Compositions for immunostimulatory small RNA structures and methods of use thereof

WO2026136368A1PCT designated stage Publication Date: 2026-06-25WASHINGTON UNIV IN SAINT LOUIS

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
WASHINGTON UNIV IN SAINT LOUIS
Filing Date
2025-12-16
Publication Date
2026-06-25

AI Technical Summary

Technical Problem

Existing immunostimulatory molecules based on RIG-I activation do not effectively utilize naturally occurring RNA motifs during viral infections, limiting the induction of robust type I interferon responses.

Method used

Development of immunostimulatory compositions comprising copy-back viral genomes (cbVG) with specific RNA stem loops and lipid nanoparticles, which activate RIG-I signaling to induce expression of proteins like IFNB1, MX1, and CXCL10.

Benefits of technology

Enhances the immune response by stimulating a robust type I interferon response, promoting cellular immunity and antibody development, and improving the efficacy of mRNA vaccines.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025059856_25062026_PF_FP_ABST
    Figure US2025059856_25062026_PF_FP_ABST
Patent Text Reader

Abstract

Immunostimulatory molecules and methods of use thereof are provided. Compositions include at least one immunostimulatory RNA molecule having a stem loop containing one or more AAAA adenine rich regions and / or one or more CAA motif regions. Methods include administering said compositions to a subject in need thereof for treating viral infection and / or increasing IFN expression.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Docket No.: 020846 / WO

[0002] COMPOSITIONS FOR IMMUNOSTIMULATORY SMALL RNA STRUCTURES AND METHODS OF USE THEREOF

[0003] CROSS-REFERENCE TO RELATED APPLICATIONS

[0004] This application claims the benefit of priority to U.S. Provisional Application Serial No. 63 / 734,353 filed 16 December 2024, which is incorporated herein by reference in its entirety.

[0005] STATEMENT OF FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0006] This invention was made with government support under Al 134862 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0007] MATERIAL INCORPORATED BY REFERENCE

[0008] The Sequence Listing, which is a part of the present disclosure, includes a computer- readable form comprising nucleotide and / or amino acid sequences of the present invention (file name “020846-WO_2025-12-16_Sequence-Listing” created on 16 December 2025; 102,925 bytes). The subject matter of the Sequence Listing is incorporated herein by reference in its entirety.

[0009] FIELD

[0010] The present disclosure generally relates to immunostimulatory molecules.

[0011] BACKGROUND

[0012] Retinoic acid-inducible gene I (RIG-I) is an important cytoplasmic sensor of viral infections that initiate the antiviral immune response. The RIG-l-like receptor (RLR) family includes RIG-I, melanoma differentiation-associated protein 5 (MDA5), and laboratory of genetics and physiology 2 (LGP2), which are host proteins that bind to RNAs and initiate the antiviral response. Binding of RLRs by foreign RNA triggers a signaling cascade through the mitochondrial antiviral signaling (MAVS) protein that ends in the expression of antiviral proteins, including type I and III interferons (IFNs). RIG-I contains a C-terminal regulatory domain that recognizes the foreign RNA and drives conformational changes in the protein helicase domain to wrap around the RNA. These conformational changes also release caspase activation and recruitment domains (CARDs) that promote oligomerization of the Docket No.: 020846 / WO

[0013] RIG-1 proteins and signaling through MAVS. RLRs recognize unique pathogen associated molecular patterns (PAMPs) found in foreign RNA but not in the host cell RNAs.

[0014] The most well-studied of the RLR PAMPs are within the RNAs that activate RIG-1. The regulatory domain of RIG-1 detects terminal 5’ triphosphates on RNA and the detection of this motif can be inhibited by methylation of the 5’ end of the RNA. While ssRNA can activate RIG-1, the highest activation occurs when blunt ended dsRNA contains the 5’ triphosphate. The addition of overhangs to the end of the dsRNA limits activation of RIG-L RIG-1 is activated best by short dsRNA while longer synthetic dsRNAs such as poly l:C (> 500nt in length) activate MDA5. With these guidelines in place, minimal ligands for activating RIG-1 that contain a short 10 base pair dsRNA stem with a 5’ triphosphate have been synthetically generated. While these studies have provided critical data to identify the motifs that RIG-I will bind to in the RNA, in general, they are not based on RNAs found naturally during viral infections. Increasing type I immune response and IFN expression is of significant importance in treatment and prevention (e.g., vaccination) of viral infection.

