Combination and method thereof for treating lipid disorders
HMGCR RNAi and dsRNA agents target HMGCR mRNA to lower lipid levels, providing an effective alternative to statins that reduces cholesterol without side effects.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- SHANGHAI ARGO BIOPHARMACEUTICAL CO LTD
- Filing Date
- 2025-12-19
- Publication Date
- 2026-06-25
AI Technical Summary
Current cholesterol-lowering drugs, such as statins, are effective but cause side effects like muscle pain and liver abnormalities, necessitating the need for alternative methods to reduce lipid levels without these drawbacks.
Combinations of HMGCR RNAi agents and non-HMGCR dsRNA therapeutic agents are used to selectively decrease lipid levels by inhibiting HMGCR expression, utilizing dsRNA strands with specific nucleotide sequences to target HMGCR mRNA.
The combination effectively reduces lipid levels, addressing the limitations of statins while minimizing side effects, thereby ameliorating lipid metabolism disorders.
Smart Images

Figure PCTCN2025143837-FTAPPB-I100001 
Figure PCTCN2025143837-FTAPPB-I100002 
Figure PCTCN2025143837-FTAPPB-I100003
Abstract
Description
COMBINATION AND METHOD THEREOF FOR TREATING LIPID DISORDERSField of the Invention
[0001] The invention relates, in part, to combinations and methods that can be used to treat lipid disorders.Background
[0002] High levels of cholesterol and in particular high levels of low-density lipoprotein (LDL) are well-recognized risk factors for the development of cardiovascular disease. Certain mutations in the gene encoding the low-density lipoprotein receptor (LDLR) reduce or prevent LDLR-mediated removal of LDL-C from the blood. HMG-CoA reductase (also known as 3-hydroxy-3-methylglutaryl-Coenzyme A reductase, HMGCR, hydroxymethylglutaryl-CoA reductase) is a transmembrane glycoprotein that catalyzes the rate-limiting, committed step in cholesterol biosynthesis, i.e., the conversion of 3-hydroxy-3-methylglutaryl-Coenzyme A (HMG-CoA) to mevalonate, a crucial intermediate in the formation of cholesterol and many nonsteroidal isoprenoid compounds including isopentenyladenine, ubiquinone, dolichol and prenyl groups which posttranslationally modify cell proteins (Aboushadi et al., Biochemistry, 2000, 39, 237-247; Asslan et al., Biochem. Biophys. Res. Commun., 1999, 260, 699-706; Istvan and Deisenhofer, Biochim. Biophys. Acta, 2000, 1529, 9-18) . HMG-CoA reductase translation and degradation rates are controlled by sterol compounds and nonsterol metabolites derived from mevalonate, and short term regulation is achieved by a bicyclic cascade involving reversible phosphorylation of both HMG-CoA reductase and reductase kinases (Asslan et al., Biochem. Biophys. Res. Commun., 1999, 260, 699-706) .
[0003] Since the reaction catalyzed by HMG-CoA reductase is the rate-limiting step in cholesterol synthesis, this enzyme represents the major drug target for contemporary cholesterol-lowering drugs in humans. Statins are widely used drugs for cholesterol lowering and have been found to reduce cardiovascular disease and mortality in those who are at high risk. However, some patients experience side effects of statins including muscle pain, increased risk of hyperlipidemia mellitus, and abnormalities in liver enzyme tests (Naci H, et al. (2013) . Circ Cardiovasc Qual Outcomes 6 (4) : 390-9) .
[0004] Accordingly, there is a need for combinations and methods for lowering the amount of lipid in human blood, thereby ameliorating at least one symptom of lipid metabolism disorders.Summary of the Invention
[0005] In general, the present disclosure features combinations comprising HMGCR RNAi agents and non-HMGCR dsRNA therapeutic agents that can be used to treat lipid disorders in subjects described herein. The combinations described herein can selectively and efficiently decrease the lipid level in a subject, e.g., a human or animal subject.
[0006] According to an aspect of the invention, a combination comprising a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) is provided, wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2 or 3 nucleotides from the nucleotide sequence of SEQ ID NO: l, 3 or 5 and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1, 2 or 3 nucleotides from the nucleotide sequence of SEQ ID NO: 2, 4 or 6, wherein the sense strand and the antisense strand can be partially, substantially, or fully complementary to each other.
[0007] In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to part of an mRNA encoding HMGCR which comprises at least 15, 16, 17, 18 or 19 contiguous nucleotides with 0, 1, 2, 3, 4 or 5 mismatches. In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to a target region of HMGCR mRNA transcript which comprises at least 15, 16, 17, 18 or 19 contiguous nucleotides with 0, 1, 2, 3, 4 or 5 mismatches.
[0008] In some embodiments, the HMGCR RNA transcript is SEQ ID NO: 1.
[0009] In some embodiments, the target region of HMGCR mRNA transcript is any one of nucleotides 96-116, 97-117, 98-116, 99-117, 99-119, 101-121, 103-121, 103-123, 105-123, 104-124, 106-124, 105-125, 107-125, 106-126, 108-126, 107-127, 109-127, 108-128, 110-128, 109-129, 111-129, 110-130, 112-130, 113-133, 115-133, 120-140, 122-140, 150-170, 152-170, 181-201, 183-201, 185-205, 187-205, 186-206, 188-206, 188-208, 190-208, 189-209, 191-209, 191-211, 193-211, 193-213, 194-214, 195-213, 196-216, 198-216, 197-217, 199-217, 199-219, 201-219, 202-222, 204-222, 203-223, 205-223, 204-224, 206-224, 205-225, 207-225, 206-226, 208-226, 207-227, 209-227, 208-228, 210-228, 210-230, 212-230, 211-231, 213-231, 212-232, 214-232, 214-234, 216-234, 215-235, 217-235, 216-236, 218-236, 217-237, 219-237, 218-238, 220-238, 221-241, 223-241, 222-242, 224-242, 223-243, 225-243, 224-244, 226-244, 225-245, 227-245, 226-246, 228-246, 227-247, 229-247, 228-248, 230-248, 229-249, 231-249, 230-250, 232-250, 234-254, 236-254, 236-256, 238-256, 237-257, 239-257, 238-258, 240-258, 240-260, 242-260, 243-263, 245-263, 244-264, 246-264, 246-266, 248-266, 247-267, 249-267, 249-269, 251-269, 253-273, 255-273, 257-277, 259-277, 263-283, 265-283, 265-285, 267-285, 269-289, 271-289, 270-290, 272-290, 271-291, 273-291, 272-292, 274-292, 273-293, 275-293, 275-295, 277-295, 278-298, 280-298, 279-299, 281-299, 280-300, 282-300, 281-301, 283-301, 282-302, 284-302, 283-303, 285-303, 284-304, 286-304, 285-305, 287-305, 287-307, 289-307, 293-313, 295-313, 294-314, 296-314, 295-315, 297-315, 296-316, 298-316, 298-318, 300-318, 299-319, 301-319, 320-340, 322-340, 324-344, 326-344, 325-345, 327-345, 326-346, 328-346, 327-347, 329-347, 330-350, 332-350, 331-351, 333-351, 332-352, 334-352, 334-354, 336-354, 335-355, 337-355, 336-356, 338-356, 337-357, 339-357, 338-358, 340-358, 339-359, 341-359, 340-360, 342-360, 341-361, 343-361, 342-362, 344-362, 344-364, 346-364, 345-365, 347-365, 346-366, 348-366, 347-367, 349-367, 348-368, 350-368, 349-369, 351-369, 350-370, 352-370, 351-371, 353-371, 352-372, 354-372, 353-373, 355-373, 354-374, 356-374, 99-119, 100-120, 102-122, 111-131, 112-132, 114-134, 115-135, 116-136, 117-137, 118-138, 119-139, 121-141, 122-142, 123-143, 124-144, 125-145, 126-146, 127-147, 128-148, 129-149, 130-150, 131-151, 132-152, 133-153, 134-154, 135-155, 136-156, 137-157, 138-158, 139-159, 140-160, 141-161, 142-162, 143-163, 144-164, 145-165, 146-166, 147-167, 148-168, 149-169, 151-171, 152-172, 153-173, 154-174, 155-175, 156-176, 157-177, 158-178, 159-179, 160-180, 161-181, 162-182, 163-183, 164-184, 165-185, 166-186, 167-187, 168-188, 169-189, 170-190, 171-191, 172-192, 173-193, 174-194, 175-195, 176-196, 177-197, 178-198, 179-199, 180-200, 182-202, 183-203, 184-204, 187-207, 190-210, 192-212, 194-214, 195-215, 198-218, 200-220, 201-221, 209-229, 213-233, 219-239, 220-240, 231-251, 232-252, 233-253, 235-255, 239-259, 241-261, 242-262, 245-265, 248-268, 250-270, 251-271, 252-272, 254-274, 255-275, 256-276, 258-278, 259-279, 260-280, 261-281, 262-282, 264-284, 266-286, 267-287, 268-288, 274-294, 276-296, 277-297, 286-306, 288-308, 289-309, 290-310, 291-311, 292-312, 297-317, 300-320, 301-321, 302-322, 303-323, 304-324, 305-325, 306-326, 307-327, 308-328, 309-329, 310-330, 311-331, 312-332, 313-333, 314-334, 315-335, 316-336, 317-337, 318-338, 319-339, 321-341, 322-342, 323-343, 328-348, 329-349, 333-353, 343-363, 355-375, 356-376, 357-377, 358-378, 359-379, 120-140, 185-205, 215-235, 216-236, 221-241, 234-254, 244-264, 253-273, 263-283, 265-285, 272-292, 275-295, 287-307, 298-318, 324-344, 325-345, 326-346, 332-352, 345-365, 392-412, 416-436, 422-442, 423-443, 458-478, 611-631, 1063-1083, 1505-1525, 3088-3108, 3089-3109, 3100-3120, 3189-3209, 3201-3221, 3318-3338, 3458-3478, 3462-3482, 3465-3485, 434-454, 454-474, 1103-1123, 1283-1303, 1395-1415, 1474-1494, 1488-1508, 1544-1564, 2157-2177, 2412-2432, 2714-2734, 3090-3110, 3224-3244, 392-412, 394-412, 393-413, 395-413, 412-432, 414-432, 413-433, 415-433, 414-434, 416-434, 415-435, 417-435, 416-436, 418-436, 418-438, 420-438, 419-439, 421-439, 420-440, 422-440, 422-442, 424-442, 423-443, 425-443, 424-444, 426-444, 425-445, 427-445, 426-446, 428-446, 427-447, 429-447, 428-448, 430-448, 429-449, 431-449, 430-450, 432-450, 431-451, 433-451, 432-452, 434-452, 433-453, 435-453, 434-454, 436-454, 435-455, 437-455, 436-456, 438-456, 437-457, 439-457, 438-458, 440-458, 439-459, 441-459, 440-460, 442-460, 441-461, 443-461, 442-462, 444-462, 450-470, 452-470, 451-471, 453-471, 452-472, 454-472, 454-474, 456-474, 455-475, 457-475, 458-478, 460-478, 461-481, 463-481, 465-485, 467-487, 469-487, 469-489, 471-489, 474-494, 476-494, 475-495, 477-495, 524-544, 526-544, 527-547, 529-547, 532-552, 534-552, 538-558, 540-558, 540-560, 542-560, 541-561, 543-561, 545-565, 547-565, 552-572, 554-572, 555-575, 557-575, 558-578, 560-578, 561-581, 563-581, 562-582, 564-582, 565-585, 567-585, 567-587, 569-587, 568-588, 570-588, 570-590, 572-590, 575-595, 577-595, 577-597, 579-597, 578-598, 580-598, 579-599, 581-599, 580-600, 582-600, 581-601, 583-601, 606-626, 608-626, 607-627, 609-627, 611-631, 613-631, 612-632, 614-632, 614-634, 616-634, 615-635, 617-635, 617-637, 619-637, 618-638, 620-638, 621-641, 623-641, 623-643, 625-643, 624-644, 626-644, 625-645, 627-645, 628-648, 630-648, 629-649, 631-649, 632-652, 634-652, 636-656, 638-656, 639-659, 641-659, 662-682, 664-682, 663-683, 665-683, 664-684, 666-684, 668-688, 670-688, 672-692, 674-692, 676-696, 678-696, 681-701, 683-701, 689-709, 691-709, 690-710, 692-710, 695-715, 697-715, 697-717, 699-717, 699-719, 701-719, 708-728, 710-728, 711-731, 713-731, 715-735, 717-735, 719-739, 721-739, 742-762, 744-762, 746-766, 748-766, 754-774, 756-774, 816-836, 818-836, 866-886, 868-886, 867-887, 869-887, 870-890, 872-890, 884-904, 886-904, 887-907, 889-907, 888-908, 890-908, 894-914, 896-914, 927-947, 929-947, 930-950, 932-950, 934-954, 936-954, 941-961, 943-961, 943-963, 945-963, 944-964, 946-964, 948-968, 950-968, 949-969, 951-969, 951-971, 953-971, 952-972, 954-972, 954-974, 956-974, 971-991, 973-991, 973-993, 975-993, 975-995, 977-995, 996-1016, 999-1019, 1043-1063, 1045-1063, 1044-1064, 1046-1064, 1050-1070, 1052-1070, 1052-1072, 1054-1072, 1063-1083, 1065-1083, 1065-1085, 1067-1085, 1070-1090, 1072-1090, 1074-1094, 1076-1094, 1075-1095, 1077-1095, 1092-1112, 1094-1112, 1094-1114, 1096-1114, 1103-1123, 1105-1123, 1106-1126, 1108-1126, 1107-1127, 1109-1127, 1152-1172, 1154-1172, 1161-1181, 1163-1181, 1173-1193, 1175-1193, 1175-1195, 1177-1195, 1177-1197, 1179-1197, 1221-1241, 1223-1241, 1226-1246, 1228-1246, 1227-1247, 1229-1247, 1258-1278, 1260-1278, 1268-1288, 1270-1288, 1272-1292, 1274-1292, 1276-1296, 1278-1296, 1283-1303, 1285-1303, 1289-1309, 1290-1310, 1292-1310, 1297-1317, 1299-1317, 1308-1328, 1310-1328, 1337-1357, 1339-1357, 1340-1360, 1342-1360, 1341-1361, 1343-1361, 1361-1381, 1363-1381, 1395-1415, 1397-1415, 1468-1488, 1470-1488, 1474-1494, 1476-1494, 1475-1495, 1477-1495, 1476-1496, 1478-1496, 1478-1498, 1480-1498, 1488-1508, 1490-1508, 1496-1516, 1498-1516, 1500-1520, 1502-1520, 1501-1521, 1503-1521, 1502-1522, 1504-1522, 1505-1525, 1507-1525, 1509-1529, 1511-1529, 1511-1531, 1513-1531, 1512-1532, 1514-1532, 1534-1554, 1536-1554, 1535-1555, 1537-1555, 1542-1562, 1544-1562, 1544-1564, 1546-1564, 1547-1567, 1549-1567, 1563-1583, 1565-1583, 1607-1627, 1609-1627, 1612-1632, 1614-1632, 1617-1637, 1619-1637, 1641-1661, 1643-1661, 1642-1662, 1644-1662, 1644-1664, 1646-1664, 1899-1919, 1901-1919, 1968-1988, 1970-1988, 1978-1998, 1980-1998, 1985-2005, 1987-2005, 1990-2010, 1992-2010, 1992-2012, 1994-2012, 1998-2018, 2000-2018, 2001-2021, 2003-2021, 2022-2042, 2024-2042, 2023-2043, 2025-2043, 2091-2111, 2093-2111, 2098-2118, 2100-2118, 2125-2145, 2127-2145, 2126-2146, 2128-2146, 2152-2172, 2154-2172, 2153-2173, 2155-2173, 2156-2176, 2158-2176, 2157-2177, 2159-2177, 2161-2181, 2163-2181, 2162-2182, 2164-2182, 2172-2192, 2174-2192, 2175-2195, 2177-2195, 2215-2235, 2217-2235, 2217-2237, 2219-2237, 2221-2241, 2223-2241, 2252-2272, 2254-2272, 2254-2274, 2256-2274, 2256-2276, 2258-2276, 2258-2278, 2260-2278, 2280-2300, 2282-2300, 2285-2305, 2287-2305, 2286-2306, 2288-2306, 2291-2311, 2293-2311, 2298-2318, 2300-2318, 2031-2051, 2356-2376, 2358-2376, 2406-2426, 2408-2426, 2409-2429, 2411-2429, 2412-2432, 2414-2432, 2413-2433, 2415-2433, 2414-2434, 2416-2434, 2416-2436, 2418-2436, 2422-2442, 2424-2442, 2430-2450, 2432-2450, 2432-2452, 2434-2452, 2437-2457, 2439-2457, 2457-2477, 2459-2477, 2483-2503, 2485-2503, 2488-2508, 2490-2508, 2491-2511, 2493-2511, 2492-2512, 2494-2512, 2572-2592, 2574-2592, 2586-2606, 2588-2606, 2647-2667, 2649-2667, 2679-2699, 2681-2699, 2681-2701, 2683-2701, 2714-2734, 2716-2734, 2718-2738, 2720-2738, 2721-2741, 2723-2741, 2810-2830, 2812-2830, 2817-2837, 2819-2837, 2820-2840, 2822-2840, 2822-2842, 2824-2842, 2828-2848, 2830-2848, 2917-2937, 2919-2937, 2966-2986, 2968-2986, 2974-2994, 2976-2994, 2976-2996, 2978-2996, 3033-3053, 3035-3053, 3035-3055, 3037-3055, 3082-3102, 3084-3102, 3088-3108, 3090-3108, 3089-3109, 3091-3109, 3090-3110, 3092-3110, 3098-3118, 3100-3118, 3100-3120, 3102-3120, 3103-3123, 3105-3123, 3106-3126, 3108-3126, 3109-3129, 3111-3129, 3110-3130, 3112-3130, 3184-3204, 3186-3204, 3187-3207, 3189-3207, 3189-3209, 3191-3209, 3190-3210, 3192-3210, 3201-3221, 3203-3221, 3210-3230, 3212-3230, 3224-3244, 3226-3244, 3232-3252, 3234-3252, 3233-3253, 3235-3253, 3234-3254, 3236-3254, 3236-3256, 3238-3256, 3318-3338, 3320-3338, 3335-3355, 3337-3355, 3349-3369, 3351-3369, 3378-3398, 3380-3398, 3380-3400, 3382-3400, 3445-3465, 3447-3465, 3448-3468, 3450-3468, 3458-3478, 3460-3478, 3462-3482, 3464-3482, 3463-3483, 3465-3483, 3464-3484, 3466-3484, 3465-3485 or 3467-3485 of SEQ ID NO: 1.
[0010] In some embodiments, the dsRNA agent targets a corresponding portion of an HMGCR mRNA transcript disclosed in Table 1 and / or the target region of HMGCR mRNA transcript described above.
[0011] In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to an mRNA encoding HMGCR, wherein the region of complementarity comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from the complement of any one of nucleotides 96-116, 97-117, 98-116, 99-117, 99-119, 101-121, 103-121, 103-123, 105-123, 104-124, 106-124, 105-125, 107-125, 106-126, 108-126, 107-127, 109-127, 108-128, 110-128, 109-129, 111-129, 110-130, 112-130, 113-133, 115-133, 120-140, 122-140, 150-170, 152-170, 181-201, 183-201, 185-205, 187-205, 186-206, 188-206, 188-208, 190-208, 189-209, 191-209, 191-211, 193-211, 193-213, 194-214, 195-213, 196-216, 198-216, 197-217, 199-217, 199-219, 201-219, 202-222, 204-222, 203-223, 205-223, 204-224, 206-224, 205-225, 207-225, 206-226, 208-226, 207-227, 209-227, 208-228, 210-228, 210-230, 212-230, 211-231, 213-231, 212-232, 214-232, 214-234, 216-234, 215-235, 217-235, 216-236, 218-236, 217-237, 219-237, 218-238, 220-238, 221-241, 223-241, 222-242, 224-242, 223-243, 225-243, 224-244, 226-244, 225-245, 227-245, 226-246, 228-246, 227-247, 229-247, 228-248, 230-248, 229-249, 231-249, 230-250, 232-250, 234-254, 236-254, 236-256, 238-256, 237-257, 239-257, 238-258, 240-258, 240-260, 242-260, 243-263, 245-263, 244-264, 246-264, 246-266, 248-266, 247-267, 249-267, 249-269, 251-269, 253-273, 255-273, 257-277, 259-277, 263-283, 265-283, 265-285, 267-285, 269-289, 271-289, 270-290, 272-290, 271-291, 273-291, 272-292, 274-292, 273-293, 275-293, 275-295, 277-295, 278-298, 280-298, 279-299, 281-299, 280-300, 282-300, 281-301, 283-301, 282-302, 284-302, 283-303, 285-303, 284-304, 286-304, 285-305, 287-305, 287-307, 289-307, 293-313, 295-313, 294-314, 296-314, 295-315, 297-315, 296-316, 298-316, 298-318, 300-318, 299-319, 301-319, 320-340, 322-340, 324-344, 326-344, 325-345, 327-345, 326-346, 328-346, 327-347, 329-347, 330-350, 332-350, 331-351, 333-351, 332-352, 334-352, 334-354, 336-354, 335-355, 337-355, 336-356, 338-356, 337-357, 339-357, 338-358, 340-358, 339-359, 341-359, 340-360, 342-360, 341-361, 343-361, 342-362, 344-362, 344-364, 346-364, 345-365, 347-365, 346-366, 348-366, 347-367, 349-367, 348-368, 350-368, 349-369, 351-369, 350-370, 352-370, 351-371, 353-371, 352-372, 354-372, 353-373, 355-373, 354-374, 356-374, 99-119, 100-120, 102-122, 111-131, 112-132, 114-134, 115-135, 116-136, 117-137, 118-138, 119-139, 121-141, 122-142, 123-143, 124-144, 125-145, 126-146, 127-147, 128-148, 129-149, 130-150, 131-151, 132-152, 133-153, 134-154, 135-155, 136-156, 137-157, 138-158, 139-159, 140-160, 141-161, 142-162, 143-163, 144-164, 145-165, 146-166, 147-167, 148-168, 149-169, 151-171, 152-172, 153-173, 154-174, 155-175, 156-176, 157-177, 158-178, 159-179, 160-180, 161-181, 162-182, 163-183, 164-184, 165-185, 166-186, 167-187, 168-188, 169-189, 170-190, 171-191, 172-192, 173-193, 174-194, 175-195, 176-196, 177-197, 178-198, 179-199, 180-200, 182-202, 183-203, 184-204, 187-207, 190-210, 192-212, 194-214, 195-215, 198-218, 200-220, 201-221, 209-229, 213-233, 219-239, 220-240, 231-251, 232-252, 233-253, 235-255, 239-259, 241-261, 242-262, 245-265, 248-268, 250-270, 251-271, 252-272, 254-274, 255-275, 256-276, 258-278, 259-279, 260-280, 261-281, 262-282, 264-284, 266-286, 267-287, 268-288, 274-294, 276-296, 277-297, 286-306, 288-308, 289-309, 290-310, 291-311, 292-312, 297-317, 300-320, 301-321, 302-322, 303-323, 304-324, 305-325, 306-326, 307-327, 308-328, 309-329, 310-330, 311-331, 312-332, 313-333, 314-334, 315-335, 316-336, 317-337, 318-338, 319-339, 321-341, 322-342, 323-343, 328-348, 329-349, 333-353, 343-363, 355-375, 356-376, 357-377, 358-378, 359-379, 120-140, 185-205, 215-235, 216-236, 221-241, 234-254, 244-264, 253-273, 263-283, 265-285, 272-292, 275-295, 287-307, 298-318, 324-344, 325-345, 326-346, 332-352, 345-365, 392-412, 416-436, 422-442, 423-443, 458-478, 611-631, 1063-1083, 1505-1525, 3088-3108, 3089-3109, 3100-3120, 3189-3209, 3201-3221, 3318-3338, 3458-3478, 3462-3482, 3465-3485, 434-454, 454-474, 1103-1123, 1283-1303, 1395-1415, 1474-1494, 1488-1508, 1544-1564, 2157-2177, 2412-2432, 2714-2734, 3090-3110, 3224-3244, 392-412, 394-412, 393-413, 395-413, 412-432, 414-432, 413-433, 415-433, 414-434, 416-434, 415-435, 417-435, 416-436, 418-436, 418-438, 420-438, 419-439, 421-439, 420-440, 422-440, 422-442, 424-442, 423-443, 425-443, 424-444, 426-444, 425-445, 427-445, 426-446, 428-446, 427-447, 429-447, 428-448, 430-448, 429-449, 431-449, 430-450, 432-450, 431-451, 433-451, 432-452, 434-452, 433-453, 435-453, 434-454, 436-454, 435-455, 437-455, 436-456, 438-456, 437-457, 439-457, 438-458, 440-458, 439-459, 441-459, 440-460, 442-460, 441-461, 443-461, 442-462, 444-462, 450-470, 452-470, 451-471, 453-471, 452-472, 454-472, 454-474, 456-474, 455-475, 457-475, 458-478, 460-478, 461-481, 463-481, 465-485, 467-487, 469-487, 469-489, 471-489, 474-494, 476-494, 475-495, 477-495, 524-544, 526-544, 527-547, 529-547, 532-552, 534-552, 538-558, 540-558, 540-560, 542-560, 541-561, 543-561, 545-565, 547-565, 552-572, 554-572, 555-575, 557-575, 558-578, 560-578, 561-581, 563-581, 562-582, 564-582, 565-585, 567-585, 567-587, 569-587, 568-588, 570-588, 570-590, 572-590, 575-595, 577-595, 577-597, 579-597, 578-598, 580-598, 579-599, 581-599, 580-600, 582-600, 581-601, 583-601, 606-626, 608-626, 607-627, 609-627, 611-631, 613-631, 612-632, 614-632, 614-634, 616-634, 615-635, 617-635, 617-637, 619-637, 618-638, 620-638, 621-641, 623-641, 623-643, 625-643, 624-644, 626-644, 625-645, 627-645, 628-648, 630-648, 629-649, 631-649, 632-652, 634-652, 636-656, 638-656, 639-659, 641-659, 662-682, 664-682, 663-683, 665-683, 664-684, 666-684, 668-688, 670-688, 672-692, 674-692, 676-696, 678-696, 681-701, 683-701, 689-709, 691-709, 690-710, 692-710, 695-715, 697-715, 697-717, 699-717, 699-719, 701-719, 708-728, 710-728, 711-731, 713-731, 715-735, 717-735, 719-739, 721-739, 742-762, 744-762, 746-766, 748-766, 754-774, 756-774, 816-836, 818-836, 866-886, 868-886, 867-887, 869-887, 870-890, 872-890, 884-904, 886-904, 887-907, 889-907, 888-908, 890-908, 894-914, 896-914, 927-947, 929-947, 930-950, 932-950, 934-954, 936-954, 941-961, 943-961, 943-963, 945-963, 944-964, 946-964, 948-968, 950-968, 949-969, 951-969, 951-971, 953-971, 952-972, 954-972, 954-974, 956-974, 971-991, 973-991, 973-993, 975-993, 975-995, 977-995, 996-1016, 999-1019, 1043-1063, 1045-1063, 1044-1064, 1046-1064, 1050-1070, 1052-1070, 1052-1072, 1054-1072, 1063-1083, 1065-1083, 1065-1085, 1067-1085, 1070-1090, 1072-1090, 1074-1094, 1076-1094, 1075-1095, 1077-1095, 1092-1112, 1094-1112, 1094-1114, 1096-1114, 1103-1123, 1105-1123, 1106-1126, 1108-1126, 1107-1127, 1109-1127, 1152-1172, 1154-1172, 1161-1181, 1163-1181, 1173-1193, 1175-1193, 1175-1195, 1177-1195, 1177-1197, 1179-1197, 1221-1241, 1223-1241, 1226-1246, 1228-1246, 1227-1247, 1229-1247, 1258-1278, 1260-1278, 1268-1288, 1270-1288, 1272-1292, 1274-1292, 1276-1296, 1278-1296, 1283-1303, 1285-1303, 1289-1309, 1290-1310, 1292-1310, 1297-1317, 1299-1317, 1308-1328, 1310-1328, 1337-1357, 1339-1357, 1340-1360, 1342-1360, 1341-1361, 1343-1361, 1361-1381, 1363-1381, 1395-1415, 1397-1415, 1468-1488, 1470-1488, 1474-1494, 1476-1494, 1475-1495, 1477-1495, 1476-1496, 1478-1496, 1478-1498, 1480-1498, 1488-1508, 1490-1508, 1496-1516, 1498-1516, 1500-1520, 1502-1520, 1501-1521, 1503-1521, 1502-1522, 1504-1522, 1505-1525, 1507-1525, 1509-1529, 1511-1529, 1511-1531, 1513-1531, 1512-1532, 1514-1532, 1534-1554, 1536-1554, 1535-1555, 1537-1555, 1542-1562, 1544-1562, 1544-1564, 1546-1564, 1547-1567, 1549-1567, 1563-1583, 1565-1583, 1607-1627, 1609-1627, 1612-1632, 1614-1632, 1617-1637, 1619-1637, 1641-1661, 1643-1661, 1642-1662, 1644-1662, 1644-1664, 1646-1664, 1899-1919, 1901-1919, 1968-1988, 1970-1988, 1978-1998, 1980-1998, 1985-2005, 1987-2005, 1990-2010, 1992-2010, 1992-2012, 1994-2012, 1998-2018, 2000-2018, 2001-2021, 2003-2021, 2022-2042, 2024-2042, 2023-2043, 2025-2043, 2091-2111, 2093-2111, 2098-2118, 2100-2118, 2125-2145, 2127-2145, 2126-2146, 2128-2146, 2152-2172, 2154-2172, 2153-2173, 2155-2173, 2156-2176, 2158-2176, 2157-2177, 2159-2177, 2161-2181, 2163-2181, 2162-2182, 2164-2182, 2172-2192, 2174-2192, 2175-2195, 2177-2195, 2215-2235, 2217-2235, 2217-2237, 2219-2237, 2221-2241, 2223-2241, 2252-2272, 2254-2272, 2254-2274, 2256-2274, 2256-2276, 2258-2276, 2258-2278, 2260-2278, 2280-2300, 2282-2300, 2285-2305, 2287-2305, 2286-2306, 2288-2306, 2291-2311, 2293-2311, 2298-2318, 2300-2318, 2031-2051, 2356-2376, 2358-2376, 2406-2426, 2408-2426, 2409-2429, 2411-2429, 2412-2432, 2414-2432, 2413-2433, 2415-2433, 2414-2434, 2416-2434, 2416-2436, 2418-2436, 2422-2442, 2424-2442, 2430-2450, 2432-2450, 2432-2452, 2434-2452, 2437-2457, 2439-2457, 2457-2477, 2459-2477, 2483-2503, 2485-2503, 2488-2508, 2490-2508, 2491-2511, 2493-2511, 2492-2512, 2494-2512, 2572-2592, 2574-2592, 2586-2606, 2588-2606, 2647-2667, 2649-2667, 2679-2699, 2681-2699, 2681-2701, 2683-2701, 2714-2734, 2716-2734, 2718-2738, 2720-2738, 2721-2741, 2723-2741, 2810-2830, 2812-2830, 2817-2837, 2819-2837, 2820-2840, 2822-2840, 2822-2842, 2824-2842, 2828-2848, 2830-2848, 2917-2937, 2919-2937, 2966-2986, 2968-2986, 2974-2994, 2976-2994, 2976-2996, 2978-2996, 3033-3053, 3035-3053, 3035-3055, 3037-3055, 3082-3102, 3084-3102, 3088-3108, 3090-3108, 3089-3109, 3091-3109, 3090-3110, 3092-3110, 3098-3118, 3100-3118, 3100-3120, 3102-3120, 3103-3123, 3105-3123, 3106-3126, 3108-3126, 3109-3129, 3111-3129, 3110-3130, 3112-3130, 3184-3204, 3186-3204, 3187-3207, 3189-3207, 3189-3209, 3191-3209, 3190-3210, 3192-3210, 3201-3221, 3203-3221, 3210-3230, 3212-3230, 3224-3244, 3226-3244, 3232-3252, 3234-3252, 3233-3253, 3235-3253, 3234-3254, 3236-3254, 3236-3256, 3238-3256, 3318-3338, 3320-3338, 3335-3355, 3337-3355, 3349-3369, 3351-3369, 3378-3398, 3380-3398, 3380-3400, 3382-3400, 3445-3465, 3447-3465, 3448-3468, 3450-3468, 3458-3478, 3460-3478, 3462-3482, 3464-3482, 3463-3483, 3465-3483, 3464-3484, 3466-3484, 3465-3485 or 3467-3485 of SEQ ID NO: 1.
