cancer) that can be treated by the cells, methods, or pharmaceutical compositions of the present invention. Non-limiting examples include humans, cattle, rats, mice, dogs, monkeys, goats, sheep, cows, deer, and other non-mammals. In a preferred embodiment, the object is a human.
[0068] The term "pharmaceutically acceptable carrier" as used herein includes any and all physiologically compatible solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents, and absorption delay agents. Preferably, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal, or epidermal administration (e.g., by injection or infusion).
[0069] As used herein, "therapeutic effective amount" or "therapeutic effective dose" or "effective amount" refers to an amount of substance, compound, material, or cell that, when applied to a subject, is at least sufficient to produce a therapeutic effect. Therefore, it is the amount necessary to prevent, cure, improve, block, or partially block the symptoms of a disease or condition. For example, an "effective amount" of the cell or pharmaceutical composition of the present invention preferably results in a reduction in the severity of disease symptoms, an increase in the frequency and duration of asymptomatic periods of disease, or prevention of damage or disability caused by disease-related suffering. For example, in the treatment of tumors, an "effective amount" of the cell, expression vector, or pharmaceutical composition of the present invention preferably inhibits tumor cell growth or tumor growth by at least about 10%, preferably at least about 20%, more preferably at least about 30%, more preferably at least about 40%, more preferably at least about 50%, more preferably at least about 60%, more preferably at least about 70%, and more preferably at least about 80%, relative to an untreated subject. The ability to inhibit tumor growth can be evaluated in an animal model system for predicting the efficacy against human tumors. Alternatively, it can also be evaluated by examining the ability to inhibit tumor cell growth, which can be determined in vitro by tests known to those skilled in the art.
[0070] Therapeutic immune cells
[0071] In one aspect, the present invention provides a modified therapeutic immune cell comprising a synthetic T-cell receptor antigen receptor (STAR), wherein one or more endogenous genes selected from at least one TCR-encoding gene, at least one immune checkpoint-encoding gene, at least one HLA-I protein or its regulatory protein-encoding gene, and at least one HLA-II protein or its regulatory protein-encoding gene are partially or completely inactivated.
[0072] In some embodiments, the modified therapeutic immune cells contain a synthetic T-cell receptor antigen receptor (STAR), and one or more endogenous genes selected from TRAC, PD-1, HLA-A, HLA-B, and CIITA in the therapeutic immune cells are partially or completely inactivated.
[0073] Sequence information of endogenous genes TRAC, PD-1, HLA-A, HLA-B, or CIITA can be readily obtained by those skilled in the art through public databases such as GenBank.
[0074] As used herein, partial inactivation of a gene refers to a reduction in the expression and / or decreased activity of the product (e.g., protein) it encodes. For example, a partially inactivated gene encodes a product (e.g., protein) with a reduction in expression of at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% or more; or a partially inactivated gene encodes a product (e.g., protein) with a reduction in expression activity of at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% or more.
[0075] As used herein, complete gene inactivation means that the product it encodes (such as a protein) is not expressed and / or expresses an inactive product (such as a protein). For example, a completely inactivated gene does not express its encoded product (such as a protein), or a completely inactivated gene expresses an inactive product (such as a protein).
[0076] Partial or complete inactivation of a gene can be achieved through a variety of methods known in the art. For example, in some embodiments, partial or complete inactivation of the gene can be caused by introducing a mutation into the gene. The mutation can be the addition, substitution, or deletion of one or more nucleotides.
[0077] The mutation can be introduced into the expression regulatory sequence of the gene, thereby causing a reduction or absence of expression of its encoded product (such as a protein).
[0078] Alternatively, the mutation may be introduced into the coding sequence of the gene, resulting in the addition, substitution, or deletion of one or more amino acids in the protein it encodes, which leads to reduced or no activity of the encoded protein.
[0079] In some embodiments, the mutation is a partial or complete deletion of a gene. The gene can be completely deleted from the cell, such that the cells of the present invention do not express the product encoded by the gene (e.g., a protein). The gene can also be partially deleted, such that the cells of the present invention express only a truncated product with reduced or no activity (e.g., a truncated protein). In some embodiments, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or even 100% of the gene (e.g., its coding sequence) is deleted.
[0080] Introducing mutations into genes can be achieved through various means known in the art. In some embodiments, mutations are introduced into genes of the cell through genetic engineering. In some embodiments, the mutation is not a naturally occurring mutation. In some embodiments, the mutation in the gene is introduced into an endogenous gene via targeted mutagenesis, such as targeted mutagenesis mediated by gene editing technologies such as CRISPR, TALEN, or ZFN, preferably via a CRISPR gene editing system.
[0081] In some embodiments, at least one endogenous TCR-encoding gene in the therapeutic immune cells is partially or completely inactivated. In some embodiments, at least one endogenous TCR-encoding gene and at least one gene encoding an endogenous HLA-I protein or its regulatory protein are partially or completely inactivated in the therapeutic immune cells. In some embodiments, at least one endogenous TCR-encoding gene, at least one gene encoding an endogenous HLA-I protein or its regulatory protein, and at least one gene encoding an endogenous HLA-II protein or its regulatory protein are partially or completely inactivated in the therapeutic immune cells. In some embodiments, at least one endogenous TCR-encoding gene, at least one endogenous immune checkpoint gene, at least one gene encoding an endogenous HLA-I protein or its regulatory protein, and at least one gene encoding an endogenous HLA-II protein or its regulatory protein are partially or completely inactivated in the therapeutic immune cells.
[0082] In some embodiments, the endogenous TRAC gene in the therapeutic immune cells is partially or completely inactivated. In some embodiments, the endogenous TRAC, HLA-A, and HLA-B genes in the therapeutic immune cells are partially or completely inactivated. In some embodiments, the endogenous TRAC, HLA-A, HLA-B, and CIITA genes in the therapeutic immune cells are partially or completely inactivated. In some embodiments, the endogenous TRAC, PD-1, HLA-A, HLA-B, and CIITA genes in the therapeutic immune cells are partially or completely inactivated.
[0083] In some implementations, the mutation is introduced by targeting the target sequence shown in SEQ ID NO:48 in the endogenous TRAC gene using a CRISPR gene editing system such as the Cas9 gene editing system.
[0084] In some implementations, the mutation is introduced by targeting the target sequence shown in SEQ ID NO:49 in the endogenous PD-1 gene using a CRISPR gene editing system such as the Cas9 gene editing system.
[0085] In some implementations, the mutation is introduced by targeting one of SEQ ID NO:24-29 in the endogenous HLA-A gene using a CRISPR gene editing system, such as the Cas9 gene editing system, preferably the target sequence shown in SEQ ID NO:24.
[0086] In some implementations, the mutation is introduced by targeting one of SEQ ID NO:30-35 in the endogenous HLA-B gene, preferably the target sequence described in SEQ ID NO:30, using a CRISPR gene editing system such as the Cas9 gene editing system.
[0087] In some implementations, the mutation is introduced by targeting one of SEQ ID NO:36-41 in the endogenous HLA-A and HLA-B genes, preferably the target sequence described in SEQ ID NO:36, using a CRISPR gene editing system such as the Cas9 gene editing system.
[0088] In some implementations, the mutation is introduced by targeting one of SEQ ID NO:42-47 in the endogenous CIITA gene using a CRISPR gene editing system, such as the Cas9 gene editing system, preferably the target sequence shown in SEQ ID NO:42.
[0089] Suitable gene editing systems, such as the Cas9 gene editing system, are described in detail in this article.
[0090] In some embodiments, the therapeutic immune cells comprise an expression cassette of the STAR gene intercalated into an endogenous TRAC gene locus. The insertion of the STAR expression cassette results in the inactivation of the endogenous TRAC gene.
[0091] In some implementations, the expression cassette of the STAR can be inserted into the endogenous TRAC locus at the location defined by SEQ ID NO:18 and SEQ ID NO:19.
[0092] In some embodiments, the expression cassette of the STAR contains the coding nucleotide sequence of the STAR (e.g., the α chain and the β chain of the STAR) and an expression regulatory element, such as a promoter, operatively linked thereto.
[0093] Examples of promoters include the MND promoter. An exemplary nucleotide sequence of the MND promoter is shown in SEQ ID NO:20.
[0094] In some embodiments, the expression cassette comprises a coding nucleotide sequence of a fusion protein of the α chain and β chain of the STAR linked by a self-cleaving peptide, preferably the coding nucleotide sequence being operatively linked to an MND promoter.
[0095] As used herein, "self-cleaving peptide" refers to a peptide capable of self-cleaving within a cell. For example, the self-cleaving peptide may contain a protease recognition site, thereby being recognized and specifically cleaved by intracellular proteases. Alternatively, the self-cleaving peptide may be a 2A peptide. 2A peptides are a class of short peptides derived from viruses whose self-cleavage occurs during translation. When two different target proteins are expressed in the same reading frame using a 2A peptide, the two target proteins are generated in an almost 1:1 ratio. Commonly used 2A peptides include P2A from porcine techovirus-1, T2A from the β-tetrasomatic moth virus (Thosea asigna virus), E2A from equine rhinitis A virus, and F2A from foot-and-mouth disease virus. P2A has the highest cleavage efficiency and is therefore preferred. Various functional variants of these 2A peptides are also known in the art and can also be used in this invention. 2A peptides can also be combined with a Furin recognition sequence to remove additional introduced amino acid sequences.
[0096] In some embodiments, the self-cleaving peptide is a 2A peptide, such as a P2A peptide. In some embodiments, the self-cleaving peptide is a Furin-2A peptide, such as the Furin-P2A peptide shown in SEQ ID NO:17.
[0097] In some embodiments, the different portions of the fusion polypeptide can be arranged in different ways, as long as they are separated by self-cleaving peptides. For example, in some embodiments, the fusion polypeptide may include the β chain, a self-cleaving peptide such as Furin-P2A, and the α chain from the N-terminus to the C-terminus.
[0098] In some embodiments, the STAR comprises an α chain and a β chain, the α chain comprising a first constant region, the β chain comprising a second constant region, and wherein the α chain and / or the β chain further comprises an antigen-binding region that specifically binds to the target antigen.
[0099] In some embodiments, the first constant region is a natural TCRα chain constant region, such as a natural human TCRα chain constant region or a natural mouse TCRα chain constant region. An exemplary natural human TCRα chain constant region comprises the amino acid sequence shown in SEQ ID NO:1. An exemplary natural mouse TCRα chain constant region comprises the amino acid sequence shown in SEQ ID NO:2.
[0100] In some implementations, the first constant region is a modified TCRα chain constant region.
[0101] In some embodiments, the modified TCRα chain constant region is derived from the mouse TCRα chain constant region, wherein the amino acid at position 48, for example threonine T, is mutated to cysteine C, relative to the wild-type mouse TCRα chain constant region.
[0102] In some embodiments, the modified TCRα chain constant region is derived from the mouse TCRα chain constant region, wherein, relative to the wild-type mouse TCRα chain constant region, the amino acid at position 112, such as serine S, is replaced with leucine L; the amino acid at position 114, such as methionine M, is replaced with isoleucine I; and the amino acid at position 115, such as glycine G, is replaced with valine V.
[0103] In some embodiments, the modified TCRα chain constant region is derived from the mouse TCRα chain constant region, which, relative to the wild-type mouse TCRα chain constant region, has its 6th amino acid, such as E, replaced by D, its 13th K replaced by R, and its 15th-18th amino acids deleted.
[0104] In some embodiments, the modified TCRα chain constant region is derived from the mouse TCRα chain constant region, which, relative to the wild-type mouse TCRα chain constant region, has the following modifications: the amino acid at position 48, such as threonine (T), is mutated to cysteine (C); the amino acid at position 112, such as serine (S), is mutated to leucine (L); the amino acid at position 114, such as methionine (M), is mutated to isoleucine (I); and the amino acid at position 115, such as glycine (G), is mutated to valine (V).
[0105] In some embodiments, the modified TCRα chain constant region is derived from the mouse TCRα chain constant region, which, relative to the wild-type mouse TCRα chain constant region, has the following modifications: amino acid at position 6, such as E, is replaced by D; amino acid at position 13, K, is replaced by R; amino acids at positions 15-18 are deleted; amino acid at position 48, such as threonine (T), is mutated to cysteine (C); amino acid at position 112, such as serine (S), is replaced by leucine (L); amino acid at position 114, such as methionine (M), is replaced by isoleucine (I); and amino acid at position 115, such as glycine (G), is replaced by valine (V).
[0106] In some embodiments, the TCRα chain constant region is a non-intracellular region relative to the wild-type TCRα chain constant region, for example, the non-intracellular region of the constant region is missing amino acids 136-137.
[0107] In some embodiments, the modified TCRα chain constant region is derived from the mouse TCRα chain constant region, which, relative to the wild-type mouse TCRα chain constant region, lacks the intracellular region of the constant region, for example, the deletion of amino acids 136-137.
[0108] In some specific embodiments, the modified TCRα chain constant region contains an amino acid sequence shown in one of SEQ ID NO:3-7.
[0109] In some embodiments, the second constant region is a natural TCRβ chain constant region, such as a natural human TCRβ chain constant region or a natural mouse TCRβ chain constant region. An exemplary natural human TCRβ chain constant region comprises the amino acid sequence shown in SEQ ID NO:8. An exemplary natural mouse TCRβ chain constant region comprises the amino acid sequence shown in SEQ ID NO:9.
[0110] In some implementations, the second constant region is a modified TCRβ chain constant region.
[0111] In some embodiments, the modified TCRβ chain constant region is derived from the mouse TCRβ chain constant region, wherein the amino acid at position 56, for example serine S, is mutated to cysteine C, relative to the wild-type mouse TCRβ chain constant region.
[0112] In some embodiments, the modified TCRβ chain constant region is derived from the mouse TCRβ chain constant region, which, relative to the wild-type mouse TCRβ chain constant region, has the following modifications: the amino acid at position 3, such as R, is replaced by K; the amino acid at position 6, such as T, is replaced by F; the amino acid at position 9, such as K, is replaced by E; the amino acid at position 11, such as S, is replaced by A; the amino acid at position 12, such as L, is replaced by V; and the amino acids at positions 17 and 21-25 are deleted.
[0113] In some embodiments, the modified TCRβ chain constant region is derived from the mouse TCRβ chain constant region, which, relative to the wild-type mouse TCRβ chain constant region, has the following modifications: the amino acid at position 56, such as serine (S), is mutated to cysteine (C); the amino acid at position 3, such as R, is replaced by K; the amino acid at position 6, such as T, is replaced by F; the amino acid at position 9, such as K, is replaced by E; the amino acid at position 11, such as S, is replaced by A; the amino acid at position 12, such as L, is replaced by V; and the amino acids at positions 17 and 21-25 are deleted.
[0114] In some embodiments, the TCRβ chain constant region is a non-intracellular region relative to the wild-type TCRβ chain constant region, for example, the intracellular region of the constant region is missing amino acids 167-172.
[0115] In some embodiments, the modified TCRβ chain constant region is derived from the mouse TCRβ chain constant region, which, relative to the wild-type mouse TCRβ chain constant region, lacks the intracellular region of the constant region, for example, the lack of amino acids 167-172.
[0116] In some specific embodiments, the modified TCRβ chain constant region contains an amino acid sequence shown in one of SEQ ID NO:10-14.
[0117] In some embodiments, the first constant region comprises the amino acid sequence shown in SEQ ID NO:3, and the second constant region comprises the amino acid sequence shown in SEQ ID NO:10. In some embodiments, the first constant region comprises the amino acid sequence shown in SEQ ID NO:6, and the second constant region comprises the amino acid sequence shown in SEQ ID NO:10. In some embodiments, the first constant region comprises the amino acid sequence shown in SEQ ID NO:3, and the second constant region comprises the amino acid sequence shown in SEQ ID NO:13. In some preferred embodiments, the first constant region comprises the amino acid sequence shown in SEQ ID NO:6, and the second constant region comprises the amino acid sequence shown in SEQ ID NO:13.
[0118] In some embodiments, the α-chain and / or β-chain, preferably the α-chain and β-chain, have at least one exogenous intracellular functional domain attached to their C-terminus. In some embodiments, the exogenous intracellular functional domain is connected directly or via a linker to the α-chain and / or β-chain, preferably to the C-terminus of the constant region of the α-chain and β-chain. In some embodiments, the exogenous intracellular functional domain is connected via a linker to the α-chain and / or β-chain missing from the intracellular region, preferably to the C-terminus of the constant region of the α-chain and β-chain. In some embodiments, the linker is a (G4S)n linker, where n represents an integer from 1 to 10, preferably n is 3.
[0119] In some embodiments, the first constant region is a modified TCRα chain constant region derived from a mouse TCRα chain constant region, wherein, relative to the wild-type mouse TCRα chain constant region, the amino acid at position 48, for example threonine (T), is mutated to cysteine (C); the amino acid at position 112, for example serine (S), is mutated to leucine (L); the amino acid at position 114, for example methionine (M), is mutated to isoleucine (I); and the amino acid at position 115, for example glycine (G), is mutated to valine (V). The modified TCRα chain constant region, relative to the wild-type mouse TCRα chain constant region, lacks an intracellular region of the constant region, for example, the amino acids at positions 136-137. The α chain includes an intracellular domain of OX40 connected to the C-terminus of the constant region (e.g., via a linker, such as a (G4S)n linker, where n represents an integer from 1 to 10, preferably n is 3).
[0120] The second constant region is a modified TCRβ chain constant region derived from the mouse TCRβ chain constant region, wherein, relative to the wild-type mouse TCRβ chain constant region, the amino acid at position 56, for example serine S, is mutated to cysteine C, and the modified TCRβ chain constant region, relative to the wild-type mouse TCRβ chain constant region, lacks the intracellular region of the constant region, for example, the amino acids at positions 167-172 are missing, and the β chain contains an intracellular domain of OX40 connected to the C-terminus of the constant region (e.g., via a linker, such as a (G4S)n linker, where n represents an integer from 1 to 10, preferably n is 3).
