Novel promoter for corynebacterium expression and use thereof

Abstract

The present invention relates to: a polynucleotide for a novel promoter capable of regulating the expression of a target gene in a microorganism of the genus Corynebacterium; a recombinant vector comprising the polynucleotide; a transformant transformed with the recombinant vector; and a method for producing L-amino acid using the transformant. A polynucleotide having promoter activity according to the present invention can enhance or weaken the expression of a target gene, and can efficiently regulate the production of a target substance through a transformant into which the polynucleotide is introduced, and thus can be effectively used to produce L-amino acids.

Description

Novel promoter for Corynebacterium expression and uses thereof

[0001] The present invention relates to a polynucleotide for a novel promoter capable of regulating the expression of a target gene in microorganisms of the genus Corynebacterium, a recombinant vector comprising said polynucleotide, a transformant transformed with said recombinant vector, and a method for producing L-amino acids using said transformant.

[0002] Corynebacterium is a Gram-positive bacterium and is traditionally the most widely used industrial microorganism for the production of amino acids and nucleic acid-related substances. In particular, Corynebacterium glutamicum has been biotechnologically important in the industrial production process of overall L-amino acids, such as L-glutamic acid, L-lysine, L-threonine, L-citrulline, and L-arginine, since its discovery in 1957.

[0003] Citrulline is one of the non-essential amino acids and performs useful functions in the body, such as promoting ammonia metabolism, improving blood flow through vasodilation, lowering blood pressure, nerve transmission, boosting immunity, and scavenging free radicals. In the kidneys, citrulline is metabolized into arginine and generates nitric oxide (NO). In other words, although citrulline is not an amino acid that constitutes proteins in the body, it is one of the intermediates of the urea cycle; it is produced from arginine along with NO, a substance known for its vasodilating effects, and is further regenerated into arginine through condensation with aspartic acid.

[0004] Although arginine is classified as a non-essential amino acid, it is a semi-essential amino acid that must be supplied in growing children and in specific conditions such as stress, trauma, or cancer. It is widely used as an ingredient in amino acid fortifiers, pharmaceuticals, and foods. In pharmaceuticals, it is used as a liver function enhancer, brain function enhancer, male infertility treatment, and comprehensive amino acid preparation; in food, it is used as an additive for fish paste, health drinks, and as a salt substitute for patients with hypertension.

[0005] Methods to improve the production efficiency of L-amino acids have been utilized, such as amplifying the expression of genes involved in amino acid biosynthetic pathways or modifying the gene promoters to enhance the activity of proteins encoded by those genes. Korean Registered Patent Publication No. 10-1053429 discloses a method for producing basic amino acids such as L-lysine, L-ornithine, L-arginine, L-histidine, and L-citrulline by enhancing the activity of acetyl-CoA synthetase, while Korean Registered Patent Publication No. 10-1504900 discloses a promoter variant of transketolase involved in carbon metabolism, suggesting that the production efficiency of amino acids such as L-lysine increases as the activity of transketolase increases due to the promoter modification.

[0006] However, existing methods for producing L-amino acids using gene or promoter mutations still require improvement in terms of gene specificity and production efficiency. Therefore, to increase L-amino acid production, it is essential to discover and develop new promoters capable of regulating the expression intensity of related genes.

[0007] [Prior Art Literature]

[0008] [Patent Literature]

[0009] Korean Registered Patent Publication No. 10-1053429

[0010] Korean Registered Patent Publication No. 10-1504900

[0011] The present invention aims to provide a polynucleotide having a novel promoter sequence.

[0012] In addition, the present invention aims to provide a recombinant vector comprising the above-mentioned polynucleotide.

[0013] In addition, the present invention aims to provide a transformant transformed with the recombinant vector.

[0014] In addition, the present invention aims to provide a method for producing L-amino acids using the above-mentioned transformant.

[0015] One aspect of the present invention provides a polynucleotide represented by any one of SEQ ID NOs 1 to 3 having promoter activity.