[0015] BRIEF DESCRIPTION OF THE DISCLOSURE

[0016] Among the various aspects of the present disclosure is the provision of compositions containing immunostimulatory molecules and methods of use thereof.

[0017] In accordance with an aspect of the present disclosure, an immunostimulatory composition is provided. The composition comprises: an immunostimulatory molecule comprising at least one portion of a copy-back viral genome (cbVG); and a lipid nanoparticle. In some embodiments, the at least one portion of the cbVG is from a virus selected from human respiratory syncytial virus (RSV), Sendai virus (SeV), and Nipah virus (NiV). In some embodiments, the at least one portion of the cbVG comprises at least one RNA stem loop. In certain embodiments, the at least one RNA stem loop comprises one or more regions selected from a CAA motif region and an AAAA adenine rich region. In some embodiments, the immunostimulatory molecule further comprises a portion of an inert RNA sequence. In certain embodiments, the inert RNA sequence is an X RNA sequence. In certain embodiments, the X RNA sequence comprises SEQ ID NO: 20. In some embodiments, the at least one portion of the cbVG is selected from SEQ ID NO: 1 , 3-10, 16, 18, 19, and 28-34. In some embodiments, the at least one portion of the cbVG is selected from SEQ ID NO: 21-27 and 35. Docket No.: 020846 / WO

[0018] In accordance with another aspect of the present disclosure, an mRNA vaccine is provided. The mRNA vaccine comprises an immunostimulatory composition as described herein.

[0019] In accordance with a further aspect of the present disclosure, a method of stimulating an immune system in a subject in need thereof is provided. The method comprises: administering to the subject an immunostimulatory composition, wherein the compositions comprises: an immunostimulatory molecule comprising at least one portion of a copy-back viral genome (cbVG); and a lipid nanoparticle. In some embodiments, the at least one portion of the cbVG is from a virus selected from human respiratory syncytial virus (RSV), Sendai virus (SeV), and Nipah virus (NiV). In some embodiments, the at least one portion of the cbVG comprises at least one RNA stem loop. In certain embodiments, the at least one RNA stem loop comprises one or more regions selected from a CAA motif region and an AAAA adenine rich region. In some embodiments, the immunostimulatory composition activates RIG-1 signaling. In certain embodiments, activating RIG-1 signaling induces expression of one or more proteins selected from IFNB1 , MX1 , IL1 B, and CXCL10. In some embodiments, the immunostimulatory molecule further comprises a portion of an inert RNA sequence. In certain embodiments, the inert RNA sequence is an X RNA sequence. In certain embodiments, the X RNA sequence comprises SEQ ID NO: 20. In some embodiments, the at least one portion of the cbVG is selected from SEQ ID NO: 21-27 and 35. In some embodiments, the subject has a viral infection.

[0020] Other objects and features will be in part apparent and in part pointed out hereinafter.

[0021] BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Those of skill in the art will understand that the drawings described herein are for illustrative purposes only. The drawings are not intended to limit the scope of the present teachings in any way.

[0023] FIG. 1 A is a quantitative PCR (qPCR) graph for type I interferon (JFNB1) expression by A549 cells at 6 hours post transfection (hpt) with 5 pmol of HCV X RNA, SeV cbVG 268, RSV cbVG 236, or NiV cbVG 378. One-way ANOVA was performed for statistical analysis, ns: p>0.05; *: p<0.05, ***: p<0.001 ; ****: p<0.0001 . Data are represented as fold change over Mock. Docket No.: 020846 / WO

[0024] FIG. 1 B is a qPCR graph for type III interferon (JFNL1) expression by A549 cells at 6 hpt with 5 pmol of HCV X RNA, SeV cbVG 268, RSV cbVG 236, or NiV cbVG 378. One-way ANOVA was performed for statistical analysis, ns: p>0.05; *: p<0.05, ***: p<0.001 ; ****: p<0.0001 . Data are represented as fold change over Mock.

