Lipoprotein a lowering therapy
Combining Lp(a) inhibitor pelacarsen with PCSK9 inhibitor inclisiran effectively lowers both Lp(a) and LDL-C levels, addressing the dual risk factors for atherosclerotic cardiovascular disease.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- NOVARTIS AG
- Filing Date
- 2025-12-18
- Publication Date
- 2026-06-25
Smart Images

Figure IB2025063174_25062026_PF_FP_ABST
Abstract
Description
PAT059441-PCT-SEC01LIPOPROTEIN A LOWERING THERAPY1. RELATED APPLICATION
[0001] This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 736,727 filed December 20, 2024, the entire contents of which is incorporated herein by reference in its entirety.2. SEQUENCE LISTING
[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled PAT059941-PCT-SEC01_SL.xml created December 14, 2025, which is 24 kilobytes in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.3. FIELD OF INVENTION
[0003] The disclosure generally relates to lipoprotein A (“Lp(a)”) inhibitors for use in treating subjects in need of Lp(a) lowering therapy, for example subjects having elevated Lp(a) and atherosclerotic cardiovascular disease and receiving PCSK9 therapy for elevated low- density lipoprotein associated cholesterol (“LDL-C”).4. BACKGROUND
[0004] Cardiovascular disease (CVD) is the leading cause of death worldwide, resulting in approximately 19.1 million deaths in 2020 (Tsao et al., 2022, Circulation 145(8):e153-e639). Eighty percent of all CVD deaths are due to coronary heart disease (CHD) or cerebrovascular stroke. Dyslipidemia is a major modifiable risk factor for CVD, wherein low- density lipoprotein (LDL) is most commonly implicated (Ference et al., 2017, Eur Heart J: 38(32):2459-72.
[0005] Elevated low-density lipoprotein associated cholesterol (“LDL-C”) plays a vital role in the development and progression of CVD and the causal link between high LDL-C and ASCVD events is well-known (Di Angelantonio et al., 2012, JAMA 307(23):2499-2506;Boren et al., 2020, Eur Heart J 41 (24) :2313-30). Lowering LDL-C has been shown to reduce the risk of death or heart attack and within the range of effects achieved so far, the clinical risk reduction is linearly proportional to the absolute LDL-C reduction (Spence & Koschinsky, 2012, Arterioscler Thromb Vase Biol 32(7): 1550-1 ; Koschinsky et al., 2024, J Clin Lipidol 18(3):e308-e319).PAT059941-PCT-SEC01
[0006] Lipoprotein(a) (“Lp(a)”) is another atherogenic lipoprotein in which the apolipoprotein B-100 (apoB-100) component of low-density lipoprotein (LDL) is linked by a disulfide bond to apolipoprotein(a) (apo(a)), the distinct protein component of Lp(a) that is mainly responsible for its signature structural and functional properties (Dube et al., 2012, Curr Opin Lipidol 23(2):133-40; Kronenberg & Utermann , 2013, J Intern Med; 273(1):6-30). Lp(a) adheres to plaque sites and has proatherogenic and pro-inflammatory properties due to its LDL and apo(a) components (Spence & Koschinsky, 2012, Arterioscler Thromb Vase Biol 32(7):1550- 1). In addition, Lp(a) may be pro-thrombotic given high homology between apo(a) and plasminogen and hypothetically mediated via impaired fibrinolysis based on in vitro data (Marston et al., 2020, Circulation 141 (20):1600-07).
[0007] Elevated Lp(a) levels in humans are associated with increased risk of cardiac death, myocardial infarction, stroke, aortic valve stenosis, and peripheral arterial disease, as evidenced by epidemiological and genetic studies (Erqou et al., 2009, JAMA 302(4):412-23; Kamstrup et al., 2009, JAMA 301 (22):2331-9; Erqou et al., 2010, J Am Coll Cardiol 55(19):2160-7; Bertoia et al., 2013, J Am Coll Cardiol 61 (21):2169-79; Thanassoulis et al., 2013, N Engl J Med; 368 (6): 503- 12). Lp(a) is recognized as an independent, genetic, causal risk factor for these diseases by leading medical societies such as European Atherosclerosis Society (EAS) (Kronenberg et al., 2022, Eur Heart J 43(39):3925-46), American Heart Association (AHA) (Reyes-Soffer, 2021 , Curr Opin Lipidol 32(3): 163-66), and the National Lipid Association (NLA) (Koschinsky et al., 2024, J Clin Lipidol 18(3):e308-e319).Importantly, the role of Lp(a) on cardiovascular events has been shown to be independent of LDL-C levels (Reyes-Soffer, 2021 , Curr Opin Lipidol 32(3):163-66; Kronenberg et al., 2022, Eur Heart J 43(39):3925-46).
[0008] There is a notable percentage of CVD patients who present with both risk factors, elevated LDL-C and elevated Lp(a), in clinical practice. This overlap of elevated LDL-C and Lp(a) was also seen in the recent cardiovascular trials such as FOURIER and ODYSSEY Outcomes (O’Donoghue et al., 2019, Circulation 139(12):1483-92; Szarek et al., 2020, Eur Heart J; 41 (44):4245-55; Bittner et al., 2020, J Am Coll Cardiol 75 (2): 133-44). Patients in both trials had entry LDL-C levels >70 mg / dL. More than 25% of the trial population had elevated Lp(a) (Lp(a) 4thquartile cutoffs: FOURIER: Lp(a) >165 nmol / L; ODYSSEY outcomes: >59.6 mg / dL).
[0009] There remains a need for treatments for subjects having both elevated Lp(a) and elevated LDL-C.PAT059941-PCT-SEC015. SUMMARY
[0010] This disclosure relates to treatment of subjects in need of Lp(a) lowering therapy, for example subjects having elevated Lp(a), elevated LDL-C, and atherosclerotic cardiovascular disease.
[0011] Accordingly, in one aspect, the disclosure provides methods of treating a subject in need of Lp(a) lowering therapy and who is receiving or who is to receive PCSK9 inhibitor (e.g., inclisiran) therapy, comprising administering a therapeutically effective amount of an Lp(a) inhibitor (e.g., pelacarsen) to the subject.
[0012] In another aspect, the disclosure provides methods of treating a subject having elevated Lp(a) and who is receiving or who is to receive PCSK9 inhibitor (e.g., inclisiran) therapy for elevated LDL-C, comprising administering a therapeutically effective amount of an Lp(a) inhibitor (e.g., pelacarsen) to the subject.
[0013] In another aspect, the disclosure provides methods of treating a subject in need of Lp(a) lowering therapy and LDL-C lowering therapy, comprising administering to the subject a therapeutically effective amount of an Lp(a) inhibitor (e.g., pelacarsen) and a therapeutically effective amount of a PCSK9 inhibitor (e.g., inclisiran).
[0014] In another aspect, the disclosure provides methods of treating a subject having elevated Lp(a) and elevated LDL-C, comprising administering to the subject a therapeutically effective amount of an Lp(a) inhibitor (e.g., pelacarsen) and a therapeutically effective amount of a proprotein convertase PCSK9 inhibitor (e.g., inclisiran).
[0015] In yet another aspect, the disclosure provides Lp(a) inhibitors (e.g., pelacarsen) for use in the methods of the disclosure.
[0016] In yet another aspect, the disclosure provides PCSK9 inhibitors (e.g., inclisiran) for use in the methods of the disclosure.
[0017] In yet another aspect, the disclosure provides a combination comprising pelacarsen and inclisiran. The combination can be used, for example, in a method of the disclosure.
[0018] Exemplary Lp(a) inhibitors are described in Section 5.2 and specific embodiments 8, 9, 19, 45, 46, and 56 infra.
[0019] Exemplary PCSK9 inhibitors are described in Section 5.3 and specific embodiments 17 to 19, 54 to 56 , infra.
[0020] Exemplary subjects who can be treated by the methods of the disclosure are described in Section 5.4 and specific embodiments 1 to 4, 29 to 32, 35 to 40, 66 to 72, and 74 to 141 , infra.PAT059941-PCT-SEC01
[0021] Exemplary treatment regimens for Lp(a) inhibitors and PCSK9 inhibitors and features thereof that can be included in the methods of the disclosure are described in Section 5.5 and specific embodiments 5 to 7, 10 to 16, 20 to 28, 33, 34, 41 to 44, 47 to 53, 57 to 65, and 73, / nfra.6. BRIEF DESCRIPTION OF THE FIGURES
[0022] FIG. 1 shows the design of the study of Example 1 .7. DETAILED DESCRIPTION7.1. Definitions
[0001] As used herein, the following terms are intended to have the following meanings:
[0002] A, An, The: As used herein, the term "a", "an", "the" and similar terms used in the context of the present disclosure (especially in the context of the claims) are to be construed to cover both the singular and plural unless otherwise indicated herein or clearly contradicted by the context. As such, the terms "a" (or "an"), "one or more", and "at least one" can be used interchangeably herein.
[0003] And / or: The term "and / or" means that each one or both or all the components or features of a list are possible variants, especially two or more thereof in an alternative or cumulative way.
[0004] Or: Unless indicated otherwise, an “or” conjunction is intended to be used in its correct sense as a Boolean logical operator, encompassing both the selection of features in the alternative (A or B, where the selection of A is mutually exclusive from B) and the selection of features in conjunction (A or B, where both A and B are selected). In some places in the text, the term “and / or” is used for the same purpose, which shall not be construed to imply that “or” is used with reference to mutually exclusive alternatives.
[0005] Agent: As used herein, “agent” means an active substance that can provide a therapeutic benefit when administered to a subject. Exemplary agents include antisense agents (e.g., antisense oligonucleotides) such as pelacarsen and RNAi agents (e.g., small interfering RNA (siRNA)) such as inclisiran.
[0006] Combination: The term “combination” refers to a set of two or more individual therapeutic agents. The terms “a combination” or “in combination with” is not intended to imply that the therapy or the therapeutic agents must be administered at the same time and / or formulated for delivery together, although these methods of delivery are within the scope described herein. The therapeutic agents in the combination can be administeredPAT059941-PCT-SEC01 concurrently with, prior to, or after, one or more other additional therapies or therapeutic agents. The therapeutic agents or therapeutic protocol can be administered in any order. In general, each agent will be administered at a dose and / or on a time schedule determined for that agent. It will further be appreciated that the additional therapeutic agent utilized in a combination may be administered together or separately in different compositions. In general, it is expected that additional therapeutic agents utilized in combination be utilized at levels that do not exceed the levels at which they are utilized individually.
[0007] Effective amount: By the term "effective amount" or "therapeutically effective amount" or "pharmaceutically effective amount", is meant the amount or quantity of active agent (or combination of agents) that is sufficient to elicit the required or desired response, or in other words, the amount that is sufficient to elicit an appreciable biological response when administered to a subject. Said amount preferably relates to an amount that is therapeutically or in a broader sense also prophylactically effective against the progression of a disease or disorder as disclosed herein. It is understood that an “effective amount" or a “therapeutically effective amount" can vary from subject to subject, due to variation in metabolism of an agent, age, weight, general condition of the subject, the condition being treated, the severity of the condition being treated, and the judgment of the prescribing physician.
[0008] Elevated: As used herein a subject having “elevated Lp(a)” refers to a subject having a serum or plasma Lp(a) level that is higher than an optimal level for a person of the same age and having the same medical history as the subject. In some embodiments, an elevated Lp(a) level (e.g., for a subject having ASCVD) is > 75 nmol / L. In some embodiments, an elevated Lp(a) level (e.g., for a subject having ASCVD) is > 30 mg / dL. Similarly, a subject having “elevated LDL-C” refers to a subject having a serum or plasma LDL-C level that is higher than an optimal level for a person of the same age and having the same medical history as the subject. In some embodiments, an elevated LDL-C level (e.g., for a subject having ASCVD) is > 70 mg / dL. In some embodiments, an elevated LDL-C level (e.g., for a subject having ASCVD) is >1 .8 mmol / L.
[0009] Lipid-lowering therapy: As used herein, “lipid-lowering therapy” or “lipid lowering agent” means a therapeutic regimen provided to a subject to reduce one or more lipids in a subject. In certain embodiments, a lipid-lowering therapy is provided to reduce one or more of apo(a), CETP, apoB, total cholesterol, LDL-C, VLDL-C, IDL-C, non-HDL-C, triglycerides, small dense LDL particles, and Lp(a) in a subject. Examples of lipid-lowering therapy include, but are not limited to, apoB inhibitors, statins, fibrates and MTP inhibitors.PAT059941-PCT-SEC01
[0010] Patient / subject: As used herein, the term "patient" or "subject" are taken to mean a human. Except when noted, the terms “patient” or “subject” are used herein interchangeably.
[0023] Treat, treating, treatment: As used herein, the term “treat”, “treating" or "treatment" of any disease, disorder, or condition refers in one embodiment to ameliorating the disease, disorder, or condition (e.g., slowing or arresting or reducing the development of the disease or at least one of the clinical symptoms or pathological features thereof). In another embodiment “treat”, "treating" or "treatment" refers to alleviating or ameliorating at least one physical parameter or pathological features of the disease, disorder, or condition, e.g., including those, which may not be discernible by the subject. In yet another embodiment, “treat”, "treating" or "treatment" refers to modulating the disease, disorder, or condition, either physically, (e.g., stabilization of at least one discernible or non-discernible symptom), physiologically (e.g., stabilization of a physical parameter) or both. In yet another embodiment, “treat”, "treating" or "treatment" refers to preventing or delaying the onset or development or progression of the disease, disorder, or condition or of at least one symptoms or pathological features associated thereof. In yet another embodiment, “treat”, "treating" or "treatment" refers to preventing or delaying progression of the disease, disorder, or condition to a more advanced stage or a more serious condition. The benefit to a patient to be treated is either statistically significant or at least perceptible to the patient or to the physician.