[0016] The term "polynucleotide" used in the present invention refers to a polymer of nucleotides in which nucleotide monomers are linked together in a long chain by covalent bonds, and is a DNA or RNA strand of a certain length or longer.

[0017] As used in this invention, the term “promoter” refers to a specific region of DNA that regulates the initiation of gene transcription, including a binding site for RNA polymerase that initiates the mRNA transcription of a target gene; generally, it is located upstream of the transcription initiation site. In prokaryotes, the promoter is defined around the transcription initiation site where RNA polymerase binds, and generally consists of two short nucleotide sequences separated by base pairs of the -10 and -35 regions forward of the transcription initiation site.

[0018] The polynucleotide having promoter activity in the present invention may be modified from the original promoter by all or part of deletion, substitution, addition, or a combination thereof in the polynucleotide sequence of the PH36 promoter reported as a strong promoter (Biotechnol Bioeng. 2013 Nov;110(11):2959-69.). Here, deletion means a change in which a base, nucleotide, polynucleotide, or nucleic acid is removed; substitution means a change in which a base, nucleotide, polynucleotide, or nucleic acid is replaced with another base, nucleotide, polynucleotide, or nucleic acid; and addition means a change in which another base, nucleotide, polynucleotide, or nucleic acid is added.

[0019] Specifically, a ribosome-binding site (RBS) may be attached to the end of the PH36 promoter and a point mutation may be induced on the PH36 promoter.

[0020] The above RBS is a nucleotide sequence upstream of the initiation codon of the mRNA transcript, and plays a role in recruiting ribosomes during translation initiation.

[0021] The polynucleotide having promoter activity according to the present invention may be represented by any one of SEQ ID NOs 1 to 3, and by regulating the transcription of the target gene, the expression or activity of the polypeptide or protein encoded by the target gene may be increased (enhanced), unchanged, or decreased (weakened) compared to before modification.

[0022]

[0023] Another aspect of the present invention provides a recombinant vector comprising the aforementioned polynucleotide.

[0024] As used in the present invention, the term "vector" refers to any type of nucleic acid sequence carrier structure used as a means to deliver and express a target gene to a mutation target (host cell). Unless otherwise specified, the vector may mean a structure in which a carried nucleic acid sequence is inserted into the host cell genome to be expressed and / or expressed independently. Such a vector comprises an essential regulatory element operably linked to enable the expression of the gene insertion, where "operably linked" means that the target gene and its regulatory sequence are linked in a manner in which they are functionally coupled to enable gene expression, and the "regulatory element" or "regulatory sequence" includes a promoter for performing transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation, etc.

[0025] The vector used in the present invention is not particularly limited as long as it is capable of replicating within a host cell, and any vector known in the art may be used. Examples of such vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors, but are not limited thereto.

[0026] The above vector can typically be constructed as a vector for cloning or as a vector for expression. The vector for expression may be a conventional one used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and may be constructed through various methods known in the art.

[0027] The “recombinant vector” used in the present invention may be constructed using a prokaryotic or eukaryotic cell as a host, and may be capable of replication independently of the host cell’s genome or may be sealed to the genome itself. The host cell is capable of replication by the vector and may include a replication origin, which is a specific nucleotide sequence at which replication is initiated. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it generally includes a potent promoter capable of proceeding transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. When the host is a eukaryotic cell, the replication origins included in the vector that operate in eukaryotic cells include, but are not limited to, f1 replication origins, SV40 replication origins, pMB1 replication origins, adeno replication origins, AAV replication origins, and BBV replication origins. In addition, promoters derived from the genome of mammalian cells (e.g., metallothionine promoters) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, HSV tk promoter) may be used and generally have a polyadenylation sequence as a transcription termination sequence.

[0028] The above-mentioned recombinant vector may include a selection marker, which is intended to select transformants (host cells) transformed by the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, the selection of transformed cells is possible. Representative examples of the selection marker include ampicillin, kanamycin, streptomycin, and chloramphenicol, but are not limited thereto.

[0029] The recombinant vector in the present invention may comprise a polynucleotide having the promoter activity and a target gene.

