Method for producing l-valine
By genetically engineering Escherichia coli and optimizing the L-valine production pathway, the problems of high cost and numerous byproducts in existing technologies have been solved, achieving efficient L-valine production.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- MEIHUA BIOTECH LANGFANG CO LTD
- Filing Date
- 2025-12-15
- Publication Date
- 2026-06-25
AI Technical Summary
Existing methods for producing L-valine are costly, produce numerous byproducts, and are difficult to achieve efficient large-scale production.
The L-valine production pathway was optimized by genetically modifying Escherichia coli, including NagA inactivation mutation, LeuDH-encoded protein mutation, IlvBN amino acid sequence mutation, gene knockout to reduce byproduct production, and transhydrogenase activity enhancement.
This improved the conversion rate of L-valine, reduced production costs, decreased the generation of byproducts, and achieved efficient L-valine production.
Smart Images

Figure PCTCN2025142662-FTAPPB-I100001 
Figure PCTCN2025142662-FTAPPB-I100002 
Figure PCTCN2025142662-FTAPPB-I100003
Abstract
Description
A method for producing L-valine
[0001] priority
[0002] This application claims the rights and priority of Chinese application No. 2024118547810, filed on December 16, 2024. The entire contents of Chinese application No. 2024118547810 are incorporated herein by reference for all purposes. Technical Field
[0003] This disclosure pertains to the field of bacterial fermentation, and particularly relates to a method for producing L-valine by using bacterial fermentation. Background Technology
[0004] L-valine is a natural essential amino acid widely used in animal feed. Therefore, there is an urgent need to improve L-valine production to reduce its production costs, ensure feed supply, and replace soybean meal, which is of great significance to national food security.
[0005] There are several methods for producing L-valine, including extraction, synthesis, and fermentation. Extraction is costly and unsuitable for modern industrial production; chemical synthesis is not only costly and complex, with numerous steps and many byproducts; fermentation, utilizing microbial fermentation, is a highly economical method due to its low raw material costs, mild reaction conditions, and large-scale production potential. Many strains are used for L-valine production, with Corynebacterium glutamicum and Escherichia coli being the most frequently reported. Anaerobic growth rescue has transformed Escherichia coli from mixed acid fermentation to isoform fermentation of n-butanol, D-lactic acid, succinic acid, ethanol, and L-alanine. The principle is to block the NADH consumption pathway in Escherichia coli, thus depriving it of its anaerobic growth ability, and then introduce the NADH consumption pathway, thereby rescuing it from anaerobic growth. This is a highly efficient breeding method.
[0006] The *E. coli* *nagA* gene encodes N-acetylglucosamine-6-phosphate deacetylase. This enzyme participates in the metabolic pathways of N-acetylglucosamine. N-acetylglucosamine is an important amino sugar involved in various biological processes, such as cell wall synthesis. In *E. coli*, this enzyme catalyzes the deacetylation of N-acetylglucosamine-6-phosphate to form glucosamine-6-phosphate, a key step in the metabolic pathway of glucosamine entering the cell. The *nagA* gene not only encodes an enzyme with metabolic functions but also plays a role in gene expression regulation. Studies have shown that mutations in the *nagA* gene lead to the accumulation of N-acetylglucosamine-6-phosphate, which affects the expression of the regulator of the *nag* operon, thereby affecting the expression of genes related to N-acetylglucosamine uptake and metabolism, suggesting a potential role for N-acetylglucosamine-6-phosphate deacetylase in gene expression regulation. The structural and functional characteristics of N-acetylglucosamine-6-phosphate deacetylase are closely related to its catalytic activity. Its active site contains specific amino acid residues that participate in substrate binding and catalytic reactions. Through specific binding to the substrate N-acetylglucosamine-6-phosphate, the enzyme can efficiently catalyze deacetylation to produce the product glucosamine-6-phosphate. Summary of the Invention
[0007] On the one hand, this disclosure provides a modified bacterium for producing L-valine, wherein the bacterium includes a NagA-inactivating modification compared to unmodified bacteria.
[0008] In one specific embodiment, the modification that inactivates NagA is a termination mutation at any amino acid position of NagA or a termination mutation caused by a frameshift mutation of the NagA gene. Preferably, the frameshift mutation is a deletion of base G at position 422 of the NagA gene, resulting in a mutation of glycine to alanine at position 141 of the amino acid sequence. After the frameshift mutation, amino acid position 169 of the sequence is a stop codon.
[0009] In one specific embodiment, the modified bacteria comprises a nucleic acid sequence as shown in SEQ ID NO: 47 or an amino acid sequence as shown in SEQ ID NO: 48.
[0010] In one specific implementation, the modified bacteria are selected from Escherichia coli.
[0011] In one specific embodiment, the modified bacteria further includes a mutation in the leucine dehydrogenase LeuDH-encoded protein that increases L-valine production; preferably, the mutation is selected from LeuDH. V22I .
[0012] In one specific implementation, the modified bacteria, wherein the LeuDH is derived from lysine-containing Bacillus.
[0013] In one specific implementation, the modified bacteria comprises one or more LeuDH cells. V22I Gene copies are preferably two to eleven, such as two, three, four, five, six, seven, eight, nine, ten, or eleven copies, with eight or ten copies being more preferred.
[0014] In one specific embodiment, the modified bacteria further includes an amino acid sequence mutation of the acetylhydroxy acid synthase IlvBN, preferably, the mutation being selected from IlvBN. G20D IlvBN V21D and IlvBN M22F .
[0015] In one specific implementation, the modified bacteria further includes modifications to reduce the production of byproducts.
[0016] In one specific embodiment, the modified bacteria, wherein the modification for reducing byproduct production is selected from all knockouts, truncations and simultaneous repair of frameshift mutations to wild type, or other truncations that reduce activity by more than 10%, of avtA, ldhA, mgsA, frd, pflB, adhE, ackA, alaA and / or alaC.
[0017] In one specific embodiment, the modified bacteria contain a modification that enhances the activity of the transhydrogenase pntAB. Preferably, the modification is selected from modifications that increase the pntAB gene copy number and promoter modifications. Preferably, the promoter modification is the insertion of a strong Ptac or PldhA promoter.
[0018] In one specific embodiment, the modified bacteria include a modification that enhances nadK activity. Preferably, the modification is selected from modifications that increase the copy number of the nadK gene and promoter modifications. Preferably, the promoter modification is the insertion of a strong Ptac or PldhA promoter.
[0019] In one specific embodiment, the modified bacteria further comprises one or more modifications that enhance the activity of ilvC, ilvD, and / or ilvE.
[0020] In one specific implementation, the modified bacteria contains one or more copies of the ilvC gene, preferably two to ten copies, such as two, three, four, five, six, seven, eight, nine, or ten copies, with five copies being more preferred.
[0021] In one specific implementation, the modified bacteria contains one or more copies of the ilvD gene, preferably two to ten copies, such as two, three, four, five, six, seven, eight, nine, or ten copies, with four copies being more preferred.
[0022] In one specific implementation, the modified bacteria contains one or more copies of the ilvE gene, preferably two to ten copies, such as two, three, four, five, six, seven, eight, nine, or ten copies, with three copies being more preferred.
