Combinations of antisense agents, pharmaceutical compositions and methods of use

Abstract

Disclosed are, inter alia, combinations comprising a first antisense (e.g., first double stranded RNAi (dsRNAi)) agent for inhibiting expression of proprotein convertase subtilisin kexin 9 (PCSK9), for example, human PCSK9, and a second antisense agent (e.g., second dsRNAi agent) for inhibiting expression of lipoprotein (a) (Lp(a)); pharmaceutical compositions including the same, and methods of treatment using the same.

Description

PAT059933-PCT-SEC01 COMBINATIONS OF ANTISENSE AGENTS, PHARMACEUTICAL COMPOSITIONS AND METHODS OF USECROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims priority and benefit to the U. S. Patent Application No.63 / 737039, filed December 20, 2024, the disclosure of which is incorporated herein by reference in its entirety.TECHNICAL FIELD

[0002] The present disclosure provides, inter alia, combinations comprising double stranded RNAi (dsRNAi) agents inhibiting expression of proprotein convertase subtilisin kexin 9 (PCSK9), for example, human PCSK9 and dsRNAi agents inhibiting expression of Lipoprotein (a) (Lp(a)), for example, human Lp(a), pharmaceutical compositions including the same, and methods of treatment using the same.BACKGROUND

[0003] Cumulative low-density lipoprotein cholesterol (LDL-C) exposure in the arterial wall is a major cause of atherosclerotic cardiovascular disease (ASCVD). The level of LDL-C in the arterial wall can be controlled (e.g., lowered) by modulating cholesterol homeostasis (e.g., cholesterol biosynthesis in liver cells) and upregulating LDL-C uptake from the blood.

[0004] PCSK9 is a member of the subtilisin serine protease family and is involved in cholesterol metabolism and homeostasis. A liver cell uptakes LDL-C via low-density lipoprotein receptor (LDLR) to directly remove such atherosclerotic lipoproteins from the plasma via uptake into a liver cell. If the level of LDLR decreases, LDL-C level increases in circulation, and the elevated circulating LDL-C level causes increased deposition in the arteries of LDL particles and the cholesterol they carry, which promotes the formation and progression of atherosclerotic plaques in the artery. PCSK9 binds to hepatic LDLR to induce endocytosis and lysosomal degradation of LDLR in the liver cell, thereby reducing LDL-C uptake by LDLR. PCSK9 inhibitors have been clinically proven to reduce LDLR degradation by inhibiting PCSK9 expression / function and lower LDL-C levels in the general population.

[0005] However, there is still an unmet need in the art for LDL-C lowering treatments that have increased potency and / or durability of action.

[0006] Lp(a) is a cholesterol rich particle of the pro-atherogenic LDL class. High concentrations of Lp(a) are strongly associated with an increased risk of cardiovascular disease. Lp(a) contains two disulfide-linked distinct proteins, apolipoprotein (a) (or ApoA) and apolipoprotein B (or ApoB). Apolipoprotein (a) is a unique apolipoprotein encoded by the LPA gene which has been shown to exclusively control thePAT059933-PCT-SEC01 physiological concentrations of Lp(a). It varies in size due to interallelic differences in the number of tandemly repeated Kringle-4-encoding 5.5 kb sequences in the LPA gene. There remains a long-felt need for additional agents and methods capable of effectively modulating, e.g., inhibiting, Lp(a) function, and particularly a need for agents capable of safe and efficacious administration to lower Lp(a) levels in patients at risk for the development of coronary artery disease.

[0007] Therefore, there is an unmet need in the art for alternative treatments (e.g., lowering cholesterol or LDL-C) for subjects having lipid metabolism disorders.

[0008] There is also a need in the art for more convenient treatments for lowering cholesterol or LDL-C, particularly in view of the poor patient adherence often associated with such treatments.SUMMARY OF THE INVENTION

[0009] Provided herein are, inter alia, compounds that can inhibit expression of PCSK9 and / or Lp(a) in a subject, for example, e.g., in liver cells of a subject.In an aspect, the disclosure provides a combination comprising a first antisense agent and a second antisense agent, wherein:(a) the first antisense agent is a proprotein convertase subtilisin kexin 9 (PCSK9) inhibitor; and(b) the second antisense agent is a lipoprotein (a) (Lp(a)) inhibitor.

[0010] In some embodiments, the first antisense agent is a double stranded RNAi (dsRNAi) agent. In some embodiments, the second antisense agent is a dsRNAi agent. In some embodiments, the first antisense agent is a double stranded RNAi (dsRNAi) agent and the second antisense agent is a dsRNAi agent. In some embodiments, the first antisense agent is an antisense oligonucleotide (ASO) agent. In some embodiments, the second antisense agent is an ASO agent. In some embodiments, the first antisense agent is an ASO agent and the second antisense agent is an ASO agent. In some embodiments, the first antisense agent is a dsRNAi agent and the second antisense agent is an ASO agent. In some embodiments, the first antisense agent is an ASO agent and the second antisense agent is a dsRNAi agent.

[0011] In an aspect, the disclosure provides a combination comprising a first antisense agent and a second antisense agent, wherein:(a) the first antisense agent is a proprotein convertase subtilisin kexin 9 (PCSK9) inhibitor; and (b) the second antisense agent is a lipoprotein (a) (Lp(a)) inhibitor.

[0012] In some embodiments, the first antisense agent is a double stranded RNAi (dsRNAi) agent. In some embodiments, the second antisense agent is a dsRNAi agent.PAT059933-PCT-SEC01

[0013] In an aspect, the disclosure provides a combination comprising a first double stranded RNAi (dsRNAi) agent and a second dsRNAi agent, wherein: (a) the first dsRNAi agent is a PCSK9 inhibitor; and (b) the second dsRNAi agent is a Lp(a) inhibitor.

[0014] In some embodiments, the first dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 761 and an antisense strand consisting of SEQ ID NO: 778.

[0015] In some embodiments, the second dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 1917 and (b) an antisense strand consisting of SEQ ID NO: 1938.

[0016] In some embodiments, the second dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 1918 and (b) an antisense strand consisting of SEQ ID NO: 1939.

[0017] In some embodiments, the first dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 761 and an antisense strand consisting of SEQ ID NO: 778; and the second dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 1917 and (b) an antisense strand consisting of SEQ ID NO: 1938.

[0018] In some embodiments, the first dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 761 and an antisense strand consisting of SEQ ID NO: 778; and the second dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 1918 and (b) an antisense strand consisting of SEQ ID NO: 1939.

[0019] In some embodiments, one or more nucleotides in the sense strand and the antisense strand of the first dsRNAi agent are modified nucleotides. In some embodiments, one or more nucleotides in the sense strand and the antisense strand of the second dsRNAi agent are modified nucleotides.

[0020] In some embodiments, each of the one or more modified nucleotides independently comprises one or more modifications selected from a 2’-deoxy modification, a 2’-O-alkyl modification, a 2'-halo modification, a threofuranosyl nucleotide (TNA) modification, a 2’-5’-linkage modification, a conformationally restricting modification, an abasic modification, a 2’-amino-modification, a 2’-O-allyl modification, 2’-C-alkyl modification, a 2’-O-alkoxyalkyl modification, a morpholino modification, a phosphoramidate modification, a non-natural nucleobase modification, a modification in a tetrahydropyran, a modification containing a 1,5-anhydrohexitol, a modification containing a cyclohexenyl, a modification containing a phosphorothioate group, a modification containing a 5’-vinyl-phosphonate, a modification containing a 5 ’-phosphate, a modification to form a thermally destabilizing nucleotide, a glycol nucleic acid (GNA) modification, a 2-O-(N-methylacetamide) modification, a phosphate linkage, a phosphorothioate linkage, an inverted deoxyadenosine (3 '-3' linked nucleotide), an isomannitol residue (Imann) for examplePAT059933-PCT-SEC01orand an inverted abasic modification, for example

[0021] In some embodiments, each of the one or more modified nucleotides independently comprises one or more modifications selected from 2’ -deoxy modification, 2'-O-alkoxyalkyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-C-alkyl modification, 2'-halo modification, modification containing a non-natural nucleobase, a GNA modification, and a TNA modification.

[0022] In some embodiments, the first and / or second dsRNAi agent comprises a 3’-phosphorothioate (PS) modification.

[0023] In some embodiments, each of the one or more modified nucleotides independently comprises one or more modifications selected from 2’-deoxy modification, 2’-O-methyl (2’-OMe) modification, 2’-fluoro (2’-F) modification, 2’-O-methoxyethyl (2’-M0E) modification, a modification containing a non-natural nucleobase, TNA, GNA, 3’-phosphorothioate (PS) modification, and 5 ’-vinyl -phosphonate (5 ’-VP) modification.

[0024] In some embodiments, the first dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 795 and (b) an antisense strand consisting of SEQ ID NO: 848.

[0025] In some embodiments, the second dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 1959 and (b) an antisense strand consisting of SEQ ID NO: 1968.

[0026] In some embodiments, the second dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 1962 and (b) an antisense strand consisting of SEQ ID NO: 1971.

[0027] In some embodiments, the first dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 795 and (b) an antisense strand consisting of SEQ ID NO: 848; and the second dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 1959 and an antisense strand consisting of SEQ ID NO: 1968.PAT059933-PCT-SEC01

[0028] In some embodiments, the first dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 795 and (b) an antisense strand consisting of SEQ ID NO: 848; and the second dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 1962 and (b) an antisense strand consisting of SEQ ID NO: 1971.

[0029] In some embodiments, the first dsRNAi agent further comprises a ligand.

[0030] In some embodiments, the second dsRNAi agent further comprises a ligand.

[0031] In some embodiments, the ligand comprises a N-acetylgalactosamine (GalNAc) moiety.

[0032] In some embodiments, the ligand has a structure of:or a pharmaceutically acceptable salt thereof, wherein:each L1is independently a linker which may be same or different in each occurrence;L2is a linker;n is an integer from 1 to 3; andis an attachment point to the sense strand or the antisense strand, or to a conjugate linker conjugated to the sense strand or the antisense strand.

[0033] In some embodiments, the ligand comprises the following structure ofPAT059933-PCT-SEC01or a pharmaceutically acceptable salt thereof, wherein:each pl, p2, p3, ql, q2, rl, r2 and r3 is independently an integer from 0 to 12;each nl, n2, and n3 is independently an integer from 1 to 3; and“*” is an attachment point to L2.

[0034] In some embodiments, the ligand has a structure of:NHAcor a pharmaceutically acceptable salt thereof, wherein:each L11, L12, L13, L14, and L15is an independently a linker;L2is a linker;is an attachment point to the sense strand or the antisense strand, or to a conjugate linker conjugated to the sense strand or the antisense strand.

[0035] In some embodiments, the ligand has a structure of:PAT059933-PCT-SEC01or a pharmaceutically acceptable salt thereof, wherein:each p11 and q11 is independently an integer from 0 to 12;each zl, z2, and z3 is independently an integer of 0 to 12; andis an attachment point to the sense strand or the antisense strand, or to a conjugate linker conjugated to the sense strand or the antisense strand.

[0036] In some embodiments, the ligand comprises the following structure:PAT059933-PCT-SEC01oror a pharmaceutically acceptable salt thereof, whereinis an attachment point to the sense strand or the antisense strand or to a conjugate linker conjugated to the sense strand or the antisense strand.

[0037] In some embodiments, the ligand is conjugated to 3’ end of the sense strand to form the following structure:PAT059933-PCT-SEC01OHor a pharmaceutically acceptable salt thereof, wherein W is -OH or -SH.

[0038] In some embodiments, the ligand is conjugated to 5’ end of the sense strand to form the following structure:or a pharmaceutically acceptable salt thereof wherein W is -OH or -SH.

[0039] In some embodiments, W is -OH.

[0040] In some embodiments, the first dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 795, and (b) an antisense strand consisting of SEQ ID NO: 848;PAT059933-PCT-SEC01 wherein the ligand (L96) is conjugated to the 3’ end of the sense strand to form the following schematic:OHor a pharmaceutically acceptable salt thereof, wherein W is -OH.

[0041] In some embodiments, the second dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 1977 and (b) an antisense strand consisting of SEQ ID NO: 2006.

[0042] In some embodiments, the second dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 1980 and (b) an antisense strand consisting of SEQ ID NO: 2009.

[0043] In some embodiments, the first dsRNAi agent comprises: a sense strand consisting of SEQ ID NO: 795, and (b) an antisense strand consisting of SEQ ID NO: 848;wherein the ligand (L96) is conjugated to the 3’ end of the sense strand to form the following schematic:PAT059933-PCT-SEC01OHor a pharmaceutically acceptable salt thereof, wherein W is -OH;and the second dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 1977 and (b) an antisense strand consisting of SEQ ID NO: 2006.

[0044] In some embodiments, the first dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 795, and (b) an antisense strand consisting of SEQ ID NO: 848; wherein the ligand (L96) is conjugated to the 3’ end of the sense strand to form the following schematic:OHor a pharmaceutically acceptable salt thereof, wherein W is -OH;and the second dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 1980 and (b) an antisense strand consisting of SEQ ID NO: 2009.PAT059933-PCT-SEC01

[0045] In some embodiments, the second antisense agent is an antisense oligonucleotide (ASO) agent.

[0046] In some embodiments, the combination comprises a double stranded RNAi (dsRNAi) agent and an antisense oligonucleotide, wherein: (a) the dsRNAi agent is a PCSK9 inhibitor; and (b) the antisense oligonucleotide agent is an Lp(a) inhibitor.

[0047] In some embodiments, the dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 761 and (b) an antisense strand consisting of SEQ ID NO: 778.

[0048] In some embodiments, the ASO agent comprises SEQ ID NO: 2035.

[0049] In some embodiments, the dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 761 and (b) an antisense strand consisting of SEQ ID NO: 778; and the ASO agent comprises SEQ ID NO: 2035.

[0050] In some embodiments, one or more nucleotides in the sense strand and the antisense strand of the dsRNAi agent and / or the ASO agent are modified nucleotides.

[0051] In some embodiments, each of the one or more modified nucleotides independently comprises one or more modifications selected from a 2’-deoxy modification, a 2’-O-alkyl modification, a 2'-halo modification, a threofuranosyl nucleotide (TNA) modification, a 2’-5’-linkage modification, a conformationally restricting modification, an abasic modification, a 2’-amino-modification, a 2’-O-allyl modification, 2’-C-alkyl modification, a 2’-O-alkoxyalkyl modification, a morpholino modification, a phosphoramidate modification, a non-natural nucleobase modification, a modification in a tetrahydropyran, a modification containing a 1,5-anhydrohexitol, a modification containing a cyclohexenyl, a modification containing a phosphorothioate group, a modification containing a 5’-vinyl-phosphonate, a modification containing a 5 ’-phosphate, a modification to form a thermally destabilizing nucleotide, a glycol nucleic acid (GNA) modification, a 2-O-(N-methylacetamide) modification, a phosphate linkage, a phosphorothioate linkage, an inverted deoxyadenosine (3 '-3' linked nucleotide), an isomannitol residue (Imann) for exampleorand an inverted abasic modification, for examplePAT059933-PCT-SEC01I

[0052] In some embodiments, each of the one or more modified nucleotides independently comprises one or more modifications selected from 2’ -deoxy modification, 2'-O-alkoxyalkyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-C-alkyl modification, 2'-halo modification, modification containing a non-natural nucleobase, a GNA modification, and a TNA modification.

[0053] In some embodiments, the dsRNAi agent and / or the ASO agent comprises a 3’-phosphorothioate (PS) modification.

[0054] In some embodiments, each of the one or more modified nucleotides independently comprises one or more modifications selected from 2’-deoxy modification, 2’-O-methyl (2’-OMe) modification, 2’-fluoro (2’-F) modification, 2’-O-methoxyethyl (2’-M0E) modification, a modification containing a non-natural nucleobase, TNA, GNA, 3’-phosphorothioate (PS) modification, and 5 ’-vinyl -phosphonate (5 ’-VP) modification.

[0055] In some embodiments, the dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 795 and (b) an antisense strand consisting of SEQ ID NO: 848.

[0056] In some embodiments, the ASO agent comprises SEQ ID NO: 2036.

[0057] In some embodiments, the dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 795 and (b) an antisense strand consisting of SEQ ID NO: 848; and the ASO agent comprises SEQ ID NO: 2036.

[0058] In some embodiments, the dsRNAi agent further comprises a ligand.

[0059] In some embodiments, the ASO agent further comprises a ligand.

[0060] In some embodiments, the ligand comprises a N-acetylgalactosamine (GalNAc) moiety.

[0061] In some embodiments, the ligand has a structure of:or a pharmaceutically acceptable salt thereof, wherein:each L1is independently a linker which may be same or different in each occurrence;L2is a linker;PAT059933-PCT-SEC01 n is an integer from 1 to 3; andis an attachment point to the sense strand or the antisense strand, or to a conjugate linker conjugated to the sense strand or the antisense strand.

[0062] In some embodiments, the ligand comprises the following structure ofor a pharmaceutically acceptable salt thereof, wherein:each pl, p2, p3, ql, q2, rl, r2 and r3 is independently an integer from 0 to 12;each nl, n2, and n3 is independently an integer from 1 to 3; and“*” is an attachment point to L2.

[0063] In some embodiments, the ligand has a structure of:NHAcPAT059933-PCT-SEC01 or a pharmaceutically acceptable salt thereof, wherein:each L11, L12, L13, L14, and L15is an independently a linker;L2is a linker;is an attachment point to the sense strand or the antisense strand, or to a conjugate linker conjugated to the sense strand or the antisense strand.

[0064] In some embodiments, the ligand has a structure of:or a pharmaceutically acceptable salt thereof, wherein:each p11 and q11 is independently an integer from 0 to 12;each zl, z2, and z3 is independently an integer of 0 to 12; andis an attachment point to the sense strand or the antisense strand, or to a conjugate linker conjugated to the sense strand or the antisense strand.

[0065] In some embodiments, the ligand comprises the following structure:PAT059933-PCT-SEC01or a pharmaceutically acceptable salt thereof, whereins an attachment point to the sense strand or the antisense strand or to a conjugate linker conjugated to the sense strand or the antisense strand.

[0066] In some embodiments, the ligand is conjugated to 3’ end of the sense strand to form the following structure:PAT059933-PCT-SEC01OHor a pharmaceutically acceptable salt thereof, wherein W is -OH or -SH.

[0067] In some embodiments, the ligand is conjugated to 5’ end of the sense strand to form the following structure:OHor a pharmaceutically acceptable salt thereof wherein W is -OH or -SH.

[0068] In some embodiments, W is -OH.

[0069] In some embodiments, the dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 795, and (b) an antisense strand consisting of SEQ ID NO: 848; wherein the ligand (L96) is conjugated to the 3’ end of the sense strand to form the following schematic:PAT059933-PCT-SEC01OHor a pharmaceutically acceptable salt thereof, wherein W is -OH.

[0070] In some embodiments, the ASO agent comprises SEQ ID NO: 2037.

[0071] In some embodiments, the dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 795, and (b) an antisense strand consisting of SEQ ID NO: 848; wherein the ligand (L96) is conjugated to the 3’ end of the sense strand to form the following schematic:OHor a pharmaceutically acceptable salt thereof, wherein W is -OH;and the ASO agent comprises SEQ ID NO: 2037.

[0072] In some embodiments, the first antisense agent (e.g., first dsRNAi agent) is in a pharmaceutically acceptable salt form.PAT059933-PCT-SEC01

[0073] In some embodiments, the second antisense agent (e.g., second dsRNAi agent) is in a pharmaceutically acceptable salt form.

[0074] In some embodiments, the pharmaceutically acceptable salt is a sodium salt.

[0075] In some embodiments, the first antisense agent (e.g., first dsRNAi agent) and the second antisense agent (e.g., second dsRNAi agent) are provided as a mixture.

[0076] In some embodiments, the first antisense agent (e.g., first dsRNAi agent) and the second antisense agent (e.g., second dsRNAi agent) are formulated separately.

[0077] In an aspect, the disclosure provides a pharmaceutical composition comprising a combination as described herein, and a pharmaceutically acceptable carrier.

[0078] In some embodiments the pharmaceutical composition is in an aqueous solution form.

[0079] In an aspect, the disclosure provides a method of inhibiting PCSK9 and / or Lp(a) expression in a cell, the method comprising:(a) contacting the cell with a combination as described herein, or a pharmaceutical composition as described herein; and(b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of a PCSK9 gene and / or an Lp(a) gene, thereby inhibiting expression of the PCSK9 gene and / or the Lp(a)gene in the cell.

[0080] In an aspect, the disclosure provides a method of lowering a level of low-density lipoprotein cholesterol (LDL-C) in a subject in need thereof, comprising administering to the subject a combination as described herein, or a pharmaceutical composition as described herein.

[0081] In an aspect, the disclosure provides a method of treating lipidemia mediated by PCSK9 and / or Lp(a) expression in a subject in need thereof, comprising administering to the subject a combination as described herein, or a pharmaceutical composition as described herein.

[0082] In an aspect, the disclosure provides a method of treating or preventing atherosclerotic cardiovascular disease (ASCVD) in a subject in need thereof, comprising administering to the subject a combination as described herein, or a pharmaceutical composition as described herein.

[0083] In an aspect, the disclosure provides a method of reducing or preventing cardiovascular event in a subject in need thereof, comprising administering to the subject a combination as described herein, or a pharmaceutical composition as described herein.

[0084] In some embodiments, the cardiovascular event is cardiovascular death, non-fatal myocardial infarction (MI), non-fatal ischemic stroke, urgent coronary revascularization, coronary heart disease (CHD) death, or any combination thereof.PAT059933-PCT-SEC01

[0085] In an aspect, the disclosure provides a method of reducing or preventing a major limb adverse event (MALE) in a subject in need thereof, comprising administering to the subject a combination as described herein, or a pharmaceutical composition as described herein.

[0086] In some embodiments, the MALE is acute lower limb ischemia, lower limb amputation due to ischemia, urgent lower limb revascularization for ischemia, or any combination thereof.

[0087] In an aspect, the disclosure provides a method of treating an Lp(a)-associated disease in a subject in need thereof, comprising administering to the subject a combination as described herein, or a pharmaceutical composition as described herein.

[0088] In some embodiments, the Lp(a)-associated disease is selected from the group consisting of inflammatory, cardiovascular and / or metabolic diseases, disorders, and conditions.

[0089] In some embodiments, the cardiovascular diseases, disorders or conditions include, for example, elevated Lp(a) associated CVD risk, recurrent cardiovascular events with elevated Lp(a), aortic stenosis (e.g., calcific aortic valve stenosis associated with high Lp(a)), aneurysm (e.g., abdominal aortic aneurysm), angina, arrhythmia, atherosclerosis, cerebrovascular disease, coronary artery disease, coronary heart disease, dyslipidemia, hypercholesterolemia, hyperlipidemia, hypertension, hypertriglyceridemia, myocardial infarction, peripheral vascular disease (e.g., peripheral artery disease, peripheral artery occlusive disease), retinal vascular occlusion, or stroke.

[0090] In some embodiments, the metabolic diseases, disorders or conditions include, for example, hyperglycemia, prediabetes, diabetes (type I and type II), obesity, insulin resistance, metabolic syndrome and diabetic dyslipidemia.

[0091] In some embodiments, the inflammatory diseases, disorders or conditions include, for example, aortic stenosis, coronary artery disease (CAD), Alzheimer's Disease and thromboembolic diseases, disorder or conditions.

[0092] In some embodiments, the thromboembolic diseases, disorders or conditions include, for example, stroke, thrombosis (e.g., venous thromboembolism), myocardial infarction and peripheral vascular disease. Certain embodiments provide compositions and methods for preventing, treating, delaying, slowing the progression and / or ameliorating aortic stenosis.

[0093] In some embodiments, the first antisense agent (e.g., first dsRNAi agent) and the second antisense agent (e.g., second dsRNAi agent) are administered to the subject concurrently.

[0094] In some embodiments, the first antisense agent (e.g. first dsRNAi agent) and the second antisense agent (e.g., second dsRNAi agent) are administered to the subject sequentially.

[0095] In some embodiments, the first antisense agent (e.g., first dsRNAi agent) and the second antisense agent (e.g. second dsRNAi agent) are administered to the subject subcutaneously or intravenously.PAT059933-PCT-SEC01

[0096] In some embodiments, the subject is a human.

[0097] In some embodiments, the subject has or is diagnosed with hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, mixed hyperlipidemia, congestive heart disease (CHD) or atherosclerosis.

[0098] In an aspect, the disclosure provides a kit comprising a first antisense agent (e.g., first dsRNAi agent) and a second antisense agent (e.g., second dsRNAi agent) as described herein, or a pharmaceutical composition as described herein.