[0121] As used in this article, "exogenous intracellular functional domain" can be the intracellular domain of co-stimulatory molecules such as CD40, OX40, ICOS, CD28, 4-1BB, CD27, and CD137; it can also be the intracellular domain of co-inhibitory molecules, such as TIM3, PD1, CTLA4, and LAG3; it can also be the intracellular domain of cytokine receptors such as interleukin receptors (e.g., IL-2β, IL-7α, or IL-21 receptors), interferon receptors, tumor necrosis factor superfamily receptors, colony-stimulating factor receptors, chemokine receptors, growth factor receptors, or other membrane proteins; or the domain of intracellular proteins such as NIK.
[0122] In some preferred embodiments, the exogenous intracellular functional domain is an intracellular domain of a co-stimulatory molecule, preferably an intracellular domain of OX40. In some embodiments, the intracellular domain of OX40 comprises the amino acid sequence of SEQ ID NO:15.
[0123] In some implementations, the antigen-binding region is fused directly or indirectly (e.g., via a linker) to the N-terminus of the first and / or second constant region.
[0124] In some embodiments, the α chain includes a first antigen-binding region and a first constant region, and the β chain includes a second constant region. In this case, the β chain does not contain an antigen-binding region.
[0125] In some embodiments, the α chain includes a first constant region, and the β chain includes a second antigen-binding region and a second constant region. In this case, the α chain does not contain an antigen-binding region.
[0126] In some embodiments, the α chain includes a first antigen-binding region and a first constant region, and the β chain includes a second antigen-binding region and a second constant region.
[0127] In some embodiments, the first antigen-binding region and the second antigen-binding region each independently or in combination specifically bind to at least one target antigen. Those skilled in the art will understand that when the antigen-binding region contains a single-domain antibody or a single-chain antibody, it can bind to the target antigen alone. However, if the first antigen-binding region contains a conventional antibody heavy chain variable region and the second antigen-binding region contains a conventional antibody light chain variable region, then the first and second antigen-binding regions bind to the target antigen in combination, and vice versa.
[0128] The target antigen described in this invention can be a disease-related antigen, preferably a cancer-related antigen. For example, the target antigen can be selected from the following antigens: GPC3 (phosphatidylinositol proteoglycan 3), BCMA, mesothelin (MSLN, Mesothelin), LILRB4, GPRC5D, NY-ESO-1, GUCY2C, CD16, CD64, CD78, CD96, CLL1, CD116, CD117, CD7, CD70, CD38, CD45, CD71, CD123, CD138, CD276, CD19, CD20, CD22, CD30, CD40, CD3, CD4, CD8, CD24, CD2 5. CD33, CD34, CD133, CD138, Foxp3, B7-1 (CD80), B7-2 (CD86), ErbB2 (HER2 / neu), Claudin18.2, Carcinoembryonic antigen (CEA), Epithelial cell adhesion molecule (EpCAM), Epidermal growth factor receptor (EGFR), EGFR variant III (EGFRvIII), Disialotetrahexosylganglioside GD2, Ductal epithelial mucin, gp36, TAG-72, Glycosphingolipids, Glioma-associated antigen, β-human chorionic gonadotropin, Alpha fetoglobulin (AFP), Exogenous lectin-reactive AFP, Thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestinal carboxyl esterase, mut hsp70-2, M-CSF, prostase, prostate enzyme-specific antigen (PSA), PAP, LAGA-1a, p53, Prostein, PSMA, survival and telomerase, prostate cancer tumor antigen-1 (PCTA-1), MAGE, ELF2M, neutrophil elastase, liver glycoprotein B2, insulin-like growth factor (IGF1)-I, IGF-II, IGFI receptor, major histocompatibility complex (MHC) molecule presenting tumor-specific peptide epitopes, 5T4, ROR1, Nkp30, NKG2D, tumor matrix antigen, extra domain A (EDA) and extra domain B (EDB) of fibronectin, A1 domain (TnC) of tendinin-C A1), fibroblast-associated protein (fap), GM-CSF, cytokine receptors, endothelial factors, major histocompatibility complex (MHC) molecules, TNFRSF17, SLAMF7, FKBP11, KAMP3, ITGA8, and FCRL5.
[0129] In some embodiments, the target antigen is an antigen derived from a pathogen or a surface antigen of cells infected by a pathogen, such as RSVF (prevention of respiratory syncytial virus), PA (inhalation anthrax), CD4 (HIV infection), etc. In some embodiments, the target antigen is HBsAg.
[0130] In some implementations, the target antigen is a molecule produced or secreted by disease-causing cells, such as CD3 (involved in transplant rejection), CD25 (involved in acute kidney transplant rejection), C5 (involved in paroxysmal nocturnal hemoglobinuria), IL-1β (involved in cold pyridine-associated periodic syndrome), RANKL (involved in cancer-related bone injury), von Willebrand factor (involved in adult acquired thrombotic thrombocytopenic purpura), plasma kallikrein (involved in angioedema), calcitonin gene-related peptide receptor (involved in adult migraine), FGF23 (involved in X-linked hypophosphatemia), etc.
[0131] In some embodiments, the STAR of the present invention targets CD19 and CD20. In some embodiments, the STAR of the present invention targets CD19 and CD22. In some embodiments, the STAR of the present invention targets CD19 and BCMA. In some embodiments, the STAR of the present invention targets CD19 and LILRB4. In some embodiments, the STAR of the present invention targets CD19 and GPC3. In some embodiments, the STAR of the present invention targets BCMA and LILRB4. Based on the teachings herein and knowledge in the art, those skilled in the art can readily construct STARs with two different antigens.
[0132] The antigen-binding region may be derived from one or more known antibodies, including any commercially available antibody such as FMC63, rituximab, alemtuzumab, epratuzumab, trastuzumab, bivatuzumab, cetuximab, labetuzumab, palivizumab, sevirumab, and tuvirumab. Baliximab, daclizumab, infliximab, omalizumab, efalizumab, keliximab, siplizumab, natalizumab, clenoliximab, pemtumomab, edrecolomab, cantuzumab, etc.
[0133] In some embodiments, the first antigen-binding region comprises a heavy chain variable region of an antibody that specifically binds to the target antigen, and the second antigen-binding region comprises a light chain variable region of the antibody; or, the first antigen-binding region comprises a light chain variable region of an antibody that specifically binds to the target antigen, and the second antigen-binding region comprises a heavy chain variable region of the antibody.
[0134] In some embodiments, the first antigen-binding region contains at least one single-chain antibody (e.g., scFv) or single-domain antibody that specifically binds to the target antigen; and / or the second antigen-binding region contains at least one single-chain antibody or single-domain antibody that specifically binds to the target antigen.
[0135] In some embodiments, the single-chain antibody (e.g., scFv) comprises a heavy chain variable region and a light chain variable region connected by a linker, such as a flexible linker. Those skilled in the art can readily utilize existing knowledge and methods to construct single-chain antibodies from the heavy chain variable regions and light chain variable regions of conventional antibodies.
[0136] In some implementations, the first antigen-binding region and the second antigen-binding region bind the same target antigen.
[0137] In some implementations, the first antigen-binding region and the second antigen-binding region bind to different regions (e.g., different epitopes) of the same target antigen.
[0138] In some implementations, the first antigen-binding region and the second antigen-binding region bind different target antigens.
[0139] In some embodiments, the antigen-binding region includes the heavy chain variable region shown in SEQ ID NO:21 and / or the light chain variable region shown in SEQ ID NO:22, thereby the STAR targets CD19. In some embodiments, the first antigen-binding region includes the heavy chain variable region shown in SEQ ID NO:21, and the second antigen-binding region includes the light chain variable region shown in SEQ ID NO:22. In some embodiments, the first antigen-binding region includes the light chain variable region shown in SEQ ID NO:22, and the second antigen-binding region includes the heavy chain variable region shown in SEQ ID NO:21. In some embodiments, the first antigen-binding region includes both the heavy chain variable region shown in SEQ ID NO:21 and the light chain variable region shown in SEQ ID NO:22.
[0140] In some embodiments, the α chain comprises the amino acid sequence shown in SEQ ID NO:51, and the β chain comprises the amino acid sequence shown in SEQ ID NO:52. (CD19-STAR)
[0141] In some embodiments, the antigen-binding region includes the heavy chain variable region shown in SEQ ID NO:54 and / or the light chain variable region shown in SEQ ID NO:55, thereby the STAR targets GPC3. In some embodiments, the first antigen-binding region includes the heavy chain variable region shown in SEQ ID NO:54, and the second antigen-binding region includes the light chain variable region shown in SEQ ID NO:55. In some embodiments, the first antigen-binding region includes the light chain variable region shown in SEQ ID NO:55, and the second antigen-binding region includes the heavy chain variable region shown in SEQ ID NO:54. In some embodiments, the first antigen-binding region includes both the heavy chain variable region shown in SEQ ID NO:54 and the light chain variable region shown in SEQ ID NO:55.
[0142] In some embodiments, the α chain comprises the amino acid sequence shown in SEQ ID NO:56, and the β chain comprises the amino acid sequence shown in SEQ ID NO:57. (GPC3-STAR)
[0143] The immune cells described in this invention include, but are not limited to, T cells or NK cells, preferably T cells.
[0144] The immune cells, such as T cells, of the present invention can be obtained from a variety of non-limiting sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, ascites, pleural effusion, spleen tissue, and tumors, by various non-limiting methods. In some embodiments, the cells can be derived from healthy donors or from patients diagnosed with cancer. In some embodiments, the cells can be part of a mixed population of cells exhibiting different phenotypic characteristics. For example, immune cells such as T cells can be obtained by isolating peripheral blood mononuclear cells (PBMCs) and then activating and expanding them with specific antibodies.
[0145] In some embodiments, the immune cells, such as T cells, described in this invention are isolated (ex vivo) immune cells, such as T cells.
[0146] In some embodiments of various aspects of the present invention, the immune cells, such as T cells, are derived from the subject's own cells. As used herein, "autologous" means that the cells, cell lines, or cell populations used to treat the subject are derived from the subject. Preferably, in some embodiments, the immune cells, such as T cells, are derived from allogeneic cells. In some embodiments, the therapeutic immune cells of the present invention are universal (allogeneic) therapeutic immune cells, for example, which can be used to administer to different subjects and substantially do not cause or only cause manageable GVHD and / or HVGR.
[0147] Methods for preparing therapeutic immune cells
[0148] In one aspect, the present invention provides a composition for preparing therapeutic immune cells, comprising:
[0149] i) A STAR expression vector, wherein the STAR expression vector comprises the expression cassette of STAR as defined above; and
[0150] ii) A gene editing system that targets at least one endogenous TCR encoding gene, at least one endogenous immune checkpoint encoding gene, at least one endogenous HLA-I protein or its regulatory protein encoding gene, and / or at least one endogenous HLA-II protein or its regulatory protein encoding gene.
[0151] In some implementations, the gene editing system is described
[0152] i) Target at least one endogenous TCR-encoding gene;
[0153] ii) Target at least one endogenous TCR encoding gene and at least one endogenous HLA-I protein or its regulatory protein encoding gene;
[0154] iii) Targeting at least one endogenous TCR-coding gene and at least one endogenous HLA-I protein or its regulatory protein-coding gene and at least one endogenous HLA-II protein or its regulatory protein-coding gene; or
[0155] iv) Target at least one endogenous TCR encoding gene, at least one endogenous immune checkpoint encoding gene, at least one endogenous HLA-I protein or its regulatory protein encoding gene, and at least one endogenous HLA-II protein or its regulatory protein encoding gene.
[0156] In some embodiments, the combination for preparing therapeutic immune cells comprises:
[0157] i) A STAR expression vector, wherein the STAR expression vector comprises the expression cassette of STAR as defined above; and
[0158] ii) Gene editing systems that target one or more endogenous genes selected from TRAC, PD-1, HLA-A, HLA-B and CIITA.
[0159] In some embodiments, the gene editing system targets the endogenous TRAC gene. In some embodiments, the gene editing system targets the endogenous TRAC, HLA-A, and HLA-B genes. In some embodiments, the gene editing system targets the endogenous TRAC, HLA-A, HLA-B, and CIITA genes. In some embodiments, the gene editing system targets the endogenous TRAC, PD-1, HLA-A, HLA-B, and CIITA genes.
[0160] In some implementations, the gene editing system causes partial or complete inactivation of the targeted endogenous gene.
[0161] The gene editing system can be a CRISPR, TALEN, or ZFN system, preferably a CRISPR system such as the Cas9 system.
[0162] In some implementations, the CRISPR system includes:
[0163] i) CRISPR nucleases and / or expression constructs containing the encoding nucleotide sequences of CRISPR nucleases; and
[0164] ii) Guide RNA and / or an expression construct containing a coding nucleotide sequence of guide RNA, wherein the guide RNA is capable of targeting a target sequence in a cell.
[0165] As used herein, the term "CRISPR nuclease" generally refers to a nuclease present in the naturally occurring CRISPR system, as well as its modified forms, variants, or catalytically active fragments thereof. CRISPR nucleases can recognize, bind to, and / or cleave target nucleic acid structures by interacting with guide RNA. The term encompasses any CRISPR-based nuclease or its functional variants capable of intracellular gene editing. In some embodiments, the functional variants retain their double-strand cleavage activity, i.e., the ability to form double-strand breaks (DSBs) in the target sequence.
[0166] The CRISPR nuclease used in this invention may be selected from, for example, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, GSU0054, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx11, Csx16, CsaX, Csx3, Csx1, and Csx15. The CRISPR nucleases include Csf1, Csf2, Csf3, Csf4, C2c3, C2c8, C2c10, Cas12a (also known as Cpf1), Cas12a2, Cas12b (also known as C2c1), Cas12c, Cas12c1, Cas12e, Cas12g, Cas12h, Cas12i, Cas12j, Cas12f, Cas12k, Cas12m, Cas12n, Cas13a (also known as C2c2), Cas13b, Cas13c, Cas13d, Cas13m.3, Cas13m.6, Cas14, Casφ, Casλ, TnpB proteins, or functional variants of these nucleases. In some preferred embodiments, the CRISPR nuclease includes the Cas9 nuclease or a variant thereof. The Cas9 nuclease may be a Cas9 nuclease from a different species, such as spCas9 from *Streptococcus pyogenes*.
[0167] As used herein, "gRNA" and "guide RNA" are used interchangeably and refer to RNA molecules capable of forming a complex with a CRISPR nuclease and, due to complementarity with the target sequence, directing the complex to the target sequence. For example, for the Cas9 nuclease, its gRNA typically consists of partially complementary crRNA and tracrRNA molecules forming a complex, wherein the crRNA contains a sequence sufficiently identical to the target sequence to hybridize with its complementary sequence and guide the CRISPR complex (Cas9 + crRNA + tracrRNA) to specifically bind to the target sequence. However, it is known in the art that single guide RNAs (sgRNAs) can be designed that simultaneously contain the characteristics of both crRNA and tracrRNA. In the case of the Cpf1 nuclease, the gRNA typically consists only of mature crRNA molecules. Designing suitable gRNAs based on the CRISPR nuclease used and the target sequence to be edited is within the capabilities of those skilled in the art.
[0168] As used herein, a “target sequence” is a sequence that is complementary to or identical (depending on the specific CRISPR nuclease) to a guide sequence of approximately 20 nucleotides contained in the guide RNA. The guide RNA targets the target sequence by base pairing with the target sequence or its complementary strand. For the Cas9 nuclease, the target sequence it recognizes typically needs to contain a PAM sequence at the 3' end, such as 5'-NGG-3'. In the Cas9 guide RNA, the target sequence is located at the 5' end of the scaffold sequence. In some embodiments, the sgRNA used for Cas9 contains the scaffold sequence shown in SEQ ID NO:23.
[0169] In some embodiments, the guide RNA targets or includes the target sequence shown in SEQ ID NO:48 of the endogenous TRAC gene.
[0170] In some embodiments, the guide RNA targets or includes the target sequence shown in SEQ ID NO:49 of the endogenous PD-1 gene.
[0171] In some embodiments, the guide RNA targets or includes one of SEQ ID NO:24-29 in the endogenous HLA-A gene, preferably the target sequence shown in SEQ ID NO:24.
[0172] In some embodiments, the guide RNA targets or includes one of SEQ ID NO:30-35 in the endogenous HLA-B gene, preferably the target sequence described in SEQ ID NO:30.
[0173] In some embodiments, the guide RNA targets or includes one of the endogenous HLA-A and HLA-B genes in SEQ ID NO:36-41, preferably the target sequence described in SEQ ID NO:36.
[0174] In some embodiments, the guide RNA targets or includes one of SEQ ID NO:42-47 of the endogenous CIITA gene, preferably the target sequence shown in SEQ ID NO:42.
[0175] In some embodiments, the guide RNA contains chemical modifications. For example, the first three bases at the 3' and 5' ends of the guide RNA contain thio and 2'-O-methyl modifications.
[0176] In some specific implementations, the gene editing system includes:
[0177] i) Ca9 nuclease; and
[0178] ii) guide RNA that targets or contains the target sequence shown in SEQ ID NO:48, guide RNA that targets or contains the target sequence shown in SEQ ID NO:49, guide RNA that targets or contains the target sequence shown in SEQ ID NO:36, and / or, guide RNA that targets or contains the target sequence shown in SEQ ID NO:42.
[0179] In some specific implementations, the gene editing system includes:
[0180] i) Ca9 nuclease; and
[0181] ii) Guide RNA that targets or contains the target sequence shown in SEQ ID NO:48.
[0182] In some specific implementations, the gene editing system includes:
[0183] i) Ca9 nuclease; and
[0184] ii) Guide RNA that targets or contains the target sequence shown in SEQ ID NO:48, and guide RNA that targets or contains the target sequence shown in SEQ ID NO:36.
[0185] In some specific implementations, the gene editing system includes:
[0186] i) Ca9 nuclease; and
[0187] ii) guide RNA that targets or contains the target sequence shown in SEQ ID NO:48, guide RNA that targets or contains the target sequence shown in SEQ ID NO:36, and guide RNA that targets or contains the target sequence shown in SEQ ID NO:42.
