Use of dsadh gene in regulating growth, reproduction, pathogenicity, and stress resistance of d. segeticola
By knocking out the DsADH protein-coding gene in D. segeticola, its pathogenicity, growth rate, and stress resistance were regulated, addressing the lack of research on the pathogenic mechanism of D. segeticola and achieving effective control of tea spot disease.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- GUIZHOU UNIV
- Filing Date
- 2025-07-11
- Publication Date
- 2026-06-18
AI Technical Summary
Current technologies have limited molecular biological research on Didymella segeticola, and there is a lack of reports on its pathogenic mechanisms, making it difficult to effectively control the disease.
By knocking out the DsADH protein-encoding gene in D. segeticola to reduce its expression and activity, DsADH knockout mutants were obtained. Antifungal drugs were designed using DsADH protein as a target, and transgenic D. segeticola was constructed through homologous recombination to regulate its pathogenicity, growth rate, and stress resistance.
It significantly reduced the pathogenicity and reproductive capacity of D. segeticola, increased its growth rate, and enhanced its sensitivity to high salinity, high osmotic pressure, and oxidative stress, providing a new method for disease control.
Smart Images

Figure CN2025108052_18062026_PF_FP_ABST
Abstract
Description
Application of DsADH gene in regulating growth, reproduction, pathogenicity and stress resistance of D.segeticola TECHNICAL FIELD
[0001] The application belongs to the field of biotechnology, and particularly relates to application of DsADH gene in regulating growth, reproduction, pathogenicity and stress resistance of D.segeticola. BACKGROUND
[0002] The genus Didymella belongs to the family Didymellaceae in the order Pleosporales of the class Dothideomycetes in the phylum Ascomycota. Fungi in this genus are pathogenic to some plants (Crous, P.W., Gams, W., Stalpers, J.A., Robert, V., Stegehuis, G. MycoBank: an online initiative to launch mycology into the 21st century. Studies in Mycology, 2004, 50: 19-22; Chen, Q., Hou, L.W., Duan, W.J., Crous, P.W., Cai, L. Didymellaceae revisited. Studies in Mycology, 2017, 87: 105-159).For example, Didymella segeticola can cause pepper leaf spot disease (Yang, J. Z., Chen, C. X., Yin, X. H., Xu, H., Long, H. J., Gu, G., Shu, R., Yuan, J., Zhou, H. C. Didymella segeticola is a new pathogen causing leaf spot disease on Zanthoxylum bungeanum. New Zealand Journal of Crop and Horticultural Science, 2022, 51: 694-703), tobacco leaf spot disease (Guo, Z. N., Xie, H. L., Wang, H. C., Huang, Y., Chen, Q. L., Xiang, L. G., Yu, Z. H., Yang, X. H. Leaf spot caused by Didymella segeticola on tobacco in China. Plant Disease, 2019, 104: 1559-1560), tea leaf spot disease (Deng, X. Y., Yang, J., Wan, Y. H., Han, Y. X., Tong, H. R., Chen, Y. J. Characteristics of leaf spot disease caused by Didymella species and the influence of infection on tea quality. Phytopathology, 2023, 113: 516-527). D. segeticola var. camelliae strain GZSQ-4 (China General Microbiological Culture Collection Center, strain preservation number CGMCC 3.20152, which is a published strain) was isolated and identified from tea leaf spot disease in Shiqian County, Guizhou Province, by the research group of the present inventors. The pathogen can infect tea shoots, tender leaves and mature leaves, and cause serious impact on the quality and yield of tea, and a technology for the disease needs to be developed (Zhao, X. Z., Wang, Y., Li, D. X., Ren, Y. F., Chen, Z. Morphological characteristics and phylogenetic analysis of Phoma segeticola var. camelliae, a new pathogen of tea plant. Plant Disease, 2018, 48: 556-559).