[0012] In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to an mRNA encoding HMGCR, wherein the region of complementarity comprises at least 15, 16, 17, 18 or 19 contiguous nucleotides from the complement of any one of nucleotides 96-116, 97-117, 98-116, 99-117, 99-119, 101-121, 103-121, 103-123, 105-123, 104-124, 106-124, 105-125, 107-125, 106-126, 108-126, 107-127, 109-127, 108-128, 110-128, 109-129, 111-129, 110-130, 112-130, 113-133, 115-133, 120-140, 122-140, 150-170, 152-170, 181-201, 183-201, 185-205, 187-205, 186-206, 188-206, 188-208, 190-208, 189-209, 191-209, 191-211, 193-211, 193-213, 194-214, 195-213, 196-216, 198-216, 197-217, 199-217, 199-219, 201-219, 202-222, 204-222, 203-223, 205-223, 204-224, 206-224, 205-225, 207-225, 206-226, 208-226, 207-227, 209-227, 208-228, 210-228, 210-230, 212-230, 211-231, 213-231, 212-232, 214-232, 214-234, 216-234, 215-235, 217-235, 216-236, 218-236, 217-237, 219-237, 218-238, 220-238, 221-241, 223-241, 222-242, 224-242, 223-243, 225-243, 224-244, 226-244, 225-245, 227-245, 226-246, 228-246, 227-247, 229-247, 228-248, 230-248, 229-249, 231-249, 230-250, 232-250, 234-254, 236-254, 236-256, 238-256, 237-257, 239-257, 238-258, 240-258, 240-260, 242-260, 243-263, 245-263, 244-264, 246-264, 246-266, 248-266, 247-267, 249-267, 249-269, 251-269, 253-273, 255-273, 257-277, 259-277, 263-283, 265-283, 265-285, 267-285, 269-289, 271-289, 270-290, 272-290, 271-291, 273-291, 272-292, 274-292, 273-293, 275-293, 275-295, 277-295, 278-298, 280-298, 279-299, 281-299, 280-300, 282-300, 281-301, 283-301, 282-302, 284-302, 283-303, 285-303, 284-304, 286-304, 285-305, 287-305, 287-307, 289-307, 293-313, 295-313, 294-314, 296-314, 295-315, 297-315, 296-316, 298-316, 298-318, 300-318, 299-319, 301-319, 320-340, 322-340, 324-344, 326-344, 325-345, 327-345, 326-346, 328-346, 327-347, 329-347, 330-350, 332-350, 331-351, 333-351, 332-352, 334-352, 334-354, 336-354, 335-355, 337-355, 336-356, 338-356, 337-357, 339-357, 338-358, 340-358, 339-359, 341-359, 340-360, 342-360, 341-361, 343-361, 342-362, 344-362, 344-364, 346-364, 345-365, 347-365, 346-366, 348-366, 347-367, 349-367, 348-368, 350-368, 349-369, 351-369, 350-370, 352-370, 351-371, 353-371, 352-372, 354-372, 353-373, 355-373, 354-374, 356-374, 100-120, 102-122, 111-131, 112-132, 114-134, 115-135, 116-136, 117-137, 118-138, 119-139, 121-141, 122-142, 123-143, 124-144, 125-145, 126-146, 127-147, 128-148, 129-149, 130-150, 131-151, 132-152, 133-153, 134-154, 135-155, 136-156, 137-157, 138-158, 139-159, 140-160, 141-161, 142-162, 143-163, 144-164, 145-165, 146-166, 147-167, 148-168, 149-169, 151-171, 152-172, 153-173, 154-174, 155-175, 156-176, 157-177, 158-178, 159-179, 160-180, 161-181, 162-182, 163-183, 164-184, 165-185, 166-186, 167-187, 168-188, 169-189, 170-190, 171-191, 172-192, 173-193, 174-194, 175-195, 176-196, 177-197, 178-198, 179-199, 180-200, 182-202, 183-203, 184-204, 187-207, 190-210, 192-212, 194-214, 195-215, 198-218, 200-220, 201-221, 209-229, 213-233, 219-239, 220-240, 231-251, 232-252, 233-253, 235-255, 239-259, 241-261, 242-262, 245-265, 248-268, 250-270, 251-271, 252-272, 254-274, 255-275, 256-276, 258-278, 259-279, 260-280, 261-281, 262-282, 264-284, 266-286, 267-287, 268-288, 274-294, 276-296, 277-297, 286-306, 288-308, 289-309, 290-310, 291-311, 292-312, 297-317, 300-320, 301-321, 302-322, 303-323, 304-324, 305-325, 306-326, 307-327, 308-328, 309-329, 310-330, 311-331, 312-332, 313-333, 314-334, 315-335, 316-336, 317-337, 318-338, 319-339, 321-341, 322-342, 323-343, 328-348, 329-349, 333-353, 343-363, 355-375, 356-376, 357-377, 358-378, 359-379, 185-205, 215-235, 216-236, 221-241, 234-254, 244-264, 253-273, 263-283, 265-285, 272-292, 275-295, 287-307, 298-318, 324-344, 325-345, 326-346, 332-352, 345-365, 392-412, 416-436, 422-442, 423-443, 458-478, 611-631, 1063-1083, 1505-1525, 3088-3108, 3089-3109, 3100-3120, 3189-3209, 3201-3221, 3318-3338, 3458-3478, 3462-3482, 3465-3485, 434-454, 454-474, 1103-1123, 1283-1303, 1395-1415, 1474-1494, 1488-1508, 1544-1564, 2157-2177, 2412-2432, 2714-2734, 3090-3110, 3224-3244, 392-412, 394-412, 393-413, 395-413, 412-432, 414-432, 413-433, 415-433, 414-434, 416-434, 415-435, 417-435, 416-436, 418-436, 418-438, 420-438, 419-439, 421-439, 420-440, 422-440, 422-442, 424-442, 423-443, 425-443, 424-444, 426-444, 425-445, 427-445, 426-446, 428-446, 427-447, 429-447, 428-448, 430-448, 429-449, 431-449, 430-450, 432-450, 431-451, 433-451, 432-452, 434-452, 433-453, 435-453, 434-454, 436-454, 435-455, 437-455, 436-456, 438-456, 437-457, 439-457, 438-458, 440-458, 439-459, 441-459, 440-460, 442-460, 441-461, 443-461, 442-462, 444-462, 450-470, 452-470, 451-471, 453-471, 452-472, 454-472, 454-474, 456-474, 455-475, 457-475, 458-478, 460-478, 461-481, 463-481, 465-485, 467-487, 469-487, 469-489, 471-489, 474-494, 476-494, 475-495, 477-495, 524-544, 526-544, 527-547, 529-547, 532-552, 534-552, 538-558, 540-558, 540-560, 542-560, 541-561, 543-561, 545-565, 547-565, 552-572, 554-572, 555-575, 557-575, 558-578, 560-578, 561-581, 563-581, 562-582, 564-582, 565-585, 567-585, 567-587, 569-587, 568-588, 570-588, 570-590, 572-590, 575-595, 577-595, 577-597, 579-597, 578-598, 580-598, 579-599, 581-599, 580-600, 582-600, 581-601, 583-601, 606-626, 608-626, 607-627, 609-627, 611-631, 613-631, 612-632, 614-632, 614-634, 616-634, 615-635, 617-635, 617-637, 619-637, 618-638, 620-638, 621-641, 623-641, 623-643, 625-643, 624-644, 626-644, 625-645, 627-645, 628-648, 630-648, 629-649, 631-649, 632-652, 634-652, 636-656, 638-656, 639-659, 641-659, 662-682, 664-682, 663-683, 665-683, 664-684, 666-684, 668-688, 670-688, 672-692, 674-692, 676-696, 678-696, 681-701, 683-701, 689-709, 691-709, 690-710, 692-710, 695-715, 697-715, 697-717, 699-717, 699-719, 701-719, 708-728, 710-728, 711-731, 713-731, 715-735, 717-735, 719-739, 721-739, 742-762, 744-762, 746-766, 748-766, 754-774, 756-774, 816-836, 818-836, 866-886, 868-886, 867-887, 869-887, 870-890, 872-890, 884-904, 886-904, 887-907, 889-907, 888-908, 890-908, 894-914, 896-914, 927-947, 929-947, 930-950, 932-950, 934-954, 936-954, 941-961, 943-961, 943-963, 945-963, 944-964, 946-964, 948-968, 950-968, 949-969, 951-969, 951-971, 953-971, 952-972, 954-972, 954-974, 956-974, 971-991, 973-991, 973-993, 975-993, 975-995, 977-995, 996-1016, 999-1019, 1043-1063, 1045-1063, 1044-1064, 1046-1064, 1050-1070, 1052-1070, 1052-1072, 1054-1072, 1063-1083, 1065-1083, 1065-1085, 1067-1085, 1070-1090, 1072-1090, 1074-1094, 1076-1094, 1075-1095, 1077-1095, 1092-1112, 1094-1112, 1094-1114, 1096-1114, 1103-1123, 1105-1123, 1106-1126, 1108-1126, 1107-1127, 1109-1127, 1152-1172, 1154-1172, 1161-1181, 1163-1181, 1173-1193, 1175-1193, 1175-1195, 1177-1195, 1177-1197, 1179-1197, 1221-1241, 1223-1241, 1226-1246, 1228-1246, 1227-1247, 1229-1247, 1258-1278, 1260-1278, 1268-1288, 1270-1288, 1272-1292, 1274-1292, 1276-1296, 1278-1296, 1283-1303, 1285-1303, 1289-1309, 1290-1310, 1292-1310, 1297-1317, 1299-1317, 1308-1328, 1310-1328, 1337-1357, 1339-1357, 1340-1360, 1342-1360, 1341-1361, 1343-1361, 1361-1381, 1363-1381, 1395-1415, 1397-1415, 1468-1488, 1470-1488, 1474-1494, 1476-1494, 1475-1495, 1477-1495, 1476-1496, 1478-1496, 1478-1498, 1480-1498, 1488-1508, 1490-1508, 1496-1516, 1498-1516, 1500-1520, 1502-1520, 1501-1521, 1503-1521, 1502-1522, 1504-1522, 1505-1525, 1507-1525, 1509-1529, 1511-1529, 1511-1531, 1513-1531, 1512-1532, 1514-1532, 1534-1554, 1536-1554, 1535-1555, 1537-1555, 1542-1562, 1544-1562, 1544-1564, 1546-1564, 1547-1567, 1549-1567, 1563-1583, 1565-1583, 1607-1627, 1609-1627, 1612-1632, 1614-1632, 1617-1637, 1619-1637, 1641-1661, 1643-1661, 1642-1662, 1644-1662, 1644-1664, 1646-1664, 1899-1919, 1901-1919, 1968-1988, 1970-1988, 1978-1998, 1980-1998, 1985-2005, 1987-2005, 1990-2010, 1992-2010, 1992-2012, 1994-2012, 1998-2018, 2000-2018, 2001-2021, 2003-2021, 2022-2042, 2024-2042, 2023-2043, 2025-2043, 2091-2111, 2093-2111, 2098-2118, 2100-2118, 2125-2145, 2127-2145, 2126-2146, 2128-2146, 2152-2172, 2154-2172, 2153-2173, 2155-2173, 2156-2176, 2158-2176, 2157-2177, 2159-2177, 2161-2181, 2163-2181, 2162-2182, 2164-2182, 2172-2192, 2174-2192, 2175-2195, 2177-2195, 2215-2235, 2217-2235, 2217-2237, 2219-2237, 2221-2241, 2223-2241, 2252-2272, 2254-2272, 2254-2274, 2256-2274, 2256-2276, 2258-2276, 2258-2278, 2260-2278, 2280-2300, 2282-2300, 2285-2305, 2287-2305, 2286-2306, 2288-2306, 2291-2311, 2293-2311, 2298-2318, 2300-2318, 2031-2051, 2356-2376, 2358-2376, 2406-2426, 2408-2426, 2409-2429, 2411-2429, 2412-2432, 2414-2432, 2413-2433, 2415-2433, 2414-2434, 2416-2434, 2416-2436, 2418-2436, 2422-2442, 2424-2442, 2430-2450, 2432-2450, 2432-2452, 2434-2452, 2437-2457, 2439-2457, 2457-2477, 2459-2477, 2483-2503, 2485-2503, 2488-2508, 2490-2508, 2491-2511, 2493-2511, 2492-2512, 2494-2512, 2572-2592, 2574-2592, 2586-2606, 2588-2606, 2647-2667, 2649-2667, 2679-2699, 2681-2699, 2681-2701, 2683-2701, 2714-2734, 2716-2734, 2718-2738, 2720-2738, 2721-2741, 2723-2741, 2810-2830, 2812-2830, 2817-2837, 2819-2837, 2820-2840, 2822-2840, 2822-2842, 2824-2842, 2828-2848, 2830-2848, 2917-2937, 2919-2937, 2966-2986, 2968-2986, 2974-2994, 2976-2994, 2976-2996, 2978-2996, 3033-3053, 3035-3053, 3035-3055, 3037-3055, 3082-3102, 3084-3102, 3088-3108, 3090-3108, 3089-3109, 3091-3109, 3090-3110, 3092-3110, 3098-3118, 3100-3118, 3100-3120, 3102-3120, 3103-3123, 3105-3123, 3106-3126, 3108-3126, 3109-3129, 3111-3129, 3110-3130, 3112-3130, 3184-3204, 3186-3204, 3187-3207, 3189-3207, 3189-3209, 3191-3209, 3190-3210, 3192-3210, 3201-3221, 3203-3221, 3210-3230, 3212-3230, 3224-3244, 3226-3244, 3232-3252, 3234-3252, 3233-3253, 3235-3253, 3234-3254, 3236-3254, 3236-3256, 3238-3256, 3318-3338, 3320-3338, 3335-3355, 3337-3355, 3349-3369, 3351-3369, 3378-3398, 3380-3398, 3380-3400, 3382-3400, 3445-3465, 3447-3465, 3448-3468, 3450-3468, 3458-3478, 3460-3478, 3462-3482, 3464-3482, 3463-3483, 3465-3483, 3464-3484, 3466-3484, 3465-3485 or 3467-3485 of SEQ ID NO: 1.
[0013] In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to an mRNA encoding HMGCR which comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from any one of the antisense sequences listed in any one of Tables 1-3. In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to an mRNA encoding HMGCR which comprises at least 15 contiguous nucleotides from any one of the antisense sequences listed in any one of Tables 1-3.
[0014] In some embodiments, the dsRNA agent including a sense strand and an antisense strand, nucleotide positions 2 to 18 in the antisense strand including a region of complementarity to an HMGCR RNA transcript, wherein the region of complementarity includes at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3, and optionally including a targeting ligand.
[0015] In some embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to any one of a target region of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent is fully complementary to any one of a target region of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments, the dsRNA agent includes a sense strand sequence set forth in any one of Tables 1-3, wherein the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA agent. In certain embodiments, the dsRNA agent includes a sense strand sequence set forth in any one of Tables 1-3, wherein the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent includes an antisense strand sequence set forth in any one of Tables 1-3. In some embodiments, the dsRNA agent includes the sequences set forth as a duplex sequence in any of Tables 1-3.
[0016] In some embodiments, the dsRNA agent includes at least one modified nucleotide. In certain embodiments, all or substantially all of the nucleotides of the antisense strand are modified nucleotides. In certain embodiments, all or substantially all of the nucleotides of the sense strand are modified nucleotides. In some embodiments, at least one of the modified nucleotides comprises: 2’ -O-methyl nucleotide, 2’ -fluoro nucleotide, 2’ -deoxy nucleotide, 2’3’ -seco nucleotide mimic, locked nucleotide, unlocked nucleic acid nucleotide (UNA) , glycol nucleic acid nucleotide (GNA) , 2’ -F-Arabino nucleotide, 2’ -methoyxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted abasic nucleotide, inverted 2’ -OMe nucleotide, inverted 2’ -deoxy nucleotide, isomannide nucleotide, 2’ -amino-modified nucleotide, 2’ -alkyl-modified nucleotide, mopholino nucleotide, and 3’ -OMe nucleotide, a nucleotide including a 5’ -phosphorothioate group, a 5'-phosphonate modified nucleotide, or a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a 2’ -amino-modified nucleotide, a phosphoramidite, or a non-natural base including nucleotide. In some embodiments, the dsRNA agent includes an E-vinylphosphonate nucleotide at the 5′ end of the guide strand. In some embodiments, all or substantially all of the nucleotides of the sense strand and the antisense strand are modified nucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from a 2’ -O-methyl nucleotide, a 2’ -fluoro nucleotide and an UNA modified nucleotide, wherein less than 6 modified nucleotides are 2’ -fluoro nucleotides. In some embodiments, the antisense strand comprises 3 or 5 2’ -fluoro nucleotides, preferably, the antisense strand comprises 5 2’ -fluoro nucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from a 2’ -O-methyl nucleotide and a 2’ -fluoro nucleotide, wherein less than 4 modified nucleotides are 2’ -fluoro nucleotides. In certain embodiments, the sense strand comprises 3 2’ -fluoro nucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from a 2’ -O-methyl nucleotide and a 2’ -fluoro nucleotide, wherein at least 14 modified nucleotides are 2’ -O-methyl nucleotides and the nucleotides at positions 2, 5, 7, 12, 14, 16 and / or 18 counting from the first matching position from the 5’ end of the antisense strand are independently a 2’ -fluoro nucleotide. In some embodiments, the antisense strand comprises at least one UNA modified nucleotide and 5 2’ -fluoro nucleotides. In some embodiments, the antisense strand comprises one UNA modified nucleotide at position 7 and 5 2’-fluoro nucleotides at positions 2, 5, 12, 14 and 16 counting from the first matching position from the 5’ end, and the rest are 2’ -O-methyl nucleotides. In some embodiments, the antisense strand comprises 5 2’ -fluoro nucleotides at positions 2, 7, 12, 14 and 16 counting from the first matching position of the 5’ end, and the rest are 2’ -O-methyl nucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from a 2’ -O-methyl nucleotide and a 2’ -fluoro nucleotide, preferably, wherein at least 18 modified nucleotides are 2’ -O-methyl nucleotides and the nucleotides at positions 9, 11 and / or 13 counting from the first matching position from the 3’ end of the sense strand are 2’ -fluoro nucleotides.
[0017] In some embodiments, the antisense strand includes one inverted abasic residue at 3’ -terminal end. In certain embodiments, the sense strand includes one or two inverted abasic residues and / or one or two imann residues at 3’ or / and 5’ terminal end. In certain embodiments, each end of the sense strand includes one inverted abasic residue. In certain embodiments, 3’ -end of the sense strand includes one inverted abasic residue. In certain embodiments, each end of the sense strand includes one imann residue.
[0018] In some embodiments, the dsRNA agent includes at least one modified nucleotide and further includes one or more targeting groups or linking groups. In some embodiments, the one or more targeting groups or linking groups are conjugated to the sense strand. In some embodiments, the targeting group or linking group includes N-acetyl-galactosamine (GalNAc) . In some embodiments, the targeting group has a structure as Formula (X) :
[0019] Each n” is independently selected from 1 or 2.
[0020] In some embodiments, the targeting group has a structure:
[0021] In certain embodiments, the dsRNA agent includes a targeting group that is conjugated to the 5’ -terminal end of the sense strand. In some embodiments, the dsRNA agent includes a targeting group that is conjugated to the 3'-terminal end of the sense strand.
[0022] In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand includes a 3’ overhang of at least 1 nucleotide. In some embodiments, at least one strand includes a 3’ overhang of at least 2 nucleotides.
[0023] In some embodiments, the dsRNA agent includes at least one phosphorothioate internucleoside linkage. In some embodiments, the sense strand includes at least one phosphorothioate internucleoside linkage. In some embodiments, the antisense strand includes at least one phosphorothioate internucleoside linkage. In some embodiments, the sense strand includes 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages. In some embodiments, the antisense strand includes 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages.
[0024] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) is provided, wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to part of an mRNA encoding HMGCR, wherein each strand is about 15 to about 30 nucleotides in length, wherein the sense strand sequence may be represented by formula (I) :
[0025] 5′- (N′L) n′N′LN′L N′N1 N′N2 N′N3 N′N4 N′L N′F N′L N′N5N′N6 N′L N′L N′L (N′L) m′-3′ (I)
[0026] wherein:
[0027] each N′F represents a 2'-fluoro-modified nucleotide; each N′N1, N′N2, N′N3, N′N4, N′N5, and N′N6 independently represents a modified or unmodified nucleotide; each N′L independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, and m′and n′are each independently an integer of 0 to 7.
[0028] In some embodiments, N′N2 and N′N4 each independently represents a 2'-fluoro-modified nucleotide;
[0029] In some embodiments, m′ is 2 and n′ is 3, or m′ is 2 and n′ is 4, m′ is 2 and n′ is 5. In some embodiments, the dsRNA agent includes a targeting group that is conjugated to the 5’ -terminal end of the sense strand, preferably, the targeting group is any one selected from aforesaid GLO-1 through GLO-16 and GLS-1*through GLS-16*, more preferably, the targeting group is aforesaid GLS-15*. In certain embodiments, the dsRNA agent includes a targeting group that is conjugated to the 3'-terminal end of the sense strand. In certain embodiments, the antisense strand includes one inverted abasic residue at 3’ -terminal end. In certain embodiments, the sense strand includes one or two inverted abasic residues and / or one or two imann residues at 3’ or / and 5’ terminal end. In certain embodiments, 3’ terminal end of the sense strand independently includes an inverted abasic residue. In certain embodiments, each 3’ and 5’ terminal end of the sense strand independently includes an inverted abasic residue. In certain embodiments, each 3’ and 5’ terminal end of the sense strand independently includes an imann residue. In certain embodiments, 3’ -end of the sense strand includes an inverted abasic residue and 5’ terminal end is conjugated to a targeting group, which preferably is aforesaid GLS-15*. In certain embodiments, each end of the sense strand includes an inverted abasic residue and either residue at 3’ or 5’ terminal end is further conjugated to a targeting group, which preferably is aforesaid GLS-15*. In certain embodiments, each end of the sense strand includes an imann residue and either residue at 3’ or 5’ terminal end is further conjugated to a targeting group, which preferably is aforesaid GLS-15*.
[0030] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) is provided, wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to part of an mRNA encoding HMGCR, wherein each strand is about 18 to about 30 nucleotides in length, wherein the antisense strand sequence may be represented by formula (II) :
[0031] 3′- (NL) n NM1 NL NM2 NL NF NL NM3 NL NM4 NL NM5 NM6 NL NM7 NM8 NL NF NL-5′ (II)
[0032] wherein:
[0033] each NF represents a 2'-fluoro-modified nucleotide; each NM1, NM2, NM3, NM4, NM5, NM6, NM7 and NM8 independently represents a modified or unmodified nucleotide; each NL independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, and n is an integer of 0 to 7.
[0034] In some embodiments, NM2, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide;
[0035] In some embodiments, NM2, NM3 and NM7 each independently represents a 2'-fluoro-modified nucleotide and NM6 represents an UNA modified nucleotide;
[0036] In some embodiments, n is 1, or n is 2, or n is 3.
[0037] In some embodiments, NM6, NM3 and NM2 are all 2'-fluoro-modified nucleotides.
[0038] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) is provided, wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein said sense strand is complementary to the antisense strand, wherein said antisense strand comprises a region of complementarity to an mRNA encoding HMGCR, wherein the region of complementarity comprises at least 15 contiguous nucleotides, wherein the dsRNA duplex represented by formula (III) :
[0039] sense: 5′- (N′L) n′N′L N′L N′N1 N′N2 N′N3 N′N4N′L N′F N′L N′N5 N′N6 N′L N′L N′L (N′L) m′-3′
[0040] antisense: 3′- (NL) n NM1 NL NM2 NL NF NL NM3 NL NM4 NL NM5 NM6 NL NM7 NM8 NL NF NL-5′ (III)
[0041] wherein:
[0042] each strand is independently about 17 to about 30 nucleotides in length;
[0043] each NF and N′F independently represents a 2'-fluoro-modified nucleotide; NM1, NM2, NM3, NM4, NM5, NM6, NM7, NM8, N′N1, N′N2, N′N3, N′N4, N′N5, and N′N6 each independently represents a modified or unmodified nucleotide; each NL and N′L independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, and m′, n′and n are each independently an integer of 0 to 7.
[0044] In some embodiments, m′is 2 and n′is 3, or m′is 2 and n′is 4, m′is 2 and n′is 5.
[0045] In some embodiments, N′N2 and N′N4 each independently represents a 2'-fluoro-modified nucleotide;
[0046] In some embodiments, n is 1, or n is 2, or n is 3.
[0047] In some embodiments, NM2, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide; in certain embodiment, NM2, NM3 and NM6 are all 2'-fluoro-modified nucleotides.
[0048] In some embodiments, NM2, NM3 and NM7 each independently represents a 2'-fluoro-modified nucleotide and NM6 represents an UNA modified nucleotide.
[0049] In some embodiments, the dsRNA agent includes a targeting group that is conjugated to the 5’ -terminal end of the sense strand, preferably, the targeting group is any one selected from aforesaid GLO-1 through GLO-16 and GLS-1*through GLS-16*, more preferably, the targeting group is aforesaid GLS-15*. In certain embodiments, the dsRNA agent includes a targeting group that is conjugated to the 5'-terminal end of the sense strand. In certain embodiments, the antisense strand includes one inverted abasic residue at 3’ -terminal end. In certain embodiments, the sense strand includes one or two inverted abasic residues and / or one or two imann residues at 3’ or / and 5’ terminal end. In certain embodiments, 3’ terminal end of the sense strand independently includes an inverted abasic residue. In certain embodiments, each 3’ and 5’ terminal end of the sense strand independently includes an inverted abasic residue. In certain embodiments, each 3’ and 5’ terminal end of the sense strand independently includes an imann residue. In certain embodiments, each 3’ and 5’ terminal end of the sense strand includes an inverted abasic residue and either residue at 3’ or 5’ terminal end is further conjugated to a targeting group, which preferably is aforesaid GLS-15*. In certain embodiments, 3’ -end of the sense strand includes an inverted abasic residue and 5’ terminal end is conjugated to a targeting group, which preferably is aforesaid GLS-15*. In certain embodiments, each 3’ and 5’ terminal end of the sense strand includes an imann residue and either residue at 3’ or 5’ terminal end is further conjugated to a targeting group, which preferably is aforesaid GLS-15*. In certain embodiments, the dsRNA agent has two blunt ends. In certain embodiments, at least one strand includes a 3’ overhang of at least 1 nucleotide. In certain embodiments, at least one strand includes a 3’ overhang of at least 2 nucleotides.
[0050] In some embodiments, at least one linkage of the sense strand and / or the antisense strand is a phosphodiester (PO) linkage. In some embodiments, at least one linkage of the sense strand and / or the antisense strand is a modified linkage. In some embodiments, at least one linkage of the sense strand and / or the antisense strand is a phosphorothioate (PS) linkage. In some embodiments, at least one phosphorothioate (PS) linkage is introduced at the 5’ -end, 3’-end or both ends of the sense strand and / or the antisense strand. In some embodiments, 1, 2, 3, 4, 5, or 6 phosphorothioate (PS) linkages are introduced at the 5’ -end, 3’ -end or both ends of the sense strand and / or the antisense strand. In some embodiments, at least the terminal two modified or unmodified nucleotides at one end or both ends of the antisense strand are linked through phosphorothioate linkages. In some embodiments, the terminal three modified or unmodified nucleotides at one end or both ends of the antisense strand are linked through phosphorothioate linkages. In some embodiments, at least the terminal two modified or unmodified nucleotides at one end or both ends of the sense strand are linked through phosphorothioate linkages. In some embodiments, the terminal three modified or unmodified nucleotides at one end or both ends of the sense strand are linked through phosphorothioate linkages. In some embodiments, the terminal three modified or unmodified nucleotides at 5’ end of the sense strand are linked through phosphorothioate linkages and the terminal two modified or unmodified nucleotides at 3’ end of the sense strand are linked through phosphorothioate linkages. In some embodiments, the sense strand comprises phosphorothioate linkages between the targeting group and the inverted abasic residue or the imann residue, and between the inverted abasic residue or the imann residue and the terminal modified or unmodified nucleotide at 5’ end of the sense strand. In some embodiments, the sense strand comprises phosphorothioate linkage between the targeting group and the terminal modified or unmodified nucleotide at 5’ end of the sense strand, and between the inverted abasic residue and the terminal modified or unmodified nucleotide at 3’ end of the sense strand.
[0051] In some embodiments, the dsRNA agent comprises one or more chirally modified internucleotide linkages. In some embodiments, the antisense strand of the dsRNA agent comprises one or more chirally modified internucleotide linkages. In some embodiments, the sense strand of the dsRNA agent comprises one or more chirally modified internucleotide linkages. In some embodiments, only the antisense strand of the dsRNA agent comprises one or more chirally modified internucleotide linkages, and all the linkages of the sense strand are achiral or racemic. In some embodiments, the one or more chirally modified internucleotide linkages are introduced to 5' end, 3' end, or both 5' end and 3' end of each strand. In some embodiments, the one or more chirally modified internucleotide linkages are introduced to 5' end, 3' end, or both 5' end and 3' end of antisense strand. In some embodiments, the one or more chirally modified internucleotide linkages are introduced to 5' end, 3' end, or both 5' end and 3' end of sense strand. In some embodiments, the first, the second or both the first and the second internucleotide linkages at the 5' terminal of antisense strand (counting from the 5' end) are chirally modified internucleotide linkages. In some embodiments, the first internucleotide linkage at the 5'-end of antisense strand (counting from the 5'-end) is a chirally modified internucleotide linkage. In some embodiments, the first internucleotide linkage at the 5'-end of antisense strand (counting from the 5'-end) is a chirally modified internucleotide linkage, and the first internucleotide linkage at the 3'-end of antisense strand is achiral or racemic (counting from the 3'-end) . In some embodiments, only the first internucleotide linkage at the 5' end of antisense strand is a chirally modified internucleotide linkage, and the rest internucleotide linkages of antisense strand are achiral or racemic. In some embodiments, the first, second or both first and second internucleotide linkages at the 3' end of antisense strand (counting from the 3' end) are chirally modified internucleotide linkages. In some embodiments, the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkages. In some embodiments, the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkages, the first internucleotide linkage at the 5' end of antisense strand is achiral or racemic. In some embodiments, the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkages, the rest internucleotide linkages of antisense strand are achiral or racemic.
[0052] In some embodiments, the chirally modified internucleotide linkages comprise asymmetric phosphorus atoms, wherein the asymmetric phosphorus atom is in either Rp or Sp configuration, or combination thereof.
[0053] In some embodiments, the first internucleotide linkage at the 5' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Rp configuration. In some embodiments, the first internucleotide linkage at the 5' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Rp configuration, and the first internucleotide linkage at the 3' end of antisense strand is achiral or racemic. In some embodiments, the first internucleotide linkage at the 5'end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Rp configuration, and the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Sp configuration. In some embodiments, the first internucleotide linkage at the 5' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Rp configuration, and the rest internucleotide linkages of antisense strand are achiral or racemic. In some embodiments, the first internucleotide linkage at the 5' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Rp configuration, and the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Sp configuration, and the rest internucleotide linkages of antisense strand are achiral or racemic.