[0188] In some specific implementations, the gene editing system includes:
[0189] i) Ca9 nuclease; and
[0190] ii) guide RNA that targets or contains the target sequence shown in SEQ ID NO:48, guide RNA that targets or contains the target sequence shown in SEQ ID NO:49, guide RNA that targets or contains the target sequence shown in SEQ ID NO:36, and guide RNA that targets or contains the target sequence shown in SEQ ID NO:42.
[0191] In some embodiments, the STAR expression cassette includes a 5' homologous arm (5'HA) at its 5' end and a 3' homologous arm (3'HA) at its 3' end, wherein the 5'HA and 3'HA contain nucleotide sequences homologous to sequences in the endogenous TRAC locus. Through the 5'HA and 3'HA, the STAR expression cassette can be site-directedly integrated into the endogenous TRAC locus via homologous recombination. The length of the homologous arm can be 100 nt to 1000 nt, for example, 300 nt to 500 nt.
[0192] In some embodiments, the STAR expression cassette includes the 5' homologous arm (5'HA) shown in SEQ ID NO:18 at its 5' end and the 3' homologous arm (3'HA) shown in SEQ ID NO:19 at its 3' end.
[0193] In some embodiments, the STAR expression vector is an AAV (adeno-associated virus) vector. In some embodiments, the STAR expression vector is an AAV6 vector. Methods for preparing AAV vectors (viral particles) are known in the art.
[0194] The components of the combination described in this invention, such as the STAR expression vector, the nuclease in the gene editing system, and the guide RNA, can exist independently or in any combination as a composition. This invention also covers kits comprising the combination.
[0195] In another aspect, the present invention provides a method for preparing therapeutic immune cells, comprising:
[0196] Step 1) Provide initial immune cells;
[0197] Step 2) Introduce the combination of the present invention into the initiating immune cells; and
[0198] Step 3) Harvest the immune cells obtained in Step 2).
[0199] In some embodiments, the STAR expression vector, the TRAC-targeting gene editing system, the PD-1-targeting gene editing system, the HLA-A-targeting gene editing system, the HLA-B-targeting gene editing system, and / or the CIITA-targeting gene editing system in the combination can be introduced into the initiating immune cells simultaneously or separately (sequentially), preferably simultaneously.
[0200] In some embodiments, the initiating immune cell is a T cell. In other embodiments, the initiating immune cell is an NK cell.
[0201] The initiating immune cells, such as T cells, of the present invention can be obtained from a variety of non-limiting sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, ascites, pleural effusion, spleen tissue, and tumors, using various non-limiting methods. In some embodiments, the cells can be derived from healthy donors or from patients diagnosed with cancer. In some embodiments, the cells can be part of a mixed population of cells exhibiting different phenotypic characteristics. For example, initiating immune cells, such as T cells, can be obtained by isolating peripheral blood mononuclear cells (PBMCs) and then activating and expanding them with specific antibodies.
[0202] In some embodiments, the initiating immune cells, such as T cells, described in this invention are isolated (ex vivo) immune cells, such as T cells. Therefore, the therapeutic immune cells, such as T cells, obtained by this invention are isolated (ex vivo) therapeutic immune cells, such as T cells.
[0203] In some embodiments, the method described in this invention is an in vitro method.
[0204] In some embodiments of various aspects of the invention, the initiating immune cells, such as T cells, are derived from the subject's own cells. As used herein, "autologous" means that the cells, cell lines, or cell populations used to treat the subject are derived from the subject. In some embodiments, the initiating immune cells, such as T cells, are derived from allogeneic cells.
[0205] The combination can be introduced into immune cells such as T cells by methods known in the art, including but not limited to microinjection, electroporation, virus-mediated transfection, liposome-mediated transfection, etc., preferably by electroporation.
[0206] In some embodiments, the method further includes, between steps 2) and 3), step x) amplifying immune cells, such as T cells, obtained in step 2). Immune cells, such as T cells, can be amplified using methods known in the art.
[0207] In some embodiments, the method further includes step y) screening for immune cells, such as T cells, expressing the STAR. In some embodiments, the method further includes step y) screening for immune cells, such as T cells, whose endogenous genes selected from TRAC, PD-1, HLA-A, HLA-B, and CIITA are partially or completely inactivated. In some embodiments, the method further includes step y) screening for immune cells, such as T cells, expressing the STAR and whose endogenous genes selected from TRAC, PD-1, HLA-A, HLA-B, and CIITA are partially or completely inactivated. In some embodiments, step y) may be performed after step 2). In some embodiments, step y) may be performed after step 2) and before step x). In some embodiments, step y) may be performed after step x). In some embodiments, the screening is performed by flow cytometry.
[0208] In another aspect, the present invention provides therapeutic immune cells such as T cells comprising the combinations of the present invention, or therapeutic immune cells such as T cells that can be obtained or acquired by the combinations of the present invention or the methods of the present invention.
[0209] Pharmaceutical Compositions and Applications
[0210] In another aspect, the present invention provides a pharmaceutical composition comprising the therapeutic immune cells of the present invention and / or combinations thereof, and a pharmaceutically acceptable carrier.
[0211] In another aspect, the present invention provides the use of the therapeutic immune cells of the present invention, the combinations of the present invention, and / or the pharmaceutical compositions of the present invention in the preparation of a medicament for treating a disease in a subject.
[0212] In another aspect, the present invention provides a method for treating a disease in a subject, comprising administering to the subject a therapeutically effective amount of the therapeutic immune cells of the present invention, combinations of the present invention, and / or pharmaceutical compositions of the present invention.
[0213] In practical applications, the dosage levels of cells and / or expression vectors in the pharmaceutical compositions of this invention may be varied to obtain an amount of active ingredient that effectively achieves the desired therapeutic response for a specific patient, composition, and route of administration, while being non-toxic to the patient. The selected dosage level depends on a variety of pharmacokinetic factors, including the activity of the specific composition of this invention applied, the route of administration, the time of administration, the excretion rate of the specific compound applied, the duration of treatment, other drugs, compounds, and / or materials used in combination with the specific composition applied, the age, sex, weight, condition, general health status, and medical history of the patient receiving treatment, and similar factors known in the medical field.
[0214] The administration of the combination, therapeutic immune cell, or pharmaceutical composition or drug according to the present invention can be carried out in any convenient manner, including by injection, infusion, implantation, or transplantation. The administration of the combination, therapeutic immune cell, or pharmaceutical composition described herein can be by intravenous, intralymphatic, intradermal, intratumoral, intramedullary, intramuscular, or intraperitoneal administration. In one embodiment, the combination, therapeutic immune cell, or pharmaceutical composition of the present invention is preferably administered by intravenous injection.
[0215] In embodiments of various aspects of the present invention, the disease depends on the target antigen targeted by the STAR.
[0216] In embodiments of various aspects of the present invention, the disease is, for example, cancer, and examples of such cancers include, but are not limited to, myeloma, lung cancer, ovarian cancer, colon cancer, rectal cancer, melanoma, kidney cancer, bladder cancer, breast cancer, liver cancer, lymphoma, hematologic malignancies, head and neck cancer, glioma, gastric cancer, nasopharyngeal carcinoma, laryngeal cancer, cervical cancer, endometrial tumors, osteosarcoma, bone cancer, pancreatic cancer, skin cancer, prostate cancer, uterine cancer, anal cancer, testicular cancer, fallopian tube cancer, endometrial cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, esophageal cancer, small bowel cancer, endocrine system cancers, thyroid cancer, parathyroid cancer, etc. Adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, chronic or acute leukemia (including acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia), childhood solid tumors, lymphocytic lymphoma, bladder cancer, kidney or ureter cancer, renal pelvis cancer, central nervous system (CNS) tumors, primary CNS lymphoma, tumor angiogenesis, spinal tumors, brainstem gliomas, pituitary adenomas, Kaposi's sarcoma, epidermal carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancers, including asbestos-induced cancers, and combinations of the aforementioned cancers.
[0217] In various embodiments of the present invention, the disease is, for example, a pathogen infection, and examples of the pathogens include, but are not limited to, respiratory syncytial virus, anthrax, and human immunodeficiency virus.
[0218] In various embodiments of the present invention, the disease is, for example, cardiovascular disease, diabetes, neurological disease, post-transplant rejection, autoimmune disease, allergic disease, or some other disease.
[0219] In embodiments of various aspects of the present invention, the disease is a phosphatidylinositol proteoglycan-3 (GPC3)-related disease, such as a disease related to abnormal GPC3 expression, or GPC3-related cancer. The cancer is, for example, liver cancer such as hepatocellular carcinoma, lung cancer such as squamous cell carcinoma (SqCC), gastric cancer, ovarian cancer, melanoma, or pediatric embryonal tumors.
[0220] In embodiments of various aspects of the present invention, the disease is a CD19-related disease, such as a disease related to abnormal CD19 expression, such as CD19-related cancer. The cancer can be a B-cell malignancy, such as chronic or acute leukemia (including acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia), lymphocytic lymphoma, non-Hodgkin's lymphoma, and combinations of the aforementioned cancers.
[0221] In embodiments of various aspects of the present invention, the disease is an autoimmune disease, such as systemic lupus erythematosus, rheumatoid arthritis, myasthenia gravis, idiopathic thrombocytopenic purpura, antiphospholipid syndrome, Chagas disease, Graves' disease, granulomatous polyangiitis, polyarteritis nodosa, Sjögren's syndrome, pemphigus vulgaris, scleroderma, multiple sclerosis, ANCA-associated vasculitis, Goodpasture's disease, Kawasaki disease, autoimmune hemolytic anemia, rapidly progressive glomerulonephritis, systemic sclerosis, inflammatory myopathy, etc.
[0222] In various embodiments of the present invention, the disease is an allergic disease, including but not limited to allergic rhinitis, allergic asthma, atopic dermatitis, food allergy, and drug allergy.
[0223] Example
[0224] The embodiments of the present invention are described in detail below to provide a full disclosure and illustration of how to conduct and utilize the tests, screening, and treatment methods of the present invention for those skilled in the art. Those skilled in the art will understand that the embodiments are described by way of example and are not intended to limit the scope of protection claimed by the present invention. Those skilled in the art can make various changes or modifications to these specific embodiments without departing from the scope of the technical solution of the present invention, and the changed and modified implementation schemes still fall within the protection scope of the present invention. For example, the STAR targeting CD19 is only used as an example to explain the content of the present invention; other known antibodies can replace the scFv portion of the STAR, and should not be construed as limiting the present invention.
[0225] The adeno-associated virus vector, adeno-associated virus packaging plasmid, lentiviral vector, and lentiviral packaging plasmid used in the embodiments of this application were all purchased from commercial companies or synthesized by commercial companies. The gene fragments used in the embodiments of this application, including signal peptides, antibody-binding regions, hinge regions, TCR constant regions, and tag proteins, were all synthesized by commercial companies. One or more target fragments were ligated using synthetic primers via PCR to obtain the corresponding functional sequences. The lentiviral vector used in this invention is pHAGE-EF1α-RFP, which was obtained using the restriction endonuclease NotI / ClaI to create the pHAGE-EF1A-WPRE-AMP vector. The fragmented gene was obtained through synthesis and PCR methods, and the complete vector was obtained through homologous recombination under the action of recombinase.
[0226] Example 1: STAR Optimization
[0227] B cell secretory antibodies (Abs) or B cell receptors (BCRs) share significant similarities with T cell receptors (TCRs) in gene structure, protein structure, and spatial conformation. Both antibodies and TCRs consist of variable and constant regions. The variable region is responsible for antigen recognition and binding, while the constant region plays a role in structural interaction and signal transduction. By replacing the variable regions of the TCRα and β chains (or TCRγ and δ chains) with the heavy chain variable regions (VH) and light chain variable regions (VL) of the antibody, a synthetic chimeric molecule called a synthetic T-cell receptor and antibody receptor (STAR) can be constructed.
[0228] The STAR molecule has two chains. The first chain is formed by fusing an antigen recognition sequence (such as the variable region VH of the antibody heavy chain) with the constant region (Cα) of the T cell receptor α chain (TCRα). The second chain is formed by fusing an antigen recognition sequence (such as the variable region VL of the antibody light chain) with the constant region (Cβ) of the T cell receptor β chain (TCRβ). The antigen recognition domains (such as VH, VL, or scFv) and constant region domains (the constant regions of TCRα, β, γ, and δ) in this construct can be arranged and combined to form various constructs with different configurations but similar functions.
[0229] After the first and second chains of the STAR molecule are expressed in T cells, they bind with endogenous CD3εδ, CD3γε, and CD3ζζ chains in the endoplasmic reticulum to form an eight-subunit complex, which is then displayed on the cell membrane surface as a complex. The immunoreceptor tyrosine-based activation motif (ITAM) is a signal transduction motif in the TCR molecule, with a conserved sequence of YxxL / V. The intracellular regions of the CD3ε, δ, γ, and ε chains contain one ITAM sequence, and the intracellular region of the CD3ζ chain contains three ITAM sequences, so a complete STAR complex contains a total of 10 ITAM sequences. When the antigen recognition sequence of the STAR receptor binds to its specific antigen, the intracellular ITAM sequences are successively phosphorylated, thereby activating downstream signaling pathways, activating transcription factors such as NF-κB, NFAT, and AP-1, triggering T cell activation, and producing effector functions.
[0230] The inventors have previously modified the constant region of STAR to improve its performance. Specifically, this includes:
[0231] First, the constant region is modified to be mouse-derived: Since the constant region sequences of human, primate and mouse TCRα / β chains (mouse TCRAC / mouse TCRBC) are highly conserved in function and have the same key amino acid sequences, they can be substituted for each other. After substitution, the efficiency of correct pairing of STAR molecules is increased, the possibility of mismatches causing unknown specificity is reduced and the safety is increased.
[0232] Secondly, point mutations were introduced into disulfide bonds using cysteine: a threonine T mutation at position 48 was replaced with a cysteine C mutation in the constant region of the murine TCR α chain, and a serine S mutation at position 56 was replaced with a cysteine C mutation in the constant region of the murine TCR β chain. These two newly added cysteine residues form disulfide bonds between the two STAR chains, reducing mismatches between the two STAR chains and the endogenous TCR chain, and helping the STAR molecule form a more stable complex. The obtained α chain constant region was named TRAC(Cys), and the obtained β chain constant region was named TRBC(Cys).
[0233] The STAR transmembrane region was designed with hydrophobic amino acid substitutions: Mutations were made at three amino acid sites within the transmembrane region of the TCR α-chain constant region, from amino acid positions 111 to 119. Serine (S) at position 112 was replaced with leucine (L), methionine (M) at position 114 with isoleucine (I), and glycine (G) at position 115 with valine (V). The overall amino acid sequence of this region changed from LSVGMLRIL to LLVIVLRIL. This design increased the hydrophobicity of the transmembrane region, counteracting the instability caused by the positive charge carried by the TCR transmembrane region, allowing the STAR molecule to exist more stably on the cell membrane and thus acquire better function. The α-chain constant region obtained by combining cysteine and hydrophobic region mutations was named TRAC(Cys-TM), and the corresponding β-chain constant region was named TRBC(Cys-TM), where TRBC(Cys-TM) is identical to TRBC(Cys).
[0234] To further optimize the design of the STAR molecule, a specific rearrangement was performed on the N-terminus of the STAR molecule's constant region, based on murine derivatization of the constant region, cysteine point mutations, and hydrophobic amino acid mutations in the α-chain constant region, to achieve better results. Rearrangement involves partial sequence deletion and humanization mutation of other sequences. The significance of humanization mutation lies in minimizing non-human sequences in the STAR molecule while maintaining its function, thereby minimizing the possibility of receptor rejection of STAR-T cells in clinical applications. Therefore, the N-terminus of the TCR α-chain constant region was further modified, including replacing amino acid E at position 6 with D, replacing K at position 13 with R, and deleting amino acids 15-18. The resulting α-chain constant region was named TRAC (Nrec-Cys-TM). Further modifications were made to the N-terminal 25 amino acids of the TCR β-chain constant region, including replacing the 3rd amino acid (R) with K, the 6th amino acid (T) with F, the 9th amino acid (K) with E, the 11th amino acid (S) with A, and the 12th amino acid (L) with V, and the 17th and 21-25th amino acids were deleted. The resulting β-chain constant region was named TRBC (Nrec-Cys-TM).
[0235] Furthermore, STAR function can be further enhanced by linking co-stimulatory molecules, such as the OX40 cytoplasmic region, to the C-terminus of the α-chain constant region and / or the β-chain constant region. These co-stimulatory molecules can be linked to the C-terminus of the α-chain constant region and / or the β-chain constant region via adapters, such as (G4S)3 adapters. In addition to the modifications described above, the constant regions linked to the co-stimulatory molecules can also lack the native intracellular region relative to the wild-type constant region, which further improves STAR function. For example, the α-chain constant region may lack amino acids 136-137; and / or, the β-chain constant region may lack amino acids 167-172.
[0236] Example 2: Construction of the expression vector
[0237] 2.1. Construction of STAR / CAR-AAV expression vector
[0238] The STARs constructed in this experiment contain anti-CD19 single-chain Fv (scFv) derived from antibody FMC63 and anti-GPC3 single-chain Fv (scFv) derived from antibody GC33. The CARs constructed in this experiment contain anti-CD19 single-chain Fv (scFv) derived from antibody FMC63.
[0239] The structure of STAR is described as follows:
[0240] STAR comprises the constant region TRAC (Cys-TM) of the TCRα chain and the constant region TRBC (Cys-TM) of the TCRβ chain, as well as the co-stimulatory factor OX40. The expressed STAR molecule contains two polypeptide chains: a first polypeptide chain formed by the TCRβ chain and OX40, and a second polypeptide chain formed by the TCRα chain and OX40. The coding sequences of the two STAR polypeptide chains are linked by the coding sequences of furin and the P2A protease cleavage site. The coding sequences of the two polypeptide chains are transcribed and translated together into a fusion polypeptide, which is then cleaved by the furin and P2A proteases into two independent protein subunits. These two subunits are covalently linked by disulfide bonds and form a complex with the endogenous CD3 subunits (ε, δ, γ, ζ) of T cells.