[0099] In some embodiments, the first antisense agent (e.g., first dsRNAi agent) and the second antisense agent (e.g., second dsRNAi agent) are contained in a single vial.[000100] In some embodiments, the first antisense agent (e.g., first dsRNAi agent) and the second antisense agent (e.g., second dsRNAi) agent are contained in separate vials.[000101] In some embodiments, the kit further comprises one or more applicators.[000102] In some embodiments, the one or more applicators are syringes.[000103] In some embodiments, the one or more applicators are pre-filled syringes.DETAILED DESCRIPTIONDefinitions[000104] Unless defined otherwise, all technical terms, scientific terms, abbreviations, chemical structures, and chemical formulae used herein have the same meaning as is commonly understood by one of ordinary skill in the art. The chemical structures and formulae set forth herein are constructed according to the standard rules of chemical valency known in the chemical arts. All patents, applications, published applications, and other publications referenced herein are incorporated by reference in their entirety unless stated otherwise.[000105] All patents, applications, published applications, and other publications referenced herein are incorporated by reference in their entirety unless stated otherwise. Unless otherwise indicated, conventional methods of mass spectroscopy, NMR, HPLC, protein chemistry, biochemistry, recombinant DNA techniques, and pharmacology are employed.[000106] Furthermore, use of the term “including” as well as other forms, such as “include”, “includes,” and “included,” is not limiting. As used in this specification, whether in a transitional phrase or in the body of the claim, the terms “comprise(s)” and “comprising” are to be interpreted as having an open-ended meaning. That is, the terms are to be interpreted synonymously with the phrases “having at least” or “including at least.” When used in the context of a process, the term “comprising” means that the process includes at least the recited steps, but may include additional steps. When used in the context of a combination, compound, pharmaceutical composition, or device,PAT059933-PCT-SEC01 the term “comprising” means that the combination, compound, pharmaceutical composition, or device includes at least the recited features or components, but may also include additional features or components. As used herein, the term "a,” "an,” "the” and similar terms used in the context of the present invention (especially in the context of the claims) are to be construed to cover both the singular and plural unless otherwise indicated herein or clearly contradicted by the context.[000107] Unless otherwise indicated, all numbers, values, and / or expressions referring to nucleotide lengths, inhibition, activities, dosages, contents, and formulations used herein are to be understood as modified in all instances by the term “about” as such numbers are inherently approximations that are reflective of, among other things, the various uncertainties of measurement encountered in obtaining such values. Further, unless specifically stated or obvious from context, as used herein, the term “about” is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the “mean. “About” may be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values provided herein are modified by the term “about.”[000108] The term “nucleic acid” means a compound containing at least two nucleotide monomers covalently linked together. Nucleic acids include polynucleotides and oligonucleotides, including double-stranded oligonucleotides and single-stranded oligonucleotides, and modified versions thereof.[000109] The term “nucleotide” means a compound including a nucleoside and a phosphate group (or phosphodiester linkage) that are covalently attached at 5' position or 3' position of the pentofuranosyl sugar (e.g., ribose or deoxyribose). In certain aspects, the nucleotide is a ribonucleotide (RNA) having the ribose as the pentofuranosyl sugar. In certain aspects, a nucleotide is a deoxyribonucleotide (DNA) having the deoxyribose (2'-deoxyribose) as the pentofuranosyl sugar. Unless otherwise specifically indicated, when referring a “nucleotide” in a chain of nucleotides (e.g., oligonucleotides), e.g., Xi to X21 and Xr to X23', a nucleotide is meant by a nucleoside and a phosphate group (or phosphodiester linkage) that is covalently attached at 3' position of the pentofuranosyl sugar (e.g., ribose or deoxyribose).[000110] The term “nucleoside” means a monomer consisting of a nucleobase and a pentofuranosyl sugar (e.g., ribose or deoxyribose). A nucleoside including a ribose sugar ring has to a structure of HCk BaseOH OH or a pharmaceutically acceptable salt thereof, and a nucleotide including aPAT059933-PCT-SEC01HO. Basedeoxyribose sugar ring has a structureof OH or a pharmaceutically acceptable salt, wherein in each structure, “Base” is a nucleobase.[000111] The term “nucleobase” or “base,” as used herein, means the heterocyclic base moiety of a nucleoside or nucleotide. Non-limiting examples of nucleobases includes cytosine or a derivative thereof (e.g., cytosine analogue), guanine or a derivative thereof (e.g., guanine analogue), adenine or a derivative thereof (e.g., adenine analogue), thymine or a derivative thereof (e.g., thymine analogue), uracil or a derivative thereof (e.g., uracil analogue), hypoxanthine or a derivative thereof (e.g., hypoxanthine analogue), xanthine or a derivative thereof (e.g., xanthine analogue), 7-methylguanine or a derivative thereof (e.g., 7-methylguanine analogue), deaza-adenine or a derivative thereof (e.g., deaza-adenine analogue), deaza-guanine or a derivative thereof (e.g., deaza-guanine), deazahypoxanthine or a derivative thereof, 5,6-dihydrouracil or a derivative thereof (e.g., 5,6-dihydrouracil analogue), 5 -methylcytosine or a derivative thereof (e.g., 5 -methylcytosine analogue), or 5-hydroxymethylcytosine or a derivative thereof (e.g., 5 -hydroxymethylcytosine analogue) moieties. In some embodiments, the nucleobase is adenine, guanine, hypoxanthine, xanthine, theobromine, caffeine, uric acid, or isoguanine, which may be optionally substituted or modified. In some embodiments, the nucleobase isadenine guanine thymine uracilor methylateduracilcytidine 4-methyl 5-methylcytidine cytidinewhich may be optionally substituted or modified, wherein” denotes the point of attachment to a pentofuranosyl sugar ring (e.g., T position).PAT059933-PCT-SEC01[000112] The term “phosphate,” or “phosphate group” as used herein a chemical species made of oII.p.<3 \ _ o”one phosphorus atom and four oxygen atoms0, or esters, salts, or acids thereof. In certain aspects, when the phosphate groups are positioned between adjacent nucleosides in RNA or DNA strand and form a “backbone” of the oligonucleotides, these terms “phosphate,” or “phosphate group” may be interchangeable used as “phosphate group,” “phosphate linkage,” “phosphodiester linkage,” or “linkage.” For example, the phosphate or phosphodiester linkage in the backbone of RNA or DNA s*o3P==0° / omay have the structuresof or esters, salts (e.g., pharmaceutically acceptable salts), or s*o^pHo"y===0oacids (e.g., ) thereof, wherein” denotes the point of attachment to pentofuranosyl sugar rings (e.g., 5' and 3' positions) in adjacent nucleosides. In certain aspects, a variant of a phosphate or phosphodiester linkage, e.g., phosphorothioate (PS) linkage, can replace a phosphate group (or phosphodiester linkage) in the backbone and connect two adjacent nucleosides. In certain aspects, a variant of a phosphate or phosphodiester linkage, e.g., phosphorothioate (PS) linkage or vinyl phosphonate (VP) group, may be additionally attached at 3' end or 5' end of the oligonucleotides (e.g., RNA or DNA), e.g., 3'-OH or 5'-OH position of the terminal pentofuranosyl sugar (e.g., ribose or deoxyribose), so as to act as chemically or biologically functional group. In certain aspects, a variant of phosphate or phosphodiester linkage may also be referred as a phosphorus-derived internucleoside linkage that includes at least one phosphorus atom in the backbone.[000113] Unless otherwise indicated herein, an unmodified RNA (or “ribonucleotide”) in a chain of nucleotides (e.g., mRNA, rRNA, or sense strand or antisense strand of siRNA) as disclosed refers to a structure ofPAT059933-PCT-SEC01or a pharmaceutically acceptable salt thereof. Likewise, an unmodified DNA (or “deoxyribonucleotides”) in a chain of nucleotides (e.g., genomic DNA or cDNA) as disclosed herein specifically refers to a structure ofO=P - OHor a pharmaceutically acceptable salt thereof. In each structure “Base” is a nucleobase and is an attachment point to the adjacent nucleotides.[000114] Unless otherwise indicated herein, when an unmodified RNA is the first nucleotide from the 5' end of an RNA chain (e.g., mRNA, or sense strand or antisense strand of siRNA), thatO=P — OHnucleotide has a structure of, or a pharmaceutically acceptable salt thereof. Likewise, when an unmodified DNA is the first nucleotide from the 5' end of a DNA chain (e.g.,genomic DNA or cDNA), that nucleotide has a structure of or a pharmaceutically acceptable salt thereof. In each structure “Base” is a nucleobase andis an attachment point (5' oxygen) to the adjacent nucleotides. Alternatively but equivalently, for example, the first nucleotide from the 5' end of an RNA chain (e.g., mRNA, or sense strand or antisense strandPAT059933-PCT-SEC01of siRNA), that nucleotide has a structure of, or a pharmaceutically acceptable salt thereof and the first nucleotide from the 5' end of a DNA chain (e.g., genomic DNA or cDNA),that nucleotide has a structure of, or a pharmaceutically acceptable salt thereof, when is an attachment point (5' oxygen) to the adjacent nucleotides.[000115] Unless otherwise indicated herein, when an unmodified RNA is the first nucleotide from the 3' end of an RNA chain (e.g., mRNA, or sense strand or antisense strand of siRNA), thatnucleotide has a structure of OH, or a pharmaceutically acceptable salt. Likewise, when an unmodified DNA is the first nucleotide from the 3' end of a DNA chain (e.g., genomic DNAO=P — OHor cDNA), that nucleotide has a structure of OH, or a pharmaceutically acceptable salt thereof. In certain embodiments, when an unmodified RNA is the first nucleotide from the 3' end of an RNA chain (e.g., mRNA, or sense strand or antisense strand of siRNA) that nucleotide does not include 3' end phosphate group or phosphodiester linkage, for example, which has been removed Baseduring hydrolysis or synthesis, has a structure of OH OH, or a pharmaceutically acceptable salt. Likewise, when an unmodified DNA is the first nucleotide from the 3' end of a DNA chain (e.g., genomic DNA or cDNA), that nucleotide does not include 3' end phosphate group, forPAT059933-PCT-SEC01 example, which has been removed during hydrolysis or synthesis, has a structure of BaseI I, or a pharmaceutically acceptable salt thereof. In each structure “Base” is a nucleobase and is an attachment point (e.g., phosphorus of the phosphate linkage) to the adjacent nucleotides.[000116] A code “A”, “G”, “C”, or “U” presented in a sequence list as disclosed herein stand for a RNA nucleotide that contains adenine, guanine, cytosine, or uracil as a base, respectively. A code “dA”, “dG”, “dC” or “dT” presented in a sequence list as disclosed herein stand for a DNA nucleotide that contains adenine, guanine, cytosine, and thymine as abase, respectively. In some embodiments, the code “T” may be present in a RNA sequence then it may refer to a nucleotide (e.g. modified nucleotide) that thymine as a base.[000117] The term “oligonucleotide” means a shorter length nucleic acid, e.g. of less than 100 nucleotides in length. Oligonucleotides may be single-stranded or double-stranded. In some embodiments, an oligonucleotide may include naturally occurring ribonucleotides, naturally occurring deoxyribonucleotides, and / or nucleotides having one or more modifications to a naturally occurring terminus, sugar, nucleobase, and / or internucleoside linkage. Non-limiting examples of oligonucleotides include double-stranded oligonucleotides (e.g., dsRNA), single-stranded oligonucleotides (e.g., single stranded RNA or ssRNA), antisense oligonucleotides (“ASO”), small interfering RNA (siRNA), microRNA mimics, short hairpin RNAs (shRNA), single-strand small interfering RNA (ssRNAi), RNaseH oligonucleotides, anti-microRNA oligonucleotides, steric blocking oligonucleotides, exon-skipping oligonucleotides, CRISPR guide RNAs, and aptamers. In certain aspects, the oligonucleotide is a dsRNA and each strand has a length less than 100 nucleotides (“nt”), less than 90 nt, less than 80 nt, less than 70 nt, less than 60 nt, less than 50 nt, less than 40 nt, less than 35 nt, less than 30 nt, less than 28 nt, less than 26 nt, less than 25 nt, less than 24 nt, less than 23 nt, less than 22 nt, less than 21 nt, less than 20 nt, less than 19 nt, less than 18 nt, less than 17 nt, less than 16 nt, or 15 nt.[000118] The terms “iRNA”, “RNAi agent,” “iRNA agent,”, “RNA interference agent” as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript (mRNA) via an RNA-induced silencing complex (RISC) pathway. An RNAi agent directs the sequence-specific degradation of mRNA through a process and thereafter inhibits expression of the gene encoded by the mRNA in a cell in vivo, e.g., in a subject (e.g., any vertebrate, mammal, or human).PAT059933-PCT-SEC01[000119] The term “small interfering RNA” or “siRNA” means a double-stranded oligonucleotide (dsRNA) formed with two anti-parallel, and partially, substantially or fully complementary nucleic acid strands (e.g., a first strand and a second strand; or a “sense” strand and an “antisense” strand), which interferes with the expression of genes in a sequence -specific manner by facilitating mRNA degradation before translation through the RNA interference pathway. In some embodiments, depending on the context, the first strand can be a “guide” or antisense strand, and the second strand can be a “passenger” or sense strand. In some embodiments, depending on the context, the “first” strand can be a passenger or sense strand, and the “second” strand can be a guide or antisense. In certain aspects, an “RNAi agent” or “siRNA agent,” as used herein, refers a double-stranded RNA (dsRNA) with or without a ligand or other conjugate, and may be interchangeably used with a term “double stranded RNAi agent (dsRNAi agent),” or “dsRNA agent.” In certain aspect of the disclosure, the term “siRNA” can be used to describe a dsRNA with specific nucleotide sequences (unmodified or modified nucleotide sequences), without a ligand or other conjugate.[000120] The term “antisense strand,” as used herein, refers an oligonucleotide (e.g., RNA) of an siRNA or a dsRNAi that is complementary (e.g., partially, substantially, or fully complementary) to the target mRNA and is incorporated into the RNA-induced silencing complex (RISC) to direct gene silencing in a sequence-specific manner through the RNA interference pathway. An antisense strand may also be referred to as the “guide strand.” In some embodiments, the antisense strand may have a length from 15-30 nt, 15-26 nt, 15-23 nt, 15-22 nt, 15-21 nt, 15-20 nt, 15-19 nt, 15-18 nt, 15-17 nt, 18-30 nt, 18-26 nt, 18-23 nt, 18-22 nt, 18-21 nt, 18-20 nt, 19-30 nt, 19-26 nt, 19-23 nt, 19-22 nt, 19-21 nt, 19-20 nt, 19 nt, 20-30 nt, 20-26 nt, 20-25 nt, 20-24 nt, 20-23 nt, 20-22 nt, 20-21 nt, 20 nt, 21-30 nt, 21-26 nt, 21-25 nt, 21-24 nt, 21-23 nt, 21-22 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, 30 nt, 31 nt, 32 nt, 33 nt, 34 nt, 35 nt, or 36 nt.[000121] The term “sense strand,” as used herein, refers an oligonucleotide that is complementary (e.g., partially, substantially, or fully complementary) to the antisense strand. The sense strand is typically degraded following incorporation of the antisense strand into RISC. The sense strand may also be referred to as the “passenger strand.” In some embodiments, the sense strand may have a length from 15-30 nt, 15-26 nt, 15-23 nt, 15-22 nt, 15-21 nt, 15-20 nt, 15-19 nt, 15-18 nt, 15-17 nt, 18-30 nt, 18-26 nt, 18-23 nt, 18-22 nt, 18-21 nt, 18-20 nt, 19-30 nt, 19-26 nt, 19-23 nt, 19-22 nt, 19-21 nt, 19-20 nt, 19 nt, 20-30 nt, 20-26 nt, 20-25 nt, 20-24 nt, 20-23 nt, 20-22 nt, 20-21 nt, 20 nt, 21-30 nt, 21-26 nt, 21-25 nt, 21-24 nt, 21-23 nt, 21-22 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, 30 nt, 31 nt, 32 nt, 33 nt, 34 nt, 35 nt, or 36 nt.PAT059933-PCT-SEC01[000122] The term “complementary” means that a nucleotide (e.g., RNA or DNA) or a sequence of nucleotides are capable of base pairing non-covalently via hydrogen bonding with another nucleotide or sequence of nucleotides. As described herein and commonly known in the art the complementary (matching) nucleotide of adenosine is thymidine or uridine and the complementary (matching) nucleotide of guanosine is cytidine. The complementarity of sequences may be partial, in which only some of the nucleic acids match according to base pairing, or complete, where all the nucleic acids match according to base pairing. For example, two sequences that are complementary to each other, may have a specified percentage of nucleotides that participate in nucleobase-pairing (i.e., about 50% complementarity, preferably 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater complementarity over a specified region). In some embodiments, two sequences are partially complementary when the percentage of nucleotides that participate in nucleobase-pairing is about 50%, about 55%, about 65%, about 70%, about 75%, or about 80%, or ranges from about 50% to about 80%. In some embodiments, two sequences are substantially complementary when the percentage of nucleotides that participate in nucleobase-pairing is about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 92%, about 93%, about 94%, or about 95%, or ranges from about 80% to about 95%.[000123] Examples of complementary (e.g., partially, substantially, or fully complementary) sequences are sense and antisense sequences, wherein the sense sequence contains complementary (e.g., partially, substantially, or fully complementary) nucleotides to the antisense sequence and thus forms the complement of the antisense sequence. In certain aspects, a sense strand and an antisense strand of a double-stranded oligonucleotide (e.g., double stranded RNA) are substantially or fully complementary over their entire lengths. In some embodiments, a sense strand and an antisense strand of dsRNA are substantially or fully complementary over the entire length of the doublestranded region of the siRNA, and one or both termini of either strand comprises single-stranded nucleotides.[000124] Other examples of complementary (e.g., partially, substantially, or fully complementary) sequences are an antisense strand and its target mRNA sequence. In certain aspects, an antisense strand is substantially or fully complementary to its target mRNA. For example, the complementary (e.g., partially, substantially, or fully complementary) sequences may be between an antisense strand and a coding region of the target mRNA, or a non-coding sequence of the target mRNA. In certain aspects, an antisense strand is substantially, or fully complementary to its target mRNA to reduce or eliminate off-target profde for and to improve down-regulation of the target gene (e.g., gene of the target mRNA sequence).PAT059933-PCT-SEC01[000125] The terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., at least 60% identity, or at least 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or within a range defined by any of two of the preceding values, identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site or the like). This definition also refers to, or may be applied to, the complement of a test sequence. The definition also includes sequences that have deletions and / or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps, insertions and the like. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared can be determined by known methods.[000126] As used herein, “target sequence” or “target gene” refer to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a gene including mRNA that is a product of RNA processing of a primary transcription product. The target portion of the sequence will be at least long enough to serve as a substrate for RNAi -directed cleavage at or near that portion. Lor example, the target sequence will generally be from 9-36 nucleotides (“nt”) in length, e.g., 15-30 nt in length, including all sub-ranges therebetween. As non-limiting examples, the target sequence may have a length from 15-30 nt, 15-26 nt, 15-23 nt, 15-22 nt, 15-21 nt, 15-20 nt, 15-19 nt, 15-18 nt, 15-17 nt, 18-30 nt, 18-26 nt, 18-23 nt, 18-22 nt, 18-21 nt, 18-20 nt, 19-30 nt, 19-26 nt, 19-23 nt, 19-22 nt, 19-21 nt, 19-20 nt, 19 nt, 20-30 nt, 20-26 nt, 20-25 nt, 20-24 nt, 20-23 nt, 20-22 nt, 20-21 nt, 20 nt, 21-30 nt, 21-26 nt, 21-25 nt, 21-24 nt, 21-23 nt, 21-22 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, 30 nt, 31 nt, 32 nt, 33 nt, 34 nt, 35 nt, or 36 nt.[000127] The term “ligand,” as used herein, refers to a compound or moiety that can impose characteristics to provide additional properties, e.g., affinity or cell delivery efficiency, to an RNAi (e.g., dsRNAi) as described herein. The ligand may be coupled or conjugated directly to the RNAi (e.g., sense strand or antisense strand of dsRNA), or indirectly to the RNAi agent (e.g., sense strandPAT059933-PCT-SEC01 or antisense strand of dsRNA) via an intervening linker (“linker”). When a ligand is conjugated or coupled indirectly to the RNAi (e.g., dsRNA) via a linker, the ligand may be formed of a core moiety (e.g., targeting moiety) that has specific function to provide affinity or efficacy and the linker that provides merely an optimal distance, e.g., between the core moiety and the RNAi agent (dsRNA). In certain aspects, the term “ligand” embraces the ligand in combination with the linker. Examples of ligands or targeting moieties thereof may include, but not be limited to, one or more selected from a synthetic or natural compound, a peptide, an antibody, a carbohydrate (e.g., sugar moiety), or an additional nucleic acid.[000128] The term “modified nucleotide” means a nucleotide having one or more modifications relative to a naturally occurring nucleotide, e.g., RNA. The modified nucleotide may be selected over an unmodified form because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for other oligonucleotides or nucleic acid targets, increased stability in the presence of nucleases, and / or reduced immune stimulation. In certain aspects, the modification may be present in at least one of (i) an internucleoside linkage (“linkage”), (ii) a nucleobase, and (iii) a sugar moiety of the nucleotide. In certain aspects, the modification is present in the internucleoside linkage, e.g., by chemically modifying a phosphate (or phosphodiester) linkage or replacing a phosphate (or phosphodiester) linkage with other linking groups. In certain aspects, the modification is present in a sugar moiety, i.e., ribose ring, by substituting hydroxyl group on 2' position of the ribose ring with other chemical group or by replacing a ring structure with other heterocycloalkyl or cycloalkyl, glycolvgroup having a structure of *, bicyclic or bridged ring on the ribose such as locked nucleic To0acid (LNA) having a structure of N, or the like. In certain aspects, the modification is present in a nucleobase (e.g., A, G, C, T, or U) by chemical modification in a nucleobase by replacing the nucleobase with other moiety, for example, by replacing one naturally occurring nucleobase with another naturally occurring nucleobase. In certain aspects, a modified nucleotide may contain a modification in a sugar moiety and an unmodified phosphate (or phosphodiester) linkage. In certain aspects, a modified nucleotide may have a modification in a sugar moiety but with an unmodified nucleobase. In certain aspects, a modified nucleotide may have a modification in a sugar moiety and a nucleobase. In certain aspects, a modified nucleotide may have a modification in a sugar moiety and a phosphate (or phosphodiester) linkage. In certain aspects, a modified nucleotide may have a modification in a sugar moiety, a phosphate (or phosphodiester) linkage and a nucleobase. In certainPAT059933-PCT-SEC01 aspects, a modified nucleotide may have an unmodified sugar moiety and an unmodified phosphate (or phosphodiester) linkage. In certain aspects, a modified nucleotide may have an unmodified sugar moiety and an unmodified nucleobase. In certain aspects, a modified nucleotide may have an unmodified sugar moiety and a modified nucleobase. In certain aspects, a modified nucleotide may have an unmodified sugar moiety and a modified phosphate (or phosphodiester) linkage. In certain aspects, a modified nucleotide may have a modified sugar moiety, a modified phosphate (or phosphodiester) linkage and a modified nucleobase.[000129] The term “modified phosphate group,” or “modified phosphodiester linkage” as used herein refers to a chemical group in place of a phosphate group (or phosphodiester linkage) in a nucleotide as being attached to the 3' end (3' carbon) of the pentofuranosyl group.[000130] The terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., at least 60% identity, or at least 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or within a range defined by any of two of the preceding values, identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site or the like). This definition also refers to, or may be applied to, the complement of a test sequence. The definition also includes sequences that have deletions and / or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps, insertions and the like. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared can be determined by known methods.[000131] Throughout the disclosure, nucleotide positions or coordinates are relative to the beginning (5' end) of the reference transcript.[000132] The term “overhang” or “nucleotide overhang” herein refers to at least one unpaired nucleotide that protrudes from the end of at least one of the two strands of the duplex structure of an RNAi agent. In some embodiments, when a 3 '-end of one strand extends beyond the 5 '-end of thePAT059933-PCT-SEC01 other strand, or vice versa, this forms a nucleotide overhang, e.g., the unpaired nucleotide(s) form the overhang.[000133] ‘ ‘Blunt” or “blunt end” means that there are no unpaired nucleotides at that end of the double stranded RNAi agent, i.e., no nucleotide overhang. A “blunt ended” dsRNAi agent is a dsRNA that is double-stranded over its entire length, i.e., no nucleotide overhang at either end of the molecule.[000134] A “mismatch” is defined herein as a difference between the base sequence (e.g., A instead of G) or length when two sequences are maximally aligned and compared. In certain aspects, the term “mismatch” means a nucleobase of a first oligonucleotide (e.g., a first strand) that is not capable of pairing with a nucleobase at a corresponding position of a second oligonucleotide (e.g., a second strand).[000135] The term “non-end” herein refers to a position between the 3' end and the 5' end of the sense or antisense strand.[000136] The term “PCSK9,” refers to a proprotein convertase subtilisin kexin 9 gene or a protein encoded by that gene. PCSK9 is also known as FH3, PC9, FHCL3, NARC1, LDLCQ1, NARC-1, or HCHOLA3. The PCSK9 gene as used herein includes human PCSK9 (e.g., Gene ID: 255738; GenBank Accession No. NM_174936.3 or NM_174936.4), mouse PCSK9 gene (e.g., Gene ID: 100102; GenBank Accession No. NM_153565.2), and dog PCSK9 gene (e.g., Gene ID: 102152231; GenBank Accession No. XM_038667514.1). Additional examples of PCSK9 mRNA sequences from different species and variants are readily available using, e.g., GenBank.[000137] Homo sapiens PCSK9, transcript variant 1, mRNA: GenBank: NM 174936.3 (SEQ ID NO: 1)1 gtccgatggg gctctggtgg cgtgatctgc gcgccccagg cgtcaagcac ccacacccta 61 gaaggtttcc gcagcgacgt cgaggcgctc atggttgcag gcgggcgccg ccgttcagtt 121 cagggtctga gcctggagga gtgagccagg cagtgagact ggctcgggcg ggccgggacg 181 cgtcgttgca gcagcggctc ccagctccca gccaggattc cgcgcgcccc ttcacgcgcc 241 ctgctcctga acttcagctc ctgcacagtc ctccccaccg caaggctcaa ggcgccgccg 301 gcgtggaccg cgcacggcct ctaggtctcc tcgccaggac agcaacctct cccctggccc 361 tcatgggcac cgtcagctcc aggcggtcct ggtggccgct gccactgctg ctgctgctgc 421 tgctgctcct gggtcccgcg ggcgcccgtg cgcaggagga cgaggacggc gactacgagg 481 agc ggtgct agccttgcgt tccgaggagg acggcctggc cgaagcaccc gagcacggaa 541 ccacagccac cttccaccgc tgcgccaagg atccgtggag gttgcctggc acctacgtgg 601 tggtgctgaa ggaggagacc cacctctcgc agtcagagcg cactgcccgc cgcctgcagg 661 cccaggctgc ccgccgggga tacctcacca agatcctgca tgtcttccat ggccttcttc 721 ctggcttcct ggtgaagatg agtggcgacc tgctggagct ggccttgaag ttgccccatg 781 tcgactacat cgaggaggac tcctctgtct ttgcccagag catcccgtgg aacctggagc 841 ggattacccc tccacggtac cgggcggatg aataccagcc ccccgacgga ggcagcctggPAT059933-PCT-SEC01 901 tggaggtgta tctcctagac accagcatac agagtgacca ccgggaaatc gagggcaggg 961 tcatggtcac cgacttcgag aatgtgcccg aggaggacgg gacccgcttc cacagacagg 1021 ccagcaagtg tgacagtcat ggcacccacc tggcaggggt ggtcagcggc cgggatgccg 1081 gcgtggccaa gggtgccagc atgcgcagcc tgcgcgtgct caactgccaa gggaagggca 1141 cggttagcgg caccctcata ggcc ggagt ttattcggaa aagccagctg gtccagcctg 1201 tggggccact ggtggtgctg ctgcccctgg cgggtgggta cagccgcgtc ctcaacgccg 1261 cctgccagcg cc ggcgagg gc gggg cg tgctggtcac cgctgccggc aacttccggg 1321 acgatgcctg cctctactcc ccagcctcag ctcccgaggt catcacagtt ggggccacca 1381 atgcccaaga ccagccggtg accc gggga ctttggggac caactttggc cgctgtgtgg 1441 acctctttgc cccaggggag gacatcattg gtgcctccag cgactgcagc acctgctttg 1501 tgtcacagag tgggacatca caggctgctg cccacgtggc tggcattgca gccatgatgc 1561 tgtctgccga gccggagctc accctggccg agttgaggca gagactgatc cacttctctg 1621 ccaaagatgt catcaatgag gcctggttcc ctgaggacca gcgggtactg acccccaacc 1681 tggtggccgc cctgcccccc agcacccatg gggcaggttg gcagctgttt tgcaggactg 1741 tatggtcagc acactcgggg cctacacgga tggccacagc cgtcgcccgc tgcgccccag 1801 atgaggagct gctgagctgc tccagtttct ccaggagtgg gaagcggcgg ggcgagcgca 1861 tggaggccca agggggcaag ctggtctgcc gggcccacaa cgcttttggg ggtgagggtg 1921 tctacgccat tgccaggtgc tgcctgctac cccaggccaa ctgcagcgtc cacacagctc 1981 caccagctga ggccagcatg gggacccgtg tccactgcca ccaacagggc cacgtcctca 2041 caggctgcag ctcccactgg gaggtggagg accttggcac ccacaagccg cctgtgctga 2101 ggccacgagg tcagcccaac cagtgcgtgg gccacaggga ggccagcatc cacgcttcct 2161 gctgccatgc cccaggtctg gaatgcaaag tcaaggagca tggaatcccg gcccctcagg 2221 agcaggtgac cgtggcctgc gaggagggc ggaccctgac tggctgcagt gccctccctg 2281 ggacctccca cgtcctgggg gcctacgccg tagacaacac gtgtgtagtc aggagccggg 2341 acgtcagcac tacaggcagc accagcgaag gggccgtgac agccgttgcc atctgctgcc 2401 ggagccggca cctggcgcag gcctcccagg agctccagtg acagccccat cccaggatgg 2461 gtgtctgggg agggtcaagg gc ggggc g agctttaaaa tggttccgac ttgtccctct 2521 ctcagccctc catggcctgg cacgagggga tggggatgct tccgcctttc cggggc gc 2581 ggcc ggccc t gag gggg cagcctcctt gcctggaact cactcactct gggtgcc cc 2641 tccccaggtg gaggtgccag gaagctccct ccctcactgt ggggcatttc accattcaaa 2701 caggtcgagc tgtgctcggg tgctgccagc tgctcccaat gtgccgatgt ccgtgggcag 2761 aatgactttt attgagctct tgttccgtgc caggcattca atcctcaggt ctccaccaag 2821 gaggcaggat tcttcccatg ga aggggag ggggcggtag gggctgcagg gacaaacatc 2881 gttggggggt gagtgtgaaa ggtgctgatg gccctcatct ccagctaact gtggagaagc 2941 ccctgggggc tccctgatta atggaggc agctttctgg atggcatcta gccagaggct 3001 ggagacaggt gcgcccctgg tggtcacagg ctgtgccttg gtttcctgag ccacctttac 3061 tctgctctat gccaggctgt gctagcaaca cccaaaggtg gcc gcgggg agccatcacc 3121 taggactgac tcggcagtgt gcagtggtgc atgcactgtc tcagccaacc cgctccacta 3181 cccggcaggg tacacattcg cacccctact tcacagagga agaaacctgg aaccagaggg 3241 ggcgtgcctg ccaagctcac acagcaggaa ctgagccaga aacgcagatt gggc ggc c 3301 tgaagccaag cctcttctta cttcacccgg ctgggctcct catttttacg ggtaacagtg 3361 aggc gggaa ggggaacaca gaccaggaag ctcggtgagt gatggcagaa cgatgcctgcPAT059933-PCT-SEC01 3421 aggcatggaa ctttttccgt tatcacccag gcctgattca ctggcctggc ggagatgctt 3481 ctaaggcatg gtcgggggag agggccaaca actgtccctc cttgagcacc agccccaccc 3541 aagcaagcag acatttatct tttgggtctg tcctctctgt tgccttttta cagccaactt 3601 ttctagacct gttttgcttt tgtaacttga agatatttat tctgggtttt gtagcatttt 3661 tattaatatg gtgacttttt aaaataaaaa caaacaaacg ttgtcctaac aaaaaaaaaa 3721 aaaaaaaaaa a[000138] Homo sapiens PCSK9, transcript variant 1, mRNA: GenBank: NM 174936.4 (SEQ ID NO: 2)1 agcgacgtcg aggcgctcat ggttgcaggc gggcgccgcc gttcagttca gggtctgagc 61 ctggaggagt gagccaggca gtgagactgg ctcgggcggg ccgggacgcg tcgttgcagc 121 agcggctccc agctcccagc caggattccg cgcgcccctt cacgcgccct gctcctgaac 181 ttcagctcct gcacagtcct ccccaccgca aggctcaagg cgccgccggc gtggaccgcg 241 cacggcctct aggtctcctc gccaggacag caacctctcc cctggccctc atgggcaccg 301 tcagctccag gcggtcctgg tggccgctgc cactgctgct gctgctgctg ctgctcctgg 361 gtcccgcggg cgcccgtgcg caggaggacg aggacggcga ctacgaggag ctggtgc ag 421 ccttgcgttc cgaggaggac ggcctggccg aagcacccga gcacggaacc acagccacct 481 tccaccgctg cgccaaggat ccgtggaggt tgcctggcac ctacgtggtg gtgctgaagg 541 aggagaccca cctctcgcag tcagagcgca ctgcccgccg cctgcaggcc caggctgccc 601 gccggggata cctcaccaag atcctgcatg tcttccatgg ccttcttcct ggcttcctgg 661 tgaagatgag tggcgacctg ctggagctgg ccttgaagtt gccccatgtc gactacatcg 721 aggaggactc ctctgtcttt gcccagagca tcccgtggaa cctggagcgg attacccctc 781 cacggtaccg ggcggatgaa taccagcccc ccgacggagg cagcctggtg gaggtgtatc 841 tcctagacac cagcatacag agtgaccacc gggaaatcga gggcagggtc atggtcaccg 901 acttcgagaa tgtgcccgag gaggacggga cccgcttcca cagacaggcc agcaagtgtg 961 acagtcatgg cacccacctg gcaggggtgg tcagcggccg ggatgccggc gtggccaagg 1021 gtgccagcat gcgcagcctg cgcgtgctca actgccaagg gaagggcacg gttagcggca 1081 ccctcatagg cctggagttt attcggaaaa gccagctggt ccagcctgtg gggccactgg 1141 tggtgctgct gcccctggcg ggtgggtaca gccgcgtcct caacgccgcc tgccagcgcc 1201 tggcgagggc tggggtcgtg ctggtcaccg ctgccggcaa cttccgggac gatgcctgcc 1261 tctactcccc agcctcagct cccgaggtca tcacagttgg ggccaccaat gcccaagacc 1321 agccggtgac cctggggact ttggggacca actttggccg ctgtgtggac ctctttgccc 1381 caggggagga catcattggt gcctccagcg actgcagcac ctgctttgtg tcacagagtg 1441 ggacatcaca ggctgctgcc cacgtggctg gcattgcagc catgatgctg tctgccgagc 1501 cggagctcac cctggccgag ttgaggcaga gactgatcca cttctctgcc aaagatgtca 1561 tcaatgaggc ctggttccct gaggaccagc gggtactgac ccccaacctg gtggccgccc 1621 tgccccccag cacccatggg gcaggttggc agctgttttg caggactgta tggtcagcac 1681 actcggggcc tacacggatg gccacagccg tcgcccgctg cgccccagat gaggagctgc 1741 tgagctgctc cagtttctcc aggagtggga agcggcgggg cgagcgcatg gaggcccaag 1801 ggggcaagct ggtctgccgg gcccacaacg cttttggggg tgagggtgtc tacgccattg 1861 ccaggtgctg cctgctaccc caggccaact gcagcgtcca cacagctcca ccagctgagg 1921 ccagcatggg gacccgtgtc cactgccacc aacagggcca cgtcctcaca ggctgcagctPAT059933-PCT-SEC01 1981 cccactggga ggtggaggac cttggcaccc acaagccgcc tgtgctgagg ccacgaggtc 2041 agcccaacca gtgcgtgggc cacagggagg ccagcatcca cgcttcctgc tgccatgccc 2101 cagg c gga atgcaaagtc aaggagcatg gaatcccggc ccctcaggag caggtgaccg 2161 tggcctgcga ggagggctgg accctgactg gctgcagtgc cctccctggg acctcccacg 2221 tcctgggggc ctacgccgta gacaacacgt gtgtagtcag gagccgggac gtcagcacta 2281 caggcagcac cagcgaaggg gccgtgacag ccgttgccat ctgctgccgg agccggcacc 2341 tggcgcaggc ctcccaggag ctccagtgac agccccatcc caggatgggt gtctggggag 2401 ggtcaagggc tggggc gag ctttaaaatg gttccgactt gtccctctct cagccctcca 2461 tggcctggca cgaggggatg gggatgcttc cgcctttccg gggctgctgg cctggccctt 2521 gagtggggca gcctccttgc ctggaactca ctcactctgg gtgcctcctc cccaggtgga 2581 ggtgccagga agctccctcc ctcactgtgg ggcatttcac cattcaaaca ggtcgagctg 2641 tgctcgggtg ctgccagctg ctcccaatgt gccgatgtcc gtgggcagaa tgacttttat 2701 tgagctcttg ttccgtgcca ggcattcaat cctcaggtct ccaccaagga ggcaggattc 2761 ttcccatgga taggggaggg ggcggtaggg gctgcaggga caaacatcgt tggggggtga 2821 gtgtgaaagg tgctgatggc cctcatctcc agctaactgt ggagaagccc c gggggc c 2881 cctgattaat ggaggcttag ctttctggat ggcatctagc cagaggctgg agacaggtgc 2941 gcccctggtg gtcacaggct gtgccttggt ttcctgagcc acctttactc tgctctatgc 3001 caggctgtgc tagcaacacc caaaggtggc c gcggggag ccatcaccta ggactgactc 3061 ggcagtgtgc agtggtgcat gcactgtctc agccaacccg ctccactacc cggcagggta 3121 cacattcgca cccctacttc acagaggaag aaacctggaa ccagaggggg cgtgcctgcc 3181 aagctcacac agcaggaact gagccagaaa cgcagattgg gctggctctg aagccaagcc 3241 tcttcttact tcacccggct gggctcctca tttttacggg taacagtgag gc gggaagg 3301 ggaacacaga ccaggaagct cggtgagtga tggcagaacg atgcctgcag gcatggaact 3361 ttttccgtta tcacccaggc ctgattcact ggcctggcgg agatgcttct aaggcatggt 3421 cgggggagag ggccaacaac tgtccctcct tgagcaccag ccccacccaa gcaagcagac 3481 atttatcttt tgggtctgtc ctctctgttg cctttttaca gccaactttt ctagacctgt 3541 tttgcttttg taacttgaag atatttattc tgggttttgt agcattttta ttaatatggt 3601 gactttttaa aataaaaaca aacaaacgtt gtcctaa[000139] In certain aspects, PCSK9 may include a fragment, variant, or mutant of the protein that may have the same or similar amino acid sequences (e.g., having about 80%, 85%, 90%, 95%, or 99% or greater of similarity or identity of amino acid sequences) with any one of the above listed PCSK9 gene (mRNA) or protein sequences. In certain aspects, PCSK9 may include a fragment, variant, or mutant of the protein having the same or in similar in vivo or in vitro enzymatic (e.g., reductase) activity, for example, having about 80%, 85%, 90%, 95%, or 99% or the native protein activity, to bind to LDLR on the surface of a liver cell.