[0003] So far, the molecular biology research of D. segeticola is still weak, especially the lack of pathogenic mechanism reports. Studies have shown that the successful infection of D. segeticola mainly depends on a series of pathogenic factors. Therefore, fully excavating the pathogenic related genes of D. segeticola and carrying out gene function research can help to fully understand the pathogenic mechanism of D. segeticola, provide important data for the prevention and control of D. segeticola disease, and also help to select disease-resistant varieties. SUMMARY
[0004] In view of this, one of the purposes of the present application is to provide a new use of DsADH protein derived from D. segeticola, i.e. the application of DsADH protein in regulating the pathogenicity and / or growth rate and / or reproductive capacity and / or stress resistance of D. segeticola, wherein the DsADH protein is a protein with an amino acid sequence as shown in SEQ ID NO. 3 or a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein as shown in SEQ ID NO. 3.
[0005] The second purpose of the present application is to provide the application of biological materials related to DsADH protein in regulating the pathogenicity and / or growth rate and / or reproductive capacity and / or stress resistance of D. segeticola, wherein the biological materials are nucleic acid molecules encoding DsADH protein or expression cassettes, recombinant vectors or recombinant microorganisms containing the nucleic acid molecules, such as recombinant vectors or recombinant microorganisms containing the expression cassettes.
[0006] Preferably, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO. 1 or SEQ ID NO. 2. The nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA, or RNA, such as mRNA or hnRNA, etc. The vector can be a plasmid, cosmid, bacteriophage or viral vector; the microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium.
[0007] The third purpose of the present application is to provide the application of the above-mentioned DsADH protein as a target in the design and screening of antifungal drugs.
[0008] The fourth purpose of the present application is to provide the application of the above-mentioned DsADH protein or the above-mentioned biological materials in cultivating transgenic D. segeticola with reduced pathogenicity and / or increased growth rate and / or reduced reproductive capacity and / or reduced stress resistance.
[0009] The fifth object of the present application is to provide a method for breeding a transgenic D. segicola with reduced pathogenicity and / or increased growth rate and / or reduced reproductive ability and / or reduced stress resistance, comprising the step of reducing the expression amount and / or activity of the above-mentioned DsADH protein in a recipient D. segicola to obtain a transgenic D. segicola (such as a DsADH knockout mutant). The pathogenicity and / or reproductive ability and / or stress resistance of the transgenic D. segicola is lower than that of the wild type D. segicola; the growth rate of the transgenic D. segicola is higher than that of the wild type D. segicola.
[0010] Preferably, the method for reducing the expression amount and / or activity of the DsADH protein in the recipient D. segicola is achieved by knocking out or inhibiting or silencing the expression of the gene encoding the DsADH protein in the recipient D. segicola.
[0011] Preferably, the method for knocking out is a method of homologous recombination to knock out the gene encoding the DsADH protein in the recipient D. segicola.
[0012] Preferably, the method of homologous recombination is to introduce a homologous recombination fragment for homologous recombination into the protoplast of the recipient D. segicola.
[0013] The sixth object of the present application is to provide the use of the above-mentioned method in the prevention and treatment of diseases caused by D. segicola.
[0014] The present application provides the use of the DsADH protein and the gene encoding the same from D. segicola in regulating the pathogenicity, growth rate, reproductive ability and stress resistance of the plant pathogenic fungus D. segicola. It is found that after knocking out the gene encoding the DsADH protein in the wild type D. segicola, the pathogenicity, reproductive ability and stress resistance of the D. segicola after knocking out are significantly reduced, and the growth rate is increased. Therefore, DsHAD can be used as a key protein for the development of fungicides and the breeding of new varieties resistant to diseases caused by D. segicola infection, and has a broad application prospect in the prevention and treatment of plant pathogenic fungal diseases. BRIEF DESCRIPTION OF DRAWINGS
[0015] Fig. 1 is a schematic diagram of the DsADH gene knockout and mutant screening strategy of D. segicola according to the present application;
[0016] Fig. 2 is a map of the plasmid pCT74 according to the present application;
[0017] Figure 3 is a PCR electrophoretogram of the knock-out detection of the present application;
[0018] Figure 4 is a growth chart of D. segicola wild type and ΔDsADH mutant mycelium on PDA;
[0019] Figure 5 is a colony growth rate chart of D. segicola wild type and ΔDsADH mutant mycelium on PDA;
[0020] Figure 6 is the spore production of D. segicola wild type and ΔDsADH mutant mycelium;
[0021] Figure 7 is a colony growth chart of wild type and mutant ΔDsADH under different stress conditions;
[0022] Figure 8 is a colony growth inhibition rate chart of D. segicola wild type and ΔDsADH mutant mycelium under different stress conditions;
[0023] Figure 9 is the pathogenicity determination result of D. segicola wild type and ΔDsADH mutant mycelium on tea leaves. DETAILED DESCRIPTION
[0024] The present application will be described in detail below with reference to the examples, which are merely illustrative and not restrictive to the scope of the present application. The present application is not limited to the following embodiments or examples, and any modification and variation made without departing from the spirit of the present application shall be included in the scope of the present application. The experimental materials used in the following examples are commercially available unless otherwise specified.