[0025] FIG. 1 C is a qPCR graph for IFNL1 of control or MAVS-KO A549 cells at 6 hpt with 5 pmol of SeV cbVG 268, RSV cbVG 236, or NiV cbVG 378. One-way ANOVA was performed for statistical analysis. ****: p<0.0001 . Data are represented as fold change over Mock. Data reported are biological triplicates.

[0026] FIG. 2A is a graphical representation of the RSV cbVG 236 gene with the indicated deletions generated by in vitro transcription then 1 pmol of IVT RNA was transfected into A549 cells.

[0027] FIG. 2B is a qPCR graph showing the expression of IFNL1 measured at 6 hpt. Oneway ANOVA was performed for statistical analysis, ns: p>0.05; ***: p<0.001 , ****: p<0.0001. Data are represented as fold change over cbVG 236.

[0028] FIG. 2C is a set of qPCR graphs showing expression of IFNB1 (left) and IFNL1 (right). Sequences from RSV cbVG 236 were attached to X RNA then in vitro transcribed. 1 pmol of RNA was transfected into A549 cells and expression of IFNB1 and IFNL1 was measured by qPCR at 6 hpt. One-way ANOVA was performed for statistical analysis, ns: p>0.05; *: p<0.05, ****: p<0.0001 . Data are represented as fold change over the X RNA control.

[0029] FIG. 2D is a graphical representation of the predicted structure of RNA stem loops from RSV cbVG 236. Data reported are biological triplicates.

[0030] FIG. 3A is a graphical representation of NiV cbVG 378 with the indicated deletions generated by in vitro transcription then 1 pmol of IVT RNA was transfected into A549 cells.

[0031] FIG. 3B is a qPCR graph showing expression of IFNL1 measured at 6 hpt. One-way ANOVA was performed for statistical analysis, ns: p>0.05; ***: p<0.001 , ****: p<0.0001. Data are represented as fold change over cbVG 378.

[0032] FIG. 3C is a set of qPCR graphs showing expression of IFNB1 (left) and IFNL1 (right). Sequences from NiV cbVG 378 were attached to X RNA then in vitro transcribed. 1 pmol of IVT RNA was transfected into A549 cells and expression of IFNB1 and IFNL1 was measured by qPCR at 6 hpt.. One-way ANOVA was performed for statistical analysis, ns: p>0.05; *: p<0.05, **: p<0.01 ; ***: P<0.001 ; ****: p<0.0001. Data are represented as fold change over the X RNA control. Docket No.: 020846 / WO

[0033] FIG. 3D is a graphical representation of the predicted structure of RNA stem loops from NiV cbVG 378. Data reported are biological triplicates.

[0034] FIG. 4A is a graphical representation of the predicted RNA structures of high immunostimulatory (left) and low immunostimulatory (right) stem loops derived from cbVGs.

[0035] FIG. 4B is a qPCR graph (left) and a corresponding graphical representation (right) of mutations made to the cbVG SeV 70-114 sequence. RNAs were in vitro transcribed and 1 pmol of IVT RNA was transfected into A549 cells. Expression of IFNL1 was measured by qPCR at 6 hpt. One-way ANOVAs were performed for statistical analysis, ns: p>0.05; *: p<0.05, **: p<0.01 ; ***: P<0.001 ; ****: p<0.0001. Data are represented as fold change over the wild-type stem loops. Data reported are biological triplicates.

[0036] FIG. 4C is a qPCR graph (left) and a corresponding graphical representation (right) of mutations made to the cbVG RSV 1-48 sequence. RNAs were in vitro transcribed and 1 pmol of IVT RNA was transfected into A549 cells. Expression of IFNL1 was measured by qPCR at 6 hpt. One-way ANOVAs were performed for statistical analysis, ns: p>0.05; *: p<0.05, **: p<0.01 ; ***: P<0.001 ; ****: p<0.0001. Data are represented as fold change over the wild-type stem loops. Data reported are biological triplicates.