[0054] In some embodiments, the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Rp configuration. In some embodiments, the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Rp configuration, and the first internucleotide linkage at the 5' end of antisense strand is achiral or racemic. In some embodiments, the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Rp configuration, and the rest internucleotide linkages of antisense strand are achiral or racemic.
[0055] In some embodiments, the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Sp configuration. In some embodiments, the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkages is Sp configuration, and the first internucleotide linkage at the 5' end of antisense strand is achiral or racemic. In some embodiments, only the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Sp configuration, and the rest internucleotide linkages of antisense strand are achiral or racemic.
[0056] In some embodiments, the first internucleotide linkage at the 5' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Sp configuration. In some embodiments, the first internucleotide linkage at the 5' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkages is Sp configuration, and the first internucleotide linkage at the 3' end of antisense strand is achiral or racemic. In some embodiments, only the first internucleotide linkage at the 5' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Sp configuration, and the rest internucleotide linkages of antisense strand are achiral or racemic.
[0057] In some embodiments, at least one of the chirally modified internucleotide linkages is a chirally modified phosphorothioate (PS) linkage. In some embodiments, the dsRNA agent includes at least one phosphorothioate internucleotide linkage. In some embodiments, the first internucleotide linkage counting from the 5'-end of antisense strand is a chirally modified phosphorothioate linkage, and the phosphorus of the phosphorothioate internucleotide linkage is in Rp configuration. In some embodiments, the first internucleotide linkage counting from the 5'-end of antisense strand is a phosphorothioate linkage, wherein the phosphorus of the phosphorothioate internucleotide linkage is in Rp configuration, and the first internucleotide linkage counting from the 3'-end of antisense strand is achiral or racemic. In some embodiments, only the first internucleotide linkage counting from the 5'-end of antisense strand is a chirally modified phosphorothioate linkage, wherein the phosphorus of the phosphorothioate internucleotide linkage is in Rp configuration, and the rest internucleotide linkages of antisense strand are achiral or racemic.
[0058] In some embodiments, the first internucleotide linkage counting from the 3'-end of antisense strand is a phosphorothioate linkage, wherein the phosphorus of the phosphorothioate internucleotide linkage is in Sp configuration. In some embodiments, the first internucleotide linkage counting from the 3'-end of antisense strand is a phosphorothioate linkage, wherein the phosphorus of the phosphorothioate internucleotide linkage is in Sp configuration, and the first internucleotide linkage counting the 5' end of antisense strand is achiral or racemic. In some embodiments, the first internucleotide linkage counting from the 3'-end of antisense strand is a phosphorothioate linkage, wherein the phosphorus of the phosphorothioate internucleotide linkage is in Sp configuration, and the rest internucleotide linkages of antisense strand are achiral or racemic.
[0059] In some embodiments, the first and the second internucleotide linkages counting from the 3' end of antisense strand are racemic phosphorothioate internucleotide, and the first internucleotide linkage counting from the 5' end of antisense strand is a phosphorothioate internucleotide linkage in Rp configuration, and the second internucleotide linkage counting from the 5'-end of antisense strand is an achiral phosphodiester linkage (PO) and the rest internucleotide linkages of antisense strand are achiral or racemic. In some embodiments, the first and the second internucleotide linkages counting from the 3'-end of antisense strand are racemic phosphorothioate linkages, and the first internucleotide linkage counting from the 5'-end of antisense strand is a Rp phosphorothioate linkage, and optionally, the rest internucleotide linkages of antisense strand are achiral phosphodiester linkages (PO) . In some embodiments, the first and the second internucleotide linkages counting from the 5'-end of antisense strand are racemic phosphorothioate linkages, and the first internucleotide linkage counting from the 3'-end of antisense strand is a Sp phosphorothioate linkage, and optionally the rest internucleotide linkages of antisense strand are achiral phosphodiester linkages (PO) .
[0060] In some embodiments, the sense strand sequence of the HMGCR dsRNA agent may be represented by formula (Ia) :
[0061] 5’- (Nd’ ) p’ (Nr’ ) q’ (Nx21) o’ Nx20Nx19Nx18Nx17Nx16Nx15Nx14Nx13Nx12Nx11Nx10Nx9Nx8Nx7Nx6Nx5Nx4Nx3Nx2 (Nx1) o (Nr) p (Nd) q-3’ (Ia)
[0062] wherein,
[0063] the sense strand is about 19 to about 30 nucleotides in length;
[0064] each o, p, q, o’ , p’ , q’ independently represents 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;
[0065] each Nx9, Nx11 and Nx13 independently represents a 2'-fluoro-modified nucleotide, preferably, Nx9, Nx11 and Nx13 are all 2'-fluoro-modified nucleotides;
[0066] each Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2, Nx1 independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, preferably, each Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2, Nx1 independently represents the modified nucleotide defined aforesaid, and more preferably, each Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2, Nx1 independently represents a 2’ -O-methyl modified nucleotide; each Nr or Nr’ independently represents an inverted abasic residue or an imann residue described elsewhere herein of the invention;
[0067] each Nd or Nd’ independently represents a targeting group; or optionally, each Nd or Nd’ independently represents a targeting group includes N-acetyl-galactosamine (GalNAc) ; or optionally, each Nd or Nd’ independently represents a targeting group has a structure as Formula (X) defined aforementioned; or optionally, each Nd or Nd’ independently represents a targeting group is independently selected from a GalNAc-containing compound of any one of compounds GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structure of each of which is provided elsewhere herein;
[0068] each linkage in the backbone is independently a phosphodiester (PO) linkage or a phosphorothioate (PS) linkage, preferably, at least one linkage in the backbone is a phosphorothioate (PS) linkage, more preferably, at least one linkage in the backbone is a chirally modified phosphorothioate linkage, more preferably, at least one linkage in the backbone is a phosphorothioate linkage in Rp configuration.
[0069] In some embodiments, p, q, p’ and q’ are each independently 0, o and o’ are each independently 1.
[0070] In some embodiments, p, q, p’ and q’ are each independently 0, o is 1, and o’ is 3.
[0071] In some embodiments, q and q’ are each independently 0, p’ , p, o and o’ are each independently 1.
[0072] In some embodiments, q is 0, p’ , p, q’ , o and o’ are each independently 1.
[0073] In some embodiments, when o or o’ is more than 1, each Nx21 or Nx1 is independently the same or different.
[0074] In some embodiments, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, and Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’-O-methyl modified nucleotides.
[0075] In some embodiments, each Nr or Nr’ independently represents an inverted abasic residue.
[0076] In some embodiments, each Nr or Nr’ independently represents an imann residue.
[0077] In some embodiments, each Nd or Nd’ independently represents GLS-15*.
[0078] In some embodiments, the linkage between Nd’ and Nr’ , Nr’ and Nx21, Nx21 and Nx20, Nx21 and Nx19, Nx3 and Nx2, Nx2 and Nx1, Nx1 and Nr, Nr and Nd each independently is a phosphodiester (PO) linkage or a phosphorothioate (PS) linkage, and at least one of the linkages is a phosphorothioate (PS) linkage.
[0079] In some embodiments, the linkage between Nd’ and Nr’ , Nr’ and Nx21, Nx21 and Nx20, Nx21 and Nx19, Nx3 and Nx2, Nx2 and Nx1, Nx1 and Nr, Nr and Nd each independently is a phosphodiester (PO) linkage or a phosphorothioate (PS) linkage, and at least one of the linkages is a chirally modified phosphorothioate (PS) linkage.
[0080] In some embodiments, the linkage between Nd’ and Nr’ , Nr’ and Nx21, Nx21 and Nx20, Nx21 and Nx19, Nx3 and Nx2, Nx2 and Nx1, Nx1 and Nr, Nr and Nd each independently is a phosphodiester (PO) linkage or a phosphorothioate (PS) linkage, and at least one of the linkages is a phosphorothioate linkage in Rp configuration.
[0081] In some embodiments, p’ , p, q, q’ are all 0, both o and o’ are 1, the linkages between Nx21 and Nx20, Nx20 and Nx19, Nx2 and Nx1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0082] In some embodiments, p’ , p, q, q’ are all 0, both o and o’ are 1, the linkages between Nx21 and Nx20, Nx20 and Nx19, Nx2 and Nx1, Nx3 and Nx2 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0083] In some embodiments, q is 0, p’ , p, q’ , o and o’ are all 1, the linkages between Nd’ and Nr’, Nr’ and Nx21, Nx1 and Nr are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0084] In some embodiments, q is 0, p’ , p, q’ , o and o’ are all 1, the linkages between Nd’ and Nr’, Nr’ and Nx21, Nx1 and Nr, Nx2 and Nx1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0085] In some embodiments, both q and q’ are 0, p’ , p, o and o’ are all 1, the linkages between Nd’ and Nx21, Nx1 and Nr, Nx2 and Nx1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0086] In some embodiments, both q and q’ are 0, p’ , p, o and o’ are all 1, the linkages between Nd’ and Nr’ , Nr’ and Nx21, Nx1 and Nr, Nx2 and Nx1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0087] In some embodiments, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’-O-methyl modified nucleotides, each Nr or Nr’ independently represents an inverted abasic residue, each Nd or Nd’ independently represents GLS-15*, p’ , p, q, q’ are all 0, both o and o’ are 1, the linkages between Nx21 and Nx20, Nx20 and Nx19, Nx2 and Nx1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0088] In some embodiments, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’-O-methyl modified nucleotides, each Nr or Nr’ independently represents an inverted abasic residue, each Nd or Nd’ independently represents GLS-15*, p’ , p, q, q’ are all 0, both o and o’ are 1, the linkages between Nx21 and Nx20, Nx20 and Nx19, Nx2 and Nx1, Nx3 and Nx2 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0089] In some embodiments, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’-O-methyl modified nucleotides, each Nr or Nr’ independently represents an inverted abasic residue, each Nd or Nd’ independently represents GLS-15*, q is 0, p’ , p, q’ , o and o’ are all 1, the linkages between Nd’ and Nr’ , Nr’ and Nx21, Nx1 and Nr are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0090] In some embodiments, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’-O-methyl modified nucleotides, each Nr or Nr’ independently represents an inverted abasic residue, each Nd or Nd’ independently represents GLS-15*, q is 0, p’ , p, q’ , o and o’ are all 1, the linkages between Nd’ and Nr’ , Nr’ and Nx21, Nx1 and Nr, Nx2 and Nx1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0091] In some embodiments, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’-O-methyl modified nucleotides, each Nr or Nr’ independently represents an inverted abasic residue, each Nd or Nd’ independently represents GLS-15*, both q and q’ are 0, p’ , p, o and o’ are all 1, the linkages between Nd’ and Nx21, Nx1 and Nr, Nx2 and Nx1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0092] In some embodiments, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’-O-methyl modified nucleotides, each Nr or Nr’ independently represents an inverted abasic residue, each Nd or Nd’ independently represents GLS-15*, both q and q’ are 0, p’ , p, o and o’ are all 1, the linkages between Nd’ and Nr’ , Nr’ and Nx21, Nx1 and Nr, Nx2 and Nx1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0093] In some embodiments, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’-O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, p’ , p, q, q’ are all 0, both o and o’ are 1, the linkages between Nx21 and Nx20, Nx20 and Nx19, Nx2 and Nx1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0094] In some embodiments, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’-O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, p’ , p, q, q’ are all 0, both o and o’ are 1, the linkages between Nx21 and Nx20, Nx20 and Nx19, Nx2 and Nx1, Nx3 and Nx2 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0095] In some embodiments, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’-O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, q is 0, p’ , p, q’ , o and o’ are all 1, the linkages between Nd’ and Nr’ , Nr’ and Nx21, Nx1 and Nr are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0096] In some embodiments, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’-O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, q is 0, p’ , p, q’ , o and o’ are all 1, the linkages between Nd’ and Nr’ , Nr’ and Nx21, Nx1 and Nr, Nx2 and Nx1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0097] In some embodiments, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’-O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, both q and q’ are 0, p’ , p, o and o’ are all 1, the linkages between Nd’ and Nx21, Nx1 and Nr, Nx2 and Nx1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0098] In some embodiments, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’-O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, both q and q’ are 0, p’ , p, o and o’ are all 1, the linkages between Nd’ and Nr’ , Nr’ and Nx21, Nx1 and Nr, Nx2 and Nx1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0099] In some embodiments, the antisense strand sequence of the HMGCR dsRNA agent may be represented by formula (IIa) :
[0100] 3’- (Nk’ ) s’ (Nj’ ) t’ (Ny21) v’ Ny20Ny19Ny18Ny17Ny16Ny15Ny14Ny13Ny12Ny11Ny10Ny9Ny8Ny7Ny6Ny5N y4Ny3Ny2 (Ny1) v (Nj) s (Nk) t-5’ (IIa)
[0101] wherein,
[0102] the antisense strand is about 19 to about 30 nucleotides in length;
[0103] each v, s, t, s’ , t’ , v’ independently represents 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;
[0104] each Ny2, Ny5, Ny7, Ny12, Ny14 and Ny16 independently represents a 2'-fluoro-modified nucleotide or a UNA modified nucleotide;
[0105] each Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1 independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, preferably, each Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1 independently represents the modified nucleotide defined aforesaid, and more preferably, each Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1 independently represents a 2’ -O-methyl modified nucleotide;
[0106] each Nj or Nj’ independently represents an inverted abasic residue or an imann residue described elsewhere herein of the invention;
[0107] each Nk or Nk’ independently represents a targeting group; or optionally, each Nk or Nk’ independently represents a targeting group includes N-acetyl-galactosamine (GalNAc) ; or optionally, each Nk or Nk’ independently represents a targeting group has a structure as Formula (X) defined aforementioned; or optionally, each Nk or Nk’ independently represents a targeting group is independently selected from a GalNAc-containing compound of any one of compounds GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structure of each of which is provided elsewhere herein;
[0108] each linkage in the backbone is independently a phosphodiester (PO) linkage or a phosphorothioate (PS) linkage, preferably, at least one linkage in the backbone is a phosphorothioate (PS) linkage, more preferably, at least one linkage in the backbone is a chirally modified phosphorothioate linkage, more preferably, at least one linkage in the backbone is a phosphorothioate linkage in Rp configuration.
[0109] In some embodiments, s, t, s’ and t’ are all 0, both v and v’ are 1.
[0110] In some embodiments, when v or v’ is more than 1, each Ny21 or Ny1 is independently the same or different.
[0111] In some embodiments, Ny2, Ny7, Ny12, Ny14 and Ny16 are 2'-fluoro-modified nucleotides, and Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny5, Ny4, Ny3, Ny1 are 2’ -O-methyl modified nucleotide.
[0112] In some embodiments, Ny2, Ny5, Ny12, Ny14 and Ny16 are 2'-fluoro-modified nucleotides, Ny7 is a UNA modified nucleotide and Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1 are 2’ -O-methyl modified nucleotides.
[0113] In some embodiments, each Nj or Nj’ independently represents an inverted abasic residue.
[0114] In some embodiments, each Nj or Nj’ independently represents an imann residue.
[0115] In some embodiments, the linkage between Nk’ and Nj’ , Nj’ and Ny21, Ny21 and Ny20, Ny21 and Ny19, Ny3 and Ny2, Ny2 and Ny1, Ny1 and Nj, Nj and Nk each independently is a phosphodiester (PO) linkage or a phosphorothioate (PS) linkage, and at least one of the linkages is a phosphorothioate (PS) linkage.
[0116] In some embodiments, the linkage between Nk’ and Nj’ , Nj’ and Ny21, Ny21 and Ny20, Ny21 and Ny19, Ny3 and Ny2, Ny2 and Ny1, Ny1 and Nj, Nj and Nk each independently is a phosphodiester (PO) linkage or a phosphorothioate (PS) linkage, and at least one of the linkages is a chirally modified phosphorothioate (PS) linkage.
[0117] In some embodiments, the linkage between Nkn and Nj’ , Nj’ and Ny21, Ny21 and Ny20, Ny21 and Ny19, Ny3 and Ny2, Ny2 and Ny1, Ny1 and Nj, Nj and Nk each independently is a phosphodiester (PO) linkage or a phosphorothioate (PS) linkage, and at least one of the linkages is a phosphorothioate linkage in Rp configuration.
[0118] In some embodiments, s, t, s’ and t’ are all 0, both v and v’ are 1, the linkages between Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2, Ny2 and Ny1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0119] In some embodiments, s, t, s’ and t’ are all 0, both v and v’ are 1, the linkages between Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2 are phosphorothioate (PS) linkages, the linkage between Ny2 and Ny1 is a chirally modified phosphorothioate (PS) linkage, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0120] In some embodiments, s, t, s’ and t’ are all 0, both v and v’ are 1, the linkages between Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2 are phosphorothioate (PS) linkages, the linkage between Ny2 and Ny1 is a phosphorothioate linkage in Rp configuration, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0121] In some embodiments, s, t, s’ and t’ are all 0, both v and v’ are 1, Ny2, Ny7, Ny12, Ny14 and Ny16 are 2'-fluoro-modified nucleotides, and Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny5, Ny4, Ny3, Ny1 are 2’ -O-methyl modified nucleotide, the linkages between Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2, Ny2 and Ny1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0122] In some embodiments, s, t, s’ and t’ are all 0, both v and v’ are 1, Ny2, Ny7, Ny12, Ny14 and Ny16 are 2'-fluoro-modified nucleotides, and Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny5, Ny4, Ny3, Ny1 are 2’ -O-methyl modified nucleotide, the linkages between Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2 are phosphorothioate (PS) linkages, the linkage between Ny2 and Ny1 is a phosphorothioate linkage in Rp configuration, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0123] In some embodiments, s, t, s’ and t’ are all 0, both v and v’ are 1, Ny2, Ny5, Ny12, Ny14 and Ny16 are 2'-fluoro-modified nucleotides, Ny7 is a UNA modified nucleotide and Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1 are 2’ -O-methyl modified nucleotides, the linkages between Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2, Ny2 and Ny1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0124] In some embodiments, s, t, s’ and t’ are all 0, both v and v’ are 1, Ny2, Ny5, Ny12, Ny14 and Ny16 are 2'-fluoro-modified nucleotides, Ny7 is a UNA modified nucleotide and Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1 are 2’ -O-methyl modified nucleotides, the linkages between Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2 are phosphorothioate (PS) linkages, the linkage between Ny2 and Ny1 is a phosphorothioate linkage in Rp configuration, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0125] In some embodiments, the sense strand represented by formula (Ia) forms a duplex with the antisense strand represented by formula (IIa) .
[0126] Accordingly, the combination comprising the HMGCR dsRNA agents of the invention may comprise a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein said sense strand is complementary to the antisense strand, wherein said antisense strand comprises a region of complementarity to an mRNA encoding HMGCR, wherein the region of complementarity comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides with 0, 1, 2 or 3 mismatches, wherein the dsRNA duplex may be represented by formula (IIIa) :
[0127] Sense strand: 5’ - (Nd’ ) p’ (Nr’ ) q’ (Nx21) o’ Nx20Nx19Nx18Nx17Nx16Nx15Nx14Nx13Nx12Nx11Nx10Nx9Nx8Nx7Nx6Nx5Nx4Nx3Nx2 (Nx1) o (Nr) p (Nd) q-3’
[0128] Antisense strand: 3’ - (Nk’ ) s’ (Nj’ ) t’ (Ny21) v’ Ny20Ny19Ny18Ny17Ny16Ny15Ny14Ny13Ny12Ny11Ny10Ny9Ny8Ny7Ny6Ny5N y4Ny3Ny2 (Ny1) v (Nj) s (Nk) t-5’ (IIIa)
[0129] wherein, the o, p, q, o’ , p’ , q’ , Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx13, Nx12, Nx11, Nx10, Nx9, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2, Nx1, Nr, Nr’ , Nd, Nd’ , v, s, t, s’ , t’ , v’ , Ny21, Ny20, Ny19, Ny18, Ny17, Ny16, Ny15, Ny14, Ny13, Ny12, Ny11, Ny10, Ny9, Ny8, Ny7, Ny6, Ny5, Ny4, Ny3, Ny2, Ny1, Nj, Nj’ , Nk, Nk’ are as defined above.
[0130] In certain embodiments, p’ , p, q, q’ , s, t, s’ and t’ are all 0, o, o’ , v and v’ are all 1, Nx9, Nx11, Nx13, Ny2, Ny7, Ny12, Ny14 and Ny16 are 2'-fluoro-modified nucleotides, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny5, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an inverted abasic residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nx21 and Nx20, Nx20 and Nx19, Nx2 and Nx1, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2, Ny2 and Ny1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0131] In certain embodiments, p’ , p, q, q’ , s, t, s’ and t’ are all 0, o, o’ , v and v’ are all 1, Ny2, Ny7, Ny12, Ny14 and Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny5, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an inverted abasic residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nx21 and Nx20, Nx20 and Nx19, Nx2 and Nx1, Nx3 and Nx2, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2, Ny2 and Ny1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0132] In certain embodiments, q s, t, s’ and t’ are all 0, p’ , p, q’ , o, o’ , v and v’ are all 1, Ny2, Ny7, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny5, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an inverted abasic residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nd’ and Nr’ , Nr’ and Nx21, Nx1 and Nr, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2, Ny2 and Ny1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0133] In certain embodiments, q, s, t, s’ and t’ are all 0, v, v’ , p’ , p, q’ , o and o’ are all 1, Ny2, Ny7, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny5, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an inverted abasic residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nd’ and Nr’ , Nr’ and Nx21, Nx1 and Nr, Nx2 and Nx1, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2, Ny2 and Ny1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0134] In certain embodiments, q, q’s , t, s’ and t’ are all 0, v, v’ , p’ , p, o and o’ are all 1, Ny2, Ny7, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny5, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an inverted abasic residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nd’ and Nx21, Nx1 and Nr, Nx2 and Nx1, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2, Ny2 and Ny1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0135] In certain embodiments, q, q’s , t, s’ and t’ are all 0, v, v’ , p’ , p, o and o’ are all 1, Ny2, Ny7, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny5, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an inverted abasic residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nd’ and Nr’ , Nr’ and Nx21, Nx1 and Nr, Nx2 and Nx1, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2, Ny2 and Ny1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0136] In certain embodiments, p’ , p, q, q’ , s, t, s’ and t’ are all 0, o, o’ , v and v’ are all 1, Ny2, Ny7, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny5, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nx21 and Nx20, Nx20 and Nx19, Nx2 and Nx1, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2, Ny2 and Ny1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0137] In certain embodiments, p’ , p, q, q’ , s, t, s’ and t’ are all 0, v and v’ , o and o’ are all 1, Ny2, Ny7, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny5, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2, Ny2 and Ny1, Nx21 and Nx20, Nx20 and Nx19, Nx2 and Nx1, Nx3 and Nx2 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0138] In certain embodiments, q, s, t, s’ and t’ are all 0, v, v’ p’ , p, q’ , o and o’ are all 1, Ny2, Ny7, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny5, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nd’ and Nr’ , Nr’ and Nx21, Nx1 and Nr, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2, Ny2 and Ny1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0139] In certain embodiments, q, s, t, s’ and t’ are all 0, v, v’ p’ , p, q’ , o and o’ are all 1, Ny2, Ny7, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny5, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nd’ and Nr’ , Nr’ and Nx21, Nx1 and Nr, Nx2 and Nx1, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2, Ny2 and Ny1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0140] In certain embodiments, both q, q’ , s, t, s’ and t’ are all 0, v, v’ , p’ , p, o and o’ are all 1, Ny2, Ny7, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny5, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nd’ and Nx21, Nx1 and Nr, Nx2 and Nx1, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2, Ny2 and Ny1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0141] In certain embodiments, q, q’ , s, t, s’ and t’ are all 0, v, v’ , p’ , p, o and o’ are all 1, Ny2, Ny7, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny5, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nd’ and Nr’ , Nr’ and Nx21, Nx1 and Nr, Nx2 and Nx1, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2, Ny2 and Ny1 are phosphorothioate (PS) linkages, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0142] In certain embodiments, q, s, t, s’ and t’ are all 0, v, v’ , p’ , p, q’ , o and o’ are all 1, Ny2, Ny5, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny7 is a UNA modified nucleotide, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an inverted abasic residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nd’ and Nr’ , Nr’ and Nx21, Nx1 and Nr, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2 are phosphorothioate (PS) linkages, the linkage between Ny2 and Ny1 is a phosphorothioate linkage in Rp configuration, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0143] In certain embodiments, q, s, t, s’ and t’ are all 0, v, v’ p’ , p, q’ , o and o’ are all 1, Ny2, Ny5, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny7 is a UNA modified nucleotide, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an inverted abasic residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nd’ and Nr’ , Nr’ and Nx21, Nx1 and Nr, Nx2 and Nx1, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2 are phosphorothioate (PS) linkages, the linkage between Ny2 and Ny1 is a phosphorothioate linkage in Rp configuration, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0144] In certain embodiments, q, q’ , s, t, s’ and t’ are all 0, v, v’ , p’ , p, o and o’ are all 1, Ny2, Ny5, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny7 is a UNA modified nucleotide, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an inverted abasic residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nd’ and Nx21, Nx1 and Nr, Nx2 and Nx1, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2 are phosphorothioate (PS) linkages, the linkage between Ny2 and Ny1 is a phosphorothioate linkage in Rp configuration, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0145] In certain embodiments, q, q’ , s, t, s’ and t’ are all 0, v, v’ , p’ , p, o and o’ are all 1, Ny2, Ny5, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny7 is a UNA modified nucleotide, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an inverted abasic residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nd’ and Nr’ , Nr’ and Nx21, Nx1 and Nr, Nx2 and Nx1, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2 are phosphorothioate (PS) linkages, the linkage between Ny2 and Ny1 is a phosphorothioate linkage in Rp configuration, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0146] In certain embodiments, p’ , p, q, q’ , s, t, s’ and t’ are all 0, v, v’ , o and o’ are all 1, Ny2, Ny5, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny7 is a UNA modified nucleotide, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nx21 and Nx20, Nx20 and Nx19, Nx2 and Nx1, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2 are phosphorothioate (PS) linkages, the linkage between Ny2 and Ny1 is a phosphorothioate linkage in Rp configuration, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0147] In certain embodiments, p’ , p, q, q’ , s, t, s’ and t’ are all 0, v, v’ , o and o’ are all 1, Ny2, Ny5, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny7 is a UNA modified nucleotide, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nx21 and Nx20, Nx20 and Nx19, Nx2 and Nx1, Nx3 and Nx2, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2 are phosphorothioate (PS) linkages, the linkage between Ny2 and Ny1 is a phosphorothioate linkage in Rp configuration, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0148] In certain embodiments, q, s, t, s’ and t’ are all 0, v, v’ , p’ , p, q’ , o and o’ are all 1, Ny2, Ny5, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny7 is a UNA modified nucleotide, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nd’ and Nr’, Nr’ and Nx21, Nx1 and Nr, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2 are phosphorothioate (PS) linkages, the linkage between Ny2 and Ny1 is a phosphorothioate linkage in Rp configuration, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0149] In certain embodiments, q, s, t, s’ and t’ are all 0, v, v’ , p’ , p, q’ , o and o’ are all 1, Ny2, Ny5, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny7 is a UNA modified nucleotide, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nd’ and Nr’, Nr’ and Nx21, Nx1 and Nr, Nx2 and Nx1, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2 are phosphorothioate (PS) linkages, the linkage between Ny2 and Ny1 is a phosphorothioate linkage in Rp configuration, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0150] In certain embodiments, q, q’ , s, t, s’ and t’ are all 0, v, v’ , p’ , p, o and o’ are all 1, Ny2, Ny5, Ny12, Ny14, Ny16, Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny7 is a UNA modified nucleotide, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nd’ and Nx21, Nx1 and Nr, Nx2 and Nx1, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2 are phosphorothioate (PS) linkages, the linkage between Ny2 and Ny1 is a phosphorothioate linkage in Rp configuration, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0151] In certain embodiments, q, q’ , s, t, s’ and t’ are all 0, v, v’ , p’ , p, o and o’ are all 1, Ny2, Ny5, Ny12, Ny14, Ny16 Nx9, Nx11 and Nx13 are 2'-fluoro-modified nucleotides, Ny7 is a UNA modified nucleotide, Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1, Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2 and Nx1 are 2’ -O-methyl modified nucleotides, each Nr or Nr’ independently represents an imann residue, each Nd or Nd’ independently represents GLS-15*, the linkages between Nd’ and Nr’, Nr’ and Nx21, Nx1 and Nr, Nx2 and Nx1, Ny21 and Ny20, Ny20 and Ny19, Ny3 and Ny2 are phosphorothioate (PS) linkages, the linkage between Ny2 and Ny1 is a phosphorothioate linkage in Rp configuration, and the rest linkages in the backbone are phosphodiester (PO) linkages.
[0152] In some embodiments, any one of the sense strands in Table 1 may further be modified in a pattern shown in aforesaid Formula (I) , (Ia) , (III) or (IIIa) . In some embodiments, any one of the antisense strands in Table 1 may further be modified in a pattern shown in aforesaid Formula (II) , (IIa) , (III) or (IIIa) . In some embodiments, any one of the duplexes in Table 1 may further be modified in a pattern shown in aforesaid Formula (III) or (IIIa) . In some embodiments, the modified sense strand has a modification pattern set forth in any one of Tables 2-3. In some embodiments, the modified antisense strand has a modification pattern set forth in any one of Tables 2-3.
[0153] In some embodiments, the modified sense strand is a modified sense strand sequence set forth in one of Tables 2-3. In some embodiments, the modified antisense strand is a modified antisense strand sequence set forth in one of Tables 2-3.
[0154] In some embodiments, the dsRNA comprises a duplex selected from the group consisting of AD00608, AD00609, AD00610, AD00611, AD00612, AD00613, AD00614, AD00615, AD00616, AD00617, AD00618, AD00619, AD00620, AD00621, AD00622, AD00623, AD00624, AD00625, AD00626, AD00627, AD00628, AD00629, AD00630, AD00631, AD00632, AD00842, AD00843, AD00844, AD00845, AD00846, AD00847, AD00848, AD00849, AD00850, AD00851, AD00852, AD00853, AD00854, AD00855, AD00856, AD00857, AD00858, AD00859, AD00860, AD00861, AD00862, AD00863, AD01021, AD01022, AD01023, AD01024, AD01025, AD01026, AD02602, AD02603, AD02604, AD02605, AD02606, AD02607, AD02608, AD02609, AD02610, AD02611, AD02612, AD02613, AD02614, AD02615, and AD02616.
[0155] In some embodiments, the dsRNA comprises a duplex selected from the group consisting of AD00850-2, AD02040-1, AD02041-1, AD01026-1, AD02059-1, AD00621-1, AD00852-1, AD00620-1, AD00844-1, AD02055-1, AD02060-1, AD02066-1, AD00844-2, and AD02055-2.
[0156] According to an aspect of the invention, a composition is provided that includes any embodiment of the aforementioned dsRNA agent aspect of the invention. In certain embodiments, the composition also includes a pharmaceutically acceptable carrier. In some embodiments, the composition also includes one or more additional therapeutic agents. In certain embodiments, the composition is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial. In some embodiments, the composition is formulated for subcutaneous administration or is formulated for intravenous (IV) administration.
[0157] According to another aspect of the invention a cell is provided that includes any embodiment of an aforementioned combination aspect of the invention. In some embodiments, the cell is a mammalian cell, optionally a human cell.