[0030] The above target gene is operably linked to a polynucleotide having promoter activity, and may be, for example, a gene encoding a product (e.g., polypeptide) to be increased or decreased in expression, a reporter gene capable of quantifying expression, but is not limited thereto.

[0031] According to one embodiment of the present invention, the target gene may be a gene involved in the amino acid biosynthesis pathway.

[0032] The genes involved in the above amino acid biosynthetic pathway are derived from ordinary amino acid-producing microorganisms and may be wild-type obtained in a natural state or from mutant strains modified to enhance the amino acid production capacity of the wild-type. For example, they may be genes encoding proteins such as enzymes, transcription factors, and transporters that act in the synthesis and release of amino acids, but are not limited thereto.

[0033] Here, amino acids refer to L-amino acids and may be, for example, L-alanine, L-valine, L-leucine, L-isoleucine, L-proline, L-phenylalanine, L-tryptophan, L-methionine, L-glycine, L-serine, L-threonine, L-cysteine, L-tyrosine, L-asparagine, L-glutamine, L-aspartic acid, L-glutamic acid, L-lysine, L-citrulline, L-arginine, L-histidine, etc., but are not limited thereto.

[0034] In addition, according to one embodiment of the present invention, the target gene may be a reporter gene.

[0035] The above reporter gene may be green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), red fluorescent protein (RFP), enhanced red fluorescent protein (eRFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (eYFP), etc., but is not limited thereto.

[0036]

[0037] Another aspect of the present invention provides a transformant transformed with the aforementioned recombinant vector.

[0038] As used in this invention, “transformation” refers to a phenomenon in which external DNA is introduced into a host cell to artificially induce a genetic change, and “transformant” refers to a host cell into which external DNA is introduced to stably maintain the expression of a target gene.

[0039] The above transformation may be performed by selecting a vector introduction technique suitable for the host cell to express the target gene or a recombinant vector containing it within the host cell. For example, vector introduction may be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene may be included without limitation, whether inserted into the chromosomes of the host cell or located extrachromosomally, as long as it can be expressed within the host cell.

[0040] The gene inserted into the recombinant vector for transformation of the present invention can be introduced into a host cell through homologous recombination crossing over.

[0041] The above transformant comprises cells that have been transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used interchangeably with recombinant host cells, recombinant cells, or recombinant microorganisms.

[0042] The transformant in the present invention may be one other than a human.

[0043] According to one embodiment of the present invention, the transformant may be of the genus Corynebacterium.

[0044] The aforementioned genus Corynebacterium includes Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, and Corynebacterium pacaense), Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium pollitisoli pollutisoli), Corynebacterium imitans,It may be Corynebacterium caspium, Corynebacterium testudinoris, Corynebacterium pseudopelargi, Corynebacterium flavescens, etc., but is not limited thereto.

[0045] For example, the above transformant may be Corynebacterium glutamicum.

[0046] The transformant according to the present invention may comprise a polynucleotide represented by SEQ ID NO. 1, 2, or 3 having promoter activity and a target gene, or a vector comprising the same, or a strain expressing the polynucleotide and the target gene, but is not limited thereto.

[0047] According to one embodiment of the present invention, the transformant may have the ability to produce L-amino acids.

[0048] The above-mentioned transformant may have the ability to produce L-amino acids naturally, or may have been artificially endowed with the ability to produce L-amino acids.

[0049] According to one embodiment of the present invention, the transformant may have enhanced L-amino acid production capacity by enhancing the expression of the target gene with a polynucleotide represented by any one of SEQ ID NOs 1 to 3 instead of the target gene's own promoter.

[0050] As used in the present invention, “expression enhancement” or “expression enhancement” means that the expression level of a protein encoded by a target gene is increased compared to the original microorganism, i.e., the wild type or the strain before modification.

[0051] The term “improved L-amino acid production capacity” as used in the present invention means that the productivity of L-amino acids is increased compared to the parent strain. The parent strain refers to a wild-type or mutant strain that is the subject of mutation, and includes the subject that is directly subjected to mutation or transformed by a recombinant vector, etc. In the present invention, the parent strain may be a wild-type Corynebacterium or a Corynebacterium genus mutated from the wild-type.