[0037] FIG. 4D is a qPCR graph (left) and a corresponding graphical representation (right) of mutations made to the cbVG NiV 85-136 sequence. RNAs were in vitro transcribed and 1 pmol of IVT RNA was transfected into A549 cells. Expression of IFNL1 was measured by qPCR at 6 hpt. One-way ANOVAs were performed for statistical analysis, ns: p>0.05; *: p<0.05, **: p<0.01 ; ***: P<0.001 ; ****: p<0.0001. Data are represented as fold change over the wild-type stem loops. Data reported are biological triplicates.

[0038] FIG. 4E is a qPCR graph (left) and a corresponding graphical representation (right) of mutations made to the cbVG NiV 324-361 sequence. RNAs were in vitro transcribed and 1 pmol of IVT RNA was transfected into A549 cells. Expression of IFNL1 was measured by qPCR at 6 hpt. One-way ANOVAs were performed for statistical analysis, ns: p>0.05; *: p<0.05, **: p<0.01 ; ***: P<0.001 ; ****: p<0.0001. Data are represented as fold change over the wild-type stem loops. Data reported are biological triplicates.

[0039] FIG. 5A is a schematic of lipid nanoparticles (LNPs) containing X + RSV 1-48 (X 1- 48) or X + RSV 189-236 (X 189-236).

[0040] FIG. 5B is a plot showing dynamic light scattering measurement of LNP sizes of empty LNPs, X 1-48, and X 189-236. Docket No.: 020846 / WO

[0041] FIG. 5C is a schematic of a timeline (top) and a corresponding set of graphs (bottom). LNPs were injected subcutaneously into the footpad of mice. Sixteen hours post injection, RNA was collected and the RNA expression of IFNB1 (top, left), MX1 (top, right), CXCL10 (bottom, left), and IL1B (bottom, right) was quantified by qPCR. One-way ANOVAs were performed for statistical analysis, ns: p>0.05; **: p<0.01 ; ***: P<0.001 ; ****: p<0.0001. Data reported are 5 individual mice.

[0042] FIG. 6A is a graphical representation of the predicted RNA fold for the full-length RSV cbVG 236.

[0043] FIG. 6B is a graphical representation of the predicted RNA fold for nucleotides 1 -48 of RSV 236.

[0044] FIG. 6C is a graphical representation of the predicted RNA fold for nucleotides 1 -188 of RSV 236.

[0045] FIG. 6D is a graphical representation of the predicted RNA fold for nucleotides 49-236 of RSV 236.

[0046] FIG. 6E is a graphical representation of the predicted RNA fold for nucleotides 189- 236 of RSV 236.

[0047] FIG. 7A is a graphical representation of the predicted RNA fold for hepatitis C virus (HCV) X RNA.

[0048] FIG. 7B is a graphical representation of the predicted RNA fold for HCV X RNA with RSV stem loop 1-48.

[0049] FIG. 7C is a graphical representation of the predicted RNA fold for HCV X RNA with RSV stem loop 39-68.

[0050] FIG. 7D is a graphical representation of the predicted RNA fold for HCV X RNA with RSV stem loop 203-236.

[0051] FIG. 7E is a graphical representation of the predicted RNA fold for HCV X RNA with RSV stem loop 44-78.

[0052] FIG. 7F is a graphical representation of the predicted RNA fold for HCV X RNA with RSV stem loop 81 -140.

[0053] FIG. 7G is a graphical representation of the predicted RNA fold for HCV X RNA with RSV stem loop 141 -178.

[0054] FIG. 7H is a graphical representation of the predicted RNA fold for HCV X RNA with RSV stem loop 325-360. Docket No.: 020846 / WO

[0055] FIG. 8A is a graphical representation of the predicted RNA fold for full-length NiV cbVG

[0056] 378.

[0057] FIG. 8B is a graphical representation of the predicted RNA fold for nucleotides 1 -95 of NiV 378.

[0058] FIG. 8C is a graphical representation of the predicted RNA fold for nucleotides 1 -150 of NiV 378.

[0059] FIG. 8D is a graphical representation of the predicted RNA fold for nucleotides 1 -283 of NiV 378.

[0060] FIG. 8E is a graphical representation of the predicted RNA fold for nucleotides 96-378 of NiV 378.

[0061] FIG. 8F is a graphical representation of the predicted RNA fold for nucleotides ISO- 378 of NiV 378.

[0062] FIG. 8G is a graphical representation of the predicted RNA fold for nucleotides 284- 378 of NiV 378.