[0024] Unit dose: As used herein, the term “unit dose” refers to the specific amount of an agent administered to a subject at a particular time point (e.g. the specific amount of an administered to a subject in a single subcutaneous injection). Each unit dose can form part of a multi-dose administration regimen.
[0025] Unit dosage form: As used herein, the term “unit dosage form” denotes the physical form in which each unit dose is presented for administration.
[0026] Abbreviations used in this disclosure are provided in Table 1 .PAT059941-PCT-SEC01PAT059941-PCT-SEC017.2. Lp(a) inhibitors
[0027] Lp(a) inhibitors are known and include, for example, antisense agents (WO 2014 / 179625; WO 2017 / 079739; WO 2005 / 000201 ; WO 2003 / 014397; WO2013 / 177468;US 2004 / 0242516; U.S. Patent Nos. 8,138,328, 8,673,632 and 7,259,150; Merki et al., 2011 , J Am Coll Cardiol 57:1611-1621 , the contents of each of which are incorporated herein by reference in their entireties) and ribozyme oligonucleotides (U.S. Patent 5,877,022, the contents of which are incorporated herein by reference in their entireties).
[0028] In some embodiments, the Lp(a) inhibitor comprises an antisense agent. An exemplary antisense agent is pelacarsen, also known as ISIS 681257. Pelacarsen is described in WO 2014 / 179625 and WO 2017 / 079739. Pelacarsen has the following structure, which includes salts thereof:PAT059941-PCT-SEC01
[0029] Pictured below is an example of pelacarsen in salt form:PAT059941-PCT-SEC01
[0030] Pelacarsen comprises a modified oligonucleotide having the nucleobase sequence TGCTCCGTTGGTGCTTGTTC (SEQ ID NO.: 1), a 5-10-5 gapmer motif, and a GalNAc conjugate.
[0031] Unless required otherwise by context, the term “pelacarsen” encompasses the base and pharmaceutically acceptable salt forms of the compound (e.g., sodium salt). Thus, for example, a method of the disclosure comprising administering pelacarsen to a subject encompasses administering pelacarsen in base form and administering pelacarsen in pharmaceutically acceptable salt form. When a mass of pelacarsen is provided, e.g., 80 mg,PAT059941-PCT-SEC01 the provided value refers to the mass of the base form of pelacarsen without regard to the weight of any counterion(s) that may be present, unless required otherwise by context.7.3. PCSK9 inhibitors
[0032] PCSK9 inhibitors are known and include, for example RNAi agents (WO 2024 / 182580; U.S. Patent No. 8,809,292; and U.S. Patent No. 10,851 ,377, the contents of each of which are incorporated herein by reference in their entireties) and antibodies (e.g., evolocumab and alirocumab).
[0033] In some embodiments, the PCSK9 inhibitor comprises the RNAi agent inclisiran.I nclisiran is a double-stranded small interfering ribonucleic acid (siRNA), conjugated on the sense strand with triantennary N-Acetylgalactosamine (GalNAc) to facilitate uptake by hepatocytes. In hepatocytes, inclisiran utilizes the RNA interference mechanism and directs catalytic breakdown of mRNA for PCSK9. This increases LDL-C receptor recycling and expression on the hepatocyte cell surface, which increases LDL-C uptake and lowers LDL-C levels in the circulation. Inclisiran comprises: an antisense strand consisting of the nucleotide sequence of5’- asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa - 3’ (SEQ ID NO:2), and a sense strand consisting of the nucleotide sequence of5’- csusagacCfuGfudTuugcuuuugu - 3’ (SEQ ID NO:3) and a ligand, wherein the ligand is conjugated to the 3’-end of the nucleotide sequence of the sense strand as shown in the following schematicPAT059941-PCT-SEC01 wherein a, c, g, and u are 2'-O-methyl (2'-OMe) A, C, G, and U, respectively; Af, Cf, Gf, and Uf are 2'-fluoro A, C, G, and U, respectively; s is a phosphorothioate linkage; dT is 2'- deoxythymidine; and X is O.
[0034] Inclisiran is depicted on pages 504-506 of Recommended INN: List 76 from the WHO Drug Information, Vol. 30, No. 3, 2016, which is incorporated by reference.
[0035] Inclisiran is further described on pages 20-24 of WO 2024 / 161368, the contents of which are incorporated herein by reference in their entireties.
[0036] Unless required otherwise by context, the term “inclisiran” encompasses base and pharmaceutically acceptable salt forms of the double-stranded compound (e.g., sodium salt). Thus, for example, a method of the disclosure comprising administering inclisiran to a subject encompasses administering inclisiran in base form and administering inclisiran in pharmaceutically acceptable salt form. When a mass of inclisiran is provided, e.g., 284 mg, the provided value refers to the mass of the base form of inclisiran without regard to the weight of any counterion(s) that may be present, unless required otherwise by context. For example, a commercially available formulation of inclisiran that can be used in the methods of the disclosure, LEQVIO®, contains 300 mg of inclisiran sodium salt in a 1.5 mL solution, equivalent to 284 mg of inclisiran in base form. Thus, the formulation can be said to contain 284 mg of inclisiran.7.4. Subject Populations
[0037] Lp(a) inhibitors of the disclosure, e.g., pelacarsen, can be administered to subjects in need of Lp(a) lowering therapy, for example subjects having elevated Lp(a) or otherwise in need of Lp(a) lowering therapy (e.g., as determined by a medical practitioner). Subjects with elevated Lp(a) commonly also have elevated LDL-C and, therefore, the subject can be one who is receiving or who is to receive PCSK9 inhibitor therapy (e.g., with inclisiran) for elevated LDL-C. For example, the subject can be already receiving PCSK9 inhibitor therapy prior to being treated with an Lp(a) inhibitor. Alternatively, the PCSK9 inhibitor therapy can be initiated concurrently with or even after initiation of treatment with the Lp(a) inhibitor.
[0038] In some embodiments, the subject has a plasma or serum Lp(a) level > 75 nmol / L prior to administration of the Lp(a) inhibitor (e.g., pelacarsen). In some embodiments, the subject has a plasma or serum Lp(a) level > 100 nmol / L prior to administration of the Lp(a) inhibitor. In some embodiments, the subject has a plasma or serum Lp(a) level > 125 nmol / L prior to administration of the Lp(a) inhibitor. In some embodiments, the subject has a plasma or serum Lp(a) level > 175 nmol / L prior to administration of the Lp(a) inhibitor. In some embodiments, the subject has a plasma or serum Lp(a) level > 30 mg / dL prior toPAT059941-PCT-SEC01 administration of the Lp(a) inhibitor. In some embodiments, the subject has a plasma or serum Lp(a) level > 50 mg / dL prior to administration of the Lp(a) inhibitor. In some embodiments, the Lp(a) level is a plasma Lp(a) level. In other embodiments, the Lp(a) level is a serum Lp(a) level. Standard laboratory tests can be used to evaluate a subject’s Lp(a) level (e.g., Quest Diagnostics test code 34604; Labcorp test code 120188). A subject’s Lp(a) level can be measured in a fasted or non-fasted state. In some embodiments, a subject’s Lp(a) level is measured in a fasted stated. In other embodiments, a subject’s Lp(a) level is measured in a non-fasted state.
[0039] In some embodiment, the subject has a plasma or serum LDL-C level > 70 mg / dL prior to receiving the PCSK9 inhibitor therapy. In some embodiment, the subject the subject has a plasma or serum LDL-C level > 100 mg / dL prior to receiving the PCSK9 inhibitor therapy. In some embodiment, the subject the subject has a plasma or serum LDL-C level > 130 mg / dL prior to receiving the PCSK9 inhibitor therapy. In some embodiment, the subject the subject has a plasma or serum LDL-C level > 160 mg / dL prior to receiving the PCSK9 inhibitor therapy. In some embodiment, the subject the subject has a plasma or serum LDL- C level > 190 mg / dL prior to receiving the PCSK9 inhibitor therapy. In some embodiment, the subject the subject has a plasma or serum LDL-C level > 1 .8 mmol / L prior to receiving the PCSK9 inhibitor therapy. In some embodiment, the subject the subject has a plasma or serum LDL-C level > 2.6 mmol / L prior to receiving the PCSK9 inhibitor therapy. In some embodiment, the subject the subject has a plasma or serum LDL-C level > 3.4 mmol / L prior to receiving the PCSK9 inhibitor therapy. In some embodiment, the subject the subject has a plasma or serum LDL-C level > 4.1 mmol / L prior to receiving the PCSK9 inhibitor therapy. In some embodiment, the subject the subject has a plasma or serum LDL-C level > 4.9 mmol / L prior to receiving the PCSK9 inhibitor therapy. In some embodiments, the LDL-C level is a plasma LDL-C level. In other embodiments, the LDL-C level is a serum LDL-C level.
[0040] In some embodiment, the subject has a plasma or serum LDL-C level > 70 mg / dL prior to administration of the Lp(a) inhibitor. In some embodiment, the subject the subject has a plasma or serum LDL-C level > 100 mg / dL prior to administration of the Lp(a) inhibitor. In some embodiment, the subject the subject has a plasma or serum LDL-C level > 130 mg / dL prior to administration of the Lp(a) inhibitor. In some embodiment, the subject the subject has a plasma or serum LDL-C level > 160 mg / dL prior to administration of the Lp(a) inhibitor. In some embodiment, the subject the subject has a plasma or serum LDL-C level > 190 mg / dL prior to administration of the Lp(a) inhibitor. In some embodiment, the subject the subject has a plasma or serum LDL-C level > 1.8 mmol / L prior to administration of the Lp(a) inhibitor. In some embodiment, the subject the subject has a plasma or serum LDL-C level > 2.6 mmol / L prior to administration of the Lp(a) inhibitor. In some embodiment, the subject the subject hasPAT059941-PCT-SEC01 a plasma or serum LDL-C level > 3.4 mmol / L prior to administration of the Lp(a) inhibitor. In some embodiment, the subject the subject has a plasma or serum LDL-C level > 4.1 mmol / L prior to administration of the Lp(a) inhibitor. In some embodiment, the subject the subject has a plasma or serum LDL-C level > 4.9 mmol / L prior to administration of the Lp(a) inhibitor. In some embodiments, the LDL-C level is a plasma LDL-C level. In other embodiments, the LDL-C level is a serum LDL-C level.
[0041] LDL-C levels can be measured by direct assay (e.g., Quest diagnostics test code 8293; Labcorp test code 120295) or calculated, for example, by the Friedewald equation (see, e.g., Martin et al., 2013, JACC 62(8):732-739). The Friedewald equation estimates LDL-C as total cholesterol minus high-density lipoprotein cholesterol (HDL-C) minus triglycerides / 5 in milligrams per deciliter. A subject’s LDL-C level can be measured (or calculated) in a fasted or non-fasted state. In some embodiments, a subject’s LDL-C level is measured (or calculated) in a fasted stated. In other embodiments, a subject’s LDL-C level is measured (or calculated) in a non-fasted state.
[0042] In some embodiments, the subject is at least 18 years of age. In some embodiments, the subject is 18 to 80 years of age.
[0043] In some embodiments, the subject has atherosclerotic cardiovascular disease (ASCVD). A subject with ASCVD can have, for example, coronary heart disease (CHD) and / or cerebrovascular disease (CVD) and / or peripheral artery disease (PAD).
[0044] A subject can be considered to have CHD if the subject has one, two, or all three of the following characteristics:1. Prior myocardial infarction2. Prior coronary revascularization (PCI or CABG)3. Angiographic or CT-imaging (e.g. MDCT / CTA) evidence of coronary atherosclerosis: >70% stenosis in at least one major epicardial coronary artery, or >50% stenosis in two major epicardial coronary arteries
[0045] A subject can be considered to have CVD if the subject has one, two, or all three of the following characteristics:1 . Prior ischemic stroke confirmed by a brain imaging study such as CT or MRI2. History of prior percutaneous or surgical carotid artery revascularization3. Carotid artery stenosis >70% or symptomatic carotid artery disease with at least 50% carotid arterial stenosis, for example as measured by angiography or ultrasoundPAT059941-PCT-SEC01
[0046] A subject can be considered to have PAD if the subject has one, two, or three of the following characteristics:1 . Prior non-traumatic amputation of a lower extremity due to peripheral artery disease2. History of prior percutaneous or surgical revascularization of an iliac, femoral, or popliteal artery3. Prior documentation of a resting ankle-brachial index <0.85
[0047] The subject can, in some embodiments, be receiving a lipid-lowering therapy in addition to the Lp(a) inhibitor and PCSK9 inhibitor, for example a statin or ezetimibe.
[0048] The subject can, in some embodiments, be receiving a standard of care treatment for a CVD risk factor such as hypertension or diabetes.
[0049] In some embodiments, the subject does not meet one or more (e.g., does not meet any) of the exclusion criteria described in Section 7.1.5.2.