[0025] In the following examples, D. segicola var. camelliae wild strain GZSQ-4 was isolated and identified from tea leaf spot in Shiqian County, Guizhou Province, and was deposited with China General Microbiological Culture Collection Center with the strain deposit number CGMCC 3.20152. The genomic sequence of alcohol dehydrogenase (DsADH) gene in the strain is shown in SEQ ID NO. 1, and the CDS sequence is shown in SEQ ID NO. 2; the amino acid sequence of DsHAD protein encoded by the gene is shown in SEQ ID NO. 3.
[0026] Example 1, D. segicola DsADH gene knock-out
[0027] The specific construction and screening strategy of D. segicola DsADH gene knock-out and mutant screening is shown in Figure 1, and the specific steps include:
[0028] 1. Constructing a knockout gene fragment
[0029] 1) Amplification of homologous sequences upstream and downstream of the target gene: The genomic DNA of D. segiticola wild type strain CGMCC 3.20152 was used as a template, and primer 1F and 2R were used to amplify the upstream A fragment, and primer 3F and 4R were used to amplify the downstream B fragment. A reverse complementary sequence of primer HYGF was added to the 5' end of primer 2R, and a reverse complementary sequence of primer HYGR was added to the 5' end of primer 3F. The sequences of primers 1F, 2R, 3F, 4R, HYGF and HYGR (from 5' end to 3' end) are as follows:
[0030] 1F: TGTCGGTAGTAAGGCTCTCCG
[0031] 2R: ACCTCCACTAGCTCCAGCCAAGTCGGTTATCAAGGAAAGCGTAG
[0032] 3F: GAATAGAGTAGATGCCGACCGGGCCAATCCTGATAGGAGCGAC
[0033] 4R: AGCAGTGACAAGGATGACAGG
[0034] HYGF: CTTGGCTGGAGCTAGTGGAGGT
[0035] HYGR: CCCGGTCGGCATCTACTCTATTC
[0036] 2) Amplification of the hygromycin resistance gene hph: The plasmid pCT74 (map as shown in Figure 2) was used as a template, and primers HYGF and HYG-1R were used to amplify the first half H1 (1094 bp) fragment of the hygromycin resistance gene; and primers HYG-1F and HYGR were used to amplify the second half H2 (748 bp) fragment of the hygromycin resistance gene. The sequences of primers HYG-1F and HYG-1R (from 5' end to 3' end) are as follows:
[0037] HYG-1F: CGTTGCAAGACCTGCCTGAA
[0038] HYG-1R: GGATGCCTCCGCTCGAAGTA
[0039] 3) The fusion of the upstream and downstream fragments of the target gene with the hygromycin resistance gene: Overlapping PCR was used to overlap the recovered A fragment and B fragment with H1 fragment and H2 fragment respectively to obtain A-H1 connecting fragment and H2-B connecting fragment. Primer 1F / HYG-1R and HYG-1F / 4R were used to amplify A-H1 and H2-B fragment respectively, and the knockout fragment was purified to make the concentration of the knockout fragment reach 500 ng / μL.