[0241] The amino acid sequence of the TCRα chain constant region mutant used in this experiment is SEQ ID NO:3; the amino acid sequence of the TCRβ chain constant region mutant is SEQ ID NO:10. The amino acid sequence of OX40 used in this experiment is SEQ ID NO:15.
[0242] The antibody sequences used in this experiment are described below:
[0243] The VH and VL sequences of the CD19-specific mouse monoclonal antibody (clone number FMC63) were used. The amino acid sequence of FMC63-VH is SEQ ID NO:21; and the amino acid sequence of FMC63-VL is SEQ ID NO:22. The amino acid sequence of the CD19-STARα chain is shown in SEQ ID NO:51, and the amino acid sequence of the β chain is shown in SEQ ID NO:52.
[0244] VH and VL of the GPC3-specific antibody (clone GC33) were used. The amino acid sequence of GC33-VH is SEQ ID NO:54; the amino acid sequence of GC33-VL is SEQ ID NO:55. The amino acid sequence of the GPC3-STARα chain is shown in SEQ ID NO:56, and the amino acid sequence of the β chain is shown in SEQ ID NO:57.
[0245] The CAR used in this experiment was assembled by sequentially linking the anti-CD19 ScFvFMC63 sequence with the CD8 hinge region, CD28 transmembrane region, CD28, and CD3ζ intracellular co-stimulatory domain. Its amino acid sequence is shown in SEQ ID NO:53.
[0246] The sequence used for CRISPR knock-in contains the following elements: a 5' homologous arm (5'HA), an MND promoter sequence, the gene to be inserted (STAR or CAR coding sequence), a PolyA sequence, and a 3' homologous arm (3'HA).
[0247] In this experiment, a STAR structure was inserted at the TRAC site. The 5'HA for homologous recombination contained the nucleotide sequence shown in SEQ ID NO:18, and the 3'HA contained the nucleotide sequence shown in SEQ ID NO:19. The MND promoter contained the nucleotide sequence shown in SEQ ID NO:20.
[0248] The above knock-in sequence was integrated between the 5' and 3' LTR sequences of the AAV6 vector to obtain vectors TRAC-MND-FMC63-STAR, TRAC-MND-GC33-STAR, and TRAC-MND-FMC63-28Z CAR, which were then packaged into AAV6 virus according to the instructions provided by the supplier (Guangzhou Paizhen Biotechnology Co., Ltd.).
[0249] The constructed AAV viral vectors are shown in the table below:
[0250] 2.2. Construction of STAR / CAR-Lenti expression vector
[0251] The coding nucleic acid sequence of the STAR or CAR structure described in section 2.1 above was commercially synthesized and assembled, and then inserted into a lentiviral vector using homologous recombination, with the MND promoter as the promoter.
[0252] Lentix-293T cells were divided into groups of 5 × 10 5Inoculate cells / mL into 10cm culture dishes and transfect when the cell density reaches about 80%. The ratio of the four plasmids is PMD2.G:PRSV-Rev:PMDlg:transfer plamid = 1:1:2:4. The volume-to-mass ratio of PEI-Max to plasmid is 3:1. Change the medium after 12-16 hours and collect the virus solution after 48 hours and 72 hours.
[0253] The virus was serially diluted 10-fold in 96-well plates, and then Jurkat-C5 cells with TCR knockout were incubated at 1.5 × 10⁻⁶ wells. 5 Virus cells / mL were added to the wells, centrifuged at 32°C and 1500 rpm for 90 min, and incubated for 72 h. Infection efficiency was measured by flow cytometry. Wells with infection rates between 2-30% were selected for titer calculation. Titrate (TU / mL) = 1.5 × 10⁻⁶. 4 × Positive rate ÷ Viral volume (μL) × 1000.
[0254] The constructed lentiviral vectors are shown in the table below:
[0255] Example 3: sgRNA design and screening
[0256] 3.1. Design of sgRNA
[0257] References (Xu et al., 2019, Cell Stem Cell 24, 566–578) were used, and the CHOPCHOP online tool (https: / / chopchop.rc.fas.harvard.edu) was used to input the specified sequence into the exon region of the target gene. The algorithm scored and screened the sequence to obtain efficient single-stranded guide RNA (gRNA) sequences with low off-target risk, which were then directly used for the construction and validation of the subsequent CRISPR system.
[0258] Based on the “NGG” characteristic in the target gene sequences, multiple sets of sgRNA sequences were designed to target the DNA sequences of HLA-A, HLA-B, HLA-AB genes (Tables 1-3), CIITA gene (Table 4), and TRAC gene (Table 5).
[0259] Based on the target DNA sequences listed in Tables 1-5, sgRNA sequences were designed and synthesized. Each sgRNA in this application consists of a 5' targeting fragment and a 3' Cas binding fragment. The 5' targeting fragment is complementary to the target site in the genome and is otherwise identical to the 20 nucleotide sequence upstream of the PAM sequence NGG (i.e., the target DNA sequence in Table 1), except that all thymine (T) is replaced by uracil (U). The 3' Cas binding fragment is a shared motif with the following nucleotide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGUGCUUUU (SEQ ID NO:23). Taking the PD-1-targeting sgRNA as an example, the 5' target DNA sequence, except that T is replaced by U, has the sequence CGACTGGCCAGGGCGCCTGT (SEQ ID NO:49), with its 3' end linked to the shared motif SEQ ID NO:23.
[0260] It should be noted that each sgRNA in this embodiment has undergone chemical modification, specifically the addition of thio and 2'-O-methyl modifications to the first three bases at the 3' and 5' ends.
[0261] Unless otherwise stated, all sgRNA sequences transformed from target DNA sequences (Tables 1-5) were synthesized according to the rules described above, and the sgRNAs were prepared by chemical synthesis.
[0262] Table 1. Target gene (HLA-A) and target DNA sequence
[0263] Table 2. Target gene (HLA-B) and target DNA sequence
[0264] Table 3. Target gene (HLA-AB) and target DNA sequence
[0265] Table 4. Target gene (CIITA) and target DNA sequence
[0266] Table 5. Target genes TRAC, FADD, and PD-1 and target DNA sequences
[0267] 3.2. sgRNA screening and gene knockout efficiency detection
[0268] This experiment uses electroporation knockout assays to detect single-gene knockout efficiency and screen for suitable sgRNAs for each gene.
[0269] Preparation of target gene RNP
[0270] RNP (Ribonucleoprotein, a ribonucleoprotein complex, whose main component is the prepared Cas9 protein (commercial Cas9: TrueCut)) TM Cas9 Protein v2 (Invitrogen) TM (Catalyst A36499) and the complex formed with the target gene sgRNA. See section 3.1. sgRNA design for the synthesis and preparation of the corresponding target gene sgRNA, where the selection of target genes is shown in Table 1-5. The amount of Cas9 protein used was 30 pmol, and the amount of sgRNA used was 60 pmol.
[0271] Knockout Experiment
[0272] First, PBMCs were isolated and T cells were activated, then cultured in T-VIVO medium. Electroporation was performed on the third day after culture. RNPs were first incubated at 37°C for 20 minutes to form. 1×10⁻⁶ cells were then used. 6 T cells, isolated and activated (cultured in T-VIVO medium for 3 days), were centrifuged and resuspended in 20 μL of electroporation buffer. These cells were then co-transferred to an electroporation cuvette with the aforementioned RNP mixture and electroporated using the Lonza EO115 electroporation program. After electroporation, the cells were transferred to preheated medium for further culture. Cell viability and target gene knockout efficiency were assessed by flow cytometry on day 3 post-electroporation.
[0273] Experimental results
[0274] (1) Figure 1 shows that among the gHLA-A series, gHLA-A, gHLA-A-1, and gHLA-A-5 have high knockout efficiency for hHLA-A24-AF647, while gHLA-A-5 cells have poor viability and may have off-target effects on HLA-I. Finally, gHLA-A was determined to be the ideal gRNA to target all HLA-A alleles.
[0275] (2) Figure 2 shows that among the gHLA-B series, gHLA-B-1 and gHLA-B-2 gRNA have a high knockout efficiency of hHLA-B07-APC, greater than 80%, and no obvious off-target effect on other HLA I (indicators in the figure are HLA-ABC). gHLA-B-1 with higher knockout efficiency is preferred.
[0276] (3) Figure 3 shows that among the gHLA-A / B series, gHLA-A / B-5 and gHLA-A / B-15 gRNAs have high knockout efficiency for HLA-A (HLA-A in the figure is HLA-A03) and HLA-B, but gHLA-A / B-15 and gHLA-A / B-17 gRNAs have low cellular activity. gHLA-A / B-5 is a candidate gRNA targeting HLA-A / B.
[0277] (4) CIITA regulates HLAII expression. HLAII expression is upregulated after T cell activation, and is further upregulated upon T cell re-stimulation. HLAII expression is positively correlated with CIITA knockout efficiency; therefore, HLAII positivity rate and CIITA indel% can be used to reflect CIITA knockout efficiency. As shown in Figures 4 and 5, the gCIITA-11 sequence has the lowest HLA-DP / DQ / DR expression level and the highest knockout efficiency, followed by the gCIITA-1 and gCIITA-6 sequences. The cell viability and amplification of the gCIITA-11 and gCIITA-1 sequences are similar. Both gCIITA-11 and gCIITA-1 are considered candidate sequences.
[0278] Example 4: Selection of AAV electro-optical targeted integration and knockout strategy and kill verification
[0279] 4.1 Construction of CD19-STAR expression vector and packaging of AAV vector
[0280] The VH and VL sequences of the CD19-specific mouse monoclonal antibody (clone number FMC63) are given, wherein the amino acid sequence of FMC63-VH is SEQ ID NO:21, and the amino acid sequence of FMC63-VL is SEQ ID NO:22. AAV virus construction and packaging are described in Example 2.
[0281] 4.2 Screening Experiment of AAV Electroporation-Based Targeted Integration and Knockout Strategy
[0282] 1) Screening Experiment 1 for AAV Electroporation-Based Targeted Integration and Knockout Strategy
[0283] To determine the optimal target gene knockout strategy, the target gene knockout strategy grouping experiment was designed as shown in Table 6, including: Cas9 protein dosage, Cas9:gRNA ratio, etc.
[0284] Table 6. Gene grouping under different knockout strategies (A)
[0285] Preparation of general-purpose STAR-T
[0286] First, PBMCs were isolated and T cells were activated, and then cultured in T-VIVO medium.
[0287] Prepare the electroporation buffer and RNP, mix thoroughly, and incubate at 37°C for 20 minutes. Centrifuge the activated PBMC cells at 90g for 10 minutes, resuspend in PBS and count. Centrifuge according to the required number of cells, resuspend in the electroporation buffer, and then begin electroporation.
[0288] After electroporation, 100 μL of preheated culture medium was added to each electroporation cuvette. The cells were then transferred to 6-well or 48-well plates. After approximately 10 minutes, AAV virus (TRAC-CD19 STAR-AAV virus, see Section 2.1 of Example 2) was added and the plates were placed in an incubator for culture. At different culture time points, appropriate amounts of cells were taken for flow cytometry to detect the knockout efficiency of relevant genes.
[0289] hTCR-a / β negative cells were enriched, and the obtained START cells were centrifuged and incubated, washed and centrifuged again, and hTCR positive cells were detected. The total number of cells that could be incubated determined the amount of TCR-a / β biotin used. Cells were washed with TCR-a / β biotin and anti-biotin reagent, and incubated for 30 min. Cells were cultured for 2 days after TCR-a / β negative selection. A suitable amount of purified cells was used for flow cytometry to detect STAR positivity rate, hTCR expression, cell viability, and gene knockout efficiency. The experimental results (Figures 6 and 7) show that, among the gene editing combination strategies, the knockout strategy gTRAC+gPD-1+gHLA-A / B-5 is superior to the gTRAC+gPD-1+gHLA-A+gHLA-B-1 strategy in terms of D10 cell viability, cell proliferation capacity, STAR knock-in efficiency, and STAR cell function. The cell viability of the TRAC and PD-1 double knockout (gTRAC+gPD-1) is similar to that of the negative control group (NC), but the cell viability gradually decreases with the increase of the number of knockout genes. Although splitting the common gRNA of HLA-A / B into gHLA-A and gHLA-B for separate knockout can improve the HLA-A knockout efficiency, it leads to a decrease in cell viability. Specific knock-in (KI) and knockout (KO) data are shown in Table 7.
[0290] Table 7 Knock-in (KI) and Knock-out (KO) Data
[0291] 2) Screening Experiment 2 on AAV Electroporation Site-Specific Integration Knockout Strategy
[0292] To determine the optimal target genes for gene knockout and knock-in, the target gene knockout strategy grouping experiment was designed as shown in Table 8, including: Cas9 protein dosage, Cas9:gRNA ratio, etc.
[0293] Table 8. Gene groupings under different knockout strategies (B)
[0294] Preparation of general-purpose STAR-T
[0295] See section 4.2 for details on preparing universal STAR-T cells and detecting STAR positivity rate, hTCR expression, cell viability, and gene knockout efficiency by flow cytometry.
[0296] The experimental results are shown in Figures 8 and 9. Among different multi-gene editing combinations, the CIITA-related four-gene combination (gTRAC+gHLA-A / B-5+gCIITA+gPD-1) and the three-gene combination (gTRAC+gHLA-A / B-5+gCIITA) showed consistent and ideal cell activity, while the FADD-related combination (gTRAC+gHLA-A / B-5+gFADD and the four-gene combination with added gPD-1) showed the worst cell activity. Considering cell expansion, knockout efficiency, and STAR knock-in efficiency, this invention preferentially selects the CIITA combination of three gRNAs and four genes (gTRAC+gHLA-A / B-5+gCIITA) or four gRNAs and five genes (gTRAC+gHLA-A / B-5+gCIITA+gPD-1) editing strategy as a universal cell therapy protocol for subsequent AAV electroporation-mediated TRAC site-specific knock-in. Specific knock-in (KI) and knockout (KO) results are shown in Table 9 below.
[0297] Table 9 Knock-in (KI) and Knock-out (KO) Data
[0298] 4.3. NALM6 target cell stimulation for in vitro expansion of STAR-T cells
[0299] Prepare T cells with TRAC+HLA-A / B+CIITA or TRAC+HLA-A / B+PD-1+CIITA knockout and TRAC-targeted STAR injection as described above.
[0300] The STAR-T cell expansion performance under two editing strategies—TRAC+HLA-A / B+CIITA or TRAC+HLA-A / B+PD-1+CIITA—was evaluated using NALM6 target cell co-culture stimulation: TRAC- / HLA-A- / HLA-B- / CIITA- / anti-CD19 STAR + Cells (CIITA group) and TRAC- / HLA-A- / HLA-B- / CIITA- / PD-1- / anti-CD19 STAR +The cells were referred to as the CIITA+PD-1 group. As shown in Figure 10, there was no statistically significant difference in the in vitro expansion capacity and cell viability between the two groups of STAR-T cells. After stimulation with NALM6 target cells at a 1:1 E:T ratio on days 2, 4, and 8, there was no significant difference in STAR-T cell expansion between the two groups, confirming that PD-1 knockout did not affect the core expansion potential of STAR-T cells.
[0301] 4.4. Validation of NALM6 target cell killing and factor secretion in vitro
[0302] The inventors have established a highly sensitive in vitro killing assessment model based on a luciferase reporter system. The principle is that luciferase activity is linearly correlated with cell number; by adding a substrate and detecting the luminescence value, the survival rate of target cells can be quantified, thereby accurately characterizing the killing function of STAR-T cells. The experiment used the NALM6 cell line (NALM6-LUC-GFP) stably expressing the luciferase-green fluorescent protein fusion gene (LUC-GFP) as a target to evaluate TRAC- / HLA-A- / HLA-B- / CIITA- / anti-CD19 STAR-T cells. + (abbreviated as CIITA group) and TRAC- / HLA-A- / HLA-B- / CIITA- / PD-1- / anti-CD19 STAR + The killing efficacy of (CIITA+PD-1 group) was compared with that of unedited T cells (MOCK-T) as a control. The results are shown in Figure 11.
[0303] Short-term killing and factor secretion experiment: 2×10 5 NALM6-LUC-GFP target cells were seeded in 24-well plates, and two types of STAR-T cells were added at E:T ratios of 0.3:1, 0.1:1, and 0.03:1 (total volume 1 mL) for co-culture. Luciferase activity was measured after 24 hours (Promega kit), and the killing efficiency was calculated (formula: 1 - experimental group RLU / control group RLU × 100%). The CIITA+PD-1 group showed a trend towards increased killing rate and IL-2, TNFα, and IFNγ secretion at 24 hours compared to the CIITA group.
[0304] Continuous killing and factor secretion experiment: 1×10 6NALM6-LUC-GFP target cells were seeded in 6-well plates, and two types of STAR-T cells were added at E:T ratios of 0.3:1 and 1:1 (total volume 3 mL) for co-culture. Every 48 h, the same volume of STAR-T cell samples were transferred to newly seeded target cell wells for the next round of killing. A control well (NE well) with no effector cells was included in each round until the killing rate was <20%. There was no significant difference in the continuous killing ability of the CIITA+PD-1 group and the CIITA group in terms of IFNγ secretion under continuous target cell stimulation.