[0050] In some embodiments, the subject does not have uncontrolled hypertension, e.g., sitting systolic blood pressure (SBP) >160 mmHg and / or diastolic blood pressure (DBP) >100 mmHg. In some embodiments, the subject does not have class IV heart failure according to the New York Heart Association (NYHA) functional classification system. In some embodiments, the subject does not have serum or plasma triglycerides >400 mg / dL. In some embodiments, the subject does not have a history of malignancy of any organ system (other than localized basal cell carcinoma or squamous cell carcinoma of the skin or in situ cervical cancer), treated or untreated, within the past 5 years. In some embodiments, the subject has not had a myocardial infarction, stroke, other major bleeding, coronary or lower limb re-vascularization, major cardiac or non-cardiac surgery within the last three months. In some embodiments, the subject does not have a platelet count <140,000 per mm3. In some embodiments, the subject does not have active liver disease or hepatic dysfunction, e.g., defined as aspartate aminotransferase (AST) or alanine aminotransferase (ALT) >2 times the upper limit of normal (ULN). In some embodiments, the subject does not have total bilirubin (TBIL) >1 .5 times the ULN or Gilbert syndrome. In some embodiments, the subject does not have an estimated Glomerular Filtration Rate (eGFR) <30 mL / min / 1 .73 m2. In some embodiments, the subject is not on dialysis. In some embodiments, the subject does not have significant glomerular disease, e.g., IgA nephropathy, diabetic nephropathy, or systemic lupus erythematosus with urinary protein-creatinine ratio (PCR) >500 mg / g (56.6 mg / mmol). In some embodiments, the subject does not have severe concomitant non-CV disease that is anticipated to reduce life expectancy to less than 5 years. In some embodiments, the subject does not have HIV, hepatitis C or hepatitis B. In some embodiments, the subjectPAT059941-PCT-SEC01 does not have an active severe infection or major hematologic, metabolic, gastrointestinal or endocrine dysfunction (e.g. uncontrolled thyroid dysfunction or uncontrolled diabetes mellitus). In some embodiments, the subject is not receiving / does not receive treatment with lipoprotein apheresis. In some embodiments, the subject does is not receiving / does not receive niacin >2 g daily. In some embodiments, the subject does not have a history of alcohol or drug abuse. In some embodiments, the subject is not pregnant or lactating. In some embodiments, when the subject is a woman physiologically capable of becoming pregnant, the subject is using a highly effective method of contraception.7.5. Treatment Regimens
[0051] In some aspects, the disclosure provides Lp(a) inhibitor treatment regimens. Treatment regimens of the disclosure can comprise administering an amount of an Lp(a) inhibitor (e.g., pelacarsen) to reduce a subject’s Lp(a) level. The treatment regimens of the disclosure typically comprise multiple administrations of the Lp(a) inhibitor. The multiple administrations of the Lp(a) inhibitor can be over the course of six months, one year, more than one year, or indefinitely (e.g., for as long as the subject has elevated Lp(a) or to maintain a lowered Lp(a) level). Similarly, treatment with a PCSK9 inhibitor (e.g., inclisiran) typically comprises multiple administrations of the PCSK9 inhibitor. The multiple administrations of the PCSK9 inhibitor can be over the course of six months, one year, more than one year, or indefinitely (e.g., for as long as the subject has elevated LDL-C or to maintain a lowered LDL-C level).
[0082] In some embodiments, methods of the disclosure comprise administering 80 mg of the Lp(a) inhibitor pelacarsen to the subject per month or per 30-day period. In some embodiments, pelacarsen is administered to the subject monthly (e.g., 80 mg once per month) or every 30 days (e.g., 80 mg once per 30 days). In practice, an administration window can be provided, for example, to accommodate slight variations to a dosing schedule. For example, a window of ± 7 days, ± 4 days, ± 3 days, ± 2 days, or ± 1 day around a scheduled dosage date can be used. Pelacarsen is typically administered subcutaneously.
[0052] In some embodiments, a unit dosage form comprising 80 mg of pelacarsen is used. The unit dosage form can comprise pelacarsen in any suitable volume, for example 80 mg of pelacarsen in a 0.8 mL volume.
[0053] When the subject is receiving inclisiran (or is administered inclisiran according to a method of the disclosure which comprises administering inclisiran), the subject typically receives two loading doses of inclisiran separated by three months and subsequently receives one dose of inclisiran every six months following the second loading dose. InclisiranPAT059941-PCT-SEC01 is typically administered subcutaneously. A suitable dose of inclisiran is 284 mg. A suitable unit dosage form comprises 284 mg of inclisiran in a 1 .5 mL volume.
[0054] In some embodiments, the first administration of pelacarsen is preceded by one or more administrations of inclisiran (e.g., two loading doses of inclisiran referenced in the preceding paragraph). For example, the first administration of pelacarsen can be one month after the second loading dose. In other embodiments, the first administration of pelacarsen is preceded by any number of administrations of inclisiran (e.g., two, three, or more than three doses of inclisiran). For example, a subject receiving inclisiran at regular six-month intervals for elevated LDL-C can be started on pelacarsen therapy for elevated Lp(a) as described herein.
[0055] Alternatively, administration of pelacarsen can begin concurrently with or before inclisiran therapy. For example, a subject presenting with both elevated Lp(a) and elevated LDL-C and not currently being treated with either an Lp(a) inhibitor or PCSK9 inhibitor can begin therapy with a combination of pelacarsen and inclisiran.
[0056] There may be instances where a pelacarsen administration is scheduled for the same day as an inclisiran administration. In such instances, administration of one or both of pelacarsen and inclisiran can be (but need not necessarily be) shifted so that there is one day or more between the administrations. For example, inclisiran can be administered on the scheduled date and pelacarsen can be administered one, two, three, or four days later, or vice versa.
[0057] Individual doses of inclisiran and pelacarsen can be administered by a healthcare provider or self-administered by the subject.8. SPECIFIC EMBODIMENTS
[0058] The present disclosure is exemplified by the specific embodiments below.1 . A method of treating a subject having elevated lipoprotein A (“Lp(a)”) and who is receiving or who is to receive proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor therapy for elevated low-density lipoprotein associated cholesterol (“LDL-C”), comprising administering a therapeutically effective amount of an Lp(a) inhibitor to the subject.2. A method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and who is receiving or who is to receive proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor therapy, comprising administering a therapeutically effective amount of an Lp(a) inhibitor to the subject.PAT059941-PCT-SEC013. An agent which is a lipoprotein A (“Lp(a)”) inhibitor for use in a method of treating a subject having elevated lipoprotein A (“Lp(a)”) and who is receiving or who is to receive proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor therapy for elevated low-density lipoprotein associated cholesterol (“LDL-C”), wherein the method comprises administering a therapeutically effective amount of the Lp(a) inhibitor to the subject.4. An agent which is a lipoprotein A (“Lp(a)”) inhibitor for use in a method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and who is receiving or who is to receive proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor therapy, wherein the method comprises administering a therapeutically effective amount of the Lp(a) inhibitor to the subject.5. The method of embodiment 1 or embodiment 2 or agent for use according to embodiment 3 or embodiment 4, wherein the therapeutically effective amount of the Lp(a) inhibitor is an amount effective to reduce an Lp(a) level of the subject.6. The method or agent for use according to any one of embodiments 1 to 5, wherein the PCSK9 inhibitor therapy has commenced prior to administration of the Lp(a) inhibitor.7. The method or agent for use according to any one of embodiments 1 to 6, wherein the method comprises multiple administrations of the Lp(a) inhibitor, e.g., over the course of six months, one year, or indefinitely.8. The method or agent for use according to any one of embodiments 1 to 7, wherein the Lp(a) inhibitor comprises an antisense agent.9. The method or agent for use according to any one of embodiments 1 to 8, wherein the Lp(a) inhibitor comprises pelacarsen.10. The method or agent for use according to embodiment 9, wherein the method comprises administering 80 mg of pelacarsen to the subject per month.11 . The method or agent for use according to embodiment 9 or embodiment 10, wherein the method comprises administering pelacarsen to the subject once per month.12. The method or agent for use according to any one of embodiments 9 to 11 , wherein the method comprises administering 80 mg of pelacarsen to the subject once per month.PAT059941-PCT-SEC0113. The method or agent for use according to embodiment 9, wherein the method comprises administering pelacarsen to the subject once every thirty days ± 7 days.14. The method or agent for use according to embodiment 9 or embodiment 13, wherein the method comprises administering 80 mg of pelacarsen to the subject once every thirty days ± 7 days.15. The method or agent for use according to any one of embodiments 9 to 14, wherein the method comprises administering pelacarsen to the subject subcutaneously.16. The method or agent for use according to any one of embodiments 9 to 15, wherein the method comprises administering a unit dosage form comprising 80 mg of pelacarsen in a volume of 0.8 mL to the subject.17. The method or agent for use according to any one of embodiments 1 to 16, wherein the PCSK9 inhibitor comprises an RNAi agent (e.g., inclisiran) or an antibody (e.g., evolocumab or alirocumab).18. The method or agent for use according to any one of embodiments 1 to 17, wherein the PCSK9 inhibitor comprises inclisiran.19. The method or agent for use according to any one of embodiments 1 to 18, wherein the Lp(a) inhibitor comprises pelacarsen and the PCSK9 inhibitor comprises inclisiran.20. The method or agent for use according to any one of embodiments 1 to 19, wherein the PCSK9 inhibitor comprises inclisiran and the PCSK9 inhibitor therapy comprises two loading doses of inclisiran.21 . The method or agent for use according to embodiment 20, wherein the two loading doses of inclisiran are separated by three months.22. The method or agent for use according to embodiment 20, wherein the two loading doses of inclisiran are separated by 90 days ± 7 days.23. The method or agent for use according to any one of embodiments 20 to 22, wherein the PCSK9 inhibitor therapy comprises one dose of inclisiran every six months following the second loading dose.PAT059941-PCT-SEC0124. The method or agent for use according to any one of embodiments 20 to 23, wherein the PCSK9 inhibitor therapy comprises an initial loading dose of inclisiran, a second loading dose of inclisiran at three months, and then a dose of inclisiran every six months.25. The method or agent for use according to any one of embodiments 20 to 24, wherein the method comprises administering the Lp(a) inhibitor to the subject subsequent to the second loading dose of inclisiran.26. The method or agent for use according to any one of embodiments 1 to 25, wherein the PCSK9 inhibitor therapy comprises inclisiran administered subcutaneously to the subject.27. The method or agent for use according to any one of embodiments 1 to 26, wherein the PCSK9 inhibitor therapy comprises inclisiran administered subcutaneously to the subject at a dose of 284 mg.28. The method or agent for use according to any one of embodiments 1 to 27, wherein the PCSK9 inhibitor therapy comprises inclisiran administered subcutaneously to the subject at a dose of 284 mg in a volume of 1 .5 mL.29. A method of treating a subject having elevated lipoprotein A (“Lp(a)”) and who is receiving or who is to receive inclisiran therapy for elevated low-density lipoprotein associated cholesterol (“LDL-C”), comprising administering a therapeutically effective amount of pelacarsen to the subject.30. A method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and who is receiving or who is to receive inclisiran therapy, comprising administering a therapeutically effective amount of pelacarsen to the subject.31 . An agent which is pelacarsen for use in a method of treating a subject having elevated lipoprotein A (“Lp(a)”) and who is receiving or who is to receive inclisiran therapy for elevated low-density lipoprotein associated cholesterol (“LDL-C”), wherein the method comprises administering a therapeutically effective amount of pelacarsen to the subject.32. An agent which is pelacarsen for use in a method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and who is receiving or who is to receive inclisiran therapy, wherein the method comprises administering a therapeutically effective amount of pelacarsen to the subject.PAT059941-PCT-SEC0133. The method of embodiment 29 or embodiment 30 or agent for use according to embodiment 31 or embodiment 32, wherein the method comprises administering 80 mg of pelacarsen to the subject subcutaneously once per month.34. The method of or agent for use according to any one of embodiments 29 to 33, wherein:(a) the inclisiran therapy comprises an initial loading dose of inclisiran, a second loading dose of inclisiran at three months, and then a dose of inclisiran every six months, wherein each dose of inclisiran is 284 mg administered subcutaneously; and(b) the method comprises administering 80 mg of pelacarsen to the subject subcutaneously once per month, optionally wherein a first dose of pelacarsen is administered to the subject subsequent to the second loading dose of inclisiran (e.g., one month after the second loading dose).35. A method of treating a subject having elevated lipoprotein A (“Lp(a)”) and elevated low-density lipoprotein associated cholesterol (“LDL-C”), comprising administering to the subject a therapeutically effective amount of an Lp(a) inhibitor and a therapeutically effective amount of a proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor.36. A method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and low-density lipoprotein associated cholesterol (“LDL-C”) lowering therapy, comprising administering to the subject a therapeutically effective amount of an Lp(a) inhibitor and a therapeutically effective amount of a proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor.37. An agent which is a lipoprotein A (“Lp(a)”) inhibitor for use in a method of treating a subject having elevated Lp(a) and elevated low-density lipoprotein associated cholesterol (“LDL-C”), wherein the method comprises administering to the subject a therapeutically effective amount of the Lp(a) inhibitor and a therapeutically effective amount of a proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor.38. An agent which is a lipoprotein A (“Lp(a)”) inhibitor for use in a method of treating a subject in need of Lp(a) lowering therapy and low-density lipoprotein associated cholesterol (“LDL-C”) lowering therapy, wherein the method comprises administering to the subject a therapeutically effective amount of the Lp(a) inhibitor and a therapeutically effective amount of a proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor.PAT059941-PCT-SEC0139. An agent which is a proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor for use in a method of treating a subject having elevated lipoprotein A (“Lp(a)”) and elevated low-density lipoprotein associated cholesterol (“LDL-C”), wherein the method comprises administering to the subject a therapeutically effective amount of an Lp(a) inhibitor and a therapeutically effective amount of the PCSK9 inhibitor.40. An agent which is a proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor for use in a method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and low-density lipoprotein associated cholesterol (“LDL-C”) lowering therapy, wherein the method comprises administering to the subject a therapeutically effective amount of an Lp(a) inhibitor and a therapeutically effective amount of the PCSK9 inhibitor.41 . The method of embodiment 35 or embodiment 36 or agent for use according to any one of embodiments 37 to 40, wherein the therapeutically effective amount of the Lp(a) inhibitor is an amount effective to reduce an Lp(a) level of the subject.42. The method or agent for use according to any one of embodiments 35 to 41 , wherein the therapeutically effective amount of the PCSK9 inhibitor is an amount effective to reduce an LDL-C level of the subject.43. The method or agent for use according to any one of embodiments 35 to 42, wherein the method comprises administering the PCSK9 inhibitor to the subject one or more times prior to administering the Lp(a) inhibitor to the subject for the first time.44. The method or agent for use according to any one of embodiments 35 to 43, wherein the method comprises multiple administrations of the Lp(a) inhibitor, e.g., over the course of six months, one year, or indefinitely.45. The method or agent for use according to any one of embodiments 35 to 44, wherein the Lp(a) inhibitor comprises an antisense agent.46. The method or agent for use according to any one of embodiments 35 to 45, wherein the Lp(a) inhibitor comprises pelacarsen.47. The method or agent for use according to embodiment 46, wherein the method comprises administering 80 mg of pelacarsen to the subject per month.48. The method or agent for use according to embodiment 46 or embodiment 47, wherein the method comprises administering pelacarsen to the subject once per month.PAT059941-PCT-SEC0149. The method or agent for use according to any