[0023] In one specific implementation, the modified bacteria are grown under anaerobic or aerobic conditions.
[0024] On the other hand, the use of the modified bacteria described in this disclosure in increasing L-valine production is provided.
[0025] On the other hand, a method for producing L-valine is provided, comprising culturing the modified bacteria described in this disclosure in a culture medium.
[0026] In one specific embodiment, the culture medium contains glucose.
[0027] In one specific embodiment, the method further includes separating L-valine.
[0028] On the other hand, a bioreactor includes the modified bacteria described in this disclosure. Beneficial effects
[0029] The genetically engineered bacteria disclosed herein have a high valine conversion rate. Attached Figure Description
[0030] This disclosure can be more fully understood with reference to the following figures.
[0031] Figure 1 illustrates the anaerobic valine metabolic pathway in Escherichia coli.
[0032] Figure 2 shows the changes in L-valine production when Synthesized 1.0 and Synthesized 2.0 are superimposed with the nagA mutation, respectively. Detailed Implementation
[0033] The following description of this disclosure is merely intended to illustrate various embodiments of the disclosure. Therefore, the specific modifications discussed should not be construed as limiting the scope of this disclosure. It will be apparent to those skilled in the art that various equivalents, changes, and modifications can be made without departing from the scope of this disclosure, and it should be understood that these equivalent embodiments are included herein. All references cited herein, including publications, patents, and patent applications, are incorporated herein by reference in their entirety.
[0034] To enable those skilled in the art to better understand the present disclosure, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present disclosure, and not all embodiments.
[0035] Experimental Materials and Methods
[0036] (1) Strains and culture media
[0037] Plasmids were constructed using *Escherichia coli* DH5α as the cloning host, and *E. coli* Synthesized 1.0 was used as the starting strain for modification. The cultures were incubated at 37°C on LB broth (liquid or solid). The LB broth formulation consisted of 5 g / L yeast extract, 10 g / L peptone, and 10 g / L sodium chloride. 1.5-2% agar powder was added to the solid culture. The working concentrations of the antibiotics used were: kanamycin 50 μg / mL, spectinomycin 100 μg / mL, chloramphenicol 25 μg / mL, and bleomycin 50 μg / mL. L-rhamnose and L-arabinose were added at a concentration of 10 mM.
[0038] NBSA and AM1A media supplemented with 2-12% (w / v) glucose were used as acclimatization and fermentation media, respectively. The media formulations are shown in Table 1. Taking 2% glucose supplementation as an example, the medium is called NBSAG20 or AM1AG20, where G represents glucose and 20 represents the glucose concentration (g / L). In the initial acclimatization for valine production, the strain was grown in antibiotic-free NBSA inorganic salt medium at 37°C, with 100 mM ammonium sulfate, 1 mM betaine, and 2% (w / v) glucose added. The strains involved in this disclosure are shown in Table 3.
[0039] Table 1. Formulations of NBS and AM1 culture media
[0040] Table 2. Micronutrient formulation
[0041] Table 3. Strains used
[0042] (2) Construction methods of strains and plasmids
[0043] The pTargetF series plasmids were constructed by replacing the N20-1 sequence (catcgccgcagcggtttcag) on pTargetF (Addgene: 62226) using QuickChange. The pTargetF plasmid names and their corresponding N20 sequences used in strain construction are shown in Table 4.
[0044] Table 4. Plasmids used in this disclosure
[0045] Table 5. Primers used in this disclosure
[0046] (3) Anaerobic fermentation in acclimatization bottles
[0047] Single colonies of the acclimatized bacteria were streaked and inoculated into 4 mL LB broth, incubated at 37°C and 240 rpm for 24 h. 1% was then transferred to 250 mL sealed Erlenmeyer flasks and cultured on NBS AG50 medium, incubated at 37°C and 120 rpm for 18 h. Finally, 10% was inoculated into 500 mL sealed Erlenmeyer flasks on AMI AG100 medium, incubated at 37°C and 500 rpm, with the pH adjusted to 7.0 using 30-50% concentrated ammonia, and cultured for 24 h.
[0048] (4) Determination of valine yield by high performance liquid chromatography
[0049] Using a UV spectrophotometer at 600 nm (OD) 600 E. coli biomass was determined by absorbance at a specific temperature. Glucose concentration was determined using an SBA-40C biosensor (Shandong Academy of Sciences, China) or high-performance liquid chromatography (HPLC). L-valine concentration was determined by HPLC after derivatization with phthalaldehyde. An acetonitrile / water (50:50, v / v) mixture and 50 mM sodium acetate were used as the mobile phase at a flow rate of 1 mL / min, and the UV detection wavelength was 360 nm.
[0050] Example
[0051] To enable those skilled in the art to better understand the present disclosure, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present disclosure, and not all embodiments.
[0052] Example 1: Constructing Synthesized 1.0
[0053] L-valine exhibits feedback inhibition of acetylhydroxyl synthase, the first-step enzyme derived from pyruvate. Acetylhydroxyl synthase is a heterodimer encoded by IlvB and IlvN. Mutations in IlvN (G20D, V21D, M22F) can relieve the feedback inhibition of L-valine (Park, JH, etc. Fed-Batch Culture of Escherichia coli for L-Valine Production Based on In Silico Flux Response Analysis. Biotechnology and Bioengineering 2011, 108, 934-946, doi: 10.1002 / bit.22995). The second-step enzyme, acetylhydroxyl isomerase, is encoded by ilvC, with a cofactor preference of NADPH. The third-step enzyme, dihydroxylase, is encoded by ilvD. The final enzyme is a branched-chain aminotransferase encoded by ilvE, with a NADPH preference for the synthesis of the amino donor L-glutamate. In addition to introducing feedback-resistant ilvBN into *E. coli* ATCC 8739, this disclosure also overexpresses an additional copy of ilvED and NADH-preferring *Corynebacterium glutamicum*-derived ilvC and *Bacillus lysinus*-derived leuDH via the tac promoter to utilize NADH produced by the upstream pathway. To make the L-valine synthesis pathway the sole pathway consuming pyruvate and NADH, key enzymes in the pathway, including ethanol, acetic acid, lactate, succinic acid, and formic acid, namely adhE, ackA, ldhA, mgsA, frd, pflB, and avtA, were knocked out. Furthermore, ygaZH, encoding a branched-chain amino acid efflux protein, and the global regulatory factor lrp were also enhanced using the tac promoter. To address the generation of L-alanine byproducts, two additional alanine synthesis-related aminotransferases, alaA and alaC, were knocked out. Furthermore, the terminal pathway was enhanced by integrating five expression cassettes: PldhA-ilvCcg, PldhA-leuDH, PldhA-ilvBN (G20D, V21D, M22F), PldhA-ilvD, and Ptac-ilvC. For added protection, PldhA-nadK and Ptac-pntAB were also integrated to enhance NADPH supply, resulting in the Synthesized 1.0 strain (Figure 1). The specific construction of the Synthesized 1.0 strain is as follows:
[0054] 1.1 Insertion of Ptac-ilvBN at the adhE site mut
[0055] (1) Construction of pEcgRNA-adhE plasmid:
[0056] The synthesized oligosaccharide nucleic acids adhE-F / adhE-R were annealed and self-assembled to form a double-stranded sequence. The reaction system consisted of 5 μl T4 ligase buffer, 5 μl primer adhE-F (20 μM), 5 μl primer adhE-R (20 μM), and 35 μl ddH2O. The reaction conditions were: incubation at 95℃ for 5 min, decreasing the temperature by 5–10℃ per minute, followed by incubation at 16℃ for 10 min. The self-assembled double-stranded sequence was diluted 200-fold, and 1 μl of the linearized fragment of pEcgRNA (Addgene: 166581) digested with BsaI was ligated using T4 ligase. The ligation product was transformed into DH5α chemocompetent cells, and the recovered bacterial culture was plated on LB agar plates containing spectinomycin (final concentration 50 μg / mL) to obtain transformants containing the pEcgRNA-adhE plasmid.