[0040] 2, Preparation of D. segiticola protoplast
[0041] 1) D. segiticola was inoculated in potato glucose broth (PDB) and cultured at 25°C for 36 h, and the mycelium was collected into a 2 mL centrifuge tube, the mycelium was broken by a grinder, and the bacterial suspension was transferred to CM liquid medium and shaken for 36 h, and fresh mycelium of D. segiticola was collected by filtration;
[0042] 2) 10 mL of 0.8 mol / L potassium chloride solution was used as an osmotic pressure stabilizer to prepare a mixed enzyme solution of Drislase, lysozyme and snailase, and the suspended mycelium was lysed for 5 g, and the enzyme was lysed at 30°C and 100 rpm for 4 h;
[0043] 3) The filter was washed with 0.8 mol / L potassium chloride, and the filtrate was collected, and the obtained filtrate was centrifuged at 4°C and 4000 rpm for 6 min. Resuspend with 15 mL of 1.2 mol / L sorbitol buffer (STC) solution;
[0044] 4) Discard the supernatant, resuspend the protoplasts with 1 mL of STC buffer to prepare a protoplast suspension with a concentration of 1×10 7 Put on ice for standby.
[0045] 3, Transformation of D. segiticola protoplast
[0046] 1) Take 200 μL of protoplast suspension and add it to a 50 mL centrifuge tube, add 10-20 μg of A-H1 and H2-B knockout transformation fragment, mix gently, and stand on ice for 20 min.
[0047] 2) Add 1.4 mL of 40% polyethylene glycol 4000 buffer (PTC) in two times, mix gently, stand at room temperature for 20 min, add 5 mL of TB3 liquid medium, mix, and culture at 25°C and 120 rpm for 12-16 h.
[0048] 3) centrifugation at room temperature, 4000 rpm / min for 6 min, discard the supernatant, and the remaining 1 mL of resuspension is mixed with the regenerated protoplasts.
[0049] 4) add 100 mL of warm TB3 regeneration solid medium, mix well and prepare a plate. After 24 h of 25 °C inverted culture, cover with PDA medium containing 30 μg / mL of Hygromycin B, and culture at 25 °C for 2-4 days until the transformants grow, and then subculture for 3 generations of selection culture.
[0050] 4、Transformant PCR verification
[0051] After subculture for 3 generations on PDA medium containing hygromycin, transformants of ΔDsADH can be obtained. DNA is extracted from the transformant colonies using the CTAB method, and 4 pairs of primers are used for PCR amplification. Primer pair HYGF / HYGR is used to amplify fragment P1 to detect the hph gene; primer pair 7F / 2R and 3F / 8R is used to detect the occurrence of homologous recombination upstream and downstream; and primer pair 5F / 6R is used to amplify the fragment to detect whether the target gene is knocked out. The sequences of primers 5F, 6R, 7F, and 8R (5' end to 3' end) are as follows:
[0052] 5F: TGTCACACTGATCTCCACGC
[0053] 6R: TGCTGGAATGGCTTCTCGTT
[0054] 7F: GACACGGTCTCGACGCTATT
[0055] 8R: ACAATTCTCCGTCCAGCGTAC
[0056] Using the homologous recombination method, the gene knockout fragment is transferred into D. segiticola protoplasts, and hygromycin-positive transformants are obtained. The positive transformants are analyzed by PCR verification using hph gene-specific primers, and the results are shown in Figure 3. In the transformants, the hph gene, the occurrence of homologous recombination upstream, and the occurrence of homologous recombination downstream are detected, and the DsADH gene is not amplified in the electrophoresis map. Therefore, the corresponding positive transformants are screened, i.e., the ΔDsADH knockout mutant is obtained.
[0057] Example 2, Phenotype observation and stress resistance analysis of D. segiticola wild type and ΔDsADH knockout mutant
[0058] 1. Colony morphology observation and growth rate determination
[0059] D. segeticola wild type and knockout mutant ΔDsADH were inoculated on PDA medium, cultured at 25℃ in dark condition, and the colony diameter was measured by cross method at 8d, and the colony morphology was observed; 3 replicates were set for each treatment.
[0060] The colony morphology observation and growth rate determination results of D. segeticola wild type and knockout mutant ΔDsADH on PDA medium are shown in Figures 4 and 5 (Figure 4 is the growth of D. segeticola wild type strain and mutant strain ΔDsADH after inoculation on PDA medium for 8d; Figure 5 is the colony growth rate of D. segeticola wild type strain and mutant strain ΔDsADH after inoculation on PDA medium for 8d, the vertical coordinate is the lesion measurement diameter, the value is the mean value based on 3 independent experiments, and the data is analyzed by Duncan new complex range method (p<0.05)), the colony morphology and growth rate of D. segeticola knockout mutant ΔDsADH on PDA medium are higher than those of D. segeticola wild type, and the aerial mycelium is less, indicating that the ΔDsADH gene has an effect on the vegetative growth of D. segeticola.