[000140] The term " Lp(a)" includes human Lp(a), the amino acid and complete coding sequence of which may be found in for example, GenBank Accession No.: NM_005577.4. Additional examples of Lp(a) mRNA sequences are readily available using publicly available databases, e.g., GenBank, UniProt, OMIM, and the Macaca genome project web site. The term " Lp(a)," as usedPAT059933-PCT-SEC01 herein, also refers to naturally occurring DNA sequence variations of the LP(a) gene, such as a single nucleotide polymorphism (SNP) in the Lp(a) gene. Exemplary SNPs may be found in the dbSNP database.[000141] Homo sapiens lipoprotein(a) (LPA), mRNA; GenBank Accession No.: NM_005577.4 (SEQ ID NO: 2038)1 gtaagtcaac aatgtcctgg gattgggaca cactttctgg gcactgctgg ccagtcccaa61 aatggaacat aaggaagtgg ttcttctact tcttttattt ctgaaatcag cagcacctga121 gcaaagccat gtggtccagg attgctacca tggtgatgga cagagttatc gaggcacgta181 ct ccaccact gtcacaggaa ggacctgcca agcttggtca tctatgacac cacatcaaca241 taataggacc acagaaaact acccaaatgc tggcttgatc atgaactact gcaggaatcc301 agatgctgtg gcagctcctt attgttatac gagggatccc ggtgtcaggt gggagtactg361 caacctgacg caatgctcag acgcagaagg gactgccgtc gcgcctccga ctgttacccc421 ggttccaagc ctagaggctc cttccgaaca agcaccgact gagcaaaggc ctggggtgca481 ggagtgctac catggtaatg gacagagtta tcgaggcaca tac ccacca ctgtcacagg541 aagaacctgc caagcttggt catctatgac accacactcg catagtcgga ccccagaata601 ctacccaaat gctggcttga tcatgaacta ctgcaggaat ccagatgctg tggcagctcc661 ttattgttat acgagggatc ccggtgtcag gtgggagtac tgcaacctga cgcaatgctc721 agacgcagaa gggactgccg tcgcgcctcc gactgttacc ccggttccaa gcctagaggc781 tcctt ccgaa caagcaccga ctgagcaaag gcctggggtg caggagtgct accatggtaa841 tggacagagt tatcgaggca catactccac cactgtcaca ggaagaacct gccaagcttg901 gtcatctatg acaccacact cgcatagtcg gaccccagaa tactacccaa atgctggctt961 gatcatgaac tactgcagga atccagatgc tgtggcagct ccttattgtt atacgaggga1021 tcccggtgtc aggtgggagt actgcaacct gacgcaatgc tcagacgcag aagggactgc 1081 cgtcgcgcct ccgactgtta ccccggttcc aagcctagag gctccttccg aacaagcacc1141 gactgagcag aggcctgggg tgcaggagtg ctaccacggt aatggacaga gttatcgagg 1201 cacatactcc accactgtca ctggaagaac ctgccaagct tggtcatcta tgacaccaca 1261 ctcgcatagt cggaccccag aatactaccc aaatgctggc ttgatcatga actactgcag 1321 gaatccagat gctgtggcag ctccttattg ttatacgagg gatcccggtg tcaggtggga 1381 gtactgcaac ctgacgcaat gctcagacgc agaagggact gccgtcgcgc ctccgactgt 1441 taccccggtt ccaagcctag aggctccttc cgaacaagca ccgactgagc aaaggcctgg 1501 ggtgcaggag tgctaccatg gtaatggaca gagttatcga ggcacatact ccaccactgt 1561 cacaggaaga acctgccaag cttggtcatc tatgacacca cactcgcata gtcggacccc 1621 agaatactac ccaaatgctg gcttgatcat gaactactgc aggaatccag atgctgtggc 1681 agctccttat tgttatacga gggatcccgg tgtcaggtgg gagtactgca acctgacgcaPAT059933-PCT-SEC01 1741 atgctcagac gcagaaggga ctgccgtcgc gcctccgact gttaccccgg ttccaagcct 1801 agaggctcct tccgaacaag caccgactga gcaaaggcct ggggtgcagg agtgctacca 1861 tggtaatgga cagagttatc gaggcacata ctccaccact gtcacaggaa gaacctgcca 1921 agcttggtca tctatgacac cacactcgca tagtcggacc ccagaatact acccaaatgc 1981 tggcttgatc atgaactact gcaggaatcc agatgctgtg gcagctcctt attgttatac 2041 gagggatccc ggtgtcaggt gggagtactg caacctgacg caatgctcag acgcagaagg 2101 gactgccgtc gcgcctccga ctgttacccc ggttccaagc ctagaggctc cttccgaaca 2161 agcaccgact gagcaaaggc ctggggtgca ggagtgctac catggtaatg gacagagtta 2221 tcgaggcaca tactccacca ctgtcacagg aagaacctgc caagcttggt catctatgac 2281 accacactcg catagtcgga ccccagaata ctacccaaat gctggcttga tcatgaacta 2341 ctgcaggaat ccagatgctg tggcagctcc ttattgttat acgagggatc ccggtgtcag 2401 gtgggagtac tgcaacctga cgcaatgctc agacgcagaa gggactgccg tcgcgcctcc 2461 gactgttacc ccggttccaa gcctagaggc tccttccgaa caagcaccga ctgagcagag 2521 gcctggggtg caggagtgct accacggtaa tggacagagt tatcgaggca catactccac 2581 cactgtcact ggaagaacct gccaagcttg gtcatctatg acaccacact cgcatagtcg 2641 gaccccagaa tactacccaa atgctggctt gatcatgaac tactgcagga atccagatcc 2701 tgtggcagcc ccttattgtt atacgaggga tcccagtgtc aggtgggagt actgcaacct 2761 gacacaatgc tcagacgcag aagggactgc cgtcgcgcct ccaactatta ccccgattcc 2821 aagcctagag gctccttctg aacaagcacc aactgagcaa aggcc gggg tgcaggagtg 2881 ctaccacgga aatggacaga gttatcaagg cacatacttc attactgtca caggaagaac 2941 ctgccaagct tggtcatcta tgacaccaca ctcgcatagt cggaccccag catactaccc 3001 aaatgctggc ttgatcaaga actactgccg aaatccagat cctgtggcag ccccttggtg 3061 ttatacaaca gatcccagtg tcaggtggga gtactgcaac ctgacacgat gctcagatgc 3121 agaatggact gccttcgtcc ctccgaatgt tattctggct ccaagcctag aggctttttt 3181 tgaacaagca ctgactgagg aaacccccgg ggtacaggac tgctactacc attatggaca 3241 gagttaccga ggcacatact ccaccactgt cacaggaaga acttgccaag cttggtcatc 3301 tatgacacca caccagcata gtcggacccc agaaaactac ccaaatgctg gcctgaccag 3361 gaactactgc aggaatccag atgctgagat tcgcccttgg tgttacacca tggatcccag 3421 tgtcaggtgg gagtactgca acctgacaca atgcctggtg acagaatcaa gtgtccttgc 3481 aactctcacg gtggtcccag atccaagcac agaggcttct tctgaagaag caccaacgga 3541 gcaaagcccc ggggtccagg attgctacca tggtgatgga cagagttatc gaggctcatt 3601 ctctaccact gtcacaggaa ggacatgtca gtcttggtcc tctatgacac cacactggca 3661 tcagaggaca acagaatatt atccaaatgg tggcctgacc aggaactact gcaggaatcc 3721 agatgctgag attagtcctt ggtgttatac catggatccc aatgtcagat gggagtactgPAT059933-PCT-SEC01 3781 caacctgaca caatgtccag tgacagaatc aagtgtcctt gcgacgtcca cggctgtttc 3841 tgaacaagca ccaacggagc aaagccccac agtccaggac tgctaccatg gtgatggaca 3901 gagttatcga ggctcattct ccaccactgt tacaggaagg acatgtcagt cttggtcctc 3961 tatgacacca cactggcatc agagaaccac agaatactac ccaaatggtg gcctgaccag 4021 gaactactgc aggaatccag atgctgagat tcgcccttgg tgttatacca tggatcccag 4081 tgtcagatgg gagtactgca acctgacgca atgtccagtg atggaatcaa ctctcctcac 4141 aactcccacg gtggtcccag ttccaagcac agagcttcct tctgaagaag caccaactga 4201 aaacagcact gggg ccagg actgctaccg aggtgatgga cagagttatc gaggcacact 4261 ctccaccact atcacaggaa gaacatgtca gtcttggtcg tctatgacac cacattggca 4321 tcggaggatc ccattatact atccaaatgc tggcctgacc aggaactact gcaggaatcc 4381 agatgctgag attcgccctt ggtgttacac catggatccc agtgtcaggt gggagtactg 4441 caacctgaca cgatgtccag tgacagaatc gagtgtcctc acaactccca cagtggcccc 4501 ggttccaagc acagaggctc cttctgaaca agcaccacct gagaaaagcc ctgtggtcca 4561 ggattgctac catggtgatg gacggagtta tcgaggcata tcctccacca ctgtcacagg 4621 aaggacctgt caatcttggt catctatgat accacactgg catcagagga ccccagaaaa 4681 ctacccaaat gctggcctga ccgagaacta ctgcaggaat ccagattctg ggaaacaacc 4741 ctggtgttac acaaccgatc cgtgtgtgag gtgggagtac tgcaatctga cacaatgctc 4801 agaaacagaa tcaggtgtcc tagagactcc cactgttgtt ccagttccaa gcatggaggc 4861 tcattctgaa gcagcaccaa ctgagcaaac ccctgtggtc cggcagtgct accatggtaa 4921 tggccagagt tatcgaggca cattctccac cactgtcaca ggaaggacat gtcaatcttg 4981 gtcatccatg acaccacacc ggcatcagag gaccccagaa aactacccaa atgatggcct 5041 gacaatgaac tactgcagga atccagatgc cgatacaggc ccttggtgtt ttaccatgga 5101 ccccagcatc aggtgggagt actgcaacct gacgcgatgc tcagacacag aagggactgt 5161 ggtcgctcct ccgactgtca tccaggttcc aagcctaggg cctccttctg aacaagactg 5221 tatgtttggg aatgggaaag gataccgggg caagaaggca accactgtta ctgggacgcc 5281 atgccaggaa tgggctgccc aggagcccca tagacacagc acgttcattc cagggacaaa 5341 taaatgggca ggtctggaaa aaaattactg ccgtaaccct gatggtgaca tcaatggtcc 5401 ctggtgctac acaatgaatc caagaaaact ttttgactac tgtgatatcc ctctctgtgc 5461 atcctcttca tttgattgtg ggaagcctca agtggagccg aagaaatgtc ctggaagcat 5521 tgtagggggg tgtgtggccc acccacattc ctggccctgg caagtcagtc tcagaacaag 5581 gtttggaaag cacttctgtg gaggcacctt aatatcccca gagtgggtgc tgactgctgc 5641 tcactgcttg aagaagtcct caaggccttc atcctacaag gtcatcctgg gtgcacacca 5701 agaagtgaac ctcgaatctc atgttcagga aatagaagtg tctaggctgt tcttggagcc 5761 cacacaagca gatattgcct tgctaaagct aagcaggcct gccgtcatca ctgacaaagtPAT059933-PCT-SEC01 5821 aatgccagct tgtctgccat ccccagacta catggtcacc gccaggactg aatgttacat 5881 cactggctgg ggagaaaccc aaggtacctt tgggactggc cttctcaagg aagcccagct 5941 ccttgttatt gagaatgaag tgtgcaatca ctataagtat atttgtgctg agcatttggc 6001 cagaggcact gacagttgcc agggtgacag tggagggcct ctggtttgct tcgagaagga 6061 caaatacatt ttacaaggag tcacttcttg gggtcttggc tgtgcacgcc ccaataagcc 6121 tggtgtctat gctcgtgttt caaggtttgt tacttggatt gagggaatga tgagaaataa 6181 ttaattggac gggagacaga gtgaagcatc aacc ac a gaagctgaaa cgtgggtaag 6241 gatttagcat gctggaaata atagacagca atcaaacgaa gacactgttc ccagctacca 6301 gctatgccaa accttggcat ttttggtatt tttgtgtata agcttttaag gtctgactga 6361 caaattctgt attaaggtgt catagctatg acatttgtta aaaataaact ctgcacttat 6421 tttgatttga a[000142] In certain aspect, Lp(a) may include a fragment, variant, or mutant of the protein that may have the same or similar amino acid sequences (e.g., having about 80%, 85%, 90%, 95%, or 99% or greater of similarity or identity of amino acid sequences) with the above listed Lp(a) gene (mRNA) or protein sequences. In certain aspect, Lp(a) may include a fragment, variant, or mutant of the protein having the same or in similar in vivo or in vitro enzymatic (e.g., reductase) activity, for example, having about 80%, 85%, 90%, 95%, or 99% or the native enzyme activity.[000143] As defined herein, the term “inhibition”, “inhibit”, “inhibiting” and the like mean negatively affecting (e.g. decreasing) activity, expression or function relative to the activity, expression or function in the absence of an inhibitor. In certain aspects, inhibition can mean negatively affecting (e.g. decreasing) the concentration or levels of a biomolecule, such as a protein or mRNA, relative to the concentration or level of the biomolecule in the absence of an inhibitor. In certain aspects, inhibition includes, partially or totally, blocking stimulation, decreasing, preventing, or delaying activation; inactivating, desensitizing, or down-regulating signal transduction or enzymatic activity; or decreasing the amount of a biomolecule target (e.g., protein target or mRNA target). In certain aspects, inhibition refers to a reduction in the expression of a particular biomolecule target, such as a protein target (e.g., PCSK9 protein and / or Lp(a) protein) or an mRNA target (e.g., PCSK9 mRNA and / or Lp(a) mRNA). In certain aspects, inhibition refers to a reduction of amount of a target biomolecule (e.g., PCSK9 protein or mRNA and / or Lp(a) protein or mRNA) resulting from a down-regulating protein expression (e.g. directly inhibiting translation or transcription). In certain aspects, inhibition refers to a reduction of activity of a target biomolecule (e.g., PCSK9 protein or mRNA and / or Lp(a) protein or mRNA) from an indirect interaction (e.g., inhibiting or regulating other transcriptional or translational factors).PAT059933-PCT-SEC01[000144] The term “inhibitor” also refers to antisense agent(s) (e.g., dsRNAi agent(s)), compounds, pharmaceutical compositions, or substances capable of detectably negatively affecting (e.g. decreasing) activity, expression or function of a given protein or gene. For example, an inhibitor may decrease activity, expression or function by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater in comparison to a control in the absence of the inhibitor. Inhibitors include, for example, synthetic or biological molecules, such as oligonucleotides. In some embodiments, the inhibitors include an RNAi agent, e.g., siRNA agent, dsRNAi agent, or dsRNA agent. In some embodiments, the inhibitors include an antisense oligonucleotide (ASO).[000145] As used herein, the “level or degree of inhibiting or decreasing expression” of a given gene refers to the at least partial suppression of the expression of a target gene (e.g., PCSK9 and / or Lp(a)), as manifested by a reduction of the amount of the target gene mRNA (e.g., PCSK9 mRNA and / or Lp(a) mRNA) or protein (e.g., PCSK9 and / or Lp(a)) encoded by the target gene, which may be isolated from or detected in a group of cells (“a first cell”) in which a target gene is transcribed and which has or have been treated such that the expression of a target gene is inhibited, as compared to group of cells substantially identical to the first cell but without treated (“control cells” or “a second cell”).[000146] In some embodiments, the level or expression of the target gene (e.g., PCSK9 and / or Lp(a)) can be measured by evaluation of mRNA (e.g., via Northern blots or PCR). The effect of the antisense agent(s) (e.g., dsRNAi(s) agent) on the target gene (e.g., PCSK9 and / or Lp(a)) expression can be determined by measuring the gene transcription rates (e.g., via Northern blots; or reverse transcriptase polymerase chain reaction or real-time polymerase chain reaction). In some embodiments, the degree of inhibition can be calculated as the following equation:(mRNA in control cells) - (mRNA in treated cells) • 100 %(mRNA in control cells)[000147] Alternatively, the degree of inhibition may be given in terms of a reduction of a parameter that is functionally linked to target gene (e.g., PCSK9 and / or Lp(a)) expression, e.g., the amount of protein encoded by a target gene (e.g., PCSK9 and / or Lp(a)), alteration in expression of the protein whose expression is dependent on the target gene (e.g., PCSK9 and / or Lp(a)), alteration in an activity of the enzyme (e.g., PCSK9 and / or Lp(a)) encoded by the target gene (e.g., PCSK9 and / or Lp(a)). In some embodiments, the level or expression of the protein (e.g., PCSK9 and / or Lp(a)) from the target gene can be evaluated by measuring the expressed protein amount (e.g., Western blots). In some embodiments, the level or expression of the protein from the target gene can be measured by the enzymatic assay (e.g., kinetic assay) of the protein.PAT059933-PCT-SEC01[000148] As used herein, the term “down-regulate” or “down-regulating” refers to any decrease (e.g., statistically significant) in a biological activity and / or expression of the target protein (e.g., PCSK9 and / or Lp(a)), including full blocking of the activity (i.e., complete inhibition) and / or expression. For example, “down-regulation” can refer to a decrease of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% in target protein (e.g., PCSK9 and / or Lp(a)) level, activity and / or expression.[000149] As used herein, the terms “salt” or “salts” refers to an acid addition or base addition salt of an antisense agent or antisense agents (e.g., dsRNAi agent or dsRNAi agents) of the present invention. “Salts” include in particular “pharmaceutical acceptable salts”. The term “pharmaceutically acceptable salts” refers to salts that retain the biological effectiveness and properties of the antisense agent(s) (e.g., dsRNAi agent(s)) of this invention and, which typically are not biologically or otherwise undesirable. In many cases, the antisense agent(s) (e.g., dsRNAi agent(s)) of the present invention are capable of forming acid and / or base salts by virtue of the presence of amino and / or carboxyl groups or groups similar thereto. When both a basic group and an acid group are present in the same molecule, the antisense agent(s) (e.g., dsRNAi agent(s)) of the present invention may also form internal salts, e.g., zwitterionic molecules. In certain aspects, pharmaceutically acceptable acid addition salts can be formed with inorganic acids and organic acids. Examples of the inorganic acids from which salts can be derived include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like. Examples of the organic acids from which salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, mandelic acid, methanesulfonic acid, ethane sulfonic acid, toluenesulfonic acid, sulfosalicylic acid, and the like. In certain aspects, the pharmaceutically acceptable base addition salts can be formed with inorganic and organic bases. Examples of the inorganic bases from which salts can be derived include, for example, ammonium salts and metals from columns I to XII of the periodic table, such as sodium, potassium, ammonium, calcium, magnesium, iron, silver, zinc, and copper; particularly suitable salts include ammonium, potassium, sodium, calcium and magnesium salts. Examples of the organic bases from which salts can be derived include, for example, primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, basic ion exchange resins, and the like, such as organic amines include isopropylamine, benzathine, cholinate, diethanolamine, diethylamine, lysine, meglumine, piperazine and tromethamine.[000150] In certain aspects, the term “pharmaceutically acceptable salt” as used herein may include the salts forms in acetate, ascorbate, adipate, aspartate, benzoate, besylate, bromide / hydrobromide,PAT059933-PCT-SEC01 bicarbonate / carbonate, bisulfate / sulfate, camphorsulfonate, caprate, chloride / hydrochloride, chlortheophyllonate, citrate, ethandisulfonate, fumarate, gluceptate, gluconate, glucuronate, glutamate, glutarate, glycolate, hippurate, hydroiodide / iodide, isethionate, lactate, lactobionate, laurylsulfate, malate, maleate, malonate, mandelate, mesylate, methylsulphate, mucate, naphthoate, napsylate, nicotinate, nitrate, octadecanoate, oleate, oxalate, palmitate, pamoate, phosphate / hydrogen phosphate / dihydrogen phosphate, polygalacturonate, propionate, sebacate, stearate, succinate, sulfosalicylate, sulfate, tartrate, tosylate trifenatate, trifluoroacetate or xinafoate.[000151] As used herein, the term "pharmaceutically acceptable carrier" refers to a substance useful in the preparation or use of a pharmaceutical composition and includes, for example, suitable diluents, solvents, dispersion media, surfactants, antioxidants, preservatives, isotonic agents, buffering agents, emulsifiers, absorption delaying agents, salts, drug stabilizers, binders, excipients, disintegration agents, lubricants, wetting agents, sweetening agents, flavoring agents, dyes, and combinations thereof, as would be known to those skilled in the art (see, for example, Remington The Science and Practice of Pharmacy, 22nd Ed. Pharmaceutical Press, 2013, pp. 1049-1070).[000152] As used herein, the term “treat,” “treating,” or “treatment” of any disease or disorder refers to alleviating or ameliorating the disease or disorder (i.e., slowing or arresting the development of the disease or at least one of the clinical symptoms thereof); or alleviating or ameliorating at least one physical parameter or biomarker associated with the disease or disorder, including those which may not be discernible to the patient. In some embodiments, treating does not include preventing.[000153] As used herein, the term “prevent”, “preventing" or “prevention” of any disease or disorder refers to the prophylactic treatment of the disease or disorder; or delaying the onset or progression of the disease or disorder. It also refers to a reduction in the likelihood that a subject will develop a symptom associated with such a disease, disorder, or condition, e.g., a symptom of a PCSK9-associated disorder and / or an Lp(a)-associated disorder, e.g., inflammatory, cardiovascular and / or metabolic diseases, disorders, and conditions. Certain such cardiovascular diseases, disorders or conditions include, but are not limited to, elevated Lp(a) associated CVD risk, recurrent cardiovascular events with elevated Lp(a), aortic stenosis (e.g., calcific aortic valve stenosis associated with high Lp(a)), aneurysm (e.g., abdominal aortic aneurysm), angina, arrhythmia, atherosclerosis, cerebrovascular disease, coronary artery disease, coronary heart disease, dyslipidemia, hypercholesterolemia, hyperlipidemia, hypertension, hypertriglyceridemia, myocardial infarction, peripheral vascular disease (e.g., peripheral artery disease, peripheral artery occlusive disease), retinal vascular occlusion, or stroke. Certain such metabolic diseases, disorders or conditions include, but are not limited to, hyperglycemia, prediabetes, diabetes (type I and type II), obesity, insulin resistance, metabolic syndrome and diabetic dyslipidemia. Certain suchPAT059933-PCT-SEC01 inflammatory diseases, disorders or conditions include, but are not limited to, aortic stenosis, coronary artery disease (CAD), Alzheimer's Disease and thromboembolic diseases, disorder or conditions. Certain thromboembolic diseases, disorders or conditions include, but are not limited to, stroke, thrombosis (e.g., venous thromboembolism), myocardial infarction and peripheral vascular disease. Certain embodiments provide compositions and methods for preventing, treating, delaying, slowing the progression and / or ameliorating aortic stenosis. The failure to develop a disease, disorder or condition, or the reduction in the development of a symptom associated with such a disease, disorder or condition (e.g., by at least about 10% on a clinically accepted scale for that disease or disorder), or the exhibition of delayed symptoms that are delayed, e.g., by days, weeks, months or years, which is considered an effective prevention.[000154] The term “therapy,” as used herein refers to an application of one or more specific procedures used for the amelioration of at least one indicator or a disease or condition. In certain aspects, the specific procedure is the administration of one or more pharmaceutical or therapeutic agents.[000155] The term “associated” or “associated with” in the context of a substance or substance activity or function associated with a disease (e.g. a protein associated disease, or PCSK9 associated disease and / or Lp(a) associated disease) means that the disease is caused by (in whole or in part), or a symptom of the disease is caused by (in whole or in part) the substance or substance activity or function (e.g., PCSK9 activity or function and / or Lp(a) activity or function). Thus, as used herein, what is described as “being associated” with a disease, if a causative agent, could be a target for treatment of the disease.[000156] As used herein, the term “hyperlipidemia” refers to any disorder, disease or condition characterized by abnormal elevation of levels of any or all lipids, such as cholesterol and triglycerides, and / or lipoproteins in the blood or a condition that can lead to abnormal elevation of levels of any or all lipids and / or lipoproteins in the blood. In some embodiments, the hyperlipidemia is hypertriglyceridemia. As used herein, the term “hypertriglyceridemia” refers to a condition in which triglyceride levels are elevated, often caused or exacerbated by uncontrolled hyperlipidemia mellitus, obesity, and sedentary habits. In some embodiments, hypertriglyceridemia means triglycerides in blood are greater than 1000-2000 mg / dL. In some embodiments, the hyperlipidemia is hypercholesterolemia. As used herein the term “hypercholesterolemia” refers to a form of hyperlipidemia (elevated levels of lipids in the blood) in which there are high levels of cholesterol in the serum of a subject. In some embodiments, hypercholesterolemia means at least about 240 mg / dL of total cholesterol.PAT059933-PCT-SEC01[000157] As used herein, the term “administering” means oral administration, administration as a suppository, topical contact, intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration, or the implantation of a slow-release device, e.g., a mini-osmotic pump, to a subject. Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal) compatible with the preparation. Parenteral administration includes, e.g., intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc.[000158] As used herein, the term “antisense agent” refers to an oligonucleotide that can provide a therapeutic effect, e.g. by interacting with a biomolecule and / or by regulating gene expression. Antisense agents include, but are not limited to, RNA interference (RNAi) agents (e.g. dsRNAi agents) and antisense oligonucleotides (ASO). RNAi is a post-transcriptional, targeted gene-silencing technique that uses RNAi agents to degrade messenger RNA (mRNA) from a gene of interest. ASOs are single-stranded nucleic acids that can be used to target mRNA derived from a gene of interest. ASOs can alter gene expression via a number of mechanisms including direct steric blockage of mRNA and ribonuclease H (RNase H) mediated degradation of mRNA.[000159] The term “combination,” embraces mixtures of first and second antisense agents, e.g., dsRNAi agents. The term “combination,” also embraces first and second antisense agents, e.g., dsRNAi agents, which are formulated separately. In some embodiments, the first antisense agent (e.g., a first dsRNAi agent) and / or the second antisense agent (e.g., a second dsRNAi agent) are administered together with one or more additional therapeutic agents. In certain embodiments, the first antisense agent (e.g., a first dsRNAi agent) is administered at the same time, prior to, or after the administration of the second antisense agent (e.g., a second dsRNAi agent). In certain embodiments, the first antisense agent (e.g., a first dsRNAi agent) and the second antisense agent (e.g., a second dsRNAi agent) are administered together. In some embodiments, the first antisense agent (e.g., a first dsRNAi agent) is formulated with one or more additional therapeutic agents, optionally in the same pharmaceutical composition as the first antisense agent (e.g., the first dsRNAi agent). In some embodiments, the second antisense agent (e.g., a second dsRNAi agent) is formulated with one or more additional therapeutic agents, optionally in the same pharmaceutical composition as the second antisense agent (e.g., a second dsRNAi agent). In some embodiments, the first antisense agent (e.g., a first dsRNAi agent) and the second antisense agent (e.g., a second dsRNAi agent) are formulated with one or more additional therapeutic agents, optionally in the same pharmaceutical compositionPAT059933-PCT-SEC01 as the first antisense agent (e.g., the first dsRNAi agent) and the second antisense agent (e.g., the second dsRNAi agent).[000160] Additional therapeutic agents include, for example, other active drugs known to be useful in treating a disease (e.g., inflammatory, cardiovascular and / or metabolic diseases, disorders, and conditions. Certain such cardiovascular diseases, disorders or conditions include, but are not limited to, elevated Lp(a) associated CVD risk, recurrent cardiovascular events with elevated Lp(a), aortic stenosis (e.g., calcific aortic valve stenosis associated with high Lp(a)), ASCVD, aneurysm (e.g., abdominal aortic aneurysm), angina, arrhythmia, atherosclerosis, cerebrovascular disease, coronary artery disease, coronary heart disease, dyslipidemia, hypercholesterolemia, hyperlipidemia, hypercholesterolemia hypertension, hypertriglyceridemia, myocardial infarction, peripheral vascular disease (e.g., peripheral artery disease, peripheral artery occlusive disease), retinal vascular occlusion, or stroke. Certain such metabolic diseases, disorders or conditions include, but are not limited to, hyperglycemia, prediabetes, diabetes (type I and type II), obesity, insulin resistance, metabolic syndrome and diabetic dyslipidemia. Certain such inflammatory diseases, disorders or conditions include, but are not limited to, aortic stenosis, coronary artery disease (CAD), Alzheimer's Disease and thromboembolic diseases, disorder or conditions. Certain thromboembolic diseases, disorders or conditions include, but are not limited to, stroke, thrombosis (e.g., venous thromboembolism), myocardial infarction and peripheral vascular disease. Certain embodiments provide compositions and methods for preventing, treating, delaying, slowing the progression and / or ameliorating aortic stenosis) or with adjunctive agents that may not be effective alone or may be known to be useful in treating a disease (e.g., hyperlipidemia, hypercholesterolemia or ASCVD). In some embodiments, the one or more additional therapeutic agents are administered alone (or separately) or can be coadministered to a patient with the first and / or second dsRNAi agent.[000161] In some embodiments, the first antisense agent (e.g., first dsRNAi agent) and the second antisense agent (e.g., second dsRNAi agent) are co-administered. Co-administration includes administering the first antisense agent (e.g., first dsRNAi agent) within 0.5, 1, 2, 4, 6, 8, 10, 12, 16, 20, or 24 hours of the second antisense agent (e.g., second dsRNAi agent). Co-administration includes administering the first antisense agent (e.g., first dsRNAi agent) and the second antisense agent (e.g. second dsRNAi agent) simultaneously, approximately simultaneously (e.g., within about 1, 5, 10, 15, 20, or 30 minutes of each other), or sequentially in any order. In some embodiments, co-administration can be accomplished by co-formulation, i.e., preparing a single pharmaceutical composition including the first antisense agent (e.g., first dsRNAi agent) and the second antisense agent (e.g., second dsRNAi agent). In some embodiments, the first antisense agent (e.g., first dsRNAi agent) and the second antisense agent (e.g., second dsRNAi agent) are formulated separately.PAT059933-PCT-SEC01[000162] The terms "subject" and “patient” as used herein are used interchangeably. The term subject includes a human or non-human animal, preferably a vertebrate, and more preferably a mammal. In certain aspects, the subject is a human. In certain aspects, the subject is a human patient.[000163] As used herein, a subject is “in need of’ a treatment if such subject would benefit biologically, medically or in quality of life from such treatment.[000164] The term "a therapeutically effective amount" of an antisense agent or antisense agents, e.g., dsRNAi agent or dsRNAi agent(s) (e.g., siRNA(s)) as disclosed herein refers to an amount of the antisense agent or antisense agents (e.g., dsRNAi agent or dsRNAi agent(s)) that will elicit the biological or medical response of a subject, for example, reduction or inhibition of an enzyme or a protein activity, or ameliorate symptoms, alleviate conditions, slow or delay disease progression, or prevent a disease, etc. In certain aspects, the term “a therapeutically effective amount” refers to the amount of the antisense agent or antisense agents, e.g., dsRNAi agent or dsRNAi agent(s) (e.g., siRNA(s)) of the disclosure that, when administered to a subject, is effective to (1) at least partially alleviate, prevent and / or ameliorate a condition, or a disorder or a disease (i) mediated by the target gene (e.g., PCSK9 and / or Lp(a)), or (ii) associated with its activity, or (iii) characterized by activity (normal or abnormal) of the protein encoded by the target gene (e.g., PCSK9 and / or Lp(a)); or (2) reduce or inhibit the activity of the protein encoded by the target gene (e.g., PCSK9 and / or Lp(a)); or (3) reduce or inhibit the expression of the target gene (e.g., PCSK9 and / or Lp(a)). In certain aspects, the term “a therapeutically effective amount” refers to the amount of the antisense agent(s) (e.g., dsRNAi agent(s)) that, when administered to a cell, or a tissue, or a non-cellular biological material, or a medium, is effective to at least partially reducing or inhibiting the activity of the protein encoded by the target gene (e.g., PCSK9 and / or Lp(a)); or at least partially reducing or inhibiting the expression of the protein (e.g., PCSK9 and / or Lp(a)) encoded by the target gene. The meaning of the term “a therapeutically effective amount” as illustrated in the above embodiment for the target gene expression also applies by the same means to any other relevant proteins / peptides / enzymes (e.g., PCSK9, Lp(a) or other proteins relevant to cholesterol uptake or biosynthesis).[000165] For any antisense agent(s) (e.g., dsRNAi agent(s)) described herein, the therapeutically effective amount can be initially determined from cell culture assays. Target concentrations will be those concentrations of active antisense agent(s) (e.g., dsRNAi agent(s)) or compound(s) that are capable of achieving the methods described herein, as measured using the methods described herein or known in the art. Therapeutically effective amounts for use in humans can also be determined from animal models. For example, a dose for humans can be formulated to achieve a concentration that has been found to be effective in animals. The dosage in humans can be adjusted by monitoring effectiveness and adjusting the dosage upwards or downwards, as described above. An example ofPAT059933-PCT-SEC01 an “therapeutically effective amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease. For example, for the given parameter (e.g., biomarker), a therapeutically effective amount will show an increase or decrease of at least about 5%, about 10%, about 15%, about 20%, about 25%, about 40%, about 50%, about 60%, about 75%, about 80%, about 90%, or about 95%. Therapeutic efficacy can also be expressed as “-fold” increase or decrease. For example, a therapeutically effective amount can have at least a 1.2-fold, 1.5-fold, 2-fold, 5-fold, or more effect over a control.[000166] The term “control” or “control experiment” is used in accordance with its plain ordinary meaning and refers to an experiment in which the subjects or reagents of the experiment are treated as in a parallel experiment except for omission of a procedure, reagent, or variable of the experiment. Typically, a control is used as a standard of comparison in evaluating experimental effects. In some embodiments, a control is the measurement of the expression of a protein or mRNA (e.g., PCSK9 and / or Lp(a)) in the absence of antisense agent(s) (e.g., RNAi agent(s)) as described herein.[000167] Unless defined otherwise, the chemical structures and formulae set forth herein are constructed according to the standard rules of chemical valency known in the chemical arts.[000168] The term “alkyl,” by itself or as part of another substituent, means, unless otherwise stated, a straight (i.e., unbranched) or branched carbon chain (or carbon), or combination thereof, which is fully saturated (i.e., molecule by only single bonds) and include mono-, di- and multivalent radicals. As used herein, the alkyl is an uncyclized chain. The alkyl may include a designated number of carbons (e.g., Ci-Cio means one to ten carbons). Examples of alkyl include, but are not limited to, groups such as C1-30 alkyl, C1-25 alkyl, C1-20 alkyl, C1-15 alkyl, C1-12 alkyl, C1-10 alkyl, C1-8 alkyl, C1-6 alkyl, C1-4 alkyl, or C1-3 alkyl. For example, C1-6 alkyl include, but are not limited to, methyl, ethyl, n-propyl, 1 -methylethyl (iso-propyl), n-butyl, n-pentyl and 1,1 -dimethylethyl (t-butyl), and their isomers.[000169] A term “alkylene,” by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from an alkyl, as exemplified, but not limited by, -CH2CH2CH2CH2-[000170] As used herein, the term "alkenyl," by itself or as part of another substituent, means, unless otherwise stated, a straight (i.e., unbranched) or branched carbon chain (or carbon), or combination thereof, which is mono- or polyunsaturated (i.e., molecule including at least one double bond) and include mono-, di- and multivalent radicals. As used herein, the alkenyl is an uncyclized chain. Like the alkyl, the alkenyl may include a designated number of carbons (e.g., C1-C10 means one to ten carbons). Examples of alkenyl include, but are not limited to, groups such as C1-30 alkenyl, Ci -25 alkenyl, C 1-20 alkenyl, C1-15 alkenyl, C1-12 alkenyl, C1-10 alkenyl, C1-8 alkenyl, C1-6 alkenyl, C1-4PAT059933-PCT-SEC01 alkenyl, or C1-3 alkenyl. For example, C2-6 alkenyl include, but are not limited to, ethenyl (vinyl), prop-l-enyl, but-l-enyl, pent-l-enyl, pent-4-enyl and penta- 1,4-dienyl, and their isomers. A term “alkenylene,” by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from an alkenyl, as exemplified, but not limited by, -CH=CHCH2CH2-.[000171] As used herein, the term " alkynyl," by itself or as part of another substituent, means, unless otherwise stated, a straight (i.e., unbranched) or branched carbon chain (or carbon), or combination thereof, which is mono- or polyunsaturated (i.e., molecule including at least one triple bond) and include mono-, di- and multivalent radicals. As used herein, the alkynyl is an uncyclized chain. Like the alkyl, the alkynyl may include a designated number of carbons (e.g., C1-C10 means one to ten carbons). Examples of alkynyl include, but are not limited to, groups such as C1-30 alkynyl, Ci-25 alkynyl, C1-20 alkynyl, C1-15 alkynyl, C1-12 alkynyl, C1-10 alkynyl, C1-8 alkynyl, C1-6 alkynyl, C1-4 alkynyl, or C1-3 alkynyl. For example, C2-6 alkynyl include, but are not limited to, alkynyl, and their isomers. A term “alkynyl,” by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from an alkenyl, as exemplified, but not limited by, -CCH2CH2-.[000172] As used herein, the term “alkoxy” refers to a radical of the formula -ORawhere Rais an alkyl (e.g., C 1-30 alkyl, Ci-25 alkyl, C1-20 alkyl, C1-15 alkyl, C1-12 alkyl, C1-10 alkyl, C1-8 alkyl, C1-6 alkyl, C1-4 alkyl, or C1-3 alkyl) radical as generally defined above. For example, C1-6 alkoxy include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, pentoxy, and hexoxy.[000173] As used herein, the term " alkoxyalkyl " refers to a radical of the formula -Ra-0-Rbwhere each Raand Rbis independently an alkyl (e.g., C1-30 alkyl, C1-25 alkyl, C1-20 alkyl, C1-15 alkyl, C1-12 alkyl, Ci-10 alkyl, C1-8 alkyl, C1-6 alkyl, C1-4 alkyl, or C1-3 alkyl) radical as defined above and oxygen atom may be bonded to any carbon atom in either alkyl radical. For example, Ci-ealkoxy Ci-ealkyl include, but are not limited to, methoxy-methyl, methoxy-ethyl, ethoxy-ethyl, 1 -ethoxy-propyl and 2 -methoxy-butyl.[000174] As used herein, the term “alkylcarbonyl” refers to a radical of the formula -C(=O)-Ra where Rais an alkyl (e.g., C1-30 alkyl, C1-25 alkyl, C1-20 alkyl, C1-15 alkyl, C1-12 alkyl, C1-10 alkyl, C1-8 alkyl, C1-6 alkyl, C1-4 alkyl, or C1-3 alkyl) radical as defined above.