[0305] Factor secretion ELISA detection: Following the above-mentioned killing assay, T cells were co-cultured with NALM6-LUC-GFP target cells, and the supernatant was collected. The secretion levels of IFN-γ, IL-2, and TNF-α were detected by ELISA. The TNF-α, IFN-γ, and IL-2 ELISA kits used were the Human IL-2 Uncoated ELISA, Human TNF-α Uncoated ELISA, and Human IFN-γ Uncoated ELISA (catalog numbers 88-7025, 88-7346, and 88-7316, respectively). The specific steps were as follows: 10× Coating Buffer was diluted to 1× with ddH2O, the coating antibody (250×) was added, and after mixing, 100 μL was added to each well of a 96-well plate (ELISA specific). After sealing with plastic wrap, incubate overnight at 4°C. Wash three times with 1×PBST (also known as Wash Buffer, 1×PBS with 0.05% Tween 20), 260 μL / well each time. Dilute 5×ELISA / ELISPOT Diluent to 1× with ddH2O, add 200 μL / well to a 96-well plate, and incubate at room temperature for 1 hour. Wash once with PBST, and dilute the standard curves (ranges: 2–250, 4–500, 4–500). Dilute the samples 20–50 times with 1×Diluent. Add 100 μL of sample and standard curve to each well, in duplicate. Incubate at room temperature for 2 h, then wash three times with PBST. Add 1×Diluent diluted detection antibody and incubate for 1 h. Wash three times with PBST, then add 1×Diluent diluted HRP and incubate for 30 min. Wash six times, add TMB for color development (no more than 15 min), and stop the reaction with 2N H2SO4. Detect the light absorption at 450 nm.
[0306] 4.5. NALM6 target cell stimulation of STAR-T cell phenotype detection
[0307] This experiment used four rounds of continuous target cell stimulation to systematically evaluate the differentiation lineage and dynamic expression of immune checkpoints in STAR-T cells under two editing strategies using flow cytometry. Key findings are as follows: In the CIITA editing group (TRAC- / HLA-A- / HLA-B- / CIITA-) and the PD-1 co-editing group (TRAC- / HLA-A- / HLA-B- / CIITA- / PD-1-), there were no significant differences in the proportions of NS (naive, stem cell-like memory T cells Tscm), central memory T cells Tcm, effector T cells Tte, and effector memory T cells Tem, confirming that PD-1 gene deletion did not interfere with T cell differentiation homeostasis (Figure 12A). More notably, after multiple rounds of antigen stimulation, the PD-1 membrane protein expression level in the PD-1 editing group remained at a low level and was not upregulated by activation signals, indicating that CRISPR-mediated gene knockout achieved permanent silencing of this checkpoint pathway (Figure 12B).
[0308] 4.6. In vivo functional validation of NALM6 target cells in mice
[0309] This experiment further constructed an in vivo NCG-immunodeficient mouse model using NALM6-LUC-GFP fluorescently labeled CD19-positive tumor cells to thoroughly verify the in vivo antitumor efficacy and biosafety of STAR-T cells under two gene editing strategies: TRAC- / HLA-A- / HLA-B- / CIITA- and TRAC- / HLA-A- / HLA-B- / CIITA- / PD-1-. The specific procedure was as follows: a NALM6-LUC-GFP mouse tumor model was established via intravenous infusion, and 1.8 × 10⁻⁶ cells were injected via tail vein on day 8 post-tumor implantation. 6 Two doses of CD19-specific STAR-T cells (with unedited MOCK-T cells as a control) were used to dynamically monitor the intensity of bioluminescent signals using an in vivo imaging system to quantify tumor burden, while simultaneously recording changes in animal body weight and clinical manifestations to assess potential toxicity.
[0310] Experimental results (Figures 13 and 14) showed that STAR-T cells using both editing strategies significantly inhibited tumor progression. In vivo imaging revealed a sharp decrease in fluorescence signal intensity in the treatment group compared to the control group. Furthermore, mouse body weight remained stable in all groups during treatment, and no graft-versus-host disease or systemic inflammatory reactions or other safety risks were observed. Simultaneously, the in vivo expansion kinetics and CD8+ of STAR-T cells in both groups were also observed. + The proportion of T cell subsets did not show statistical differences, which fully confirms that the co-knockout of the PD-1 gene does not introduce new safety risks while maintaining equivalent anti-tumor activity, providing solid preclinical evidence for clinical translation.
[0311] 4.7. In vitro killing function of B cells in SLE patients
[0312] The ability of TRAC- / HLA-A- / HLA-B- / CIITA- / anti-CD19 STAR+ cells and TRAC- / HLA-A- / HLA-B- / CIITA- / PD- / anti-CD19 STAR+ cells to kill B cells in SLE patients was evaluated using the SLE patient B cell killing assay, to verify the effect of the two knockout strategies of STAR-T on B cell killing in SLE patients.
[0313] Luciferase is a common substance used in cell function research. Enzyme activity is determined by adding a luciferase substrate to a system, and luciferase activity is closely related to the expression and binding strength of the target gene, as well as the number of cells. In this invention, a target cell line stably expressing luciferase is established, and the amount of luciferase is used to indicate the number of target cells, thereby indicating the cytotoxic function of functional cells.
[0314] To investigate the cytotoxic effect of CD19 STAR-T on autoimmune cells (such as SLE systemic lupus erythematosus cells), the expression of CD19 antigen in the SLE B cell line was detected by flow cytometry. Specific experimental and validation results are as follows.
[0315] Peripheral blood was obtained from SLE patients, PBMCs were isolated from the peripheral blood, and B cells were obtained by sorting using the EasySep Human B isolation kit. The target cells were then stained with 5uM CFSE.
[0316] In the experiment, CD19-STAR obtained from the two knockout protocols was expressed in T cells, with B cells and uninfected STAR-T cells (NC+B) used as controls. CD19-STAR-T cells and uninfected STAR-T cells (NC) were revived 24 hours in advance, with B cells and uninfected STAR-T (NC) cells used as controls. SLE was selected as the target cell line, and cells were seeded in 96-well plates at a density of 1E4 / well / 200µl. STAR-positive T cells were co-cultured with SLE B cells at a ratio of 3:1 or 1:1. Uninfected STAR-T (NC) cells were co-cultured with SLE B cells in the same number as the total number of STAR-T cells, with a co-culture volume of 1mL for 6 hours. The killing efficiency of STAR-T cells against target cells was calculated. CD19-STAR specifically killed SLE B cells.
[0317] The results of the in vitro killing experiment are shown in Figure 15. As shown in Figure 15, STAR-T cells obtained by TRAC+HLA-A / B+CIITA and TRAC+HLA-A / B+PD-1+CIITA knockout both exhibited strong killing ability against target cells SLE B cells.
[0318] Example 5: Comparative Verification of AAV Vector and Lenti Vector in the Preparation of Allogeneic STAR-T
[0319] 5.1. Construction of CD19-STAR vector
[0320] The VH and VL sequences of the CD19-specific mouse monoclonal antibody (clone number FMC63) are shown, with the amino acid sequence of FMC63-VH being SEQ ID NO:21 and the amino acid sequence of FMC63-VL being SEQ ID NO:22. AAV virus and lentivirus construction and packaging are described in Example 2. Vector structures are shown in Table 10.
[0321] Table 10. AAV / Lenti expression vector of FMC63 STAR
[0322] 5.2. Preparation of CD19-STAR T cells
[0323] CD19-STAR-T prepared by AAV electrospinning with TRAC site-specific insertion
[0324] Referring to Example 4.2, STAR was inserted into the TRAC gene at a specific site, and HLA-A, HLA-B, CIITA, and PD-1 were further knocked out to prepare universal STAR-T cells. Flow cytometry was used to detect STAR positivity rate, hTCR expression, cell viability, and gene knockout efficiency.
[0325] Universal CD19-STAR-T was prepared using the lentivirus Lenti under CRISPR-Cas9 electroporation editing conditions.
[0326] First, PBMCs were isolated and activated to form T cells, which were then cultured in T-VIVO medium for one day. The next day, the cultured T cells were infected with lentivirus (TRAC-CD19-STAR-Lenti) with an MOI of 4, and cultured for three days.
[0327] Prepare electroporation buffer and RNP (knockout TRAC, HLA-AB, CIITA, PD-1), mix thoroughly, and incubate at 37°C for 20 minutes. Centrifuge the activated PBMC cells at 90g for 10 minutes, resuspend in PBS, count, centrifuge according to the required cell number, resuspend in electroporation buffer, and then begin electroporation.
[0328] After electroporation, 100 μL of preheated culture medium was added to each electroporation cuvette. Cells were then transferred to 6-well or 48-well plates, and lentivirus (TRAC-CD19-STAR-Lenti) was added after approximately 10 minutes. The plates were then incubated. At different culture time points, appropriate amounts of cells were taken for flow cytometry analysis to detect the knockout efficiency of relevant genes.
[0329] 5.3. CD19-STAR T-cell infection detection
[0330] STAR-T cells prepared from AAV or lentivirus were collected and specifically fluorescently labeled with FMC63 monoclonal antibody targeting CD19. Cells were then analyzed using a multi-laser flow cytometer (BD Fortesca). TM The antibody binding signal was detected; when a significantly shifted independent positive cell population was observed in the flow cytometry scatter plot, it was confirmed that the STAR engineered receptor had been successfully expressed on the surface of PBMC cell membranes.
[0331] As shown in Figure 16, the FMC63 antibody-bound fluorescence signal intensity of the TRAC site-specific integrated CD19-STAR-T cells (TRAC-CD19-STAR-AAV) prepared based on AAV is significantly higher than that of cell products prepared by traditional lentiviral random integration vectors (TRAC-CD19-STAR-Lenti). More importantly, the homologous recombination mechanism unique to AAV vectors can precisely guide the CD19-STAR expression cassette to insert into the TRAC locus, fundamentally avoiding positional variation and resulting in highly uniform STAR receptor expression in the cell population. In contrast, the random integration characteristics of lentiviral vectors lead to increased dispersion in expression levels. This difference confirms the core advantage of the site-specific integration strategy in improving the homogenization of engineered T cell products.
[0332] 5.4. In vitro lethality test results
[0333] This experiment used the NALM6 cell line (NALM6-LUC-GFP) stably expressing the luciferase-green fluorescent protein fusion gene (LUC-GFP) as a target to evaluate the killing efficacy of T cells prepared by TRAC-CD19-STAR-AAV relative to T cells prepared by TRAC-CD19-STAR-Lenti, with unedited T cells (MOCK-T) as a control.
[0334] In the short-term lethality experiment, 2×10 5NALM6-LUC-GFP target cells were seeded in 24-well plates and co-cultured with two types of STAR-T cells at E:T ratios of 1:1, 0.3:1, and 0.1:1 (total volume 1 mL). After 24 hours, luciferase activity was measured (Promega kit) and the killing efficiency was calculated (formula: 1 - experimental group RLU / control group RLU × 100%).
[0335] Continuous lethality experiment: 1×10 6 NALM6-LUC-GFP target cells were seeded in 6-well plates, and two types of STAR-T cells were added at E:T ratios of 0.3:1 and 1:1 (total volume 3 mL) for co-culture. Every 48 h, the same volume of STAR-T cell samples were taken and transferred to newly seeded target cell wells for the next round of killing. Each round included a control well (NE well) with no effector cells until the killing rate was <20%.
[0336] The results of the in vitro killing experiment are shown in Figure 17. The above-mentioned target cells TRAC-CD19-STAR-AAV showed better specific killing and specific recognition compared to TRAC-CD19-STAR-Lenti. The AAV electroporation process showed stronger short-term (Figure 17A) and continuous killing (Figure 17B) capabilities compared to the Lenti electroporation process.
[0337] Example 6: Functional Verification of Allogeneic TRAC-STAR-AAV and Allogeneic TRAC-CAR-AAV
[0338] 6.1. Construction of CD19-STAR / CAR vector
[0339] The construction and packaging of CD19-STAR AAV virus are described in Example 2. CD19-CAR AAV virus was constructed similarly, except that STAR was replaced with CAR. The amino acid sequence of CD19-CAR is shown in SEQ ID NO:53. The vector structure is shown in Figure 11.
[0340] Table 11. AAV expression vectors for FMC63 STAR / CAR
[0341] 6.2 Preparation of CD19-STAR / CAR T cells
[0342] CD19-STAR / CAR T cells were prepared by electroporation of AAV to target TRAC insertion sites, as described in Section 4.2 of the Examples. STAR-T (TRAC-STAR-AAV) and CAR-T (TRAC-CAR-AAV) were prepared, and TRAC, HLA-A, HLA-B, CIITA, and PD-1 were knocked out. Flow cytometry was used to detect STAR positivity rate, hTCR expression, cell viability, and gene knockout efficiency.
[0343] 6.3 CD19-STAR / CAR T infection efficiency assay
[0344] After infecting T cells with the above vector and culturing them for one week, the expression levels of STAR and FMC63 on the cells were detected by flow cytometry. APC-antiFMC63 antibody staining was used to detect the membrane expression ratio of the CAR structure FMC63, BV421-anti mTCRβ antibody staining was used to detect the membrane expression efficiency of the STAR structure, and FITC-anti-human CD3 was used to detect the TRAC knockout efficiency. As shown in Figure 18, both FMC63STAR and CAR prepared by AAV electroporation exhibited good membrane expression and TRAC knockout efficiency. Table 12 shows the gene knock-in (KI) and knockout (KO) efficiencies.
[0345] Table 12 Knock-in (KI) and Knock-out (KO) Data
[0346] 6.4. Validation of External Killing Function
[0347] In the short-term killing experiment, NALM6-LUC-GFP target cells were constructed and grown at a rate of 4 × 10⁻⁶ cells / year. 5 The cells were seeded at a density of 1 mL in a 24-well plate. STAR-T cells were added to the target cells at ratios of 0.3:1, 0.1:1, and 0.03:1, respectively. The co-culture volume was 1 mL. After 6 hours and 24 hours of co-culture, the co-cultured cell suspension was collected, and the LUC luminescence value was detected using a luciferase reporter gene assay kit to calculate the killing efficiency of STAR-T cells against the target cells.
[0348] Continuous killing experiment: (1) NALM6-LUC-GFP target cells 1×10 6 / The cells were seeded in a 6-well plate. STAR-T or CAR-T cells were added to the target cell wells at an effector-target ratio of 0.3:1 for STAR / CAR positive T cells to target cells, and the co-culture volume was 3 mL. (2) Every 2 days, the co-cultured cell suspension was taken and the LUC luminescence value was detected using a luciferase reporter gene assay kit. The killing efficiency of STAR-T / CAR-T cells on target cells was calculated. (3) 2 mL of cells of the same volume were taken from each group and repeatedly stimulated with 1 mL of 2E6 target cells (NE was updated each time) to perform a new round of killing detection until no cells were killed and the experiment was terminated.
[0349] The results of the in vitro killing experiment are shown in Figure 19. TRAC-CD19-STAR-AAV T cells prepared by AAV electroporation exhibit higher killing efficiency compared to TRAC-CD19-CAR-AAV T cells. Specifically, by utilizing AAV electroporation to target TRAC integration, allogeneic STAR (TRAC-CD19-STAR-AAV) T cells demonstrate a greater short-term (6-hour) killing advantage compared to allogeneic CAR (TRAC-CD19-CAR-AAV) T cells. Under the same effector-to-target ratio, allogeneic STAR (TRAC-CD19-STAR-AAV) T cells show a greater advantage in continuous killing than allogeneic CAR (TRAC-CD19-CAR-AAV) T cells.
[0350] 6.5. Allogeneic CD19-STAR / CAR T cell secretion in vitro
[0351] In the above-mentioned killing assay, T cells were co-cultured with NALM6-LUC-GFP cells, and the supernatant was collected at 6 h and 24 h. The secretion levels of IFN-γ, IL-2, and TNF-α were detected by ELISA. In the continuous killing assay, the supernatant of co-cultured cells was collected from the wells at 48 h in the 7th round to detect the number of STAR-T / CAR-T cells in the wells.
[0352] During T cell activation, a large number of cytokines are released to help T cells kill target cells or promote T cell proliferation. Common cytokines include TNF-α, IFN-γ, and IL-2. After T cells are stimulated by target cells or antigens, they are collected, centrifuged, and the supernatant is collected. The TNF-α, IFN-γ, and IL-2 ELISA kits used are Human IL-2 Uncoated ELISA, Human TNF-α Uncoated ELISA, and Human IFN-γ Uncoated ELISA (catalog numbers 88-7025, 88-7346, and 88-7316, respectively). The specific steps are as follows: Dilute 10× Coating Buffer to 1× with ddH2O, add coating antibody (250×), mix well, and then add 100 μL / well to a 96-well plate (ELISA specific). After sealing with plastic wrap, incubate overnight at 4°C. Wash three times with 1×PBST (also known as Wash Buffer, 1×PBS with 0.05% Tween 20), 260 μL / well each time. Dilute 5×ELISA / ELISPOT Diluent to 1× with ddH2O, add 200 μL / well to a 96-well plate, and incubate at room temperature for 1 hour. Wash once with PBST, and dilute the standard curves (ranges: 2–250, 4–500, 4–500). Dilute the samples 20–50 times with 1×Diluent. Add 100 μL of sample and standard curve to each well, in duplicate. Incubate at room temperature for 2 h, then wash three times with PBST. Add 1×Diluent diluted detection antibody and incubate for 1 h. Wash three times with PBST, then add 1×Diluent diluted HRP and incubate for 30 min. Wash six times, add TMB for color development (no more than 15 min), and stop the reaction with 2N H2SO4. Detect the light absorption at 450 nm.
[0353] As shown in Figure 20, co-culturing T cells with NALM6-LUC-GFP target cells significantly stimulated T cells to secrete IL-2, TNF-α, and IFNγ. The secretion levels of cytokines IL-2, IFN-γ, and TNF-α were all higher in allogeneic STAR (TRAC-CD19-STAR-AAV) cells than in allogeneic CAR (TRAC-CD19-CAR-AAV) cells. The advantage of allogeneic STAR (TRAC-CD19-STAR-AAV) cells was more pronounced at 24 hours. After 48 hours of continuous killing at an effector-to-target ratio of 0.3:1, the number of STAR-T / CAT-T cells in the co-culture wells showed that the number of allogeneic STAR (TRAC-CD19-STAR-AAV) cells was significantly higher than that of allogeneic CAR (TRAC-CD19-CAR-AAV) cells.