one of embodiments 46 to 48, wherein the method comprises administering 80 mg of pelacarsen to the subject once per month.50. The method or agent for use according to embodiment 46, wherein the method comprises administering pelacarsen to the subject once every thirty days ± 7 days.51 . The method or agent for use according to embodiment 46 or embodiment 50, wherein the method comprises administering 80 mg of pelacarsen to the subject once every thirty days ± 7 days.52. The method or agent for use according to any one of embodiments 46 to 51 , wherein the method comprises administering pelacarsen to the subject subcutaneously.53. The method or agent for use according to any one of embodiments 46 to 52, wherein the method comprises administering a unit dosage form comprising 80 mg of pelacarsen in a volume of 0.8 mL to the subject.54. The method or agent for use according to any one of embodiments 35 to 53, wherein the PCSK9 inhibitor comprises an RNAi agent (e.g., inclisiran) or an antibody (e.g., evolocumab or alirocumab).55. The method or agent for use according to any one of embodiments 35 to 54, wherein the PCSK9 inhibitor comprises inclisiran.56. The method or agent for use according to any one of embodiments 35 to 55, wherein the Lp(a) inhibitor comprises pelacarsen and the PCSK9 inhibitor comprises inclisiran.57. The method or agent for use according to any one of embodiments 35 to 56, wherein the PCSK9 inhibitor comprises inclisiran and the method comprises administering two loading doses of inclisiran to the subject.58. The method or agent for use according to embodiment 57, wherein the two loading doses of inclisiran are separated by three months.59. The method or agent for use according to embodiment 57, wherein the two loading doses of inclisiran are separated by 90 days ± 7 days.PAT059941-PCT-SEC0160. The method or agent for use according to any one of embodiments 57 to 59, wherein the method comprises administering one dose of inclisiran to the subject every six months following the second loading dose.61 . The method or agent for use according to any one of embodiments 55 to 60, wherein the method comprises administering an initial loading dose of inclisiran to the subject, administering a second loading dose of inclisiran to the subject at three months, and then administering a dose of inclisiran to the subject every six months.62. The method or agent for use according to any one of embodiments 57 to 61 , wherein the method comprises administering the Lp(a) inhibitor to the subject subsequent to the second loading dose of inclisiran.63. The method or agent for use according to any one of embodiments 35 to 62, wherein the PCSK9 inhibitor comprises inclisiran and the method comprises administering inclisiran to the subject subcutaneously.64. The method or agent for use according to any one of embodiments 35 to 63, wherein the PCSK9 inhibitor comprises inclisiran and the method comprises administering inclisiran subcutaneously to the subject at a dose of 284 mg.65. The method or agent for use according to any one of embodiments 35 to 64, wherein the PCSK9 inhibitor comprises inclisiran and the method comprises administering inclisiran subcutaneously to the subject at a dose of 284 mg in a volume of 1 .5 mL.66. A method of treating a subject having elevated lipoprotein A (“Lp(a)”) and elevated lipoprotein associated cholesterol (“LDL-C”), comprising administering a therapeutically effective amount of pelacarsen and a therapeutically effective amount of inclisiran to the subject.67. A method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and lipoprotein associated cholesterol (“LDL-C”) lowering therapy, comprising administering a therapeutically effective amount of pelacarsen and a therapeutically effective amount of inclisiran to the subject.68. An agent which is pelacarsen for use in a method of treating a subject having elevated lipoprotein A (“Lp(a)”) and elevated low-density lipoprotein associated cholesterol (“LDL-C”), wherein the method comprises administering a therapeutically effective amount of pelacarsen and a therapeutically effective amount of inclisiran to the subject.PAT059941-PCT-SEC0169. An agent which is pelacarsen for use in a method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and low-density lipoprotein associated cholesterol (“LDL-C”) lowering therapy, wherein the method comprises administering a therapeutically effective amount of pelacarsen and a therapeutically effective amount of inclisiran to the subject70. An agent which is inclisiran for use in a method of treating a subject having elevated lipoprotein A (“Lp(a)”) and elevated low-density lipoprotein associated cholesterol (“LDL-C”), wherein the method comprises administering a therapeutically effective amount of pelacarsen and a therapeutically effective amount of inclisiran to the subject.71. An agent which is inclisiran for use in a method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and low-density lipoprotein associated cholesterol (“LDL-C”) lowering therapy, wherein the method comprises administering a therapeutically effective amount of pelacarsen and a therapeutically effective amount of inclisiran to the subject.72. The method of embodiment 66 or embodiment 67 or agent for use according to any one of embodiments embodiment 68 to 71 , wherein the method comprises administering 80 mg of pelacarsen to the subject subcutaneously once per month and 284 mg of inclisiran to the subject once every six months.73. The method or agent for use according to any one of embodiments 66 to 72, wherein the method comprises:(a) administering an initial loading dose of inclisiran to the subject, administering a second loading dose of inclisiran to the subject at three months, and then administering a dose of inclisiran every six months, wherein each dose of inclisiran is 284 mg administered subcutaneously; and(b) administering 80 mg of pelacarsen to the subject subcutaneously once per month, optionally wherein a first dose of pelacarsen is administered to the subject subsequent to the second loading dose of inclisiran (e.g., one month after the second loading dose).74. The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a plasma or serum Lp(a) level > 75 nmol / L prior to administration of the Lp(a) inhibitor.PAT059941-PCT-SEC0175. The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a plasma or serum Lp(a) level > 100 nmol / L prior to administration of the Lp(a) inhibitor.76. The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a plasma or serum Lp(a) level > 125 nmol / L prior to administration of the Lp(a) inhibitor.77. The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a plasma or serum Lp(a) level > 175 nmol / L prior to administration of the Lp(a) inhibitor.78. The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a plasma or serum Lp(a) level > 30 mg / dL prior to administration of the Lp(a) inhibitor.79. The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a plasma or serum Lp(a) level > 50 mg / dL prior to administration of the Lp(a) inhibitor.80. The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a plasma Lp(a) level > 75 nmol / L prior to administration of the Lp(a) inhibitor.81 . The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a plasma Lp(a) level > 100 nmol / L prior to administration of the Lp(a) inhibitor.82. The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a plasma Lp(a) level > 125 nmol / L prior to administration of the Lp(a) inhibitor.83. The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a plasma Lp(a) level > 175 nmol / L prior to administration of the Lp(a) inhibitor.84. The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a plasma Lp(a) level > 30 mg / dL prior to administration of the Lp(a) inhibitor.PAT059941-PCT-SEC0185. The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a plasma Lp(a) level > 50 mg / dL prior to administration of the Lp(a) inhibitor.86. The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a serum Lp(a) level > 75 nmol / L prior to administration of the Lp(a) inhibitor.87. The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a serum Lp(a) level > 100 nmol / L prior to administration of the Lp(a) inhibitor.88. The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a serum Lp(a) level > 125 nmol / L prior to administration of the Lp(a) inhibitor.89. The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a serum Lp(a) level > 175 nmol / L prior to administration of the Lp(a) inhibitor.90. The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a serum Lp(a) level > 30 mg / dL prior to administration of the Lp(a) inhibitor.91 . The method or agent for use according to any one of embodiments 1 to 73, wherein the subject has a serum Lp(a) level > 50 mg / dL prior to administration of the Lp(a) inhibitor.92. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 70 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.93. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 100 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.94. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 130 mg / dL prior to the PCSK9PAT059941-PCT-SEC01 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.95. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 160 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.96. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 190 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.97. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 1.8 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.98. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 2.6 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.99. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 3.4 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.100. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 4.1 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.101 . The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 4.9 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.102. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma LDL-C level > 70 mg / dL prior to the PCSK9 inhibitorPAT059941-PCT-SEC01 therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.103. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma LDL-C level > 100 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.104. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma LDL-C level > 130 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.105. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma LDL-C level > 160 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.106. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma LDL-C level > 190 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.107. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma LDL-C level > 1 .8 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.108. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma LDL-C level > 2.6 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.109. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma LDL-C level > 3.4 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.110. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma LDL-C level > 4.1 mmol / L prior to the PCSK9 inhibitorPAT059941-PCT-SEC01 therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.111. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a plasma LDL-C level > 4.9 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.112. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a serum LDL-C level > 70 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.113. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a serum LDL-C level > 100 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.114. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a serum LDL-C level > 130 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.115. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a serum LDL-C level > 160 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.116. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a serum LDL-C level > 190 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.117. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a serum LDL-C level > 1.8 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.118. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a serum LDL-C level > 2.6 mmol / L prior to the PCSK9 inhibitorPAT059941-PCT-SEC01 therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.119. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a serum LDL-C level > 3.4 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.120. The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a serum LDL-C level > 4.1 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.121 . The method or agent for use according to any one of embodiments 1 to 91 , wherein the subject has a serum LDL-C level > 4.9 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.122. The method or agent for use according to any one of embodiments 92 to 121 , wherein the LDL-C level is an LDL-C level as calculated by the Friedewald equation.123. The method or agent for use according to any one of embodiments 1 to 122, wherein the subject is at least 18 years of age.124. The method or agent for use according to any one of embodiments 1 to 123, wherein the subject is 18 to 80 years of age.125. The method or agent for use according to any one of embodiments 1 to 124, wherein the subject has atherosclerotic cardiovascular disease (ASCVD).126. The method or agent for use according to any one of embodiments 1 to 125, wherein the subject has coronary heart disease.127. The method or agent for use according to any embodiment 126, wherein the subject has had a myocardial infarction priorto administration of the Lp(a) inhibitor (e.g., >3 months prior).128. The method or agent for use according to any embodiment 126 or embodiment 127, wherein the subject has had a coronary revascularization procedure prior to administration of the Lp(a) inhibitor (e.g., >3 months prior).PAT059941-PCT-SEC01129. The method or agent for use according to embodiment 128, wherein the revascularization procedure is percutaneous coronary intervention (PCI) or coronary artery bypass grafting (CABG).130. The method for use according to any one of embodiments 126 to 129, wherein the subject has >70% stenosis in at least one major epicardial coronary artery or >50% stenosis in two major epicardial coronary arteries, e.g., as determined by angiographic or CT-imaging (e.g. MDCT / CTA).131 . The method or agent for use according to any one of embodiments 1 to 130, wherein the subject has subject has cerebrovascular disease (CVD).132. The method or agent for use according to embodiment 131 , wherein the subject has had an ischemic stroke prior (e.g., >3 months prior) to administration of the Lp(a) inhibitor, e.g., confirmed by a brain imaging study such as CT or MRI.133. The method or agent for use according to embodiment 131 or embodiment132, wherein the subject has had a percutaneous or surgical carotid artery revascularization prior to (e.g., >3 months prior) to administration of the Lp(a) inhibitor.134. The method or agent for use according to any one of embodiments 131 to133, wherein the subject has a carotid artery stenosis >70% or symptomatic carotid artery disease with at least 50% carotid arterial stenosis (e.g., as determined by angiography or ultrasound) prior to administration of the Lp(a) inhibitor.135. The method or agent for use according to any one of embodiments 1 to 134, wherein the subject has peripheral arterial disease (PAD).136. The method or agent for use according to embodiment 135, wherein the subject has had a non-traumatic amputation of a lower extremity due to peripheral artery disease prior to administration of the Lp(a) inhibitor.137. The method or agent for use according to embodiment 135 or embodiment136, wherein the subject has had a percutaneous or surgical revascularization of an iliac, femoral, or popliteal artery prior to administration of the Lp(a) inhibitor.138. The method or agent for use according to any one of embodiments 135 to137, wherein the subject has a resting ankle-brachial index <0.85 prior to administration of the Lp(a) inhibitor.PAT059941-PCT-SEC01139. The method or agent for use according to any one of embodiments 1 to 138, wherein the subject is receiving a lipid-lowering therapy (e.g., a statin and / or ezetimibe).140. The method or agent for use according to any one of embodiments 1 to 139, wherein the subject is receiving a standard of care (SoC) treatment for a CVD risk factor (e.g., hypertension and / or diabetes).141 . The method or agent for use according to any one of embodiments 1 to 140, wherein the subject is a subject as described in Section 5.4.142. A combination comprising pelacarsen and inclisiran, optionally for use in a method described in any of the preceding embodiments.9. EXAMPLES9.1. Example 1 : Lp(a) lowering study of pelacarsen with background inclisiran in subjects with elevated Lp(a) and established ASCVD9.1.1. Overview
[0059] This Example describes a study to evaluate the efficacy, safety, and tolerability of pelacarsen compared to placebo in subjects with atherosclerotic cardiovascular disease (ASCVD) who have elevated Lp(a), and who are on background inclisiran treatment for elevated LDL-C. An overview of objectives, endpoints, and estimands of the study are listed in Table 2.PAT059941-PCT-SEC010060] The study is a randomized, double-blind, placebo-controlled, multicenter phase lllb study in subjects with ASCVD presenting with elevated LDL-C and elevated Lp(a). The study includes a screening period (approximately 30 days), inclisiran background treatment run-in period (approximately 120 days), a double-blind treatment period (six months), an open-label treatment period (6 months), and a safety follow-up period from the last dose (16 weeks). Eligible subjects are assigned to one of two treatment arms (1 :1): pelacarsen or placebo. Pelacarsen (80 mg) or placebo is administered s.c. QM. At Month 6 visit, subjects end thePAT059941-PCT-SEC01 double-blind treatment period and transition to the open-label treatment period. During the open-label treatment period, all subjects receive monthly injections of pelacarsen. The study design is shown in FIG. 1 .