[0057] (2) Preparation of electroporation fragments:
[0058] Following the method described in patent document CN112662607A, the plasmid pTargetT-Ptac-stlA(exo) was constructed using the following steps:
[0059] Using the genome of *E. coli* Nissle 1917 as a template, PCR amplification was performed using primers exo-F1 / exo-R1 and exo-F2 / exo-R2 to obtain exo-UP and exo-DN fragments, each approximately 600 bp. Using p57-tac plasmid as a template, PCR amplification was performed using primers tac(exo)-F / tac-R to obtain the tac(exo) fragment, approximately 2.1 kb. Using pTargetT-Ptac-stlA(rhtC) plasmid as a template, PCR amplification was performed using primers stlA(rhtC)-F / stlA(exo)-R to obtain the stlA(exo) fragment, approximately 1.6 kb. The exo-UP, tac(exo), stlA(exo), and exo-DN fragments were then assembled using DNA assembly methods. The kit was purchased from TransGen. The pTargetF-exo (modified from Addgene: 62226, with the N20-1 sequence (catcgccgcagcggtttcag changed to N20: tttattgatatatttacgtc) was cloned into the EcoRI / HindIII site to obtain the pTargetT-Ptac-stlA(exo) plasmid.
[0060] Using the E. coli ATCC8739 genome as a template, PCR amplification was performed using primers adhE-F1(KO) / adhE-R1(KO), adhE-F2(KO) / adhE-R2(KO), ilvBNm-F1 / ilvBNm-R1, and ilvBNm-F2 / ilvBNm-R2 to obtain the following fragments: adhE-UP, adhE-DN, ilvBNm-1, and ilvBNm-2, with approximate values of 530 bp, 550 bp, and 1.8 kb, respectively. b and 400bp; using pTargetT-Ptac-stlA(exo)(CN112662607A) plasmid as template and Ptac-F(TY) / Ptac-R as primers, PCR amplification yielded a Ptac fragment of approximately 200bp; using adhE-UP, adhE-DN, ilvBNm-1, ilvBNm-2, and Ptac fragments as templates and adhE-F1(KO) / adhE-R2(KO) as primers, overlap PCR amplification yielded a Ptac-ilvBNm(adhE) fragment of approximately 3.4kb.
[0061] (3) Preparation of competent cells:
[0062] The pEcCas(MC_0101208) plasmid was transformed into *E. coli* ATCC 8739 chemically competent cells. Transformants were obtained by screening on LB agar plates containing kanamycin (50 μg / mL) (the preparation method for chemically competent cells is described in *Molecular Cloning: A Laboratory Manual*, 3rd edition). Single colonies of ATCC8739 / pEcCas were picked and incubated in 4 mL LB tubes containing kanamycin (50 μg / mL) at 37°C and 220 rpm. 600 When the concentration was 0.4, arabinose was added to a final concentration of 10 mM for induction, and the cells were cultured for another hour to prepare electrocompetent cells (for the preparation method of electrocompetent cells, refer to Li, 2021, Acta Biochim Biophys Sin.ibid.).
[0063] (4) Electrostatic transfer:
[0064] The Ptac-ilvBNm(adhE) fragment and pEcgRNA-adhE plasmid were electroporated into ATCC8739 / pEcCas competent cells (electroporation conditions: 2.5kV, 200Ω, 25μF). The cells were plated on LB plates containing spectinomycin (50μg / ml) and kanamycin (50μg / ml) and incubated overnight at 37°C. Single colonies were grown and colony PCR was performed using the adhE-VF / ilvBN-VR primers to verify the colony. The positive fragment was approximately 1kb.
[0065] (5) Loss of pEcgRNA-adhE plasmid:
[0066] Single colonies that were positive for PCR were picked and inoculated into LB tubes containing kanamycin (final concentration 50 μg / ml), along with 10 mM rhamnose, and incubated overnight at 37°C. The next day, the bacterial culture was streaked directly onto LB agar plates containing kanamycin (final concentration 50 μg / ml) and incubated overnight at 37°C. The following day, single colonies were picked and transferred to LB agar plates containing spectinomycin (final concentration 50 μg / ml). If no growth was observed, it indicated that the pEcgRNA-adhE plasmid had been lost, yielding ATCC8739(ΔadhE::Ptac-ilvBN). mut ) / pEcCas strain.
[0067] (6) pEcCas plasmid loss:
[0068] Pick ATCC 8739(ΔadhE::Ptac-ilvBN mut Positive clones of pEcCas were directly cultured overnight at 37°C on an antibiotic-free LB medium using a shaker. A small amount of the bacterial culture was streaked onto 10 g / L sucrose LB agar plates for single colony agarization. Single colonies were identified on LB agar plates containing kanamycin (50 μg / mL) to verify pEcCas plasmid elimination. ATCC8739(ΔadhE::Ptac-ilvBN) was obtained. mut ).
[0069] 1.2. Insertion of Ptac-leuDH at the avtA site
[0070] (1) Construction of pEcgRNA-avtA plasmid:
[0071] The synthesized oligosaccharide nucleic acids avtA-F / avtA-R were annealed and self-assembled to form a double-stranded sequence. The reaction system consisted of: 5 μl T4 ligase buffer, 5 μl primer avtA-F (20 μM), 5 μl primer avtA-R (20 μM), and 35 μl ddH2O. The reaction conditions were: incubation at 95℃ for 5 min, decreasing the temperature by 5–10℃ per minute, followed by incubation at 16℃ for 10 min. The self-assembled double-stranded sequence was diluted 200-fold, and 1 μl of the sequence was ligated with the BsaI-digested linearized fragment of pEcgRNA using T4 ligase. The ligation product was transformed into DH5α chemocompetent cells, and the recovered bacterial culture was plated on LB agar plates containing spectinomycin (final concentration 50 μg / mL) to obtain transformants containing the pEcgRNA-avtA plasmid.