[0158] According to another aspect of the invention, a method of decreasing the lipid level in a cell, is provided, the method including: (i) preparing a cell including an effective amount of any embodiment of the aforementioned combination aspect of the invention or any embodiment of an aforementioned composition of the invention. In certain embodiments, the method also includes: (ii) maintaining the prepared cell for a time sufficient to obtain the decreased lipid level in the cell. In some embodiments, the cell is in a subject and the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the cell is in a subject and the dsRNA agent is administered to the subject by IV administration. In certain embodiments, the method also includes assessing the lipid level, following the administration of the combination to the subject, wherein a means for the assessing comprises: (i) determining one or more physiological characteristics of an HMGCR-associated disease or condition in the subject and (ii) comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the HMGCR-associated disease or condition and / or to a control physiological characteristic of the HMGCR-associated disease or condition, wherein the comparison indicates one or more of a presence or absence of inhibition of expression of the HMGCR gene in the subject. In some embodiments, the physiological characteristic is one or more of: the HMGCR mRNA level and the HMGCR protein level. A reduction in the expression of HMGCR may also be assessed indirectly by measuring a decrease in biological activity of HMGCR, e.g., a decrease in one or more of: cholesteryl ester (CE) levels, triglyceride levels, cholesterol levels (such as high-density lipoprotein cholesterol (HDL-C) , intermediate-density lipoprotein cholesterol (IDL-C) , low-density lipoprotein cholesterol (LDL-C) level, very-low-density lipoprotein cholesterol (VLDL-C) level) , free fatty acid level and lipid level in blood or serum, level of 3-hydroxy-3-methylglutaryl-CoA reductase expression in the cytoplasma.
[0159] According to another aspect of the invention, a method of decreasing the lipid level in a subject, is provided, the method including administering to the subject an effective amount of an embodiment of the aforementioned combination aspect of the invention or an embodiment of an aforementioned composition of the invention. In some embodiments, the combination is administered to the subject subcutaneously. In certain embodiments, the combination is administered to the subject by IV administration. In some embodiments, the method also includes: assessing inhibition of the HMGCR gene, following the administration of the dsRNA agent, wherein a means for the assessing comprises: (i) determining one or more physiological characteristics of an HMGCR-associated disease or condition in the subject and (ii) comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the HMGCR-associated disease or condition and / or to a control physiological characteristic of the HMGCR-associated disease or condition, wherein the comparison indicates one or more of a presence or absence of inhibition of expression of the HMGCR gene in the subject. In some embodiments, expression of the HMGCR gene can be assessed based on the level or change in level of any variable associated with HMGCR gene expression, such as the HMGCR mRNA level and the HMGCR protein level. A reduction in the expression of HMGCR may also be assessed indirectly by measuring a decrease in biological activity of HMGCR, e.g., a decrease in one or more of: cholesteryl ester (CE) levels, triglyceride levels, cholesterol levels (such as high-density lipoprotein cholesterol (HDL-C) , intermediate-density lipoprotein cholesterol (IDL-C) , low-density lipoprotein cholesterol (LDL-C) level, very-low-density lipoprotein cholesterol (VLDL-C) level) , free fatty acid and lipid level in blood or serum. The expression of an HMGCR may also be assessed indirectly based on other variables associated with HMGCR gene expression, e.g., level of 3-hydroxy-3-methylglutaryl-CoA reductase expression in the cytoplasma, nuclear localization of 3-hydroxy-3-methylglutaryl-CoA reductase, or expression of certain target genes such as Jun, c-Myc and CyclinD-1 or other oncogenes under transcription control of 3-hydroxy-3-methylglutaryl-CoA reductase.
[0160] According to another aspect of the invention, a method of treating a disease or condition associated with the presence of HMGCR protein is provided, the method including: administering to a subject an effective amount of an embodiment of any aforementioned dsRNA agent aspect of the invention or an embodiment of any aforementioned composition of the invention, to inhibit HMGCR gene expression. In some embodiments, the disease, disorder or condition associated with HMGCR is selected from the group consisting of: hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, mixed hyperlipidemia, congestive heart disease (CHD) and atherosclerosis, atherosclerosis, dyslipidemia, acute pancreatitis associated with hypertriglyceridemia, chylomicron syndrom, familial chylomicronemia, Apo-E deficiency or resistance, LPL deficiency or hypoactivity, familial partial lipodystrophy type 1 (FPLD1) , polycystic ovarian syndrome related to insulin resistance, renal transplantation, nephrotic syndrome, Cushing's syndrome, acromegaly, systemic lupus erythematosus, dysglobulinemia, lipodystrophy, glycogenosis type I, and Addison's disease, or other disorders of lipid metabolism related to HMGCR.
[0161] In some embodiments, the method also includes: administering an additional therapeutic regimen to the subject. In some embodiments, the additional therapeutic regimen includes a treatment for the HMGCR-associated disease or condition. In certain embodiments, the additional therapeutic regimen comprises: administering to the subject one or more HMGCR antisense polynucleotides of the invention, administering to the subject a non-HMGCR dsRNA therapeutic agent, and a behavioral modification in the subject. In some embodiments, the non-HMGCR dsRNA therapeutic agent is one or more of: an HMG-CoA reductase inhibitor (e.g., a statin) , a fibrate, a bile acid sequestrant, niacin, a PCSK9 inhibitor (e.g., a PCSK9 RNAi agent, such as Inclisiran) , an antiplatelet agent, an angiotensin converting enzyme inhibitor, an angiotensin II receptor antagonist (e.g., losartan potassium, such as Merck &Co. 's ) , an acylCoA cholesterol acetyltransferase (ACAT) inhibitor, a cholesterol absorption inhibitor, a cholesterol ester transfer protein (CETP) inhibitor, a microsomal triglyceride transfer protein (MTTP) inhibitor, a cholesterol modulator, a bile acid modulator, a peroxisome proliferation activated receptor (PPAR) agonist, a gene -based therapy, a composite vascular protectant (e.g., AGT 1067, from Atherogenics) , a glycoprotein Ilb / IIIa inhibitor, aspirin or an aspirin-like compound, an IB AT inhibitor (e.g., S-8921 , from Shionogi) , a squalene synthase inhibitor, or a monocyte chemoattractant protein (MCP) -I inhibitor, or a combination of any of the foregoing, wherein HMG-CoA reductase inhibitors include, but are not limited to, atorvastatin (Pfizer's / Tahor / Sortis / Torvast / Cardyl) , pravastatin (Bristol-Myers Squibb 's Pravachol, Sankyo's Mevalotin / Sanaprav) , simvastatin (Merck's / Sinvacor, Boehringer Ingelheim's Denan, Banyu's Lipovas) , lovastatin (Merck's Mevacor / Mevinacor, Bexal's Lovastatina, Cepa; Schwarz Pharma's Liposcler) , fluvastatin (Novartis' / Locol / Lochol, Fujisawa's Cranoc, Solvay's Digaril) , cerivastatin (Bayer's Lipobay / GlaxoSmithKline's Baycol) , rosuvastatin (AstraZeneca's ) , and pitivastatin (itavastatin / risivastatin) (Nissan Chemical, Kowa Kogyo, Sankyo, and Novartis) , wherein fibrates include, but are not limited to, bezafibrate (e.g., Roche's Kissei's Bezatol) , clofibrate (e.g., Wyeth's ) , fenofibrate (e.g., Founder's Lipidil / Lipantil, Abbott's Takeda's Lipantil, generics) , gemfibrozil (e.g., Pfizer's Lopid / Lipur) and ciprofibrate (Sanofi-Synthelabo's ) , wherein bile acid sequestrants include, but are not limited to, cholestyramine (Bristol-Myers Squibb's and Questran LightTM) , colestipol (e.g., Pharmacia's Colestid) , and colesevelam (Genzyme / Sankyo's WelCholTM) , wherein niacin therapies include, but are not limited to, immediate releaseformulations, such as Aventis' Nicobid, Upsher-Smith's Niacor, Aventis' Nicolar, and Sanwakagaku's Perycit, wherein Niacin extended release formulations include, e.g., Kos Pharmaceuticals' Niaspan and Upsher-Smith's SIo-Niacin, wherein antiplatelet agents include, but are not limited to, aspirin (e.g., Bayer's aspirin) , clopidogrel (Sanofi-Synthelabo / Bristol-Myers Squibb's Plavix) , and ticlopidine (e.g., Sanofi-Synthelabo's Ticlid and Daiichi's Panaldine) , wherein aspirin-like compounds include, but are not limited to, Asacard (slow-release aspirin, by Pharmacia) and Pamicogrel (Kanebo / Angelini Ricerche / CEPA) , wherein angiotensin-converting enzyme inhibitors include, but are not limited to, ramipril (e.g., Aventis' Altace) and enalapril (e.g., Merck &Co. 's Vasotec) , wherein acyl CoA cholesterol acetyltransferase (AC AT) inhibitors include, but are not limited to, avasimibe (Pfizer) , eflucimibe (BioMsrieux Pierre Fabre / Eli Lilly) , CS-505 (Sankyo and Kyoto) , and SMP-797 (Sumito) , wherein cholesterol absorption inhibitors include, but are not limited to, ezetimibe (Merck / Schering-Plough Pharmaceuticals ) and Pamaqueside (Pfizer) , wherein CETP inhibitors include, but are not limited to, Torcetrapib (also called CP-529414, Pfizer) , JTT-705 (Japan Tobacco) , and CETi-I (Avant Immunotherapeutics) , wherein microsomal triglyceride transfer protein (MTTP) inhibitors include, but are not limited to, implitapide (Bayer) , R-103757 (Janssen) , and CP-346086 (Pfizer) , wherein cholesterol modulators include, but are not limited to, NO-1886 (Otsuka / TAP Pharmaceutical) , CT 1027 (Pfizer) , and WAY-135433 (Wyeth-Ayerst) , wherein bile acid modulators include, but are not limited to, HBS-107 (Hisamitsu / Banyu) , Btg-511 (British Technology Group) , BARI-1453 (Aventis) , S-8921 (Shionogi) , SD-5613 (Pfizer) , and AZD-7806 (AstraZeneca) , wherein peroxisome proliferation activated receptor (PPAR) agonists include, but are not limited to, tesaglitazar (AZ-242) (AstraZeneca) , Netoglitazone (MCC-555) (Mitsubishi / Johnson &Johnson) , GW-409544 (Ligand Pharniaceuticals / GlaxoSmithKline) , GW-501516 (Ligand Pharmaceuticals / GlaxoSmithKline) , LY-929 (Ligand Pharmaceuticals and Eli Lilly) , LY-465608 (Ligand Pharmaceuticals and Eli Lilly) , LY-518674 (Ligand Pharmaceuticals and Eli Lilly) , and MK-767 (Merck and Kyorin) , wherein gene-based therapies include, but are not limited to, AdGWEGF 121.10 (GenVec) , ApoAl (UCB Pharma / Groupe Fournier) , EG-004 (Trinam) (Ark Therapeutics) , and ATP -binding cassette transporter-Al (ABCA1) (CV Therapeutics / Incyte, Aventis, Xenon) , wherein Glycoprotein Ilb / IIIa inhibitors include, but are not limited to, roxifiban (also called DMP754, Bristol-Myers Squibb) , Gantofiban (Merck KGaA / Yamanouchi) , and Cromafiban (Millennium Pharmaceuticals) , wherein squalene synthase inhibitors include, but are not limited to, BMS-1884941 (Bristol-Myers Squibb) , CP-210172 (Pfizer) , CP-295697 (Pfizer) , CP-294838 (Pfizer) , and TAK-475 (Takeda) , wherein MCP-I inhibitor include, but are not limited to, RS-504393 (Roche Bioscience) , wherein anti-atherosclerotic agent include, but are not limited to, BO-653 (Chugai Pharmaceuticals) , wherein the nicotinic acid derivative include, but are not limited to, Nyclin (Yamanouchi Pharaiacuticals) . Exemplary combination therapies suitable for administration with a dsRNA targeting HMGCR include, but are not limited to, advicor (Niacin / lovastatin from Kos Pharmaceuticals) , amlodipine / atorvastatin (Pfizer) , and ezetimibe / simvastatin (e.g., 10 / 10, 10 / 20, 10 / 40, and 10 / 80 tablets by Merck / Schering-Plough Pharmaceuticals) . In some embodiments, the dsRNA agent is administered to the subject subcutaneously. In certain embodiments, the dsRNA agent is administered to the subject by IV administration. In some embodiments, the method also includes determining an efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject. In some embodiments, a means of determining an efficacy of the treatment in the subject comprises: (i) determining one or more physiological characteristics of the HMGCR-associated disease or condition in the subject and (ii) comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the HMGCR-associated disease or condition wherein the comparison indicates one or more of a presence, absence, and level of efficacy of the administration of the double-stranded ribonucleic acid (dsRNA) agent to the subject. In some embodiments, expression of the HMGCR gene can be assessed based on the level or change in level of any variable associated with HMGCR gene expression, such as HMGCR mRNA level, HMGCR protein level in the subject, or cholesteryl ester (CE) levels, triglyceride levels, cholesterol levels (such as high-density lipoprotein cholesterol (HDL-C) , intermediate-density lipoprotein cholesterol (IDL-C) , low-density lipoprotein cholesterol (LDL-C) level, very-low-density lipoprotein cholesterol (VLDL-C) level) , and lipid level in blood or serum.
[0162] According to another aspect of the invention, the aforementioned combination for use in a method of treating a disease or condition associated with the presence of HMGCR protein is provided. In some embodiments, the disease or condition is one or more of: hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, mixed hyperlipidemia, congestive heart disease (CHD) and atherosclerosis, atherosclerosis, dyslipidemia, acute pancreatitis associated with hypertriglyceridemia, chylomicron syndrom, familial chylomicronemia, Apo-E deficiency or resistance, LPL deficiency or hypoactivity, familial partial lipodystrophy type 1 (FPLD1) , polycystic ovarian syndrome related to insulin resistance, renal transplantation, nephrotic syndrome, Cushing's syndrome, acromegaly, systemic lupus erythematosus, dysglobulinemia, lipodystrophy, glycogenosis type I, and Addison's disease, or other disorders of lipid metabolism related to HMGCR.
[0163] Brief Description of the Sequences
[0164] SEQ ID NO: 1 and SEQ ID NO: 2 (reverse complement) are Homo sapiens 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) mRNA [NCBI Reference Sequence: NM_000859.3] .
[0165] SEQ ID NO: 3 and SEQ ID NO: 4 (reverse complement) are Predicted Macaca fascicularis 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) mRNA [NCBI Reference Sequence: XM_005557177.3] .
[0166] SEQ ID NO: 5 and SEQ ID NO: 6 (reverse complement) are Macaca mulatta 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) mRNA [NCBI Reference Sequence: XM_001104607.4] .
[0167] SEQ ID NOs: 7-876, 3157-3164 , 3181-3388, 4023-4234 are shown in Table 1 and are sense strand sequences.
[0168] SEQ ID NOs: 877-1746, 3165-3172, 3389-3596, 4235-4446 are shown in Table 1 and are antisense strand sequences.
[0169] SEQ ID NOs: 1747-2616, 2723-3024, 3173-3180, 3795-4022 are shown in Table 2 with chemical modifications.
[0170] SEQ ID NOs: 2617-2722, 3025-3156, 3597-3794, 4447-4448 are shown in Table 3. A delivery molecule is indicated as “GLX-__” at the 3’ end or 5’ end of each sense strand.Detailed Description
[0171] The invention in part, includes RNAi agents, for example, though not limited to double stranded (ds) RNAi agents, which are capable of inhibiting 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) gene expression. The invention, in part also includes compositions comprising HMGCR RNAi agents and methods of use of the compositions. HMGCR RNAi agents disclosed herein may be attached to delivery compounds for delivery to cells, including to hepatocytes. Pharmaceutical compositions of the invention may include at least one dsRNA HMGCR agent and a delivery compound. In some embodiments of compositions and methods of the invention, the delivery compound is a GalNAc-containing delivery compound. HMGCR RNAi agents delivered to cells are capable of inhibiting HMGCR gene expression, thereby reducing activity in the cell of the HMGCR protein product of the gene. DsRNAi agents of the invention can be used to treat HMGCR-associated diseases and conditions.
[0172] In some embodiments of the invention reducing HMGCR expression in a cell or subject treats a disease or condition associated with HMGCR expression in the cell or subject, respectively. Non-limiting examples of diseases and conditions that may be treated by reducing HMGCR activity are: hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, mixed hyperlipidemia, congestive heart disease (CHD) and atherosclerosis, atherosclerosis, dyslipidemia, acute pancreatitis associated with hypertriglyceridemia, chylomicron syndrom, familial chylomicronemia, Apo-E deficiency or resistance, LPL deficiency or hypoactivity, familial partial lipodystrophy type 1 (FPLD1) , polycystic ovarian syndrome related to insulin resistance, renal transplantation, nephrotic syndrome, Cushing's syndrome, acromegaly, systemic lupus erythematosus, dysglobulinemia, lipodystrophy, glycogenosis type I, and Addison's disease, or other diseases for which reducing a level and activity of HMGCR protein is medically beneficial.
[0173] As used herein, "G, " "C, " "A" and "U" each generally stand for a nucleotide that contains guanine, cytosine, adenine, and uracil as a base, respectively. However, it will be understood that the term "ribonucleotide" or "nucleotide" can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person understands that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base may base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of the invention by a nucleotide containing, for example, inosine. Sequences comprising such replacement moieties are embodiments of the invention.
[0174] As used herein, "3-hydroxy-3-methylglutaryl-CoA reductase" used interchangeably with the term "HMGCR" refers to the naturally occurring gene that encodes a 3-hydroxy-3-methylglutaryl-CoA reductase protein from any vertebrate or mammalian source, including, but not limited to, human, bovine, chicken, rodent, mouse, rat, porcine, ovine, primate, monkey, and guinea pig, unless specified otherwise. The term also refers to fragments and variants of native HMGCR that maintain at least one in vivo or in vitro activity of a native HMGCR. The amino acid and complete coding sequences of the reference sequence of the human HMGCR gene may be found in, for example, GenBank Ref Seq Accession No. NM_000859.3 (SEQ ID NO: 1 and SEQ ID NO: 2) . Mammalian orthologs of the human HMGCR gene may be found in, for example, GenBank Ref Seq Accession No. XM_005557177.3, Cynomolgus monkey (SEQ ID NO: 3 and SEQ ID NO: 4) , GenBank Ref Seq Accession No. XM_001104607.4, Rhesus monkey (SEQ ID NO: 5 and SEQ ID NO: 6) . Additional examples of HMGCR mRNA sequences are readily available using publicly available databases, e.g., GenBank, UniProt, Ensembl and OMIM.
[0175] The following describes how to make and use compositions comprising HMGCR single-stranded (ssRNA) and dsRNA agents to inhibit HMGCR gene expression, as well as compositions and methods for treating diseases and conditions caused by or modulated by HMGCR gene expression. The term “RNAi” is also known in the art, and may be referred to as “siRNA” .
[0176] As used herein, the term “RNAi” refers to an agent that comprises RNA and mediates targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. As is known in the art, an RNAi a target region, which is also defined as “target region” or “target portion” , refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a gene, including messenger RNA (mRNA) that is a product of RNA processing of a primary transcription product. The target portion of the sequence will be at least long enough to serve as a substrate for RNAi-directed cleavage at or near that portion. A target sequence may be from 8-30 nucleotides long (inclusive) , from 10 -30 nucleotides long (inclusive) , from 12 -25 nucleotides long (inclusive) , from 15 -23 nucleotides long (inclusive) , from 16 -23 nucleotides long (inclusive) , or from 18 –23 nucleotides long (inclusive) , including all shorter lengths within each stated range. In some embodiments of the invention, a target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides long. In certain embodiment a target sequence is between 9 and 26 nucleotides long (inclusive) , including all sub-ranges and integers there between. For example, though not intended to be limiting, in certain embodiments of the invention a target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long, with the sequence fully or at least substantially complementary to at least part of an RNA transcript of an HMGCR gene. Some aspects of the invention include pharmaceutical compositions comprising one or more HMGCR dsRNA agents and a pharmaceutically acceptable carrier. In certain embodiments of the invention, an HMGCR RNAi as described herein inhibits expression of HMGCR protein.
[0177] As used herein, a “dsRNA agent” means a composition that contains an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting translation of messenger RNA (mRNA) transcripts of a target mRNA in a sequence specific manner. Although not wishing to be limited to a particular theory, dsRNA agents of the invention may operate through the RNA interference mechanism (i.e., inducing RNA interference through interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells) , or by any alternative mechanism (s) or pathway (s) . Methods for silencing genes in plant, invertebrate, and vertebrate cells are well known in the art [see, for example, (Sharp et al., Genes Dev. 2001, 15: 485; Bernstein, et al., (2001) Nature 409: 363; Nykanen, et al., (2001) Cell 107: 309; and Elbashir, et al., (2001) Genes Dev. 15: 188) ] , the disclosure of each of which is incorporated herein by reference in its entirety. ] . Art-known gene silencing procedures can be used in conjunction with the disclosure provided herein to inhibit expression of HMGCR.
[0178] DsRNA agents disclosed herein are comprised of a sense strand and an antisense strand, and include, but are not limited to: short interfering RNAs (siRNAs) , RNAi agents, micro RNAs (miRNAs) , short hairpin RNAs (shRNA) , and dicer substrates. The antisense strand of the dsRNA agents described herein is at least partially complementary to the mRNA being targeted. It is understood in the art that different lengths of dsRNA duplex structure can be used to inhibit target gene expression. For example, dsRNAs having a duplex structure of 19, 20, 21, 22, and 23 base pairs are known to be effective to induce RNA interference (Elbashir et al., EMBO 2001, 20: 6877-6888) . It is also known in the art that shorter or longer RNA duplex structures are also effective to induce RNA interference. It is also known in the art that shorter or longer RNA duplex structures are also effective to induce RNA interference. As used herein, the terms “double stranded region” , “duplex region” and “the region of complementarity” can be used interchangeably, and refer to the region that the sense strand is complementary or substantially complementary to the antisense strand as is known in the art. In some embodiments, the sense strand and the antisense strand may be the same length or different lengths. In some embodiments, each strand is no more than 40 nucleotides in length. In some embodiments, each strand is no more than 30 nucleotides in length. In some embodiments, each strand is no more than 25 nucleotides in length. In some embodiments, each strand is no more than 23 nucleotides in length. In some embodiments, each strand is no more than 21 nucleotides in length. In some embodiments, the sense and antisense strands of the RNAi agents can each be 15 to 49 nucleotides in length. In some embodiments, the antisense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the length of the sense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. In some embodiments, the sense strand and the antisense strand are both 21 nucleotides in length. In some embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity is between 15 and 23 nucleotides in length. In some embodiments, the region of complementarity is 19-21 nucleotides in length. In some embodiments, the region of complementarity is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. HMGCR dsRNAs in certain embodiments of the invention can include at least one strand of a length of minimally 21 nt or may have shorter duplexes based on one of the sequences set forth in any one of Tables 1-3, but minus 1, 2, 3, or 4 nucleotides on one or both ends may also be effective as compared to the dsRNAs set forth in Tables 1-3, respectively. In some embodiments of the invention, HMGCR dsRNA agents may have a partial sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from one or more sequences of Tables 1-3, and differ in their ability to inhibit the expression of an HMGCR gene by not more than 5%, 10%, 15%, 20%, 25%, or 30%from the level of inhibition resulting from a dsRNA comprising the full sequence. A sense sequence, an antisense sequence and a duplex disclosed in Tables 1-3 may be referred to herein as a “parent” sequence, meaning that the sequences disclosed in Tables 1-3 may be modified, shorten, lengthened, include substitutions, etc. as set forth herein, with the resulting sequences retaining all or at least a portion of the efficacy of their parent sequences in methods and compositions of the invention. Sense and antisense strands included in a dsRNA of the invention are independently selected. As used herein the term “independently selected” means each of two or more like elements can be selected independent of the selection of the other elements. For example, though not intended to be limiting, in preparing a dsRNA of the invention, one may select the “elements” of the two strands to include in the duplex. One selected element, the sense sequence may be SEQ ID NO: 1747 (shown in Table 2) and the other selected element, the antisense sequence, may be SEQ ID NO: 2182, or may be SEQ ID NO: 2182 that is modified, shortened, lengthened, and / or includes 1, 2, or 3 substitutions as compared to its parent sequence SEQ ID NO: 2182. It will be understood that a duplex of the invention need not include both sense and antisense sequences shown as paired in duplexes in Tables 1-3. Each sense and antisense strand sequence in the tables is immediately followed by its SEQ ID NO.
[0179] Certain embodiments of compositions and methods of the invention comprise a single-strand RNA in a composition and / or administered to a subject. For example, an antisense strand such as one listed in any one of Tables 1-3 may be a composition or in a composition administered to a subject to reduce HMGCR polypeptide activity and / or expression of HMGCR gene in the subject. Tables 1 shows certain HMGCR dsRNA agent antisense strand and sense strand core stretch base sequences. A single-strand antisense molecule that may be included in certain compositions and / or administered in certain methods of the invention are referred to herein as a “single-strand antisense agent” or an “antisense polynucleotide agent” . A single-strand sense molecule that may be included in certain compositions and / or administered in certain methods of the invention are referred to herein as a “single-strand sense agent” or a “sense polynucleotide agent” . The term “base sequence” is used herein in reference to a polynucleotide sequence without chemical modifications or delivery compounds. For example, the sense strand GUUGUCAAGACUUUUUCGAAA (SEQ ID NO: 7) shown in Table 1 is the base sequence for SEQ ID NO: 1747 in Table 2 and for SEQ ID NO: 2642 in Table 3, with SEQ ID NO: 1747 and SEQ ID NO: 2642 shown with their chemical modifications and a delivery compound. Sequences disclosed herein may be assigned identifiers. For example, a single-stranded sense sequence may be identified with a “Sense strand SS#” ; a single stranded antisense sequence may be identified with an “Antisense strand AS#” and a duplex that includes a sense strand and an antisense strand may be identified with a “Duplex AD# / AV#” .
[0180] Table 1 includes sense and antisense strands and provides the identification number of duplexes formed from the sense and antisense strand on the same line in Table 1. In certain embodiments of the invention an antisense sequence includes nucleobase u or nucleobase a in position 1 of the antisense sequence. In certain embodiments of the invention an antisense sequence includes nucleobase u in position 1 of the antisense sequence. As used herein, the term “matching position” in a sense and an antisense strand are the positions in each strand that “pair” when the two strands are duplexed strands. For example, in a 21 nucleobases sense strand and a 21 nucleobases antisense strand, nucleobase in position 1 of the sense strand and position 21 in the antisense strand are in “matching positions” . In yet another non-limiting example in a 23 nucleobases sense strand and a 23 nucleobases antisense strand, nucleobase 2 of the sense strand and position 22 of the antisense strand are in matching positions. In another non-limiting example, in an 18 nucleobases sense strand and an 18 nucleobases antisense strand, nucleobase in position 1 of the sense strand and nucleobase 18 in the antisense strand are in matching positions, and nucleobase 4 in the sense strand and nucleobase 15 in the antisense strand are in matching positions. A skilled artisan will understand how to identify matching positions in sense and antisense strands that are or will be duplexed strands and paired strands.
[0181] The first column in Table 1 indicates a Duplex AD#for a duplex that includes the sense and antisense sequences in the same table row. For example, Table 1 discloses the duplex assigned Duplex AD#AD00810. um, which includes sense strand SEQ ID NO: 7 and antisense strand SEQ ID NO: 877. Thus, each row in Table 1 identifies a duplex of the invention, each comprising the sense and antisense sequences shown in the same row, with the assigned identifier for each duplex shown in the first column in the row. The final column in Table 1 indicates the target regions in SEQ ID NO. 1.
[0182] In some embodiments of methods of the invention, an RNAi agent comprising a polynucleotide sequence shown in any one of Tables 1-3 is administered to a subject.
[0183] In some embodiments of the invention an RNAi agent administered to a subject compri ses is a duplex comprising at least one of the base sequences set forth in Table 1, including 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 sequence mod ifications. In some embodiments of methods of the invention an RNAi agent comprising a poly nucleotide sequence shown in any one of Tables 1-3 is attached to a delivery molecule, a non-li miting example of which is a delivery compound comprising a GalNAc compound, or a GLS-1 5*compound.
[0184] Table 3 shows certain chemically modified HMGCR RNAi agent antisense strand and sense strand sequences of the invention. In some embodiments of methods of the invention, RNAi agents shown in Table 3 are administered to a cell and / or subject. In some embodiments of methods of the invention, a RNAi agent with a polynucleotide sequence shown in Table 3 is administered to a subject. In some embodiments of the invention an RNAi agent administered to a subject comprises is a duplex identified in a row in Table 3, column one and includes the sequence modifications and / or delivery compound show in the sense and antisense strand sequences in the same row in Table 3, columns three and six, respectively. The sequences were used in certain in vivo testing studies described elsewhere herein. In some embodiments of methods of the invention, a sequence shown in Table 3 may be attached to (also referred to herein as “conjugated to” ) a compound for delivery, a non-limiting example of which is a GalNAc-containing compound, with a delivery compound identified in Table 3 as “GLX-n” on sense strands in column three. As used herein, “GLX-n” is used to represent either a “GLS-n*” or a “GLO-n” delivery compound ( “X” can be either “S” or “O” ) and GLX-0 can be any of the “GLS-n*” and “GLO-n” delivery compounds that can be attached to 3'-end of oligonucleotide during synthesis. As used herein and shown in Table 3, “GLX-n” is used to indicate the attached GalNAc-containing compound is any one of compounds GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structure of each of which is provided elsewhere herein. One skilled in the art will be able to prepare and use a dsRNA compound of the invention in which the attached delivery compound is one of GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. Column one of Table 3 provides a Duplex AD#assigned to the duplex of the sense and antisense sequences in that row of the table. For example, Duplex AD#AD00842 is the duplex of sense strand SEQ ID NO: 2642 and antisense strand SEQ ID NO: 2695. Each line in Table 3 provides a sense strand and an antisense strand, and discloses the duplex of the sense and antisense strands shown. The “Sense strand SS#” in Table 3 column two is the assigned identifier for the Sense Sequence (including modifications) shown column 3 in the same row. The “Antisense strand AS#” in Table 3 column five is the assigned identifier for the Antisense sequence (including modifications) shown in column six. An identifier for certain attached GalNAc-containing “GLO-n” or “GLS-n*” compounds is shown as GLS-5*or GLS-15*, with the resulting compound included in an embodiment of a method and / or a composition of the invention.
[0185] In certain embodiments of the invention a dsRNA (also referred to herein as a “duplex” ) is one disclosed in one of Tables 1-3. Each row in Tables 1-3 discloses a duplex comprising the sequence of the sense strand and the sequence of the antisense strand in that table row. In addition to the duplexes disclosed in Tables 1-3, it will be understood that in some embodiments, a duplex of the invention may include sense and antisense sequences shown in Tables 1-3, that differ by zero, one, two, or three nucleotides shown in a sequence shown in Tables 1-3. Thus, as non-limiting examples, in some embodiments, an antisense strand in a duplex of the invention may be SEQ ID NO: 2670, 2671, 2672, 2673, 2674, 2675, 2676, 2677 or 2678 with zero, one, two, or three different nucleotides than those in SEQ ID NO: 2670, 2671, 2672, 2673, 2674, 2675, 2676, 2677 or 2678, respectively.
[0186] It will be understood that the sequence of the sense strand and the sequence of the antisense strand in a duplex of the invention may be independently selected. Thus, a dsRNA of the invention may comprise a sense strand and an antisense strand of a duplex disclosed in a row in Tables 1-3. Alternatively, in a dsRNA of the invention, one or both of the selected sense and antisense strand in the dsRNA may include sequences shown in Tables 1-3 but with one or both of the sense and antisense sequences including 1, 2, 3, or more nucleobase substitutions from the parent sequence. The selected sequences may in some embodiments be longer or shorter than their parent sequence. Thus, dsRNA agents included in the invention can but need not include exact sequences of the sense and antisense pairs disclosed as duplexes in Tables 1-3.
[0187] In some embodiments, a dsRNA agent comprises a sense strand and an antisense strand, nucleotide positions 2 to 18 in the antisense strand comprising a region of complementarity to an HMGCR RNA transcript, wherein the region of complementarity comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3, and optionally comprising a targeting ligand. In some instances, the region of complementarity to the HMGCR RNA transcript comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by no more than 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3. In some embodiments of a dsRNA agent of the invention, the antisense strand of the dsRNA is at least substantially complementary to any one of a target region of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments, an antisense strand of a dsRNA agent of the invention is fully complementary to any one of a target region of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments a dsRNA agent includes a sense strand sequence set forth in any one of Tables 1-3, and the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA agent. In other embodiments, a dsRNA agent of the invention comprises a sense strand sequence set forth in any one of Tables 1-3, and the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some instances, a dsRNA agent of the invention comprises an antisense strand sequence set forth in any one of Tables 1-3. Some embodiments of a dsRNA agent of the invention comprises the sense and antisense sequences disclosed as duplex in any of Tables 1-3. As described herein, it will be understood that the sense and antisense strands in a duplex of the invention may be independently selected.