[000175] As used herein, the term "alkyl-carbonyl alkyl” refers to a radical of the formula, e.g., -Ra-C(=O)-Rbwhere each Raand Rbis independently an alkyl (e.g., C1-30 alkyl, C1-25 alkyl, C1-20 alkyl, Ci-15 alkyl, C1-12 alkyl, C1-10 alkyl, C1-8 alkyl, C1-6 alkyl, C1-4 alkyl, or C1-3 alkyl) radical as defined above. The carbon atom of the carbonyl group may be bonded to any carbon atom in either alkyl radical.PAT059933-PCT-SEC01[000176] As used herein, the term "alkylaminocarbonyl" refers to a radical of the formula -C(=O)-NH-Rawhere Rais an alkyl (e.g., C1-30 alkyl, C1-25 alkyl, C1-20 alkyl, C1-15 alkyl, C1-12 alkyl, C1-10 alkyl, C1-8 alkyl, C1-6 alkyl, C1-4 alkyl, or C1-3 alkyl) as defined above.[000177] As used herein, the term "alkoxy carbonyl” refers to a radical of the formula -C(=O)-O-Rawhere Rais an alkyl (e.g., C1-30 alkyl, C1-25 alkyl, C1-20 alkyl, C1-15 alkyl, C1-12 alkyl, C1-10 alkyl, Ci-8 alkyl, C1-6 alkyl, C1-4 alkyl, or C1-3 alkyl) radical as defined above.[000178] As used herein, the term “alkoxy carbonyl alkyl” refers to a radical of the formula -Ra-C(=O)-O-Rbwhere each Raand Rbis independently an alkyl (e.g., C1-30 alkyl, C1-25 alkyl, C1-20 alkyl, Ci-15 alkyl, C1-12 alkyl, C1-10 alkyl, C1-8 alkyl, C1-6 alkyl, C1-4 alkyl, or C1-3 alkyl) radical as defined above.[000179] As used herein, the term "haloalkyl" refers to an alkyl (e.g., C1-30 alkyl, C1-25 alkyl, C1-20 alkyl, C 1-15 alkyl, C 1-12 alkyl, C1-10 alkyl, C1-8 alkyl, C1-6 alkyl, C1-4 alkyl, or C1-3 alkyl) radical, as defined above, substituted by one or more halo radicals, as defined above. Examples of halogenCi-ealkyl include, but are not limited to, trifluoromethyl, difluoromethyl, fluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, l,3-dibromopropan-2-yl, 3-bromo-2-fluoropropyl and l,4,4-trifluorobutan-2-yl.[000180] As used herein, the term "hydroxyalkyl” refers to an alkyl (e.g., C1-30 alkyl, C1-25 alkyl, C1-20 alkyl, Ci-15 alkyl, C1-12 alkyl, C1-10 alkyl, C1-8 alkyl, C1-6 alkyl, C1-4 alkyl, or C1-3 alkyl) radical as defined above, wherein one of the hydrogen atoms of the alkyl radical is replaced by OH. Examples of hydroxyCi-6 alkyl include, but are not limited to, hydroxy-methyl, 2-hydroxy-ethyl, 2-hydroxy-propyl, 3 -hydroxy-propyl and 5 -hydroxy-pentyl.[000181] As used herein, the term “aminoalkyl” refers to an alkyl (e.g., C1-30 alkyl, C1-25 alkyl, Ci-20 alkyl, Ci-15 alkyl, C1-12 alkyl, C1-10 alkyl, C1-8 alkyl, C1-6 alkyl, C1-4 alkyl, or C1-3 alkyl) radical as defined above, wherein one of the hydrogen atoms of the Ci-ealkyl group is replaced by a primary amino group. Examples of amino C1-6 alkyl include, but are not limited to, amino-methyl, 2-amino-ethyl, 2-amino-propyl, 3 -amino-propyl, 3 -amino-pentyl and 5 -amino-pentyl.[000182] As used herein, the term “alkylamino” refers to a radical of the formula -NH-Rawhere Rais an alkyl (e.g., C1-30 alkyl, C1-25 alkyl, C1-20 alkyl, C1-15 alkyl, C1-12 alkyl, C1-10 alkyl, C1-8 alkyl, C1-6 alkyl, C1-4 alkyl, or C1-3 alkyl) radical as defined above.[000183] The term “heteroalkyl,” by itself or in combination with another term, means, unless otherwise stated, a stable straight or branched chain, or combination thereof, which is fully saturated (i.e., molecule by only single bonds) and include mono-, di- and multivalent radicals, including at least one carbon atom and at least one heteroatom (e.g., O, N, S, Si, or P), and wherein the nitrogen and sulfur atoms may optionally be oxidized, and the nitrogen heteroatom may optionally be quatemized. The heteroatom(s) (e.g., O, N, S, Si, or P) may be placed at any interior position of thePAT059933-PCT-SEC01 heteroalkyl group or at the position at which the alkyl group is attached to the remainder of the molecule. Heteroalkyl is an uncyclized chain. The heteroalkyl may include a designated number of carbons and heteroatoms (e.g., “2 to 10 membered heteroalkyl” means two to 10 atoms including carbons and heteroatoms).[000184] Similarly, the term “heteroalkylene,” by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from heteroalkyl, as exemplified, but not limited by, -CH2-CH2-S-CH2-CH2- and -CH2-S-CH2-CH2-NH-CH2-. For heteroalkylene groups, heteroatoms can also occupy either or both of the chain termini (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, and the like).[000185] As used herein, the term "heteroalkenyl," by itself or as part of another substituent, means, unless otherwise stated, a straight (i.e., unbranched) or branched carbon chain (or carbon), or combination thereof, which is mono- or polyunsaturated (i.e., molecule including at least one double bond between carbon and carbon) and include mono-, di- and multivalent radicals. As used herein, the alkenyl is an uncyclized chain. Like the alkenyl, the heteroalkenyl may include a designated number of carbons and heteroatoms (e.g., “2 to 10 membered heteroalkenyl” means two to 10 atoms including carbons and heteroatoms).[000186] As used herein, the term " heteroalkynyl," by itself or as part of another substituent, means, unless otherwise stated, a straight (i.e., unbranched) or branched carbon chain (or carbon), or combination thereof, which is mono- or polyunsaturated (i.e., molecule including at least one triple bond between carbon and carbon) and include mono-, di- and multivalent radicals. As used herein, the alkynyl is an uncyclized chain. The heteroalkynyl may include a designated number of carbons and heteroatoms (e.g., “2 to 10 membered heteroalkynyl” means two to 10 atoms including carbons and heteroatoms).[000187] For alkylene and heteroalkylene linking groups, no orientation of the linking group is implied by the direction in which the formula of the linking group is written. For example, the formula -C(O)2R'- represents both -C(O)2R'- and -R'C(O)2-.[000188] A “cycloalkylene” and a “heterocycloalkylene,” alone or as part of another substituent, means a divalent radical derived from a cycloalkyl and heterocycloalkyl, respectively. The terms “cycloalkyl” and “heterocycloalkyl,” by themselves or in combination with other terms, mean, unless otherwise stated, cyclic versions of “alkyl” and “heteroalkyl,” respectively. Cycloalkyl and heterocycloalkyl are not aromatic. Additionally, for heterocycloalkyl, a heteroatom can occupy the position at which the heterocycle is attached to the remainder of the molecule. Examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 1 -cyclohexenyl, 3-cyclohexenyl, cycloheptyl, and the like. Examples of heterocycloalkyl include, but are not limited to,PAT059933-PCT-SEC01 1-(1,2,5,6-tetrahydropyridyl), 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl, tetrahydrothien-2-yl, tetrahydrothien-3-yl, 1-piperazinyl, 2-piperazinyl, and the like. A “cycloalkylene” and a “heterocycloalkylene,” alone or as part of another substituent, means a divalent radical derived from a cycloalkyl and heterocycloalkyl, respectively.[000189] The term “aryl” means, unless otherwise stated, a polyunsaturated, aromatic, hydrocarbon substituent, which can be a single ring or multiple rings (preferably from 1 to 3 rings) that are fused together (i.e., a fused ring aryl) or linked covalently. A fused ring aryl refers to multiple rings fused together wherein at least one of the fused rings is an aryl ring. The term “heteroaryl” refers to aryl groups (or rings) that contain at least one heteroatom such as N, O, or S, wherein the nitrogen and sulfur atoms are optionally oxidized, and the nitrogen atom(s) are optionally quatemized. Thus, the term “heteroaryl” includes fused ring heteroaryl groups (i.e., multiple rings fused together wherein at least one of the fused rings is a heteroaromatic ring). A 5,6-fused ring heteroarylene refers to two rings fused together, wherein one ring has 5 members and the other ring has 6 members, and wherein at least one ring is a heteroaryl ring. Likewise, a 6,6-fused ring heteroarylene refers to two rings fused together, wherein one ring has 6 members and the other ring has 6 members, and wherein at least one ring is a heteroaryl ring. And a 6,5 -fused ring heteroarylene refers to two rings fused together, wherein one ring has 6 members and the other ring has 5 members, and wherein at least one ring is a heteroaryl ring. A heteroaryl group can be attached to the remainder of the molecule through a carbon or heteroatom. Non-limiting examples of aryl and heteroaryl groups include phenyl, naphthyl, pyrrolyl, pyrazolyl, pyridazinyl, triazinyl, pyrimidinyl, imidazolyl, pyrazinyl, purinyl, oxazolyl, isoxazolyl, thiazolyl, furyl, thienyl, pyridyl, pyrimidyl, benzothiazolyl, benzooxazoyl benzimidazolyl, benzofuran, isobenzofuranyl, indolyl, isoindolyl, benzothiophenyl, isoquinolyl, quinoxalinyl, quinolyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2 -furyl, 3-furyl, 2-thienyl, 3 -thienyl, 2-pyridyl, 3 -pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5 -benzothiazolyl, purinyl, 2-benzimidazolyl, 5 -indolyl, 1 -isoquinolyl, 5 -isoquinolyl, 2-quinoxalinyl, 5 -quinoxalinyl, 3 -quinolyl, and 6-quinolyl. Substituents for each of the above noted aryl and heteroaryl ring systems are selected from the group of acceptable substituents described below. An “arylene” and a “heteroarylene,” alone or as part of another substituent, mean a divalent radical derived from an aryl and heteroaryl, respectively.[000190] The terms “halo” or “halogen,” by themselves or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom. Additionally, terms such asPAT059933-PCT-SEC01 “haloalkyl” are meant to include monohaloalkyl and polyhaloalkyl. For example, the term “halo(Ci-C4)alkyl” includes, but is not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, 3 -bromopropyl, and the like.[000191] The symbol “ ' v- ” denotes the point of attachment of a chemical moiety to the remainder of a molecule or chemical formula.[000192] The term “oxo,” as used herein, means an oxygen that is double-bonded to a carbon atom.[000193] Each of the above terms (e.g., “alkyl,” “heteroalkyl,” “cycloalkyl,” “heterocycloalkyl,” “aryl,” and “heteroaryl”) includes both substituted and unsubstituted forms of the indicated radical. Substituents for the alkyl and heteroalkyl radicals (including those groups often referred to as alkylene, alkenyl, heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) can be one or more of a variety of groups selected from, but not limited to, —OR', =0, =NR', =N— OR', —NR'R", —SR', -halogen, — SiR'R" R'", — OC(O)R', — C(O)R', — CO2R', — CONR'R", — 0C(0)NR'R", — NR''C(0)R', — NR'— C(0)NR" R'", — NR" C(0)2R', — NR— C(NR'R''R'")=NR"", — NR— C(NR'R")=NR'", — S(O)R', — S(O)2R', — S(O)2NR'R", — NRSO2R', — NR'NR" R'", — ONR'R", — NR'C(O)NR''NR'''R'''', — CN, — NO2, — NR'SO2R", — NR'C(0)R", — NR'C(O) — OR", — NR'OR", in a number ranging from zero to (2m'+l), where m' is the total number of carbon atoms in such radical. R, R', R", R'", and R'"' each preferably independently refer to hydrogen, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl (e.g., aryl substituted with 1-3 halogens), substituted or unsubstituted heteroaryl, substituted or unsubstituted alkyl, alkoxy, or thioalkoxy groups, or arylalkyl groups. When a dsRNAi agent described herein includes more than one R group, for example, each of the R groups is independently selected as are each R', R", R'", and R'”' group when more than one of these groups is present. When R' and R" are attached to the same nitrogen atom, they can be combined with the nitrogen atom to form a 4-, 5-, 6-, or 7-membered ring. For example, — NR'R" includes, but is not limited to, 1-pyrrolidinyl and 4-morpholinyl. From the above discussion of substituents, one of skill in the art will understand that the term “alkyl” is meant to include groups including carbon atoms bound to groups other than hydrogen groups, such as haloalkyl (e.g., -CF3 and -CH2CF3) and acyl (e.g., -C(O)CH3, —C(O)CF3, —C(O)CH2OCH3, and the like).[000194] Certain dsRNAi agent(s) provided herein possess asymmetric carbon atoms (optical or chiral centers) or double bonds; the enantiomers, racemates, diastereomers, tautomers, geometric isomers, stereoisomeric forms that may be defined, in terms of absolute stereochemistry, as (R)- or (S)- or, as (D)- or (L)- for amino acids, and individual isomers are encompassed within the scope of the present disclosure. The dsRNAi agent(s) provided herein do not include those that are known inPAT059933-PCT-SEC01 art to be too unstable to synthesize and / or isolate. dsRNAi agent(s) provided herein include those in racemic and optically pure forms. Optically active (R)- and (S)-, or (D)- and (L)-isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques. When the dsRNAi agent(s) described herein contain olefinic bonds (vinyl group) and unless specified otherwise, it is intended that the compounds include both (E) and (Z) geometric isomers.[000195] As used herein, the term “isomers” refers to antisense agent(s) (e.g., dsRNAi agent(s)) having the same number and kind of atoms, and hence the same molecular weight, but differing in respect to the structural arrangement or configuration of the atoms.Antisense Agents[000196] The antisense agent may be an RNAi agent. In an aspect, the disclosure provides RNAi agents including a double stranded RNA (dsRNA). In an aspect, also provided are dsRNA interference (dsRNAi) agents that include a dsRNA comprising (i) a sense strand and (ii) an antisense strand. In an aspect, also provided are dsRNA interference (dsRNAi) agents that include a dsRNA consisting of (i) a sense strand and (ii) an antisense strand, and a ligand attached to at least one of the sense strand and the antisense strand.[000197] A dsRNA is a complex of ribonucleic acid (RNA) molecules formed in a duplex structure. In certain aspects, the dsRNA may be a small interfering RNA (siRNA) that has 10 to 30, or particularly 15-25 nucleotides in each RNA molecule, respectively, “passenger strand” and “guide strand”, and can be incorporated into an RNA-induced silencing complex (RISC). The siRNA is dissociated or unwounded in the RISC, and the passenger strand is degraded while the guide strand remains in the RISC pathway. The guide strand can subsequently bind to an mRNA molecule that includes a complementary sequence to the guide strand and induce or initiate cleavage or degradation of the mRNA molecule. In certain aspects, the mRNA encodes a target gene (e.g., mRNA transcript of a target gene) such that expression of the target gene is suppressed or inhibited through a post-transcriptional gene-silencing (“RNA silencing”). A guide RNA molecule has a complementary sequence to a target mRNA sequence and has anti-parallel orientation to the target gene, so it is interchangeably referred to as an antisense strand. A passenger RNA molecule forming a duplex with the guide RNA and having a complementary sequence to the guide strand (antisense strand) has the same orientation with the target mRNA sequence, so it is interchangeably referred to as a sense strand.The first antisense agent[000198] In an aspect, the first antisense agent is a PCSK9 inhibitor.[000199] In some embodiments, the first antisense agent is a dsRNAi agent. In some embodiments, the first antisense agent is an ASO or an ASO agent.PAT059933-PCT-SEC01[000200] The disclosure provides a dsRNA interference (dsRNAi) agent that is capable of interacting or recruiting a target mRNA sequence, e.g., PCSK9 mRNA sequence, in the RISC thereby cleaving the target mRNA. The first dsRNAi agent can silence PCSK9 gene, e.g., by inhibiting, downregulating, or suppressing the expression of PCSK9 gene. Gene-silencing (e.g., inhibiting, downregulating, or suppressing of the gene) may be assessed by a decrease in an absolute or relative level of one or more variables that are associated with PCSK9 expression compared with a control level. The control level may be any type obtained from, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or untreated or treated subject with inactive agents (e.g., PBS buffer). In some embodiments, the level of silencing the PCSK9 may be demonstrated by a reduction of the amount of a total PCSK9 mRNA in a cell. In some embodiments, the level of silencing the PCSK9 may be demonstrated by a reduction of the amount of a total PCSK9 protein in a cell.[000201] In some embodiments, expression of the PCSK9 gene (e.g., human PCSK9) is inhibited by at least about 10%, about 15%, about 20%, about 25%, about 30 %, about 40%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% based on the expression level of the PCSK9 gene in untreated cell or subject. In some embodiments, expression of the PCSK9 gene (e.g., human PCSK9) is inhibited by at least about 20% based on the expression level of the PCSK9 gene in untreated cell or subject. In some embodiments, expression of the PCSK9 gene (e.g., human PCSK9) is inhibited by at least about 30% based on the expression level of the PCSK9 gene in untreated cell or subject. In some embodiments, expression of the PCSK9 gene (e.g., human PCSK9) is inhibited by at least about 40% based on the expression level of the PCSK9 gene in untreated cell or subject. In some embodiments, expression of the PCSK9 gene (e.g., human PCSK9) is inhibited by at least about 50% based on the expression level of the PCSK9 gene in untreated cell or subject. In some embodiments, expression of the PCSK9 gene (e.g., human PCSK9) is inhibited by at least about 60% based on the expression level of the PCSK9 gene in untreated cell or subject. In some embodiments, expression of the PCSK9 gene (e.g., human PCSK9) is inhibited by at least about 70% based on the expression level of the PCSK9 gene in untreated cell or subject.[000202] In some embodiments, inhibition of the expression of the PCSK9 gene may be manifested by a reduction of the amount of mRNA expressed in a first cell or a first group of cells obtained from a subject that has been treated, e.g., by contacting the cell or by administering the first antisense agent (e.g., first dsRNAi agent) as described herein, as compared to a second cell or a second group of cells obtained from a subject that has not been treated but is identical to the first cell or the first group of cells. For example, the level of gene-silencing (e.g., inhibiting, downregulating, or suppressing of the gene) of the PCSK9 (e.g., human PCSK9) may be presented as a percentage of remaining mRNAPAT059933-PCT-SEC01 in the treated cells (first cell or group of cells) compared to the mRNA amount in the control (untreated) cells, as shown in the following equation:(mRNA in control cells) - (mRNA in treated cells)(mRNA in control cells)[000203] In some embodiments, the level of gene -silencing (e.g., inhibiting, downregulating, or suppressing of the gene) of the PCSK9 (e.g., human PCSK9) may be assessed by measuring a parameter or biomarker, e.g., human PCSK9 protein level, in a biological sample (e.g., e.g., a blood, serum or liver tissue obtained from a subject), which may be treated or untreated. Conventional analytical methods as known in the art such as electrophoresis (e.g., SDS or capillary electrophoresis), chromatography (e.g., high performance liquid chromatography (HPLC)), spectroscopy, western blotting, enzyme- linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like can be used without limitation, but examples are not limited thereto. In some embodiments, reduced level of gene-silencing (e.g., inhibiting, downregulating, or suppressing of the gene) of the PCSK9 (e.g., human PCSK9) may be observed or assessed by in a liver (tissue) biopsy of the treated subject.[000204] In certain aspects, the first antisense agent (e.g., first dsRNAi agent) is a free acid. In certain aspects, the first antisense agent (e.g. first dsRNAi agent) is in a salt form (e.g., a pharmaceutically acceptable salt form). It will be understood that references to first antisense agent (e.g., first dsRNAi agent) are meant to also include the pharmaceutically acceptable salts of the first antisense agent (e.g., first dsRNAi agent). If the first antisense agent (e.g., first dsRNAi agent) has, for example, at least one basic center, they can form acid addition salts. Corresponding acid addition salts can also be formed having, if desired, an additionally present basic center. Active substances having an acid group, e.g., COOH, can form salts with bases. The first antisense agent (e.g. first dsRNAi agent) or pharmaceutically acceptable salts thereof may also be used in form of a hydrate or include other solvents used for crystallization. In some embodiments, the first antisense agent (e.g., dsRNAi agent) is a sodium salt. In some embodiments, the first antisense agent (e.g., first dsRNAi agent) is in a salt form (e.g., a pharmaceutically acceptable salt form), where the salt is sodium (Na+), ammonium (NH4+), calcium (Ca2+), iron (Fe2+or Fe3+), magnesium (Mg2+), potassium (K+), pyridinium (C5H5NH+). quaternary ammonium (NR4+, R being an alkyl group or an aryl group as described herein), or copper (Cu2+).[000205] In an aspect, the disclosure provides a first dsRNA agent having sequences (e.g., antisense strand sequence) that can recognize a specific region of a PCSK9 mRNA (e.g., human PCSK9 mRNA) and lead cleavage of the PCSK9 mRNA and silencing of the gene. The first dsRNA agent includes a sense strand and an antisense strand and each strand may range from 12 to 30 nucleotidesPAT059933-PCT-SEC01 in length. In some embodiments, each strand may have 15 to 30 nucleotides in length. In some embodiments, each strand may have 15 to 25 nucleotides in length. In some embodiments, the antisense strand may have 15 to 25 nucleotides in length. In some embodiments, the sense strand may have 15 to 25 nucleotides in length. In some embodiments, the antisense strand may have 15 to 23 nucleotides in length. In some embodiments, the sense strand may have 15 to 23 nucleotides in length. In some embodiments, the antisense strand may have 18 to 25 nucleotides in length. In some embodiments, the sense strand may have 18 to 25 nucleotides in length.[000206] In some embodiments, the sense strand may have 19 to 23 nucleotides in length. In some embodiments, the sense strand may have 21 to 23 nucleotides in length. In some embodiments, the sense strand may have 19 nucleotides in length. In some embodiments, the sense strand may have 20 nucleotides in length. In some embodiments, the sense strand may have 21 nucleotides in length. In some embodiments, the sense strand may have 22 nucleotides in length. In some embodiments, the sense strand may have 23 nucleotides in length.[000207] In some embodiments, the antisense strand may have 19 to 25 nucleotides in length. In some embodiments, the antisense strand may have 19 to 23 nucleotides in length. In some embodiments, the antisense strand may have 21 to 23 nucleotides in length. In some embodiments, the antisense strand may have 23 to 25 nucleotides in length. In some embodiments, the antisense strand may have 19 nucleotides in length. In some embodiments, the antisense strand may have 20 nucleotides in length. In some embodiments, the antisense strand may have 21 nucleotides in length. In some embodiments, the antisense strand may have 22 nucleotides in length. In some embodiments, the antisense strand may have 23 nucleotides in length. In some embodiments, the antisense strand may have 24 nucleotides in length. In some embodiments, the antisense strand may have 25 nucleotides in length.[000208] In some embodiments, the sense strand is 21 to 23 nucleotides in length and the antisense strand is 23 to 25 nucleotides in length. In some embodiments, the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length. In some embodiments, the sense strand is 22 nucleotides in length and the antisense strand is 24 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 25 nucleotides in length.[000209] In an aspect, a first dsRNAi agent as described herein forms a double -stranded (or “duplex”) region made between a sense strand and an antisense strand and having 10 to 25 nucleotide pairs in length. The double stranded or duplex region are loaded into the RISC and subsequent specific degradation of the sense strand occurs during the RISC pathway. In some embodiments, the double stranded region has 10 nucleotide base pairs in length. In some embodiments, the doublePAT059933-PCT-SEC01 stranded region has 11 nucleotide base pairs in length. In some embodiments, the double stranded region has 12 nucleotide base pairs in length. In some embodiments, the double stranded region has 13 nucleotide base pairs in length. In some embodiments, the double stranded region has 14 nucleotide base pairs in length. In some embodiments, the double stranded region has 15 nucleotide base pairs in length. In some embodiments, the double stranded region has 16 nucleotide base pairs in length. In some embodiments, the double stranded region has 17 nucleotide base pairs in length. In some embodiments, the double stranded region has 18 nucleotide base pairs in length. In some embodiments, the double stranded region has 19 nucleotide base pairs in length. In some embodiments, the double stranded region has 20 nucleotide base pairs in length. In some embodiments, the double stranded region has 21 nucleotide base pairs in length. In some embodiments, the double stranded region has 22 nucleotide base pairs in length. In some embodiments, the double stranded region has 23 nucleotide base pairs in length.[000210] In an aspect, a first dsRNAi agent as described herein may include at least one singlestranded nucleotide overhang, for example, for increasing in vivo effectiveness of the first dsRNAi agent and having substantially improved inhibition of the target genes. In certain aspects, the first dsRNAi agent may contain one or more extra nucleotides constituting overhang regions that locate other than the double stranded region at the 3 '-end, 5 '-end, or both ends of either stand or both strands (sense and antisense strands). In some embodiments, the overhang region may exist at the 3 '-end, 5'-end, or both ends of the sense strand. In some embodiments, the overhang region may exist at the 3'-end, 5 '-end, or both ends of the antisense strand. In some embodiments, the antisense strand may have a greater length than a length in the sense strand. In some embodiments, the antisense strand may have a shorter length than a length in the sense strand.[000211] In some embodiments, the first dsRNA agent may contain one or more extra nucleotides constituting overhang regions at the 3 '-end, 5 '-end, or both ends of the antisense strand. In some embodiments, the overhang region in the antisense strand may consist of 1-6 nucleotides in length, for example, 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, or 6 nucleotides in length. In some embodiments, the first dsRNA agent may contain one or more extra nucleotides constituting overhang regions at the 3'-end, 5'-end, or both ends of the sense strand. In some embodiments, the overhang region may consist of 1 to 6 nucleotides in length, for example, 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, or 6 nucleotides in length.[000212] In some embodiments, the antisense strand may include one-nucleotide overhang at the 5' end. In some embodiments, the antisense strand may include one-nucleotide overhang at the 3' end. In some embodiments, the antisense strand may include two-nucleotides overhang. In some embodiments, the antisense contains two-nucleotides overhang at the 5' end. In some embodiments,PAT059933-PCT-SEC01 the antisense contains two-nucleotides overhang at the 3' end. In some embodiments, the antisense contains one-nucleotide overhang at the 5' end and one-nucleotide overhang at the 3' end. In some embodiments, the antisense strand may include three-nucleotide overhang. In some embodiments, the antisense contains three-nucleotides overhang at the 5' end. In some embodiments, the antisense contains three-nucleotides overhang at the 3' end. In some embodiments, the antisense contains two-nucleotides overhang at the 5' end and one-nucleotide overhang at the 3' end. In some embodiments, the antisense contains two nucleotides overhang at the 3' end and one-nucleotide overhang at the 5' end.[000213] In certain aspects, a first dsRNAi agent as described herein may include at least one blunt end, e.g., for increasing in vivo stability with resistance to degradation in physiological surroundings. In some embodiments, the first dsRNAi agent may have a blunt end at the 3 '-end, 5 '-end, or both ends of the duplex. In some embodiments, the first dsRNAi agent includes one overhang (e.g., at 3' end of antisense strand) and one blunt end (e.g., at 5' end of antisense strand). In some embodiments, the first dsRNAi agent includes a blunt end at the 5 '-end of the sense strand (and at 3 ' end of the antisense strand) and contain overhang nucleotide(s) at the other end. In some embodiments, the first dsRNAi agent may have a blunt end at the 3 '-end of the sense strand (and at 5' end of the antisense strand) and contain overhang nucleotide(s) at the other end.[000214] In certain aspects, the target PCSK9 mRNA sequence may range from 12 to 30 nucleotides, from 15 to 30 nucleotides, from 18 to 30 nucleotides, from 18 to 25 nucleotides, from 18 to 23 nucleotides. In certain aspects, the target PCSK9 mRNA sequence may range from 19 to 25 nucleotides, from 19 to 23 nucleotides, or from 19 to 21 nucleotides. In some embodiments, the target PCSK9 mRNA sequence may have 15 nucleotides in length. In some embodiments, the target PCSK9 mRNA sequence may have 16 nucleotides in length. In some embodiments, the target PCSK9 mRNA sequence may have 17 nucleotides in length. In some embodiments, the target PCSK9 mRNA sequence may have 18 nucleotides in length. In some embodiments, the target PCSK9 mRNA sequence may have 19 nucleotides in length. In some embodiments, the target PCSK9 mRNA sequence may have 20 nucleotides in length. In some embodiments, the target PCSK9 mRNA sequence may have 21 nucleotides in length. In some embodiments, the target PCSK9 mRNA sequence may have 22 nucleotides in length. In some embodiments, the target PCSK9 mRNA sequence may have 23 nucleotides in length.[000215] In certain aspects, exemplary first dsRNAi agent sequences including sense strands and antisense strands targeting human PCSK9 mRNAs of SEQ ID NO: 2 (GenBank: NM_174936.4) are in Table 1.PAT059933-PCT-SEC01 Table 1: Examples of unmodified nucleotide sequences of first dsRNAi agents (e.g., PCSK9 siRNA)PCSK9 Site of Region Sense sequence SEQ Antisense sequence SEQ siRNA mRNA ID ID Target* NO: NO: U1 27 5' GUCGAGGCGCUCAUGGUUGCA 3 UGCAACCAUGAGCGCCUCGACGU 382 UTRU2 30 5' GAGGCGCUCAUGGUUGCAGGA 4 UCCUGCAACCAUGAGCGCCUCGA 383 UTRU3 117 5' CGGGCCGGGACGCGUCGUUGA 5 UCAACGACGCGUCCCGGCCCGCC 384 UTRU4 121 5' CCGGGACGCGUCGUUGCAGCA 6 UGCUGCAACGACGCGUCCCGGCC 385 UTRU5 153 5' CUCCCAGCCAGGAUUCCGCGA 7 UCGCGGAAUCCUGGCUGGGAGCU 386 UTRU6 155 5' CCCAGCCAGGAUUCCGCGCGA 8 UCGCGCGGAAUCCUGGCUGGGAG 387 UTRU7 161 5' CAGGAUUCCGCGCGCCCCUUA 9 UAAGGGGCGCGCGGAAUCCUGGC 388 UTRU8 219 5' CUCCCCACCGCAAGGCUCAAA 10 UUUGAGCCUUGCGGUGGGGAGGA 389 UTRU9 220 5' UC C C CAC CGCAAGGCUCAAGG 11 UCUUGAGCCUUGCGGUGGGGAGG 390 UTRU10 256 5' CCGCGCACGGCCUCUAGGUCU 12 AGACCUAGAGGCCGUGCGCGGUC 391 UTRUll 256 5' CCGCGCACGGCCUCUAGGUCA 13 UGACCUAGAGGCCGUGCGCGGUC 392 UTRU12 257 5' CGCGCACGGCCUCUAGGUCUA 14 UAGACCUAGAGGCCGUGCGCGGU 393 UTRU13 260 5' GCACGGC CUCUAGGUCUC CUA 15 UAGGAGACCUAGAGGCCGUGCGC 394 UTRU14 316 CDS CACCGUCAGCUCCAGGCGGUA 16 UACCGCCUGGAGCUGACGGUGCC 395 U15 317 CDS ACCGUCAGCUCCAGGCGGUCC 17 UGACCGCCUGGAGCUGACGGUGC 396 U16 318 CDS C CGUCAGCUC CAGGCGGUC CU 18 AGGACCGCCUGGAGCUGACGGUG 397 U17 318 CDS C CGUCAGCUC CAGGCGGUC CA 19 UGGACCGCCUGGAGCUGACGGUG 398 U18 378 CDS UGGGUCCCGCGGGCGCCCGUG 20 UACGGGCGCCCGCGGGACCCAGG 399 U19 386 CDS GCGGGCGCCCGUGCGCAGGAA 21 UUCCUGCGCACGGGCGCCCGCGG 400 U20 392 CDS GCCCGUGCGCAGGAGGACGAA 22 UUCGUCCUCCUGCGCACGGGCGC 401 U21 393 CDS C C CGUGCGCAGGAGGACGAGA 23 UCUCGUCCUCCUGCGCACGGGCG 402 U22 404 CDS GAGGACGAGGACGGCGACUAA 24 UUAGUCGC CGUC CUCGUC CUC CU 403 U23 421 CDS CUACGAGGAGCUGGUGCUAGA 25 UCUAGCACCAGCUCCUCGUAGUC 404 U24 425 CDS GAGGAGCUGGUGCUAGCCUUA 26 UAAGGCUAGCAC CAGCUC CUCGU 405 U25 430 CDS GCUGGUGCUAGCCUUGCGUUA 27 UAACGCAAGGCUAGCACCAGCUC 406 U26 432 CDS UGGUGCUAGCCUUGCGUUCCG 28 UGGAACGCAAGGCUAGCACCAGC 407 U27 437 CDS CUAGCCUUGCGUUCCGAGGAA 29 UUCCUCGGAACGCAAGGCUAGCA 408 U28 476 CDS CCCGAGCACGGAACCACAGCA 30 UGCUGUGGUUCCGUGCUCGGGUG 409 U29 479 CDS GAGCACGGAACCACAGCCACA 31 UGUGGCUGUGGUUCCGUGCUCGG 410 U30 490 CDS CACAGCCACCUUCCACCGCUA 32 UAGCGGUGGAAGGUGGCUGUGGU 411 U31 496 CDS CACCUUCCACCGCUGCGCCAA 33 UUGGCGCAGCGGUGGAAGGUGGC 412 U32 497 CDS ACCUUCCACCGCUGCGCCAAG 34 UUUGGCGCAGCGGUGGAAGGUGG 413 U33 500 CDS UUCCACCGCUGCGCCAAGGAU 35 AUCCUUGGCGCAGCGGUGGAAGG 414 U34 500 CDS UUCCACCGCUGCGCCAAGGAA 36 UUCCUUGGCGCAGCGGUGGAAGG 415 U35 502 CDS CCACCGCUGCGCCAAGGAUCA 37 UGAUCCUUGGCGCAGCGGUGGAA 416 U36 503 CDS CACCGCUGCGCCAAGGAUCCA 38 UGGAUCCUUGGCGCAGCGGUGGA 417 U37 505 CDS CCGCUGCGCCAAGGAUCCGUA 39 UACGGAUCCUUGGCGCAGCGGUG 418U38 506 CDS CGCUGCGCCAAGGAUCCGUGA 40 UCACGGAUCCUUGGCGCAGCGGU 419PAT059933-PCT-SEC01 U39 539 CDS ACCUACGUGGUGGUGCUGAAG 41 UUUCAGCACCACCACGUAGGUGC 420 U40 570 CDS ACCUCUCGCAGUCAGAGCGCA 42 UGCGCUCUGACUGCGAGAGGUGG 421 U41 571 CDS CCUCUCGCAGUCAGAGCGCAA 43 UUGCGCUCUGACUGCGAGAGGUG 422 U42 573 CDS UCUCGCAGUCAGAGCGCACUG 44 UAGUGCGCUCUGACUGCGAGAGG 423 U43 611 CDS CAGGCUGCCCGCCGGGGAUAA 45 UUAUCCCCGGCGGGCAGCCUGGG 424 U44 613 CDS GGCUGCCCGCCGGGGAUACCU 46 AGGUAUCCCCGGCGGGCAGCCUG 425 U45 613 CDS GGCUGCCCGCCGGGGAUACCA 47 UGGUAUCCCCGGCGGGCAGCCUG 426 U46 616 CDS UGC C CGC CGGGGAUAC CUCAC 48 UUGAGGUAUC C C CGGCGGGCAGC 427 U47 620 CDS CGC CGGGGAUAC CUCAC CAAA 49 UUUGGUGAGGUAUCCCCGGCGGG 428 U48 621 CDS GC CGGGGAUAC CUCAC CAAGA 50 UCUUGGUGAGGUAUCCCCGGCGG 429 U49 623 CDS CGGGGAUACCUCACCAAGAUA 51 UAUCUUGGUGAGGUAUC C C CGGC 430 U50 624 CDS GGGGAUAC CUCAC CAAGAUCA 52 UGAUCUUGGUGAGGUAUC C C CGG 431 U51 668 CDS C CUGGCUUC CUGGUGAAGAUA 53 UAUCUUCACCAGGAAGCCAGGAA 432 U52 680 CDS GUGAAGAUGAGUGGCGAC CUA 54 UAGGUCGC CACUCAUCUUCAC CA 433 U53 683 CDS AAGAUGAGUGGCGACCUGCUG 55 UAGCAGGUCGCCACUCAUCUUCA 434 U54 709 CDS GGCCUUGAAGUUGCCCCAUGU 56 ACAUGGGGCAACUUCAAGGCCAG 435 U55 709 CDS GGCCUUGAAGUUGCCCCAUGA 57 UCAUGGGGCAACUUCAAGGCCAG 436 U56 711 CDS CCUUGAAGUUGCCCCAUGUCA 58 UGACAUGGGGCAACUUCAAGGCC 437 U57 712 CDS CUUGAAGUUGC C C CAUGUCGA 59 UCGACAUGGGGCAACUUCAAGGC 438 U58 713 CDS UUGAAGUUGC C C CAUGUCGAC 60 UUCGACAUGGGGCAACUUCAAGG 439 U59 714 CDS UGAAGUUGC C C CAUGUCGACU 61 AGUCGACAUGGGGCAACUUCAAG 440 U60 714 CDS UGAAGUUGC C C CAUGUCGACA 62 UGUCGACAUGGGGCAACUUCAAG 441 U61 715 CDS GAAGUUGC C C CAUGUCGACUA 63 UAGUCGACAUGGGGCAACUUCAA 442 U62 716 CDS AAGUUGC C C CAUGUCGACUAC 64 UUAGUCGACAUGGGGCAACUUCA 443 U63 717 CDS AGUUGCCCCAUGUCGACUACA 65 UGUAGUCGACAUGGGGCAACUUC 444 U64 718 CDS GUUGCCCCAUGUCGACUACAU 66 AUGUAGUCGACAUGGGGCAACUU 445 U65 718 CDS GUUGCCCCAUGUCGACUACAA 67 UUGUAGUCGACAUGGGGCAACUU 446 U66 720 CDS UGC C C CAUGUCGACUACAUCG 68 UGAUGUAGUCGACAUGGGGCAAC 447 U67 721 CDS GCCCCAUGUCGACUACAUCGA 69 UCGAUGUAGUCGACAUGGGGCAA 448 U68 722 CDS CCCCAUGUCGACUACAUCGAA 70 UUCGAUGUAGUCGACAUGGGGCA 449 U69 725 CDS CAUGUCGACUACAUCGAGGAA 71 UUC CUCGAUGUAGUCGACAUGGG 450 U70 726 CDS AUGUCGACUACAUCGAGGAGG 72 UCUC CUCGAUGUAGUCGACAUGG 451 U71 728 CDS GUCGACUACAUCGAGGAGGAA 73 UUC CUC CUCGAUGUAGUCGACAU 452 U72 731 CDS GACUACAUCGAGGAGGACUCA 74 UGAGUCCUCCUCGAUGUAGUCGA 453 U73 770 CDS AUC C CGUGGAAC CUGGAGCGG 75 UCGCUCCAGGUUCCACGGGAUGC 454 U74 794 CDS AC C C CUC CACGGUAC CGGGCG 76 UGC C CGGUAC CGUGGAGGGGUAA 455 U75 795 CDS CCCCUCCACGGUACCGGGCGA 77 UCGC C CGGUAC CGUGGAGGGGUA 456 U76 796 CDS C C CUC CACGGUAC CGGGCGGA 78 UC CGC C CGGUAC CGUGGAGGGGU 457 U77 798 CDS CUC CACGGUAC CGGGCGGAUA 79 UAUC CGC C CGGUAC CGUGGAGGG 458 U78 799 CDS UC CACGGUAC CGGGCGGAUGA 80 UCAUCCGCCCGGUACCGUGGAGG 459 U79 800 CDS C CACGGUAC CGGGCGGAUGAA 81 UUCAUC CGCC CGGUAC CGUGGAG 460 U80 801 CDS CACGGUACCGGGCGGAUGAAU 82 AUUCAUC CGCC CGGUAC CGUGGA 461 U81 801 CDS CACGGUACCGGGCGGAUGAAA 83 UUUCAUC CGCC CGGUAC CGUGGA 462 U82 802 CDS ACGGUACCGGGCGGAUGAAUA 84 UAUUCAUC CGCC CGGUAC CGUGG 463 U83 806 CDS UAC CGGGCGGAUGAAUAC CAG 85 UUGGUAUUCAUC CGCC CGGUAC C 464 U84 840 CDS GCAGCCUGGUGGAGGUGUAUA 86 UAUACAC CUC CAC CAGGCUGC CU 465 U85 843 CDS GCCUGGUGGAGGUGUAUCUCA 87 UGAGAUACAC CUC CAC CAGGCUG 466 U86 847 CDS GGUGGAGGUGUAUCUC CUAGA 88 UCUAGGAGAUACAC CUC CAC CAG 467 U87 848 CDS GUGGAGGUGUAUCUC CUAGAA 89 UUCUAGGAGAUACACCUCCACCA 468 U88 850 CDS GGAGGUGUAUCUC CUAGACAA 90 UUGUCUAGGAGAUACAC CUC CAC 469 U89 851 CDS GAGGUGUAUCUCCUAGACACA 91 UGUGUCUAGGAGAUACAC CUC CA 470 U90 852 CDS AGGUGUAUCUCCUAGACACCA 92 UGGUGUCUAGGAGAUACAC CUC C 471 U91 853 CDS GGUGUAUCUC CUAGACAC CAA 93 UUGGUGUCUAGGAGAUACAC CUC 472U92 856 CDS GUAUCUC CUAGACAC CAGCAU 94 AUGCUGGUGUCUAGGAGAUACAC 473PAT059933-PCT-SEC01 U93 856 CDS GUAUCUC CUAGACAC CAGCAA 95 UUGCUGGUGUCUAGGAGAUACAC 474 U94 857 CDS UAUCUCCUAGACACCAGCAUA 96 UAUGCUGGUGUCUAGGAGAUACA 475 U95 858 CDS AUCUC CUAGACAC CAGCAUAC 97 UUAUGCUGGUGUCUAGGAGAUAC 476 U96 862 CDS C CUAGACAC CAGCAUACAGAA 98 UUCUGUAUGCUGGUGUCUAGGAG 477 U97 868 CDS CAC CAGCAUACAGAGUGAC CA 99 UGGUCACUCUGUAUGCUGGUGUC 478 U98 870 CDS C CAGCAUACAGAGUGAC CACA 100 UGUGGUCACUCUGUAUGCUGGUG 479 U99 873 CDS GCAUACAGAGUGACCACCGGA 101 UCCGGUGGUCACUCUGUAUGCUG 480 U100 875 CDS AUACAGAGUGAC CAC CGGGAA 102 UUC C CGGUGGUCACUCUGUAUGC 481 U1O1 876 CDS UACAGAGUGACCACCGGGAAA 103 UUUC C CGGUGGUCACUCUGUAUG 482 U102 878 CDS CAGAGUGAC CAC CGGGAAAUA 104 UAUUUC C CGGUGGUCACUCUGUA 483 U1O3 879 CDS AGAGUGAC