[0072] (2) Preparation of electroporation fragments:
[0073] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers avtA-F1(KO) / avtA-R1(KO) and avtA-F2(KO) / avtA-R2(KO) to obtain avtA-UP and avtA-DN fragments, approximately 500 bp each. Using the pTargetT-Ptac-stlA(exo) plasmid (CN112662607A) as a template, and primers Ptac-F(avtA) / Ptac-R, the fragments were amplified. The Ptac(avtA) fragment, approximately 200 bp, was obtained by PCR amplification. Using pUC-leuDH plasmid (synthesized by GenScript) as a template and leuDH-F / leuDH-R as primers, the leuDH fragment was amplified by PCR. The leuDH gene sequence is shown in Table 6 and is approximately 1.1 kb. Using avtA-UP, avtA-DN, Ptac(avtA), and leuDH fragments as templates and avtA-F1(KO) / avtA-R2(KO) as primers, the Ptac-leuDH(avtA) fragment, approximately 2.3 kb, was obtained by overlap PCR amplification.
[0074] (3) Preparation of competent cells:
[0075] The pEcCas(Addgene: 62225) plasmid was transformed into E. coli ATCC 8739(ΔadhE::Ptac-ilvBN). mut ATCC 8739 (ΔadhE::Ptac-ilvBN) was obtained by screening competent cells on LB agar plates containing kanamycin (50 μg / mL). mut Competent cells / pEcCas transformants (for the preparation of competent cells through chemical transformation, refer to *Molecular Cloning: A Laboratory Manual* (3rd edition)). Pick ATCC 8739 (ΔadhE::Ptac-ilvBN). mut A single colony of ) / pEcCas was cultured in a 4 mL LB tube containing kanamycin (50 μg / mL) at 37°C and 220 rpm. The bacterial concentration was determined by OD0.05. 600 When the concentration was 0.4, arabinose was added to a final concentration of 10 mM for induction, and the cells were cultured for another hour to prepare electrocompetent cells (for the preparation method of electrocompetent cells, refer to Li, 2021, Acta Biochim Biophys Sin.ibid.).
[0076] (4) Electrostatic transfer:
[0077] The Ptac-leuDH(avtA) fragment and pEcgRNA-avtA plasmid were electroporated into ATCC 8739(ΔadhE::Ptac-ilvBN). mutSingle colonies were grown in leuDH-VF / avtA-VR primers and verified by colony PCR. The positive fragment was about 1.3kb.
[0078] (5) Loss of pEcgRNA-avtA plasmid:
[0079] The method is the same as 1.1(5) in Example 1, and ATCC8739(ΔadhE::Ptac-ilvBN) is obtained. mut , ΔavtA::Ptac-leuDH) / pEcCas strain.
[0080] 1.3. Insertion of Ptac-ilvC at the ldhA site cg
[0081] (1) Construction of pEcgRNA-ldhA plasmid:
[0082] The two synthesized oligosaccharide nucleic acids ldhA-F / ldhA-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-ldhA plasmid.
[0083] (2) Preparation of electroporation fragments:
[0084] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers ldhA-F1(KO) / ldhA-R1(KO) and ldhA-F2(KO) / ldhA-R2(KO) to obtain ldhA-UP and ldhA-DN fragments, approximately 500 bp each. Using the pTargetT-Ptac-stlA(exo)(CN112662607A) plasmid as a template, and primers Ptac-F(ldhA) / Ptac-R2(KO), PCR amplification was performed to obtain ldhA-UP and ldhA-DN fragments, approximately 500 bp each. Primers were used to amplify the Ptac(ldhA) fragment by PCR, which was approximately 200 bp. Using pUC-ilvCcg plasmid (synthesized by GenScript) as a template and ilvCcg-F / ilvCcg-R as primers, the ilvCcg fragment was amplified by PCR. The gene sequence is shown in Table 6, which is approximately 1 kb. Using ldhA-UP, ldhA-DN, Ptac(ldhA), and ilvCcg fragments as templates and ldhA-F1(KO) / ldhA-R2(KO) as primers, the Ptac-ilvCcg(ldhA) fragment was amplified by overlap PCR, which was approximately 2.3 kb.
[0085] (3) Electrostatic transfer:
[0086] The method is the same as in 1.1(3) and (4) of Example 1. The Ptac-ilvCcg(ldhA) fragment and pEcgRNA-ldhA plasmid were electroporated into ATCC8739(ΔadhE::Ptac-ilvBN) mut In competent cells of ΔavtA::Ptac-leuDH) / pEcCas, single colonies were verified by colony PCR using primers ldhA-VF / ilvCcg-VR, and the positive fragment was approximately 1.2kb.
[0087] (4) Loss of pEcgRNA-ldhA plasmid:
[0088] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN) mut , ΔavtA::Ptac-leuDH, ΔldhA::Ptac-ilvCcg) / pEcCas strain.
[0089] Table 6. Gene sequences and aminoase sequences
[0090] 1.4. mgsA site insertion into Ptac-lrp
[0091] (1) Construction of pEcgRNA-mgsA plasmid:
[0092] The two synthesized oligosaccharide nucleic acids mgsA-F / mgsA-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-mgsA plasmid.
[0093] (2) Preparation of electroporation fragments:
[0094] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers mgsA-F1(KO) / mgsA-R1(KO), mgsA-F2(KO) / mgsA-R2(KO), and lrp-F / lrp-R to obtain mgsA-UP, mgsA-DN, and lrp fragments, approximately 450bp, 400bp, and 600bp, respectively. Using the pTargetT-Ptac-stlA(exo)(CN112662607A) plasmid as a template, PCR amplification was performed using primers Ptac-F(TY) / Ptac-R to obtain the Ptac fragment, approximately 200bp. Using the mgsA-UP, mgsA-DN, lrp, and Ptac fragments as templates, and primers mgsA-F1(KO) / mgsA-R2(KO), overlap... PCR amplification yielded a Ptac-lrp(mgsA) fragment, approximately 1.7 kb.
[0095] (3) Electrostatic transfer:
[0096] The method is the same as in 1.1(3) and (4) of Example 1. The Ptac-lrp(mgsA) fragment and pEcgRNA-mgsA plasmid were electroporated into ATCC8739(ΔadhE::Ptac-ilvBN) mut In competent cells, single colonies were verified by colony PCR using the mgsA-VF / lrp-VR primers. The positive fragment was approximately 1 kb.
[0097] (4) Loss of pEcgRNA-mgsA plasmid:
[0098] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN) mut , ΔavtA::Ptac-leuDH, ΔldhA::Ptac-ilvCcg, ΔmgsA::Ptac-lrp) / pEcCas strain.
[0099] 1.5. FRD site insertion of Ptac-ygaZH
[0100] (1) Construction of pEcgRNA-frd plasmid:
[0101] The synthesized two oligosaccharide nucleic acids, frd-F and frd-R, were annealed to form a double-stranded sequence. The method was the same as in Example 1, section 1.1.
[0102] (1) Obtain the pEcgRNA-frd plasmid.
[0103] (2) Preparation of electroporation fragments:
[0104] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers frd-F1(KO) / frd-R1(KO), frd-F2(KO) / frd-R2(KO), and ygaZH-F / ygaZH-R to obtain frd-UP, frd-DN, and ygaZH fragments, approximately 500bp, 450bp, and 1.1kb, respectively. Using frd-UP, frd-DN, ygaZH, and Ptac fragments as templates, and frd-F1(KO) / frd-R2(KO) as primers, overlap PCR amplification was performed to obtain the Ptac-ygaZH(frd) fragment, approximately 2.3kb.