[0061] Table 3 lists all of the assessments performed. “X” in Table 3 denotes assessments to be recorded in the clinical database or received electronically from a vendor. “S” in Table 3 denotes assessments that are only in the subject’s source documentation and are not recorded in the clinical database.
[0062] Subjects are seen for all visits / assessments as outlined in Table 3 or as close to the designated day / time as possible. Missed or rescheduled visits do not lead to automatic discontinuation.
[0063] Subjects who discontinue from study treatment attend the follow-up visits as indicated in Table 3.
[0064] Subjects who discontinue from the study are scheduled for a final evaluation visit if they agree, as soon as possible, at which time all of the assessments listed for the final visit (EOS - End of Study visit) are performed.PAT059941-PCT-SEC01PAT059941-PCT-SEC01xAssessment recorded in the clinical database or received electronically from a vendorsAssessment recorded in the source documentation only1Screening visit is optionally conducted in a one-day visit (i.e. Screening 1 and 2 on the same visit day) or in two days (Screening 1 and 2 on different days). Screening 2 is performed within approximately 15 days after Screening 1) to allow the laboratory evaluation of Lp(a) and LDL-C.2Separate aliquots are made to allow testing for Lp(a) in both nmol / L and mg / dL.3LDL-C is measured by Friedewald calculation and included in standard lipid panels used for other lipids using the same blood collection tube.4The Injection device use assessment is completed at any visit starting at the Baseline visit.5Study treatment injections self-administered at home at Days 120, 150, 300 and 330. Study subjects who do not prefer to perform study treatment self-administration come to the clinic for their injections.6H=Home administration. Subjects are instructed to self-administer study treatment 4 days after the site visit (inclisiran injection) at Days 150 and 330.7Only sampled in subjects signing genetic informed consent.9.1.2. Introduction9.1.2.1. Study Rationale
[0065] Pelacarsen, once approved, is expected to be used, in some cases, by patients who are already on LDL-C lowering therapy. As elevated Lp(a) has been recognized as a significant risk factor for CV events, patients with elevated Lp(a) may be managed with an aggressive LDL-C lowering regimen with a PCSK9 inhibitor agent in clinical care, with the aim to reduce the overall CV risk of the patient. Considering that PCSK9 inhibitors are known to have a modest effect on lowering Lp(a), it is worthwhile investigating the efficacy of pelacarsen when administered in conjunction with a PCSK9 inhibitor. This potential lowering of Lp(a) with PCSK9 inhibitor is taken into account in this study by a higher Lp(a) eligibility criterion at Screening visit (i.e. >175 nmol / L). With such a considerable overlap of highPAT059941-PCT-SEC01 LDL-C and Lp(a) levels in patients with ASCVD, it is anticipated that a significant number of patients will benefit from simultaneous treatment of these two risk factors. Therefore, this study evaluates the safety and efficacy of pelacarsen in a setting of background inclisiran treatment.9.1.2.2. Background
[0066] Lp(a) is a highly prevalent independent genetic CVD risk factor (Tsimikas et al., 2018, J Am Coll Cardiol 71 (2):177-92). Current data highlight that lifestyle changes, including low fat diet and physical exercise, are unable to modify Lp(a) levels (Wilson et al., 2019, J Clin Lipidol 13(3):374-392). Therapeutic modalities to reduce Lp(a) levels in humans are few, and there are no drugs currently approved that specifically target Lp(a). Some specialized lipid centers use weekly or biweekly lipoprotein apheresis (LA) for Lp(a) reduction in selected very-high-risk patients, such as patients with recurrent CVD events despite being optimally treated with lipid lowering drugs. While this treatment option is expensive and burdensome for patients, it only provides a time-averaged reduction of approximately 35%. (Jaeger et al., 2009, Nat Clin Pract Cardiovasc Med 6(3):229-39; Leebmann et al., 2013, Circulation 128(24):2567-76; Waldmann & Parhofer, 2016, J Lipid Res 57(10):1751-57). Moreover, Lp(a) levels may return to previous levels within 2-weeks post-apheresis (Langsted et al., 2019, J Am Coll Cardiol; 74(1):54-66) which fails to provide a long-term reduction of elevated Lp(a).
[0067] Antisense oligonucleotides (ASOs) are emerging as viable therapeutic agents to treat disorders where overexpression of proteins is associated with a disease process. Apo(a) is synthesized primarily in the liver, a target organ for ASOs, where it is subsequently covalently linked to the apoB-100 component of LDL to form the Lp(a) lipoprotein. Pelacarsen, an ASO conjugated with triantennary N-Acetylgalactosamine (GalNAc) for enhanced delivery to hepatocytes, mediates cleavage of apo(a) mRNA through an RNaseHI mechanism, leading to lower plasma or serum Lp(a) levels. The results from the Phase lib ISIS 681257CS6 study demonstrated that pelacarsen is able to achieve dose dependent reductions in Lp(a) levels by up to 80%, indicating that the drug is potent enough to potentially improve CV outcomes in patients with elevated Lp(a). This is supported by two published Mendelian randomization analyses that suggest a reduction of about 100 mg / dL (Burgess et al., 2018, JAMA Cardiol 3(7):619-27) or 65.7 mg / dL (Lamina & Kronenberg, 2019, JAMA Cardiol 4(6):575-79) could reach the same effect as a 38.67 mg / dL lowering of LDL-C (i.e. ~22% CHD Outcome risk reduction).
[0068] In patients with established ASCVD, an ultimate LDL-C goal <1 .5 mmol / L (55 mg / dL) and a >50% reduction in LDL-C vs. baseline are recommended (ESC guideline 2021).PAT059941-PCT-SEC01However, the American College of Cardiology (ACC) recommends an LDL-C goal of <70 mg / dL in very high riskASCVD patients (Lloyd-Jones et al., 2022, J Am Coll Cardiol 80(14):1366-1418). A significant percentage of patients do not achieve their LDL-C target with the maximum tolerated dose (MTD) of a statin alone or in combination with ezetimibe (Virani et al., 2023, Circulation 148(9):e9-e119; Cannon et al., 2017, JAMA Cardiol 2(9):959- 66). For these patients, combination therapy with an inhibitor of proprotein convertase subtilisin / kexin type 9 (“PCSK9”) is often considered. PCSK9 inhibition can be achieved either through monoclonal antibodies to PCSK9 (e.g., evolocumab or aliricumab) or PCSK9 synthesis inhibitor (e.g., inclisiran).
[0069] Inclisiran is a long-acting hepatic PCSK9 synthesis inhibitor. It is a double-stranded small interfering ribonucleic acid (siRNA), conjugated on the sense strand with triantennary N Acetylgalactosamine (GalNAc) to facilitate uptake by hepatocytes. In hepatocytes, inclisiran utilizes the RNA interference mechanism and directs catalytic breakdown of PCSK9 mRNA. This increases LDL-C receptor recycling and expression on the hepatocyte cell surface, which increases LDL-C uptake and lowers LDL-C levels in the circulation. The efficacy of inclisiran is comparable to anti-PCSK9 monoclonal antibodies (evolocumab and aloricumab) with a >50% reduction in LDL-C levels, complemented by a favorable safety profile and the benefit of infrequent dosing (twice a year). In addition to infrequent dosing, its administration by a healthcare professional is expected to significantly improve treatment adherence. Although the complete effect of PCSK9 inhibitors (e.g., inclisiran) on Lp(a) levels has not been delineated, inclisiran has been shown to reduce Lp(a) levels by approximately 20% (Katsiki et al., 2023, Pharmaceuticals (Basel) 16(4):577).
[0070] Patients treated with pelacarsen in the phase lib study AKCEA-CS1 (CTQJ230X1102) had up to 20.5 % reduction of LDL-C from their baseline. Laboratory reported LDL-C methods have the limitation that they cannot measure LDL-C independent of lipoprotein(a) cholesterol (Lp(a)-C), and thus, the reported “LDL-C” is a combination of true LDL-C plus Lp(a)-C. Therefore, the reduction in LDL-C observed may not be a real physiological effect of pelacarsen, but a byproduct of the fact that Lp(a)-C is included in laboratory measures of LDL-C. Yeang et al., 2022, J Am Coll Cardiol 79(11):1035-46 shed light on this hypothesis by applying a quantitative, sensitive, high-throughput method to directly measure Lp(a)-associated cholesterol (Lp(a)-C) in subjects from the phase lib pelacarsen trial (Yeang et al., 2022, J Am Coll Cardiol 79(11):1035-46). Lp(a)-C was determined following isolation of the Lp(a) on magnetic beads linked to monoclonal antibody LPA4 recognizing apo(a). Pelacarsen resulted in statistically significant dose-dependent mean percent decreases in Lp(a)-C (29% ~ 67%), compared with 2% decrease in pooled placebo. The extent and temporal changes in directly measured Lp(a)-C were consistentPAT059941-PCT-SEC01 with change in Lp(a) molar concentration. This analysis provided proof that in individuals with elevated Lp(a), the contribution of Lp(a) to the reported LDL-C is non-negligible, with 13-16 mg / dL lower LDL-C after being adjusted with Lp(a)-C.
[0071] It was also observed that pelacarsen lowered oxidized phospholipids (OxPL) on Apo(B) by up to 81 .18% and apo(B) by up to 14.5% in the phase lib study (Tsimikas et al., 2020, N Engl J Med; 382(3):244-55). The reduction of OxPL on Apo(B) and Apo(B) may suggest a small indirect physiological effect of pelacarsen on LDL-C. Direct pharmacological effect on PCSK9 by pelacarsen or direct effect on apo(a) by inclisiran is not expected because inclisiran and pelacarsen do not affect their respective mRNA target.9.1.3. Objectives, endpoints, and estimands9.1.3.1. Objective and related endpoints
[0072] Objectives and related endpoints are described in Table 2.9.1.3.2. Primary estimands
[0073] The estimand is the precise description of the treatment effect and reflects strategies to address events occurring during trial conduct which could impact the interpretation of the trial results (e.g. premature discontinuation of treatment).
[0074] The primary clinical question of interest is:What is the reduction in Lp(a), quantified by the change in log-transformed Lp(a) concentration from baseline at Month 6, in subjects with established ASCVD and having LDL C >70 mg / dL, Lp(a) >175 nmol / L and inclisiran as background treatment, who receive pelacarsen (TQJ230) 80 mg subcutaneous (s.c) QM compared to those who are on placebo s.c QM?
[0075] The primary estimand is described by the following attributes:Population: Subjects with established ASCVD of age 18 to <80 years with LDL C >70 mg / dL and Lp(a) >175 nmol / L, and on background inclisiran after Screening visit.Endpoint: Change in log-transformed Lp(a) concentration from baseline at Month 6.Treatment of interest: Pelacarsen 80 mg s.c QM versus placebo s.c QM regardless of discontinuation of study treatment, use of other LLT or use of prohibited treatment (treatment policy strategy).Intercurrent events:• Discontinuation of study treatment for any reason is handled according to treatment policy strategy. Data collected after treatment discontinuation is used for analyses.PAT059941-PCT-SEC01• Death (should any occur) is handled as an unfavorable outcome (composite strategy). Efficacy parameter measurements, quantified by change in log- transformed Lp(a) from baseline, after death are imputed based on subjects who have observed measurements, i.e. no missing Lp(a) data at all, and have the worst 10% of the log-transformed change from baseline at the respective time point among both treatment groups.• Use of other LLT are handled according to treatment-policy strategy.• Use of prohibited treatment (should any occur) is handled according to treatmentpolicy strategy.Summary measure: Difference in mean change from baseline at Month 6 in log-transformed Lp(a) concentration between treatment arms.9.1.3.3. Secondary estimandsEfficacy of pelacarsen versus placebo in reducing Lp(a) to <125 nmol / L at Month 6
[0076] The clinical question of interest for the first secondary estimand is: What is the effect of pelacarsen versus placebo on the proportion of subjects achieving Lp(a) <125 nmol / L from baseline to Month 6?
[0077] The population, treatment of interest and intercurrent events are the same as the primary estimand. Other attributes are listed below.Endpoint: Proportion of subjects achieving Lp(a) levels <125 nmol / L at Month 6Summary measure: Odds ratio from logistic regression model adjusted for covariatesSafety and tolerability of pelacarsen compared to placebo in subjects on background inclisiran treatment
[0078] The clinical question of interest for the second secondary estimand is: What is the effect of pelacarsen versus placebo on safety and tolerability in subjects treated with background inclisiran?
[0079] The population, treatment of interest and intercurrent events are the same as the primary estimand. Other attributes are listed below.Endpoints:• Incidence proportion of the following: o TEAEs o TESAEsPAT059941-PCT-SEC01 o TEAEs of special interest o Study and treatment discontinuations due to TEAEs• Observed value and change from baseline for the following: o ECGs o Vital signs o Laboratory values (e.g. CBC, CMP, Liver Function Tests)Summary measure:• Incidence proportion of TEAEs, TEAEs, study discontinuations due to TEAEs and TEAEs of special interest by treatment group;• Mean observed value and mean change from baseline at post-baseline visits for safety laboratory measures, ECGs and vital signs by treatment group and visit; and change in the frequency with observed proportions of subjects across categories of safety laboratory measures, from baseline to the worst value in on-treatment period by treatment group.
[0080] The TEAEs are defined as any recorded AE with start date located in the on- treatment period. The on-treatment period lasts from the date of first administration of study treatment to 16 weeks after the date of the last actual administration of any study treatment.9.1.4. Study Design9.1.4.1. Overall design
[0081] This study is a randomized, double-blind, placebo-controlled, multicenter, parallel group study followed by an open-label treatment period (refer to FIG. 1 for study design).
[0082] The purpose of the study is to evaluate the efficacy, safety and tolerability of pelacarsen compared to placebo in subjects with ASCVD who have elevated Lp(a) and who are on background inclisiran for elevated LDL-C after the Screening visit.