CAC CGGGAAAUCG 105 UGAUUUC C CGGUGGUCACUCUGU 484 U104 880 CDS GAGUGAC CAC CGGGAAAUCGA 106 UCGAUUUCCCGGUGGUCACUCUG 485 U1O5 881 CDS AGUGACCACCGGGAAAUCGAG 107 UUCGAUUUCCCGGUGGUCACUCU 486 U106 882 CDS GUGAC CAC CGGGAAAUCGAGA 108 UCUCGAUUUC C CGGUGGUCACUC 487 U107 883 CDS UGAC CAC CGGGAAAUCGAGGG 109 UC CUCGAUUUC C CGGUGGUCACU 488 U108 892 CDS GGAAAUCGAGGGCAGGGUCAU 110 AUGAC C CUGC C CUCGAUUUC C CG 489 U109 892 CDS GGAAAUCGAGGGCAGGGUCAA 111 UUGAC C CUGC C CUCGAUUUC C CG 490 U11O 893 CDS GAAAUCGAGGGCAGGGUCAUA 112 UAUGAC C CUGC C CUCGAUUUC C C 491 Ulll 894 CDS AAAUCGAGGGCAGGGUCAUGG 113 UCAUGAC C CUGC C CUCGAUUUC C 492 U112 896 CDS AUCGAGGGCAGGGUCAUGGUC 114 UACCAUGACCCUGCCCUCGAUUU 493 U113 900 CDS AGGGCAGGGUCAUGGUCACCG 115 UGGUGAC CAUGAC C CUGC C CUCG 494 U114 902 CDS GGCAGGGUCAUGGUCACCGAA 116 UUCGGUGACCAUGACCCUGCCCU 495 U115 903 CDS GCAGGGUCAUGGUCACCGACU 117 AGUCGGUGAC CAUGAC C CUGC C C 496 U116 903 CDS GCAGGGUCAUGGUCACCGACA 118 UGUCGGUGAC CAUGAC C CUGC C C 497 U117 904 CDS CAGGGUCAUGGUCAC CGACUU 119 AAGUCGGUGAC CAUGAC C CUGC C 498 U118 904 CDS CAGGGUCAUGGUCAC CGACUA 120 UAGUCGGUGACCAUGACCCUGCC 499 U119 945 CDS ACGGGACCCGCUUCCACAGAC 121 UUCUGUGGAAGCGGGUC C CGUC C 500 U120 946 CDS CGGGACCCGCUUCCACAGACA 122 UGUCUGUGGAAGCGGGUC C CGUC 501 U121 960 CDS ACAGACAGGCCAGCAAGUGUG 123 UACACUUGCUGGCCUGUCUGUGG 502 U122 976 CDS GUGUGACAGUCAUGGCAC C CA 124 UGGGUGCCAUGACUGUCACACUU 503 U123 993 CDS C C CAC CUGGCAGGGGUGGUCA 125 UGAC CAC C CCUGC CAGGUGGGUG 504 U124 994 CDS C CAC CUGGCAGGGGUGGUCAA 126 UUGAC CAC CC CUGC CAGGUGGGU 505 U125 1054 CDS CAGCCUGCGCGUGCUCAACUA 127 UAGUUGAGCACGCGCAGGCUGCG 506 U126 1055 CDS AGCCUGCGCGUGCUCAACUGC 128 UCAGUUGAGCACGCGCAGGCUGC 507 U127 1059 CDS UGCGCGUGCUCAACUGCCAAG 129 UUUGGCAGUUGAGCACGCGCAGG 508 U128 1060 CDS GCGCGUGCUCAACUGCCAAGA 130 UCUUGGCAGUUGAGCACGCGCAG 509 U129 1070 CDS AACUGCCAAGGGAAGGGCACG 131 UGUG C C CUUC C CUUGG C AGUUGA 510 U13O 1071 CDS ACUGCCAAGGGAAGGGCACGG 132 UCGUGC C CUUC C CUUGGCAGUUG 511 U131 1081 CDS GAAGGGCACGGUUAGCGGCAA 133 UUGCCGCUAACCGUGCCCUUCCC 512 U132 1082 CDS AAGGGCACGGUUAGCGGCACC 134 UGUGCCGCUAACCGUGCCCUUCC 513 U133 1085 CDS GGCACGGUUAGCGGCACCCUA 135 UAGGGUGCCGCUAACCGUGCCCU 514 U134 1088 CDS ACGGUUAGCGGCACCCUCAUA 136 UAUGAGGGUGCCGCUAACCGUGC 515 U135 1089 CDS CGGUUAGCGGCACCCUCAUAA 137 UUAUGAGGGUGCCGCUAACCGUG 516 U136 1090 CDS GGUUAGCGGCAC C CUCAUAGA 138 UCUAUGAGGGUGC CGCUAAC CGU 517 U137 1097 CDS GGCACCCUCAUAGGCCUGGAA 139 UUCCAGGCCUAUGAGGGUGCCGC 518 U138 1099 CDS CAC C CUCAUAGGC CUGGAGUU 140 AACUC CAGGC CUAUGAGGGUGC C 519 U139 1100 CDS ACC CUCAUAGGC CUGGAGUUU 141 AAACUCCAGGCCUAUGAGGGUGC 520 U140 1102 CDS CCUCAUAGGCCUGGAGUUUAU 142 AUAAACUC CAGGC CUAUGAGGGU 521 U141 1102 CDS C CUCAUAGGC CUGGAGUUUAA 143 UUAAACUC CAGGC CUAUGAGGGU 522 U142 1106 CDS AUAGGCCUGGAGUUUAUUCGG 144 UCGAAUAAACUC CAGGC CUAUGA 523 U143 1107 CDS UAGGCCUGGAGUUUAUUCGGA 145 UC CGAAUAAACUC CAGGC CUAUG 524 U144 1108 CDS AGGCCUGGAGUUUAUUCGGAA 146 UUC CGAAUAAACUC CAGGC CUAU 525 U145 1111 CDS C CUGGAGUUUAUUCGGAAAAA 147 UUUUUC CGAAUAAACUC CAGGC C 526U146 1112 CDS CUGGAGUUUAUUCGGAAAAGA 148 UCUUUUC CGAAUAAACUC CAGGC 527PAT059933-PCT-SEC01 U147 1113 CDS UGGAGUUUAUUCGGAAAAGCC 149 UGCUUUUC CGAAUAAACUC CAGG 528 U148 1118 CDS UUUAUUCGGAAAAGCCAGCUG 150 UAGCUGGCUUUUCCGAAUAAACU 529 U149 1168 CDS GCUGCCCCUGGCGGGUGGGUA 151 UACCCACCCGCCAGGGGCAGCAG 530 U150 1169 CDS CUGCCCCUGGCGGGUGGGUAA 152 UUACCCACCCGCCAGGGGCAGCA 531 U151 1170 CDS UGCCCCUGGCGGGUGGGUACA 153 UGUACCCACCCGCCAGGGGCAGC 532 U152 1221 CDS UGGCGAGGGCUGGGGUCGUGC 154 UCACGACCCCAGCCCUCGCCAGG 533 U153 1228 CDS GGCUGGGGUCGUGCUGGUCAA 155 UUGACCAGCACGACCCCAGCCCU 534 U154 1234 CDS GGUCGUGCUGGUCACCGCUGA 156 UCAGCGGUGAC CAGCACGAC C C C 535 U155 1237 CDS CGUGCUGGUCACCGCUGCCGA 157 UCGGCAGCGGUGACCAGCACGAC 536 U156 1238 CDS GUGCUGGUCACCGCUGCCGGA 158 UCCGGCAGCGGUGACCAGCACGA 537 U157 1241 CDS CUGGUCACCGCUGCCGGCAAA 159 UUUGCCGGCAGCGGUGACCAGCA 538 U158 1246 CDS CACCGCUGCCGGCAACUUCCA 160 UGGAAGUUGCCGGCAGCGGUGAC 539 U159 1252 CDS UGC CGGCAACUUC CGGGACGA 161 UCGUC C CGGAAGUUGC CGGCAGC 540 U160 1253 CDS GCCGGCAACUUCCGGGACGAU 162 AUCGUC C CGGAAGUUGC CGGCAG 541 U161 1253 CDS GCCGGCAACUUCCGGGACGAA 163 UUCGUCCCGGAAGUUGCCGGCAG 542 U162 1254 CDS C CGGCAACUUC CGGGACGAUA 164 UAUCGUC C CGGAAGUUGC CGGCA 543 U163 1255 CDS CGGCAACUUCCGGGACGAUGA 165 UCAUCGUCCCGGAAGUUGCCGGC 544 U164 1256 CDS GGCAACUUCCGGGACGAUGCA 166 UGCAUCGUCCCGGAAGUUGCCGG 545 U165 1257 CDS GCAACUUCCGGGACGAUGCCU 167 AGGCAUCGUC C CGGAAGUUGC CG 546 U166 1257 CDS GCAACUUCCGGGACGAUGCCA 168 UGGCAUCGUC C CGGAAGUUGC CG 547 U167 1258 CDS CAACUUCCGGGACGAUGCCUA 169 UAGGCAUCGUC C CGGAAGUUGC C 548 U168 1260 CDS ACUUCCGGGACGAUGCCUGCC 170 UGCAGGCAUCGUCCCGGAAGUUG 549 U169 1292 CDS GCCUCAGCUCCCGAGGUCAUA 171 UAUGACCUCGGGAGCUGAGGCUG 550 U170 1293 CDS C CUCAGCUC C CGAGGUCAUCA 172 UGAUGACCUCGGGAGCUGAGGCU 551 U171 1296 CDS CAGCUCCCGAGGUCAUCACAA 173 UUGUGAUGACCUCGGGAGCUGAG 552 U172 1299 CDS CUC C CGAGGUCAUCACAGUUA 174 UAACUGUGAUGACCUCGGGAGCU 553 U173 1308 CDS UCAUCACAGUUGGGGC CAC CA 175 UGGUGGC C CCAACUGUGAUGAC C 554 U174 1309 CDS CAUCACAGUUGGGGC CAC CAA 176 UUGGUGGCCCCAACUGUGAUGAC 555 U175 1354 CDS GGGGACUUUGGGGAC CAACUU 177 AAGUUGGUCC C CAAAGUC C C CAG 556 U176 1354 CDS GGGGACUUUGGGGAC CAACUA 178 UAGUUGGUCC C CAAAGUC C C CAG 557 U177 1355 CDS GGGACUUUGGGGACCAACUUU 179 AAAGUUGGUC C C CAAAGUC C C CA 558 U178 1355 CDS GGGACUUUGGGGACCAACUUA 180 UAAGUUGGUC C C CAAAGUC C C CA 559 U179 1357 CDS GACUUUGGGGAC CAACUUUGA 181 UCAAAGUUGGUC C C CAAAGUC C C 560 U180 1359 CDS CUUUGGGGACCAACUUUGGCA 182 UG C C AAAGUUGGUC C C CAAAGUC 561 U181 1361 CDS UUGGGGAC CAACUUUGGC CGC 183 UCGG C C AAAGUUGGUC C C C AAAG 562 U182 1365 CDS GGACCAACUUUGGCCGCUGUA 184 UACAGCGGCCAAAGUUGGUCCCC 563 U183 1367 CDS AC CAACUUUGGC CGCUGUGUG 185 UACACAGCGGCCAAAGUUGGUCC 564 U184 1376 CDS GGCCGCUGUGUGGACCUCUUU 186 AAAGAGGUCCACACAGCGGCCAA 565 U185 1376 CDS GGCCGCUGUGUGGACCUCUUA 187 UAAGAGGUCCACACAGCGGCCAA 566 U186 1378 CDS C CGCUGUGUGGAC CUCUUUGA 188 UCAAAGAGGUCCACACAGCGGCC 567 U187 1379 CDS CGCUGUGUGGACCUCUUUGCA 189 UGCAAAGAGGUCCACACAGCGGC 568 U188 1401 CDS CAGGGGAGGACAUCAUUGGUA 190 UAC CAAUGAUGUC CUC C C CUGGG 569 U189 1409 CDS GACAUCAUUGGUGCCUCCAGA 191 UCUGGAGGCAC CAAUGAUGUC CU 570 U190 1414 CDS CAUUGGUGCCUCCAGCGACUA 192 UAGUCGCUGGAGGCACCAAUGAU 571 U191 1430 CDS GACUGCAGCACCUGCUUUGUA 193 UACAAAGCAGGUGCUGCAGUCGC 572 U192 1433 CDS UGCAGCACCUGCUUUGUGUCA 194 UGACACAAAGCAGGUGCUGCAGU 573 U193 1435 CDS CAGCACCUGCUUUGUGUCACA 195 UGUGACACAAAGCAGGUGCUGCA 574 U194 1478 CDS GCCCACGUGGCUGGCAUUGCA 196 UGCAAUGCCAGCCACGUGGGCAG 575 U195 1488 CDS CUGGCAUUGCAGCCAUGAUGA 197 UCAUCAUGGCUGCAAUGCCAGCC 576 U196 1489 CDS UGGCAUUGCAGCCAUGAUGCU 198 AGCAUCAUGGCUGCAAUGCCAGC 577 U197 1489 CDS UGGCAUUGCAGCCAUGAUGCA 199 UGCAUCAUGGCUGCAAUGCCAGC 578 U198 1494 CDS UUGCAGCCAUGAUGCUGUCUG 200 UAGACAGCAUCAUGGCUGCAAUG 579 U199 1502 CDS AUGAUGCUGUCUGCCGAGCCG 201 UGGCUCGGCAGACAGCAUCAUGG 580U200 1504 CDS GAUGCUGUCUGCCGAGCCGGA 202 UCCGGCUCGGCAGACAGCAUCAU 581PAT059933-PCT-SEC01 U201 1505 CDS AUGCUGUCUGCCGAGCCGGAG 203 UUCCGGCUCGGCAGACAGCAUCA 582 U202 1522 CDS GGAGCUCAC C CUGGC CGAGUU 204 AACUCGGCCAGGGUGAGCUCCGG 583 U203 1522 CDS GGAGCUCAC C CUGGC CGAGUA 205 UACUCGGCCAGGGUGAGCUCCGG 584 U204 1523 CDS GAGCUCACCCUGGCCGAGUUA 206 UAACUCGGCCAGGGUGAGCUCCG 585 U205 1526 CDS CUCACCCUGGCCGAGUUGAGA 207 UCUCAACUCGGCCAGGGUGAGCU 586 U206 1533 CDS UGGCCGAGUUGAGGCAGAGAC 208 UUCUCUGCCUCAACUCGGCCAGG 587 U207 1538 CDS GAGUUGAGGCAGAGACUGAUA 209 UAUCAGUCUCUGCCUCAACUCGG 588 U208 1546 CDS GCAGAGACUGAUCCACUUCUA 210 UAGAAGUGGAUCAGUCUCUGCCU 589 U209 1547 CDS CAGAGACUGAUC CACUUCUCU 211 AGAGAAGUGGAUCAGUCUCUGCC 590 U210 1547 CDS CAGAGACUGAUC CACUUCUCA 212 UGAGAAGUGGAUCAGUCUCUGCC 591 U211 1548 CDS AGAGACUGAUC CACUUCUCUG 213 UAGAGAAGUGGAUCAGUCUCUGC 592 U212 1562 CDS UUCUCUGCCAAAGAUGUCAUC 214 UAUGACAUCUUUGGCAGAGAAGU 593 U213 1571 CDS AAAGAUGUCAUCAAUGAGGCC 215 UGCCUCAUUGAUGACAUCUUUGG 594 U214 1577 CDS GUCAUCAAUGAGGCCUGGUUA 216 UAACCAGGCCUCAUUGAUGACAU 595 U215 1578 CDS UCAUCAAUGAGGCCUGGUUCC 217 UGAAC CAGGC CUCAUUGAUGACA 596 U216 1598 CDS C CUGAGGAC CAGCGGGUACUA 218 UAGUAC C CGCUGGUCCUCAGGGA 597 U217 1600 CDS UGAGGACCAGCGGGUACUGAC 219 UUCAGUACCCGCUGGUCCUCAGG 598 U218 1601 CDS GAGGACCAGCGGGUACUGACA 220 UGUCAGUACCCGCUGGUCCUCAG 599 U219 1603 CDS GGAC CAGCGGGUACUGAC C CA 221 UGGGUCAGUAC C CGCUGGUC CUC 600 U220 1695 CDS CAGCACACUCGGGGCCUACAA 222 UUGUAGGCCCCGAGUGUGCUGAC 601 U221 1696 CDS AGCACACUCGGGGCCUACACG 223 UGUGUAGGCCCCGAGUGUGCUGA 602 U222 1697 CDS GCACACUCGGGGCCUACACGA 224 UCGUGUAGGC C C CGAGUGUGCUG 603 U223 1698 CDS CACACUCGGGGCCUACACGGA 225 UC CGUGUAGGC C C CGAGUGUGCU 604 U224 1699 CDS ACACUCGGGGCCUACACGGAU 226 AUC CGUGUAGG C C C CGAGUGUG C 605 U225 1699 CDS ACACUCGGGGCCUACACGGAA 227 UUC CGUGUAGG C C C CGAGUGUG C 606 U226 1700 CDS CACUCGGGGCCUACACGGAUA 228 UAUC CGUGUAGGC C CCGAGUGUG 607 U227 1703 CDS UCGGGGCCUACACGGAUGGCC 229 UGC CAUC CGUGUAGGC C C CGAGU 608 U228 1708 CDS GC CUACACGGAUGGC CACAGA 230 UCUGUGGC CAUC CGUGUAGGC C C 609 U229 1709 CDS CCUACACGGAUGGCCACAGCA 231 UGCUGUGGCCAUCCGUGUAGGCC 610 U230 1756 CDS GCUGCUGAGCUGCUCCAGUUU 232 AAACUGGAGCAGCUCAGCAGCUC 611 U231 1756 CDS GCUGCUGAGCUGCUCCAGUUA 233 UAACUGGAGCAGCUCAGCAGCUC 612 U232 1759 CDS GCUGAGCUGCUCCAGUUUCUA 234 UAGAAACUGGAGCAGCUCAGCAG 613 U233 1800 CDS GCGAGCGCAUGGAGGCCCAAA 235 UUUGGGCCUCCAUGCGCUCGCCC 614 U234 1823 CDS GGCAAGCUGGUCUGCCGGGCA 236 UGCCCGGCAGACCAGCUUGCCCC 615 U235 1829 CDS CUGGUCUGCCGGGCCCACAAA 237 UUUGUGGGCCCGGCAGACCAGCU 616 U236 1831 CDS GGUCUGC CGGGC C CACAACGA 238 UCGUUGUGGGC C CGGCAGAC CAG 617 U237 1832 CDS GUCUGCCGGGCCCACAACGCU 239 AGCGUUGUGGGCCCGGCAGACCA 618 U238 1832 CDS GUCUGCCGGGCCCACAACGCA 240 UGCGUUGUGGGCCCGGCAGACCA 619 U239 1833 CDS UCUGCCGGGCCCACAACGCUU 241 AAGCGUUGUGGGCCCGGCAGACC 620 U240 1833 CDS UCUGCCGGGCCCACAACGCUA 242 UAGCGUUGUGGGCCCGGCAGACC 621 U241 1835 CDS UGCCGGGCCCACAACGCUUUU 243 AAAAGCGUUGUGGGCCCGGCAGA 622 U242 1835 CDS UGCCGGGCCCACAACGCUUUA 244 UAAAGCGUUGUGGGCCCGGCAGA 623 U243 1836 CDS GCCGGGCCCACAACGCUUUUA 245 UAAAAGCGUUGUGGGCCCGGCAG 624 U244 1860 CDS GUGAGGGUGUCUACGCCAUUA 246 UAAUGGCGUAGACACC CUCAC C C 625 U245 1861 CDS UGAGGGUGUCUACGC CAUUGC 247 UCAAUGGCGUAGACAC C CUCAC C 626 U246 1862 CDS GAGGGUGUCUACGCCAUUGCA 248 UGCAAUGGCGUAGACACCCUCAC 627 U247 1863 CDS AGGGUGUCUACGCCAUUGCCA 249 UGGCAAUGGCGUAGACAC C CUCA 628 U248 1867 CDS UGUCUACGC CAUUGC CAGGUG 250 UACCUGGCAAUGGCGUAGACACC 629 U249 1914 CDS GCGUCCACACAGCUCCACCAA 251 UUGGUGGAGCUGUGUGGACGCUG 630 U250 1938 CDS AGGCCAGCAUGGGGACCCGUG 252 UACGGGUCCCCAUGCUGGCCUCA 631 U251 1943 CDS AGCAUGGGGAC C CGUGUC CAC 253 UUGGACACGGGUCCCCAUGCUGG 632 U252 1945 CDS CAUGGGGAC C CGUGUC CACUA 254 UAGUGGACACGGGUCCCCAUGCU 633 U253 1946 CDS AUGGGGAC C CGUGUC CACUGC 255 UCAGUGGACACGGGUC C C CAUGC 634U254 1977 CDS GCCACGUCCUCACAGGCUGCA 256 UGCAGCCUGUGAGGACGUGGCCC 635PAT059933-PCT-SEC01 U255 2006 CDS UGGGAGGUGGAGGAC CUUGGC 257 UC CAAGGUCCUC CACCUC C CAGU 636 U256 2017 CDS GGACCUUGGCACCCACAAGCA 258 UGCUUGUGGGUGCCAAGGUCCUC 637 U257 2018 CDS GACCUUGGCACCCACAAGCCA 259 UGGCUUGUGGGUGCCAAGGUCCU 638 U258 2020 CDS CCUUGGCACCCACAAGCCGCA 260 UGCGGCUUGUGGGUGCCAAGGUC 639 U259 2022 CDS UUGGCACCCACAAGCCGCCUG 261 UAGGCGGCUUGUGGGUGCCAAGG 640 U260 2025 CDS GCACCCACAAGCCGCCUGUGA 262 UCACAGGCGGCUUGUGGGUGCCA 641 U261 2027 CDS ACCCACAAGCCGCCUGUGCUG 263 UAGCACAGGCGGCUUGUGGGUGC 642 U262 2038 CDS GCCUGUGCUGAGGCCACGAGA 264 UCUCGUGGCCUCAGCACAGGCGG 643 U263 2039 CDS C CUGUGCUGAGGC CACGAGGU 265 AC CUCGUGGC CUCAGCACAGGCG 644 U264 2039 CDS C CUGUGCUGAGGC CACGAGGA 266 UC CUCGUGGC CUCAGCACAGGCG 645 U265 2040 CDS CUGUGCUGAGGCCACGAGGUA 267 UACCUCGUGGCCUCAGCACAGGC 646 U266 2044 CDS GCUGAGGCCACGAGGUCAGCA 268 UGCUGACCUCGUGGCCUCAGCAC 647 U267 2045 CDS CUGAGGC CACGAGGUCAGC CA 269 UGGCUGACCUCGUGGCCUCAGCA 648 U268 2048 CDS AGGCCACGAGGUCAGCCCAAC 270 UUUGGGCUGACCUCGUGGCCUCA 649 U269 2053 CDS ACGAGGUCAGC C CAAC CAGUG 271 UACUGGUUGGGCUGACCUCGUGG 650 U270 2054 CDS CGAGGUC AG C C C AAC C AGUGA 272 UCACUGGUUGGGCUGACCUCGUG 651 U271 2086 CDS GGAGGCCAGCAUCCACGCUUA 273 UAAGCGUGGAUGCUGGCCUCCCU 652 U272 2120 CDS C CAGGUCUGGAAUGCAAAGUA 274 UACUUUGCAUUC CAGAC CUGGGG 653 U273 2135 CDS AAAGUCAAGGAGCAUGGAAUC 275 UAUUCCAUGCUCCUUGACUUUGC 654 U274 2136 CDS AAGUCAAGGAGCAUGGAAUCC 276 UGAUUC CAUGCUC CUUGACUUUG 655 U275 2140 CDS CAAGGAGCAUGGAAUC C CGGA 277 UC CGGGAUUC CAUGCUC CUUGAC 656 U276 2248 CDS GGCCUACGCCGUAGACAACAA 278 UUGUUGUCUACGGCGUAGGC C C C 657 U277 2249 CDS GCCUACGCCGUAGACAACACA 279 UGUGUUGUCUACGGCGUAGGCCC 658 U278 2250 CDS CCUACGCCGUAGACAACACGU 280 ACGUGUUGUCUACGGCGUAGGCC 659 U279 2250 CDS CCUACGCCGUAGACAACACGA 281 UCGUGUUGUCUACGGCGUAGGCC 660 U280 2251 CDS CUACGCCGUAGACAACACGUA 282 UACGUGUUGUCUACGGCGUAGGC 661 U281 2253 CDS ACGCCGUAGACAACACGUGUG 283 UACACGUGUUGUCUACGGCGUAG 662 U282 2254 CDS CGCCGUAGACAACACGUGUGU 284 ACACACGUGUUGUCUACGGCGUA 663 U283 2254 CDS CGCCGUAGACAACACGUGUGA 285 UCACACGUGUUGUCUACGGCGUA 664 U284 2255 CDS GCCGUAGACAACACGUGUGUA 286 UACACACGUGUUGUCUACGGCGU 665 U285 2274 CDS UAGUCAGGAGCCGGGACGUCA 287 UGACGUC C CGGCUC CUGACUACA 666 U286 2277 CDS UCAGGAGCCGGGACGUCAGCA 288 UGCUGACGUC C CGGCUC CUGACU 667 U287 2293 CDS CAGCACUACAGGCAGCACCAA 289 UUGGUGCUGCCUGUAGUGCUGAC 668 U288 2296 CDS CACUACAGGCAGCACCAGCGA 290 UCGCUGGUGCUGCCUGUAGUGCU 669 U289 2322 CDS CCGUGACAGCCGUUGCCAUCU 291 AGAUGGCAACGGCUGUCACGGCC 670 U290 2322 CDS CCGUGACAGCCGUUGCCAUCA 292 UGAUGGCAACGGCUGUCACGGCC 671 U291 2326 CDS GACAGCCGUUGCCAUCUGCUA 293 UAGCAGAUGGCAACGGCUGUCAC 672 U292 2330 CDS GCCGUUGCCAUCUGCUGCCGA 294 UCGGCAGCAGAUGGCAACGGCUG 673 U293 2428 3' GGCUGGGGCUGAGCUUUAAAA 295 UUUUAAAGCUCAGCCCCAGCCCU 674 UTRU294 2429 3' GCUGGGGCUGAGCUUUAAAAU 296 AUUUUAAAGCUCAGCCCCAGCCC 675 UTRU295 2429 3' GCUGGGGCUGAGCUUUAAAAA 297 UUUUUAAAGCUCAGCCCCAGCCC 676 UTRU296 2430 3' CUGGGGCUGAGCUUUAAAAUA 298 UAUUUUAAAGCUCAGC C C CAGC C 677 UTRU297 2431 3' UGGGGCUGAGCUUUAAAAUGG 299 UCAUUUUAAAGCUCAGCCCCAGC 678 UTRU298 2432 3' GGGGCUGAGCUUUAAAAUGGU 300 AC C AUUUUAAAG CUCAG C C C C AG 679 UTRU299 2432 3' GGGGCUGAGCUUUAAAAUGGA 301 UC C AUUUUAAAG CUCAG C C C C AG 680 UTRU300 2435 3' GCUGAGCUUUAAAAUGGUUCA 302 UGAAC CAUUUUAAAGCUCAGC C C 681 UTRU301 2618 3' UC C CUCACUGUGGGGCAUUUC 303 UAAAUGCCCCACAGUGAGGGAGG 682UTRPAT059933-PCT-SEC01 U302 2619 3' C C CUCACUGUGGGGCAUUUCA 304 UGAAAUGCCCCACAGUGAGGGAG 683 UTRU303 2621 3' CUCACUGUGGGGCAUUUCACA 305 UGUGAAAUGC C C CACAGUGAGGG 684 UTRU304 2624 3' ACUGUGGGGCAUUUCACCAUU 306 AAUGGUGAAAUGCCCCACAGUGA 685 UTRU305 2624 3' ACUGUGGGGCAUUUCACCAUA 307 UAUGGUGAAAUGCCCCACAGUGA 686 UTRU306 2625 3' CUGUGGGGCAUUUCACCAUUA 308 UAAUGGUGAAAUGCCCCACAGUG 687 UTRU307 2643 3' UUCAAACAGGUCGAGCUGUGC 309 UCACAGCUCGACCUGUUUGAAUG 688 UTRU308 2763 3' ACCAAGGAGGCAGGAUUCUUC 310 UAAGAAUCCUGCCUCCUUGGUGG 689 UTRU309 2770 3' AGGCAGGAUUCUUCCCAUGGA 311 UC CAUGGGAAGAAUCCUGC CUC C 690 UTRU310 2837 3' GUGAGUGUGAAAGGUGCUGAU 312 AUCAGCAC CUUUCACACUCAC C C 691 UTRU311 2849 3' GGUGCUGAUGGCCCUCAUCUA 313 UAGAUGAGGGCCAUCAGCACCUU 692 UTRU312 2853 3' CUGAUGGC C CUCAUCUC CAGA 314 UCUGGAGAUGAGGGCCAUCAGCA 693 UTRU313 2907 3' UAAUGGAGGCUUAGCUUUCUG 315 UAGAAAGCUAAGCCUCCAUUAAU 694 UTRU314 2916 3' CUUAGCUUUCUGGAUGGCAUA 316 UAUGCCAUCCAGAAAGCUAAGCC 695 UTRU315 2917 3' UUAGCUUUCUGGAUGGCAUCU 317 AGAUGCCAUCCAGAAAGCUAAGC 696 UTRU316 2917 3' UUAGCUUUCUGGAUGGCAUCA 318 UGAUGCCAUCCAGAAAGCUAAGC 697 UTRU317 2918 3' UAGCUUUCUGGAUGGCAUCUA 319 UAGAUGCCAUCCAGAAAGCUAAG 698 UTRU318 2925 3' CUGGAUGGCAUCUAGCCAGAA 320 UUCUGGCUAGAUGCCAUCCAGAA 699 UTRU319 2930 3' UGGCAUCUAGCCAGAGGCUGG 321 UCAGCCUCUGGCUAGAUGCCAUC 700 UTRU320 3035 3' AACACCCAAAGGUGGCCUGCG 322 UGCAGGCCACCUUUGGGUGUUGC 701 UTRU321 3104 3' CUGUCUCAGCCAACCCGCUCA 323 UGAGCGGGUUGGCUGAGACAGUG 702 UTRU322 3105 3' UGUCUCAGCCAACCCGCUCCA 324 UGGAGCGGGUUGGCUGAGACAGU 703 UTRU323 3109 3' UCAGCCAACCCGCUCCACUAC 325 UUAGUGGAGCGGGUUGGCUGAGA 704 UTRU324 3111 3' AGCCAACCCGCUCCACUACCC 326 UGGUAGUGGAGCGGGUUGGCUGA 705 UTRU325 3190 3' GCGUGCCUGCCAAGCUCACAA 327 UUGUGAGCUUGGCAGGCACGCCC 706 UTRU326 3248 3' CUGAAGC CAAGC CUCUUCUUA 328 UAAGAAGAGGCUUGGCUUCAGAG 707 UTRU327 3251 3' AAGCCAAGCCUCUUCUUACUU 329 AAGUAAGAAGAGGCUUGGCUUCA 708 UTRU328 3251 3' AAGCCAAGCCUCUUCUUACUA 330 UAGUAAGAAGAGGCUUGGCUUCA 709 UTRU329 3252 3' AGCCAAGCCUCUUCUUACUUC 331 UAAGUAAGAAGAGGCUUGGCUUC 710 UTRU330 3314 3' GGGAAGGGGAACACAGAC CAA 332 UUGGUCUGUGUUC C CCUUC C CAG 711 UTRU331 3330 3' ACCAGGAAGCUCGGUGAGUGA 333 UCACUCAC CGAGCUUC CUGGUCU 712UTRPAT059933-PCT-SEC01 U332 3333 3' AGGAAGCUCGGUGAGUGAUGG 334 UCAUCACUCAC CGAGCUUC CUGG 713 UTRU333 3415 3' UGGCGGAGAUGCUUCUAAGGC 335 UC CUUAGAAGCAUCUC CGC CAGG 714 UTRU334 3455 3' AACAACUGUC C CUCCUUGAGC 336 UCUCAAGGAGGGACAGUUGUUGG 715 UTRU335 3458 3' AACUGUCCCUCCUUGAGCACC 337 UGUGCUCAAGGAGGGACAGUUGU 716 UTRU336 3475 3' CAC CAGC C C CAC C CAAGCAAA 338 UUUGCUUGGGUGGGGCUGGUGCU 717 UTRU337 3480 3' GCCCCACCCAAGCAAGCAGAA 339 UUCUGCUUGCUUGGGUGGGGCUG 718 UTRU338 3481 3' CCCCACCCAAGCAAGCAGACA 340 UGUCUGCUUGCUUGGGUGGGGCU 719 UTRU339 3485 3' ACCCAAGCAAGCAGACAUUUA 341 UAAAUGUCUGCUUGCUUGGGUGG 720 UTRU340 3486 3' C C C AAGC AAG C AGAC AUUUAU 342 AUAAAUGUCUGCUUGCUUGGGUG 721 UTRU341 3486 3' C C C AAGC AAG C AGAC AUUUAA 343 UUAAAUGUCUGCUUGCUUGGGUG 722 UTRU342 3488 3' CAAGCAAGCAGACAUUUAUCU 344 AGAUAAAUGUCUGCUUGCUUGGG 723 UTRU343 3492 3' CAAGCAGACAUUUAUCUUUUA 345 UAAAAGAUAAAUGUCUGCUUGCU 724 UTRU344 3498 3' GACAUUUAUCUUUUGGGUCUA 346 UAGAC C CAAAAGAUAAAUGUCUG 725 UTRU345 3501 3' AUUUAUCUUUUGGGUCUGUCC 347 UGACAGACCCAAAAGAUAAAUGU 726 UTRU346 3502 3' UUUAUCUUUUGGGUCUGUC CU 348 AGGACAGACCCAAAAGAUAAAUG 727 UTRU347 3502 3' UUUAUCUUUUGGGUCUGUC CA 349 UGGACAGACCCAAAAGAUAAAUG 728 UTRU348 3505 3' AUCUUUUGGGUCUGUC CUCUC 350 UAGAGGACAGAC C CAAAAGAUAA 729 UTRU349 3543 3' CAACUUUUCUAGACCUGUUUU 351 AAAACAGGUCUAGAAAAGUUGGC 730 UTRU350 3543 3' CAACUUUUCUAGACCUGUUUA 352 UAAACAGGUCUAGAAAAGUUGGC 731 UTRU351 3544 3' AACUUUUCUAGAC CUGUUUUG 353 UAAAACAGGUCUAGAAAAGUUGG 732 UTRU352 3547 3' UUUUCUAGACCUGUUUUGCUU 354 AAGCAAAACAGGUCUAGAAAAGU 733 UTRU353 3551 3' CUAGACCUGUUUUGCUUUUGU 355 ACAAAAGCAAAACAGGUCUAGAA 734 UTRU354 3551 3' CUAGACCUGUUUUGCUUUUGA 356 UCAAAAGCAAAACAGGUCUAGAA 735 UTRU355 3553 3' AGACCUGUUUUGCUUUUGUAA 357 UUACAAAAGCAAAACAGGUCUAG 736 UTRU356 3558 3' UGUUUUGCUUUUGUAACUUGA 358 UCAAGUUACAAAAGCAAAACAGG 737 UTRU357 3559 3' GUUUUGCUUUUGUAACUUGAA 359 UUCAAGUUACAAAAGCAAAACAG 738 UTRU358 3561 3' UUUGCUUUUGUAACUUGAAGA 360 UCUUCAAGUUACAAAAGCAAAAC 739 UTRU359 3562 3' UUGCUUUUGUAACUUGAAGAU 361 AUCUUCAAGUUACAAAAGCAAAA 740 UTRU360 3562 3' UUGCUUUUGUAACUUGAAGAA 362 UUCUUCAAGUUACAAAAGCAAAA 741 UTRU361 3563 3' UGCUUUUGUAACUUGAAGAUA 363 UAUCUUCAAGUUACAAAAGCAAA 742UTRPAT059933-PCT-SEC01 U362 3564 3' GCUUUUGUAACUUGAAGAUAU 364 AUAUCUUCAAGUUACAAAAGCAA 743 UTRU363 3564 3' GCUUUUGUAACUUGAAGAUAA 365 UUAUCUUCAAGUUACAAAAGCAA 744 UTRU364 3567 3' UUUGUAACUUGAAGAUAUUUA 366 UAAAUAUCUUCAAGUUACAAAAG 745 UTRU365 3568 3' UUGUAACUUGAAGAUAUUUAU 367 AUAAAUAUCUUCAAGUUACAAAA 746 UTRU366 3587 3' AUUCUGGGUUUUGUAGCAUUU 368 AAAUGCUACAAAACCCAGAAUAA 747 UTRU367 3587 3' AUUCUGGGUUUUGUAGCAUUA 369 UAAUGCUACAAAACCCAGAAUAA 748 UTRU368 3590 3' CUGGGUUUUGUAGCAUUUUUA 370 UAAAAAUGCUACAAAACCCAGAA 749 UTRU369 3595 3' UUUUGUAGCAUUUUUAUUAAU 371 AUUAAUAAAAAUGCUACAAAACC 750 UTRU370 3597 3' UUGUAGCAUUUUUAUUAAUAU 372 AUAUUAAUAAAAAUGCUACAAAA 751 UTRU371 3600 3' UAGCAUUUUUAUUAAUAUGGU 373 ACCAUAUUAAUAAAAAUGCUACA 752 UTRU372 3604 3' AUUUUUAUUAAUAUGGUGACU 374 AGUCACCAUAUUAAUAAAAAUGC 753 UTRU373 3606 3' UUUUAUUAAUAUGGUGACUUU 375 AAAGUCAC CAUAUUAAUAAAAAU 754 UTRU374 3607 3' UUUAUUAAUAUGGUGACUUUU 376 AAAAGUCACCAUAUUAAUAAAAA 755 UTRU375 3608 3' UUAUUAAUAUGGUGACUUUUU 377 AAAAAGUCAC CAUAUUAAUAAAA 756 UTRU376 3609 3' UAUUAAUAUGGUGACUUUUUA 378 UAAAAAGUCAC CAUAUUAAUAAA 757 UTRU377 3610 3' AUUAAUAUGGUGACUUUUUAA 379 UUAAAAAGUCAC CAUAUUAAUAA 758 UTRU378 3612 3' UAAUAUGGUGACUUUUUAAAA 380 UUUUAAAAAGUCAC CAUAUUAAU 759 UTRU379 3613 3' AAUAUGGUGACUUUUUAAAAU 381 AUUUUAAAAAGUCACCAUAUUAA 760UTR* site of mRNA target is located in human PCSK9 mRNA sequence in SEQ ID NO: 2.[000216] In Table 1, each code (letter, e.g., A, G, C, and U) represents a single ribonucleotide in the first dsRNAi agent. In some embodiments, the sequence list may be inclusive of any possible modifications, for example, a modification in a nucleobase, a ribose sugar ring, and / or a phosphate group (i.e., phosphodiester internucleoside linkage). In some embodiments, the last nucleotide from the 5' end (or the first nucleotide from 3' end) in each strand (sense strand and antisense strand) may have not include a phosphate group as being hydrolyzed or processed, e.g., during the synthesis of the oligonucleotides, but may contain 3'-terminal -OH group. In some embodiments, a phosphate group in the last nucleotide from the 5' end (or the first nucleotide from 3' end) in the sense strand may be added as a functional group for conjugation with a ligand.[000217] In some embodiments, the first dsRNA agent includes a sense strand having 10 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisensePAT059933-PCT-SEC01 strand having 10 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 11 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 11 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 12 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 12 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 13 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 13 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 14 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 14 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 16 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 16 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 17 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 17 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 18 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selectedPAT059933-PCT-SEC01 from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 18 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 19 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 19 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 20 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 20 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 21 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 21 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes an antisense strand having 22 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes an antisense strand having 23 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760.[000218] In some embodiments, the first dsRNAi agent includes a sense strand having 10 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 10 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 11 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the dsRNA includes an antisense strand having 11 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 12 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 12 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selectedPAT059933-PCT-SEC01 from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 13 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 13 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 14 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 14 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 15 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 15 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 16 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 16 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 17 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 17 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 18 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 18 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 19 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 19 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 20 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisensePAT059933-PCT-SEC01 strand having 20 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 21 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 21 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes an antisense strand having 22 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes an antisense strand having 23 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760.[000219] In some embodiments, the first dsRNAi agent includes a sense strand having 10 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 10 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 11 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 11 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 12 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 12 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 13 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 13 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 14 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 14 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 15 contiguousPAT059933-PCT-SEC01 nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 15 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 16 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 16 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 17 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 17 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 18 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 18 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 19 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 19 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 20 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 20 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes a sense strand having 21 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 3 to 381. In some embodiments, the first dsRNAi agent includes an antisense strand having 21 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes an antisense strand having 22 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes an antisense strand having 23PAT059933-PCT-SEC01 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 382 to 760.[000220] In some embodiments, the first dsRNAi agent includes (i) a sense strand having 15 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 15 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes (i) a sense strand having 16 contiguous nucleotides differing by no more than one, two or three from the nucleotide sequence selected from SEQ ID NOs: 3 to 381 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 16 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes (i) a sense strand having 17 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 17 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes (i) a sense strand having 18 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 18 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes (i) a sense strand having 19 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 19 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes (i) a sense strand having 20 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 20 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes (i) a sense strand having 21 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 21 contiguous nucleotidesPAT059933-PCT-SEC01 differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes (i) a sense strand having 21 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 22 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760. In some embodiments, the first dsRNAi agent includes (i) a sense strand having 21 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 3 to 381 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 23 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 382 to 760.[000221] In certain aspects, the sequences of the single strands (i.e., sense strand and antisense strand) of the first dsRNAi agent can be selected by selecting a target region and a length in the PCSK9 mRNA. In certain aspects, a dsRNA as described herein may target a nucleotide region selected from regions of (i) 600-800; (ii) 800 to 1000; (iii) 1000-1200; (iv) 3100-3300; or (v) 3400-3600 of a human PCSK9 mRNA sequence that has at least about 85% (e.g., about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or 100%) identity to SEQ ID NO: 2 (human PCSK9 isoform, transcript variant 1, mRNA (GenBank: NM_174936.4)). In some embodiments, the target region is selected from regions of (i) 650-750; (ii) 850-950; (iii) 1050-1150; (iv) 3200-3300; (v) 3400-3500; or (vi) 3500-3600 of a human PCSK9 mRNA sequence that has at least about 85% (e.g., about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or 100%) identity to SEQ ID NO: 2 (human PCSK9 isoform, transcript variant 1, mRNA (GenBank: NM_174936.4)).[000222] In some embodiments, the antisense strand of the first dsRNAi agent targets a region of (i) 600-800; (ii) 800-1000; (iii) 1000-1200; (iv) 3100-3300; or (v) 3400-3600 nucleotides in a human PCSK9 mRNA sequence that has at least about 85% (e.g., about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or 100%) identity to SEQ ID NO: 2 (human PCSK9 isoform, transcript variant 1, mRNA (GenBank: NM_174936.4)). In some embodiments, the antisense strand of the first dsRNAi agent targets a region of (i) 650-750; (ii) 850-950; (iii) 1050-1150; (iv) 3200-3300; (v) 3400-3500; or (vi) 3500-3600 nucleotides in a human PCSK9 mRNA sequence that has at least about 85% (e.g., about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%PAT059933-PCT-SEC01 or 100%) identity to SEQ ID NO: 2 (human PCSK9 isoform, transcript variant 1, mRNA (GenBank: NM_174936.4)). In some embodiments, the antisense strand of the first dsRNAi agent targets a region of 3500th to 3600th nucleotides in a human PCSK9 mRNA sequence that has at least about 85% (e.g., about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or 100%) identity to SEQ ID NO: 2 (human PCSK9 isoform, transcript variant 1, mRNA (GenBank: NM_174936.4)).[000223] Exemplary selected first dsRNAi agent sequences targeting the regions described herein (e.g., target region of (i) 600-800; (ii) 800 to 1000; (iii) 1000-1200; (iv) 3100-3300; or(v) 3400-3600) are shown in Table 2.Table 2: Selected sequences of first dsRNAi agents (e.g., PCSK9 siRNA) (unmodified nucleotide sequences)siRNA Site of Sense strand SEQ Antisense strand SEQ No. mRNA ID ID Target * NO. NO. Pl 3551 CUAGACCUGUUUUGCUUUUGU 761 ACAAAAGCAAAACAGGUCUAGAA 778 P2 3492 CAAGCAGACAUUUAUCUUUUA 762 UAAAAGAUAAAUGUCUGCUUGCU 779 P3 3543 CAACUUUUCUAGAC CUGUUUU 763 AAAACAGGUCUAGAAAAGUUGGC 780 P4 3564 GCUUUUGUAACUUGAAGAUAU 764 AUAUCUUCAAGUUACAAAAGCAA 781 P5 713 UUGAAGUUGCCCCAUGUCGAA 765 UUCGACAUGGGGCAACUUCAAGG 782 P6 1102 CCUCAUAGGCCUGGAGUUUAU 766 AUAAACUCCAGGCCUAUGAGGGU 783 P7 3251 AAGCCAAGCCUCUUCUUACUU 767 AAGUAAGAAGAGGCUUGGCUUCA 784 P8 3252 AGCCAAGCCUCUUCUUACUUA 768 UAAGUAAGAAGAGGCUUGGCUUC 785 P9 3547 UUUUCUAGACCUGUUUUGCUU 769 AAGCAAAACAGGUCUAGAAAAGU 786 P10 3553 AGACCUGUUUUGCUUUUGUAA 770 UUACAAAAGCAAAACAGGUCUAG 787 Pll 3568 UUGUAACUUGAAGAUAUUUAU 771 AUAAAUAUCUUCAAGUUACAAAA 788 P12 3559 GUUUUGCUUUUGUAACUUGAA 772 UUCAAGUUACAAAAGCAAAACAG 789 P13 432 UGGUGCUAGCCUUGCGUUCCA 773 UGGAACGCAAGGCUAGCACCAGC 790 P14 881 AGUGACCACCGGGAAAUCGAA 774 UUCGAUUUCCCGGUGGTCACUCU 791 P15 2907 UAAUGGAGGCUUAGCUUUCUA 775 UAGAAAGCUAAGCCUCCAUUAAU 792 P16 865 AGACACCAGCAUACAGAGUGA 776 UCACUCUGUAUGCUGGUGUCUAG 793P17 3551 CUAGACCUGUUUUGCUUUUGU 777 ACAAAAGCAAAACAGGUCUAGAA 794 * site of mRNA target is located in human PCSK9 mRNA sequence in SEQ ID NO: 2.Table 2A. Additional first dsRNAi agents (unmodified nucleotide sequences)siRNA Sense strand 5’-3’ SEQ Antisense strand 5’-3’ SEQ No. ID ID NO NO2A. 1 CCAAGAUCCUGCAUGUCUUCC 2039 AAGACAUGCAGGAUCUUGGUG 2081 2A. 2 GUCUGGAAUGCAAAGUCAAGG 2040 UUGACUUUGCAUUCCAGACCU 2082 2A. 3 CCUGUUUUGCUUUUGUAACUU 2041 AAGUUACAAAAGCAAAACAGGUC 2083 2A.4 UGUUUUGCUUUUGUAACUUGA 2042 UCAAGUUACAAAAGCAAAACAGG 2084 2A. 5 UGAAGAUAUUUAUUCUGGGUU 2043 AACCCAGAAUAAAUAUCUUCAAG 20852A. 6 AAGAUAUUUAUUCUGGGUUUU 2044 AAAACCCAGAAUAAAUAUCUUCA 2086PAT059933-PCT-SEC01 2A. 7 GCUCGGUGAGUGAUGGCAGAA 2045 UUCUGCCAUCACUCACCGAGC 2087 2A. 8 GGUCAC CGACUUCGAGAAUGU 2046 ACAUUCUCGAAGUCGGUGACC 2088 2A. 9 CCCAAGCAAGCAGACAUUU 2047 AAAUGUCUGCUUGCUUGGG 2089 2A. 10 GCAGGAACUGAGCCAGAAA 2048 UUUCUGGCUCAGUUCCUGC 2090 2A. 11 GCCAAGCCUCUUCUUACUUCA 2049 UGAAGUAAGAAGAGGCUUGGC 2091 2A. 12 CUUUUGUAACUUGAAGAUAUUUATT 2050 AAUAAAUAUCUUCAAGUUACAAAAGCA 2092 2A. 13 GUUUUGUAGCAUUUUUAUUAA 2051 UUAAUAAAAAUGCUACAAAAC C C 2093 2A. 14 CUUUUGUAACUUGAAGAUAUU 2052 AAUAUCUUCAAGUUACAAAAGCA 2094 2A. 15 CUUUUGUAACUUGAAGAUAUU 2053 AAUAUCUUCAAGUUACAAAAGCA 2095 2A. 16 CUUAUUCUGGGUUUUGUAGCA 2054 UGCUACAAAACCCAGAAUAAG 2096 2A. 17 GCAGCCAACUUUUCUAGAA 2055 UUCUAGAAAAGUUGGCUGUGG 2097 2A. 18 CUACAGCCAACUUUUCUAGAA 2056 UUCUAGAAAAGUUGGCUGUA 2098 2A. 19 CUUUUGUAACUUGAAGAUAA 2057 UUAUCUUCAAGUUACAAAAGCA 2099 2A. 20 AACUUGAAGAUAUUUAUUCA 2058 UGAAUAAAUAUCUUCAAGUUAC 2100 2A. 21 UGGGUUUUGUAGCAUUUUUA 2059 UAAAAAUGCUACAAAACCCAGA 2101 2A. 22 GUUUUGUAGCAUUUUUAUUA 2060 UAAUAAAAAUGCUACAAAAC C C 2102 2A. 23 UUUGUAGCAUUUUUAUUAAA 2061 UUUAAUAAAAAUGCUACAAAAC 2103 2A. 24 UGUAGCAUUUUUAUUAAUAA 2062 UUAUUAAUAAAAAUGCUACAAA 2104 2A. 25 AUUCUGGGUUUUGUAGCAUA 2063 UAUGCUACAAAACCCAGAAUAA 2105 2A. 26 UUUUGUAGCAUUUUUAUUAA 2064 UUAAUAAAAAUGCUACAAAACC 2106 2A. 27 CAGGUCGAGCUGUGCUCGGGU 2065 ACCCGAGCACAGCUCGACCUGUU 2107 2A. 28 GC CGAUGUC CGUGGGCAGAAU 2066 AUUCUGCCCACGGACAUCGGCAC 2108 2A. 29 CACUACCCGGCAGGGUACACA 2067 UGUGUACCCUGCCGGGUAGUGGA 2109 2A. 30 GAAGAUAUUUAUUCUGGGUUU 2068 AAACCCAGAAUAAAUAUCUUCAA 2110 2A. 31 CUUUUUACAGCCAACUUUUCA 2069 UGAAAAGUUGGCUGUAAAAAGGC 2111 2A. 32 CUUUUUACAGCCAACUUUUCU 2070 AGAAAAGUUGGCUGUAAAAAGGC 2112 2A. 33 CUUUUGUAACUUGAAGAUAUA 2071 UAUAUCUUCAAGUUACAAAAGCA 2113 2A. 34 CUAGACCUGUUUUGCUUUUGA 2072 UCAAAAGCAAAACAGGUCUAGAA 2114 2A. 35 CUAGACCUGUUUUGCUUUUGA 2073 UCAAAAGCAAAACAGGUCUAGAA 2115 2A. 36 AGACCUGUUUUGCUUUUGU 2074 ACAAAAGCAAAACAGGUCUAG 2116 2A. 37 CGUUUUGCUUUUGUAACUU 2075 AAGUUACAAAAGCAAAACG 2117 2A. 38 UGUUUUGCUUUUGUAACUU 2076 AAGUUACAAAAGCAAAACA 2118 2A. 39 GGACCUGUUUUGCUUUUGU 2077 ACAAAAGCAAAACAGGUCC 2119 2A.40 CCUGUUUUGCUUUUGUAACUU 2078 AAGUUACAAAAGCAAAACAGG 2120 2A.41 CUAGACCUGUUUUGCUUUUGU 2079 ACAAAAGCAAAACAGGUCUAGAA 21212A.42 CUAGACCUGUUUUGCUUUUGU 2080 UGGAACAAAAGCAAAACAGGUCUAGAA 2122[000224] In some embodiments, the first dsRNAi agent includes a sense strand having 10 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 10 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 11 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 11 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sensePAT059933-PCT-SEC01 strand having 12 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 12 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 13 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 13 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 14 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 14 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 16 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 16 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 17 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 17 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 18 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 18 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 19 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQPAT059933-PCT-SEC01 ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 19 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 20 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 20 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 21 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 21 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes an antisense strand having 22 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes an antisense strand having 23 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122.[000225] In some embodiments, the first dsRNAi agent includes a sense strand having 10 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 10 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 11 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 11 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 12 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 12 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 13 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisensePAT059933-PCT-SEC01 strand having 13 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 14 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 14 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 15 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 15 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 16 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 16 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 17 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 17 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 18 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 18 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 19 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 19 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 20 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 20 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQPAT059933-PCT-SEC01 ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 21 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 21 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes an antisense strand having 22 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes an antisense strand having 23 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122.