[0105] (3) Electrostatic transfer:
[0106] The method is the same as 1.1(3) and (4) in Example 1. The Ptac-ygaZH(frd) fragment and pEcgRNA-frd plasmid were electroporated into ATCC8739(ΔadhE::Ptac-ilvBN) mut In competent cells, single colonies were verified by colony PCR using primers frd-VF / ygaZH-VR. The positive fragment was approximately 1.2 kb.
[0107] (4) Loss of pEcgRNA-frd plasmid:
[0108] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN) mut , ΔavtA::Ptac-leuDH, ΔldhA::Ptac-ilvCcg, ΔmgsA::Ptac-lrp, Δfrd::Ptac-ygaZH) / pEcCas strain.
[0109] 1.6. pflB gene knockout
[0110] (1) Construction of pEcgRNA-pflB plasmid:
[0111] The synthesized two oligosaccharide nucleic acids, pflB-F / pflB-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-pflB plasmid.
[0112] (2) Preparation of electroporation fragments:
[0113] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using pflB-F1(KO) / pflB-R1(KO) and pflB-F2(KO) / pflB-R2(KO) as primers to obtain pflB-UP and pflB-DN fragments, each approximately 400 bp. Using pflB-UP and pflB-DN fragments as templates, and pflB-F1(KO) / pflB-R2(KO) as primers, overlap PCR amplification was performed to obtain the pflB(KO) fragment, approximately 800 bp.
[0114] (3) Electrostatic transfer:
[0115] The method is the same as 1.1(3) and (4) in Example 1. The pflB(KO) fragment and pEcgRNA-pflB plasmid were electroporated into ATCC8739(ΔadhE::Ptac-ilvBN) mutIn competent cells, single colonies were verified by colony PCR using primers pflB-VF / pflB-R2(KO), and the positive fragment was approximately 1 kb.
[0116] (4) Loss of pEcgRNA-pflB plasmid:
[0117] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN) mut , ΔavtA::Ptac-leuDH, ΔldhA::Ptac-ilvCcg, ΔmgsA::Ptac-lrp, Δfrd::Ptac-ygaZH, ΔpflB) / pEcCas strain.
[0118] 1.7. ackA site insertion Ptac-ilvED
[0119] (1) Construction of pEcgRNA-ackA plasmid:
[0120] The two synthesized oligosaccharide nucleic acids ackA-F / ackA-R were annealed to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-ackA plasmid.
[0121] (2) Preparation of electroporation fragments:
[0122] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers ackA-F1(KO) / ackA-R1(KO), ackA-F2(KO) / ackA-R2(KO), and ilvED-F / ilvED-R to obtain ackA-UP, ackA-DN, and ilvED fragments, approximately 550bp, 500bp, and 2.8kb, respectively. Using ackA-UP, ackA-DN, ilvED, and Ptac fragments as templates, and primers ackA-F1(KO) / ackA-R2(KO), overlap PCR amplification was performed to obtain the Ptac-ilvED(ackA) fragment, approximately 4.2kb.
[0123] (3) Electrostatic transfer:
[0124] The method is the same as in 1.1(3) and (4) of Example 1. The Ptac-ilvED(ackA) fragment and pEcgRNA-ackA plasmid were electroporated into ATCC8739(ΔadhE::Ptac-ilvBN) mutIn competent cells, single colonies were verified by colony PCR using primers ackA-VF / ilvED-VR. The positive fragment was approximately 1.6 kb.
[0125] (4) Loss of pEcgRNA-ackA plasmid:
[0126] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN) mut , ΔavtA::Ptac-leuDH, ΔldhA::Ptac-ilvCcg, ΔmgsA::Ptac-lrp, Δfrd::Ptac-ygaZH, ΔpflB, ΔackA::Ptac-ilvED) / pEcCas strain.
[0127] (5) pEcCas plasmid loss:
[0128] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN) mut , ΔavtA::Ptac-leuDH, ΔldhA::Ptac-ilvCcg, ΔmgsA::Ptac-lrp, Δfrd::Ptac-ygaZH, ΔpflB, ΔackA::Ptac-ilvED), named TYS8975.
[0129] 1.8. alaA gene knockout
[0130] (1) Construction of pEcgRNA-alaA plasmid:
[0131] The two synthesized oligosaccharide nucleic acids alaA-F / alaA-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-alaA plasmid.
[0132] (2) Preparation of electroporation fragments:
[0133] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using alaA-F1(KO) / alaA-R1(KO) and alaA-F2(KO) / alaA-R2(KO) as primers to obtain alaA-UP and alaA-DN fragments of approximately 500bp and 400bp, respectively. Using alaA-UP and alaA-DN fragments as templates, and alaA-F1(KO) / alaA-R2(KO) as primers, overlap PCR amplification was performed to obtain the alaA(KO) fragment of approximately 900bp.
[0134] (3) Electrostatic transfer:
[0135] The method is the same as in Example 1, 1.1(3)(4). The alaA(KO) fragment and pEcgRNA-alaA plasmid were electroporated into TYS8975 / pEcCas competent cells. Single colonies were verified by colony PCR using alaA-VF / alaA-R2(KO) primers. The positive fragment was approximately 1.1 kb.
[0136] (4) Loss of pEcgRNA-alaA plasmid
[0137] The method was the same as in Example 1, 1.1(5), to obtain the TYS8975(ΔalaA) / pEcCas strain.
[0138] (5) pEcCas plasmid loss:
[0139] The method was the same as in Example 1, 1.1(5), to obtain the TYS8975(ΔalaA) strain.
[0140] 1.9.alaC gene knockout
[0141] (1) Construction of pISFbalreRNA-alaC plasmid:
[0142] The two synthesized oligosaccharide nucleic acids alaC-F / alaC-R were replaced with the spacer sequence (CTGATGGTCCATGTCTGTTA) on pISFbalreRNA (Addgene: 226822) using QuickChange to obtain the pISFbalreRNA-alaC plasmid.
[0143] (2) Preparation of electroporation fragments:
[0144] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using alaC-F1(KO) / alaC-R1(KO) and alaC-F2(KO) / alaC-R2(KO) as primers to obtain alaC-UP and alaC-DN fragments, approximately 600bp and 500bp, respectively. Using alaC-UP and alaC-DN fragments as templates, and alaC-F1(KO) / alaC-R2(KO) as primers, overlap PCR amplification was performed to obtain the alaC(KO) fragment, approximately 1.1kb.