[0188] Mismatches
[0189] It is known to skilled in art, mismatches are tolerated for efficacy in dsRNA, especially the mismatches are within terminal region of dsRNA. Certain mismatches tolerate better, for example mismatches with wobble base pairs G: U and A: C are tolerated better for efficacy (Du et el., A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21; 33 (5) : 1671-7. Doi: 10.1093 / nar / gki312. Nucleic Acids Res. 2005; 33 (11) : 3698) . Some embodiments of methods and compounds of the invention an HMGCR dsRNA agent may contain one or more mismatches to the HMGCR target sequence. In some embodiments, HMGCR dsRNA agent of the invention includes no mismatches. In certain embodiments, HMGCR dsRNA agent of the invention includes no more than 1 mismatch. In some embodiments, HMGCR dsRNA agent of the invention includes no more than 2 mismatches. In certain embodiments, HMGCR dsRNA agent of the invention includes no more than 3 mismatches. In some embodiments of the invention, an antisense strand of an HMGCR dsRNA agent contains mismatches to an HMGCR target sequence that are not located in the center of the region of complementarity. In some embodiments, the antisense strand of the HMGCR dsRNA agent includes 1, 2, 3, 4, or more mismatches that are within the last 5, 4, 3, 2, or 1 nucleotide from one or both of the 5' or 3' end of the region of complementarity. Methods described herein and / or methods known in the art can be used to determine whether an HMGCR dsRNA agent containing a mismatch to an HMGCR target sequence is effective in inhibiting the expression of the HMGCR gene.
[0190] Complementarity
[0191] As used herein, unless otherwise indicated, the term “complementary, ” when used to describe a first nucleotide sequence (e.g., HMGCR dsRNA agent sense strand or targeted HMGCR mRNA) in relation to a second nucleotide sequence (e.g., HMGCR dsRNA agent antisense strand or a single-stranded antisense polynucleotide) , means the ability of an oligonucleotide or polynucleotide including the first nucleotide sequence to hybridize [form base pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro) ] and form a duplex or double helical structure under certain conditions with an oligonucleotide or polynucleotide including the second nucleotide sequence. Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. A skilled artisan will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are fulfilled. Sequence identity or complementarity is independent of modification.
[0192] Complementary sequences, for example, within an HMGCR dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. It will be understood that in embodiments when two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs are not regarded herein as mismatches with regard to the determination of complementarity. For example, an HMGCR dsRNA agent comprising one oligonucleotide 19 nucleotides in length and another oligonucleotide 20 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 19 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein. Thus, as used herein, “fully complementary” means that all (100%) of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.
[0193] The term “substantially complementary” as used herein means that in a hybridized pair of nucleobase sequences, at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, but not all, of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The term “substantially complementary” can be used in reference to a first sequence with respect to a second sequence if the two sequences include one or more, for example at least 1, 2, 3, 4, or 5 mismatched base pairs upon hybridization for a duplex up to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs (bp) , while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of HMGCR gene expression via a RISC pathway.
[0194] The term, “partially complementary” may be used herein in reference to a hybridized pair of nucleobase sequences, in which at least 75%, but not all, of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. In some embodiments, “partially complementary” means at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide.
[0195] The terms “complementary, ” “fully complementary, ” “substantially complementary, ” and “partially complimentary” are used herein in reference to the base matching between the sense strand and the antisense strand of an HMGCR dsRNA agent, between the antisense strand of an HMGCR dsRNA agent and a sequence of a target HMGCR mRNA, or between a single-stranded antisense oligonucleotide and a sequence of a target HMGCR mRNA. It will be understood that the term “antisense strand of an HMGCR dsRNA agent” may refer to the same sequence of an “HMGCR antisense polynucleotide agent” .
[0196] As used herein, the term “substantially identical” or “substantial identity” used in reference to a nucleic acid sequence means a nucleic acid sequence comprising a sequence with at least about 85%sequence identity or more, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, compared to a reference sequence. Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. The inventions disclosed herein encompasses nucleotide sequences substantially identical to those disclosed herein. e.g., in Tables 1-3. In some embodiments, the sequences disclosed herein are exactly identical, or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%percent identical to those disclosed herein, e.g., in Tables 1-3.
[0197] As used herein, the term “strand comprising a sequence” means an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature. The term “double-stranded RNA” or “dsRNA, ” as used herein, refers to an RNAi that includes an RNA molecule or complex of molecules having a hybridized duplex region comprising two anti-parallel and substantially or fully complementary nucleic acid strands, which are referred to as having “sense” and “antisense” orientations with respect to a target HMGCR RNA. The duplex region can be of any length that permits specific degradation of a desired target HMGCR RNA through a RISC pathway but will typically range from 9 to 30 base pairs in length, e.g., 15-30 base pairs in length. Considering a duplex between 9 and 30 base pairs, the duplex can be any length in this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, and any sub-range therein between, including, but not limited to 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. HMGCR dsRNA agents generated in the cell by processing with Dicer and similar enzymes are generally in the range of 19-22 base pairs in length. One strand of the duplex region of an HMGCR dsDNA agent comprises a sequence that is substantially complementary to a region of a target HMGCR RNA. The two strands forming the duplex structure can be from a single RNA molecule having at least one self-complementary region, or can be formed from two or more separate RNA molecules. Where the duplex region is formed from two strands of a single molecule, the molecule can have a duplex region separated by a single stranded chain of nucleotides (herein referred to as a “hairpin loop” ) between the 3'-end of one strand and the 5'-end of the respective other strand forming the duplex structure. In some embodiments of the invention, a hairpin look comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more unpaired nucleotides. Where the two substantially complementary strands of an HMGCR dsRNA agent are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. Where the two strands are connected covalently by means other than a hairpin loop, the connecting structure is referred to as a “linker. ” The term “siRNA” is also used herein to refer to a dsRNA agent as described herein.
[0198] In some embodiments of the invention an HMGCR dsRNA agent may include a sense and antisense sequence that have no-unpaired nucleotides or nucleotide analogs at one or both terminal ends of the dsRNA agent. An end with no unpaired nucleotides is referred to as a “blunt end” and as having no nucleotide overhang. If both ends of a dsRNA agent are blunt, the dsRNA is referred to as “blunt ended. ” In some embodiments of the invention, a first end of a dsRNA agent is blunt, in some embodiments a second end of a dsRNA agent is blunt, and in certain embodiments of the invention, both ends of an HMGCR dsRNA agent are blunt.
[0199] In some embodiments of dsRNA agents of the invention, the dsRNA does not have one or two blunt ends. In such instances there is at least one unpaired nucleotide at the end of a strand of a dsRNA agent. For example, when a 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least 1, 2, 3, 4, 5, 6, or more nucleotides. A nucleotide overhang can comprise or consist of a nucleotide / nucleoside analog, including a deoxynucleotide / nucleoside. It will be understood that in some embodiments a nucleotide overhang is on a sense strand of a dsRNA agent, on an antisense strand of a dsRNA agent, or on both ends of a dsRNA agent and nucleotide (s) of an overhang can be present on the 5' end, 3' end or both ends of either an antisense or sense strand of a dsRNA. In certain embodiments of the invention, one or more of the nucleotides in an overhang is replaced with a nucleoside thiophosphate.
[0200] As used herein, the term “antisense strand” or “guide strand” refers to the strand of an HMGCR dsRNA agent that includes a region that is substantially complementary to an HMGCR target sequence. As used herein the term “sense strand, ” or “passenger strand” refers to the strand of an HMGCR dsRNA agent that includes a region that is substantially complementary to a region of the antisense strand of the HMGCR dsRNA agent.
[0201] Modifications
[0202] In some embodiments of the invention the RNA of an HMGCR RNAi agent is chemically modified to enhance stability and / or one or more other beneficial characteristics. Nucleic acids in certain embodiments of the invention may be synthesized and / or modified by methods well established in the art, for example, those described in “Current protocols in Nucleic Acid Chemistry, "Beaucage, S. L. et al. (Eds. ) , John Wiley &Sons, Inc., New York, N.Y., USA, which is incorporated herein by reference. Modifications that can be present in certain embodiments of HMGCR dsRNA agents of the invention include, for example, (a) end modifications, e.g., 5' end modifications (phosphorylation, conjugation, inverted linkages, etc. ) 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc. ) , (b) base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides) , or conjugated bases, (c) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar, as well as (d) backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of RNA compounds useful in certain embodiments of HMGCR dsRNA agents, HMGCR antisense polynucleotides, and HMGCR sense polynucleotides of the invention include, but are not limited to RNAs comprising modified backbones or no natural internucleoside linkages. As a non-limiting example, an RNA having a modified backbone may not have a phosphorus atom in the backbone. RNAs that do not have a phosphorus atom in their internucleoside backbone may be referred to as oligonucleosides. In certain embodiments of the invention, a modified RNA has a phosphorus atom in its internucleoside backbone.
[0203] It will be understood that the term “RNA molecule” or “RNA” or “ribonucleic acid molecule” encompasses not only RNA molecules as expressed or found in nature, but also analogs and derivatives of RNA comprising one or more ribonucleotide / ribonucleoside analogs or derivatives as described herein or as known in the art. The terms “ribonucleoside” and “ribonucleotide” may be used interchangeably herein. An RNA molecule can be modified in the nucleobase structure or in the ribose-phosphate backbone structure, e.g., as described herein below, and molecules comprising ribonucleoside analogs or derivatives must retain the ability to form a duplex. As non-limiting examples, an RNA molecule can also include at least one modified ribonucleoside including but not limited to a 2'-O-methyl modified nucleoside, a nucleoside comprising a 5' phosphorothioate group, a terminal nucleoside linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a locked nucleoside, an abasic nucleoside, a 2'-deoxy-2'-fluoro modified nucleoside, a 2'-amino-modified nucleoside, 2'-alkyl-modified nucleoside, morpholino nucleoside, a phosphoramidate or a non-natural base comprising nucleoside, or any combination thereof. In some embodiments of the invention, an RNA molecule comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or up to the full length of the HMGCR dsRNA agent molecule’s ribonucleosides that are modified ribonucleosides. The modifications need not be the same for each of such a plurality of modified ribonucleosides in an RNA molecule.
[0204] DsRNA agents, HMGCR antisense polynucleotides, and / or HMGCR sense polynucleotides of the invention may, in some embodiments comprise one or more independently selected modified nucleotide and / or one or more independently selected non-phosphodiester linkage. As used herein, the terms “internucleotide linkage” , “internucleoside linkage” , “linkage” , and “linker” may be used interchangeably, and refer to the linking groups between unmodified or modified nucleosides, and / or between an unmodified or modified nucleoside and one or more targeting groups in an oligonucleotide strand. In some embodiments, the linkage may be independently selected from a phosphodiester (PO) linkage, a phosphorothioate (PS) linkage, and / or a phosphorodithioate (PS2) linkage of a dinucleotide at any position of single stranded or double stranded oligonucleotide. As used herein the term “independently selected” used in reference to a selected element, such as a modified nucleotide, non-phosphodiester linkage, etc., means that two or more selected elements can but need not be the same as each other.
[0205] As used herein, a “nucleotide base, ” “nucleotide, ” or “nucleobase” is a heterocyclic pyrimidine or purine compound, which is a standard constituent of all nucleic acids, and includes the bases that form the nucleotides adenine, guanine, cytosine, thymine, and uracil. A nucleobase may further be modified to include, though not intended to be limiting: universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. The term “ribonucleotide” or “nucleotide” may be used herein to refer to an unmodified nucleotide, a modified nucleotide, or a surrogate replacement moiety. Those in the art will recognize that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety.
[0206] As used herein, " optionally" or "optionally" means that the event or environment described later may, but need not, occur, including where the event or environment occurred or did not occur. For example, "C1-6 alkyl optionally substituted by halogen or cyano" means that halogen or cyano may, but not necessarily, be present, including the case where alkyl is substituted by halogen or cyano and the case where alkyl is not substituted by halogen and cyano.
[0207] As used herein, in the chemical structures of the compounds of the present disclosure, the bond represents an unspecified configuration, i.e., if a chiral isomer is present in the chemical structure, the bond can be or both two configurations. Although some of the above structural formulas are depicted as some isomeric forms for simplicity, the present disclosure may include all isomers, such as tautomers, rotamers, and mixtures thereof. Suitable chiral compounds include: geometric isomers, diastereomers, racemates and enantiomers.
[0208] As used herein as a non-limiting example, one way of characterizing the chiral (asymmetric) phosphorothioates linkage phosphorus atom (s) using the traditional IUPAC R-Ssystem nomenclature. In the present disclosure, regulating an absolute configuration of phosphorus to the R-configuration may be called regulating to "Rp" , and regulating an absolute configuration to the S-configuration may be called regulating to "Sp" . In the chirally-modified dsRNA agent, the (Rp) and / or (Sp) phosphorothioates connects two nucleotides to form a dinucleotide, each nucleotide of a dinucleotide connected by the site specific (e.g., terminal) , dinucleotide comprise one or more of (Rp) and / or (Sp) phosphorothioates the following formulas, respectively, wherein "B" indicates a nucleobase, the labels "R" and "S" in all the strand denote Rp and Sp configuration of phosphorus atom of the linkage:
[0209] Unless otherwise indicated, the internucleotide linkages of modified oligonucleotides (e.g., a chirally-modified dsRNA agent) described herein can be stereorandom or in a particular stereochemical configuration or racemic or achiral. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003) , Wan et al. Nuc. Acid. Res. 42, 13456 (2014) , Nucleic Acids Research, 2022, Vol. 50, No. 3 1221–1240, and WO 2017 / 015555. In some embodiments, internucleotide linkages of modified oligonucleotides (e.g., a chirally-modified dsRNA agent) described herein can be achiral (e.g., a phosphodiester linkage (PO) is achiral) .
[0210] The chiral purity with respect to the chiral linkage phosphorus atom for each terminal, chirally modified internucleotide linkage is at least 50%, for instance, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or virtually 100%. At least some of the nucleosides in at least one region selected from the group consisting of the terminal regions and the middle region being bonded together by bonds including asymmetric phosphorus atoms, and absolute configurations of the asymmetric phosphorus atoms being regulated, wherein at least some of the nucleosides in the middle region are bonded by bonds including asymmetric phosphorus atoms, and an absolute configuration of each asymmetric phosphorus atom is regulated to an Sp-configuration or an Rp-configuration, or bonds including asymmetric phosphorus atoms in which an absolute configuration of each asymmetric phosphorus atom is not regulated.
[0211] Non-limiting examples of internucleotide linkages including asymmetric phosphorus atoms are also described in WO2014 / 012081, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO2019 / 126651, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784, WO 2019 / 032612, WO2020257194, WO2021237223, WO2021 / 092371, and / or WO202349218 etc..
[0212] In some embodiments, a non-limiting example of an internucleotide linkage including asymmetric phosphorus atom may have a structure shown in Formula I-6 or Formula I-7,
[0213] wherein RL is independently -LL, -R' or -N=C (-LL-R') , LL is independently -L, is a covalent bond or an optionally substituted, linear or branched group selected from C1-C30 aliphatic group, and C1-C30 hetetroaliphatic group having 1-10 heteroatoms, wherein one or more methylene units of L are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, ——c≡c——, -C (R') 2, -Cy-, -O-, -S-, -S-S-, -N (R') -, --C (O) -, -C (S) -, -C (NR') -, -C (O) N (R') -, -N (R') C (O) N (R') -, -N (R') C (O) -, -N (R') C (O) O-, -OC (O) N (R') -, -S (O) -, -S (O) 2-, -S (O) 2N (R') -, -N (R') S (O) 2-, -SC (O) -, -C (O) S-, -OC (O) -, or -C (O) O-;
[0214] each R′is independently -R, -C (O) R, -CO2R, or -SO2R;
[0215] each R is independently hydrogen, or an optionally substituted group selected from C1-C30 aliphatic, C1-C30 heteroaliphatic having 1-10 heteroatoms, C6-C30 aryl, C6-C30 aryl aliphatic, C6-C30 aryl heteroaliphatic having 1-10 heteroatoms, 5-30 membered heteroaryl having 1-10 heteroatoms, or 5-30 membered heterocyclyl having 1-10 heteroatoms; or two R groups are optionally and independently taken together to form a covalent bond, or: two or more R groups on the same atom are optionally and independently taken together with the atom to form an optionally substituted, 3-30 membered, monocyclic, bicyclic or polycyclic ring having, in addition to the atom, 0-10 heteroatoms; or two or more R groups on two or more atoms are optionally and independently taken together with their intervening atoms to form an optionally substituted, 3-30 membered, monocyclic, bicyclic or polycyclic ring having, in addition to the intervening atoms, 0-10 heteroatoms.
[0216] each independently represents a connection to a nucleoside.
[0217] In some embodiments, each independently represents a connection between 3'-carbon of the first nucleoside and 5'-carbon of the second nucleoside and vice versa.
[0218] In some embodiments, another non-limiting example of an internucleotide linkage including asymmetric phosphorus atom is illustrated as u (01*) .
[0219] As used herein, used in the chemical formulas of the present disclosure may be attached to any one or more groups according to the scope of the invention described herein.
[0220] In a particular embodiment, unless otherwise specified (e.g., a chirally modified linkage or a chirally modified internucleotide linkage) , the linkage is achiral or racemic.
[0221] In one embodiment, modified RNAs contemplated for use in methods and compositions described herein are peptide nucleic acids (PNAs) that have the ability to form the required duplex structure and that permit or mediate the specific degradation of a target RNA via a RISC pathway. In certain embodiments of the invention, an HMGCR RNA interference agent includes a single stranded RNA that interacts with a target HMGCR RNA sequence to direct the cleavage of the target HMGCR RNA.
[0222] Modified RNA backbones can include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those) having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included. Means of preparing phosphorus-containing linkages are routinely practiced in the art and such methods can be used to prepare certain modified HMGCR dsRNA agents, certain modified HMGCR antisense polynucleotides, and / or certain modified HMGCR sense polynucleotides of the invention.
[0223] Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside) ; siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. Means of preparing modified RNA backbones that do not include a phosphorus atom are routinely practiced in the art and such methods can be used to prepare certain modified HMGCR dsRNA agents, certain modified HMGCR antisense polynucleotides, and / or certain modified HMGCR sense polynucleotides of the invention.
[0224] In certain embodiments of the invention, RNA mimetics are included in HMGCR dsRNAs, HMGCR antisense polynucleotides, and / or HMGCR sense polynucleotides, such as, but not limited to: replacement of the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units with novel groups. In such embodiments, base units are maintained for hybridization with an appropriate HMGCR nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA) . In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Means of preparing RNA mimetics are routinely practiced in the art and such methods can be used to prepare certain modified HMGCR dsRNA agents of the invention.
[0225] Some embodiments of the invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular -CH2-NH-CH2-, -CH2-N (CH3) -O-CH2- [known as a methylene (methylimino) or MMI backbone] , -CH2-O-N (CH3) -CH2-, -CH2-N (CH3) -N (CH3) -CH2-and -N (CH3) -CH2- [wherein the native phosphodiester backbone is represented as -O-P-O-CH2-] . Means of preparing RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones are routinely practiced in the art and such methods can be used to prepare certain modified HMGCR dsRNA agents, certain HMGCR antisense polynucleotides, and / or certain HMGCR sense polynucleotides of the invention.
[0226] Modified RNAs can also contain one or more substituted sugar moieties. HMGCR dsRNAs, HMGCR antisense polynucleotides, and / or HMGCR sense polynucleotides of the invention may comprise one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Exemplary suitable modifications include O [ (CH2) nO] mCH3, O (CH2) nOCH3, O (CH2) nNH2, O (CH2) nCH3, O (CH2) nONH2, and O (CH2) nON [ (CH2) nCH3) ] 2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2' position: C1 to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an HMGCR dsRNA agent, or a group for improving the pharmacodynamic properties of an HMGCR dsRNA agent, HMGCR antisense polynucleotide, and / or HMGCR sense polynucleotide, and other substituents having similar properties. In some embodiments, the modification includes a 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O- (2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78: 486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a O (CH2) 2ON (CH3) 2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE) , i.e., 2'-O-CH2-O-CH2-N (CH2) 2. Means of preparing modified RNAs such as those described are routinely practiced in the art and such methods can be used to prepare certain modified HMGCR dsRNA agents of the invention.
[0227] Other modifications include 2'-methoxy (2'-OCH3) , 2'-aminopropoxy (2'-OCH2CH2CH2NH2) and 2'-fluoro (2'-F) . Similar modifications can also be made at other positions on the RNA of an HMGCR dsRNA agent, HMGCR antisense polynucleotide, and / or HMGCR sense polynucleotide of the invention, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked HMGCR dsRNAs, HMGCR antisense polynucleotides, or HMGCR sense polynucleotides, and the 5' position of 5' terminal nucleotide. HMGCR dsRNA agents, HMGCR antisense polynucleotides, and / or HMGCR sense polynucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Means of preparing modified RNAs such as those described are routinely practiced in the art and such methods can be used to prepare certain modified HMGCR dsRNA agents, HMGCR antisense polynucleotides, and / or HMGCR sense polynucleotides of the invention.
[0228] A HMGCR dsRNA agent, HMGCR antisense polynucleotide, and / or HMGCR sense polynucleotide may, in some embodiments, include nucleobase (often referred to in the art simply as "base" ) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine and guanine, and the pyrimidine bases thymine, cytosine and uracil. Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-Me-C) , 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil) , 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Additional nucleobases that may be included in certain embodiments of HMGCR dsRNA agents of the invention are known in the art, see for example: Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, Ed. John Wiley &Sons, 1990, English et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Means of preparing dsRNAs, HMGCR antisense strand polynucleotides and / or HMGCR sense strand polynucleotides that comprise nucleobase modifications and / or substitutions such as those described herein are routinely practiced in the art and such methods can be used to prepare certain modified HMGCR dsRNA agents, HMGCR sense polynucleotides, and / or HMGCR antisense polynucleotides of the invention. Teachings regarding the synthesis of particular modified oligonucleotides may be found in the following U.S. patents: U.S. Pat. No. 5,218,105, drawn to polyamine conjugated oligonucleotides; U.S. Pat. No. 5,541,307, drawn to oligonucleotides having modified backbones; U.S. Pat. No. 5,521,302, drawn to processes for preparing oligonucleotides having chiral phosphorus linkages; U.S. Pat. No. 5,539,082, drawn to peptide nucleic acids; U.S. Pat. No. 5,554,746, drawn to oligonucleotides having (3-lactam backbones; U.S. Pat. No. 5,571,902, drawn to methods and materials for the synthesis of oligonucleotides; U.S. Pat. No. 5,578,718, drawn to nucleosides having alkylthio groups, wherein such groups may be used as linkers to other moieties attached at any of a variety of positions of the nucleoside; U.S. Pat. No. 5,587,361 drawn to oligonucleotides having phosphorothioate linkages of high chiral purity; U.S. Pat. No. 5,506,351, drawn to processes for the preparation of 2'-O-alkyl guanosine and related compounds, including 2, 6-diaminopurine compounds; U.S. Pat. No. 5,587,469, drawn to oligonucleotides having N-2 substituted purines; U.S. Pat. No. 5,587,470, drawn to oligo-nucleotides having 3-deazapurines; U.S. Pat. No. 5,608,046, both drawn to conjugated 4'-desmethyl nucleoside analogs; U.S. Pat. No. 5,610,289, drawn to backbone-modified oligonucleotide analogs; U.S. Pat. No. 6,262,241 drawn to, inter alia, methods of synthesizing 2'-fluoro-oligonucleotides.
[0229] Certain embodiments of HMGCR dsRNA agents, HMGCR antisense polynucleotides, and / or HMGCR sense polynucleotides of the invention include RNA modified to include one or more locked nucleic acids (LNA) . A locked nucleic acid is a nucleotide with a modified ribose moiety comprising an extra bridge connecting the 2' and 4' carbons. This structure effectively “locks” the ribose in the 3'-endo structural conformation. The addition of locked nucleic acids in an HMGCR dsRNA agent, HMGCR antisense polynucleotides, and / or HMGCR sense polynucleotides of the invention may increase stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33 (1) : 439-447; Mook, O R. et al., (2007) Mol Canc Ther 6 (3) : 833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31 (12) : 3185-3193) . Means of preparing dsRNA agents, HMGCR antisense polynucleotides, and / or HMGCR sense polynucleotides that comprise locked nucleic acid (s) are routinely practiced in the art and such methods can be used to prepare certain modified HMGCR dsRNA agents of the invention.
[0230] Certain embodiments of HMGCR dsRNA compounds, sense polynucleotides, and / or antisense polynucleotides of the invention, include at least one modified nucleotide, wherein the at least one modified nucleotide comprises: a 2’ -O-methyl nucleotide, 2’ -Fluoro nucleotide, 2’-deoxy nucleotide, 2’ 3’ -seco nucleotide mimic, locked nucleotide, 2’ -F-Arabino nucleotide, 2’-methoyxyethyl nucleotide, 2’ -amino-modified nucleotide, 2’ -alkyl-modified nucleotide, mopholino nucleotide, and 3’ -OMe nucleotide, a nucleotide comprising a 5’ -phosphorothioate group, a nucleotide comprising vinyl phosphonate, a nucleotide comprising adenosine-glycol nucleic acid (GNA) , a nucleotide comprising thymidine-glycol nucleic acid (GNA) S-Isomer, a nucleotide comprising 2’ -deoxythymidine-3’ phosphate, a nucleotide comprising 2’ -deoxyguanosine-3’ -phosphate, a nucleotide comprising 2’ -deoxyadenosine-3’ -phosphate, a nucleotide comprising 2’ -deoxycytidine-3’ -phosphate, a nucleotide comprising 2’ -deoxyuridine-3’ -phosphate, or a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a 2’ -amino-modified nucleotide, a phosphoramidate, or a non-natural base comprising nucleotide. In some embodiments, an HMGCR dsRNA compound includes an E-vinylphosphonate nucleotide at the 5′ -end of the antisense strand, also referred to herein as the guide strand.
[0231] Certain embodiments of HMGCR dsRNA compounds, 3’ and 5’ end of sense polynucleotides, and / or 3’ end of antisense polynucleotides of the invention, include at least one modified nucleotide, wherein the at least one modified nucleotide comprises: abasic nucleotide, ribitol, inverted nucleotide, inverted abasic nucleotide, inverted 2’ -OMe nucleotide, inverted 2’ -deoxy nucleotide. It is known to skilled in art, including an abasic or inverted abasic nucleotide at the end of oligonucleotide enhances stability (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003; 31 (11) : 2705-2716. doi: 10.1093 / nar / gkg393) . In some embodiments, an HMGCR dsRNA compound includes one or more inverted abasic residues (invab) at either 3’ -end or 5’ -end, or both 3’ -end and 5’ -end. Exemplified inverted abasic residues (invab) include, but are not limited to the following:
[0232] Certain embodiments of HMGCR dsRNA compounds, 3’ and 5’ end of sense polynucleotides, and / or 3’ end of antisense polynucleotides of the invention, include at least one modified nucleotide, wherein the at least one modified nucleotide comprises: isomannide nucleotide or stereoisomer of said isomannide nucleotide. Specific examples of isomannide nucleotides or stereoisomers of said isomannide nucleotides include, but are not limited to: wherein the phrase “Olig” each independently represents a polynucleotide moiety. Exemplified isomannide residues (imann) include, but are not limited to, the following:
[0233] In certain embodiments, the isomannide nucleotides may further conjugate to one or more targeting groups or delivery molecules, such as GalNAc moieties.
[0234] Certain embodiments of HMGCR dsRNA compounds, antisense polynucleotides of the invention, include at least one modified nucleotide, wherein the at least one modified nucleotide comprises unlocked nucleic acid nucleotide (UNA) or / and glycol nucleic acid nucleotide (GNA) . It is known to skilled in art, UNA and GNA are thermally destabilizing chemical modifications, can significantly improves the off-target profile of a siRNA compound (Janas, et al., Selection of GalNAc-conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat Commun. 2018; 9 (1) : 723. doi: 10.1038 / s41467-018-02989-4; Laursen et al., Utilization of unlocked nucleic acid (UNA) to enhance siRNA performance in vitro and in vivo. Mol BioSyst. 2010; 6: 862–70) .
[0235] Another modification that may be included in the RNA of certain embodiments of HMGCR dsRNA agents, HMGCR antisense polynucleotides, and / or HMGCR sense polynucleotides of the invention, comprises chemically linking to the RNA one or more ligands, moieties or conjugates that enhance one or more characteristics of the HMGCR dsRNA agent, HMGCR antisense polynucleotide, and / or HMGCR sense polynucleotide, respectively. Non-limiting examples of characteristics that may be enhanced are: HMGCR dsRNA agent, HMGCR antisense polynucleotide, and / or HMGCR sense polynucleotide activity, cellular distribution, delivery of an HMGCR dsRNA agent, pharmacokinetic properties of an HMGCR dsRNA agent, and cellular uptake of the HMGCR dsRNA agent. In some embodiments of the invention, an HMGCR dsRNA agent comprises one or more targeting groups or linking groups, which in certain embodiments of HMGCR dsRNA agents of the invention are conjugated to the sense strand. A non-limiting example of a targeting group is a compound comprising N-acetyl-galactosamine (GalNAc) . The terms “targeting group” , “targeting agent” , “linking agent” , “targeting compound” , “delivery molecule” , “delivery compound” and “targeting ligand” may be used interchangeably herein. In certain embodiments of the invention an HMGCR dsRNA agent comprises a targeting compound that is conjugated to the 5'-terminal end of the sense strand. In certain embodiments of the invention an HMGCR dsRNA agent comprises a targeting compound that is conjugated to the 3'-terminal end of the sense strand. In some embodiments of the invention, an HMGCR dsRNA agent comprises a targeting group that comprises GalNAc. In certain embodiments of the invention an HMGCR dsRNA agent does not include a targeting compound conjugated to one or both of the 3'-terminal end and the 5'-terminal end of the sense strand. In certain embodiments of the invention an HMGCR dsRNA agent does not include a GalNAc containing targeting compound conjugated to one or both of the 5'-terminal end and the 3'-terminal end of the sense strand.
[0236] Additional targeting and linking agents are well known in the art, for example, targeting and linking agents that may be used in certain embodiments of the invention include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556) , cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4: 1053-1060) , a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N. Y. Acad. Sci., 1992, 660: 306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3: 2765-2770) , a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20: 533-538) , an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10: 1111-1118; Kabanov et al., FEBS Lett., 1990, 259: 327-330; Svinarchuk et al., Biochimie, 1993, 75: 49-54) , a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1, 2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18: 3777-3783) , a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides &Nucleotides, 1995, 14: 969-973) , or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651-3654) , a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264: 229-237) , or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277: 923-937) .
[0237] Certain embodiments of a composition comprising an HMGCR dsRNA agent, HMGCR antisense polynucleotide, and / or HMGCR sense polynucleotide may comprise a ligand that alters distribution, targeting, or etc. of the HMGCR dsRNA agent. In some embodiments of a composition comprising an HMGCR dsRNA agent of the invention, the ligand increases affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. A ligand useful in a composition and / or method of the invention may be a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA) , low-density lipoprotein (LDL) , or globulin) ; a carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid) ; or a lipid. A ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid or polyamine. Examples of polyamino acids are a polylysine (PLL) , poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly (L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N- (2-hydroxypropyl) methacrylamide copolymer (HMPA) , polyethylene glycol (PEG) , polyvinyl alcohol (PVA) , polyurethane, poly (2-ethylacryllic acid) , N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL) , spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.