[000226] In some embodiments, the first dsRNAi agent includes a sense strand having 10 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 10 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 11 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 11 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 12 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 12 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 13 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 13 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 14 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 14 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand havingPAT059933-PCT-SEC01 15 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 15 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 16 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 16 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 17 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 17 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 18 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 18 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 19 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 19 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 20 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 20 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes a sense strand having 21 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080. In some embodiments, the first dsRNAi agent includes an antisense strand having 21 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes an antisense strand having 22 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs:PAT059933-PCT-SEC01 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes an antisense strand having 23 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122.[000227] In some embodiments, the first dsRNAi agent includes (i) a sense strand having 15 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 15 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes (i) a sense strand having 16 contiguous nucleotides differing by no more than one, two or three from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 16 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes (i) a sense strand having 17 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 17 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes (i) a sense strand having 18 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 18 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes (i) a sense strand having 19 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 19 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes (i) a sense strand having 20 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 20 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes (i) a sense strand having 21 contiguousPAT059933-PCT-SEC01 nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 21 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes (i) a sense strand having 21 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 22 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122. In some embodiments, the first dsRNAi agent includes (i) a sense strand having 21 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 761-777 or 2039-2080 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 23 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 778-794 or 2081-2122.[000228] In certain aspects, when a sense strand or an antisense strand of a first dsRNAi agent in above paragraphs is differing by a certain number of nucleotides (e.g., one, two or three nucleotides) from a specific sequence (e.g., SEQ ID NOs: 3 to 794 or 2039 to 2122), it is meant by that the sense strand or the antisense strand of the dsRNA includes one, two or three nucleotides having different nucleobases compared to the nucleobases of the nucleotides at the corresponding positions of the specific sequence (e.g., SEQ ID NOs: 3 to 794 or 2039 to 2122).[000229] In some embodiments, the first dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 761 andan antisense strand consisting of SEQ ID NO: 778;(b) a sense strand consisting of SEQ ID NO: 772 andan antisense strand consisting of SEQ ID NO: 789.[000230] Additional suitable first dsRNAi agents are described in CN120265777, WO2025077949, WO2025097633, CN118955591, CN120769912, WO2024188174, WO 2024 / 228030, GB2635479, WO2024163497, CN120501756, CN120505340, WO2025171649, WO2025171650, WO2025171684, CN120775842, US 2025 / 0313844, US 2024 / 0376476, CN118109463, CN119528986, CN119040325, W02025060884, WO2024263915, CN119662645, WO 2025 / 096355, WO2025 / 124364, WO 2025 / 184301, WO2025038418, W02025 / 021034, WO2014089313, W02022150508, W02019204021, WO2018039364, WO2018175839, WO2014207232, WO2022125913, CN109957565, and CN115572726, the entire contents of which are incorporated herein by reference.PAT059933-PCT-SEC01The second antisense agent[000231] In an aspect, the second antisense agent is a Lp(a) inhibitor.[000232] In some embodiments, the second antisense agent is a dsRNAi agent. In some embodiments, the second antisense agent is an ASO or an ASO agent.[000233] The disclosure provides a second dsRNA interference (dsRNAi) agent that is capable of interacting or recruiting a target mRNA sequence, e.g., Lp(a) target mRNA sequence, in the RISC thereby cleaving the target mRNA. The second dsRNAi agent can silence Lp(a) gene, e.g., by inhibiting, downregulating, or suppressing the expression of Lp(a) gene. Gene-silencing (e.g., inhibiting, downregulating, or suppressing of the gene) may be assessed by a decrease in an absolute or relative level of one or more variables that are associated with Lp(a) expression compared with a control level. The control level may be any type obtained from, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or untreated or treated subject with inactive agents (e.g., PBS buffer). In some embodiments, the level of silencing the Lp(a) may be demonstrated by a reduction of the amount of a total Lp(a) mRNA in a cell. In some embodiments, the level of silencing the Lp(a) may be demonstrated by a reduction of the amount of a total Lp(a) protein in a cell.[000234] In some embodiments, expression of the Lp(a) gene (e.g., human LPA) is inhibited by at least about 10%, about 15%, about 20%, about 25%, about 30 %, about 40%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% based on the expression level of the Lp(a) gene in untreated cell or subject. In some embodiments, expression of the Lp(a) gene (e.g., human Lp(a)) is inhibited by at least about 20% based on the expression level of the Lp(a) gene in untreated cell or subject. In some embodiments, expression of the Lp(a) gene (e.g., human Lp(a)) is inhibited by at least about 30% based on the expression level of the Lp(a) gene in untreated cell or subject. In some embodiments, expression of the Lp(a) gene (e.g., human Lp(a)) is inhibited by at least about 40% based on the expression level of the LPA gene in untreated cell or subject. In some embodiments, expression of the Lp(a) gene (e.g., human Lp(a)) is inhibited by at least about 50% based on the expression level of the Lp(a) gene in untreated cell or subject. In some embodiments, expression of the Lp(a) gene (e.g., human Lp(a)) is inhibited by at least about 60% based on the expression level of the Lp(a) gene in untreated cell or subject. In some embodiments, expression of the Lp(a) gene (e.g., human Lp(a)) is inhibited by at least about 70% based on the expression level of the Lp(a) gene in untreated cell or subject.[000235] In some embodiments, inhibition of the expression of the Lp(a) gene may be manifested by a reduction of the amount of mRNA expressed in a first cell or a first group of cells obtained fromPAT059933-PCT-SEC01 a subject that has been treated, e.g., by contacting the cell or by administering the second antisense agent (e.g., second dsRNAi agent) as described herein, as compared to a second cell or a second group of cells obtained from a subject that has not been treated but is identical to the first cell or the first group of cells. For example, the level of gene-silencing (e.g., inhibiting, downregulating, or suppressing of the gene) of the Lp(a) (e.g., human Lp(a)) may be presented as a percentage of remaining mRNA in the treated cells (first cell or group of cells) compared to the mRNA amount in the control (untreated) cells, as shown in the following equation:(mRNA in control cells) - (mRNA in treated cells)(mRNA in control cells)[000236] In some embodiments, the level of gene -silencing (e.g., inhibiting, downregulating, or suppressing of the gene) of the Lp(a) (e.g., human Lp(a)) may be assessed by measuring a parameter or biomarker, e.g., human Lp(a) protein level, in a biological sample (e.g., e.g., a blood, serum or liver tissue obtained from a subject), which may be treated or untreated. Conventional analytical methods as known in the art such as electrophoresis (e.g., SDS or capillary electrophoresis), chromatography (e.g., high performance liquid chromatography (HPLC)), spectroscopy, western blotting, enzyme- linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like can be used without limitation, but examples are not limited thereto. In some embodiments, reduced level of gene-silencing (e.g., inhibiting, downregulating, or suppressing of the gene) of the Lp(a) (e.g., human Lp(a)) may be observed or assessed by in a liver (tissue) biopsy of the treated subject.[000237] In certain aspect, the second antisense agent (e.g., second dsRNAi agent) is a free acid. In certain aspect, the second antisense agent (e.g., second dsRNAi agent) is in a salt form (e.g., a pharmaceutically acceptable salt form. It will be understood that references to second antisense agent (e.g., second dsRNAi agent) are meant to also include the pharmaceutically acceptable salts of the second antisense agent (e.g. second dsRNAi agent). If the second antisense agent (e.g., second dsRNAi agent) has, for example, at least one basic center, they can form acid addition salts. Corresponding acid addition salts can also be formed having, if desired, an additionally present basic center. Active substances having an acid group, e.g., COOH, can form salts with bases. The second antisense agent (e.g., second dsRNAi agent) or pharmaceutically acceptable salts thereof may also be used in form of a hydrate or include other solvents used for crystallization. In some embodiments, the second antisense agent (e.g., second dsRNAi agent) is a sodium salt. In some embodiments, the second antisense agent (e.g. second dsRNAi agent) is in a salt form (e.g., a pharmaceutically acceptable salt form), where the salt is sodium (Na+), ammonium (NH4+), calcium (Ca2+), iron (Fe2+PAT059933-PCT-SEC01 or Fe3+), magnesium (Mg2+), potassium (K+), pyridinium (C5H5NH+), quaternary ammonium (NR4+, R being an alkyl group or an aryl group as described herein), or copper (Cu2+).[000238] In an aspect, the second antisense agent is an antisense oligonucleotide, having sequences (e.g., antisense strand sequence) that can recognize a specific region of a Lp(a) mRNA (e.g., human Lp(a) mRNA) and lead cleavage of the Lp(a) mRNA and silencing of the gene.[000239] In an aspect, the disclosure provides a second dsRNAi agent having sequences (e.g., antisense strand sequence) that can recognize a specific region of a Lp(a) mRNA (e.g., human Lp(a) mRNA) and lead cleavage of the Lp(a) mRNA and silencing of the gene. The second dsRNAi agent includes a sense strand and an antisense strand and each strand may range from 12 to 30 nucleotides in length. In some embodiments, each strand may have 15 to 30 nucleotides in length. In some embodiments, each strand may have 15 to 25 nucleotides in length. In some embodiments, the antisense strand may have 15 to 25 nucleotides in length. In some embodiments, the sense strand may have 15 to 25 nucleotides in length. In some embodiments, the antisense strand may have 15 to 23 nucleotides in length. In some embodiments, the sense strand may have 15 to 23 nucleotides in length. In some embodiments, the antisense strand may have 18 to 25 nucleotides in length. In some embodiments, the sense strand may have 18 to 25 nucleotides in length.[000240] In some embodiments, the sense strand may have 19 to 23 nucleotides in length. In some embodiments, the sense strand may have 21 to 23 nucleotides in length. In some embodiments, the sense strand may have 19 nucleotides in length. In some embodiments, the sense strand may have 20 nucleotides in length. In some embodiments, the sense strand may have 21 nucleotides in length. In some embodiments, the sense strand may have 22 nucleotides in length. In some embodiments, the sense strand may have 23 nucleotides in length.[000241] In some embodiments, the antisense strand may have 19 to 25 nucleotides in length. In some embodiments, the antisense strand may have 19 to 23 nucleotides in length. In some embodiments, the antisense strand may have 21 to 23 nucleotides in length. In some embodiments, the antisense strand may have 23 to 25 nucleotides in length. In some embodiments, the antisense strand may have 19 nucleotides in length. In some embodiments, the antisense strand may have 20 nucleotides in length. In some embodiments, the antisense strand may have 21 nucleotides in length. In some embodiments, the antisense strand may have 22 nucleotides in length. In some embodiments, the antisense strand may have 23 nucleotides in length. In some embodiments, the antisense strand may have 24 nucleotides in length. In some embodiments, the antisense strand may have 25 nucleotides in length.[000242] In some embodiments, the sense strand is 21 to 23 nucleotides in length and the antisense strand is 23 to 25 nucleotides in length. In some embodiments, the sense strand is 21PAT059933-PCT-SEC01 nucleotides in length and the antisense strand is 23 nucleotides in length. In some embodiments, the sense strand is 22 nucleotides in length and the antisense strand is 24 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 25 nucleotides in length.[000243] In an aspect, a second dsRNAi agent as described herein forms a double-stranded (or "duplex”) region made between a sense strand and an antisense strand and having 10 to 25 nucleotide pairs in length. The double stranded or duplex region are loaded into the RISC complex and subsequent specific degradation of the sense strand occurs during the RISC pathway. In some embodiments, the double stranded region has 10 nucleotide base pairs in length. In some embodiments, the double stranded region has 11 nucleotide base pairs in length. In some embodiments, the double stranded region has 12 nucleotide base pairs in length. In some embodiments, the double stranded region has 13 nucleotide base pairs in length. In some embodiments, the double stranded region has 14 nucleotide base pairs in length. In some embodiments, the double stranded region has 15 nucleotide base pairs in length. In some embodiments, the double stranded region has 16 nucleotide base pairs in length. In some embodiments, the double stranded region has 17 nucleotide base pairs in length. In some embodiments, the double stranded region has 18 nucleotide base pairs in length. In some embodiments, the double stranded region has 19 nucleotide base pairs in length. In some embodiments, the double stranded region has 20 nucleotide base pairs in length. In some embodiments, the double stranded region has 21 nucleotide base pairs in length. In some embodiments, the double stranded region has 22 nucleotide base pairs in length. In some embodiments, the double stranded region has 23 nucleotide base pairs in length.[000244] In an aspect, a second dsRNAi agent as described herein may include at least one singlestranded nucleotide overhang, for example, for increasing in vivo effectiveness of the second dsRNAi agent and having substantially improved inhibition of the target genes. In certain aspect, the second dsRNAi agent may contain one or more extra nucleotides constituting overhang regions that locate other than the double stranded region at the 3 '-end, 5 '-end, or both ends of either stand or both strands (sense and antisense strands). In some embodiments, the overhang region may exist at the 3 '-end, 5'-end, or both ends of the sense strand. In some embodiments, the overhang region may exist at the 3'-end, 5 '-end, or both ends of the antisense strand. In some embodiments, the antisense strand may have a greater length than a length in the sense strand. In some embodiments, the antisense strand may have a shorter length than a length in the sense strand.[000245] In some embodiments, the second dsRNAi agent may contain one or more extra nucleotides constituting overhang regions at the 3 '-end, 5 '-end, or both ends of the antisense strand.PAT059933-PCT-SEC01 In some embodiments, the overhang region in the antisense strand may consist of 1-6 nucleotides in length, for example, 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, or 6 nucleotides in length. In some embodiments, the second dsRNAi agent may contain one or more extra nucleotides constituting overhang regions at the 3'-end, 5'-end, or both ends of the sense strand. In some embodiments, the overhang region may consist of 1-6 nucleotides in length, for example, 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, or 6 nucleotides in length.[000246] In some embodiments, the antisense strand may include one -nucleotide overhang at the 5’ end. In some embodiments, the antisense strand may include one-nucleotide overhang at the 3’ end. In some embodiments, the antisense strand may include two-nucleotides overhang. In some embodiments, the antisense contains two-nucleotides overhang at the 5’ end. In some embodiments, the antisense contains two-nucleotides overhang at the 3’ end. In some embodiments, the antisense contains one-nucleotide overhang at the 5’ end and one-nucleotide overhang at the 3’ end. In some embodiments, the antisense strand may include three-nucleotide overhang. In some embodiments, the antisense contains three-nucleotides overhang at the 5’ end. In some embodiments, the antisense contains three-nucleotides overhang at the3’ end. In some embodiments, the antisense contains two-nucleotides overhang at the 5’ end and one-nucleotide overhang at the 3’ end. In some embodiments, the antisense contains two nucleotides overhang at the 3’ end and one-nucleotide overhang at the 5’ end.[000247] In certain aspect, a second dsRNAi agent as described herein may include at least one blunt end, e.g., for increasing in vivo stability with resistance to degradation in physiological surroundings. In some embodiments, the second dsRNAi agent may have a blunt end at the 3 '-end, 5 '-end, or both ends of the duplex. In some embodiments, the second dsRNAi agent includes one overhang (e.g., at 3’ end of antisense strand) and one blunt end (e.g., at 5’ end of antisense strand). In some embodiments, the second dsRNAi agent includes a blunt end at the 5 '-end of the sense strand (and at 3’ end of the antisense strand) and contain overhang nucleotide(s) at the other end. In some embodiments, the second dsRNAi agent may have a blunt end at the 3 '-end of the sense strand (and at 5’ end of the antisense strand) and contain overhang nucleotide(s) at the other end.[000248] In certain aspect, the target LPA mRNA sequence may range from 12 to 30 nucleotides, from 15 to 30 nucleotides, from 18 to 30 nucleotides, from 18 to 25 nucleotides, from 18 to 23 nucleotides. In some embodiments, the target Lp(A) mRNA sequence may have 15 nucleotides in length. In some embodiments, the target Lp(a) mRNA sequence may have 16 nucleotides in length. In some embodiments, the target Lp(a) mRNA sequence may have 17 nucleotides in length. In some embodiments, the target Lp(a) mRNA sequence may have 18 nucleotides in length. In some embodiments, the target Lp(a) mRNA sequence may have 19 nucleotides in length. In somePAT059933-PCT-SEC01 embodiments, the target Lp(a) mRNA sequence may have 20 nucleotides in length. In some embodiments, the target Lp(a) mRNA sequence may have 21 nucleotides in length. In some embodiments, the target Lp(a) mRNA sequence may have 22 nucleotides in length. In some embodiments, the target Lp(a) mRNA sequence may have 23 nucleotides in length.[000249] In certain aspect, exemplary second dsRNAi agent sequences including sense strands and antisense strands targeting the above indicated Lp(a) mRNA (SEQ ID NO: 2038, or GenBank Accession No.: NM_005577.4).Table 3: UNMODIFIED LP(A) SEQUENCESsiRNA Sense strand SEQ Antisense strand SEQ No. ID ID NO. NO. Al GAGAGUUAUCGAGGCACAUAA 1917 UUAUGUGCCUCGAUAACUCUC 1938 A2 GAGAGUUAUCGAGGCACAUAA 1918 UUAUGUGCCUCGAUAACUCUC 1939 A3 CAGC C C CUUAUUGUUAUACGA 1919 UCGUAUAACAAUAAGGGGCUG 1940 A4 GC C C CUUAUUGUUAUACG 1920 CGUAUAACAAUAAGGGGC 1941 A5 CGGUAAUGGACAGAGUUAU 1921 AUAACUCUGUC CAUUAC CG 1942 UUGCCAAGCUUGGUCAUCUAGCAGC 1922 UAGAUGACCAAGCUUGGCAAGG 1943 A6 CGAAAGGCUGCUC CAC CACUGUCACAGGAAAGCAGC 1923 UUUCCUGUGACAGUGGUGGAGG 1944 A7 CGAAAGGCUGCUGGUAAUGGACAGAGUUAUAGCAGC 1924 UAUAACUCUGUCCAUUACCAGG 1945 A8 CGAAAGGCUGCUACUGCAACCUGACACGAUAGCAGC 1925 UAUCGUGUCAGGUUGCAGUAGG 1946 A9 CGAAAGGCUGCAGAACUUGCCAAGCUUGGUAGCAGC 1926 UACCAAGCUUGGCAAGUUCUGG 1947 A10 CGAAAGGCUGCAACUUGCCAAGCUUGGUCAAGCAGC 1927 UUGACCAAGCUUGGCAAGUUGG 1948 All CGAAAGGCUGCAUGGACAGAGUUAUCGAGGAGCAGC 1928 UC CUCGAUAACUCUGUC CAUGG 1949 A12 CGAAAGGCUGCUGGACAGAGUUAUCGAGGCAGCAGC 1929 UGCCUCGAUAACUCUGUCCAGG 1950 A13 CGAAAGGCUGCUGGUCAUCUAUGAUACCACAGCAGC 1930 UGUGGUAUCAUAGAUGACCAGG 1951 A14 CGAAAGGCUGCUACUGCAGGAAUCCAGAUUAGCAGC 1931 UAAUCUGGAUUCCUGCAGUAGG 1952 A15 CGAAAGGCUGCAGAAAUGUCCUGGAAGCAUAGCAGC 1932 UAUGCUUC CAGGACAUUUCUGG 1953 A16 CGAAAGGCUGCGACAACAGAAUAUUAUCCAAGCAGC 1933 UUGGAUAAUAUUCUGUUGUCGG 1954 A17 CGAAAGGCUGCAUGGACAGAGUUAUCAAGGAGCAGC 1934 UC CUUGAUAACUCUGUC CAUGG 1955 A18 CGAAAGGCUGCGACAACAGAAUAUUAUCCAAGCAGC 1935 UUGGAUAAUAUUCUGUUGUCGG 1956 A19 CGAAAGGCUGCAUGGACAGAGUUAUCAAGGAGCAGC 1936 UC CUUGAUAACUCUGUC CAUGG 1957 A20 CGAAAGGCUGCGACAACAGAAUAUUAUCCAAGCAGC 1937 UUGGAUAAUAUUCUGUUGUCGG 1958A21 CGAAAGGCUGCTable 3A: Unmodified Lp(a) sequencessiRNA Sense strand SEQ Antisense strand SEQ No. ID IDNO. NO.PAT059933-PCT-SEC01 3A. 1 UAC CACGGUAAUGGACAGAGA 2123 UCUCUGUCCAUUACCGUGGUAGC 2136 3A. 2 UGACACAAUGCUCAGACGCAA 2124 UUGCGUCUGAGCAUUGUGUCAGG 2137 3A. 3 UGACACAAUGCUCAAACGCAA 2125 UUGCGUUGAGCAUUGUGUCAGG 2138 3A.4 UGACACAAUGCUCAGGCGCAA 2126 UUGCGCUGAGCAUUGUGUCAGG 2139 3A. 5 UGACACAAUGCUCGGACGCAA 2127 UUGCGUCGAGCAUUGUGUCAGG 2140 3A. 6 UAC CACGGUAAUGGACAGAGA 2128 UCUCUGTCCAUUACCGUGGUAGC 2141 3A. 7 UAC CACGGUAAUGGACAGAGA 2129 UCUCUGUCCAUTACCGUGGUAGC 2142 3A. 8 UAC CACGGUAAUGGACAGAGA 2130 UCUCUGTCCAUTACCGUGGUAGC 2143 3A. 9 UAC CACGGUAAUGGACAGAGA 2131 UCUCUUCCAUUACCGUGGUAGC 2144 3A. 10 UAC CACGGUAAUGGACAGAGA 2132 UCUCUGCCAUUACCGUGGUAGC 2145 3A. 11 UAC CACGGUAAUGGACAGAGA 2133 UCUCUGUCAUUACCGUGGUAGC 2146 3A. 12 UAC CACGGUAAUGAACAGAGA 2134 UCUCUGUUCAUUACCGUGGUAGC 2147 3A. 13 UAC CACGGUAAUGGAUAGAGA 2135 UCUCUAUCCAUUACCGUGGUAGC 2148[000250] Homo sapiens lipoprotein(a) (LPA), mRNA; GenBank Accession No.: NM_005577.4 (SEQ ID NO: 2038). In Table 3, each code (letter, e.g., A, G, C, and U) represents a single ribonucleotide in the second dsRNAi agent. In some embodiments, the sequence list may be inclusive of any possible, additional modifications in a nucleobase, a ribose sugar ring, and / or a phosphate group (i.e., internucleoside linkage). In some embodiments, the last nucleotide from the 5’ end (or the first nucleotide from 3’ end) in each strand (sense strand and antisense strand) may have not include a phosphate group as being hydrolyzed or processed, e.g., during the synthesis of the oligonucleotides. In some embodiments, a phosphate group in the last nucleotide from the 5’ end (or the first nucleotide from 3’ end) in the sense strand may be added as a functional group for conjugation with a ligand.[000251] In some embodiments, the second dsRNAi agent includes a sense strand having 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 16 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 16 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 17 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 17 contiguousPAT059933-PCT-SEC01 nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 18 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 18 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 19 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 19 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 20 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 20 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 21 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 21 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 22 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 22 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 23 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 23 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148.[000252] In some embodiments, the second dsRNAi agent includes a sense strand having 15 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 15 contiguous nucleotides differing by no more than 2 nucleotidesPAT059933-PCT-SEC01 from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 16 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 16 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 17 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 17 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 18 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 18 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 19 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 19 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 20 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 20 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 21 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 21 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 22 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 22 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-PAT059933-PCT-SEC01 2148. In some embodiments, the second dsRNAi agent includes a sense strand having 23 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 23 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148.[000253] In some embodiments, the second dsRNAi agent includes a sense strand having 15 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 15 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 16 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 16 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 17 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 17 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 18 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 18 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 19 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 19 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 20 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 20 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agentPAT059933-PCT-SEC01 includes a sense strand having 21 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 21 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 22 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 22 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes a sense strand having 23 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135. In some embodiments, the second dsRNAi agent includes an antisense strand having 23 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148.[000254] In some embodiments, the second dsRNAi agent includes (i) a sense strand having 15 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 15 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes (i) a sense strand having 16 contiguous nucleotides differing by no more than one, two or three from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 16 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes (i) a sense strand having 17 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 17 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes (i) a sense strand having 18 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 18 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958PAT059933-PCT-SEC01 or 2136-2148. In some embodiments, the second dsRNAi agent includes (i) a sense strand having 19 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 19 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes (i) a sense strand having 20 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 20 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes (i) a sense strand having 21 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 21 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes (i) a sense strand having 22 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 22 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148. In some embodiments, the second dsRNAi agent includes (i) a sense strand having 23 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1917-1937 or 2123-2135 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 23 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1938-1958 or 2136-2148.[000255] In certain aspect, when a sense strand or an antisense strand of a second dsRNAi agent in above paragraphs is differing by a certain number of nucleotides (e.g., one, two or three nucleotides) from a specific sequence (e.g., SEQ ID NOs: 1917-1937, 1938-1958, or 2123-2148), it is meant by that the sense strand or the antisense strand of the second dsRNAi agent includes one, two or three nucleotides having different nucleobases compared to the nucleobases of the nucleotides at the corresponding positions of the specific sequence (e.g., SEQ ID NOs: 1917-1937, 1938-1958, or 2123-2148).PAT059933-PCT-SEC01[000256] Additional suitable dsRNAi agents targeting Lp(a), or variants thereof and synthesis thereof are also described in WO2022 / 098841, WO 2017 / 059223, WO2019 / 092283, WO2022 / 032288, WO2023 / 138689, WO2025 / 064819, WO2025 / 064815, WO2025 / 064821, WO2025 / 117709 and WO2025 / 170868, the entire contents of which are incorporated herein by reference.Combinations I[000257] Also provided herein are combinations that include a first dsRNAi agent and a second dsRNAi agent, wherein the first dsRNAi agent is selected from Tables 1-2 or SEQ ID Nos 3-794 and the second dsRNAi agent is selected from Table 3 or SEQ ID Nos 1917-1958. Also provided herein are combinations that include a first dsRNAi agent and a second dsRNAi agent, wherein the first dsRNAi agent is selected from Tables 1, 2 or 2A, or SEQ ID Nos 3-794 and 2039-2122; and the second dsRNAi agent is selected from Tables 3 or 3A or SEQ ID Nos 1917-1958 or 2123-2148. In some embodiments, the first dsRNAi agent comprises a sense strand comprising a sequence selected from SEQ ID NOs: 3-381, 761-777 and 2039-2080, and an antisense strand comprising a sequence selected from SEQ ID NOs: 382-760, 778-794 and 2081-2122; and the second dsRNAi agent comprises a sense strand comprising a sequence selected from SEQ ID NOs: 1917-1937 and 2123-2135, and an antisense strand comprising a sequence selected from SEQ ID NOs: 1938-1958 and 2136-2148.[000258] Also provided herein are combinations that include a first dsRNAi agent and a second dsRNAi agent, where the first dsRNAi agent is selected from:(a) a dsRNAi agent comprising a sense strand consisting of SEQ ID NO: 761 and an antisense strand consisting of SEQ ID NO: 778; and(b) a dsRNAi agent comprising a sense strand consisting of SEQ ID NO: 772 and an antisense strand consisting of SEQ ID NO: 789;and the second dsRNAi agent is selected from Table 3 or SEQ ID Nos 1917-1958.[000259] Also provided herein are combinations that include a first dsRNAi agent and a second dsRNAi agent, where the first dsRNAi agent is selected from:(a) a dsRNAi agent comprising a sense strand consisting of SEQ ID NO: 761 and an antisense strand consisting of SEQ ID NO: 778; and(b) a dsRNAi agent comprising a sense strand consisting of SEQ ID NO: 772 and an antisense strand consisting of SEQ ID NO: 789;PAT059933-PCT-SEC01 and the second dsRNAi agent is selected from Tables 3 or 3A or SEQ ID Nos 1917-1958, or 2123-2148.[000260] Also provided herein are combinations that include a first dsRNAi agent and a second dsRNAi agent, where the first dsRNAi agent is selected from:(a) a dsRNAi agent comprising a sense strand consisting of SEQ ID NO: 761 and an antisense strand consisting of SEQ ID NO: 778;(b) a dsRNAi agent comprising a sense strand consisting of SEQ ID NO: 772 and an antisense strand consisting of SEQ ID NO: 789;and the second dsRNAi agent comprises a sense strand comprising a sequence selected from SEQ ID NOs: 1917-1937 and 2123-2135, and an antisense strand comprising a sequence selected from SEQ ID NOs: 1938-1958 and 2136-2148.[000261] Also provided herein are combinations that include a first dsRNAi agent and a second dsRNAi agent, wherein the first dsRNAi agent is selected from Tables 1-2 or SEQ ID Nos 3-794; and the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1917 and(b) an antisense strand consisting of SEQ ID NO: 1938.[000262] Also provided herein are combinations that include a first dsRNAi agent and a second dsRNAi agent, wherein the first dsRNAi agent is selected from Tables 1, 2 or 2A, or SEQ ID Nos 3-794 and 2039-2122; and the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1917 and(b) an antisense strand consisting of SEQ ID NO: 1938.[000263] Also provided herein are combinations that include a first dsRNAi agent and a second dsRNAi agent, wherein the first dsRNAi agent comprises a sense strand comprising a sequence selected from SEQ ID NOs: 3-381, 761-777 and 2039-2080, and an antisense strand comprising a sequence selected from SEQ ID NOs: 382-760, 778-794 and 2081-2122; and the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1917 and(b) an antisense strand consisting of SEQ ID NO: 1938.[000264] Also provided herein are combinations that include a first dsRNAi agent and a second dsRNAi agent, where the first dsRNAi agent is selected from:(a) a dsRNAi agent comprising a sense strand consisting of SEQ ID NO: 761 and an antisense strand consisting of SEQ ID NO: 778; and(b) a dsRNAi agent comprising a sense strand consisting of SEQ ID NO: 772 and an antisense strand consisting of SEQ ID NO: 789;PAT059933-PCT-SEC01 and the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1917 and[000265] (b) an antisense strand consisting of SEQ ID NO: 1938. Also provided herein are combinations that include a first dsRNAi agent and a second dsRNAi agent, where the first dsRNAi agent is:a dsRNAi agent comprising a sense strand consisting of SEQ ID NO: 761 and an antisense strand consisting of SEQ ID NO: 778; andand the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1918 and(b) an antisense strand consisting of SEQ ID NO: 1939.[000266] Also provided herein are combinations that include a first dsRNAi agent and a second dsRNAi agent, where the first dsRNAi agent is:a dsRNAi agent comprising a sense strand consisting of SEQ ID NO: 761 and an antisense strand consisting of SEQ ID NO: 778; andand the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1917 and(b) an antisense strand consisting of SEQ ID NO: 1938.[000267] In some embodiments, the first dsRNAi agent is selected from:(a) a sense strand consisting of SEQ ID NO: 761 andan antisense strand consisting of SEQ ID NO: 778; and(b) a sense strand consisting of SEQ ID NO: 772 andan antisense strand consisting of SEQ ID NO: 789.[000268] In some embodiments, the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1917 and(b) an antisense strand consisting of SEQ ID NO: 1938.[000269] In some embodiments, the first dsRNAi agent is selected from:(a) a sense strand consisting of SEQ ID NO: 761 andan antisense strand consisting of SEQ ID NO: 778; and(b) a sense strand consisting of SEQ ID NO: 772 andan antisense strand consisting of SEQ ID NO: 789and the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1917 and(b) an antisense strand consisting of SEQ ID NO: 1938.PAT059933-PCT-SEC01[000270] Also provided herein are combinations that include a first dsRNAi agent and a second dsRNAi agent, where the first dsRNAi agent comprises:a sense strand consisting of SEQ ID NO: 761 andan antisense strand consisting of SEQ ID NO: 778; andand the second dsRNAi agent is selected from Tables 3 or 3A or SEQ ID Nos 1917-1958, or 2123-2148.[000271] Also provided herein are combinations that include a first dsRNAi agent and a second dsRNAi agent, where the first dsRNAi agent comprises:a sense strand consisting of SEQ ID NO: 761 andan antisense strand consisting of SEQ ID NO: 778;and the second dsRNAi agent comprises a sense strand comprising a sequence selected from SEQ ID NOs: 1917-1937 and 2123-2135, and an antisense strand comprising a sequence selected from SEQ ID NOs: 1938-1958 and 2136-2148.Modifications[000272] In one embodiment, the first dsRNAi agent comprises a modified nucleotide. In one embodiment, the second dsRNAi agent comprises a modified nucleotide. In one embodiment, the first dsRNAi agent and the second dsRNAi agent comprise a modified nucleotide.[000273] In an aspect, the disclosure provides a set of modification patterns determined or arranged by modified nucleotides in dsRNA(s) described herein. Aside from or in addition to the nucleobase sequences, various arrangements of modified nucleotides and the modification patterns thereof can be introduced, for example, to increase stability in a biological or physiological surrounding, to facilitate or promote cleavage by the RNA-induced silencing complex, and / or to mitigate or reduce off-targeting risk (e.g., to PCSK9 off-targeting risk and / or to Lp(a) off-targeting risk).