[0145] (3) Electrostatic transfer:
[0146] 300 ng of pISFbal (Addgene: 226820) plasmid was transformed into E. coli TYS8975(ΔalaA) electrocompetent cells. Transformants were obtained by screening on LB agar plates containing kanamycin (50 μg / mL). TYS8975(ΔalaA) / pISFbal transformants were inoculated into LB tubes containing 5 mL of kanamycin and cultured overnight at 37°C and 220 rpm. The overnight culture was then transferred at a 1% inoculum to fresh LB tubes containing kanamycin and a final concentration of 10 mM L-arabinose, and cultured at 37°C and 220 rpm until OD500 was reached. 600 The concentration was 0.6-0.8. Electroporation competent cells were prepared. The alaC(KO) fragment and pISFbalreRNA-alaC plasmid were electroporated into TYS8975(ΔalaA) / pISFbal competent cells. Single colonies were verified by colony PCR using alaC-VF / alaA-R2(KO) primers. The positive fragment was approximately 1.3kb.
[0147] (4) Loss of pISFbalreRNA-alaC and pISFbal plasmid:
[0148] Positive clones were inoculated into LB medium containing rhamnose (10 mM) and kanamycin and incubated overnight at 37°C. They were then diluted and plated or streaked onto solid LB agar plates containing kanamycin and incubated overnight at 37°C. Clones were randomly selected and spotted onto LB agar plates containing kanamycin and spectinomycin, respectively, for selection. Clones sensitive to spectinomycin successfully eliminated the plasmid. Next, to eliminate the pISFbal plasmid, spectinomycin-sensitive strains were inoculated into liquid LB medium and incubated overnight at 37°C. The bacterial culture was streaked onto LB agar plates containing 10 g / L sucrose and incubated overnight at 37°C. Single colonies were then randomly selected and selected on LB agar plates containing and without kanamycin. Colonies sensitive to kanamycin successfully eliminated the plasmid. After complete plasmid elimination, strain TYS8975 (ΔalaA, ΔalaC) was obtained and named strain TYS8976.
[0149] 1.10. Insert PldhA-ilvC at the lacZ site. cg
[0150] (1) Construction of pEcgRNA-ilvCcg(1acZ) plasmid:
[0151] The two synthesized oligosaccharide nucleic acids lacZ-F / lacZ-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-lacZ plasmid.
[0152] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers lacZ-F1(ld) / lacZ-R1(ld), lacZ-F2(ld) / lacZ-R2(ld), lacZ-F3(ld) / lacZ-R3(ld), Pldh-F / Pldh-R, and ilvCcg-F(ld) / ilvCcg-R(ld) to obtain lacZ1(ld), lacZ2(ld), lacZ3(ld), PldhA, and ilvCcg(ld) fragments, approximately 730bp, 500bp, 470bp, 830bp, and 1kb, respectively. The lacZ1(ld), lacZ2(ld), lacZ3(ld), PldhA, and ilvCcg(ld) fragments were then cloned into the EcoRI / Hind array of pEcgRNA-lacZ using a DNA assembly method (DNA assembly kit purchased from TransGen). At site III, the pEcgRNA-ilvCcg(lacZ) plasmid was obtained.
[0153] (2) Electrostatic transfer:
[0154] The method is the same as 1.1(3) and (4) in Example 1. pEcCas was electroporated into TYS8976 to obtain TYS8976 / pEcCas / . The pEcgRNA-ilvCcg(lacZ) plasmid was electroporated into TYS8976 / pEcCas competent cells. Single colonies were verified by colony PCR using lacZ-VF / ilvCcg-V-R2 primers. The positive fragment was about 2.1kb.
[0155] (3) Loss of pEcgRNA-ilvCcg(lacZ) plasmid:
[0156] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg ) / pEcCas strain.
[0157] 1.11. Insert PldhA-leuDH at the lacI site
[0158] (1) Construction of pEcgRNA-leuDH(lacI) plasmid:
[0159] The two synthesized oligosaccharide nucleic acids lacI-F / lacI-R were annealed to form a double-stranded sequence. The method was the same as in Example 1, 1.1(1), to obtain the pEcgRNA-lacI plasmid.
[0160] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers lacI-F1(ld) / lacI-R1(ld), lacI-F2(ld) / lacI-R2(ld), lacI-F3(ld) / lacI-R3(ld), and leuDH-F(ld) / leuDH-R(ld) to obtain lacI1(ld), lacI2(ld), lacI3(ld), and leuDH(ld) fragments, approximately 670 bp, 500 bp, 400 bp, and 1.1 kb, respectively. The lacI1(ld), lacI2(ld), lacI3(ld), PldhA, and leuDH(ld) fragments were cloned into the EcoR I / Hind III site of pEcgRNA-lacI using DNA assembly (DNA assembly kit purchased from TransGen), to obtain the pEcgRNA-leuDH(lacI) plasmid.
[0161] (2) Electrostatic transfer:
[0162] The method is the same as 1.1(3) and (4) in Example 1. The pEcgRNA-leuDH(lacI) plasmid was electroporated into TYS8976(ΔlacZ::PldhA-ilvC cgIn ) / pEcCas competent cells, single colonies were verified by colony PCR using leuDH-VF / lacI-VR primers, and the positive fragment was approximately 2.2kb.
[0163] (3) Loss of pEcgRNA-leuDH(lacI) plasmid:
[0164] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg , ΔlacI::PldhA-leuDH) / pEcCas strain.
[0165] 1.12. Insert PldhA-ilvD at the ydjK site
[0166] (1) Construction of pEcgRNA-ilvD(ydjK) plasmid:
[0167] The synthesized two oligosaccharide nucleic acids, ydjK-F / ydjK-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-ydjK plasmid.
[0168] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers ydjK-F1(ld) / ydjK-R1(ld), ydjK-F2(ld) / ydjK-R2(ld), ydjK-F3(ld) / ydjK-R3(ld), and ilvD-F(ld) / ilvD-R(ld) to obtain fragments ydjK1(ld), ydjK2(ld), ydjK3(ld), and ilvD(ld), approximately 650 bp, 460 bp, 350 bp, and 1.9 kb, respectively. The ydjK1(ld), ydjK2(ld), ydjK3(ld), PldhA, and ilvD(ld) fragments were then cloned into the EcoRI / Hind array of pEcgRNA-ydjK using a DNA assembly method (DNA assembly kit purchased from TransGen). At site III, the pEcgRNA-ilvD(ydjK) plasmid was obtained.
[0169] (2) Electrostatic transfer:
[0170] The method is the same as 1.1(3) and (4) in Example 1. The pEcgRNA-ilvD(ydjK) plasmid was electroporated into TYS8976(ΔlacZ::PldhA-ilvC cgIn competent cells, single colonies were verified by colony PCR using primers ydjK-VF / ilvD-VR, and the positive fragment was approximately 1.8 kb.
[0171] (3) Loss of pEcgRNA-ilvD(ydjK) plasmid:
[0172] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg , ΔlacI::PldhA-leuDH, ΔydjK::PldhA-ilvD) / pEcCas strain.
[0173] 1.13. Insert PldhA-nadK at the yaiT site
[0174] (1) Construction of pEcgRNA-nadK(yaiT) plasmid:
[0175] The synthesized two oligosaccharide nucleic acids, yaiT-F / yaiT-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as in 1.1(1) of Example 1, to obtain the pEcgRNA-yaiT plasmid.