[0052] The above-mentioned transformant with enhanced L-amino acid production capacity has an L-amino acid production of at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the parent strain, or 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times, 20 times, 30 times, 40 times, It may be increased by 50, 60, 70, 80, 90, or 100 times, but is not limited to this.

[0053] The transformant according to the present invention can be used as a composition for producing L-amino acids.

[0054] Specifically, the above composition may be a composition for producing L-amino acids comprising the above transformant.

[0055]

[0056] Another aspect of the present invention provides a method for producing L-amino acids, comprising the steps of: culturing the aforementioned transformant in a medium; and recovering L-amino acids from the transformant or the medium in which the transformant is cultured.

[0057] The above culture may be carried out according to appropriate media and culture conditions known in the art, and a person skilled in the art can easily adjust and use the media and culture conditions. Specifically, the media may be liquid media, but is not limited thereto. The culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination thereof, but is not limited thereto.

[0058] According to one embodiment of the present invention, the medium must satisfy the requirements of a specific strain in an appropriate manner and may be appropriately modified by a person skilled in the art. For culture media for strains of the genus Corynebacterium, reference may be made to the known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but is not limited thereto.

[0059] According to one embodiment of the present invention, the culture medium may contain various carbon sources, nitrogen sources, and trace element components. Carbon sources that may be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that may be used include peptone, yeast extract, meat broth, malt extract, corn steep liquid, soybean meal, and urea or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that may be used may include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts. Additionally, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but are not limited thereto. Furthermore, essential growth substances such as amino acids and vitamins may be included. In addition, suitable precursors may be used in the culture medium. The medium or individual components may be added to the culture solution in a batch or continuous manner in a manner suitable for the culture process, but are not limited thereto.

[0060] According to one embodiment of the present invention, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the microbial culture medium in an appropriate manner during cultivation. Additionally, bubble formation can be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester during cultivation. Furthermore, oxygen or an oxygen-containing gas (e.g., air) can be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium can typically be 20°C to 45°C, for example, 25°C to 40°C. The cultivation period can be continued until a desired amount of useful material is obtained, for example, 10 to 160 hours.

[0061] According to one embodiment of the present invention, the step of recovering L-amino acids from the cultured mutant strain and the medium in which the mutant strain is cultured may involve collecting or recovering L-amino acids produced from the medium using a suitable method known in the art according to the culture method. For example, methods such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), and chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but are not limited thereto.

[0062] According to one embodiment of the present invention, the step of recovering L-amino acids may involve removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0063] According to one embodiment of the present invention, the step of recovering the L-amino acid may include a process of purifying the L-amino acid.

[0064] According to one embodiment of the present invention, the L-amino acid may be one or more selected from the group consisting of L-alanine, L-valine, L-leucine, L-isoleucine, L-proline, L-phenylalanine, L-tryptophan, L-methionine, L-glycine, L-serine, L-threonine, L-cysteine, L-tyrosine, L-asparagine, L-glutamine, L-aspartic acid, L-glutamic acid, L-lysine, L-citrulline, L-arginine, and L-histidine.

[0065] The polynucleotide having promoter activity according to the present invention can enhance or weaken the expression of a target gene, and since the production of a target substance can be efficiently controlled through a transformant into which such a polynucleotide is introduced, it can be usefully utilized for producing L-amino acids.

[0066] The present invention will be described in more detail below. However, this description is provided merely as an example to aid in understanding the invention, and the scope of the invention is not limited by this exemplary description.

[0067]

[0068] Example 1. Production of a new promoter

[0069] We produced a new promoter to secure promoters of various centuries.

[0070] First, a primary synthesis (PH36RBS) was performed by linking an Escherichia coli-derived RBS sequence (SEQ No. 5) to the PH36 promoter (SEQ No. 4), and based on this, a final promoter was synthesized by inserting a base G or C as a point mutation at the -86 bp position relative to the start codon ATG. Here, the promoter with G inserted was named PH36RBS-1, and the promoter with C inserted was named PH36RBS-2.