[000274] In an aspect, the disclosure provides dsRNA agent(s) that are partially (e.g., greater than about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, or 45% of the total nucleotides), substantially (e.g., greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the total nucleotides), or entirely made of modified nucleotides, which can provide improved resistance to chemical and / or nuclease digestion and increased in vivo stability thereby imposing a longer in vivo half-life. Further, increasing the in vivo half-life of dsRNA(s) results in enhanced bioavailability and enhanced effectiveness in inhibiting expression or activity of a target gene (e.g., human PCSK9 and / or human Lp(a)). For example, the stability of dsRNA(s) in blood or serum may be determined, e.g., by its susceptibility to degradation by the cellular enzymes, which may be dependent on the characteristics (e.g., sequences, modification, modification pattern, or other chemical moieties) ofPAT059933-PCT-SEC01 each strand (i.e., sense strand or antisense strand) of the dsRNA. In certain aspects, the efficiency of dsRNA(s) as a therapeutic agent may be improved by increasing the in vivo stability (e.g., in blood or serum) of dsRNA(s) while maintaining the ability of the dsRNA(s) to mediate RNA interference in vivo.Modified Nucleotides[000275] The modified nucleotides as used herein contain one or more modifications, for example, the modified nucleotides contain at least one chemical modification or replacement in an internucleoside linkage (“linkage”), a nucleobase, and / or a sugar moiety of the nucleotide. Nonlimiting examples include a 2'-modification on a ribose sugar ring (e.g., 2'-deoxy, 2'-O-alkyl, 2'-halo, 2'-O-alkoxyalkyl, 2'-O-amino alkyl, etc.), 3 '-modification (e.g., substitution) in backbone phosphate group (or phosphodiester linkage), or 4'-modification on a ribose sugar ring (e.g., 4'-thio RNA). Also, other non-limiting examples of modifications may include one or more modifications selected from a deoxy modification, a 2'-O-alkyl modification, a 2'-halo modification, a 2'-5'-linkage modification, a conformationally restricting modification, an abasic modification, a 2'-amino-modification, a 2'-O-allyl modification, 2'-C-alkyl modification, a 2'-O-alkoxyalkyl modification, a morpholino modification, a modification containing a phosphoramidate group, a non-natural nucleobase modification, a modification in a tetrahydropyran, a threofuranosyl nucleotide (TNA) modification, a modification containing a 1,5-anhydrohexitol, a modification containing a cyclohexyl, a modification containing a cyclohexenyl, a modification containing a phosphorothioate group, a modification containing a methylphosphonate group, a modification containing an alkylphosphate, a modification containing a phosphonate, a modification containing an alkylphosphonate, a modification to form a thermally destabilizing nucleotide, a glycol nucleic acid (GNA) modification, a 2-O-(N-methylacetamide) modification a phosphate linkage, a phosphorothioate linkage, an inverted deoxyadenosine (3 '-3' linked nucleotide), an isomannitol residue (Imann), and an inverted abasic modification.[000276] In some embodiments, the isomannitol residue (Imann) isH6 HLwhen at the end of each strand, orPAT059933-PCT-SEC01H pA‘dHLwhen further coupling to a delivery molecule.In some embodiments, the inverted abasic modification is[000277]. For example, a modified nucleotide may include a single modification, or two or more modifications at the positions at which the chemical modification groups do not hinder or intervene each other.[000278] In some embodiments, each of the modified nucleotides is independently selected from TNA, GNA, LNA, 2'-O-alkoxyalkyl modified nucleotide, 2'-O-alkyl modified nucleotide, 2'-O-allyl modified nucleotide, 2'-C-alkyl modified nucleotide, 2'-halo modified nucleotide, and 2'-deoxy modified nucleotide (DNA). In some embodiments, each of the modified nucleotides contain independently selected from TNA modification, GNA modification, LNA modification, 2'-O-alkoxyalkyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-C-alkyl modification, 2'-halo modification, and 2'-deoxy modification (DNA). The term alkyl, alkoxyl, allyl, amino, and halo can be interpreted as described above. In some embodiments, the modified nucleotides include at least one TNAs. In some embodiments, the modified nucleotides include at least one GNAs. In some embodiments, the modified nucleotides include at least one LNAs. In some embodiments, the modified nucleotides include at least one 2'-O-alkoxyalkyl modified nucleotides. In some embodiments, the modified nucleotides include at least one 2'-O-alkyl modified nucleotides. In some embodiments, the modified nucleotides include at least one 2'-O-allyl modified nucleotides. In some embodiments, the modified nucleotides include at least one 2'-C-alkyl modified nucleotides. In some embodiments, the modified nucleotides include at least one 2'-halo (e.g., -F) modified nucleotides. In some embodiments, the modified nucleotides include at least one 2'-deoxy modified nucleotides (DNA).[000279] In some embodiments, the modified nucleotide may be a bicyclic (or bridged) nucleic acid (“BNA”) having a covalent linkage between the 2' and 4' carbons on a ribose sugar. In some embodiments, the modified nucleotide is a locked RNA (“LNA”) having covalent linkage of aPAT059933-PCT-SEC01 bicyclic sugar modification is a 4'-CH2-O-2' linkage (methylene oxy), also known as “LNA having a * ^-O-^^Basei OI OH * structure of e.g.,, or a pharmaceutically acceptable salt thereof, wherein » is an attachment point to the adjacent nucleotides.[000280] In some embodiments, a ribose ring may be replaced with a glycol moiety linked to ) BaseOphosphate and the GNA includes a moiety of, or a pharmaceutically acceptable salt A) Base°< P<°I OHthereof. In some embodiments, the GNA may have a structure ofor a pharmaceutically acceptable salt thereof. In some embodiments, the phosphodiester linkage in the GNA may be modified, e.g., with phosphorothioate group and modified GNA may have the structure of A BaseO^°I SH. or a pharmaceutically acceptable salt thereof. The GNA may further include one or more substituents replacing hydrogen(s) and such modified GNA may be encompassed by the definition of GNA herein.[000281] In some embodiments, a ribose pentofuranosyl ring may be replaced with a threofuranosyl ring linked to the phosphate and a threofuranosyl nucleotide (TNA) may include a, or a pharmaceutically acceptable salt thereof. In some embodiments, theTNA may have a structure of or a pharmaceutically acceptable salt thereof. In some embodiments, the phosphodiester linkage in the TNA may be modified, e.g., with phosphorothioatePAT059933-PCT-SEC01group and modified TNA may include a structureof or a pharmaceutically acceptable salt thereof. The TNA may further include one or more substituents at T, 3' and / or 4' positions and such modified TNA may be encompassed by the definition of TNA herein.[000282] In certain aspects, the modified nucleotide may include a heterocyclic group (e.g., 5 to 6 membered heterocycloalkyl ring) in place of a ribose ring. In some embodiments, the ribose ring may be replaced with a morpholinyl ring, e.g., to form an morpholino oligonucleotide. In some embodiments, the ribose ring may be replaced with an arabinose ring.[000283] In certain aspects, the modified nucleotides contain one or more modification groups at 2' position on the ribose ring by replacing 2'-OH. In some embodiments, the modification group may include one or more selected from hydrogen (i.e. deoxy), halogen (e.g., -F), substituted or unsubstituted alkyl (e.g., C1-C12 alkyl), substituted or unsubstituted heteroalkyl (e.g., -O-(Ci-Ci2 alkyl), -N-(Ci-Ci2 alkyl), -C(O)NH-(Ci-Ci2 alkyl), -NHC(O)-(Ci-Ci2 alkyl), and -C(O)-(Ci-Ci2 alkyl)). In some embodiments, the modification group may be hydrogen, -F, -O-alkyl (e.g., C1-C4 alkyl), or -O-alkoxyalkyl (e.g., -O-(Ci-C4 alkylene)-(Ci-C4 alkoxyl)). Any of the alkyl, heteroalkyl, alkylene in the disclosure are optionally substituted with one or more of hydroxyl (-OH), C1-C3 alkyl (e.g., methyl, or ethyl), amine (e.g., monoamine or diamine), alkoxyl (e.g., -O-CH3 (OMe) or -O-CH2CH3 (OEt)), halogen (e.g., -F) or the like.[000284] In certain aspects, the modified nucleotides may include one or more of 2'-deoxy modification, 2'-O-alkyl modification, 2'-O-subsituted alkyl modification, 2'-O-alkoxyalkyl modification, and 2'-O-aminoalkyl modification. In some embodiments, the modified nucleotides may include one or more of 2'-deoxy modification, 2'-O-alkyl modification, 2'-O-subsituted alkyl modification, 2'-O-alkoxyalkyl modification, and 2'-O-aminoalkyl modification. In some embodiments, the modified nucleotides include at least one GNAs. In some embodiments, the modified nucleotides include at least one 2'-O-alkoxyalkyl modifications. In some embodiments, the modified nucleotides include at least one 2'-O-alkyl modifications. In some embodiments, the modified nucleotides include at least one 2'-O-allyl modifications. In some embodiments, the modified nucleotides include at least one 2'-C-alkyl modifications. In some embodiments, the modified nucleotides include at least one 2'-halo (e.g., -F) modifications. In some embodiments, the modified nucleotides include at least one 2'-deoxy modifications (DNA). In some embodiments, the modified nucleotides do not include 2'-deoxy modifications (DNA).PAT059933-PCT-SEC01[000285] In certain aspects, the modified nucleotides may include one or more of 2'-deoxy nucleotide (DNA), 2'-O-methyl (2'-0Me) modification, 2'-flouro (2'-F) modification, 2'-O-methoxyethyl (2'-0-M0E or “2'-MOE”) modification, 2'-O-aminopropyl (2'-O-AP) modification, 2'-O-dimethylaminoethyl (2'-O-DMAOE) modification, 2'-O-dimethylaminopropyl (2'-O-DMAP) modification, 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE) modification, and 2'-O-N-methylacetamido (2'-0-NMA) modification. In some embodiments, the modified nucleotides may include at least one 2'-deoxy modification (DNA). In some embodiments, the modified nucleotides may include at least one 2'-O-methyl (2'-OMe) modification. In some embodiments, the modified nucleotides may include at least one 2'-flouro (2'-F) modification. In some embodiments, the modified nucleotides may include at least one 2'-O-methoxyethyl (2'-O-MOE or “2'-MOE”) modification. In some embodiments, the modified nucleotides may include at least one 2'-O-aminopropyl (2'-O-AP) modification. In some embodiments, the modified nucleotides may include at least one 2'-O-dimethylaminoethyl (2'-O-DMAOE) modification. In some embodiments, the modified nucleotides may include at least one 2'-O-dimethylaminopropyl (2'-O-DMAP) modification. In some embodiments, the modified nucleotides may include at least one 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE) modification. In some embodiments, the modified nucleotides may include at least one 2'-O-N-methylacetamido (2'-0-NMA) modification.[000286] In some embodiments, each modified nucleotide containing a modification on a 2' sugar ring may optionally contain a phosphorothioate group at 5' or 3' linkage. In some embodiments, each modified nucleotide containing a modification on a 2' sugar ring may optionally contain a modification such as an abasic modification (absence of a nucleobase) or methylated nucleobase modification at nucleobase (e.g., thymine (T) or 5 -methyl cytosine (5mC)).[000287] In certain aspects, the dsRNA agent(s) are partially (e.g., greater than about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, or 45% of the total nucleotides), substantially (e.g., greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the total nucleotides), or entirely made of modified nucleotides containing the modification on 2' sugar ring. In some embodiments, the dsRNA(s) are partially (e.g., greater than about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, or 45% of the total nucleotides) made of modified nucleotides containing the modification on 2' sugar ring. In some embodiments, the dsRNA agent(s) are substantially (e.g., greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the total nucleotides) made of modified nucleotides containing the modification on 2' sugar ring. In some embodiments, the dsRNA agent(s) include greater than about 80% of modified nucleotides containing the modification on 2' sugar ring based on the total nucleotides. In some embodiments, the dsRNA agent(s) include greater than about 85% of modified nucleotides containing the modification on 2' sugar ring based on the totalPAT059933-PCT-SEC01 nucleotides. In some embodiments, the dsRNA agent(s) include greater than about 90% of modified nucleotides containing the modification on 2' sugar ring based on the total nucleotides. In some embodiments, the dsRNA agent(s) include greater than about 95% of modified nucleotides containing the modification on 2' sugar ring based on the total nucleotides. In some embodiments, the dsRNA agent(s) are entirely made of modified nucleotides containing the modification on 2' sugar ring.[000288] In certain aspects, the modified nucleotide may include a modification in a phosphate or phosphodiester linkage, in other words, an internucleoside linkage modification (e.g., phosphorothioate, phosphorodithioate, methylphosphonate, methylene phosphonate, or vinyl phosphonate (VP) linkage). In some embodiments, the linkage modification may includeO=PXphosphorothioate (PS) having a structureof *, which may be an Rp isomer or an Sp isomer. In some embodiments, the linkage modification may include phosphorothioate (PS) having a^SHstructure of °=P'o *, which may be a stereopure Rp isomer. In some embodiments, the linkageO=PXmodification may include phosphorothioate (PS) having a structureof o _ Is, which may be a stereopure Sp isomer.[000289] For example, the modified nucleotide including 3'-PS modification can be represented aso=p — SH, or a pharmaceutically acceptable salt thereof, wherein R represents H, OH or a substituent (e.g., -F, -CH3, -OMe, or MOE) andis an attachment point to the adjacent nucleotides. In some embodiments, the 3'-PS group may be a stereopure Sp isomer. In some embodiments, the 3'-PS group may be a stereopure Rp isomer.[000290] In certain aspects, the dsRNAi agent(s) may be entirely made of modified nucleotides having one or more internucleoside linkage modification and / or modifications in the sugar moieties of the nucleotides.[000291] In certain aspects, the first nucleotide from the 5' end of each strand (e.g., sense strand and antisense strand) may include an additional phosphate group or a variant thereof (e.g.,PAT059933-PCT-SEC01 phosphorothioate, phosphorodithioate, methylphosphonate, methylene phosphonate, or vinyl phosphonate (VP)) attached or linked to the 5' terminal group of the first nucleotide.[000292] In some embodiments, the first nucleotide from the 5' end of each strand (e.g., sense strand and antisense strand) includes a 5 '-vinyl phosphonate (5'-VP) group that is a chemical moiety0=P\=ihaving the structure of*, or a pharmaceutically acceptable salt thereof, whereinrepresents the point of attachment to the 5' carbon of the pentofuranosyl sugar of a nucleotide. In some embodiments, the first nucleotide from the 5' end of each strand (e.g., sense strand and antisenseO=P\ strand) may include (E)-vinyl phosphonate (VP) having a structure of. or a pharmaceutically acceptable salt thereof, whereinrepresents the point of attachment to the 4' carbon of the pentofuranosyl sugar. In some embodiments, the first nucleotide from the 5' end of each strand (e.g., sense strand and antisense strand) may include (Z)-vinyl phosphonate having a i / °H%O=P> istructure of \= / , or a pharmaceutically acceptable salt thereof, wherein » represents the point of attachment to the 4' carbon of the pentofuranosyl sugar.[000293] In certain aspects, one or more of the modified nucleotides contain a 2' modification (e.g., 2'-0Me, 2'-F, 2'-MOE, 2'-deoxy, etc.) and an internucleoside linkage modification (e.g., phosphorothioate or (E)-vinyl phosphonate). In some embodiments, one or more of the modified nucleotides contain 2'-0Me modification and phosphorothioate group. In some embodiments, one or more of the modified nucleotides contain 2'-0Me modification and (E)-vinyl phosphonate group. In some embodiments, one or more of the modified nucleotides contain 2'-F modification and phosphorothioate group. In some embodiments, one or more of the modified nucleotides contain 2'-F and (E)-vinyl phosphonate group. In some embodiments, one or more of the modified nucleotides contain 2'-MOE modification and phosphorothioate group. In some embodiments, one or more of the modified nucleotides contain 2'-MOE modification and (E)-vinyl phosphonate group. In some embodiments, one or more of the modified nucleotides contain 2'-deoxy modification and phosphorothioate group. In some embodiments, one or more of the modified nucleotides contain 2'-OMe modification and (E)-vinyl phosphonate group. In some embodiments, one or more of the modified nucleotides are GNA containing (E)-vinyl phosphonate group. In some embodiments, one or more of the modified nucleotides are GNA containing a phosphorothioate group. In some embodiments, one or more of the modified nucleotides are TNA containing (E)-vinyl phosphonatePAT059933-PCT-SEC01 group. In some embodiments, one or more of the modified nucleotides are TNA containing a phosphorothioate group.[000294] In certain aspects, the modified nucleotides contain one or more modifications on a modified nucleobase. In some embodiments, one or more of the modified nucleotides may include thymine (“T”) nucleobase (“ribothymidine” or “5-methyluridine”) in the ribonucleotide (e.g., including 2'-OH). In some embodiments, one or more of the modified nucleotides may include methylcytosine nucleobase (e.g., 5 -methylcytidine or N4- methylcytidine). In certain aspects, one or more of the modified nucleotides may contain no nucleobase or be abasic.Sense Strand (SS)[000295] In certain aspects, a sense strand of the dsRNA agent(s) as described herein are substantially (e.g., greater than about 80%, 85%, 90%, or 95% of the total nucleotides) made of modified nucleotides. In another certain aspect, the sense strand is entirely made of modified nucleotides.[000296] In certain aspects, a sense strand of the dsRNA agent(s) as described herein includes two or more 2'-MOE modifications. In some embodiments, the sense strand includes two, four, six or eight 2'-MOE modifications. In some embodiments, the sense strand includes two 2'-MOE modifications. In some embodiments, the sense strand includes four 2'-MOE modifications. In some embodiments, the sense strand includes six 2'-MOE modifications. In some embodiments, the sense strand includes eight 2'-MOE modifications.[000297] In some embodiments, the 2'-MOE modified nucleotides in the sense strand asdescribed herein include a structure of, or a pharmaceutically acceptable salt thereof, wherein71is an attachment point to a linkage (e.g., phosphate or phosphorothioate group) or the adjacent nucleotides and “Base” is a nucleobase.[000298] In some embodiments, the 2'-MOE modified nucleotides in the sense strand asdescribed herein include a structure ofPAT059933-PCT-SEC01pharmaceutically acceptable salt thereof, wherein1is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides and “Base” is a nucleobase. In some embodiments, the 2'-MOE modified nucleotides in the sense strand as described herein include a structure ofor a pharmaceutically acceptable salt thereof.[000299] In some embodiments, the 2'-MOE modified nucleotides include a structure ofwherein71is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, the 2'-MOE modified nucleotides include a structure of, or a pharmaceutically acceptable salt thereof. In some embodiments, the 2'-MOE modified nucleotides include a structure of, or a pharmaceutically acceptable salt thereof.PAT059933-PCT-SEC01[000300] In some embodiments, the 2'-MOE modified nucleotides include a nucleotide having asalt thereof, wherein1is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, the 2'-MOE modified nucleotides include a nucleotidehaving a structure of, or a pharmaceutically acceptable salt thereof. In some embodiments, the 2'-MOE modified nucleotides include a nucleotide having a structure of, or a pharmaceutically acceptable salt thereof. In some embodiments, the 2'-MOE modified nucleotides include a nucleotide having a structure of, or a pharmaceutically acceptable salt thereof.PAT059933-PCT-SEC01[000301] In some embodiments, the 2'-MOE modified nucleotides in the sense strand asdescribed herein include a nucleotide having a structure ofNH2, or a pharmaceutically acceptable salt thereof, wherein1is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, the 2'-MOE modified nucleotides in the sense strand as described herein include aNH2nucleotide having a structure of or a pharmaceutically acceptable salt thereof.[000302] In some embodiments, the 2'-MOE modified nucleotides include a nucleotide having aacceptable salt thereof, wherein1is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, the 2'-MOE modified nucleotides include aIllPAT059933-PCT-SEC01nucleotide having a structure of, or a pharmaceutically acceptable salt thereof.[000303] In certain aspects, at least one of the 2'-MOE modified nucleotides in the sense strandas described herein has a structure of, or a pharmaceutically acceptable salt thereof, wherein1is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, at least one of the 2'-MOE modified nucleotides in the sense strand as described herein has a, or a pharmaceutically acceptable salt thereof.PAT059933-PCT-SEC01[000304] In some embodiments, the first nucleotide from the 5' end of the sense strand includes a, or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 5' end of the sense strand includes a structure of, or a pharmaceutically acceptable salt thereof.[000305] In some embodiments, the first nucleotide from the 3' end of the sense strand includes a, or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 3' end of the sense strand includes aPAT059933-PCT-SEC01acceptable salt thereof, wherein71is an attachment point to a ligand. In some embodiments, thefirst nucleotide from the 3' end of the sense strand includes a structure of a pharmaceutically acceptable salt thereof.[000306] In certain aspects, at least one of the 2'-MOE modified nucleotides in the sense strandas described herein has a structure of, or a pharmaceutically acceptable salt thereof, whereinis an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments,PAT059933-PCT-SEC01 at least one of the 2'-MOE modified nucleotides in the sense strand as described herein has a, or a pharmaceutically acceptable salt thereof.[000307] In some embodiments, the first nucleotide from the 5' end of the sense strand includes a, or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 5' end of the sense strand includes astructure of, or a pharmaceutically acceptable salt thereof.[000308] In some embodiments, the first nucleotide from the 3' end of the sense strand includes a, or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 3' end of the sense strand includes aPAT059933-PCT-SEC01acceptable salt thereof, whereinis an attachment point to a ligand. In some embodiments, thefirst nucleotide from the 3' end of the sense strand includes a structureof, or a pharmaceutically acceptable salt thereof.[000309] In certain aspects, at least one of the 2'-MOE modified nucleotides in the sense strandas described herein has a structure ofor a pharmaceutically acceptable salt thereof, wherein is anPAT059933-PCT-SEC01 attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, at least one of the 2'-MOE modified nucleotides in the sense strand as describedherein has a structureof or a pharmaceutically acceptable salt thereof.[000310] In some embodiments, the first nucleotide from the 5' end of the sense strand includes aor a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 5' end of the sense strand includes, or a pharmaceutically acceptable salt thereof.[000311] In some embodiments, the first nucleotide from the 3' end of the sense strand has astructure oof OH, OH, or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 3' end of the sensePAT059933-PCT-SEC01, or a pharmaceutically acceptable salt thereof, whereinis an attachment point to a ligand. In some embodiments, the first nucleotide from the 3' end of the senseOH O^Qstrand has a structureof I or a pharmaceutically acceptable salt thereof.[000312] In certain aspects, at least one of the 2'-MOE modified nucleotides in the sense strandas described herein has a structureofPAT059933-PCT-SEC01 oor a pharmaceutically acceptable salt thereof, wherein71is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, at least one of the 2'-MOE modified nucleotides in thesense strand as described herein has a structureof pharmaceutically acceptable salt thereof.[000313] In some embodiments, the first nucleotide from the 5' end of the sense strand includes aacceptable salt thereof. In some embodiments, the first nucleotide from the 5' end of the sensestrand includes a structure of, or a pharmaceutically acceptable salt thereof.PAT059933-PCT-SEC01[000314] In some embodiments, the first nucleotide from the 3' end of the sense strand has apharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 3' end of the sense strand has a structure ofor a pharmaceutically acceptable salt thereof, wherein71is an attachment point to a ligand. In some embodiments, the first nucleotide from the 3' end of the sense strand has a structure ofor a pharmaceutically acceptable salt thereof.[000315] In certain aspects, the 2'-MOE modified nucleotides locate at both 5' and 3' ends of a sense strand so as to form a structural confinement (“2'-MOE clamp”) at the sense strand termini. In some embodiments, the 2'-MOE clamps may be symmetric and having the same number of 2'-MOE modified nucleotides at both 5' and 3' ends of the sense strand. For example, the sense strand includes one 2'-MOE modified nucleotide at 5' end and one 2'-MOE modified nucleotide at 3' end;PAT059933-PCT-SEC01 two 2'-MOE modified nucleotides at 5' end and two 2'-MOE modified nucleotides at 3' end; or three 2'-MOE modified nucleotides at 5' end and three 2'-MOE modified nucleotides at 3' end. In some embodiments, the 2'-MOE clamps may be asymmetric and having different numbers of 2'-MOE nucleotides at 5' and 3' ends of the sense strand. For example, the sense strand includes one 2'-MOE modified nucleotide at 5' end only; one 2'-MOE modified nucleotide at 3' end only; two 2'-MOE modified nucleotides at 5' end only; two 2'-MOE modified nucleotides at 3' end only; one 2'-MOE modified nucleotide at 5' end and two 2'-MOE modified nucleotides at 3' end; or two 2'-MOE modified nucleotides at 5' end and one 2'-MOE modified nucleotide at 3' end.[000316] In certain aspects, the sense strand includes one 2'-MOE modified nucleotide at 5' end and one 2'-MOE modified nucleotide at 3' end. In some embodiments, the sense strand includes only one 2'-MOE modified nucleotide at 5' end and only one 2'-MOE modified nucleotide at 3' end. In some embodiments, the sense strand includes only one 2'-MOE modified nucleotide at 5' end. In some embodiments, the sense strand includes only one 2'-MOE modified nucleotide at 3' end.[000317] In certain aspects, the sense strand includes at least two contiguous 2'-MOE modified nucleotides at 5' end and at least two 2'-MOE modified nucleotides at 3' end. In some embodiments, the sense strand includes only two 2'-MOE modified nucleotides at 5' end and only two 2'-MOE modified nucleotides at 3' end. In some embodiments, the sense strand includes only two 2'-MOE modified nucleotides at 5' end. In some embodiments, the sense strand includes only two 2'-MOE modified nucleotides at 3' end.[000318] Alternatively, in certain aspects, a sense strand of the dsRNA agent(s) as described herein includes two or more TNAs. In some embodiments, the sense strand includes two, four, six or eight TNAs. In some embodiments, the sense strand includes two TNAs. In some embodiments, the sense strand includes four TNAs. In some embodiments, the sense strand includes six TNAs. In some embodiments, the sense strand includes eight TNAs.[000319] In certain aspects, the sense strand includes at least two contiguous TNAs at 5' end and at least two TNAs at 3' end. In some embodiments, the sense strand includes only two TNAs at 5' end and only two TNAs at 3' end. In some embodiments, the sense strand includes only two TNAs at 5' end. In some embodiments, the sense strand includes only two TNAs at 3' end.[000320] In some embodiments, the TNAs in the sense strand as described herein include a° n BaseOstructureof, or a pharmaceutically acceptable salt thereof, wherein is anPAT059933-PCT-SEC01 attachment point to a linkage (e.g., phosphate or phosphorothioate group) or the adjacent nucleotides and “Base” is a nucleobase.[000321] In some embodiments, the TNAs in the sense strand as described herein include astructure of or a pharmaceutically acceptable salt thereof, wherein is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides and “Base” is a nucleobase. In some embodiments, the TNAs in the dsRNA agent(s) asdescribed herein include a structureof or a pharmaceutically acceptable salt thereof.[000322] In some embodiments, the TNAs include a structure ofO=P-OH O=p— SH, or a pharmaceutically acceptable salt thereof, wherein is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. InPAT059933-PCT-SEC01some embodiments, the TNAs include a structure of acceptable salt thereof.[000323] In some embodiments, the TNAs include a nucleotide having a structure ofoo=p— SHior a pharmaceutically acceptable salt thereof, wherein1is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, the TNAs include a nucleotide having astructure of, or a pharmaceutically acceptable salt thereof.[000324] In some embodiments, the TNAs in the dsRNA agent(s) as described herein include anucleotide having a structure of, or a pharmaceutically acceptable salt thereof, wherein71is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In somePAT059933-PCT-SEC01 embodiments, the TNAs in the dsRNA agent(s) as described herein include a nucleotide having astructure of, or a pharmaceutically acceptable salt thereof.[000325] In some embodiments, the TNAs include a nucleotide having a structure ofacceptable salt thereof, wherein71is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, the TNAs include a nucleotide having astructure of, or a pharmaceutically acceptable salt thereof.[000326] In certain aspects, at least one of the TNAs in the sense strand as described herein has aacceptable salt thereof, wherein71is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, at least one of the TNAs in the sense strand asPAT059933-PCT-SEC01described herein has a structure of, or a pharmaceutically acceptable salt thereof.[000327] In some embodiments, the first nucleotide from the 5' end of the sense strand includes a, or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 5' end of the sense strand includes a structure of, or a pharmaceutically acceptable salt thereof.[000328] In some embodiments, the first nucleotide from the 3' end of the sense strand includes aor a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 3' end of the sense strand includes a structure ofPAT059933-PCT-SEC01, or a pharmaceutically acceptable salt thereof and71is an attachment point to a ligand. In some embodiments, the first nucleotide from the 3' end of thesense strand includes a structure of, or a pharmaceutically acceptable salt thereof.[000329] In certain aspects, at least one of the TNAs in the sense strand as described herein has apharmaceutically acceptable salt thereof, wherein71is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, at least one of the TNAs inthe sense strand as described herein has a structure of acceptable salt thereof.PAT059933-PCT-SEC01[000330] In some embodiments, the first nucleotide from the 5' end of the sense strand includes a, or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 5' end of the sense strand includes astructure of, or a pharmaceutically acceptable salt thereof.[000331] In some embodiments, the first nucleotide from the 3' end of the sense strand includes a, or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 3' end of the sense strand includes aacceptable salt thereof and71is an attachment point to a ligand. In some embodiments, the firstPAT059933-PCT-SEC01nucleotide from the 3' end of the sense strand includes a structure of OH or a pharmaceutically acceptable salt thereof.[000332] In certain aspects, at least one of the TNAs in the sense strand as described herein has apharmaceutically acceptable salt thereof, wherein1is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, at least one of the TNAs inthe sense strand as described herein has a structureof or a pharmaceutically acceptable salt thereof.[000333] In some embodiments, the first nucleotide from the 5' end of the sense strand includes a, or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 5' end of the sense strand includes astructure of, or a pharmaceutically acceptable salt thereof.PAT059933-PCT-SEC01[000334] In some embodiments, the first nucleotide from the 3' end of the sense strand includes astructure of OH?OH, or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 3' end of the sense strand includes aacceptable salt thereof and71is an attachment point to a ligand. In some embodiments, the firstnucleotide from the 3' end of the sense strand includes a structure of OH, ora pharmaceutically acceptable salt thereof.[000335] In certain aspects, at least one of the TNAs in the sense strand as described herein has astructure ofPAT059933-PCT-SEC01 or a pharmaceutically acceptable salt thereof, wherein1is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, at least one of the TNAs inNH2the sense strand as described herein has a structureof or a pharmaceutically acceptable salt thereof.[000336] In some embodiments, the first nucleotide from the 5' end of the sense strand includes astructure of or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 5' end of the senseo=p— SHstrand includes a structure of, or a pharmaceutically acceptable salt thereof.[000337] In some embodiments, the first nucleotide from the 3' end of the sense strand includes astructure of OH?OH, or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 3' end of the sensePAT059933-PCT-SEC01strand includes a structure ofNH2, or a pharmaceutically acceptable salt thereof and1is an attachment point to a ligand. In some embodiments, the first nucleotide from the 3' end of the sense strandincludes a structure of, or a pharmaceutically acceptable salt thereof.[000338] In certain aspects, the TNAs locate at both 5' and 3' ends of a sense strand so as to form a structural confinement (“TNA clamp”) at the sense strand termini. In some embodiments, the TNA clamps may be symmetric and having the same number of TNAs at both 5' and 3' ends of the sense strand. For example, the sense strand includes one TNA at 5' end and one TNA at 3' end; two TNAs at 5' end and two TNAs at 3' end; or three TNAs at 5' end and three TNAs at 3' end. In some embodiments, the TNA clamps may be asymmetric and having different numbers of TNAs at 5' and 3' ends of the sense strand. For example, the sense strand includes one TNA at 5' end only; one TNA at 3' end only; two TNAs at 5' end only; two TNAs at 3' end only; one TNA at 5' end and two TNAs at 3' end; ortwo TNAs at 5' end and one TNA at 3' end.[000339] In certain aspects, the sense strand includes one TNA at 5' end and one TNA at 3' end. In some embodiments, the sense strand includes only one TNA at 5' end and only one TNA at 3'PAT059933-PCT-SEC01 end. In some embodiments, the sense strand includes only one TNA at 5' end. In some embodiments, the sense strand includes only one TNA at 3' end.[000340] In certain aspects, the sense strand includes at least two contiguous TNAs at 5' end and at least two TNAs at 3' end. In some embodiments, the sense strand includes only two TNAs at 5' end and only two TNAs at 3' end. In some embodiments, the sense strand includes only two TNAs at 5' end. In some embodiments, the sense strand includes only two TNAs at 3' end.[000341] In certain aspects, the sense strand of the dsRNA agent(s) as described herein includes two or more 2'-F modifications. In some embodiments, the sense strand of the dsRNA agent(s) includes two, three, four, five, six, seven, or eight 2'-F modified nucleotides. In some embodiments, the sense strand includes two 2'-F modified nucleotides. In some embodiments, the sense strand includes three 2'-F modified nucleotides. In some embodiments, the sense strand includes four 2'-F modified nucleotides. In some embodiments, the sense strand includes five 2'-F modified nucleotides. In some embodiments, the sense strand includes six 2'-F modified nucleotides. In some embodiments, the sense strand includes seven 2'-F modified nucleotides. In some embodiments, the sense strand includes eight 2'-F modified nucleotides. In some embodiments, two contiguous 2'-F modified nucleotides locate in the sense strand. In some embodiments, three contiguous 2'-F modified nucleotides locate in the sense strand. In some embodiments, four contiguous 2'-F modified nucleotides locate in the sense...