[0083] The study includes the following:• a Screening Period of approximately 30 days• a Run-in Period of approximately 120 days• a double-blind treatment period of 6 months• an open-label treatment period of 6 months• a safety follow-up period of 16 weeks from the last dose (approximately 4 months)PAT059941-PCT-SEC019.1.4.1.1. Screening period
[0084] Screening visit consists of two parts, which are conducted in a one-day visit or in two visits (one visit for each part) to allow the laboratory evaluation of Lp(a) and LDL-C before other screening activities in Screening 2. The first part is conducted to measure Lp(a) and LDL-C level. Screening 2 is performed within approximately 15 days after Screening 1 to allow the laboratory evaluation of Lp(a) and LDL-C . All assessments are performed as detailed in Table 3.
[0085] Upon successful completion of the Screening Period, study subjects proceed to the Run in period, during which subjects initiate inclisiran treatment (i.e., two loading injections of inclisiran separated by 3 months) and any LLT dose modifications, if needed, as per clinical requirements. Approximately 30 days after the second loading injection of inclisiran, subjects enter the interventional double-blind treatment period of 6 months, followed by a 6-month open-label treatment period.9.1.4.1.2. Double-blind treatment period
[0086] Upon successful completion of the Screening Period and the run-in period, subjects proceed to the interventional double-blind treatment period. Subjects are randomized 1 :1 to one of two treatment arms• pelacarsen 80 mg s.c, monthly injection• placebo s.c, monthly injection9.1.4.1.3. Open-label treatment period
[0087] All subjects including those receiving placebo during the double-blind treatment period receive pelacarsen 80 mg s.c, monthly injection for 6 months.
[0088] Administration of background inclisiran treatment is per approved label, every 6 months during the double-blind treatment period and open-label treatment period.
[0089] After the open-label treatment period, all subjects complete a safety follow-up period of 16 weeks from the last treatment dose.9.1.4.2. Scientific rationale for study design
[0090] The scientific rationale for the study design is summarized in Table 4._ Table 4 _ Study Design Aspect _ Rationale _Overall The parallel, placebo-controlled design is appropriate to investigate efficacy, safety andPAT059941-PCT-SEC01Table 4Study Design Aspect Rationale tolerability of pelacarsen compared to placebo with background inclisiran treatmentRandomization (strata, allocation ratio) Randomization is the standard means for addressing known and unknown confounders in a clinical trial. 1 :1 randomization ensures equal allocation of subjects on each treatment armBlinding Double blinding minimizes bias and maximizes the internal validity of the results.Duration of study periods In pelacarsen’s phase lib study, 20 mg QW(total monthly exposure 80 mg) produced a large Lp(a) reduction of ~80% at Week 21 , similar to what was observed at the end of treatment period (week 25~27). Therefore, treatment duration of 6 months is believed to be sufficient for observing the maximum effect of pelacarsen.The 6-month open-label treatment period allows the collection of additional and longer-term safety data for pelacarsen with background inclisiran treatment9.1.4.3. Justification for dose
[0091] Pelacarsen 80 mg QM is chosen to provide maximal efficacy with an acceptable safety profile. A QM regimen decreases the overall burden to the subject associated with more frequent dosing and is expected to provide better local tolerability.
[0092] The maximal dose evaluated in a previous phase lib study of pelacarsen was 20 mg QW (total monthly exposure 80 mg). The 80 mg QM dose is expected to provide similar efficacy to the 20 mg QW regimen, as the overall monthly exposure is comparable. This is supported by the similar efficacy of pelacarsen observed at doses of 40 mg Q4W and 20 mg injected biweekly (Q2W). The overall exposure and reduction in Lp(a) between these regimens were similar; therefore, total monthly exposure to pelacarsen is believed to account for the efficacy of the drug. With regards to safety, there were no pelacarsen-related changes in PLT counts in humans at doses ranging from 20 mg / month to 20 mg / week (equivalent to 80 mg / month; total dose ranging from 260 to 1040 mg) relative to placebo. The intensive monitoring of PLT counts up to 52 weeks in the Phase lib study did not show confirmed decrease in PLT count below 100,000 / mm3. There was no imbalance in the incidence of any two occurrences of PLT counts <140,000 / mm3 between any of the individual pelacarsen treatment groups or pooled pelacarsen groups, and pooled placebo.PAT059941-PCT-SEC019.1.4.4. Rationale for choice of control drugs or combination drugs and background therapy
[0093] I nclisiran is a long-acting hepatic PCSK9 synthesis inhibitor providing >50% reduction in LDL C levels, complemented by a favorable safety profile. In addition, the benefits of infrequent dosing (twice a year) and administration by a healthcare professional are expected to significantly improve treatment adherence. As mentioned previously, a significant overlap may exist in patients with elevated LDL-C as well as elevated Lp(a). It is anticipated that pelacarsen, once approved, will be a viable therapy for the reduction of Lp(a) in patients with background inclisiran treatment. Therefore, it is imperative to evaluate the efficacy, safety, and tolerability of pelacarsen compared to placebo with background inclisiran treatment in subjects with ASCVD who have elevated levels of LDL-C and Lp(a). During the study when both pelacarsen and inclisiran need to be administered, pelacarsen is administered 4 days after the inclisiran injection in order to differentiate any drug-related safety events.
[0094] A placebo comparator is acceptable for this study since subjects will have the treatment of their CV risk factors optimized before initiating study treatment. No comparative Lp(a) lowering treatment to date has demonstrated to benefit patients with established CVD and elevated Lp(a) to reduce their CV risk; therefore, an active comparator has not been considered in this study.9.1.4.5. End of study definition
[0095] The end of the study is defined as the date of the last visit of the last subject in the study or last scheduled procedure shown in Table 3 for the last subject in the study globally.
[0096] All randomized and / or treated subjects have a safety follow-up conducted at least 16 weeks after last administration of study treatment. SAE reporting continues during this time period.9.1.5. Study Population
[0097] Approximately 340 subjects meeting the eligibility criteria are randomized.9.1.5.1. Inclusion criteria
[0098] Subjects eligible for inclusion in this study meet all of the following criteria:1 . Signed informed consent obtained prior to participation in the study2. Male and female subjects 18 to <80 years of age with established ASCVD at Screening visit.PAT059941-PCT-SEC013. Established ASCVD, defined as any of the following three conditions at Screening visit:Coronary heart disease (CHD) (at least one of below):• Prior myocardial infarction which occurred >3 months prior to the Screening visit• Prior coronary revascularization (PCI or CABG) which occurred >3 months prior to the Screening visit• Angiographic or CT-imaging (e.g. MDCT / CTA) evidence of coronary atherosclerosis: >70% stenosis in at least one major epicardial coronary artery, or >50% stenosis in two major epicardial coronary arteriesAnd / orCerebrovascular disease (CVD) (at least one of below):• Prior ischemic stroke confirmed by a brain imaging study - CT or MRI which occurred >3 months prior to the Screening visit• History of prior percutaneous or surgical carotid artery revascularization which occurred >3 months prior to the Screening visit• Carotid artery stenosis >70% or symptomatic carotid artery disease with at least 50% carotid arterial stenosis on prior angiography or ultrasoundAnd / orPeripheral arterial disease (PAD) (at least one of below):• Prior non-traumatic amputation of a lower extremity due to peripheral artery disease• History of prior percutaneous or surgical revascularization of an iliac, femoral, or popliteal artery• Prior documentation of a resting ankle-brachial index <0.854. On stable dose of local guideline recommended lipid lowering therapy (e.g., statins or ezetimibe, etc.) for at least 30-days prior to Screening visit as determined by the investigator5. Subjects successfully complete the run-in period of background inclisiran treatment6. On standard of care (SoC) treatment for other CVD risk factors including hypertension and diabetes for at least 30-days prior to Randomization / Baseline visit7. Central laboratory reported Lp(a) >175 nmol / L at Screening visitPAT059941-PCT-SEC018, Central laboratory reported LDL-C >70 mg / dL (or >1 .8 mmol / L) at Screening visit9.1.5.2. Exclusion criteria
[0099] Subjects meeting any of the following criteria are not eligible for inclusion in the study.1. Prior treatment with inclisiran2. Treatment with medication(s) capable of affecting the endogenous levels of proprotein convertase subtilisin / kexin type 9 (“PCSK9”) protein (e.g., evolocumab, alirocumab) within 4 months prior to Screening visit3. Uncontrolled hypertension defined as sitting systolic blood pressure (SBP) >160 mmHg and / or diastolic blood pressure (DBP) >100 mmHg (mean of 3 measurements for both SBP and DBP assessment) at Randomization / Baseline visit4. Heart failure New York Heart Association (NYHA) class IV at Screening visit or at Randomization / Baseline visit (Day 1)5. Triglycerides >400 mg / dL at Screening visit6. History of malignancy of any organ system (other than localized basal cell carcinoma or squamous cell carcinoma of the skin or in situ cervical cancer), treated or untreated, within the past 5 years, or if diagnosed between Screening visit and Randomization / Baseline visit (Day 1), regardless of whether there is evidence of local recurrence or metastases7. Between Screening visit and Randomization / Baseline visit (Day 1): myocardial infarction, stroke, other major bleeding, coronary or lower limb re-vascularization, major cardiac or non-cardiac surgery. The subject can be re-screened 3 months after the relevant event / procedure8. Platelet count <140,000 per mm3 from the central laboratory test at Screening visit confirmed by a second central laboratory test prior to the Randomization / Baseline visit (Day 1)9. Active liver disease or hepatic dysfunction, defined as aspartate aminotransferase (AST) or alanine aminotransferase (ALT) >2 times the upper limit of normal (ULN) from the central laboratory test at Screening visit, confirmed by a second central laboratory test prior to the Randomization / Baseline visit (Day 1)10. Total bilirubin (TBIL) >1 .5 times the ULN from the central laboratory test at Screening visit, confirmed by a second central laboratory test prior to thePAT059941-PCT-SEC01Randomization / Baseline visit (Day 1), or subjects with known Gilbert syndrome, independent of the TBIL value at Screening visit Estimated Glomerular Filtration Rate (eGFR) <30 mL / min / 1 .73 m2from central laboratory test at Screening visit, confirmed by a second central laboratory test prior to the Randomization / Baseline visit (Day 1); or patient on dialysis Significant glomerular disease (including but not limited to IgA nephropathy, diabetic nephropathy, systemic lupus erythematosus, etc.) with urinary protein-creatinine ratio (PCR) >500 mg / g (56.6 mg / mmol) at Screening visit, confirmed by a second central laboratory test prior to the Randomization / Baseline visit (Day 1) Severe concomitant non-CV disease that is anticipated to reduce life expectancy to less than 5 years, at Screening visit or at Randomization / Baseline visit (Day 1) Positive Human Immunodeficiency Virus (HIV), Hepatitis C screening or Hepatitis B Surface Antigen tests from the central laboratory test at Screening visit Use of other investigational drugs within 5 half-lives of Screening visit, or within 30 days, whichever is longer Unwillingness or inability (e.g., physical or cognitive) to comply with study procedures and medication administration (injections) and schedule at Screening visit Any other conditions, at Screening visit or between Screening visit and Randomization / Baseline visit (Day 1), which in the opinion of the Investigator would make the subject unsuitable for inclusion, or could interfere with the subject joining or completing the study Known active severe infection or major hematologic, metabolic, gastrointestinal or endocrine dysfunction (e.g. uncontrolled thyroid dysfunction or uncontrolled diabetes mellitus) in the judgment of the investigator, at Screening visit or at Randomization / Baseline visit (Day 1) Treatment with any oligonucleotide or small interfering ribonucleic acid (siRNA) within 9 months of Screening visit. Exceptions are RNA-based vaccines approved by health authorities Current treatment with lipoprotein apheresis at Screening visit or already planned to start lipoprotein apheresis during the study Treatment with niacin >2000 mg (2 g) daily in the 3 months prior to the Screening visit; niacin in multi-vitamins is allowed History of alcohol or drug abuse at Screening visitPAT059941-PCT-SEC0123. Any uncontrolled chronic or serious medical condition which may pose an immediate risk to clinical stability of the study subject at Screening visit24. Pregnant or nursing (lactating) women at Screening visit25. Women of child-bearing potential, defined as all women physiologically capable of becoming pregnant, unless they are using highly effective methods of contraception while taking study treatment and 16 weeks after the last dose of the study treatment. Highly effective contraception methods include one of the following:• Total abstinence (when this is in line with the preferred and usual lifestyle of the subject). Periodic abstinence (e.g., calendar, ovulation, symptothermal, post ovulation methods) and withdrawal are not acceptable methods of contraception• Female sterilization (have had surgical bilateral oophorectomy with or without hysterectomy), total hysterectomy at least six weeks before taking study treatment. In case of oophorectomy alone, only when the reproductive status of the woman has been confirmed by follow up hormone level assessment is she considered to be not of child bearing potential• Male sterilization (vasectomy) of male partner(s) of the female subject at least 6 months prior to Screening visit. For female subjects on the study, the vasectomized male partner should be the sole partner for that subject• Use of oral (estrogen and progesterone), injected, or implanted hormonal methods of contraception or placement of an intrauterine device (IUD) or intrauterine system (IUS), or other forms of hormonal contraception that have comparable efficacy (failure rate <1 %), for example hormone vaginal ring or transdermal hormone contraception• Bilateral tubal ligation at least six weeks before taking study treatment
[0100] In case of use of hormonal contraception, women should have been stable on the same method for a minimum of 3 months before taking study treatment.