[0238] A ligand included in a composition and / or method of the invention may comprise a targeting group, non-limiting examples of which are a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody that binds to a specified cell type such as a kidney cell or a liver cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.
[0239] Other examples of ligands include dyes, intercalating agents (e.g. acridines) , cross-linkers (e.g. psoralene, mitomycin C) , porphyrins (TPPC4, texaphyrin, Sapphyrin) , polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine) , artificial endonucleases (e.g. EDTA) , lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1, 3-Bis-O (hexadecyl) glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1, 3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3- (oleoyl) lithocholic acid, O3- (oleoyl) cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide) , alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K) , MPEG, [MPEG] 2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin) , transport / absorption facilitators (e.g., aspirin, vitamin E, folic acid) , synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles) , dinitrophenyl, HRP, or AP.
[0240] A ligand included in a composition and / or method of the invention may be a protein, e.g., glycoprotein, or peptide, for example a molecule with a specific affinity for a co-ligand, or an antibody, for example an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, cardiac cell, or bone cell. A ligand useful in an embodiment of a composition and / or method of the invention can be a hormone or hormone receptor. A ligand useful in an embodiment of a composition and / or method of the invention can be a lipid, lectin, carbohydrates, vitamin, cofactos, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, or multivalent fucose. A ligand useful in an embodiment of a composition and / or method of the invention can be a substance that can increase uptake of the HMGCR dsRNA agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and / or intermediate filaments. Non-limiting examples of this type of agent are: taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, and myoservin.
[0241] In some embodiments, a ligand attached to an HMGCR dsRNA agent of the invention functions as a pharmacokinetic (PK) modulator. An example of a PK modulator that may be used in compositions and methods of the invention includes but is not limited to: a lipophiles, a bile acid, a steroid, a phospholipid analogue, a peptide, a protein binding agent, PEG, a vitamin, cholesterol, a fatty acid, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, a phospholipid, a sphingolipid, naproxen, ibuprofen, vitamin E, biotin, an aptamer that binds a serum protein, etc. Oligonucleotides comprising a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone may also be used in compositions and / or methods of the invention as ligands.
[0242] HMGCR dsRNA agent compositions
[0243] In some embodiments of the invention, an HMGCR dsRNA agent is in a composition. A composition of the invention may include one or more HMGCR dsRNA agent and optionally one or more of a pharmaceutically acceptable carrier, a delivery agent, a targeting agent, detectable label, etc. A non-limiting example of a targeting agent that may be useful according to some embodiments of methods of the invention is an agent that directs an HMGCR dsRNA agent of the invention to and / or into a cell to be treated. A targeting agent of choice will depend upon such elements as: the nature of the HMGCR-associated disease or condition, and on the cell type being targeted. In a non-limiting example, in some embodiments of the invention it may be desirable to target an HMGCR dsRNA agent to and / or into a liver cell. It will be understood that in some embodiments of methods of the invention, a therapeutic agent comprises an HMGCR dsRNA agent with only a delivery agent, such as a delivery agent comprising N-Acetylgalactosamine (GalNAc) , without any additional attached elements. For example, in some aspects of the invention an HMGCR dsRNA agent may be attached to a delivery compound comprising GalNAc and included in a composition comprising a pharmaceutically acceptable carrier and administered to a cell or subject without any detectable labels, or targeting agents, etc. attached to the HMGCR dsRNA agent.
[0244] In cases where an HMGCR dsRNA agent of the invention is administered with and / or attached to one or more delivery agents, targeting agents, labeling agents, etc. a skilled artisan will be aware of and able to select and use suitable agents for use in methods of the invention. Labeling agents may be used in certain methods of the invention to determine the location of an HMGCR dsRNA agent in cells and tissues and may be used to determine a cell, tissue, or organ location of a treatment composition comprising an HMGCR dsRNA agent that has been administered in methods of the invention. Procedures for attaching and utilizing labeling agents such as enzymatic labels, dyes, radiolabels, etc. are well known in the art. It will be understood that in some embodiments of compositions and methods of the invention, a labeling agent is attached to one or both of a sense polynucleotide and an antisense polynucleotide included in an HMGCR dsRNA agent.
[0245] Delivery of HMGCR dsRNA agents and HMGCR antisense polynucleotide agents
[0246] Certain embodiments of methods of the invention, includes delivery of an HMGCR dsRNA agent into a cell. As used herein the term, “delivery” means facilitating or effecting uptake or absorption into the cell. Absorption or uptake of an HMGCR dsRNA agent can occur through unaided diffusive or active cellular processes, or by use of delivery agents, targeting agents, etc. that may be associated with an HMGCR dsRNA agent of the invention. Delivery means that are suitable for use in methods of the invention include, but are not limited to:in vivo delivery, in which an HMGCR dsRNA agent is in injected into a tissue site or administered systemically. In some embodiments of the invention, an HMGCR dsRNA agent is attached to a delivery agent.
[0247] Non-limiting examples of methods that can be used to deliver HMGCR dsRNA agents to cells, tissues and / or subjects include: HMGCR dsRNA-GalNAc conjugates, SAMiRNA technology, LNP-based delivery methods, and naked RNA delivery. These and other delivery methods have been used successfully in the art to deliver therapeutic RNAi agents for treatment of various diseases and conditions, such as but not limited to: liver diseases, acute intermittent porphyria (AIP) , hemophilia, pulmonary fibrosis, etc. Details of various delivery means are found in publications such as: Nikam, R.R. &K.R. Gore (2018) Nucleic Acid Ther, 28 (4) , 209-224 Aug 2018; Springer A.D. &S.F. Dowdy (2018) Nucleic Acid Ther. Jun 1; 28 (3) : 109–118; Lee, K. et al., (2018) Arch Pharm Res, 41 (9) , 867-874; and Nair, J.K. et al., (2014) J. Am. Chem. Soc. 136: 16958-16961, the content each of which is incorporated by reference herein.
[0248] Some embodiments of the invention comprise use of lipid nanoparticles (LNPs) to deliver an HMGCR dsRNA agent of the invention to a cell, tissue, and / or subject. LNPs are routinely used for in vivo delivery of HMGCR dsRNA agents, including therapeutic HMGCR dsRNA agents. One benefit of using an LNP or other delivery agent is an increased stability of the HMGCR RNA agent when it is delivered to a subject using the LNP or other delivery agent. In some embodiments of the invention an LNP comprises a cationic LNP that is loaded with one or more HMGCR RNAi molecules of the invention. The LNP comprising the HMGCR RNAi molecule (s) is administered to a subject, the LNPs and their attached HMGCR RNAi molecules are taken up by cells via endocytosis, their presence results in release of RNAi trigger molecules, which mediate RNAi.
[0249] Another non-limiting example of a delivery agent that may be used in embodiments of the invention to delivery an HMGCR dsRNA agent of the invention to a cell, tissue and / or subject is an agent comprising GalNAc that is attached to an HMGCR dsRNA agent of the invention and delivers the HMGCR dsRNA agent to a cell, tissue, and / or subject. Examples of certain additional delivery agents comprising GalNAc that can be used in certain embodiments of methods and composition of the invention are disclosed in PCT Application: WO2020191183A1 (incorporated herein in its entirety) . A non-limiting example of a GalNAc targeting ligand that can be used in compositions and methods of the invention to deliver an HMGCR dsRNA agent to a cell is a targeting ligand cluster. Examples of targeting ligand clusters that are presented herein are referred to as: GalNAc Ligand with phosphodiester link (GLO) and GalNAc Ligand with phosphorothioate link (GLS) . The term “GLX-n” may be used herein to indicate the attached GalNAc-containing compound is any one of compounds GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structure of each of which is shown below, with the below with location of attachment of the GalNAc-targeting ligand to an RNAi agent of the invention at far right of each (shown with ) . It will be understood that any RNAi and dsRNA molecule of the invention can be attached to the GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, GLO-1 through GLO-16 and GLS-1*through GLS-16*structures are shown below.
[0250] In certain embodiments, the aforesaid isomannide nucleotides may further conjugate to one or more GalNAc targeting ligands. Specific examples of isomannide nucleotides conjugated to a GalNAc targeting ligand include, but are not limited to:
[0251] wherein the phrase "olig" each independently represents a polynucleotide moiety.
[0252] In some embodiments of the invention, in vivo delivery can also be by a beta-glucan delivery system, such as those described in U.S. Pat. Nos. 5, 032, 401 and 5, 607, 677, and U.S. Publication No. 2005 / 0281781, which are hereby incorporated by reference in their entirety. In vitro introduction of an HMGCR RNAi agent into a cell may also be done using art-known methods such as electroporation and lipofection. In certain embodiments of methods of the invention, an HMGCR dsRNA is delivered without a targeting agent. These RNAs may be delivered as “naked” RNA molecules. As a non-limiting example, an HMGCR dsRNA of the invention may be administered to a subject to treat an HMGCR-associated disease or condition in the subject, such as hyperlipidemia, in a pharmaceutical composition comprising the RNAi agent, but not including a targeting agent such as a GalNAc targeting compound.
[0253] In addition to certain delivery means described herein, it will be understood that RNAi delivery means, such as but not limited to those described herein and those used in the art, can be used in conjunction with embodiments of HMGCR RNAi agents and treatment methods described herein.
[0254] HMGCR dsRNA agents of the invention may be administered to a subject in an amount and manner effective to reduce a level and activity of HMGCR polypeptide in a cell and / or subject. In some embodiments of methods of the invention one or more HMGCR dsRNA agents are administered to a cell and / or subject to treat a disease or condition associated with HMGCR expression and activity. Methods of the invention, in some embodiments, include administering one or more HMGCR dsRNA agents to a subject in need of such treatment to reduce a disease or condition associated with HMGCR expression in the subject. HMGCR dsRNA agents or HMGCR antisense polynucleotide agents of the invention can be administered to reduce HMGCR expression and / or activity in one more of in vitro, ex vivo, and in vivo cells.
[0255] In some embodiments of the invention, a level, and thus an activity, of HMGCR polypeptide in a cell is reduced by delivering (e.g. introducing) an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent into a cell. Targeting agents and methods may be used to aid in delivery of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent to a specific cell type, cell subtype, organ, spatial region within a subject, and / or to a sub-cellular region within a cell. A HMGCR dsRNA agent can be administered in certain methods of the invention singly or in combination with one or more additional HMGCR dsRNA agents. In some embodiments, 2, 3, 4, or more independently selected HMGCR dsRNA agents are administered to a subject.
[0256] In certain embodiments of the invention, an HMGCR dsRNA agent is administered to a subject to treat an HMGCR-associated disease or condition in conjunction with one or more additional therapeutic regimens for treating the HMGCR-associate disease or condition. Non-limiting examples of additional therapeutic regimens are: administering one or more HMGCR antisense polynucleotides of the invention, administering a non-HMGCR dsRNA therapeutic agent, and a behavioral modification. An additional therapeutic regimen may be administered at a time that is one or more of: prior to, simultaneous with, and following administration of an HMGCR dsRNA agent of the invention. It will be understood that simultaneous with as used herein, within five minutes of time zero, within 10 minutes of time zero, within 30 minutes of time zero, within 45 minutes of time zero, and within 60 minutes of time zero, with “time zero” the time of administration of the HMGCR dsRNA agent of the invention to the subject. Non-limiting examples of non-HMGCR dsRNA therapeutic agents are: an HMG-CoA reductase inhibitor (e.g., a statin) , a fibrate, a bile acid sequestrant, niacin, an antiplatelet agent, an angiotensin converting enzyme inhibitor, an angiotensin II receptor antagonist (e.g., losartan potassium, such as Merck &Co. 's ) , an acylCoA cholesterol acetyltransferase (ACAT) inhibitor, a cholesterol absorption inhibitor, a cholesterol ester transfer protein (CETP) inhibitor, a microsomal triglyceride transfer protein (MTTP) inhibitor, a cholesterol modulator, a bile acid modulator, a peroxisome proliferation activated receptor (PPAR) agonist, a gene -based therapy, a PCSK9 inhibitor, composite vascular protectant (e.g., AGT 1067, from Atherogenics) , a glycoprotein Ilb / IIIa inhibitor, aspirin or an aspirin-like compound, an IB AT inhibitor (e.g., S-8921 , from Shionogi) , a squalene synthase inhibitor, or a monocyte chemoattractant protein (MCP) -I inhibitor, or a combination of any of the foregoing, wherein HMG-CoA reductase inhibitors include, but are not limited to, atorvastatin (Pfizer's / Tahor / Sortis / Torvast / Cardyl) , pravastatin (Bristol-Myers Squibb 's Pravachol, Sankyo's Mevalotin / Sanaprav) , simvastatin (Merck's / Sinvacor, Boehringer Ingelheim's Denan, Banyu's Lipovas) , lovastatin (Merck's Mevacor / Mevinacor, Bexal's Lovastatina, Cepa; Schwarz Pharma's Liposcler) , fluvastatin (Novartis' / Locol / Lochol, Fujisawa's Cranoc, Solvay's Digaril) , cerivastatin (Bayer's Lipobay / GlaxoSmithKline's Baycol) , rosuvastatin (AstraZeneca's ) , and pitivastatin (itavastatin / risivastatin) (Nissan Chemical, Kowa Kogyo, Sankyo, and Novartis) , wherein fibrates include, but are not limited to, bezafibrate (e.g., Roche's Kissei's Bezatol) , clofibrate (e.g., Wyeth's ) , fenofibrate (e.g., Founder's Lipidil / Lipantil, Abbott's Takeda's Lipantil, generics) , gemfibrozil (e.g., Pfizer's Lopid / Lipur) and ciprofibrate (Sanofi-Synthelabo's ) , wherein bile acid sequestrants include, but are not limited to, cholestyramine (Bristol-Myers Squibb's and Questran LightTM) , colestipol (e.g., Pharmacia's Colestid) , and colesevelam (Genzyme / Sankyo's WelCholTM) , wherein niacin therapies include, but are not limited to, immediate releaseformulations, such as Aventis' Nicobid, Upsher-Smith's Niacor, Aventis' Nicolar, and Sanwakagaku's Perycit, wherein Niacin extended release formulations include, e.g., Kos Pharmaceuticals' Niaspan and Upsher-Smith's SIo-Niacin, wherein antiplatelet agents include, but are not limited to, aspirin (e.g., Bayer's aspirin) , clopidogrel (Sanofi-Synthelabo / Bristol-Myers Squibb's Plavix) , and ticlopidine (e.g., Sanofi-Synthelabo's Ticlid and Daiichi's Panaldine) , wherein aspirin-like compounds include, but are not limited to, Asacard (slow-release aspirin, by Pharmacia) and Pamicogrel (Kanebo / Angelini Ricerche / CEPA) , wherein angiotensin-converting enzyme inhibitors include, but are not limited to, ramipril (e.g., Aventis' Altace) and enalapril (e.g., Merck &Co. 's Vasotec) , wherein acyl CoA cholesterol acetyltransferase (AC AT) inhibitors include, but are not limited to, avasimibe (Pfizer) , eflucimibe (BioMsrieux Pierre Fabre / Eli Lilly) , CS-505 (Sankyo and Kyoto) , and SMP-797 (Sumito) , wherein cholesterol absorption inhibitors include, but are not limited to, ezetimibe (Merck / Schering-Plough Pharmaceuticals ) and Pamaqueside (Pfizer) , wherein CETP inhibitors include, but are not limited to, Torcetrapib (also called CP-529414, Pfizer) , JTT-705 (Japan Tobacco) , and CETi-I (Avant Immunotherapeutics) , wherein microsomal triglyceride transfer protein (MTTP) inhibitors include, but are not limited to, implitapide (Bayer) , R-103757 (Janssen) , and CP-346086 (Pfizer) , wherein cholesterol modulators include, but are not limited to, NO-1886 (Otsuka / TAP Pharmaceutical) , CT 1027 (Pfizer) , and WAY-135433 (Wyeth-Ayerst) , wherein bile acid modulators include, but are not limited to, HBS-107 (Hisamitsu / Banyu) , Btg-511 (British Technology Group) , BARI-1453 (Aventis) , S-8921 (Shionogi) , SD-5613 (Pfizer) , and AZD-7806 (AstraZeneca) , wherein peroxisome proliferation activated receptor (PPAR) agonists include, but are not limited to, tesaglitazar (AZ-242) (AstraZeneca) , Netoglitazone (MCC-555) (Mitsubishi / Johnson &Johnson) , GW-409544 (Ligand Pharniaceuticals / GlaxoSmithKline) , GW-501516 (Ligand Pharmaceuticals / GlaxoSmithKline) , LY-929 (Ligand Pharmaceuticals and Eli Lilly) , LY-465608 (Ligand Pharmaceuticals and Eli Lilly) , LY-518674 (Ligand Pharmaceuticals and Eli Lilly) , and MK-767 (Merck and Kyorin) , wherein gene-based therapies include, but are not limited to, AdGWEGF 121.10 (GenVec) , ApoAl (UCB Pharma / Groupe Fournier) , EG-004 (Trinam) (Ark Therapeutics) , and ATP -binding cassette transporter-Al (ABCA1) (CV Therapeutics / Incyte, Aventis, Xenon) , wherein PCSK9 inhibitors include, but are not limited to, alirocumab evolocumab and inclisiran wherein Glycoprotein Ilb / IIIa inhibitors include, but are not limited to, roxifiban (also called DMP754, Bristol-Myers Squibb) , Gantofiban (Merck KGaA / Yamanouchi) , and Cromafiban (Millennium Pharmaceuticals) , wherein squalene synthase inhibitors include, but are not limited to, BMS-1884941 (Bristol-Myers Squibb) , CP-210172 (Pfizer) , CP-295697 (Pfizer) , CP-294838 (Pfizer) , and TAK-475 (Takeda) , wherein MCP-I inhibitor include, but are not limited to, RS-504393 (Roche Bioscience) , wherein anti-atherosclerotic agent include, but are not limited to, BO-653 (Chugai Pharmaceuticals) , wherein the nicotinic acid derivative include, but are not limited to, Nyclin (Yamanouchi Pharaiacuticals) . Exemplary combination therapies suitable for administration with a dsRNA targeting HMGCR include, but are not limited to, advicor (Niacin / lovastatin from Kos Pharmaceuticals) , amlodipine / atorvastatin (Pfizer) , and ezetimibe / simvastatin (e.g., 10 / 10, 10 / 20, 10 / 40, and 10 / 80 tablets by Merck / Schering-Plough Pharmaceuticals) . Non-limiting examples of behavioral modifications are: a dietary regimen, counseling, and an exercise regimen. These and other therapeutic agents and behavior modifications are known in the art and used to treat an HMGCR-associated disease or condition in a subject and may be administered to a subject in combination with the administration of one or more HMGCR dsRNA agents of the invention to treat the HMGCR-associated disease or condition. A HMGCR dsRNA agent of the invention administered to a cell or subject to treat an HMGCR-associated disease or condition may act in a synergistic manner with one or more other therapeutic agents or activities and increase the effectiveness of the one or more therapeutic agents or activities and / or to increase the effectiveness of the HMGCR dsRNA agent at treating the HMGCR-associated disease or condition.
[0257] Treatment methods of the invention that include administration of an HMGCR dsRNA agent can be used prior to the onset of an HMGCR-associated disease or condition and / or when an HMGCR-associated disease or condition is present, including at an early stage, mid-stage, and late stage of the disease or condition and all times before and after any of these stages. Methods of the invention may also be to treat subjects who have previously been treated for an HMGCR-associated disease or condition with one or more other therapeutic agents and / or therapeutic activities that were not successful, were minimally successful, and / or are no longer successful at treating the HMGCR-associated disease or condition in the subject.
[0258] Vector Encoded dsRNAs
[0259] In certain embodiments of the invention, an HMGCR dsRNA agent can be delivered into a cell using a vector. HMGCR dsRNA agent transcription units can be included in a DNA or RNA vector. Prepare and use of such vectors encoding transgenes for delivering sequences into a cell and or subject are well known in the art. Vectors can be used in methods of the invention that result in transient expression of HMGCR dsRNA, for example for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more weeks. The length of the transient expression can be determined using routine methods based on elements such as, but not limited to the specific vector construct selected and the target cell and / or tissue. Such transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92: 1292) .
[0260] An individual strand or strands of an HMGCR dsRNA agent can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co-introduced to a cell using means such as transfection or infection. In certain embodiments each individual strand of an HMGCR dsRNA agent of the invention can be transcribed by promoters that are both included on the same expression vector. In certain embodiments of the invention an HMGCR dsRNA agent is expressed as inverted repeat polynucleotides joined by a linker polynucleotide sequence such that the HMGCR dsRNA agent has a stem and loop structure.
[0261] Non-limiting examples of RNA expression vectors are DNA plasmids or viral vectors. Expression vectors useful in embodiments of the invention can be compatible with eukaryotic cells. Eukaryotic cell expression vectors are routinely used in the art and are available from a number of commercial sources. Delivery of HMGCR dsRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from a subject followed by reintroduction into the subject, or by any other means that allows for introduction into a desired target cell.
[0262] Viral vector systems that may be included in an embodiment of a method of the include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc. ; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Constructs for the recombinant expression of an HMGCR dsRNA agent may include regulatory elements, such as promoters, enhancers, etc., which may be selected to provide constitutive or regulated / inducible expression. Viral vector systems, and the use of promoters and enhancers, etc. are routine in the art and can be used in conjunction with methods and compositions described herein.
[0263] Certain embodiments of the invention include use of viral vectors for delivery of HMGCR dsRNA agents into cells. Numerous adenovirus-based delivery systems are routinely used in the art for deliver to, for example, lung, liver, the central nervous system, endothelial cells, and muscle. Non-limiting examples of viral vectors that may be used in methods of the invention are: AAV vectors, a pox virus such as a vaccinia virus, a Modified Virus Ankara (MVA) , NYVAC, an avipox such as fowl pox or canary pox.
[0264] Certain embodiments of the invention include methods of delivering HMGCR dsRNA agents into cells using a vector and such vectors may be in a pharmaceutically acceptable carrier that may, but need not, include a slow release matrix in which the gene delivery vehicle is imbedded. In some embodiments, a vector for delivering an HMGCR dsRNA can be produced from a recombinant cell, and a pharmaceutical composition of the invention may include one or more cells that produced the HMGCR dsRNA delivery system.
[0265] Pharmaceutical Compositions Containing HMGCR dsRNA or ssRNA agents
[0266] Certain embodiments of the invention include use of pharmaceutical compositions containing an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent and a pharmaceutically acceptable carrier. The pharmaceutical composition containing the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent can be used in methods of the invention to reduce HMGCR gene expression and HMGCR activity in a cell and is useful to treat an HMGCR-associated disease or condition. Such pharmaceutical compositions can be formulated based on the mode of delivery. Non-limiting examples of formulations for modes of delivery are: a composition formulated for subcutaneous delivery, a composition formulated for systemic administration via parenteral delivery, a composition formulated for intravenous (IV) delivery, a composition formulated for intrathecal delivery, a composition formulated for direct delivery into brain, etc. Administration of a pharmaceutic composition of the invention to deliver an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent into a cell may be done using one or more means such as: topical (e.g., by a transdermal patch) , pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration. A HMGCR dsRNA agent or HMGCR antisense polynucleotide agent can also be delivered directly to a target tissue, for example directly into the liver, directly into a kidney, etc. It will be understood that “delivering an HMGCR dsRNA agent” or “delivering an HMGCR antisense polynucleotide agent” into a cell encompasses delivering an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent, respectively, directly as well as expressing an HMGCR dsRNA agent in a cell from an encoding vector that is delivered into a cell, or by any suitable means with which the HMGCR dsRNA or HMGCR antisense polynucleotide agent becomes present in a cell. Preparation and use of formulations and means for delivering inhibitory RNAs are well known and routinely used in the art.
[0267] As used herein, a “pharmaceutical composition” comprises a pharmacologically effective amount of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the invention and a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier” refers to a carrier for administration of a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture medium. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents. Binding agents may include starch and gelatin, while the lubricating agent, if present, will generally be magnesium stearate, stearic acid or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract. Agents included in drug formulations are described further herein below.
[0268] As used herein terms such as: “pharmacologically effective amount, ” “therapeutically effective amount” and “effective amount” refers to that amount of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the invention to produce the intended pharmacological, therapeutic or preventive result. For example, if a given clinical treatment is considered effective when there is at least a 10%reduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of a drug for the treatment of that disease or disorder is the amount necessary to effect at least a 10%reduction in that parameter. For example, a therapeutically effective amount of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent can reduce HMGCR polypeptide levels by at least 10%.
[0269] Effective amounts
[0270] Methods of the invention, in some aspects comprise contacting a cell with an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent in an effective amount to reduce HMGCR gene expression in the contacted cell. Certain embodiments of methods of the invention comprise administering an HMGCR dsRNA agent or an HMGCR antisense polynucleotide agent to a subject in an amount effective to reduce HMGCR gene expression and treat an HMGCR-associated disease or condition in the subject. An “effective amount” used in terms of reducing expression of HMGCR and / or for treating an HMGCR-associated disease or condition, is an amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent to treat an HMGCR-associated disease or condition could be that amount necessary to (i) slow or halt progression of the disease or condition; or (ii) reverse, reduce, or eliminate one or more symptoms of the disease or condition. In some aspects of the invention, an effective amount is that amount of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent that when administered to a subject in need of a treatment of an HMGCR-associated disease or condition, results in a therapeutic response that prevents and / or treats the disease or condition. According to some aspects of the invention, an effective amount is that amount of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the invention that when combined or co-administered with another therapeutic treatment for an HMGCR-associated disease or condition, results in a therapeutic response that prevents and / or treats the disease or condition. In some embodiments of the invention, a biologic effect of treating a subject with an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the invention may be the amelioration and or absolute elimination of symptoms resulting from the HMGCR-associated disease or condition. In some embodiments of the invention, a biologic effect is the complete abrogation of the HMGCR-associated disease or condition, as evidenced for example, by a diagnostic test that indicates the subject is free of the HMGCR-associated disease or condition. A non-limiting example of a physiological symptom that may be detected includes a reduction in HMGCR level in liver of a subject following administration of an agent of the invention. Additional art-known means of assessing the status of an HMGCR-associated disease or condition can be used to determine an effect of an agent and / or methods of the invention on an HMGCR-associated disease or condition.
[0271] Typically, an effective amount of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent to decrease HMGCR polypeptide activity to a level to treat an HMGCR-associated disease or condition will be determined in clinical trials, establishing an effective dose for a test population versus a control population in a blind study. In some embodiments, an effective amount will be that results in a desired response, e.g., an amount that diminishes an HMGCR-associated disease or condition in cells, tissues, and / or subjects with the disease or condition. Thus, an effective amount of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent to treat an HMGCR-associated disease or condition that can be treated by reducing HMGCR polypeptide activity may be the amount that when administered decreases the amount of HMGCR polypeptide activity in the subject to an amount that is less than the amount that would be present in the cell, tissue, and / or subject without the administration of the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent. In certain aspects of the invention the level of HMGCR polypeptide activity, and / or HMGCR gene expression present in a cell, tissue, and / or subject that has not been contacted with or administered an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the invention is referred to as a “control” amount. In some embodiments of methods of the invention a control amount for a subject is a pre-treatment amount for the subject, in other words, a level in a subject before administration of an HMGCR agent can be a control level for that subject and compared to a level of HMGCR polypeptide activity and / or HMGCR gene expression in the subject following siRNA administered to the subject. In the case of treating an HMGCR-associated disease or condition the desired response may be reducing or eliminating one or more symptoms of the disease or condition in the cell, tissue, and / or subject. The reduction or elimination may be temporary or may be permanent. It will be understood that the status of an HMGCR-associated disease or condition can be monitored using methods of determining HMGCR polypeptide activity, HMGCR gene expression, symptom evaluation, clinical testing, etc. In some aspects of the invention, a desired response to treatment of an HMGCR-associated disease or condition is delaying the onset or even preventing the onset of the disease or condition.
[0272] An effective amount of a compound that decreases HMGCR polypeptide activity may also be determined by assessing physiological effects of administration of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent on a cell or subject, such as a decrease of an HMGCR-associated disease or condition following administration. Assays and / or symptomatic monitoring of a subject can be used to determine efficacy of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the invention, which may be administered in a pharmaceutical compound of the invention, and to determine the presence or absence of a response to the treatment. A non-limiting example, is that one or more art-known tests of serum cholesterol or triglyceride levels. Another non-limiting example, is that one or more art-known tests of liver function can be used to determine the status of the HMGCR-associated lipid imbalance in a subject before and after treatment of the subject with an HMGCR dsRNA agent of the invention.
[0273] Some embodiments of the invention include methods of determining an efficacy of an dsRNA agent or HMGCR antisense polynucleotide agent of the invention administered to a subject, to treat an HMGCR-associated disease or condition by assessing and / or monitoring one or more “physiological characteristics” of the HMGCR-associated disease or condition in the subject. Non-limiting examples of physiological characteristics of an HMGCR-associated disease or condition are the HMGCR mRNA level, the HMGCR protein level, or cholesteryl ester (CE) levels, triglyceride levels, cholesterol levels (such as high-density lipoprotein cholesterol (HDL-C) , intermediate-density lipoprotein cholesterol (IDL-C) , low-density lipoprotein cholesterol (LDL-C) level, very-low-density lipoprotein cholesterol (VLDL-C) level) , and lipid level in blood or serum, etc. Standard means of determining such physiological characteristic are known in the art and include, but are not limited to, blood tests, imaging studies, physical examination, etc.
[0274] It will be understood that the amount of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent administered to a subject can be modified based, at least in part, on such determinations of disease and / or condition status and / or physiological characteristics determined for a subject. The amount of a treatment may be varied for example by increasing or decreasing the amount of an HMGCR-dsRNA agent or HMGCR antisense polynucleotide agent, by changing the composition in which the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent, respectively, is administered, by changing the route of administration, by changing the dosage timing and so on. The effective amount of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent will vary with the particular condition being treated, the age and physical condition of the subject being treated; the severity of the condition, the duration of the treatment, the nature of the concurrent therapy (if any) , the specific route of administration, and additional factors within the knowledge and expertise of the health practitioner. For example, an effective amount may depend upon the desired level of HMGCR polypeptide activity and or HMGCR gene expression that is effective to treat the HMGCR-associated disease or condition. A skilled artisan can empirically determine an effective amount of a particular HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the invention for use in methods of the invention without necessitating undue experimentation. Combined with the teachings provided herein, by selecting from among various HMGCR dsRNA agents or HMGCR antisense polynucleotide agents of the invention, and weighing factors such as potency, relative bioavailability, patient body weight, severity of adverse side-effects and preferred mode of administration, an effective prophylactic or therapeutic treatment regimen can be planned that is effective to treat the particular subject. As used in embodiments of the invention, an effective amount of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the invention can be that amount that when contacted with a cell results in a desired biological effect in the cell.
[0275] It will be recognized that HMGCR gene silencing may be determined in any cell expressing HMGCR, either constitutively or by genomic engineering, and by any appropriate assay. In some embodiments of the invention, HMGCR gene expression is reduced by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%by administration of an HMGCR dsRNA agent of the invention. In some embodiments of the invention, HMGCR gene expression is reduced by at between 5%and 10%, 5%and 25%, 10%and 50%, 10%and 75%, 25%and 75%, 25%and 100%, or 50%and 100%by administration of an HMGCR dsRNA agent of the invention.