[0061] 2. Spore production determination
[0062] D. segeticola wild type and knockout mutant ΔDsADH were inoculated on oat medium (OA), cultured at 25℃ in dark condition, and after 14d, the mycelium was washed with sterile water, and spores were collected by sterilizing 3-4 layers of filter, centrifuged to discard the supernatant, suspended with 0.1% Tween water, and counted by blood cell counting plate; 3 replicates were set for each treatment.
[0063] The spore production determination results of D. segeticola wild type and knockout mutant ΔDsADH on OA medium can be known from Figure 6, the spore production of D. segeticola knockout mutant ΔDsADH is lower than that of wild type, indicating that after knocking out the DsADH gene, the pathogenicity and reproductive ability of D. segeticola are inhibited.
[0064] 3. Analysis of stress resistance
[0065] 1) High osmotic pressure stress analysis
[0066] D. segicola wild type and knockout mutant ΔDsADH were inoculated on PDA medium containing 1.0 mol / L NaCl, 1.0 mol / L KCl, and 1 mol / L sorbitol, respectively, and cultured in an inverted incubator at 25°C for 7 days. The colony growth of the knockout mutant ΔDsADH and the wild type strain was observed.
[0067] The colony diameters of all strains were measured (cross method) and photographed. The strain growth inhibition rate was calculated = (control strain colony diameter - treatment strain colony diameter) / control strain colony diameter * 100%.
[0068] 2) Oxidative stress analysis: D. segicola wild type and knockout mutant ΔDsADH were inoculated on PDA medium containing 20 mmol / L H2O2, respectively, and cultured in an inverted incubator at 25°C for 7 days. The colony growth of the knockout mutant ΔDsADH and the wild type was observed.
[0069] 3) Cell membrane integrity analysis
[0070] D. segicola wild type and knockout mutant ΔDsADH were inoculated on PDA medium containing 0.05% sodium dodecyl sulfate (SDS), respectively, and cultured in an inverted incubator at 25°C for 7 days. The colony growth of the knockout mutant ΔDsADH and the wild type strain was observed.
[0071] 4) Cell wall integrity analysis
[0072] D. segicola wild type and knockout mutant ΔDsADH were inoculated on PDA medium containing 200 μg / mL Congo red, respectively, and cultured in an inverted incubator at 25°C for 8 days. The colony growth of the knockout mutant ΔDsADH and the wild type strain was observed.
[0073] The growth of D. segicola DsADH mutants and wild type under different stress conditions is shown in Figure 7 (wherein A-G are the growth of D. segicola wild type strain on medium under different stress conditions; H-N are the growth of D. segicola mutant strain on medium under different stress conditions; 1 mol / L KCl: containing 1 mol / L KCl in final concentration; 1 mol / L NaCl: containing 1 mol / L NaCl in final concentration; 0.005% SDS: containing 0.005% SDS in final concentration; 200 μg / mL Congo red: containing 200 μg / mL Congo red in final concentration; 20 mmol / L H2O2: containing 20 mmol / L H2O2 in final concentration; 1 mol / L sorbitol: containing 1 mol / L sorbitol in final concentration; PDA medium; scale bar is 1 cm); and the relative growth inhibition rate of the colonies under different stress conditions is shown in Figure 8, wherein the vertical coordinate is the relative growth inhibition rate, the numerical value is the mean value based on three independent experiments, and the data is analyzed by Duncan's new multiple range method (p<0.05). In Figure 8, from left to right are the relative growth inhibition rates of the wild type and knockout mutant under NaCl, KCl, sorbitol, H2O2, SDS and Congo red stress; the data is analyzed by Duncan's new multiple range method (p<0.05). As can be seen from Figures 7 and 8, the relative growth inhibition rate of the ΔDsADH mutant colonies is significantly higher than that of the wild type in PDA medium containing 1 mol / L KCl, 1 mol / L sorbitol and 20 mmol / L H2O2, indicating that the knockout of DsADH gene improves the sensitivity of mycelium to KCl, sorbitol and H2O2. In summary, the knockout of DsADH gene slightly improves the growth rate of D. segicola, and significantly improves the sensitivity to high salt and high osmotic stress and oxidative stress, indicating that the knockout of DsADH gene reduces the tolerance of D. segicola to high salt and high osmotic stress and oxidative stress.