[0071] The sequences of the PH36 promoter and the produced promoter are shown in Table 1 below.

[0072] Promoter NamePromoter Sequence (5'-3') SEQ ID NO: PH36TCTATCTGTGCCCTAAACGGGGGAATATTAACGGGCCCAGGGTGGTCGCACCTTGGTTGGTAGGAGTAGCATGGGATCCATG4PH36RBSTCTATCTGGTGCCCTAAACGGG GGAATATTAACGGGCCCAGGGTGGTCGCACCTTGGTTGGTAGGAGTAGCATGGGATCCAGGAGGCGCCCTGCAGAAAAGATCTTTTAAGAAGGAGATATACATATG1PH36RBS-1TCTATCTGGTGC CCTAAACGGGGAATAATTAACGGGCCCGAGGGTGGTCGCACCTTGGTTGGTAGGAGTAGCATGGGATCCAGGAGGCGCCCTGCAGAAAAGATCTTTTAAGAAGGAGATATACATATG2PH36RBS-2T CTATCTGGTGCCCTAAACGGGGAATAATTAACGGGCCCCAGGGTGGTCGCACCTTGGTTGGTAGGAGTAGCATGGGATCCAGGAGGCGCCCTGCAGAAAAGATCTTTTAAGAAGGAGATATACATATG3

[0073]

[0074] Experimental Example 1. Evaluation of Promoter Activity

[0075] The activity of three novel promoters produced in Example 1 was evaluated in comparison with the PH36 promoter. As a control, the promoter of the trc gene encoding the serine / threonine-protein kinase of Corynebacterium glutamicum (Ptrc, SEQ ID NO. 6) was used.

[0076] After attaching RFP as a target gene to the end of each promoter, it was introduced into Corynebacterium glutamicum, and promoter activity was measured. The results are shown in Table 2 below.

[0077] Promoter Name RFP Fluorescence Intensity (24-hour incubation) Normalized RFP Fluorescence Intensity Ptrc 40 80.73 PH36 10 75 2.64 PH36 RBS 22 48 5.51 PH36 RBS - 13 4 45 6.07 PH36 RBS - 24 8 33 17.46

[0078] As shown in Table 2 above, the fluorescence sensitivity of the three new promoters increased by at least 2 times compared to PH36, and in particular, it was confirmed that the fluorescence sensitivity of PH36RBS-1 and PH36RBS-2 increased by approximately 1.1 times and 3.1 times, respectively, compared to PH36RBS. Therefore, it was found that the activity of a promoter having any one of the nucleotide sequences of SEQ ID NOs 1 to 3 according to the present invention was improved compared to the conventional PH36 promoter.

[0079]

[0080] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.

Claims

1. A polynucleotide represented by any one of SEQ ID NOs 1 to 3 having promoter activity.

2. A recombinant vector comprising the polynucleotide of Claim 1 and a target gene.

3. In Claim 2, The above target gene is a recombinant vector in which the gene involved in the amino acid biosynthesis pathway.

4. A transformant transformed with the recombinant vector of claim 2.

5. In Claim 4, The above transformant is a transformant of the genus Corynebacterium.

6. In Claim 4, The above-mentioned transformant is a transformant having the ability to produce amino acids.

7. A step of culturing the transformant of claim 4 in a medium; and A method for producing L-amino acids comprising the step of recovering L-amino acids from the transformant or the medium in which the transformant is cultured.

8. In Claim 7, A method in which the above L-amino acid is one or more selected from the group consisting of L-alanine, L-valine, L-leucine, L-isoleucine, L-proline, L-phenylalanine, L-tryptophan, L-methionine, L-glycine, L-serine, L-threonine, L-cysteine, L-tyrosine, L-asparagine, L-glutamine, L-aspartic acid, L-glutamic acid, L-lysine, L-citrulline, L-arginine, and L-histidine.