[0354] Example 7: Functional validation of allogeneic STAR-T (TRAC-CD19-STAR-AAV) and autologous STAR-T cells (CD19-STAR-Lenti)
[0355] 7.1. Construction of CD19 STAR / CAR vectors
[0356] The AAV virus TRAC-CD19-STAR-AAV and the lentiviruses CD19-STAR-Lenti and CD19-CAR-Lenti were constructed as described in Example 2.
[0357] 7.2. Preparation of CD19-STAR / CAR T cells
[0358] Preparation of CD19-STAR-T using AAV electro-transfer TRAC site-specific insertion
[0359] Referring to Section 4.2 of the Examples, universal allogeneic STAR-T cells (TRAC-CD19-STAR-AAV) were prepared, and flow cytometry was used to detect STAR positivity, hTCR expression, cell viability, and gene knockout efficiency. CD19-STAR-T and CD19-CAR-T cells were prepared using the lentivirus Lenti.
[0360] Primary T cells were obtained using the Ficoll isolation method and cultured in X-VIVO medium containing IL-7, IL-15, and IL-21 at an initial culture density of 1×10⁶ cells / year. 6 / mL was added to pre-coated CD3, CD28, and Fibronectin plates for activation. After 24 hours of activation, lentiviruses CD19-STAR-Lenti and CD19-CAR-Lenti were added, centrifuged at 1500 rpm for 90 minutes, and incubated in a CO2 incubator. After 24 hours of infection, X-VIVO medium containing IL-7, IL-15, and IL-21 was added and the medium was rotated into wells. Subculture was performed every 1-2 days thereafter.
[0361] 7.3 Detection of CD19-STAR / CAR-Lenti infection efficiency and membrane assay
[0362] (1) Infection detection methods
[0363] Seven days after infection, infected cells were collected and stained with the antigen or antibody corresponding to the N-terminus of STAR cells. Flow cytometry (BDFortessa) was used to detect RFP and the corresponding antigen / antibody fluorescent channels. The membrane transfer efficiency was evaluated by comparing the RFP positivity rate with the STAR antibody or antigen positivity rate. As shown in Figure 21, if there is a significant positive cell population for RFP or mTCRβ, it indicates that STAR and CAR cells have been successfully transferred into PBMCs.
[0364] (2) Measurement of membrane uptake efficiency by co-culturing T cells and target cells in vitro
[0365] The above-mentioned vector was packaged into lentivirus and used to infect T cells. During two weeks of continuous culture, the expression levels of STAR or CAR on the cells were detected by flow cytometry after APC-R19 (evaluation of STAR) and FSC-Hantibody staining. As shown in Figure 22, the detection of STAR and CAR expression by R19 indicates that TRAC-CD19-STAR-AAV, CD19-STAR-Lenti, and CD19-CAR-Lenti can be normally expressed on the membrane.
[0366] 7.4. Validation of the in vitro killing function of Sort B cells
[0367] To investigate the cytotoxic effect of CD19 STAR-T / CAR-T on target cells (e.g., SLE B cells), CD19 antigen expression in multiple systemic lupus erythematosus (SLE) patient-derived B cells (including Sort-B) was detected by luciferase and flow cytometry. Specific cytotoxic experiments and results are as follows.
[0368] (1) Construction of B cell killing system
[0369] PBMCs were isolated from 2 mL of fresh blood from normal individuals and then separated using the Easy Sephuman Bisolation kit - negative selection method to obtain B cells.
[0370] (2) In vitro killing assay of B cells
[0371] First, PBMCs from freshly collected peripheral blood were separated using Ficoll, and then B cells were obtained by magnetic bead negative selection. The purity of the separated B cells was above 95% (Figure 23A, upper left, only B). After obtaining the B cells, they were then stained with CFSE live cell dye for labeling.
[0372] T cells containing the aforementioned TRAC-CD19 STAR-AAV, CD19 STAR-Lenti, and CD19 CAR-Lenti vectors were revived 24 hours in advance, with uninfected STAR T cells (MOCK-T) serving as a control. Isolated B cells / unisolated PBMCs (Sort-B) were constructed as target cells, and the tumor cell line NALM6-LUC was used as a control target cell. Cells were seeded at a density of 5E4 cells / well. The aforementioned T cells (based on STAR-positive T cells) were co-cultured with target cells at ratios of 1:1, 3:1, and 10:1, with a volume of 1 mL. After 15 hours of co-culture, the co-cultured cell suspension was collected and stained with Anti-CD19 (PE), Annexin V (APC), and Zombieviolet (BV421) to assess the killing efficiency of STAR-T or CAR-T cells against target cells.
[0373] The chemiluminescence values of the NALM6 tumor cell line co-culture wells were detected using a multi-functional microplate reader. Luciferase killing assay: luciferase luciferase killing activity assay. Cell killing efficiency calculation: killing efficiency = 100% - (effective cells - target cell well value) / (control cells - target cell well value).
[0374] Flow cytometry assay for cell killing: After co-culturing STAR-T cells and target cells for 15 h, co-cultured cells were collected. Dead cells were pretreated with Zombieviolet (BV421), stained in the dark for 30 min, washed twice with PBS, and fixed with cell fixation solution. The cell killing efficiency of STAR-T or CAR-T cells against target cells was detected by flow cytometry. Target cell killing efficiency was calculated as: Killing efficiency = Dead + B / CFSE + B - NE(Dead + B / CFSE + B).
[0375] Figure 23B shows the results of flow cytometry analysis of Sort B cells after 15 hours. TRAC-CD19-STAR-AAV T cells showed high killing efficiency against human primary B cells, higher than CD19 STAR-T cells (CD19 STAR-lenti) prepared by lentivirus, and much higher than control CD19 CAR-T (CD19-CAR-lenti) cells, with a good dose-response relationship. Mock-T cells had no significant killing function against B cells. CD19-CAR-T (CD19 CAR-lenti) had a certain killing function against human primary B cells, but the killing efficiency did not increase with the increase of effector-target ratio. From the perspective of B cell antigen expression, the expression level of CD19 antigen was slightly downregulated after co-culturing with TRAC-CD19-STAR-AAV cells; while the expression level of CD19 on the surface of B cells was significantly downregulated after co-culturing with CD19 STAR-lenti. In particular, after co-culturing with CD19 CAR-lenti, almost no CD19 antigen was expressed on the surface of B cells. It is speculated that the reason may be that CD19 CAR-lenti has a strong cytotoxic effect, which leads to the loss of CD19 antigen on B cells, and thus CD19 CAR-lenti loses its B cell killing ability.
[0376] 7.5. Validation of NALM6 target cell killing function in vitro
[0377] Experimental objective: To evaluate the in vitro killing function of allogeneic CD19-STAR-T (TRAC-CD19-STAR-AAV) cells and autologous CD19-STAR-T (CD19 STAR-Lenti) cells using the NALM6-LUC-GFP cell in vitro killing assay.
[0378] NALM6-LUC-GFP target cells were constructed to verify the killing effect of allogeneic CD19-STAR (TRAC-CD19-STAR-AAV) T cells and autologous CD19-STAR (CD19 STAR-Lenti) T cells on tumor cells expressing the NALM6 target. Allogeneic CD19-STAR (TRAC-CD19-STAR-AAV) and autologous CD19-STAR (CD19 STAR-Lenti) expression in T cells, and uninfected STAR-positive T cells (MOCK-T) were used as controls. NALM6-LUC-GFP target cells were constructed at a ratio of 2 × 10⁻⁶ cells / cells. 5The STAR-T cells were seeded at specific densities in 24-well plates. STAR-T cells were added to target cells at ratios of 0.1:1, 0.3:1, and 1:1, with a co-culture volume of 1 mL. After 24 hours of co-culturing with NALM6 target cells, the co-cultured cell suspension was analyzed. The luciferase reporter gene assay kit was used to detect the LUC luminescence value, and the killing efficiency of STAR-T cells against target cells was calculated. As shown in Figure 24, the killing efficiency of allogeneic STAR (TRAC-CD19-STAR-AAV) T cells was significantly higher than that of STAR (CD19-STAR-Lenti) T cells in co-culturing with NALM6-LUC-GFP target cells.
[0379] 7.6. NALM6 target cell exocrine factor
[0380] In the above-mentioned killing experiment, T cells and NALM6-LUC-GFP target cells were co-cultured at a killing efficiency of 0.3:T for 24 hours, and the supernatant was collected. The secretion levels of IFN-γ, IL-2, and TNF-α were detected by ELISA.
[0381] During T cell activation, a large number of cytokines are released to help T cells kill target cells or promote T cell proliferation. Common cytokines include TNF-α, IFN-γ, and IL-2. After T cells are stimulated by target cells or antigens, they are collected, centrifuged, and the supernatant is collected. The TNF-α, IFN-γ, and IL-2 ELISA kits used are Human IL-2 Uncoated ELISA, Human TNF-α Uncoated ELISA, and Human IFN-γ Uncoated ELISA (catalog numbers 88-7025, 88-7346, and 88-7316, respectively). The specific steps are as follows: Dilute 10× Coating Buffer to 1× with ddH2O, add coating antibody (250×), mix well, and then add 100 μL / well to a 96-well plate (ELISA specific). After sealing with plastic wrap, incubate overnight at 4°C. Wash three times with 1×PBST (also known as Wash Buffer, 1×PBS with 0.05% Tween 20), 260 μL / well each time. Dilute 5×ELISA / ELISPOT Diluent to 1× with ddH2O, add 200 μL / well to a 96-well plate, and incubate at room temperature for 1 hour. Wash once with PBST, and dilute the standard curves (ranges: 2–250, 4–500, 4–500). Dilute the samples 20–50 times with 1×Diluent. Add 100 μL of sample and standard curve to each well, in duplicate. Incubate at room temperature for 2 h, then wash three times with PBST. Add 1×Diluent diluted detection antibody and incubate for 1 h. Wash three times with PBST, then add 1×Diluent diluted HRP and incubate for 30 min. Wash six times, add TMB for color development (no more than 15 min), and stop the reaction with 2N H2SO4. Detect the light absorption at 450 nm.
[0382] As shown in Figure 25, co-culturing T cells with NALM6-LUC-GFP target cells significantly stimulated T cells to secrete IL-2, TNF-α, and IFNγ. The secretion levels of cytokines IL-2, IFN-γ, and TNF-α were all higher in allogeneic STAR (TRAC-CD19-STAR-AAV) T cells than in STAR (CD19-STAR-Lenti) T cells.
[0383] 7.7 In vivo efficacy validation of NALM6 target cells in mice
[0384] This experiment constructed a CD19 fluorescently labeled NALM6-LUC-GFP. +A mouse model of NCG-immunodeficient tumor cells was established to systematically evaluate the in vivo antitumor efficacy and biosafety of allogeneic site-specific integrated CD19-STAR-T cells (TRAC-CD19-STAR-AAV) and conventional autologous random integrated CD19-STAR-T cells (CD19-STAR-Lenti). A systemic tumor model was established via intravenous infusion, and on day 8 post-tumor implantation, 2 × 10⁻⁶ cells were administered via tail vein infusion. 6 / only 4×10 6 / doses of AAV allogeneic STAR-T, Lenti autologous STAR-T, and unedited MOCK-T cells were used to monitor changes in tumor burden by dynamically quantifying bioluminescence signal intensity using an in vivo imaging system, while simultaneously recording body weight, activity status, and organ pathological indicators.
[0385] The experimental results (Figures 26 and 27) showed that both the AAV allogeneic group and the Lenti autologous group significantly inhibited tumor progression, and the in vivo imaging signal showed a sharp attenuation. Moreover, the allogeneic group showed stronger tumor clearance ability at both doses, and its fluorescence signal attenuation rate and depth were significantly better than those of the autologous group. At the same time, flow cytometry confirmed that the T cell proliferation kinetics in the AAV group were significantly improved in vivo. During the treatment period, the body weight of mice in all groups remained stable, and no signs of GvHD or abnormal liver and kidney function were observed. Histopathological analysis also showed no evidence of targeted / non-targeted toxicity. This fully verified that the allogeneic CD19-STAR-T achieved excellent anti-tumor activity while possessing excellent safety characteristics, providing key supporting data for the clinical translation of universal cell therapy.
[0386] Example 8: HVGR of allogeneic CD19 STAR-T (TRAC-CD19-STAR-AAV) products
[0387] 8.1. Detection of allogeneic CD19 STAR-T (TRAC-CD19-STAR-AAV) activation of allogeneic T cells by mixed lymphocyte reaction
[0388] To demonstrate that knocking out HLA-A / B in STAR-T cells and knocking out CIITA to downregulate HLA-DR / DQ expression can reduce the recipient T cell immune rejection response to donor STAR-T cells, an allogeneic CD19 STAR (TRAC-CD19-STAR-AAV) was used as the stimulator (S), and T cells of different HLA-I / II types were used as the responders (R) in a one-way mixed lymphocyte reaction (MLR). The CD3+T donor 1 (Miao Shun, P323070111C, HLA-A11:01; 24:02, HLA-B15:02; 40:46, HLA-C03:04; 08:01, HLA-DR04:01; 11:01, HLA-DQ03:01; 03:01, also known as CD3T1) and CD3+T donor 2 (Miao Shun, P323090511C, HLA-A02:07; 32:01, HLA-B46:01; 52:01, HLA-C01:02; 12:02, HLA-DR09:01; 15:02, HLA-DQ06:01; 03:03, also known as CD3T2) obtained by negative selection were used as the responders (R). After activating PBMC donor3 (Miaoshun, P122050702C, HLA-A 03:01; 03:01, HLA-B 07:02; 07:02, HLA-C 07:02; 07:02, HLA-DR 04:01; 14:01, HLA-DQ 05:03; 05:03), HLA-A / B knockout, CIITA knockout, endogenous TRAC knockout, and PD1 knockout were prepared. At the same time, CD19 STAR was knocked into the TRAC site at a specific site, and TRAC-CD19 STAR-AAV cells and MOCK-T cells (HLA wild type) were used as stimulator cells (S).
[0389] As shown in Figure 28A, the expression of HLA-A, HLA-B, and class II HLA in allogeneic CD19 STAR (TRAC-CD19-STAR-AAV) T cells was significantly lower than that in MOCK-T cells. Before co-culturing, the stimulating cells were treated with mitomycin C to inhibit cell division; the responding cells were stained with CFSE (5 μM) for viable cell growth. After co-culturing the stimulating and responding cells at a 1:1 S / R ratio for 3-5 days, the proportion of CFSE+ T cells was detected by flow cytometry at a fixed time and rate.
[0390] As can be seen from Figure 28B, after co-incubation with allogeneic CD19 STAR (TRAC-CD19-STAR-AAV) cells, the proportion of CFSE+ cells in CD3T1 and CD3T2, which are from two different donor sources, is lower than that in response cells co-incubated with HLA wild-type MOCK-T cells.
[0391] The results showed that knocking out HLA-A, HLA-B, and CIITA reduced the activation of allogeneic T cells and decreased the immune rejection response of recipient T cells to allogeneic CD19 STAR (TRAC-CD19-STAR-AAV) T cells.
[0392] 8.2. Detection of T cell activation of NK cells by mixed lymphocyte reaction
[0393] To demonstrate that knocking out HLA-A / B in STAR-T cells while retaining other HLA-I molecules can reduce the attack of recipient NK cells on allogeneic STAR-T (TRAC-CD19 STAR-AAV) cells, an in vitro mixed lymphocyte reaction (MLR) was performed using TRAC-CD19 STAR-AAV cells as stimulators (S) and NK cells from different donor sources as responders (R). B2M KO T cells (HLA-I knockout cells) were used as positive stimulation control cells, and MOCK-T cells (HLA-I wild-type, also known as WT) were used as negative stimulation control cells. As shown in Figure 29A, WT T cells highly expressed HLA-I, and the HLA-I positivity rate of B2M KO T cells was only 5.02%, while allogeneic STAR-T cells (TRAC-CD19 STAR-AAV) retained some HLA-I expression (positive rate of 31.5%).
[0394] First, stimulated cells were stained with CFSE (5 μM) and then co-cultured with NK response cells at S / R ratios of 1:1 and 3:1 in 3 replicates. The culture medium contained CD107a antibody (1:50, Biolegend, 328620) and the protein transport inhibitor Brefeldin A (Biolengend, 420601). After 5 hours, cells were collected and stained with the NK cell marker CD56. NK cell activity and cytotoxic activity against T response cells were then detected by flow cytometry. Lysosome-associated membrane protein-1 (CD107a or LAMP-1) is a highly glycosylated transmembrane protein found in lysosomes. At the end of NK cell degranulation, the outer membrane of the granule merges with the NK cell membrane, resulting in the exposure of CD107a molecules on the surface, which is a marker of NK cell activation. As shown in Figure 29B, when NK cells from two different donor sources were co-incubated with allogeneic STAR-T (TRAC-CD19 STAR-AAV) cells, the proportion of CD107a-positive cells was significantly lower than that in the B2M KO group. This indicates that allogeneic STAR-T (TRAC-CD19 STAR-AAV knocks out HLA-A / B in STAR-T cells while retaining other HLA-I molecules) significantly reduces NK cell activation compared to B2M KO T cells (HLA-I knockout cells).
[0395] After recognizing target cells, NK cells can directly disrupt the cell membrane and rapidly lyse the target cells by releasing cytotoxic substances such as granzymes and perforin. After 5 hours of co-culture, the cytotoxic effect of NK cells on stimulator cells (S) was assessed by flow cytometry analysis of the proportion of dead T cells to total T cells (CFSE+). As shown in Figure 29C, the cytotoxic efficiency of both types of NK cells against allogeneic STAR-T (TRAC-CD19 STAR-AAV) cells at an S / R ratio of 1:1 was significantly lower than that against B2M KO T cells. These results suggest that allogeneic STAR-T (TRAC-CD19 STAR-AAV) cells with HLA-A / B knockout but retaining other HLA-I molecules can effectively reduce recipient NK cell attack, thereby prolonging the survival time of STAR-T cells in vivo.