[0074] Example 3, pathogenicity analysis of D. segicola knockout mutants
[0075] The wild type and ΔDsADH mutant of D. segicola were inoculated on PDA medium, respectively, and incubated in an incubator at 25°C for 7 days, and then a sterile puncher with a diameter of 4 mm was used to punch several fungus cakes at the edge of the colonies, which were then inoculated on the surface of tea leaves, and the tea leaf disease was investigated after 3 days.
[0076] The results of the pathogenicity determination of the D. segicola ΔDsADH mutant on tea leaves are shown in Figure 9, wherein Figure 9A is a plot of the lesions of the D. segicola wild type strain and the mutant strain ΔDsADH on tea leaves 3 days after inoculation; and Figure 9B is a plot of the lesion area measurement results of the mycelium of the D. segicola wild type strain and the mutant strain ΔDsADH on tea leaves 3 days after inoculation, wherein the vertical coordinate is the lesion area measurement, and the values are the mean values based on 20 independent experiments, and the data are analyzed by Duncan's new multiple range method (p<0.05). As can be seen from Figure 9, compared with the wild type, the lesion area of the ΔDsADH mutant on tea leaves is significantly reduced, indicating that after knocking out the DsADH gene, the pathogenicity of D. segicola is significantly reduced.
[0077] The conventional techniques and schemes not described in detail in the above examples are well known in the art, and thus will not be described in detail herein. The above examples and / or experimental examples describe the preferred embodiments of the present application in detail, however, the present application is not limited to the specific details in the above embodiments, and within the technical concept of the present application, various simple modifications can be made to the technical scheme of the present application, and these simple modifications all belong to the protection scope of the present application.
Claims
1. The application of DsADH protein in regulating the pathogenicity and / or growth rate and / or reproductive capacity and / or stress resistance of Didymella segeticola, characterized in that, The DsADH protein is a protein with the amino acid sequence shown in SEQ ID NO.3 or a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a protein with the sequence shown in SEQ ID NO.
3.
2. The use of biomaterials related to the DsADH protein described in claim 1 in regulating the pathogenicity and / or growth rate and / or reproductive capacity and / or stress resistance of D. segeticola, characterized in that, The biomaterial includes a nucleic acid molecule encoding the DsADH protein or an expression cassette, recombinant vector, or recombinant microorganism containing the nucleic acid molecule.
3. The application as described in claim 2, characterized in that, The nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO.1 or SEQ ID NO.
2.
4. The use of the DsADH protein as a target in the design and screening of antifungal drugs as described in claim 1.
5. The use of the DsADH protein as described in claim 1 or the biological material as described in claim 2 or 3 in the cultivation of transgenic D. segeticola with reduced pathogenicity and / or increased growth rate and / or reduced reproductive capacity or reduced resistance to adverse conditions.
6. A method for breeding transgenic *D. segeticola* with reduced pathogenicity and / or increased growth rate and / or reduced reproductive capacity and / or reduced resistance to adverse conditions, characterized in that, The method includes the step of reducing the expression level and / or activity of the DsADH protein as described in claim 1 in the receptor D. segeticola to obtain transgenic D. segeticola.
7. The method as described in claim 6, characterized in that, The method for reducing the expression level and / or activity of the DsADH protein as described in claim 1 in the receptor D. segeticola is achieved by knocking out, inhibiting, or silencing the gene encoding the DsADH protein in the receptor D. segeticola.
8. The method as described in claim 7, characterized in that, The knockout method is homologous recombination.
9. The method as described in claim 8, characterized in that, The method of homologous recombination involves introducing the homologous recombination fragment for homologous recombination into the protoplast of the receptor D. segeticola.
10. The application of the method according to any one of claims 6-9 in the prevention and control of diseases caused by D. segeticola.