[0276] Dosing
[0277] HMGCR dsRNA agents and HMGCR antisense polynucleotide agents are delivered in pharmaceutical compositions in dosages sufficient to inhibit expression of HMGCR genes. In certain embodiments of the invention, a dose of HMGCR dsRNA agent or HMGCR antisense polynucleotide agent is in a range of 0.01 to 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of 1 to 50 mg per kilogram body weight, 5 to 40 mg / kg body weight, 10 to 30 mg / kg body weight, 1 to 20 mg / kg body weight, 1 to 10 mg / kg body weight, 4 to 15 mg / kg body weight per day, inclusive. For example, the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent can be administered in an amount that is from about 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3.0 mg / kg, 3.1 mg / kg, 3.2 mg / kg, 3.3 mg / kg, 3.4 mg / kg, 3.5 mg / kg, 3.6 mg / kg, 3.7 mg / kg, 3.8 mg / kg, 3.9 mg / kg, 4 mg / kg, 4.1 mg / kg, 4.2 mg / kg, 4.3 mg / kg, 4.4 mg / kg, 4.5 mg / kg, 4.6 mg / kg, 4.7 mg / kg, 4.8 mg / kg, 4.9 mg / kg, 5 mg / kg, 5.1 mg / kg, 5.2 mg / kg, 5.3 mg / kg, 5.4 mg / kg, 5.5 mg / kg, 5.6 mg / kg, 5.7 mg / kg, 5.8 mg / kg, 5.9 mg / kg, 6 mg / kg, 6.1 mg / kg, 6.2 mg / kg, 6.3 mg / kg, 6.4 mg / kg, 6.5 mg / kg, 6.6 mg / kg, 6.7 mg / kg, 6.8 mg / kg, 6.9 mg / kg, 7 mg / kg, 7.1 mg / kg, 7.2 mg / kg, 7.3 mg / kg, 7.4 mg / kg, 7.5 mg / kg, 7.6 mg / kg, 7.7 mg / kg, 7.8 mg / kg, 7.9 mg / kg, 8 mg / kg, 8.1 mg / kg, 8.2 mg / kg, 8.3 mg / kg, 8.4 mg / kg, 8.5 mg / kg, 8.6 mg / kg, 8.7 mg / kg, 8.8 mg / kg, 8.9 mg / kg, 9 mg / kg, 9.1 mg / kg, 9.2 mg / kg, 9.3 mg / kg, 9.4 mg / kg, 9.5 mg / kg, 9.6 mg / kg, 9.7 mg / kg, 9.8 mg / kg, 9.9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, 20 mg / kg, 21 mg / kg, 22 mg / kg, 23mg / kg, 24 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, through 50 mg / kg body per single dose.
[0278] Various factors may be considered in the determination of dosage and timing of delivery of an HMGCR dsRNA agent of the invention. The absolute amount of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent delivered will depend upon a variety of factors including a concurrent treatment, the number of doses and the individual subject parameters including age, physical condition, size and weight. These are factors well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. In some embodiments, a maximum dose can be used, that is, the highest safe dose according to sound medical judgment.
[0279] Methods of the invention may in some embodiments include administering to a subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent. In some instances, a pharmaceutical compound, (e.g., comprising an HMGCR dsRNA agent or comprising an HMGCR antisense polynucleotide agent) can be administered to a subject at least daily, every other day, weekly, every other week, monthly, etc. Doses may be administered once per day or more than once per day, for example, 2, 3, 4, 5, or more times in one 24 hour period. A pharmaceutical composition of the invention may be administered once daily, or the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent may be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In some embodiments of methods of the invention, a pharmaceutical composition of the invention is administered to a subject one or more times per day, one or more times per week, one or more times per month, or one or more times per year.
[0280] Methods of the invention, in some aspects, include administration of a pharmaceutical compound alone, in combination with one or more other HMGCR dsRNA agents or HMGCR antisense polynucleotide agents, and / or in combination with other drug therapies or treatment activities or regimens that are administered to subjects with an HMGCR-associated disease or condition. Pharmaceutical compounds may be administered in pharmaceutical compositions. Pharmaceutical compositions used in methods of the invention may be sterile and contain an amount of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent that will reduce activity of an HMGCR polypeptide to a level sufficient to produce the desired response in a unit of weight or volume suitable for administration to a subject. A dose administered to a subject of a pharmaceutical composition that includes an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent to reduce HMGCR protein activity can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits.
[0281] Treatment
[0282] As used herein, “HMGCR-associated disease” , “HMGCR-associated diseases and conditions” and “diseases and conditions caused and / or modulated by HMGCR” , “HMGCR-associated disorder” includes a disease, disorder or condition that would benefit from a decrease in HMGCR gene expression, replication, or protein activity. Exemplary HMGCR-associated diseases include acquired or inherited “disorders of lipid metabolism"which include any disorder associated with or caused by a disturbance in lipid metabolism. For example, this term includes any disorder, disease or condition characterized by abnormal elevation of levels of any or all lipids and / or lipoproteins in the blood or a condition that can lead to abnormal elevation of levels of any or all lipids and / or lipoproteins in the blood, such as a hyperlipidemia, and other forms of lipid imbalance such as hypercholesterolemia, hypertriglyceridemia, mixed hyperlipidemia, as well as the pathological conditions associated with these disorders, e.g., congestive heart disease (CHD) and atherosclerosis. Exemplary disorders of lipid metabolism include, but are not limited to, atherosclerosis, dyslipidemia, hypertriglyceridemia (including drug-induced hypertriglyceridemia, diuretic-induced hypertriglyceridemia, alcohol-induced hypertriglyceridemia, β-adrenergic blocking agent-induced hypertriglyceridemia, estrogen-induced hypertriglyceridemia, glucocorticoid-induced hypertriglyceridemia, retinoid-induced hypertriglyceridemia, and cimetidine-induced hypertriglyceridemia, and familial hypertriglyceridemia) , acute pancreatitis associated with hypertriglyceridemia, chylomicron syndrom, familial chylomicronemia, Apo-E deficiency or resistance, LPL deficiency or hypoactivity, hyperlipidemia (including familial combined hyperlipidemia) , familial partial lipodystrophy type 1 (FPLD1) , hypercholesterolemia, mixed hyperlipidemia (or mixed hyperlipoproteinemia familial, gout associated with hypercholesterolemia, xanthomatosis (subcutaneous cholesterol deposits) , hyperlipidemia with heterogeneous LPL deficiency, and hyperlipidemia with high LDL, heterogeneous LPL deficiency, and an induced or acquired disorder, such as a disorder induced or acquired as a result of a disease. As used herein, the term “serum lipid” refers to any major lipid present in the blood. Serum lipids may be present in the blood either in free form or as a part of a protein complex, e.g., a lipoprotein complex. Non-limiting examples of serum lipids include triglycerides, cholesterol, such as total cholesterol, low density lipoprotein cholesterol (LDL-C) , high-density lipoprotein cholesterol (HDL-C) , very low density lipoprotein cholesterol (VLDL-C) and intermediate-density lipoprotein cholesterol (IDL-C) . In some embodiments, the disorder of lipid metabolism is a hyperlipidemia. As used herein, the term “hyperlipidemia” refers to any any disorder, disease or condition characterized by abnormal elevation of levels of any or all lipids, such as cholesterol and triglycerides, and / or lipoproteins in the blood or a condition that can lead to abnormal elevation of levels of any or all lipids and / or lipoproteins in the blood. In one embodiment, the hyperlipidemia is hypertriglyceridemia. As used herein, the term “hypertriglyceridemia” refers to a condition in which triglyceride levels are elevated, often caused or exacerbated by uncontrolled hyperlipidemia mellitus, obesity, and sedentary habits. This condition is a risk factor for coronary artery disease. Hypertriglyceridemia is usually asymptomatic until triglycerides are greater than 1000-2000 mg / dL. Signs and symptoms may include the following: pain in the mid-epigastric, chest, or back regions; nausea, vomiting, dyspnea, xanthomas, corneal arcus, and / or xanthelasmas In some embodiments, the hyperlipidemia is hypercholesterolemia. As used herein the term “hypercholesterolemia” refers to a form of hyperlipidemia (elevated levels of lipids in the blood) in which there are high levels of cholesterol in the serum of a subject, e.g., at least about 240 mg / dL of total cholesterol. In other embodiments, the hyperlipidemia is mixed hyperlipidemia. As used herein the term “mixed hyperlipidemia” also referred to as type 5 hyperlipidemia refers to a form of hyperlipidemia in which there are elevated levels of VLDL and chylomicrons found in plasma in the serum of a subject, e.g., at least about 240 mg / dL of total cholesterol. Cardiovascular diseases associated with disorders of lipid metabolism are also considered “disorders of lipid metabolism” , as defined herein. These diseases may include coronary artery disease (also called ischemic heart disease) , atherosclerosis, inflammation associated with coronary artery disease, restenosis, peripheral vascular diseases, and stroke. Disorders related to body weight are also considered “disorders of lipid metabolism” , as defined herein. Such disorders may include obesity, metabolic syndrome including independent components of metabolic syndrome (e.g., central obesity, FBG / pre-hyperlipidemia / hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, and hypertension) , hypothyroidism, uremia, and other conditions associated with weight gain (including rapid weight gain) , weight loss, maintenance of weight loss, or risk of weight regain following weight loss. Blood sugar disorders are further considered “disorders of lipid metabolism” , as defined herein. Such disorders may include hyperlipidemia, hypertension, and polycystic ovarian syndrome related to insulin resistance. Other exemplary disorders of lipid metabolism may also include renal transplantation, nephrotic syndrome, Cushing's syndrome, acromegaly, systemic lupus erythematosus, dysglobulinemia, lipodystrophy, glycogenosis type I, and Addison's disease.
[0283] In certain aspects of the invention, a subject may be administered an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the invention at a time that is one or more of before or after diagnosis of an HMGCR-associated disease or condition. In some aspects of the invention, a subject is at risk of having or developing an HMGCR-associated disease or condition. A subject at risk of developing an HMGCR-associated disease or condition is one who has an increased probability of developing the HMGCR-associated disease or condition, compared to a control risk of developing the HMGCR-associated disease or condition. In some embodiments of the invention, a level of risk may be statistically significant compared to a control level of risk. A subject at risk may include, for instance, a subject who is, or will be, a subject who has a preexisting disease and / or a genetic abnormality that makes the subject more susceptible to an HMGCR-associated disease or condition than a control subject without the preexisting disease or genetic abnormality; a subject having a family and / or personal medical history of the HMGCR-associated disease or condition; and a subject who has previously been treated for an HMGCR-associated disease or condition. It will be understood that a preexisting disease and / or a genetic abnormality that makes the subject more susceptible to an HMGCR-associated disease or condition, may be a disease or genetic abnormality that when present has been previously identified as having a correlative relation to a higher likelihood of developing an HMGCR-associated disease or condition.
[0284] It will be understood that an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent may be administered to a subject based on a medical status of the individual subject. For example, a health-care provided for a subject may assess an HMGCR level measured in a sample obtained from a subject and determine it is desirable to reduce the subject’s HMGCR level, by administration of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the invention. In this example, the HMGCR level may be considered to be a physiological characteristic of an HMGCR-associated condition, even if the subject is not diagnosed as having an HMGCR-assoicated disease such as one disclosed herein. A healthcare provider may monitor changes in the subject’s HMGCR level, as a measure of efficacy of the administered HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the invention. In a non-limiting example, a biological sample, such as a blood or serum sample may be obtained from a subject and an HMGCR level for the subject determined in the sample. A HMGCR dsRNA agent or HMGCR antisense polynucleotide agent is administered to the subject and a blood sample is obtained from the subject following the administration and the HMGCR level determined using the sample and the results compared to the results determined in the subject’s pre-administration (prior) sample. A reduction in the subject’s HMGCR level in the later sample compared to the pre-administration level indicates the administered HMGCR dsRNA agent or HMGCR antisense polynucleotide agent efficacy in reducing the lipid level in the subject.
[0285] Certain embodiments of methods of the invention include adjusting a treatment that includes administering a dsRNA agent or an HMGCR antisense polynucleotide agent of the invention to a subject based at least in part on assessment of a change in one or more of the subject’s physiological characteristics of an HMGCR-associated disease or condition resulting from the treatment. For example, in some embodiments of the invention, an effect of an administered dsRNA agent or HMGCR antisense polynucleotide agent of the invention may be determined for a subject and used to assist in adjusting an amount of a dsRNA agent or HMGCR antisense polynucleotide agent of the invention subsequently administered to the subject. In a non-limiting example, a subject is administered a dsRNA agent or HMGCR antisense polynucleotide agent of the invention, the subject’s HMGCR level is determined after the administration, and based at least in part on the determined level, a greater amount of the dsRNA agent or HMGCR antisense polynucleotide agent is determined to be desirable in order to increase the physiological effect of the administered agent, for example to reduce or further reduce the subject’s HMGCR level. In another non-limiting example, a subject is administered a dsRNA agent or HMGCR antisense polynucleotide agent of the invention, the subject’s HMGCR level is determined after the administration and based at least in part on the determined level, a lower amount of the dsRNA agent or HMGCR antisense polynucleotide agent is desirable to administer to the subject.
[0286] Thus, some embodiments of the invention include assessing a change in one or more physiological characteristics of resulting from a subject’s previous treatment to adjust an amount of a dsRNA agent or HMGCR antisense polynucleotide agent of the invention subsequently administered to the subject. Some embodiments of methods of the invention include 1, 2, 3, 4, 5, 6, or more determinations of a physiological characteristic of an HMGCR-associated disease or condition to assess and / or monitor the efficacy of an administered HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the invention, and optionally using the determinations to adjust one or more of: a dose, administration regimen, and or administration frequency of a dsRNA agent or HMGCR antisense polynucleotide agent of the invention to treat an HMGCR-associated disease or condition in a subject. In some embodiments of methods of the invention, a desired result of administering an effective amount of a dsRNA agent or HMGCR antisense polynucleotide agent of the invention to a subject is a reduction of the subject’s the HMGCR mRNA level, the HMGCR protein level in the subject, or cholesteryl ester (CE) levels, triglyceride levels, cholesterol levels (such as high-density lipoprotein cholesterol (HDL-C) , intermediate-density lipoprotein cholesterol (IDL-C) , low-density lipoprotein cholesterol (LDL-C) level, very-low-density lipoprotein cholesterol (VLDL-C) level) , and lipid level in blood or serum, etc., as compared to a prior level determined for the subject, or to a control level.
[0287] As used herein, the terms “treat” , “treated” , or “treating” when used with respect to an HMGCR-associated disease or condition may refer to a prophylactic treatment that decreases the likelihood of a subject developing the HMGCR-associated disease or condition, and also may refer to a treatment after the subject has developed an HMGCR-associated disease or condition in order to eliminate or reduce the level of the HMGCR-associated disease or condition, prevent the HMGCR-associated disease or condition from becoming more advanced (e.g., more severe) , and / or slow the progression of the HMGCR-associated disease or condition in a subject compared to the subject in the absence of the therapy to reduce activity in the subject of HMGCR polypeptide.
[0288] Certain embodiments of agents, compositions, and methods of the invention can be used to inhibit HMGCR gene expression. As used herein in reference to expression of an HMGCR gene, the terms “inhibit, ” “silence, ” “reduce, ” “down-regulate, ” and “knockdown” mean the expression of the HMGCR gene, as measured by one or more of: a level of RNA transcribed from the gene, a level of activity of HMGCR expressed, and a level of HMGCR polypeptide, protein or protein subunit translated from the mRNA in a cell, group of cells, tissue, organ, or subject in which the HMGCR gene is transcribed, is reduced when the cell, group of cells, tissue, organ, or subject is contacted with (e.g., treated with) an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the invention, compared to a control level of RNA transcribed from the HMGCR gene, a level of activity of expressed HMGCR, or a level of HMGCR translated from the MRNA, respectively. In some embodiments, a control level is a level in a cell, tissue, organ or subject that has not been contacted with (e.g., treated with) the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent.
[0289] Administration methods
[0290] A variety of administration routes for an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent are available for use in methods of the invention. The particular delivery mode selected will depend at least in part, upon the particular condition being treated and the dosage required for therapeutic efficacy. Methods of this invention, generally speaking, may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of treatment of an HMGCR-associated disease or condition without causing clinically unacceptable adverse effects. In some embodiments of the invention, an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent may be administered via an oral, enteral, mucosal, subcutaneous, and / or parenteral route. The term “parenteral” includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal, and intrasternal injection, or infusion techniques. Other routes include but are not limited to nasal (e.g., via a gastro-nasal tube) , dermal, vaginal, rectal, sublingual, and inhalation. Delivery routes of the invention may include intrathecal, intraventricular, or intracranial. In some embodiments of the invention, an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent may be placed within a slow-release matrix and administered by placement of the matrix in the subject. In some aspects of the invention, an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent may be delivered to a subject cell using nanoparticles coated with a delivery agent that targets a specific cell or organelle. Various delivery means, methods, agents are known in the art. Non-limiting examples of delivery methods and delivery agents are additionally provided elsewhere herein. In some aspects of the invention, the term “delivering” in reference to an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent may mean administration to a cell or subject of one or more “naked” HMGCR dsRNA agent or HMGCR antisense polynucleotide agent sequences and in certain aspects of the invention “delivering” means administration to a cell or subject via transfection means, delivering a cell comprising an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent to a subject, delivering a vector encoding an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent into a cell and / or subject, etc. Delivery of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent using a transfection means may include administration of a vector to a cell and / or subject.
[0291] In some methods of the invention one or more HMGCR dsRNA agents or HMGCR antisense polynucleotide agents may be administered in formulations, which may be administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients. In some embodiments of the invention an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent may be formulated with another therapeutic agent for simultaneous administration. According to methods of the invention, an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent may be administered in a pharmaceutical composition. In general, a pharmaceutical composition comprises an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent and optionally, a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well-known to those of ordinary skill in the art. As used herein, a pharmaceutically acceptable carrier means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients, e.g., the ability of the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent to inhibit HMGCR gene expression in a cell or subject. Numerous methods to administer and deliver dsRNA agents or HMGCR antisense polynucleotide agents for therapeutic use are known in the art and may be utilized in methods of the invention.
[0292] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers and other materials that are well-known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Pat. No. 5,211,657 and others are known by those skilled in the art. Such preparations may routinely contain salt, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof and are not excluded from the scope of the invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like. Also, pharmaceutically acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.
[0293] Some embodiments of methods of the invention include administering one or more HMGCR dsRNA agents or HMGCR antisense polynucleotide agents directly to a tissue. In some embodiments, the tissue to which the compound is administered is a tissue in which the HMGCR-associated disease or condition is present or is likely to arise, non-limiting examples of which are the heart. Direct tissue administration may be achieved by direct injection or other means. Many orally delivered compounds naturally travel to and through the liver and kidneys and some embodiments of treatment methods of the invention include oral administration of one or more HMGCR dsRNA agents to a subject. HMGCR dsRNA agents or HMGCR antisense polynucleotide agents, either alone or in conjunction with other therapeutic agents, may be administered once, or alternatively they may be administered in a plurality of administrations. If administered multiple times, the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent may be administered via different routes. For example, though not intended to be limiting, a first (or first several) administrations may be made via subcutaneous means and one or more additional administrations may be oral and / or systemic administrations.
[0294] For embodiments of the invention in which it is desirable to administer an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent systemically, the HMGCR dsRNA agent or HMGCR antisense polynucleotide agent may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with or without an added preservative. HMGCR dsRNA agent formulations (also referred to as pharmaceutical compositions) may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents.
[0295] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's , or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose) , and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. Lower doses will result from other forms of administration, such as intravenous administration. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits. Multiple doses per day may be used as needed to achieve appropriate systemic or local levels of one or more HMGCR dsRNA agents or HMGCR antisense polynucleotide agents and to achieve appropriate reduction in HMGCR protein activity.
[0296] In yet other embodiments, methods of the invention include use of a delivery vehicle such as biocompatible microparticle, nanoparticle, or implant suitable for implantation into a recipient, e.g., a subject. Exemplary bioerodible implants that may be useful in accordance with this method are described in PCT Publication No. WO 95 / 24929 (incorporated by reference herein) , which describes a biocompatible, biodegradable polymeric matrix for containing a biological macromolecule.
[0297] Both non-biodegradable and biodegradable polymeric matrices can be used in methods of the invention to deliver one or more HMGCR dsRNA agents or HMGCR antisense polynucleotide agents to a subject. In some embodiments, a matrix may be biodegradable. Matrix polymers may be natural or synthetic polymers. A polymer can be selected based on the period of time over which release is desired, generally in the order of a few hours to a year or longer. Typically, release over a period ranging from between a few hours and three to twelve months can be used. The polymer optionally is in the form of a hydrogel that can absorb up to about 90%of its weight in water and further, optionally is cross-linked with multivalent ions or other polymers.
[0298] In general, HMGCR dsRNA agents or HMGCR antisense polynucleotide agents may be delivered in some embodiments of the invention using the bioerodible implant by way of diffusion, or by degradation of the polymeric matrix. Exemplary synthetic polymers for such use are well known in the art. Biodegradable polymers and non-biodegradable polymers can be used for delivery of HMGCR dsRNA agents or HMGCR antisense polynucleotide agents using art-known methods. Bioadhesive polymers such as bioerodible hydrogels (see H.S. Sawhney, C.P. Pathak and J.A. Hubell in Macromolecules, 1993, 26, 581-587, the teachings of which are incorporated by reference herein) may also be used to deliver HMGCR dsRNA agents or HMGCR antisense polynucleotide agents for treatment of an HMGCR-associated disease or condition. Additional suitable delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent, increasing convenience to the subject and the medical care professional. Many types of release delivery systems are available and known to those of ordinary skill in the art. (See for example: U.S. Pat. Nos. 5,075,109; 4,452,775; 4,675,189; 5,736,152; 3,854,480; 5,133,974; and 5,407,686 (the teaching of each of which is incorporated herein by reference) . In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.
[0299] Use of a long-term sustained release implant may be suitable for prophylactic treatment of subjects and for subjects at risk of developing a recurrent HMGCR-associated disease or condition. Long-term release, as used herein, means that the implant is constructed and arranged to deliver a therapeutic level of an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent for at least up to 10 days, 20 days, 30 days, 60 days, 90 days, six months, a year, or longer. Long-term sustained release implants are well-known to those of ordinary skill in the art and include some of the release systems described above.
[0300] Therapeutic formulations of HMGCR dsRNA agents or HMGCR antisense polynucleotide agents may be prepared for storage by mixing the molecule or compound having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers [Remington's Pharmaceutical Sciences 21st edition, (2006) ] , in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol) ; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes) ; and / or non-ionic surfactants such as or polyethylene glycol (PEG) .
[0301] Cells, Subjects, and Controls
[0302] Methods of the invention may be used in conjunction with cells, tissues, organs and / or subjects. In some aspects of the invention a subject is a human or vertebrate mammal including but not limited to a dog, cat, horse, cow, goat, mouse, rat, and primate, e.g., monkey. Thus, the invention can be used to treat HMGCR-associated diseases or conditions in human and non-human subjects. In some aspects of the invention a subject may be a farm animal, a zoo animal, a domesticated animal or non-domesticated animal and methods of the invention can be used in veterinary prevention and treatment regimens. In some embodiments of the invention, the subject is a human and methods of the invention can be used in human prevention and treatment regimens.
[0303] Non-limiting examples of subjects to which the present invention can be applied are subjects who are diagnosed with, suspected of having, or at risk of having a disease or condition associated with a higher than desirable HMGCR expression and / or activity, also referred to as “elevated levels of HMGCR expression” . Non-limiting examples of diseases and conditions associated with a higher than desirable levels of HMGCR expression and / or activity are described elsewhere herein. Methods of the invention may be applied to a subject who, at the time of treatment, has been diagnosed as having the disease or condition associated with a higher than desirable HMGCR expression and / or activity, or a subject who is considered to be at risk for having or developing a disease or condition associated with a higher than desirable HMGCR expression and / or activity. In some aspects of the invention a disease or condition associated with a higher than desirable HMGCR level of expression and / or activity is an acute disease or condition, and in certain aspects of the invention a disease or condition associated with a higher than desirable HMGCR level of expression and / or activity is a chronic disease or condition.
[0304] In a non-limiting example, an HMGCR dsRNA agent of the invention is administered to a subject diagnosed with, suspected of having, or at risk of having, statin resistant hypercholesterolemia, which is a disease in which it is desirable to reduce HMGCR expression. Methods of the invention may be applied to the subject who, at the time of treatment, has been diagnosed as having the disease or condition, or a subject who is considered to be at risk for having or developing the disease or condition.
[0305] In another non-limiting example, an HMGCR dsRNA agent of the invention is administered to a subject diagnosed with, suspected of having, or at risk of having, hyperlipidemia, which is a disease in which it is desirable to reduce HMGCR expression. Methods of the invention may be applied to the subject who, at the time of treatment, has been diagnosed as having the disease or condition, or a subject who is considered to be at risk for having or developing the disease or condition.
[0306] A cell to which methods of the invention may be applied include cells that are in vitro, in vivo, ex vivo cells. Cells may be in a subject, in culture, and / or in suspension, or in any other suitable state or condition. A cell to which a method of the invention may be applied can be a liver cell, a hepatocyte, a cardiac cell, a pancreatic cell, a cardiovascular cell, kidney cell or other type of vertebrate cell, including human and non-human mammalian cells. In certain aspects of the invention, a cell to which methods of the invention may be applied is a healthy, normal cell that is not known to be a disease cell. In certain embodiments of the invention a cell to which methods and compositions of the invention are applied to a liver cell, a hepatocyte, a cardiac cell, a pancreatic cell, a cardiovascular cell, and / or a kidney cell. In certain aspects of the invention, a control cell is a normal cell, but it will be understood that a cell having a disease or condition may also serve as a control cell in particular circumstances for example to compare results in a treated cell having a disease or condition versus an untreated cell having the disease or condition, etc.
[0307] A level of HMGCR polypeptide activity can be determined and compared to control level of HMGCR polypeptide activity, according to methods of the invention. A control may be a predetermined value, which can take a variety of forms. It can be a single cut-off value, such as a median or mean. It can be established based upon comparative groups, such as in groups having normal levels of HMGCR polypeptide and / or HMGCR polypeptide activity and groups having increased levels of HMGCR polypeptide and / or HMGCR polypeptide activity. Another non-limiting example of comparative groups may be groups having one or more symptoms of or a diagnosis of an HMGCR-associated disease or condition; groups without having one or more symptoms of or a diagnosis of the disease or condition; groups of subjects to whom an siRNA treatment of the invention has been administered; groups of subjects to whom an siRNA treatment of the invention has not been administered. Typically, a control may be based on apparently healthy normal individuals in an appropriate age bracket or apparently healthy cells. It will be understood that controls according to the invention may be, in addition to predetermined values, samples of materials tested in parallel with the experimental materials. Examples include samples from control populations or control samples generated through manufacture to be tested in parallel with the experimental samples. In some embodiments of the invention, a control may include a cell or subject not contacted or treated with an HMGCR dsRNA agent of the invention and in such instances, a control level of HMGCR polypeptide and / or HMGCR polypeptide activity can be compared to a level of HMGCR polypeptide and / or HMGCR polypeptide activity in a cell or subject contacted with an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the invention.
[0308] In some embodiments of the invention a level of HMGCR polypeptide determined for a subject can be a control level against which a level of HMGCR polypeptide determined for the same subject at a different time is compared. In a non-limiting example, a level of HMGCR is determined in a biological sample obtained from a subject who has not been administered an HMGCR treatment of the invention. In some embodiments, the biological sample is a serum sample. The level of HMGCR polypeptide determined in the sample obtained from the subject can serve as a baseline or control value for the subject. After one or more administrations of an HMGCR dsRNA agent to the subject in a treatment method of the invention, one or more additional serum samples can be obtained from the subject and the level of HMGCR polypeptide in the subsequent sample or samples can be compared to the control / baseline level for the subject. Such comparisons can be used to assess onset, progression, or recession of an HMGCR associated disease or condition in the subject. For example, a level of HMGCR polypeptide in the baseline sample obtained from the subject that is higher than a level obtained from the same subject after the subject has been administered an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the invention indicates regression of the HMGCR-associated disease or condition and indicates efficacy of the administered HMGCR dsRNA agent of the invention for treatment of the HMGCR-associated disease or condition.
[0309] In some aspects of the invention, values of one or more of a level of HMGCR polypeptide and / or HMGCR polypeptide activity determined for a subject may serve as control values for later comparison of levels of HMGCR polypeptide and / or HMGCR activity, in that same subject, thus permitting assessment of changes from a “baseline” HMGCR polypeptide activity in a subject. Thus, an initial HMGCR polypeptide level and / or initial HMGCR polypeptide activity level may be present and / or determined in a subject and methods and compounds of the invention may be used to decrease the level of HMGCR polypeptide and / or HMGCR polypeptide activity in the subject, with the initial level serving as a control level for that subject.
[0310] Using methods of the invention, HMGCR dsRNA agents and / or HMGCR antisense polynucleotide agents of the invention may be administered to a subject. Efficacy of the administration and treatment of the invention can be assessed when a level of HMGCR polypeptide in a serum sample obtained from a subject is decreased by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to a pre-administration level of HMGCR polypeptide in a serum sample obtained from the subject at a prior time point, or compared to a non-contacted control level, for example a level of HMGCR polypeptide in a control serum sample. It will be understood that a level of HMGCR polypeptide and a level of HMGCR polypeptide activity both correlate with a level of HMGCR gene expression. Certain embodiments of methods of the invention comprise administering an HMGCR dsRNA and / or HMGCR antisense agent of the invention to a subject in an amount effective to inhibit HMGCR gene expression and thereby reduce a level of HMGCR polypeptide and reduce a level of HMGCR polypeptide activity in the subject.
[0311] Some embodiments of the invention, include determining presence, absence, and / or an amount (also referred to herein as a level) of HMGCR polypeptide in one or more biological samples obtained from one or more subjects. The determination can be used to assess efficacy of a treatment method of the invention. For example, methods and compositions of the invention can be used to determine a level of HMGCR polypeptide in a biological sample obtained from a subject previously treated with administration of an HMGCR dsRNA agent and / or an HMGCR antisense agent of the invention. A level of HMGCR polypeptide determined in a serum sample obtained from the treated subject that is lower by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to a pretreatment level of HMGCR polypeptide determined for the subject, or compared to a non-contacted control biological sample level, indicates a level of efficacy of the treatment administered to the subject.
[0312] In some embodiments of the invention a physiological characteristic of an HMGCR-associated disease or condition determined for a subject can be a control determination against which a determination of the physiological characteristic in the same subject at a different time is compared. In a non-limiting example, a physiological characteristic such as the HMGCR mRNA level, the HMGCR protein level in the subject, or the lipid level, the triglyceride, the cholesterol level in the plasma or the tissue sample is determined in a biological sample, such as a serum sample, obtained from a subject who has not been administered an HMGCR treatment of the invention. The HMGCR mRNA level (and / or other physiological characteristic of an HMGCR disease or condition) determined in the sample obtained from the subject can serve as a baseline or control value for the subject. After one or more administrations of an HMGCR dsRNA agent to the subject in a treatment method of the invention, one or more additional serum samples can be obtained from the subject and HMGCR mRNA level and / or HMGCR protein level in the subsequent sample or samples are compared to the control / baseline level and / or ratio, respectively, for the subject. Such comparisons can be used to assess onset, progression, or recession of an HMGCR associated disease or condition in the subject. For example, HMGCR mRNA level in the baseline sample obtained from the subject that is higher than HMGCR mRNA level determined in a sample obtained from the same subject after the subject has been administered an HMGCR dsRNA agent or HMGCR antisense polynucleotide agent of the invention indicates regression of the HMGCR-associated disease or condition and indicates efficacy of the administered HMGCR dsRNA agent of the invention for treatment of the HMGCR-associated disease or condition.
[0313] In some aspects of the invention, values of one or more of a physiological characteristic of an HMGCR-associcated disease or condition determined for a subject may serve as control values for later comparison of the physiological characteristics in that same subject, thus permitting assessment of changes from a “baseline” physiological characteristic in a subject. Thus, an initial physiological characteristic may be present and / or determined in a subject and methods and compounds of the invention may be used to decrease the level of HMGCR polypeptide and / or HMGCR polypeptide activity in the subject, with the initial physiological characteristic determination serving as a control for that subject.