[0396] Example 9: GVHD of allogeneic CD19 STAR-T (TRAC-CD19-STAR-AAV) products
[0397] To verify whether TRAC-CD19 STAR-AAV cell knockout of TRAC induces GVHD toxicity, 1×10⁻⁶ cells were used to treat the cells. 7TRAC-CD19 STAR-AAV cells and lentiviral control CD19-STAR-Lenti cells were infused into NCG immunodeficient mice via tail vein to construct a non-tumor-bearing NCG mouse GVHD model.
[0398] Following T-cell inoculation, the basic survival status of mice was observed daily, and clinical scores (body weight, posture, activity, fur, skin, etc.) were assessed twice weekly based on clinical observations (see Table 13). During the experimental phase, mice in the TRAC-CD19STAR-AAV group showed normal and good health in terms of body weight, posture, activity, fur, and skin, with a clinical score of 0 and no GVHD symptoms. Mice in the CD19-STAR-Lenti group began to exhibit GVHD symptoms such as weight loss, arched back, and hair loss 21 days after T-cell infusion (Figure 30A and Table 13). Their clinical score was 7 on day 32 and 9 on days 35, 39, and 42.
[0399] Table 13 Clinical scores of NCG mice
[0400] Peripheral blood was collected from mice on days 12, 33, and 40 after T cell infusion. Flow cytometry was used to detect T cell expansion in peripheral blood. The results showed that CD19-STAR-Lenti group cells began to show typical GVHD-related nonspecific expansion on day 33 (Figures 30B and 30C). TRAC-CD19 STAR-AAV cells gradually decreased over time, showing a normal cell survival trend. Pathological analysis of inflamed skin, heart, liver, spleen, lung, kidney, stomach, intestine, brain, pancreas, and ovary tissues of mice revealed severe GVHD tissue damage in the liver, lungs, and skin of CD19-STAR-Lenti group mice, while the tissue structures of TRAC-CD19 STAR-AAV group mice were normal. This mouse model demonstrates the feasibility and safety of TRAC-CD19 STAR-AAV knockout inhibiting the GVHD response.
[0401] Example 10: Functional Verification of Allogeneic STAR-T (TRAC-GC33-STAR-AAV) and Autologous STAR-T (GC33-STAR-Lenti)
[0402] 10.1. Construction of GPC3-STAR vector
[0403] The AAV virus TRAC-GPC3-STAR-AAV and the lentivirus GPC3-STAR-Lenti were constructed as described in Example 2.
[0404] 10.2. Preparation of GPC3 STAR T cells
[0405] GPC3 STAR-T cells prepared by AAV electroporation and TRAC site-specific insertion
[0406] Referring to Section 4.2 of Example, allogeneic STAR-T (TRAC-GC33-STAR-AAV) cells were prepared. TRAC, HLA-A, HLA-B, and CIITA were knocked out. Flow cytometry was used to detect STAR positivity rate, hTCR expression, cell viability, and gene knockout efficiency.
[0407] GPC3 STAR-T cells prepared using Lenti lentivirus
[0408] Primary T cells were obtained using the Ficoll isolation method and cultured in X-VIVO medium containing IL-7, IL-15, and IL-21 at an initial culture density of 1×10⁶ cells / year. 6 / mL was added to CD3, CD28, and Fibronectin pre-coated well plates for activation. After 24 h of activation, GPC3-STAR-Lenti lentivirus was added, centrifuged at 1500 rpm for 90 min, and incubated in a CO2 incubator. After 24 h of infection, X-VIVO medium containing IL-7, IL-15, and IL-21 was added and the medium was transferred to wells. Subculture was performed every 1-2 days thereafter.
[0409] 10.3. GC33-STAR Infection Efficiency Detection
[0410] After infecting T cells with the above vector and culturing them for one week, the TRAC knockout efficiency and STAR upper membrane expression level were detected by flow cytometry. PE-anti mTCRβ antibody staining was used to detect the upper membrane expression ratio of STAR structure, and FITC-anti CD3 was used to detect TRAC knockout.
[0411] As shown in Figure 31, both the universal allogeneic STAR-T (TRAC-GC33-STAR-AAV) prepared by AAV electroporation with TRAC and the STAR-T (GC33-STAR-Lenti) prepared by lentivirus Lenti can achieve normal infection efficiency.
[0412] 10.4. GC33-STAR In Vitro Kill Function Verification
[0413] In the experiment, uninfected STAR T cells (MOCK-T) were used as a control. MKN45-LUC-GFP target cells were constructed and seeded in 24-well plates at a density of 2E5 cells / well. The aforementioned STAR-T cells were added to the target cells at STAR-positive T cell to target cell ratios of 1:1 and 3:1, respectively. The co-culture volume was 1 mL. After co-culturing for 24 hours, the co-cultured cell suspension was collected for analysis, and the killing efficiency of STAR-T cells against target cells was calculated.
[0414] The results of the in vitro killing experiment are shown in Figure 32. The target cells TRAC-GC33-STAR-AAV exhibited higher killing efficiency compared to GC33-STAR-Lenti. Therefore, the in vitro killing efficiency of GC33-STAR-AAV-KO (TRAC-GC33-STAR-AAV) prepared by AAV electroporation with TRAC site-specific insertion is superior to that of GC33-STAR-Lenti prepared using lentivirus.
[0415] Partial sequence description:
[0416] SEQ ID NO:1 Human T cell receptor α chain constant region
[0417] SEQ ID NO:2 Mouse T cell receptor α chain constant region
[0418] SEQ ID NO:3 Mouse T cell receptor α chain constant region containing cysteine substitution and hydrophobic region modification (TRAC-Cys-TM)
[0419] SEQ ID NO:4 Mouse T cell receptor α chain constant region (TRAC-Nrec-Cys-TM) containing N-terminal modification, cysteine substitution and hydrophobic modification of the transmembrane region.
[0420] SEQ ID NO:5 Mouse T cell receptor α chain homeostasis region lacking intracellular region
[0421] SEQ ID NO:6 Mouse T cell receptor α chain constant region lacking intracellular region and containing cysteine substitutions and hydrophobic regions.
[0422] SEQ ID NO:7 Mouse T cell receptor α chain constant region lacking intracellular region, containing N-terminal modification, cysteine substitution, and hydrophobic modification of the transmembrane region.
[0423] SEQ ID NO:8 Human T cell receptor β chain constant region
[0424] SEQ ID NO:9 Mouse T cell receptor β chain constant region
[0425] SEQ ID NO:10 Contains cysteine-substituted mouse T cell receptor β-chain constant region (TRBC-Cys-TM)
[0426] SEQ ID NO:11 Mouse T cell receptor β chain constant region containing N-terminal modification and cysteine substitution (TRBC-Nrecc-Cys-TM)
[0427] SEQ ID NO:12 Mouse T cell receptor β chain homeostasis region lacking intracellular region
[0428] SEQ ID NO:13 Deletion of intracellular region, containing cysteine-substituted mouse T cell receptor β chain constant region
[0429] SEQ ID NO:14 Mouse T cell receptor β chain constant region lacking intracellular region, containing N-terminal modification and cysteine substitution.
[0430] SEQ ID NO:15 OX40 intracellular domain
[0431] SEQ ID NO:16 (G4S)3 connector
[0432] SEQ ID NO:17 Furin-P2A
[0433] SEQ ID NO:18 5'HA
[0434] SEQ ID NO:19 3'HA
[0435] SEQ ID NO:20 MND promoter
[0436] SEQ ID NO:21 Anti-CD19 FMC63 VH
[0437] SEQ ID NO:22 Anti-CD19 FMC63 VL
[0438] SEQ ID NO:23 3'Cas binding fragment (sgRNA scaffold sequence)
[0439] SEQ ID NO:51 CD19-STARα chain
[0440] SEQ ID NO:52 CD19-STARβ chain
[0441] SEQ ID NO:53 CD19-CAR
[0442] SEQ ID NO:54 GC33 VH
[0443] SEQ ID NO:55 GC33 VL
[0444] SEQ ID NO:56 GPC3-STARα chain
[0445] SEQ ID NO:57 GPC3-STARβ chain
Claims
1. A modified therapeutic immune cell comprising a synthetic T-cell receptor antigen receptor (STAR), wherein one or more endogenous genes selected from at least one TCR-encoding gene, at least one immune checkpoint-encoding gene, at least one HLA-I protein or its regulatory protein-encoding gene, and at least one HLA-II protein or its regulatory protein-encoding gene are partially or completely inactivated. Preferably, one or more endogenous genes selected from TRAC, PD-1, HLA-A, HLA-B and CIITA in the therapeutic immune cells are partially or completely inactivated.
2. The therapeutic immune cells according to claim 1, wherein... i) At least one endogenous TCR-encoding gene is partially or completely inactivated, preferably, an endogenous TRAC gene is partially or completely inactivated; or ii) At least one endogenous TCR encoding gene and at least one endogenous HLA-I protein or its regulatory protein encoding gene are partially or completely inactivated; preferably, endogenous TRAC, HLA-A, and HLA-B genes are partially or completely inactivated; or iii) At least one endogenous TCR encoding gene and at least one endogenous HLA-I protein or its regulatory protein encoding gene and at least one endogenous HLA-II protein or its regulatory protein encoding gene are partially or completely inactivated; preferably, endogenous TRAC, HLA-A, HLA-B and CIITA genes are partially or completely inactivated; or iv) At least one endogenous TCR encoding gene, at least one endogenous immune checkpoint gene, at least one endogenous HLA-I protein or its regulatory protein encoding gene, and at least one endogenous HLA-II protein or its regulatory protein encoding gene are partially or completely inactivated. Preferably, endogenous TRAC, PD-1, HLA-A, HLA-B and CIITA genes are partially or completely inactivated.
3. The therapeutic immune cells according to claim 1 or 2, wherein the endogenous gene is partially or completely inactivated by introducing a mutation into the endogenous gene.
4. The therapeutic immune cells according to any one of claims 1-3, wherein the endogenous TRAC gene is partially or completely inactivated by targeting the target sequence shown in SEQ ID NO:48 using a gene editing system such as the Cas9 gene editing system; the endogenous PD-1 gene is partially or completely inactivated by targeting the target sequence shown in SEQ ID NO:49; the endogenous HLA-A gene is partially or completely inactivated by targeting one of SEQ ID NO:24-29, preferably the target sequence shown in SEQ ID NO:24; the endogenous HLA-B gene is partially or completely inactivated by targeting one of SEQ ID NO:30-35, preferably the target sequence shown in SEQ ID NO:30; the endogenous HLA-A and HLA-B genes are partially or completely inactivated by targeting one of SEQ ID NO:36-41, preferably the target sequence shown in SEQ ID NO:36; and / or the endogenous CIITA gene is partially or completely inactivated by targeting one of SEQ ID NO:42-47, preferably the target sequence shown in SEQ ID NO:
42.
5. The therapeutic immune cell according to any one of claims 1-4, wherein the therapeutic immune cell comprises an expression cassette of the STAR inserted into an endogenous TRAC locus.
6. The therapeutic immune cell of claim 5, wherein the STAR expression cassette is inserted into the endogenous TRAC locus at the position defined by SEQ ID NO:18 and SEQ ID NO:
19.
7. The therapeutic immune cell according to any one of claims 5-6, wherein the expression cassette of said STAR comprises the encoding nucleotide sequence of said STAR and an expression regulatory element, such as a promoter, operatively linked thereto.
8. The therapeutic immune cell of claim 7, wherein the promoter is the MND promoter.
9. The therapeutic immune cell according to any one of claims 5-8, wherein the expression cassette comprises a nucleotide sequence encoding a fusion protein of the α chain and β chain of the STAR linked by a self-cleaving peptide, such as the Furin-P2A polypeptide shown in SEQ ID NO:17, preferably, the encoding nucleotide sequence being operatively linked to an MND promoter.
10. The therapeutic immune cell according to any one of claims 1-9, wherein the STAR comprises an α chain and a β chain, the α chain comprising a first constant region, the β chain comprising a second constant region, and wherein the α chain and / or the β chain further comprises an antigen-binding region that specifically binds to a target antigen.
11. The therapeutic immune cell of claim 10, wherein the first constant region is a natural TCRα chain constant region, for example, a natural human TCRα chain constant region or a natural mouse TCRα chain constant region; or, the first constant region is a modified TCRα chain constant region.
12. The therapeutic immune cell of claim 10, wherein the modified TCRα chain constant region is derived from the mouse TCRα chain constant region, wherein, relative to the wild-type mouse TCRα chain constant region, the amino acid at position 48, for example threonine T, is mutated to cysteine C.
13. The therapeutic immune cell according to claim 11 or 12, wherein the modified TCRα chain constant region is derived from the mouse TCRα chain constant region, wherein, relative to the wild-type mouse TCRα chain constant region, the amino acid at position 112, such as serine S, is replaced with leucine L, the amino acid at position 114, such as methionine M, is replaced with isoleucine I, and the amino acid at position 115, such as glycine G, is replaced with valine V.
14. The therapeutic immune cell according to any one of claims 11-13, wherein the modified TCRα chain constant region is derived from the mouse TCRα chain constant region, wherein, relative to the wild-type mouse TCRα chain constant region, the amino acid at position 6, such as E, is replaced by D, the amino acid at position 13, K, is replaced by R, and the amino acids at positions 15-18 are deleted.
15. The therapeutic immune cell according to any one of claims 11-14, wherein the modified TCRα chain constant region is derived from the mouse TCRα chain constant region, wherein, relative to the wild-type mouse TCRα chain constant region, the amino acid at position 48, such as threonine (T), is mutated to cysteine (C), the amino acid at position 112, such as serine (S), is mutated to leucine (L), the amino acid at position 114, such as methionine (M), is mutated to isoleucine (I), and the amino acid at position 115, such as glycine (G), is mutated to valine (V).
16. The therapeutic immune cell according to any one of claims 11-15, wherein the modified TCRα chain constant region is derived from the mouse TCRα chain constant region, wherein, relative to the wild-type mouse TCRα chain constant region, the amino acid at position 6, such as E, is replaced by D; the amino acid at position 13, K, is replaced by R; the amino acids at positions 15-18 are deleted; the amino acid at position 48, such as threonine T, is mutated to cysteine C; the amino acid at position 112, such as serine S, is replaced by leucine L; the amino acid at position 114, such as methionine M, is replaced by isoleucine I; and the amino acid at position 115, such as glycine G, is replaced by valine V.
17. The therapeutic immune cell according to any one of claims 11-16, wherein the TCRα chain constant region is a non-intracellular region of the constant region relative to the wild-type TCRα chain constant region, for example, lacking amino acids 136-137.
18. The therapeutic immune cell according to any one of claims 11-17, wherein the modified TCRα chain constant region is derived from the mouse TCRα chain constant region, and which, relative to the wild-type mouse TCRα chain constant region, lacks the intracellular region of the constant region, for example, lacking amino acids 136-137.
19. The therapeutic immune cell according to any one of claims 11-18, wherein the modified TCRα chain constant region comprises an amino acid sequence shown in one of SEQ ID NO: 3-7.
20. The therapeutic immune cell according to any one of claims 10-19, wherein the second constant region is a natural TCRβ chain constant region, for example, a natural human TCRβ chain constant region or a natural mouse TCRβ chain constant region; or, the second constant region is a modified TCRβ chain constant region.
21. The therapeutic immune cell of claim 20, wherein the modified TCRβ chain constant region is derived from the mouse TCRβ chain constant region, wherein, relative to the wild-type mouse TCRβ chain constant region, the amino acid at position 56, for example serine S, is mutated to cysteine C.
22. The therapeutic immune cell according to claim 20 or 21, wherein the modified TCRβ chain constant region is derived from the mouse TCRβ chain constant region, wherein, relative to the wild-type mouse TCRβ chain constant region, the amino acid at position 3, such as R, is replaced by K; the amino acid at position 6, such as T, is replaced by F; the amino acid at position 9, such as K, is replaced by E; the amino acid at position 11, such as S, is replaced by A; the amino acid at position 12, such as L, is replaced by V; and the amino acids at positions 17 and 21-25 are deleted.
23. The therapeutic immune cell according to any one of claims 20-22, wherein the modified TCRβ chain constant region is derived from the mouse TCRβ chain constant region, wherein, relative to the wild-type mouse TCRβ chain constant region, the amino acid at position 56, such as serine S, is mutated to cysteine C; the amino acid at position 3, such as R, is replaced by K; the amino acid at position 6, such as T, is replaced by F; the amino acid at position 9, K, is replaced by E; the amino acid at position 11, S, is replaced by A; the amino acid at position 12, L, is replaced by V; and the amino acids at positions 17 and 21-25 are deleted.
24. The therapeutic immune cell according to any one of claims 20-23, wherein the intracellular region of the TCRβ chain constant region is missing from the wild-type TCRβ chain constant region, for example, by deleting amino acids 167-172.
25. The therapeutic immune cell according to any one of claims 20-24, wherein the modified TCRβ chain constant region is derived from the mouse TCRβ chain constant region, which, relative to the wild-type mouse TCRβ chain constant region, lacks the intracellular region of the constant region, for example, lacking amino acids 167-172.
26. The therapeutic immune cell according to any one of claims 20-25, wherein the modified TCRβ chain constant region comprises the amino acid sequence shown in one of SEQ ID NO:10-14.
27. The therapeutic immune cells according to any one of claims 10-26, wherein i) The first constant region contains the amino acid sequence shown in SEQ ID NO:3, and the second constant region contains the amino acid sequence shown in SEQ ID NO:10; ii) The first constant region contains the amino acid sequence shown in SEQ ID NO:6, and the second constant region contains the amino acid sequence shown in SEQ ID NO:10; iii) The first constant region contains the amino acid sequence shown in SEQ ID NO:3, and the second constant region contains the amino acid sequence shown in SEQ ID NO:13; or iv) The first constant region contains the amino acid sequence shown in SEQ ID NO:6, and the second constant region contains the amino acid sequence shown in SEQ ID NO:
13.