[0176] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers yaiT-F1(ld) / yaiT-R1(ld), yaiT-F2(ld) / yaiT-R2(ld), yaiT-F3(ld) / yaiT-R3(ld), and nadK-F(ld) / nadK-R(ld) to obtain yaiT1(ld), yaiT2(ld), yaiT3(ld), and nadK(ld) fragments, approximately 650 bp, 460 bp, 350 bp, and 1.9 kb, respectively. The yaiT1(ld), yaiT2(ld), yaiT3(ld), PldhA, and nadK(ld) fragments were cloned into the EcoR I / Hind III site of pEcgRNA-yaiT using DNA assembly (DNA assembly kit purchased from TransGen), to obtain the pEcgRNA-nadK(yaiT) plasmid.
[0177] (2) Electrostatic transfer:
[0178] The method is the same as 1.1(3) and (4) in Example 1. The pEcgRNA-nadK(yaiT) plasmid was electroporated into TYS8976(ΔlacZ::PldhA-ilvC) cgIn competent cells, single colonies were verified by colony PCR using primers yaiT-VF / nadK-VR. The positive fragment was approximately 2.1 kb.
[0179] (3) Loss of pEcgRNA-nadK(yaiT) plasmid:
[0180] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg , ΔlacI::PldhA-leuDH, ΔydjK::PldhA-ilvD, ΔyaiT::PldhA-nadK) / pEcCas strain.
[0181] 1.14. Insert PldhA-ilvBN at the yihF site. mut
[0182] (1) pEcgRNA-ilvBN mut (yihF) plasmid construction:
[0183] The synthesized two oligosaccharide nucleic acids, yihF-F / yihF-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-yihF plasmid.
[0184] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers yihF-F1(ld) / yihF-R1(ld), yihF-F2(ld) / yihF-R2(ld), and yihF-F3(ld) / yihF-R3(ld) to obtain yihF1(ld), yihF2(ld), and yihF3(ld) fragments, approximately 730 bp, 510 bp, and 490 bp, respectively. Using the *Ptac-ilvBNm(adhE)* fragment as a template, PCR amplification was performed using primers ilvBN-F(ld) / ilvBN-R(ld) to obtain the ilvBNmut(ld) fragment, approximately 2.1 kb. The yihF1(ld), yihF2(ld), yihF3(ld), *PldhA*, and ilvBNmut(ld) fragments were then processed using DNA assembly methods. The kit was purchased from TransGen (Taiwan). The pEcgRNA-yihF site was cloned into the EcoR I / Hind III site to obtain pEcgRNA-ilvBN. mut (yihF) plasmid.
[0185] (2) Electrostatic transfer:
[0186] The method is the same as 1.1(3) and (4) in Example 1. pEcgRNA-ilvBN mut (yihF) plasmid was electrotransferred into TYS8976(ΔlacZ::PldhA-ilvC) cg In competent cells, single colonies were verified by colony PCR using primers yihF-VF / ilvBN-VR. The positive fragment was approximately 1.9 kb.
[0187] (3) pEcgRNA-ilvBN mut (yihF) plasmid loss:
[0188] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg , ΔlacI::PldhA-leuDH, ΔydjK::PldhA-ilvD, ΔyaiT::PldhA-nadK, ΔyihF::PldhA-ilvBN mut ) / pEcCas strain.
[0189] 1.15. Insert Ptac-ilvC at the yjcS site
[0190] (1) Construction of pEcgRNA-yjcS plasmid:
[0191] The synthesized two oligosaccharide nucleic acids, yjcS-F / yjcS-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-yjcS plasmid.
[0192] (2) Preparation of electroporation fragments:
[0193] Using the E. coli ATCC8739 genome as a template, PCR amplification was performed using primers yjcS-F1 / yjcS-R1, yjcS-F2 / yjcS-R2, yjcS-F3 / yjcS-R3, and ilvC-F(yjcS) / ilvC-R(yjcS) to obtain fragments yjcS-1, yjcS-2, yjcS-3, and ilvC(yjcS), with values of approximately 650 bp, 450 bp, 530 bp, and 1.6 kb, respectively. Using fragments yjcS-1, yjcS-2, yjcS-3, Ptac, and ilvC(yjcS) as templates, and primers yjcS-F1 / yjcS-R3, overlap PCR amplification was performed to obtain the Ptac-ilvC(yjcS) fragment, with a value of approximately 3.5 kb.
[0194] (3) Electrostatic transfer:
[0195] The method is the same as in 1.1(3) and (4) of Example 1. The Ptac-ilvC(yjcS) fragment and pEcgRNA-yjcS plasmid were electroporated into TYS8976(ΔlacZ::PldhA-ilvC) cg , ΔlacI::PldhA-leuDH, ΔydjK::PldhA-ilvD, ΔyaiT::PldhA-nadK, ΔyihF::PldhA-ilvBN mut In ) / pEcCas competent cells, single colonies were verified by colony PCR using yjcS-VF / ilvC-VR primers, and the positive fragment was approximately 1.4kb.
[0196] (4) Loss of pEcgRNA-yjcS plasmid:
[0197] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvCx) g , ΔlacI::PldhA-leuDH, ΔydjK::PldhA-ilvD, ΔyaiT::PldhA-nadK, ΔyihF::PldhA-ilvBN mut , ΔyjcS::Ptac-ilvC) / pEcCas strain.
[0198] 1.16. Insert Ptac-pntAB at the ybaP site
[0199] (1) Construction of pEcgRNA-ybaP plasmid:
[0200] The synthesized two oligosaccharide nucleic acids, ybaP-F / ybaP-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-ybaP plasmid.
[0201] (2) Preparation of electroporation fragments:
[0202] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers ybaP-F1 / ybaP-R1, ybaP-F2 / ybaP-R2, ybaP-F3 / ybaP-R3, and pntAB-F(ybaP) / pntAB-R(ybaP) to obtain ybaP-1, ybaP-2, ybaP-3, and pntAB(ybaP) fragments, approximately 670 bp, 520 bp, 560 bp, and 3.0 kb, respectively. Using ybaP-1, ybaP-2, ybaP-3, Ptac, and pntAB(ybaP) fragments as templates, and primers ybaP-F1 / ybaP-R3, overlap PCR amplification was performed to obtain the Ptac-pntAB(ybaP) fragment, approximately 5.0 kb.
[0203] (3) Electrostatic transfer:
[0204] The method is the same as 1.1(3) and (4) in Example 1. The Ptac-pntAB(ybaP) fragment and pEcgRNA-ybaP plasmid were electroporated into TYS8976(ΔlacZ::PldhA-ilvC cg , ΔlacI::PldhA-leuDH, ΔydjK::PldhA-ilvD, ΔyaiT::PldhA-nadK, ΔyihF::PldhA-ilvBN mut In competent cells, single colonies were verified by colony PCR using primers ybaP-VF / pntAB-VR, and the positive fragment was approximately 1.5 kb.
[0205] (4) Loss of pEcgRNA-ybaP plasmid:
[0206] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg , ΔlacI::PldhA-leuDH, ΔydjK::PldhA-ilvD, ΔyaiT::PldhA-nadK, ΔyihF::PldhA-ilvBN mut , ΔyjcS::Ptac-ilvC, ΔybaP::Ptac-pntAB) / pEcCas strains.