Claims

PAT059933-PCT-SEC01 WHAT IS CLAIMED:

1. A combination comprising a first antisense agent and a second antisense agent, wherein:(a) the first antisense agent is a proprotein convertase subtilisin kexin 9 (PCSK9) inhibitor; and(b) the second antisense agent is a lipoprotein (a) (Lp(a)) inhibitor.

2. The combination of claim 1, wherein the first antisense agent is a double stranded RNAi (dsRNAi) agent.

3. The combination of claim 1 or claim 2, wherein the second antisense agent is a dsRNAi agent.

4. The combination of any one of claims 1 to 3, comprising a first double stranded RNAi (dsRNAi) agent and a second dsRNAi agent, wherein:(a) the first dsRNAi agent is a PCSK9 inhibitor; and(b) the second dsRNAi agent is an Lp(a) inhibitor.

5. The combination of any one of claims 2 to 4, wherein the first dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 761 andan antisense strand consisting of SEQ ID NO: 778.

6. The combination of any one of claims 2 to 5, wherein the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1917 and(b) an antisense strand consisting of SEQ ID NO: 1938.

7. The combination of any one of claims 2 to 5, wherein the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1918 and(b) an antisense strand consisting of SEQ ID NO: 1939.

8. The combination of any one of claims 2 to 6, wherein the first dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 761 andan antisense strand consisting of SEQ ID NO: 778.and the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1917 andPAT059933-PCT-SEC01 (b) an antisense strand consisting of SEQ ID NO: 1938.

9. The combination of any one of claims 2 to 5, wherein the first dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 761 andan antisense strand consisting of SEQ ID NO: 778,and the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1918 andan antisense strand consisting of SEQ ID NO: 1939.

10. The combination of any one of claims 2 to 9, wherein one or more nucleotides in the sense strand and the antisense strand of the first dsRNAi agent are modified nucleotides.

11. The combination of any one of claims 3 to 10, wherein one or more nucleotides in the sense strand and the antisense strand of the second dsRNAi agent are modified nucleotides.

12. The combination of claim 10 or claim 11, wherein each of the one or more modified nucleotides independently comprises one or more modifications selected from a 2’-deoxy modification, a 2’-O-alkyl modification, a 2'-halo modification, a threofuranosyl nucleotide (TNA) modification, a 2’-5 ’-linkage modification, a conformationally restricting modification, an abasic modification, a 2’- amino-modification, a 2’-O-allyl modification, 2’-C-alkyl modification, a 2’-O-alkoxyalkyl modification, a morpholino modification, a phosphoramidate modification, a non-natural nucleobase modification, a modification in a tetrahydropyran, a modification containing a 1,5-anhydrohexitol, a modification containing a cyclohexenyl, a modification containing a phosphorothioate group, a modification containing a 5’ -vinyl - phosphonate, a modification containing a 5 ’-phosphate, a modification to form a thermally destabilizing nucleotide, a glycol nucleic acid (GNA) modification, a 2-O-(N-methylacetamide) modification, a phosphate linkage, a phosphorothioate linkage, an inverted deoxyadenosine (3'- 3' linked nucleotide), an isomannitol residue (Imann) for exampleorand an inverted abasic modification, for examplePAT059933-PCT-SEC01 / VW*0413. The combination of claim 12, wherein each of the one or more modified nucleotides independently comprises one or more modifications selected from 2 ’-deoxy modification, 2'-O-alkoxyalkyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-C-alkyl modification, 2'-halo modification, modification containing a non-natural nucleobase, a GNA modification, and a TNA modification.

14. The combination of any one of claims 10 to 13, wherein the first and / or second dsRNAi agent comprises a 3’-phosphorothioate (PS) modification.

15. The combination of any one of claims 10 to 14, wherein each of the one or more modified nucleotides independently comprises one or more modifications selected from 2’-deoxy modification, 2’-O-methyl (2’-OMe) modification, 2 ’-fluoro (2’-F) modification, 2’-O-methoxyethyl (2 ’-MOE) modification, a modification containing a non-natural nucleobase, TNA, GNA, 3’-phosphorothioate (PS) modification, and 5 ’-vinyl -phosphonate (5 ’-VP) modification.

16. The combination of any one of claims 1 to 15, wherein the first dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 795 and(b) an antisense strand consisting of SEQ ID NO: 848.

17. The combination of any one of claims 1 to 16, wherein the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1959 and(b) an antisense strand consisting of SEQ ID NO: 1968.

18. The combination of any one of claims 1 to 16, wherein the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1962 and(b) an antisense strand consisting of SEQ ID NO: 1971.

19. The combination of any one of claims 1 to 17, wherein the first dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 795 andPAT059933-PCT-SEC01 (b) an antisense strand consisting of SEQ ID NO: 848.and the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1959 andan antisense strand consisting of SEQ ID NO: 1968.

20. The combination of any one of claims 1 to 16, wherein the first dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 795 and(b) an antisense strand consisting of SEQ ID NO: 848.and the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1962 and(b) an antisense strand consisting of SEQ ID NO: 1971.

21. The combination of any one of claims 1 to 20, wherein the first dsRNAi agent further comprises a ligand.

22. The combination of any one of claims 1 to 21, wherein the second dsRNAi agent further comprises a ligand.

23. The combination of claim 21 or claim 22, wherein the ligand comprises a N-acetylgalactosamine (GalNAc) moiety.

24. The combination of any one of claims 21 to 23, wherein the ligand has a structure of:or a pharmaceutically acceptable salt thereof, wherein:each L1is independently a linker which may be same or different in each occurrence;L2is a linker;n is an integer from 1 to 3; andis an attachment point to the sense strand or the antisense strand, or to a conjugate linker conjugated to the sense strand or the antisense strand.

25. The combination of claim 24, wherein the ligand comprises the following structure ofPAT059933-PCT-SEC01or a pharmaceutically acceptable salt thereof, wherein:each pl, p2, p3, ql, q2, rl, r2 and r3 is independently an integer from 0 to 12;each nl, n2, and n3 is independently an integer from 1 to 3; and“*” is an attachment point to L2.

26. The combination of any one of claims 21 to 23, wherein the ligand has a structure of:NHAcor a pharmaceutically acceptable salt thereof, wherein:each L11, L12, L13, L14, and L15is an independently a linker;L2is a linker;PAT059933-PCT-SEC01 is an attachment point to the sense strand or the antisense strand, or to a conjugate linker conjugated to the sense strand or the antisense strand.

27. The combination of claim 26, wherein the ligand has a structure of:or a pharmaceutically acceptable salt thereof, wherein:each p11 and q11 is independently an integer from 0 to 12;each zl, z2, and z3 is independently an integer of 0 to 12; andis an attachment point to the sense strand or the antisense strand, or to a conjugate linker conjugated to the sense strand or the antisense strand.

28. The combination of any one of claims 21 to 27, wherein the ligand comprises the following structure:PAT059933-PCT-SEC01or a pharmaceutically acceptable salt thereof, whereinis an attachment point to the sense strand or the antisense strand or to a conjugate linker conjugated to the sense strand or the antisense strand.

29. The combination of claim 28, wherein the ligand is conjugated to 3’ end of the sense strand to form the following structure:PAT059933-PCT-SEC01OHor a pharmaceutically acceptable salt thereof, wherein W is -OH or -SH.

30. The combination of claim 28, wherein the ligand is conjugated to 5’ end of the sense strand to form the following structure:OHor a pharmaceutically acceptable salt thereof wherein W is -OH or -SH.

31. The combination of claim 29 or claim 30, wherein W is -OH.PAT059933-PCT-SEC01 32. The combination of any one of claims 1 to 31, wherein the first dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 795, and(b) an antisense strand consisting of SEQ ID NO: 848;wherein the ligand (L96) is conjugated to the 3’ end of the sense strand to form the following schematic:OHor a pharmaceutically acceptable salt thereof, wherein W is -OH.

33. The combination of any one of claims 1 to 32, wherein the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1977 and(b) an antisense strand consisting of SEQ ID NO: 2006.

34. The combination of any one of claims 1 to 32, wherein the second dsRNAi agent comprises: (a) a sense strand consisting of SEQ ID NO: 1980 and(b) an antisense strand consisting of SEQ ID NO: 2009.

35. The combination of any one of claims 1 to 34, wherein the first dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 795, and(b) an antisense strand consisting of SEQ ID NO: 848;wherein the ligand (L96) is conjugated to the 3’ end of the sense strand to form the following schematic:PAT059933-PCT-SEC01OHor a pharmaceutically acceptable salt thereof, wherein W is -OH;and the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1977 and(b) an antisense strand consisting of SEQ ID NO: 2006.

36. The combination of any one of claims 1 to 32, wherein the first dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 795, and(b) an antisense strand consisting of SEQ ID NO: 848;wherein the ligand (L96) is conjugated to the 3’ end of the sense strand to form the following schematic:PAT059933-PCT-SEC01OHor a pharmaceutically acceptable salt thereof, wherein W is -OH;and the second dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 1980 and(b) an antisense strand consisting of SEQ ID NO: 2009.

37. The combination of claim 1 or claim 2, wherein the second antisense agent is an antisense oligonucleotide (ASO) agent.

38. The combination of claim 37, comprising a double stranded RNAi (dsRNAi) agent and an antisense oligonucleotide, wherein:(a) the dsRNAi agent is a PCSK9 inhibitor; and(b) the antisense oligonucleotide agent is an Lp(a) inhibitor.

39. The combination of any one of claims 37 to 38, wherein the dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 761 and(b) an antisense strand consisting of SEQ ID NO: 778.

40. The combination of any one of claims 37 to 39, wherein the ASO agent comprises SEQ ID NO: 2035.

41. The combination of any one of claims 37 to 40, wherein the dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 761 andPAT059933-PCT-SEC01 (b) an antisense strand consisting of SEQ ID NO: 778;and the ASO agent comprises SEQ ID NO: 2035.

42. The combination of any one of claims 37 to 41, wherein one or more nucleotides in the sense strand and the antisense strand of the dsRNAi agent and / or the ASO agent are modified nucleotides.

43. The combination of claim 42, wherein each of the one or more modified nucleotides independently comprises one or more modifications selected from a 2 ’-deoxy modification, a 2’-O-alkyl modification, a 2'-halo modification, a threofuranosyl nucleotide (TNA) modification, a 2’-5 ’-linkage modification, a conformationally restricting modification, an abasic modification, a 2’- amino-modification, a 2’-O-allyl modification, 2’-C-alkyl modification, a 2’-O-alkoxyalkyl modification, a morpholino modification, a phosphoramidate modification, a non-natural nucleobase modification, a modification in a tetrahydropyran, a modification containing a 1,5-anhydrohexitol, a modification containing a cyclohexenyl, a modification containing a phosphorothioate group, a modification containing a 5 ’-vinyl - phosphonate, a modification containing a 5 ’-phosphate, a modification to form a thermally destabilizing nucleotide, a glycol nucleic acid (GNA) modification, a 2-O-(N-methylacetamide) modification, a phosphate linkage, a phosphorothioate linkage, an inverted deoxyadenosine (3'- 3' linked nucleotide), an isomannitol residue (Imann) for exampleand an inverted abasic modification, for example44. The combination of claim 43, wherein each of the one or more modified nucleotides independently comprises one or more modifications selected from 2 ’-deoxy modification, 2'-O-alkoxyalkyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-C-alkyl modification,PAT059933-PCT-SEC01 2'-halo modification, modification containing a non-natural nucleobase, a GNA modification, and a TNA modification.

45. The combination of any one of claims 42 to 44, wherein the dsRNAi agent and / or the ASO agent comprises a 3’-phosphorothioate (PS) modification.

46. The combination of any one of claims 42 to 44, wherein each of the one or more modified nucleotides independently comprises one or more modifications selected from 2’-deoxy modification, 2’-O-methyl (2’-0Me) modification, 2 ’-fluoro (2’-F) modification, 2’-O-methoxyethyl (2 ’-MOE) modification, a modification containing a non-natural nucleobase, TNA, GNA, 3’-phosphorothioate (PS) modification, and 5 ’-vinyl -phosphonate (5 ’-VP) modification.

47. The combination of any one of claims 37 to 46, wherein the dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 795 and(b) an antisense strand consisting of SEQ ID NO: 848.

48. The combination of any one of claims 37 to 47, wherein the ASO agent comprisesSEQ ID NO: 2036.

49. The combination of any one of claims 37 to 48, wherein the dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 795 and(b) an antisense strand consisting of SEQ ID NO: 848;and the ASO agent comprises SEQ ID NO: 2036.

50. The combination of any one of claims 37 to 49, wherein the dsRNAi agent further comprises a ligand.

51. The combination of any one of claims 37 to 50, wherein the ASO agent further comprises a ligand.

52. The combination of claim 50 or claim 51, wherein the ligand comprises a N-acetylgalactosamine (GalNAc) moiety.

53. The combination of any one of claims 50 to 52, wherein the ligand has a structure of:PAT059933-PCT-SEC01or a pharmaceutically acceptable salt thereof, wherein:each L1is independently a linker which may be same or different in each occurrence;L2is a linker;n is an integer from 1 to 3; andis an attachment point to the sense strand or the antisense strand, or to a conjugate linker conjugated to the sense strand or the antisense strand.

54. The combination of claim 53, wherein the ligand comprises the following structure ofor a pharmaceutically acceptable salt thereof, wherein:each pl, p2, p3, ql, q2, rl, r2 and r3 is independently an integer from 0 to 12;each nl, n2, and n3 is independently an integer from 1 to 3; and“*” is an attachment point to L2.PAT059933-PCT-SEC01 55. The combination of any one of claims 50 to 52, wherein the ligand has a structure of:NHAcor a pharmaceutically acceptable salt thereof, wherein:each L11, L12, L13, L14, and L15is an independently a linker;L2is a linker;is an attachment point to the sense strand or the antisense strand, or to a conjugate linker conjugated to the sense strand or the antisense strand.

56. The combination of claim 55, wherein the ligand has a structure of:PAT059933-PCT-SEC01or a pharmaceutically acceptable salt thereof, wherein:each p11 and q11 is independently an integer from 0 to 12;each zl, z2, and z3 is independently an integer of 0 to 12; andis an attachment point to the sense strand or the antisense strand, or to a conjugate linker conjugated to the sense strand or the antisense strand.

57. The combination of any one of claims 50 to 56, wherein the ligand comprises the following structure:PAT059933-PCT-SEC01or a pharmaceutically acceptable salt thereof, whereinis an attachment point to the sense strand or the antisense strand or to a conjugate linker conjugated to the sense strand or the antisense strand.

58. The combination of claim 57, wherein the ligand is conjugated to 3’ end of the sense strand to form the following structure:PAT059933-PCT-SEC01OHor a pharmaceutically acceptable salt thereof, wherein W is -OH or -SH.

59. The combination of claim 57, wherein the ligand is conjugated to 5’ end of the sense strand to form the following structure:OHor a pharmaceutically acceptable salt thereof wherein W is -OH or -SH.

60. The combination of claim 58 or claim 59, wherein W is -OH.PAT059933-PCT-SEC01 61. The combination of any one of claims 1 to 60, wherein the dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 795, and(b) an antisense strand consisting of SEQ ID NO: 848;wherein the ligand (L96) is conjugated to the 3’ end of the sense strand to form the following schematic:OHor a pharmaceutically acceptable salt thereof, wherein W is -OH.

62. The combination of any one of claims 37 to 61, wherein the ASO agent comprisesSEQ ID NO: 2037.

63. The combination of any one of claims 1 to 62, wherein the dsRNAi agent comprises:(a) a sense strand consisting of SEQ ID NO: 795, and(b) an antisense strand consisting of SEQ ID NO: 848;wherein the ligand (L96) is conjugated to the 3’ end of the sense strand to form the following schematic:PAT059933-PCT-SEC01OHor a pharmaceutically acceptable salt thereof, wherein W is -OH;and the ASO agent comprises SEQ ID NO: 2037.

64. The combination of any one of claims 1 to 63, wherein the first antisense agent (e.g., first dsRNAi agent) is in a pharmaceutically acceptable salt form.

65. The combination of any one of claims 1 to 64, wherein the second antisense agent (e.g., second dsRNAi agent) is in a pharmaceutically acceptable salt form.

66. The combination of claim 64 or claim 65, wherein the pharmaceutically acceptable salt is a sodium salt.

67. The combination of any one of claims 1 to 66, wherein the first antisense agent (e.g., first dsRNAi agent) and the second antisense agent (e.g., second dsRNAi agent) are provided as a mixture.

68. The combination of any one of claims 1 to 67, wherein the first antisense agent (e.g., first dsRNAi agent) and the second antisense agent (e.g., second dsRNAi agent) are formulated separately.

69. A pharmaceutical composition comprising the combination of any one of claims 1 to 68, and a pharmaceutically acceptable carrier.PAT059933-PCT-SEC01 70. The pharmaceutical composition of claim 69, wherein the pharmaceutical composition is in an aqueous solution form.

71. A method of inhibiting PCSK9 and / or Lp(a) expression in a cell, the method comprising:(a) contacting the cell with the combination of any one of claims 1 to 68, or the pharmaceutical composition of any one of claim 69 or claim 70; and(b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of a PCSK9 gene and / or an Lp(a) gene, thereby inhibiting expression of the PCSK9 gene and / or the Lp(a)gene in the cell.

72. A method of lowering a level of low-density lipoprotein cholesterol (LDL-C) in a subject in need thereof, comprising administering to the subject the combination of any one of claims 1 to 68, or the pharmaceutical composition of claim 69 or claim 70.

73. A method of treating lipidemia mediated by PCSK9 and / or Lp(a) expression in a subject in need thereof, comprising administering to the subject the combination of any one of claims 1 to 68, or the pharmaceutical composition of claim 69 or claim 70.

74. A method of treating or preventing atherosclerotic cardiovascular disease (ASCVD) in a subject in need thereof, comprising administering to the subject the combination of any one of claims 1 to 68, or the pharmaceutical composition of claim 69 or claim 70.

75. A method of reducing or preventing cardiovascular event in a subject in need thereof, comprising administering to the subject the combination of any one of claims 1 to 68, or the pharmaceutical composition of any one of claim 69 or claim 70.

76. The method of claim 75, wherein the cardiovascular event is cardiovascular death, non-fatal myocardial infarction (MI), non-fatal ischemic stroke, urgent coronary revascularization, coronary heart disease (CHD) death, or any combination thereof.

77. A method of reducing or preventing a major limb adverse event (MALE) in a subject in need thereof, comprising administering to the subject the combination of any one of claims 1 to 68, or the pharmaceutical composition of claim 69 or claim 70.PAT059933-PCT-SEC01 78. The method of claim 77, wherein the MALE is acute lower limb ischemia, lower limb amputation due to ischemia, urgent lower limb revascularization for ischemia, or any combination thereof.

79. A method of treating an Lp(a)-associated disease in a subject in need thereof, comprising administering to the subject the combination of any one of claims 1 to 68, or the pharmaceutical composition of claim 69 or claim 70.

80. The method of claim 79, wherein the Lp(a)-associated disease is selected from the group consisting of inflammatory, cardiovascular and / or metabolic diseases, disorders, and conditions.

81. The method of claim 80, wherein the cardiovascular diseases, disorders or conditions include, for example, elevated Lp(a) associated CVD risk, recurrent cardiovascular events with elevated Lp(a), aortic stenosis (e.g., calcific aortic valve stenosis associated with high Lp(a)), aneurysm (e.g., abdominal aortic aneurysm), angina, arrhythmia, atherosclerosis, cerebrovascular disease, coronary artery disease, coronary heart disease, dyslipidemia, hypercholesterolemia, hyperlipidemia, hypertension, hypertriglyceridemia, myocardial infarction, peripheral vascular disease (e.g., peripheral artery disease, peripheral artery occlusive disease), retinal vascular occlusion, or stroke.

82. The method of claim 80, wherein the metabolic diseases, disorders or conditions include, for example, hyperglycemia, prediabetes, diabetes (type I and type II), obesity, insulin resistance, metabolic syndrome and diabetic dyslipidemia.

83. The method of claim 80, wherein the inflammatory diseases, disorders or conditions include, for example, aortic stenosis, coronary artery disease (CAD), Alzheimer's Disease and thromboembolic diseases, disorder or conditions.

84. The method of claim 83, wherein the thromboembolic diseases, disorders or conditions include, for example, stroke, thrombosis (e.g., venous thromboembolism), myocardial infarction and peripheral vascular disease. Certain embodiments provide compositions and methods for preventing, treating, delaying, slowing the progression and / or ameliorating aortic stenosis.

85. The method of any one of claims 71 to 84, wherein the first antisense agent (e.g., first dsRNAi agent) and the second antisense agent (e.g., second dsRNAi agent) are administered to the subject concurrently.PAT059933-PCT-SEC0186. The method of any one of claims 71 to 84, wherein the first antisense agent (e.g. first dsRNAi agent) and the second antisense agent (e.g., second dsRNAi agent) are administered to the subject sequentially.

87. The method of any one of claims 71 to 86, wherein the first antisense agent (e.g., first dsRNAi agent) and the second antisense agent (e.g. second dsRNAi agent) are administered to the subject subcutaneously or intravenously.

88. The method of any one of claims 71 to 87, wherein the subject is a human.

89. The method of any one of claims 71 to 88, wherein the subject has or is diagnosed with hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, mixed hyperlipidemia, congestive heart disease (CHD) or atherosclerosis.

90. A kit comprising a first antisense agent (e.g., first dsRNAi agent) and a second antisense agent (e.g., second dsRNAi agent) as defined in any one of claims 1 to 68, or the pharmaceutical composition of any one of claims 69 or 70.

91. The kit of claim 90, wherein the first antisense agent (e.g., first dsRNAi agent) and the second antisense agent (e.g., second dsRNAi agent) are contained in a single vial.

92. The kit of claim 90, wherein the first antisense agent (e.g., first dsRNAi agent) and the second antisense agent (e.g., second dsRNAi) agent are contained in separate vials.

92. The kit of any one of claims 90 to 92, further comprising one or more applicators.

93. The kit of claim 92, wherein the one or more applicators are syringes.

94. The kit of claim 93, wherein the one or more applicators are pre-filled syringes.

Images