[0101] Women are considered post-menopausal if they have had 12 months of natural (spontaneous) amenorrhea with an appropriate clinical profile (e.g., age-appropriate history of vasomotor symptoms). Women subjects are considered not of child-bearing potential if they are post menopausal or have had surgical bilateral oophorectomy (with or without hysterectomy), total hysterectomy or bilateral salpingectomy at least six weeks prior to enrollment on study. In the case of oophorectomy alone, only when the reproductive status of the woman has been confirmed by follow-up hormone level assessment is not considered to be of child-bearing potential. Pregnant or lactating women are excluded. Bilateral tubalPAT059941-PCT-SEC01 ligation is considered as a highly effective contraception method; however, it is not considered as permanent sterilization.9.1.5.3. Lifestyle considerations
[0102] At the Randomization / Baseline visit (Day 1), subjects are instructed to comply with lifestyle changes according to international recommendations (Eckel et al., 2014, Circulation: 129(25 Suppl 2):S76-99; Mach et al., 2020, Eur Heart J 41 (1 ): 111 -88), or equivalent local recommendations, and these instructions are enforced at visits specified in Table 3.9.1.6. Study Treatments9.1.6.1. Description of study treatments and treatment arms
[0103] The investigational drug, placebo, and demonstration kit used in this study are described in Table 5. Background treatment used in this study is described in Table 6.PAT059941-PCT-SEC01
[0104] Subjects are assigned at Day 1 (Baseline) to either pelacarsen or placebo in a 1 :1 randomization (Table 7).9.1.6.2. Instruction for prescribing and taking study treatment
[0105] Pelacarsen or placebo are administered once every 30 days.
[0106] For a subject, pelacarsen or placebo is dispensed every month at site injection visits (baseline to Month 3 and Month 6), and a 2-month supply to cover home administration visits at Month 4 and Month 5, during the double-blind treatment period. All subjects are dispensed only pelacarsen every month at site injection visits (Month 7, Month 8, Month 9 and Month 12), and a 2-month supply is provided to cover home administration at Month 10 and Month 11 of the open-label treatment period. In-between dispensation visits, subjects can return to the study site as required and in accordance with the drug supply situation at the site.
[0107] Pelacarsen can be injected independent of food intake. The injection is administered every 30 days calculated based on the first injection at the Baseline visit, with a time window for each injection ±7 days of that 30-day cycle. If the injection is not done within this time frame, the injection is considered missed, and the schedule continues with the next plannedPAT059941-PCT-SEC01 injection. Subjects are instructed not to administer missed doses outside the 7-day treatment window. The prefilled syringe, including the Needle Safety Device (NSD), is designed to deliver the investigational drug or placebo in a safe way, so that the subjects or their caregivers can use it in outpatient setting after appropriate instructions by a study site staff member according to the Instructions for Use (IFU).
[0108] The first four injections of pelacarsen / placebo, starting from the Baseline visit (Day 1), are performed in the context of observed assessment under the supervision of one study site staff member. The instruction and the review of the injection technique at the first 4 visits at the study site is documented in the source documents. If at any of these visits a subject / caregiver is evaluated by the study staff to be capable of unsupervised (self- jinjection, the subject is no longer be required to undergo the IFU injection assessment. In case that a subject or care provider is not assessed to be capable for unsupervised (self- jinjection before Visit 4 (Month 3), training and re-assessment continues at the following study visits.
[0109] All subjects are administered two loading doses of inclisiran as background treatment at Run-in 1 and Run-in 2, separated by 3 months, according to the approved label. After that inclisiran is administered every 6 months, i.e., Month 5 and Month 11. Inclisiran is administrated by a healthcare professional at the site by injection subcutaneously into the abdomen, upper arm, or thigh. At Month 5 and Month 11 , when both pelacarsen and inclisiran need to be administered, pelacarsen is administered 4 days after the inclisiran injection in order to differentiate any drug-related safety events.
[0110] The study treatment (pelacarsen or placebo) or background treatment (inclisiran) are not injected in areas of active skin disease or injury, such as sunburns, skin rashes, inflammation, or skin infection. The background treatment and study treatment are injected at different locations, in order to record any drug-related injection site reactions appropriately.9.1.6.3. Prohibited Therapies
[0111] Use of the treatments displayed in the Table 8 are not allowed to be initiated during the study:PAT059941-PCT-SEC019.1.7. Results
[0112] Pelacarsen treatment in subjects with atherosclerotic cardiovascular disease (ASCVD) who have elevated Lp(a), and who are on background inclisiran treatment for elevated LDL-C, reduces Lp(a) levels.10. CITATION OF REFERENCES
[0113] All publications, patents, patent applications and other documents cited in this application are hereby incorporated by reference in their entireties for all purposes to the same extent as if each individual publication, patent, patent application or other document were individually indicated to be incorporated by reference for all purposes. In the event that there is an inconsistency between the teachings of one or more of the references incorporated herein and the present disclosure, the teachings of the present specification are intended.
Claims
PAT059941-PCT-SEC01WHAT IS CLAIMED IS:1 . A method of treating a subject having elevated lipoprotein A (“Lp(a)”) and who is receiving or who is to receive proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor therapy for elevated low-density lipoprotein associated cholesterol (“LDL-C”), comprising administering a therapeutically effective amount of an Lp(a) inhibitor to the subject.
2. A method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and who is receiving or who is to receive proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor therapy, comprising administering a therapeutically effective amount of an Lp(a) inhibitor to the subject.
3. An agent which is a lipoprotein A (“Lp(a)”) inhibitor for use in a method of treating a subject having elevated lipoprotein A (“Lp(a)”) and who is receiving or who is to receive proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor therapy for elevated low-density lipoprotein associated cholesterol (“LDL-C”), wherein the method comprises administering a therapeutically effective amount of the Lp(a) inhibitor to the subject.
4. An agent which is a lipoprotein A (“Lp(a)”) inhibitor for use in a method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and who is receiving or who is to receive proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor therapy, wherein the method comprises administering a therapeutically effective amount of the Lp(a) inhibitor to the subject.
5. The method of claim 1 or claim 2 or agent for use according to claim 3 or claim 4, wherein the therapeutically effective amount of the Lp(a) inhibitor is an amount effective to reduce an Lp(a) level of the subject.
6. The method or agent for use according to any one of claims 1 to 5, wherein the PCSK9 inhibitor therapy has commenced prior to administration of the Lp(a) inhibitor.
7. The method or agent for use according to any one of claims 1 to 6, wherein the method comprises multiple administrations of the Lp(a) inhibitor, e.g., over the course of six months, one year, or indefinitely.
8. The method or agent for use according to any one of claims 1 to 7, wherein the Lp(a) inhibitor comprises an antisense agent.PAT059941-PCT-SEC019. The method or agent for use according to any one of claims 1 to 8, wherein the Lp(a) inhibitor comprises pelacarsen.
10. The method or agent for use according to claim 9, wherein the method comprises administering 80 mg of pelacarsen to the subject per month.11 . The method or agent for use according to claim 9 or claim 10, wherein the method comprises administering pelacarsen to the subject once per month.
12. The method or agent for use according to any one of claims 9 to 11 , wherein the method comprises administering 80 mg of pelacarsen to the subject once per month.
13. The method or agent for use according to claim 9, wherein the method comprises administering pelacarsen to the subject once every thirty days ± 7 days.
14. The method or agent for use according to claim 9 or claim 13, wherein the method comprises administering 80 mg of pelacarsen to the subject once every thirty days ± 7 days.
15. The method or agent for use according to any one of claims 9 to 14, wherein the method comprises administering pelacarsen to the subject subcutaneously.
16. The method or agent for use according to any one of claims 9 to 15, wherein the method comprises administering a unit dosage form comprising 80 mg of pelacarsen in a volume of 0.8 mL to the subject.
17. The method or agent for use according to any one of claims 1 to 16, wherein the PCSK9 inhibitor comprises an RNAi agent (e.g., inclisiran) or an antibody (e.g., evolocumab or alirocumab).
18. The method or agent for use according to any one of claims 1 to 17, wherein the PCSK9 inhibitor comprises inclisiran.
19. The method or agent for use according to any one of claims 1 to 18, wherein the Lp(a) inhibitor comprises pelacarsen and the PCSK9 inhibitor comprises inclisiran.
20. The method or agent for use according to any one of claims 1 to 19, wherein the PCSK9 inhibitor comprises inclisiran and the PCSK9 inhibitor therapy comprises two loading doses of inclisiran.PAT059941-PCT-SEC0121 . The method or agent for use according to claim 20, wherein the two loading doses of inclisiran are separated by three months.
22. The method or agent for use according to claim 20, wherein the two loading doses of inclisiran are separated by 90 days ± 7 days.
23. The method or agent for use according to any one of claims 20 to 22, wherein the PCSK9 inhibitor therapy comprises one dose of inclisiran every six months following the second loading dose.
24. The method or agent for use according to any one of claims 20 to 23, wherein the PCSK9 inhibitor therapy comprises an initial loading dose of inclisiran, a second loading dose of inclisiran at three months, and then a dose of inclisiran every six months.
25. The method or agent for use according to any one of claims 20 to 24, wherein the method comprises administering the Lp(a) inhibitor to the subject subsequent to the second loading dose of inclisiran.
26. The method or agent for use according to any one of claims 1 to 25, wherein the PCSK9 inhibitor therapy comprises inclisiran administered subcutaneously to the subject.
27. The method or agent for use according to any one of claims 1 to 26, wherein the PCSK9 inhibitor therapy comprises inclisiran administered subcutaneously to the subject at a dose of 284 mg.
28. The method or agent for use according to any one of claims 1 to 27, wherein the PCSK9 inhibitor therapy comprises inclisiran administered subcutaneously to the subject at a dose of 284 mg in a volume of 1 .5 mL.
29. A method of treating a subject having elevated lipoprotein A (“Lp(a)”) and who is receiving or who is to receive inclisiran therapy for elevated low-density lipoprotein associated cholesterol (“LDL-C”), comprising administering a therapeutically effective amount of pelacarsen to the subject.
30. A method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and who is receiving or who is to receive inclisiran therapy, comprising administering a therapeutically effective amount of pelacarsen to the subject.PAT059941-PCT-SEC0131 . An agent which is pelacarsen for use in a method of treating a subject having elevated lipoprotein A (“Lp(a)”) and who is receiving or who is to receive inclisiran therapy for elevated low-density lipoprotein associated cholesterol (“LDL-C”), wherein the method comprises administering a therapeutically effective amount of pelacarsen to the subject.
32. An agent which is pelacarsen for use in a method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and who is receiving or who is to receive inclisiran therapy, wherein the method comprises administering a therapeutically effective amount of pelacarsen to the subject.
33. The method of claim 29 or claim 30 or agent for use according to claim 31 or claim 32, wherein the method comprises administering 80 mg of pelacarsen to the subject subcutaneously once per month.
34. The method of or agent for use according to any one of claims 29 to 33, wherein:(a) the inclisiran therapy comprises an initial loading dose of inclisiran, a second loading dose of inclisiran at three months, and then a dose of inclisiran every six months, wherein each dose of inclisiran is 284 mg administered subcutaneously; and(b) the method comprises administering 80 mg of pelacarsen to the subject subcutaneously once per month, optionally wherein a first dose of pelacarsen is administered to the subject subsequent to the second loading dose of inclisiran (e.g., one month after the second loading dose).
35. A method of treating a subject having elevated lipoprotein A (“Lp(a)”) and elevated low-density lipoprotein associated cholesterol (“LDL-C”), comprising administering to the subject a therapeutically effective amount of an Lp(a) inhibitor and a therapeutically effective amount of a proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor.
36. A method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and low-density lipoprotein associated cholesterol (“LDL-C”) lowering therapy, comprising administering to the subject a therapeutically effective amount of an Lp(a) inhibitor and a therapeutically effective amount of a proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor.
37. An agent which is a lipoprotein A (“Lp(a)”) inhibitor for use in a method of treating a subject having elevated Lp(a) and elevated low-density lipoprotein associatedPAT059941-PCT-SEC01 cholesterol (“LDL-C”), wherein the method comprises administering to the subject a therapeutically effective amount of the Lp(a) inhibitor and a therapeutically effective amount of a proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor.
38. An agent which is a lipoprotein A (“Lp(a)”) inhibitor for use in a method of treating a subject in need of Lp(a) lowering therapy and low-density lipoprotein associated cholesterol (“LDL-C”) lowering therapy, wherein the method comprises administering to the subject a therapeutically effective amount of the Lp(a) inhibitor and a therapeutically effective amount of a proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor.
39. An agent which is a proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor for use in a method of treating a subject having elevated lipoprotein A (“Lp(a)”) and elevated low-density lipoprotein associated cholesterol (“LDL-C”), wherein the method comprises administering to the subject a therapeutically effective amount of an Lp(a) inhibitor and a therapeutically effective amount of the PCSK9 inhibitor.
40. An agent which is a proprotein convertase subtilisin / kexin type 9 (“PCSK9”) inhibitor for use in a method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and low-density lipoprotein associated cholesterol (“LDL-C”) lowering therapy, wherein the method comprises administering to the subject a therapeutically effective amount of an Lp(a) inhibitor and a therapeutically effective amount of the PCSK9 inhibitor.41 . The method of claim 35 or claim 36 or agent for use according to any one of claims 37 to 40, wherein the therapeutically effective amount of the Lp(a) inhibitor is an amount effective to reduce an Lp(a) level of the subject.
42. The method or agent for use according to any one of claims 35 to 41 , wherein the therapeutically effective amount of the PCSK9 inhibitor is an amount effective to reduce an LDL-C level of the subject.
43. The method or agent for use according to any one of claims 35 to 42, wherein the method comprises administering the PCSK9 inhibitor to the subject one or more times prior to administering the Lp(a) inhibitor to the subject for the first time.
44. The method or agent for use according to any one of claims 35 to 43, wherein the method comprises multiple administrations of the Lp(a) inhibitor, e.g., over the course of six months, one year, or indefinitely.
45. The method or agent for use according to any one of claims 35 to 44, wherein the Lp(a) inhibitor comprises an antisense agent.PAT059941-PCT-SEC0146. The method or agent for use according to any one of claims 35 to 45, wherein the Lp(a) inhibitor comprises pelacarsen.