[0314] Using methods of the invention, HMGCR dsRNA agents and / or HMGCR antisense polynucleotide agents of the invention may be administered to a subject in an effective amount to treat an HMGCR disease or condition. Efficacy of the administration and treatment of the invention can be assessed by determining a change in one or more physiological characteristics of the HMGCR disease or condition. In a non-limiting example, an HMGCR mRNA level in a serum sample obtained from a subject is decreased by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to a pre-administration lipid in a serum sample obtained from the subject at a prior time point, or compared to a non-contacted control level, for example HMGCR mRNA level in a control serum sample. It will be understood that the HMGCR mRNA level, the HMGCR protein level in the subject, or the lipid level, the triglyceride, the cholesterol level in the plasma or the tissue sample each correlates with a level of HMGCR gene expression. Certain embodiments of methods of the invention comprise administering an HMGCR dsRNA and / or HMGCR antisense agent of the invention to a subject in an amount effective to inhibit HMGCR gene expression and thereby reduce the HMGCR mRNA level, the HMGCR protein level in the subject, or otherwise positively impact a physiological characteristic of an HMGCR-assocaited disease or condition in the subject.
[0315] Some embodiments of the invention, include determining presence, absence, and / or a change in a physiological characteristic of an HMGCR-associated disease or condition using methods such as but not limited to: (1) assessing one or more biological samples obtained from one or more subjects for the physiological characteristic; (2) imaging a subject (for example but not limited to obtaining a liver image) ; and (3) or physical examination of the subject. The determination can be used to assess efficacy of a treatment method of the invention.
[0316] Kits
[0317] Also within the scope of the invention are kits that comprise one or more HMGCR dsRNA agents and / or HMGCR antisense polynucleotide agents and instructions for its use in methods of the invention. Kits of the invention may include one or more of an HMGCR dsRNA agent, HMGCR sense polynucleotide, and HMGCR antisense polynucleotide agent that may be used to treat an HMGCR-associated disease or condition. Kits containing one or more HMGCR dsRNA agents, HMGCR sense polynucleotides, and HMGCR antisense polynucleotide agents can be prepared for use in treatment methods of the invention. Components of kits of the invention may be packaged either in aqueous medium or in lyophilized form. A kit of the invention may comprise a carrier being compartmentalized to receive in close confinement therein one or more container means or series of container means such as test tubes, vials, flasks, bottles, syringes, or the like. A first container means or series of container means may contain one or more compounds such as an HMGCR dsRNA agent and / or HMGCR sense or antisense polynucleotide agent. A second container means or series of container means may contain a targeting agent, a labelling agent, a delivery agent, etc. that may be included as a portion of an HMGCR dsRNA agent and / or HMGCR antisense polynucleotide to be administered in an embodiment of a treatment method of the invention.
[0318] A kit of the invention may also include instructions. Instructions typically will be in written form and will provide guidance for carrying-out a treatment embodied by the kit and for making a determination based upon that treatment.
[0319] The following examples are provided to illustrate specific instances of the practice of the present invention and are not intended to limit the scope of the invention. As will be apparent to one of ordinary skill in the art, the present invention will find application in a variety of compositions and methods.
[0320] Examples
[0321] Example 1. Synthesis of HMGCR RNAi Agents.
[0322] HMGCR RNAi agent duplexes shown in Table 2-3, above, were synthesized in accordance with the following general procedures:
[0323] Sense and antisense strand sequences of siRNA were synthesized on oligonucleotide synthesizers using a well-established solid phase synthesis method based on phosphoramidite chemistry. Oligonucleotide chain propagation is achieved through 4-step cycles: a deprotection, a coupling, a capping and an oxidation or a sulfurization step for addition of each nucleotide. Syntheses were performed on a solid support made of controlled pore glass (CPG, ) . Monomer phosphoramidites may be purchased from commercial sources or may be the phosporamidite compounds in WO2016028649. The phosporamidite compounds herein may be attached to the 3'-end of a CPG or polystyrene solid support as a monomeric nucleotide. In the case of attachment at the 5'-end, the phosphoramidite compounds may be used for the final coupling reaction, and can be further conjugated to target ligands if necessary.
[0324] The nucleotides in the chirally-modified dsRNA agent may be made using the general methods for preparing an oligoribonucleotide with solid phase synthesis. The chirally-modified dsRNA agent in a single diastereomeric form can be prepared on the oligonucleotide level or by coupling the diastereomeric form of dinucleotide building blocks.
[0325] When preparing the single diastereomeric form of the chirally-modified dsRNA agent on the dinucleotide building block level, the dsRNA agent may be synthesized according to the general oligonucleotide synthesis method as discussed above. Each of the desirable site specific (e.g., terminal) , chirally-modified internucleotide linkages (e.g., phosphorothioate internucleotide linkages) may be introduced to the dsRNA agent by coupling the corresponding dinucleotide building block containing a chirally-modified internucleotide linkage. Each of the dinucleotide building blocks may be synthesized with incorporating the chirally modified internucleotide linkage (e.g., phosphorothioate internucleotide linkage) between the dinucleotide, e.g., based on the phosphate group synthesis method as discussed above. The resulting epimeric mixture may be separated into individual diastereomers by methods known to one skilled in the art. A chirally pure (or substantially chirally pure) diastereoisomeric form of the chirally-modified RNA agent may then then be prepared by coupling a single diastereoisomeric form of each of the dinucleotide building blocks to the desired locations of the dsRNA agent. The single diastereomeric form of dinucleotide building blocks obtain see, e.g., " Chirality matters: stereo-defined phosphorothioate linkages at the termini of small interfering RNAs improve pharmacology in vivo" , Nucleic Acids Research, 2022, Vol. 50, No. 3, 1221–1240. Oligonucleotides containing chirally pure phosphorothioate linkages were prepared using the method discribed above.
[0326] The phosphoramidites with GalNAc ligand cluster were published in WO2023 / 045995A1 (incorporated herein in its entirety) . The imann residues can be added to the 5' end and / or 3' end of the oligonucleotide chain using imann phosphoramidites by a method well known to those skilled in the art, such as use the inverted abasic residues (invab) method, and / or further added to the target to the GalNAc targeting group. Imann phosphoramidites used herein were published in WO 2024 / 114776 A1 (incorporated herein in its entirety) .
[0327] The sense strands and the antisense strands were synthesis by solid phase synthesis with 4-step cycles, which detailed as below: Trichloroacetic acid (TCA) 3%in dichloromethane or Dichloroacetic acid (DCA) 10%in toluene was used for deprotection of 4, 4′-dimethoxytrityl protecting group (DMT) . 5-Ethylthio-1H-tetrazole was used as an activator in coupling step. Capping with CapA (Acetic Anhydride in Acetonitrile) / CapB (Pyridine / NMI / Acetonitrile) (v / v, 1: 1) . I2 in Py / H2O and phenylacetyl disulfide (PADS) in pyridine / MeCN or Xanthane Hydride (DDTT) in pyridine was used for oxidation and sulfurization reactions, respectively.
[0328] After the final solid phase synthesis step, solid support bound oligomer was cleaved and protecting groups were removed by treating with a 1: 1 volume solution of 40 wt. %methylamine in water and 28%ammonium hydroxide solution. Solid support bound oligomer containing monomer phosphate mimic was treated with MeCN: TMSI: Pyridine=50: 2: 2 (v / v / v) before C&D (cleave and protecting) if necessary. For the synthesis of siRNAs used for in vitro screening, crude mixture was concentrated. The remaining solid was dissolved in 1.0 M NaOAc, and ice cold EtOH was added to precipitate out the single strand product as the sodium salt, which was used for annealing without further purification. For the synthesis of multi-targeted molecules used for in vivo testing, crude single strand product was further purified by ion pairing reversed phase HPLC (IP-RP-HPLC) . Purified single strand oligonucleotide product from IP-RP-HPLC was converted to sodium salt by dissolving in 1.0 M NaOAc and precipitation by addition of ice cold EtOH. Annealing of equimolar complementary sense stand and antisense strand oligonucleotide in water was performed to form the double strand siRNA product, which was lyophilized to afford a fluffy white solid.
[0329] Example 5. In Vitro Screening of HMGCR siRNA Duplexes
[0330] Huh7 cells were trypsinized and adjusted to appropriate density, mixed with the complexes of psiCHECK (TM) -2 Vector plasmid and Lipofectamine 2000 (Invitrogen-11668-019) and seeded into 96-well plates. Cells were transfected with test siRNAs or a control siRNA using Lipofectamine RNAiMax (Invitrogen -13778-150) at the same time of seeding following the protocol according to manufacturer’s recommendation. The siRNAs were tested at different concentrations (0.2 nM and 1 nM, 0.5nM and 5nM) in triplicate.
[0331] Day 1, psiCHECK (TM) -2 Vector transfection (one plate)
[0332] (1) Transfer 2.5μg psiCHECK (TM) -2 Vector plasmid into an RNASE free Eppendorf tube (solution mix#1)
[0333] (2) Add trypsin to disassociate Huh7 cells in one flask, and count cells using Vi-Cell counting machine, adjust the cell density to 1*10^5 / ml
[0334] (3) Transfer 7.5μL Lipofectamine 2000 (Invitrogen-11668-019) into solution mix#1 tube, mix.
[0335] (4) Add solution in Step 3 into cell suspension, mix, and dispense suspension into the 96 well plate (100 μl / well)
[0336] Day 2, siRNAs transfection
[0337] (1) Dilute RNAiMAX Reagent with Medium.
[0338] (2) Dilute the siRNA with RNA-free water to make 12× stock.
[0339] (3) Mix equal volume of diluted RNAiMax and siRNA. Incubate the mixture at RT for 15 min to allow complex formation.
[0340] (4) Add 45μl / well compound RNAiMAX (Opti-MEM) mix into 225μl / well DMEM fresh medium, and discard the supernatants in assay plate, add 120μl / well compound mix into 96 well plates.
[0341] (5) No compound control well was defined as cells transfected with psiCHECK (TM) -2 Vector and without siRNA treatment; blank control was cell only wells.
[0342] Day 3, Luciferase Assay
[0343] (1) Add Reagent to assay plate, wait 10 minutes to allow for cell lysis to occur.
[0344] (2) Transfer 100 μl cell lysates into a plate, then measure the firefly luminescence.
[0345] (3) Add 50μl of Reagent to the assay plates and mix, wait 10 minutes, then measure Renilla luminescence.
[0346] (4) Calculate the relative expression
[0347] Data analysis
[0348] Ratio of sample well= (sample Renilla luminescence-background blank) / (sample Fireflyluminescence-background blank)
[0349] Ratio of no compound control well= (control Renilla luminescence-background blank) / (control sample Fireflyluminescence-background blank)
[0350] %inhibition= 100- (Ratio of sample well / the average Ratio of no compound control) ×100%
[0351] Table 5 provides experimental results of in vitro studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 2.
[0352] Table 6 provides experimental results of in vitro studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 2.
[0353] Table 7 provides experimental results of in vitro studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 2.
[0354] Table 8 provides experimental results of in vitro studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 2.
[0355] Huh7 cells were trypsinized and adjusted to appropriate density seeded into 96-well plates. Cells were transfected with the complexes of HMGCR-psiCHECK (TM) -2 Vector plasmid, blank vector pCNDNA 3.0, siRNAs or a control siRNA using Lipofectamine 2000 (Invitrogen-11668-019) at the next day of seeding following the protocol according to manufacturer’s recommendation. The siRNAs were tested at different concentrations (0.2 nM and 1 nM) in triplicate.
[0356] Day 1, Add trypsin to disassociate Huh7 cells in one flask, and count cells using Vi-Cell counting machine, adjust the cell density to 1*10^5 / ml and culture with DMEM medium.
[0357] Day 2, HMGCR-psiCHECK (TM) -2 Vector / blank vector pCDNA3.0 / siRNAs / Lipofectamine 2000 mixture transfection.
[0358] (1) Mix appropriate Lipofectamine 2000 (Invitrogen-11668-019) with Medium (solution mix#1) . Final equal 0.3 μl Lipofectamine 2000 and Medium 4.7 μl per well.
[0359] (2) Mix appropriate HMGCR-psiCHECK (TM) -2 Vector, blank pCNDNA 3.0 vector and siRNAs with Medium (solution mix#2) .
[0360] (3) Mix equal volume of solution mix#1 and mix#2 (mix#3) , final 10 μl per well. Incubate the mixture at RT for 15 min to allow complex formation.
[0361] (4) Remove DMEM medium, add 10 μl mixed solution mix#3 and 90 μl fresh DMEM medium.
[0362] (5) No compound control well was defined as cells transfected with HMGCR-psiCHECK (TM) -2 Vector and blank vector pCNDNA 3.0 and without siRNA treatment; blank control was cell only wells.
[0363] Day 3, Luciferase Assay
[0364] (1) Add Reagent to assay plate, wait 10 minutes to allow for cell lysis to occur.
[0365] (2) Transfer 100 μl cell lysates into a plate, then measure the firefly luminescence.
[0366] (3) Add 50μl of Reagent to the assay plates and mix, wait 10 minutes, then measure Renilla luminescence.
[0367] (4) Calculate the relative expression
[0368] Data analysis
[0369] Ratio of sample well= (sample Renilla luminescence-background blank) / (sample Fireflyluminescence-background blank)
[0370] Ratio of no compound control well= (control Renilla luminescence-background blank) / (control sample Fireflyluminescence-background blank)
[0371] %inhibition= 100- (Ratio of sample well / the average Ratio of no compound control) ×100%
[0372] Table 9 provides experimental results of in vitro studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 2.
[0373] Table 10 provides experimental results of in vitro studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 2.
[0374] Example 6 In Vivo testing of HMGCR siRNA Duplexes
[0375] At day 1, female C57BL / 6J mice (4 in each group) were infected by intravenous administration of a solution of adeno-associated virus 8 (AAV8) vector encoding 99~3504 (NCBI Reference Sequence: NM_000859.3) human HMGCR fused to luciferase gene. At day 8, mice were subcutaneously administered a single 3 mg / kg of HMGCR siRNA agents or PBS. Blood samples were collected at day 8, before dosing of siRNA, at day 15 and at the terminal day 22. Serum samples were collected, and luciferase activity of serum samples was measured per manufacturer’s recommended protocol. The results are shown in Tables 10.
[0376] Table 10 provides experimental results of in vivo studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 3.
[0377] At day 1, female C57BL / 6J mice (4 in each group) were infected by intravenous administration of a solution of adeno-associated virus 8 (AAV8) vector encoding 99~3504 (NCBI Reference Sequence: NM_000859.3) human HMGCR fused to luciferase gene. At day 8, mice were subcutaneously administered a single 2 mg / kg or a single 1 mg / kg of HMGCR siRNA agents or PBS. Blood samples were collected at day 8, before dosing of siRNA, at day 15 and at the terminal day 22. Serum samples were collected, and luciferase activity of serum samples was measured per manufacturer’s recommended protocol. The results are shown in Tables 11-12.
[0378] Table 11 provides experimental results of in vivo studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 3.
[0379] Table 12 provides experimental results of in vivo studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 3.
[0380] At day 1, female C57BL / 6J mice (4 in each group) were infected by intravenous administration of a solution of adeno-associated virus 8 (AAV8) vector encoding 99~2772 and 2658~4530 (NCBI Reference Sequence: NM_000859.3) human HMGCR fused to luciferase gene . At day 8, mice were subcutaneously administered a single 2 mg / kg or a single 1 mg / kg of HMGCR siRNA agents or PBS. Blood samples were collected at day 8, before dosing of siRNA, at day 15 and at the terminal day 22. Serum samples were collected, and luciferase activity of serum samples was measured per manufacturer’s recommended protocol. The results are shown in Tables 13-24.
[0381] Table 13 provides experimental results of in vivo studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 3.
[0382] Table 14 provides experimental results of in vivo studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 3.
[0383] Table 15 provides experimental results of in vivo studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 3.
[0384] Table 16 provides experimental results of in vivo studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 3.
[0385] Table 17 provides experimental results of in vivo studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 3.
[0386] Table 18 provides experimental results of in vivo studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 3.
[0387] Table 19 provides experimental results of in vivo studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 3.
[0388] Table 20 provides experimental results of in vivo studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 3.
[0389] Table 21 provides experimental results of in vivo studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 3.
[0390] Table 22 provides experimental results of in vivo studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 3.
[0391] Table 23 provides experimental results of in vivo studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 3.
[0392] Table 24 provides experimental results of in vivo studies using various HMGCR RNAi agents to inhibit HMGCR expression. The duplex sequences used correspond to those shown in Table 3.
[0393] Example 7 In Vivo testing of HMGCR siRNA Duplexes
[0394] Cynomolgus monkeys (3-7 years old, 3~7 kg of weights, 3 monkeys in each group) were enrolled in the study. Each monkey was subcutaneously administered a single 5 mg / kg of HMGCR siRNA agents or Saline at day 1 (pre-dosing of siRNA) . After overnight fast, Serum were drawn at day -21 (pre-dose) , day -14 (pre-dose) , day -7 (pre-dose) , 1 (pre-dose) , 8, 15, 22 and 29. PCSK9 protein concentration in serum were measured by ELISA method (PCSK9 ELISA kit, R&D, DPC900) . As is well known in this field, HMGCR inhibition increases the activity / nuclear translocation of sterol regulatory element-binding protein-2 (SREBP-2) , thus activates the expression of its downstream target gene PCSK9 and increases PCSK9 protein levels in circulation (see e.., Welder G et al., J. Lipid Res., 2010.51: 2714-2721) . Tables 25-26 provides serum PCSK9 protein concentration as results of in vivo HMGCR mRNA knockdown in liver.
[0395] Table 25 provides experimental results of in vivo studies using various HMGCR RNAi agents to increase serum PCSK9 protein. The duplex sequences used correspond to those shown in Table 3.
[0396] Table 26 provides experimental results of in vivo studies using various HMGCR RNAi agents to increase serum PCSK9 protein. The duplex sequences used correspond to those shown in Table 3.
[0397] Example 8 In Vivo testing of HMGCR siRNA Duplexes of the invention combined with a PCSK9 inhibitor
[0398] Cynomolgus monkeys (3-7 years old, 3~7 kg of weights, 4 monkeys in each group) were enrolled in the study, the dosing of the study as shown in Table 27. After overnight fast, Serum were drawn at day -28 (pre-dose) , day -21 (pre-dose) , day -14 (pre-dose) , day -7 (pre-dose) , 1 (pre-dose) , 8, 15, 22, 29, 36 and 43. PCSK9 protein concentration in serum were measured by ELISA method (PCSK9 ELISA kit, R&D, DPC900) . Triglyceride (TG)...
Claims
1.A combination comprising a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) ; and one or more non-HMGCR dsRNA therapeutic agents;wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: l and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 2, wherein the sense strand and the antisense strand can be partially, substantially, or fully complementary to each other.wherein the non-HMGCR dsRNA therapeutic agent is one of more of: a statin, a bile sequestering agent, a VLDL secretion inhibitor, a lipophilic antioxidant, an acyl-CoA cholesterol acyl transferase inhibitor, a PCSK9 inhibitor, a farnesoid X receptor antagonist, a sterol regulatory binding protein cleavage activating protein (SCAP) activator, a microsomal triglyceride transfer protein (MTP) inhibitor, an ApoE-related peptide, a cholesteryl ester transfer protein (CETP) inhibitor, a therapeutic antibody against HMGCR, and a combination of any of the foregoing.2.The combination of claim 1, wherein said antisense strand comprises a region of complementarity to an mRNA encoding HMGCR which comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from any one of the antisense sequences listed in any one of Tables 1-3.3.The combination of claim 1, wherein said antisense strand comprises a region of complementarity to an mRNA encoding HMGCR which comprises at least 15 contiguous nucleotides from any one of the antisense sequences listed in any one of Tables 1-3.4.The combination of claim 3, wherein the sense strand sequence is at least substantially complementary to or fully complementary to the antisense strand sequence in the dsRNA agent, preferably, wherein the dsRNA agent comprises a sense strand sequence set forth in any one of Tables 1-3.5.The combination of any one of claims 1-4, wherein the dsRNA agent comprises at least one modified nucleotide.6.The combination of any one of claims 1-5, wherein all or substantially all of the nucleotides of the sense strand and / or the antisense strand are modified nucleotides.7.The combination of claim 6, wherein the one or more modified nucleotides are independently selected from the group consisting of: a 2’ -O-methyl nucleotide, a 2’ -Fluoro nucleotide, a 2’ -deoxy nucleotide, a 2’ 3’ -seco nucleotide mimic, a locked nucleotide, an unlocked nucleic acid nucleotide (UNA) , a glycol nucleic acid nucleotide (GNA) , a 2’ -F-Arabino nucleotide, a 2’ -methoyxyethyl nucleotide, an abasic nucleotide, an ribitol, inverted nucleotide, an inverted abasic nucleotide, an isomannide nucleotide, an inverted 2’ -Ome nucleotide, an inverted 2’ -deoxy nucleotide, a 2’ -amino-modified nucleotide, a 2’ -alkyl-modified nucleotide, a mopholino nucleotide, a 3’ -OMe nucleotide, a nucleotide comprising a 5’-phosphorothioate group, a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a 2’ -amino-modified nucleotide, a phosphoramidate, or a non-natural base comprising nucleotide.8.The combination of any one of claims 6-7, comprises an E-vinylphosphonate nucleotide at the 5′ end of the guide strand.9.The combination of any one of claims 6-8, wherein the dsRNA agent comprises at least one modified nucleotide and further comprises one or more targeting groups or linking groups.10.The combination of claim 9, wherein the one or more targeting groups or linking groups are conjugated to the sense strand, preferably, the one or more targeting groups or linking groups are conjugated to 5’ -end of the sense strand.11.The combination of claim 9 or 10, wherein the targeting group or linking group comprises N-acetyl-galactosamine (GalNAc) .12.The combination of any one of claims 9-11, wherein the targeting group has a structure: 13.The combination of any one of claims 1-12, wherein the sense strand and / or the antisense strand comprises one or two inverted abasic residues or imann residues at 3’ or / and 5’ terminal end.14.The combination of any one of claims 1-13, wherein the sense strand comprises one inverted abasic residue at 3’ -terminal end.15.The combination of any one of claims 1-14, wherein the dsRNA agent has two blunt ends.16.The combination of any one of claims 1-15, wherein at least one strand comprises a 3’ overhang of at least 1 or 2 nucleotides.17.The combination of any one of claims 1-16, wherein the dsRNA agent comprises at least one phosphorothioate internucleoside linkage.18.The combination of any one of claims 1-16, wherein the sense strand comprises at least one phosphorothioate internucleoside linkage, preferably, the at least one phosphorothioate (PS) linkage is introduced at the 5’ -end, 3’ -end or both ends of the sense strand.19.The combination of any one of claims 1-16, wherein the antisense strand comprises at least one phosphorothioate internucleoside linkage, preferably, the at least one phosphorothioate (PS) linkage is introduced at the 5’ -end, 3’ -end or both ends of the antisense strand.20.The combination of any one of claims 1-19, wherein the sense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages, preferably, the 1, 2, 3, 4, 5, or 6 phosphorothioate (PS) linkages are introduced at the 5’ -end, 3’ -end or both ends of the sense strand.21.The combination of any one of claims 1-19, wherein the antisense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages, preferably, the 1, 2, 3, 4, 5, or 6 phosphorothioate (PS) linkages are introduced at the 5’ -end, 3’ -end or both ends of the antisense strand.22.The combination of any one of claims 1-21, wherein the at least one phosphorothioate (PS) linkage is a chirally modified phosphorothioate (PS) linkage.23.The combination of any one of claims 1-22, wherein the first linkage counting from the 5'-end of antisense strand is a chirally modified phosphorothioate linkage, and the phosphorus of the phosphorothioate internucleotide linkage is in Rp configuration.24.The combination of any one of claims 1-23, wherein the first linkage counting from the 5'-end of antisense strand is a chirally modified phosphorothioate linkage, wherein the phosphorus of the phosphorothioate internucleotide linkage is in Rp configuration, and the first linkage counting from the 3'-end of antisense strand is achiral or racemic.25.The combination of any one of claims 1-24, wherein only the first linkage counting from the 5'-end of antisense strand is a chirally modified phosphorothioate linkage, wherein the phosphorus of the phosphorothioate internucleotide linkage is in Rp configuration, and the rest linkages of the antisense strand and the sense strand are achiral or racemic.26.The combination of any one of claims 1-25, wherein the sense strand sequence of the dsRNA agent is represented by formula (I) :5′- (N′L) n′N′LN′L N′N1 N′N2 N′N3 N′N4 N′L N′F N′L N′N5N′N6 N′L N′L N′L (N′L) m′-3′ (I)wherein:each strand is about 15 to about 30 nucleotides in length;each N′F represents a 2'-fluoro-modified nucleotide;each N′N1, N′N2, N′N3, N′N4, N′N5, and N′N6 independently represents a modified or unmodified nucleotide;each N′L independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide;and m′and n′are each independently an integer of 0 to 7.27.The combination of any one of claims 1-25, wherein the antisense strand sequence of the dsRNA agent is represented by formula (II) :3′- (NL) n NM1 NL NM2 NL NF NL NM3 NL NM4 NL NM5 NM6 NL NM7 NM8 NL NF NL-5′ (II)wherein:each strand is about 18 to about 30 nucleotides in length;each NF represents a 2'-fluoro-modified nucleotide;each NM1, NM2, NM3, NM4, NM5, NM6, NM7 and NM8 independently represents a modified or unmodified nucleotide;each NL independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide;and n is an integer of 0 to 7.28.The combination of any one of claims 1-25, wherein the sense strand is represented by formula (Ia) :5’- (Nd’ ) p’ (Nr’ ) q’ (Nx21) o’ Nx20Nx19Nx18Nx17Nx16Nx15Nx14Nx13Nx12Nx11Nx10Nx9Nx8Nx7Nx6Nx5Nx4Nx3Nx2 (Nx1) o (Nr) p (Nd) q-3’ (Ia)wherein,the sense strand is about 19 to about 30 nucleotides in length;each o, p, q, o’ , p’ , q’ independently represents 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;each Nx9, Nx11 and Nx13 independently represents a 2'-fluoro-modified nucleotide, preferably, Nx9, Nx11 and Nx13 are all 2'-fluoro-modified nucleotides;each Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2, Nx1 independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, preferably, each Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2, Nx1 independently represents the modified nucleotide defined aforesaid, and more preferably, each Nx21, Nx20, Nx19, Nx18, Nx17, Nx16, Nx15, Nx14, Nx12, Nx10, Nx8, Nx7, Nx6, Nx5, Nx4, Nx3, Nx2, Nx1 independently represents a 2’ -O-methyl modified nucleotide;each Nr or Nr’ independently represents an inverted abasic residue or an imann residue;each Nd or Nd’ independently represents a targeting group is independently selected from a GalNAc-containing compound of any one of compounds GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16;each linkage in the backbone is independently a phosphodiester (PO) linkage or a phosphorothioate (PS) linkage, preferably, at least one linkage in the backbone is a phosphorothioate (PS) linkage, more preferably, at least one linkage in the backbone is a chirally modified phosphorothioate linkage, more preferably, at least one linkage in the backbone is a phosphorothioate linkage in Rp configuration.29.The combination of any one of claims 1-25, wherein the antisense strand is represented by formula (IIa) :3’- (Nk’ ) s’ (Nj’ ) t’ (Ny21) v’ Ny20Ny19Ny18Ny17Ny16Ny15Ny14Ny13Ny12Ny11Ny10Ny9Ny8Ny7Ny6Ny5N y4Ny3Ny2 (Ny1) v (Nj) s (Nk) t-5’ (IIa)wherein,the antisense strand is about 19 to about 30 nucleotides in length;each v, s, t, s’ , t’ , v’ independently represents 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;each Ny2, Ny5, Ny7, Ny12, Ny14 and Ny16 independently represents a 2'-fluoro-modified nucleotide or a UNA modified nucleotide;each Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1 independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, preferably, each Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1 independently represents the modified nucleotide defined aforesaid, and more preferably, each Ny21, Ny20, Ny19, Ny18, Ny17, Ny15, Ny13, Ny11, Ny10, Ny9, Ny8, Ny6, Ny4, Ny3, Ny1 independently represents a 2’ -O-methyl modified nucleotide;each Nj or Nj’ independently represents an inverted abasic residue or an imann residue;each Nk or Nk’ independently represents a targeting group is independently selected from a GalNAc-containing compound of any one of compounds GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16;each linkage in the backbone is independently a phosphodiester (PO) linkage or a phosphorothioate (PS) linkage, preferably, at least one linkage in the backbone is a phosphorothioate (PS) linkage, more preferably, at least one linkage in the backbone is a chirally modified phosphorothioate linkage, more preferably, at least one linkage in the backbone is a phosphorothioate linkage in Rp configuration.30.The combination of any one of claims 26-29, wherein the dsRNA agent is a duplex formed by the sense strand sequence represented by formula (I) and the antisense strand sequence represented by formula (II) ; or a duplex formed by the sense strand sequence represented by formula (Ia) and the antisense strand sequence represented by formula (IIa) .31.The combination of any one of claims 1-30, wherein the modified sense strand is a modified sense strand sequence set forth in one of Tables 2-3.32.The combination of any one of claims 1-30, wherein the modified antisense strand is a modified antisense strand sequence set forth in one of Tables 2-3.33.The combination of any one of claims 1-32, wherein the dsRNA agent comprises the sequences set forth as a duplex sequence in any of Tables 1-3.34.The combination of any one of claims 1-33, wherein the non-HMGCR dsRNA therapeutic agent is a PCSK9 inhibitor, optionally, the PCSK9 inhibitor is an anti-PCSK9 monoclonal antibody, optionally, the PCSK9 inhibitor is a PCSK9 siRNA, optionally, the PCSK9 inhibitor is a PCSK9 small-molecule compound.35.The combination of any one of claims 1-34, wherein the non-HMGCR dsRNA therapeutic agent is alirocumab and / or evolocumab.36.The combination of any one of claims 1-34, wherein the non-HMGCR dsRNA therapeutic agent is inclisiran.37.The combination of any one of claims 1-36, wherein the dsRNA agent is AD02059-1, and the non-HMGCR dsRNA therapeutic agent is AD00738.38.A composition comprising the combination of any one of claims 1-37, wherein further comprising a pharmaceutically acceptable carrier.39.The composition of claim 38, wherein the composition is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial.40.The composition of any one of claims 38-39, wherein the composition is formulated for subcutaneous administration or is formulated for intravenous (IV) administration.41.A method of decreasing one or more of cholesteryl ester (CE) levels, triglyceride levels, cholesterol levels (such as high-density lipoprotein cholesterol (HDL-C) , intermediate-density lipoprotein cholesterol (IDL-C) , low-density lipoprotein cholesterol (LDL-C) level, very-low-density lipoprotein cholesterol (VLDL-C) level) , Apolipoprotein B (ApoB) and other lipid levels in blood or serum, comprising administering an effective amount of the combination of any one of claims 1-37 or the composition of any one of claims 38-40.42.A method of treating one or more diseases or conditions in a subject in need thereof comprising administering to the subject an effective amount of the combination of any one of claims 1-37 or the composition of any one of claims 38-40,wherein, the one or more diseases or conditions are selected from the group consist of hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, mixed hyperlipidemia, congestive heart disease (CHD) and atherosclerosis, atherosclerosis, dyslipidemia, acute pancreatitis associated with hypertriglyceridemia, chylomicron syndrom, familial chylomicronemia, Apo-E deficiency or resistance, LPL deficiency or hypoactivity, familial partial lipodystrophy type 1 (FPLD1) , polycystic ovarian syndrome related to insulin resistance, renal transplantation, nephrotic syndrome, Cushing's syndrome, acromegaly, systemic lupus erythematosus, dysglobulinemia, lipodystrophy, glycogenosis type I, and Addison's disease, or other disorders of lipid metabolism.43.The method of claim 41 or 42, wherein the combination or the composition is administered to the subject subcutaneously.44.The method of claim 41 or 42, wherein the combination or the composition is administered to the subject by IV administration.45.The method of any one of claims 41-44, the HMGCR dsRNA agent and the non-HMGCR dsRNA therapeutic agents is administered to the subject sequentially or simultaneously.