28. The therapeutic immune cell according to any one of claims 10-27, wherein the α chain and / or β chain, preferably the α chain and β chain, are connected to at least one exogenous intracellular functional domain at their C-terminus, such as the intracellular domain of a co-stimulatory molecule, preferably the intracellular domain of OX40, and more preferably, the intracellular domain of OX40 comprises the amino acid sequence of SEQ ID NO:
15.
29. The therapeutic immune cell of claim 28, wherein the exogenous intracellular functional domain is directly or via a adapter connected to the α chain and / or β chain, preferably to the C-terminus of the constant region of the α chain and β chain; preferably, the exogenous intracellular functional domain is connected via a adapter to the α chain and / or β chain missing in the intracellular region, preferably to the C-terminus of the constant region of the α chain and β chain; preferably, the adapter is a (G4S)n adapter, where n represents an integer from 1 to 10, preferably, n is 3.
30. The therapeutic immune cell of claim 29, wherein the first constant region is a modified TCRα chain constant region derived from a mouse TCRα chain constant region, and relative to the wild-type mouse TCRα chain constant region, the amino acid at position 48, for example threonine T, is mutated to cysteine C; the amino acid at position 112, for example serine S, is mutated to leucine L; the amino acid at position 114, for example methionine M, is mutated to isoleucine I; the amino acid at position 115, for example glycine G, is mutated to valine V; and the modified TCRα chain constant region, relative to the wild-type mouse TCRα chain constant region, lacks an intracellular region of the constant region, for example, the amino acids at positions 136-137; and the α chain comprises an intracellular domain of OX40 connected to the C-terminus of the constant region (e.g., via a linker, for example (G4S)n linker, where n represents an integer from 1 to 10, preferably n is 3); and The second constant region is a modified TCRβ chain constant region derived from the mouse TCRβ chain constant region, wherein, relative to the wild-type mouse TCRβ chain constant region, the amino acid at position 56, for example serine S, is mutated to cysteine C, and the modified TCRβ chain constant region, relative to the wild-type mouse TCRβ chain constant region, lacks the intracellular region of the constant region, for example, the amino acids at positions 167-172 are missing, and the β chain contains an intracellular domain of OX40 connected to the C-terminus of the constant region (e.g., via a linker, such as a (G4S)n linker, where n represents an integer from 1 to 10, preferably n is 3).
31. The therapeutic immune cell according to any one of claims 10-30, wherein the target antigen is a disease-associated antigen, for example... The target antigen may be selected from the following antigens: GPC3 (phosphatidylinositol proteoglycan 3), BCMA, mesothelin (MSLN, Mesothelin), LILRB4, GPRC5D, NY-ESO-1, GUCY2C, CD16, CD64, CD78, CD96, CLL1, CD116, CD117, CD7, CD70, CD38, CD45, CD71, CD123, CD138, CD276, CD19, CD20, CD22, CD30, CD40, CD3, CD4, CD8, CD24, CD25, CD33, CD34, CD133, CD138, Foxp3, B7 -1 (CD80), B7-2 (CD86), ErbB2 (HER2 / neu), Claudin18.2, Carcinoembryonic antigen (CEA), Epithelial cell adhesion molecule (EpCAM), Epidermal growth factor receptor (EGFR), EGFR variant III (EGFRvIII), Disialotetrahexosylganglioside GD2, Ductal epithelial mucin, gp36, TAG-72, Glycosphingolipids, Glioma-associated antigen, β-human chorionic gonadotropin, Alpha-fetoglobulin (AFP), Exogenous lectin-reactive AFP, Thyroglobulin, RAGE-1, MN-CAIX, Human telomerase reverse transcriptase, RU1, RU2 (AS), Intestinal carboxylesterase, mut hsp70-2, M-CSF, prostase, prostate enzyme-specific antigen (PSA), PAP, LAGA-1a, p53, Prostein, PSMA, survival and telomerase, prostate cancer tumor antigen-1 (PCTA-1), MAGE, ELF2M, neutrophil elastase, liver glycoside B2, insulin-like growth factor (IGF1)-I, IGF-II, IGFI receptor, major histocompatibility complex (MHC) molecule presenting tumor-specific peptide epitopes, 5T4, ROR1, Nkp30, NKG2D, tumor matrix antigen, extra domain A (EDA) and extra domain B (EDB) of fibronectin, A1 domain (TnC) of tendinin-C A1), fibroblast-associated protein (fap), GM-CSF, cytokine receptors, endothelial factors, major histocompatibility complex (MHC) molecules, TNFRSF17, SLAMF7, FKBP11, KAMP3, ITGA8, and FCRL5; or The target antigen is an antigen derived from a pathogen or a surface antigen of cells infected by the pathogen, such as RSVF (prevention of respiratory syncytial virus), PA (inhalation anthrax), CD4 (HIV infection), or HBsAg; or The target antigens are antigens associated with other diseases, such as CD3 (involved in transplant rejection), CD25 (involved in acute kidney transplant rejection), C5 (involved in paroxysmal nocturnal hemoglobinuria), IL-1β (involved in cold pyridine-associated periodic syndrome), RANKL (involved in cancer-related bone injury), von Willebrand factor (involved in adult acquired thrombotic thrombocytopenic purpura), plasma kallikrein (involved in angioedema), calcitonin gene-related peptide receptor (involved in adult migraine), and FGF23 (involved in X-linked hypophosphatemia).
32. The therapeutic immune cells according to any one of claims 10-31, wherein i) The α chain comprises a first antigen-binding region and a first constant region, and the β chain comprises a second constant region; ii) The α chain contains a first constant region, and the β chain contains a second antigen-binding region and a second constant region; or iii) The α chain comprises a first antigen-binding region and a first constant region, and the β chain comprises a second antigen-binding region and a second constant region.
33. The therapeutic immune cell of claim 32, wherein the first antigen-binding region and the second antigen-binding region each independently or in combination specifically bind at least one target antigen.
34. The therapeutic immune cell of claim 32 or 33, wherein the first antigen-binding region comprises a heavy chain variable region of an antibody that specifically binds to a target antigen, and the second antigen-binding region comprises a light chain variable region of the antibody; or, the first antigen-binding region comprises a light chain variable region of an antibody that specifically binds to a target antigen, and the second antigen-binding region comprises a heavy chain variable region of the antibody.
35. The therapeutic immune cell of claim 32 or 33, wherein the first antigen-binding region comprises a single-chain antibody (e.g., scFv) or a single-domain antibody that specifically binds to the target antigen; and / or the second antigen-binding region comprises a single-chain antibody or a single-domain antibody that specifically binds to the target antigen.
36. The therapeutic immune cell of claim 35, wherein the first antigen-binding region and the second antigen-binding region bind the same target antigen.
37. The therapeutic immune cell of claim 36, wherein the first antigen-binding region and the second antigen-binding region bind different regions (e.g., different epitopes) of the same target antigen; or the first antigen-binding region and the second antigen-binding region bind different target antigens.
38. The therapeutic immune cell according to any one of claims 10-37, wherein the antigen-binding region comprises the heavy chain variable region shown in SEQ ID NO:21 and / or the light chain variable region shown in SEQ ID NO:22, thereby the STAR targets CD19.
39. The therapeutic immune cell according to any one of claims 10-37, wherein the antigen-binding region comprises the heavy chain variable region shown in SEQ ID NO:54 and / or the light chain variable region shown in SEQ ID NO:55, thereby the STAR targets CD19.
40. The therapeutic immune cell of claim 39, wherein the α chain comprises the amino acid sequence shown in SEQ ID NO:51, and the β chain comprises the amino acid sequence shown in SEQ ID NO:
52.
41. The therapeutic immune cell according to any one of claims 10-37, wherein the antigen-binding region comprises the heavy chain variable region shown in SEQ ID NO:54 and / or the light chain variable region shown in SEQ ID NO:55, thereby the STAR targets GPC3.
42. The therapeutic immune cell of claim 41, wherein the α chain comprises the amino acid sequence shown in SEQ ID NO:56, and the β chain comprises the amino acid sequence shown in SEQ ID NO:
57.
43. The therapeutic immune cell according to any one of claims 1-42, wherein the immune cell is a T cell or an NK cell, preferably a T cell.
44. A combination for preparing therapeutic immune cells, comprising: i) a STAR expression vector, said STAR expression vector comprising an expression cassette of STAR as defined in any one of claims 1-43; and ii) A gene editing system that targets at least one endogenous TCR encoding gene, at least one endogenous immune checkpoint encoding gene, at least one endogenous HLA-I protein or its regulatory protein encoding gene and / or at least one endogenous HLA-II protein or its regulatory protein encoding gene, preferably a gene editing system that targets one or more endogenous genes selected from TRAC, PD-1, HLA-A, HLA-B and CIITA.
45. The combination of claims 44, wherein the gene editing system i) Target at least one endogenous TCR encoding gene, preferably targeting an endogenous TRAC gene; ii) Target at least one endogenous TCR encoding gene and at least one endogenous HLA-I protein or its regulatory protein encoding gene, preferably targeting endogenous TRAC, HLA-A and HLA-B genes; iii) Target at least one endogenous TCR encoding gene and at least one endogenous HLA-I protein or its regulatory protein encoding gene and at least one endogenous HLA-II protein or its regulatory protein encoding gene, preferably targeting endogenous TRAC, HLA-A, HLA-B and CIITA genes; or iv) Target at least one endogenous TCR encoding gene, at least one endogenous immune checkpoint encoding gene, at least one endogenous HLA-I protein or its regulatory protein encoding gene, and at least one endogenous HLA-II protein or its regulatory protein encoding gene, preferably targeting endogenous TRAC, PD-1, HLA-A, HLA-B and CIITA genes.
46. The gene editing system according to a combination of claim 44 or 45, wherein the gene editing system is a CRISPR, TALEN, or ZFN system, preferably a CRISPR system.
47. The combination of claim 46, wherein the CRISPR system comprises: i) A CRISPR nuclease and / or an expression construct containing the encoding nucleotide sequence of a CRISPR nuclease, preferably, the CRISPR nuclease being Cas9; and ii) Guide RNA and / or an expression construct containing a coding nucleotide sequence of guide RNA, wherein the guide RNA is capable of targeting a target sequence within a target gene in a cell.
48. The combination of claims 47, wherein the guide RNA is sgRNA, the sgRNA comprising the scaffold sequence shown in SEQ ID NO:
23.
49. The guide RNA of claim 47 or 48, wherein the guide RNA targets or contains The target sequence shown in SEQ ID NO:48 of the endogenous TRAC gene; The target sequence shown in SEQ ID NO:49 in the endogenous PD-1 gene; One of SEQ ID NO:24-29 in the endogenous HLA-A gene, preferably the target sequence shown in SEQ ID NO:24; The target sequence is one of SEQ ID NO:30-35 in the endogenous HLA-B gene, preferably the target sequence described in SEQ ID NO:
30. One of SEQ ID NO:36-41 in the endogenous HLA-A and HLA-B genes, preferably the target sequence described in SEQ ID NO:36; or The target sequence is one of SEQ ID NO:42-47 in the endogenous CIITA gene, preferably the target sequence shown in SEQ ID NO:
42.
50. The combination of any one of claims 47-49, wherein the gene editing system comprises: i) Ca9 nuclease; and ii) guide RNA that targets or contains the target sequence shown in SEQ ID NO:48, guide RNA that targets or contains the target sequence shown in SEQ ID NO:49, guide RNA that targets or contains the target sequence shown in SEQ ID NO:36, and / or, guide RNA that targets or contains the target sequence shown in SEQ ID NO:
42.
51. The combination of claims 50, wherein the gene editing system comprises: i) Ca9 nuclease; and ii) ii-1) Guide RNA that targets or contains the target sequence shown in SEQ ID NO:48; ii-2) Guide RNA that targets or contains the target sequence shown in SEQ ID NO:48, and guide RNA that targets or contains the target sequence shown in SEQ ID NO:36; ii-3) Guide RNAs that target or contain the target sequence shown in SEQ ID NO:48, guide RNAs that target or contain the target sequence shown in SEQ ID NO:36, and guide RNAs that target or contain the target sequence shown in SEQ ID NO:42; or ii-4) Guide RNA that targets or contains the target sequence shown in SEQ ID NO:48, guide RNA that targets or contains the target sequence shown in SEQ ID NO:49, guide RNA that targets or contains the target sequence shown in SEQ ID NO:36, and guide RNA that targets or contains the target sequence shown in SEQ ID NO:
42.
52. The combination of any one of claims 44-51, wherein the expression cassette of STAR includes a 5' homologous arm (5'HA) at its 5' end and a 3' homologous arm (3'HA) at its 3' end, said 5'HA and 3'HA comprising nucleotide sequences homologous to sequences in the endogenous TRAC locus.
53. The combination of claim 52, wherein the expression cassette of STAR includes the 5' homologous arm (5'HA) shown in SEQ ID NO:18 at its 5' end and the 3' homologous arm (3'HA) shown in SEQ ID NO:19 at its 3' end.
54. The combination of any one of claims 44-53, wherein the STAR expression vector is an AAV vector.
55. A method for preparing therapeutic immune cells, comprising: Step 1) Provide initial immune cells; Step 2) Introduce the combination of any one of claims 44-54 into the initiating immune cells; and Step 3) Harvest the immune cells obtained in Step 2).
56. The method of claim 55, wherein the initiating immune cell is a T cell or an NK cell, preferably a T cell.
57. A combination comprising any one of claims 44-54, or a therapeutic immune cell such as a T cell that can be obtained or acquired by any one of claims 44-54 or by the method of claim 55 or 56.
58. A pharmaceutical composition comprising any combination of claims 44-54, and / or any therapeutic immune cell of claims 1-43 and 57, and a pharmaceutically acceptable carrier.
59. Use of the combination of any one of claims 44-54, the therapeutic immune cells of any one of claims 1-43 and 57, and / or the pharmaceutical composition of claim 58 in the preparation of a medicament for treating a disease in a subject.
60. A method of treating a disease in a subject, comprising administering to the subject a therapeutically effective amount of any combination of claims 44-54, any one of claims 1-43 and 57, and / or the pharmaceutical composition of claim 58.
61. The pharmaceutical composition of claim 58, the use of claim 59, or the method of claim 60, wherein the disease is selected from cancer, pathogen infection, cardiovascular disease, diabetes, neurological disease, post-transplant rejection, autoimmune disease, or allergic disease.
62. The pharmaceutical composition, use, or method of claim 61, wherein the cancer is selected from myeloma (e.g., multiple myeloma (MM), particularly relapsed or refractory multiple myeloma (RRMM)), lung cancer such as squamous cell carcinoma of the lung (SqCC), ovarian cancer, colon cancer, rectal cancer, colorectal cancer, melanoma, kidney cancer, bladder cancer, breast cancer, liver cancer such as hepatocellular carcinoma, lymphoma, hematologic malignancies, head and neck cancer, glioma, gastric cancer, nasopharyngeal carcinoma, laryngeal cancer, cervical cancer, endometrial tumor, osteosarcoma, bone cancer, pancreatic cancer, skin cancer, prostate cancer, uterine cancer, anal cancer, testicular cancer, fallopian tube cancer, endometrial cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, esophageal cancer, small intestine cancer, etc. Colorectal cancer, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, chronic or acute leukemia (including acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia), pediatric solid tumors such as embryonal tumors, lymphocytic lymphoma, bladder cancer, kidney or ureter cancer, renal pelvis cancer, central nervous system (CNS) tumors, primary CNS lymphoma, tumor angiogenesis, spinal tumors, brainstem gliomas, pituitary adenomas, Kaposi's sarcoma, epidermal carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancers, including asbestos-induced cancers, and combinations of the aforementioned cancers; or The autoimmune diseases mentioned are systemic lupus erythematosus, rheumatoid arthritis, myasthenia gravis, idiopathic thrombocytopenic purpura, antiphospholipid syndrome, Chagas disease, Graves' disease, granulomatous polyangiitis, polyarteritis nodosa, Sjögren's syndrome, pemphigus vulgaris, scleroderma, multiple sclerosis, ANCA-associated vasculitis, Goodpasture's disease, Kawasaki disease, autoimmune hemolytic anemia, rapidly progressive glomerulonephritis, systemic sclerosis, and inflammatory myopathy; or The allergic diseases mentioned are selected from allergic rhinitis, allergic asthma, atopic dermatitis, food allergies, and drug allergies.
63. The pharmaceutical composition, use, or method of claim 61, wherein the disease is a phosphatidylinositol proteoglycan-3 (GPC3)-related disease, such as a disease related to abnormal GPC3 expression, such as a GPC3-related cancer; the cancer is, for example, liver cancer such as hepatocellular carcinoma, lung cancer such as squamous cell carcinoma of the lung (SqCC), gastric cancer, ovarian cancer, melanoma, or pediatric embryonal tumor.
64. The pharmaceutical composition, use, or method of claim 61, wherein the disease is a CD19-related disease, such as a disease related to abnormal CD19 expression, such as CD19-related cancer, autoimmune disease, or allergic disease. For example, the cancer is selected from B-cell malignancies, such as chronic or acute leukemia (including acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia), lymphocytic lymphoma, non-Hodgkin's lymphoma, and combinations of the cancers; or For example, the autoimmune diseases mentioned are systemic lupus erythematosus, rheumatoid arthritis, myasthenia gravis, idiopathic thrombocytopenic purpura, antiphospholipid syndrome, Chagas disease, Graves' disease, granulomatous polyangiitis, polyarteritis nodosa, Sjögren's syndrome, pemphigus vulgaris, scleroderma, multiple sclerosis, ANCA-associated vasculitis, Goodpasture's disease, Kawasaki disease, autoimmune hemolytic anemia, rapidly progressive glomerulonephritis, systemic sclerosis, inflammatory myopathy; or The allergic diseases mentioned are selected from allergic rhinitis, allergic asthma, atopic dermatitis, food allergies, and drug allergies.