47. The method or agent for use according to claim 46, wherein the method comprises administering 80 mg of pelacarsen to the subject per month.
48. The method or agent for use according to claim 46 or claim 47, wherein the method comprises administering pelacarsen to the subject once per month.
49. The method or agent for use according to any one of claims 46 to 48, wherein the method comprises administering 80 mg of pelacarsen to the subject once per month.
50. The method or agent for use according to claim 46, wherein the method comprises administering pelacarsen to the subject once every thirty days ± 7 days.51 . The method or agent for use according to claim 46 or claim 50, wherein the method comprises administering 80 mg of pelacarsen to the subject once every thirty days ± 7 days.
52. The method or agent for use according to any one of claims 46 to 51 , wherein the method comprises administering pelacarsen to the subject subcutaneously.
53. The method or agent for use according to any one of claims 46 to 52, wherein the method comprises administering a unit dosage form comprising 80 mg of pelacarsen in a volume of 0.8 mL to the subject.
54. The method or agent for use according to any one of claims 35 to 53, wherein the PCSK9 inhibitor comprises an RNAi agent (e.g., inclisiran) or an antibody (e.g., evolocumab or alirocumab).
55. The method or agent for use according to any one of claims 35 to 54, wherein the PCSK9 inhibitor comprises inclisiran.
56. The method or agent for use according to any one of claims 35 to 55, wherein the Lp(a) inhibitor comprises pelacarsen and the PCSK9 inhibitor comprises inclisiran.
57. The method or agent for use according to any one of claims 35 to 56, wherein the PCSK9 inhibitor comprises inclisiran and the method comprises administering two loading doses of inclisiran to the subject.PAT059941-PCT-SEC0158. The method or agent for use according to claim 57, wherein the two loading doses of inclisiran are separated by three months.
59. The method or agent for use according to claim 57, wherein the two loading doses of inclisiran are separated by 90 days ± 7 days.
60. The method or agent for use according to any one of claims 57 to 59, wherein the method comprises administering one dose of inclisiran to the subject every six months following the second loading dose.61 . The method or agent for use according to any one of claims 55 to 60, wherein the method comprises administering an initial loading dose of inclisiran to the subject, administering a second loading dose of inclisiran to the subject at three months, and then administering a dose of inclisiran to the subject every six months.
62. The method or agent for use according to any one of claims 57 to 61 , wherein the method comprises administering the Lp(a) inhibitor to the subject subsequent to the second loading dose of inclisiran.
63. The method or agent for use according to any one of claims 35 to 62, wherein the PCSK9 inhibitor comprises inclisiran and the method comprises administering inclisiran to the subject subcutaneously.
64. The method or agent for use according to any one of claims 35 to 63, wherein the PCSK9 inhibitor comprises inclisiran and the method comprises administering inclisiran subcutaneously to the subject at a dose of 284 mg.
65. The method or agent for use according to any one of claims 35 to 64, wherein the PCSK9 inhibitor comprises inclisiran and the method comprises administering inclisiran subcutaneously to the subject at a dose of 284 mg in a volume of 1 .5 mL.
66. A method of treating a subject having elevated lipoprotein A (“Lp(a)”) and elevated lipoprotein associated cholesterol (“LDL-C”), comprising administering a therapeutically effective amount of pelacarsen and a therapeutically effective amount of inclisiran to the subject.
67. A method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and lipoprotein associated cholesterol (“LDL-C”) lowering therapy, comprising administering a therapeutically effective amount of pelacarsen and a therapeutically effective amount of inclisiran to the subject.PAT059941-PCT-SEC0168. An agent which is pelacarsen for use in a method of treating a subject having elevated lipoprotein A (“Lp(a)”) and elevated low-density lipoprotein associated cholesterol (“LDL-C”), wherein the method comprises administering a therapeutically effective amount of pelacarsen and a therapeutically effective amount of inclisiran to the subject.
69. An agent which is pelacarsen for use in a method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and low-density lipoprotein associated cholesterol (“LDL-C”) lowering therapy, wherein the method comprises administering a therapeutically effective amount of pelacarsen and a therapeutically effective amount of inclisiran to the subject70. An agent which is inclisiran for use in a method of treating a subject having elevated lipoprotein A (“Lp(a)”) and elevated low-density lipoprotein associated cholesterol (“LDL-C”), wherein the method comprises administering a therapeutically effective amount of pelacarsen and a therapeutically effective amount of inclisiran to the subject.
71. An agent which is inclisiran for use in a method of treating a subject in need of lipoprotein A (“Lp(a)”) lowering therapy and low-density lipoprotein associated cholesterol (“LDL-C”) lowering therapy, wherein the method comprises administering a therapeutically effective amount of pelacarsen and a therapeutically effective amount of inclisiran to the subject.
72. The method of claim 66 or claim 67 or agent for use according to any one of claims claim 68 to 71 , wherein the method comprises administering 80 mg of pelacarsen to the subject subcutaneously once per month and 284 mg of inclisiran to the subject once every six months.
73. The method or agent for use according to any one of claims 66 to 72, wherein the method comprises:(a) administering an initial loading dose of inclisiran to the subject, administering a second loading dose of inclisiran to the subject at three months, and then administering a dose of inclisiran every six months, wherein each dose of inclisiran is 284 mg administered subcutaneously; and(b) administering 80 mg of pelacarsen to the subject subcutaneously once per month, optionally wherein a first dose of pelacarsen is administered to the subject subsequent to the second loading dose of inclisiran (e.g., one month after the second loading dose).PAT059941-PCT-SEC0174. The method or agent for use according to any one of claims 1 to 73, wherein the subject has a plasma or serum Lp(a) level > 75 nmol / L prior to administration of the Lp(a) inhibitor.
75. The method or agent for use according to any one of claims 1 to 73, wherein the subject has a plasma or serum Lp(a) level > 100 nmol / L prior to administration of the Lp(a) inhibitor.
76. The method or agent for use according to any one of claims 1 to 73, wherein the subject has a plasma or serum Lp(a) level > 125 nmol / L prior to administration of the Lp(a) inhibitor.
77. The method or agent for use according to any one of claims 1 to 73, wherein the subject has a plasma or serum Lp(a) level > 175 nmol / L prior to administration of the Lp(a) inhibitor.
78. The method or agent for use according to any one of claims 1 to 73, wherein the subject has a plasma or serum Lp(a) level > 30 mg / dL prior to administration of the Lp(a) inhibitor.
79. The method or agent for use according to any one of claims 1 to 73, wherein the subject has a plasma or serum Lp(a) level > 50 mg / dL prior to administration of the Lp(a) inhibitor.
80. The method or agent for use according to any one of claims 1 to 73, wherein the subject has a plasma Lp(a) level > 75 nmol / L prior to administration of the Lp(a) inhibitor.81 . The method or agent for use according to any one of claims 1 to 73, wherein the subject has a plasma Lp(a) level > 100 nmol / L prior to administration of the Lp(a) inhibitor.
82. The method or agent for use according to any one of claims 1 to 73, wherein the subject has a plasma Lp(a) level > 125 nmol / L prior to administration of the Lp(a) inhibitor.
83. The method or agent for use according to any one of claims 1 to 73, wherein the subject has a plasma Lp(a) level > 175 nmol / L prior to administration of the Lp(a) inhibitor.PAT059941-PCT-SEC0184. The method or agent for use according to any one of claims 1 to 73, wherein the subject has a plasma Lp(a) level > 30 mg / dL prior to administration of the Lp(a) inhibitor.
85. The method or agent for use according to any one of claims 1 to 73, wherein the subject has a plasma Lp(a) level > 50 mg / dL prior to administration of the Lp(a) inhibitor.
86. The method or agent for use according to any one of claims 1 to 73, wherein the subject has a serum Lp(a) level > 75 nmol / L prior to administration of the Lp(a) inhibitor.
87. The method or agent for use according to any one of claims 1 to 73, wherein the subject has a serum Lp(a) level > 100 nmol / L prior to administration of the Lp(a) inhibitor.
88. The method or agent for use according to any one of claims 1 to 73, wherein the subject has a serum Lp(a) level > 125 nmol / L prior to administration of the Lp(a) inhibitor.
89. The method or agent for use according to any one of claims 1 to 73, wherein the subject has a serum Lp(a) level > 175 nmol / L prior to administration of the Lp(a) inhibitor.
90. The method or agent for use according to any one of claims 1 to 73, wherein the subject has a serum Lp(a) level > 30 mg / dL prior to administration of the Lp(a) inhibitor.91 . The method or agent for use according to any one of claims 1 to 73, wherein the subject has a serum Lp(a) level > 50 mg / dL prior to administration of the Lp(a) inhibitor.
92. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 70 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
93. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 100 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
94. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 130 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
95. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 160 mg / dL prior to the PCSK9 inhibitorPAT059941-PCT-SEC01 therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
96. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 190 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
97. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 1.8 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
98. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 2.6 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
99. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 3.4 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
100. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 4.1 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.101 . The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma or serum LDL-C level > 4.9 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
102. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma LDL-C level > 70 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
103. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma LDL-C level > 100 mg / dL priorto the PCSK9 inhibitor therapy orPAT059941-PCT-SEC01 prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
104. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma LDL-C level > 130 mg / dL priorto the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
105. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma LDL-C level > 160 mg / dL priorto the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
106. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma LDL-C level > 190 mg / dL priorto the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
107. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma LDL-C level > 1.8 mmol / L priorto the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
108. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma LDL-C level > 2.6 mmol / L priorto the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
109. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma LDL-C level > 3.4 mmol / L priorto the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
110. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma LDL-C level > 4.1 mmol / L priorto the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
111. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a plasma LDL-C level > 4.9 mmol / L priorto the PCSK9 inhibitor therapy orPAT059941-PCT-SEC01 prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
112. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a serum LDL-C level > 70 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or priorto administration of the Lp(a) inhibitor.
113. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a serum LDL-C level > 100 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
114. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a serum LDL-C level > 130 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
115. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a serum LDL-C level > 160 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
116. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a serum LDL-C level > 190 mg / dL prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
117. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a serum LDL-C level > 1.8 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
118. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a serum LDL-C level > 2.6 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
119. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a serum LDL-C level > 3.4 mmol / L prior to the PCSK9 inhibitor therapy orPAT059941-PCT-SEC01 prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
120. The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a serum LDL-C level > 4.1 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.121 . The method or agent for use according to any one of claims 1 to 91 , wherein the subject has a serum LDL-C level > 4.9 mmol / L prior to the PCSK9 inhibitor therapy or prior to administration of the PCSK9 inhibitor, and / or prior to administration of the Lp(a) inhibitor.
122. The method or agent for use according to any one of claims 92 to 121 , wherein the LDL-C level is an LDL-C level as calculated by the Friedewald equation.
123. The method or agent for use according to any one of claims 1 to 122, wherein the subject is at least 18 years of age.
124. The method or agent for use according to any one of claims 1 to 123, wherein the subject is 18 to 80 years of age.
125. The method or agent for use according to any one of claims 1 to 124, wherein the subject has atherosclerotic cardiovascular disease (ASCVD).
126. The method or agent for use according to any one of claims 1 to 125, wherein the subject has coronary heart disease.
127. The method or agent for use according to claim 126, wherein the subject has had a myocardial infarction prior to administration of the Lp(a) inhibitor (e.g., >3 months prior).
128. The method or agent for use according to any claim 126 or claim 127, wherein the subject has had a coronary revascularization procedure priorto administration of the Lp(a) inhibitor (e.g., >3 months prior).
129. The method or agent for use according to claim 128, wherein the revascularization procedure is percutaneous coronary intervention (PCI) or coronary artery bypass grafting (CABG).PAT059941-PCT-SEC01130. The method for use according to any one of claims 126 to 129, wherein the subject has >70% stenosis in at least one major epicardial coronary artery or >50% stenosis in two major epicardial coronary arteries, e.g., as determined by angiographic or CT-imaging (e.g. MDCT / CTA).131 . The method or agent for use according to any one of claims 1 to 130, wherein the subject has subject has cerebrovascular disease (CVD).
132. The method or agent for use according to claim 131 , wherein the subject has had an ischemic stroke prior (e.g., >3 months prior) to administration of the Lp(a) inhibitor, e.g., confirmed by a brain imaging study such as CT or MRI.
133. The method or agent for use according to claim 131 or claim 132, wherein the subject has had a percutaneous or surgical carotid artery revascularization priorto (e.g., >3 months prior) to administration of the Lp(a) inhibitor.
134. The method or agent for use according to any one of claims 131 to 133, wherein the subject has a carotid artery stenosis >70% or symptomatic carotid artery disease with at least 50% carotid arterial stenosis (e.g., as determined by angiography or ultrasound) prior to administration of the Lp(a) inhibitor.
135. The method or agent for use according to any one of claims 1 to 134, wherein the subject has peripheral arterial disease (PAD).
136. The method or agent for use according to claim 135, wherein the subject has had a non-traumatic amputation of a lower extremity due to peripheral artery disease prior to administration of the Lp(a) inhibitor.
137. The method or agent for use according to claim 135 or claim 136, wherein the subject has had a percutaneous or surgical revascularization of an iliac, femoral, or popliteal artery prior to administration of the Lp(a) inhibitor.
138. The method or agent for use according to any one of claims 135 to 137, wherein the subject has a resting ankle-brachial index <0.85 prior to administration of the Lp(a) inhibitor.
139. The method or agent for use according to any one of claims 1 to 138, wherein the subject is receiving a lipid-lowering therapy (e.g., a statin and / or ezetimibe).PAT059941-PCT-SEC01140. The method or agent for use according to any one of claims 1 to 139, wherein the subject is receiving a standard of care (SoC) treatment for a CVD risk factor (e.g., hypertension and / or diabetes).
141. The method or agent for use according to any one of claims 1 to 140, wherein the subject is a subject as described in Section 5.4.
142. A combination comprising pelacarsen and inclisiran, optionally for use in a method described in any of the preceding claims.