[0207] (5) pEcCas plasmid loss:
[0208] The method is the same as 1.1(5) in Example 1, to obtain TYS8976ΔlacZ::PldhA-ilvC cg, ΔlacI::PldhA-leuDH, ΔydjK::PldhA-ilvD, ΔyaiT::PldhA-nadK, ΔyihF::PldhA-ilvBN mut ,ΔyjcS::Ptac-ilvC,ΔybaP::Ptac-pntAB), named Synthesized 1.0.
[0209] Table 7. List of primers used in Example 1
[0210] The Synthesized 1.0 strain exhibited the following fermentation performance under anaerobic conditions: 5.48 g / L valine production after 48 hours; OD... 600 Approximately 0.73, with a production intensity of 0.11 g / L / h.
[0211] Example 2: Mutating nagA on Synthesized 1.0 or Synthesized 2.0
[0212] To increase valine production, this invention performed a frameshift mutation on nagA (nagA p.Gly141AlafsTer29), specifically the deletion of the 422nd base (G), resulting in a change from glycine to alanine at position 141. The mutated sequence then introduces a stop codon at position 169 (numbering restarts from position 141; position 29 after the frameshift mutation also becomes a stop codon). This reduces the open reading frame of NagA from 382 amino acids to 168 amino acids. The mutated nagA nucleic acid sequence is shown in SEQ ID NO: 47, and the amino acid sequence is shown in SEQ ID NO: 48.
[0213] First, we constructed homologous repair fragments of pTargetF-nagA and mutant nagA. Using nagAUF / nagAfs-R and nagAfs-F / nagADR primer pairs, we amplified nagAfs-1 and nagAfs-2 using Synthesized 1.0 and Synthesized 2.0 templates, respectively. Using nagAUF / nagADR primer pairs, and nagAfs-1 and nagAfs-2 templates, we obtained nagA p.Gly141AlafsTer29 HR via Overlap Extension PCR. pEcCas-2.0 was then transformed into Synthesized 1.0 and Synthesized 2.0, respectively, and screened on LB agar plates containing chloramphenicol to obtain Synthesized 1.0 / pEcCas-2.0 or Synthesized 2.0 / pEcCas-2.0 transformants. Inoculate either Synthesized 1.0 / pEcCas-2.0 or Synthesized 2.0 / pEcCas-2.0 into 5 mL LB tubes containing chloramphenicol and incubate overnight at 37°C and 220 rpm. Transfer the overnight culture to fresh LB tubes containing chloramphenicol and a final concentration of 10 mM L-arabinose at a 1% inoculation rate. Incubate at 37°C and 220 rpm until OD500 is reached. 600 Electrocompetent cells were prepared with a pH of 0.6-0.8. 300 ng pTargetF-nagA and 600 ng nagA p.Gly141AlafsTer29 HR were transduced into the above electrocompetent cells. The resuscitation solution was plated on LB agar plates containing chloramphenicol and spectinomycin and incubated overnight at 37°C. The nagA mutation was verified by PCR sequencing using primers nagAUF / nagADR. Correct clones were passaged in antibiotic-free LB liquid medium to eliminate all plasmids, yielding synthesized 1.0 nagA and synthesized 2.0 nagA cells.
[0214] As shown in Figure 2, the L-valine production of Synthesized 1.0nagA increased by about 8 g / L compared to Synthesized 1.0, and the L-valine production of Synthesized 2.0nagA increased by about 9 g / L compared to Synthesized 2.0, demonstrating that the frameshift mutation of nagA can increase valine production.
[0215] By incorporating references
[0216] The full contents of every patent and scientific document mentioned in this article are incorporated herein by reference for all purposes.
[0217] Equivalence
[0218] This disclosure may be embodied in other specific ways without departing from its spirit or essential characteristics. Therefore, the above embodiments should be considered illustrative in all cases and not as limiting of the invention described herein. Consequently, the scope of this disclosure is defined by the appended claims rather than by the foregoing description and is intended to be encompassed therein by all variations within the equivalent meaning and scope of the claims.
Claims
1. A modified bacterium that produces L-valine, wherein the bacterium comprises a NagA-inactivating modification.
2. The modified bacteria as described in claim 1, wherein the modification that inactivates NagA is a stop mutation that mutates any amino acid of NagA into a stop codon or a stop mutation caused by a frameshift mutation of the NagA gene, preferably, the frameshift mutation is a deletion of base G at position 422 of the NagA gene, resulting in a mutation of glycine to alanine at position 141 of the amino acid sequence, and the amino acid at position 169 of the sequence after the frameshift mutation is a stop codon.
3. The modified bacteria as described in claim 1 or 2, wherein the modified bacteria comprises a nucleic acid sequence as shown in SEQ ID NO: 47 or an amino acid sequence as shown in SEQ ID NO:
48.
4. The modified bacteria of any one of claims 1 to 3, further comprising a leucine dehydrogenase LeuDH mutation that increases L-valine production, preferably the mutation is LeuDH V22I .
5. The modified bacteria of any one of claims 1 to 4, comprising one or more LeuDH V22I gene copies, preferably two to ten copies, more preferably ten copies.
6. The modified bacteria of any one of claims 1 to 5, further comprising an acetohydroxy acid synthase IlvBN amino acid sequence mutation, preferably the mutation is selected from the group consisting of IlvBN G20D , IlvBN V21D , and IlvBN M22F .
7. The modified bacteria according to any one of claims 1 to 6, wherein the bacteria further comprises a modification to reduce the production of byproducts, preferably the modification to reduce the production of byproducts is selected from all knockouts, truncations and simultaneous repair of frameshift mutations to wild type, or other truncations with a reduction in activity of more than 10% of avtA, ldhA, mgsA, frd, pflB, adhE, ackA, alaA and / or alaC.
8. The modified bacteria according to any one of claims 1 to 7, wherein the bacteria comprises a modification that enhances the activity of the transhydrogenase pntAB, preferably, the modification is selected from modifications that increase the copy number of the pntAB gene and promoter modifications, preferably, the promoter modification is the insertion of a strong Ptac or PldhA promoter.
9. The modified bacteria according to any one of claims 1 to 8, wherein the bacteria comprises a modification that enhances nadK activity, preferably, the modification is selected from modifications that increase the copy number of the nadK gene and promoter modifications, preferably, the promoter modification is the insertion of a strong Ptac or PldhA promoter.
10. The modified bacteria according to any one of claims 1 to 9, wherein the bacteria further comprises one or more modifications that enhance the activity of ilvC, ilvD, and / or ilvE.
11. The modified bacteria as claimed in any one of claims 1 to 10, comprising one or more copies of the ilvC gene, preferably two to ten copies, more preferably five copies; comprising one or more copies of the ilvD gene, preferably two to ten copies, more preferably four copies; and / or comprising one or more copies of the ilvE gene, preferably two to ten copies, more preferably three copies.
12. Use of the modified bacteria as described in any one of claims 1 to 11 in increasing L-valine production.
13. A method for producing L-valine, comprising culturing the modified bacteria as described in any one of claims 1-11 in a culture medium.