[0063] FIG. 9A is a graphical representation of the predicted RNA fold for X RNA attached with SeV 70-11 stem loop.

[0064] FIG. 9B is a graphical representation of the predicted RNA fold for X RNA attached with SeV 70-114 with the mutation C88G.

[0065] FIG. 9C is a graphical representation of the predicted RNA fold for X RNA attached with SeV 70-114 with the mutation C88A.

[0066] FIG. 9D is a graphical representation of the predicted RNA fold for X RNA attached with SeV 70-114 with the mutation C88U.

[0067] FIG. 9E is a graphical representation of the predicted RNA fold for X RNA attached with SeV 70-114 with the mutation A89G.

[0068] FIG. 9F is a graphical representation of the predicted RNA fold for X RNA attached with SeV 70-114 with the mutation A89C.

[0069] FIG. 9G is a graphical representation of the predicted RNA fold for X RNA attached with SeV 70-114 with the mutation A89LI.

[0070] FIG. 9H is a graphical representation of the predicted RNA fold for X RNA attached with SeV 70-114 with the mutation A90G.

[0071] FIG. 9I is a graphical representation of the predicted RNA fold for X RNA attached with SeV 70-114 with the mutation A90C. Docket No.: 020846 / WO

[0072] FIG. 9J is a graphical representation of the predicted RNA fold for X RNA attached with SeV 70-114 with the mutation A90U.

[0073] FIG. 10A is a graphical representation of the predicted RNA fold for X RNA attached with RSV 1-48 stem loop.

[0074] FIG. 10B is a graphical representation of the predicted RNA fold for X RNA attached with RSV 1 -48 with the mutation C17G.

[0075] FIG. 10C is a graphical representation of the predicted RNA fold for X RNA attached with RSV 1 -48 with the mutation C17A.

[0076] FIG. 10D is a graphical representation of the predicted RNA fold for X RNA attached with RSV 1 -48 with the mutation C17U.

[0077] FIG. 10E is a graphical representation of the predicted RNA fold for X RNA attached with RSV 1 -48 with the mutation C18G.

[0078] FIG. 10F is a graphical representation of the predicted RNA fold for X RNA attached with RSV 1 -48 with the mutation C18C.

[0079] FIG. 10G is a graphical representation of the predicted RNA fold for X RNA attached with RSV 1 -48 with the mutation C18U.

[0080] FIG. 10H is a graphical representation of the predicted RNA fold for X RNA attached with RSV 1 -48 with the mutation A19G.

[0081] FIG. 101 is a graphical representation of the predicted RNA fold for X RNA attached with RSV 1 -48 with the mutation A19C.

[0082] FIG. 10J is a graphical representation of the predicted RNA fold for X RNA attached with RSV 1 -48 with the mutation A19U.

[0083] FIG. 11 A is a graphical representation of the predicted RNA fold for X RNA attached with NiV 81 -140 stem loop.

[0084] FIG. 11 B is a graphical representation of the predicted RNA fold for X RNA attached with NiV 81 -140 with the mutation A111 G.

[0085] FIG. 11 C is a graphical representation of the predicted RNA fold for X RNA attached with NiV 81 -140 with the mutation A111 C.

[0086] FIG. 11 D is a graphical representation of the predicted RNA fold for X RNA attached with NiV 81 -140 with the mutation A111 U.

[0087] FIG. 11 E is a graphical representation of the predicted RNA fold for X RNA attached with NiV 81 -140 with the mutation A112G. Docket No.: 020846 / WO

[0088] FIG. 11 F is a graphical representation of the predicted RNA fold for X RNA attached with NiV 81 -140 with the mutation A112C.

[0089] FIG. 11 G is a graphical representation of the predicted RNA fold for X RNA attached with NiV 81 -140 with the mutation A112U.

[0090] FIG. 12A is a graphical representation of the predicted RNA fold for X RNA attached with NiV 325-360 stem loop.

[0091] FIG. 12B is a graphical representation of the predicted RNA fold for X RNA attached with NiV 325-360 with the mutation A342G.

[0092] FIG. 12C is a graphical representation of the predicted RNA fold for X RNA attached with NiV 325-360 with the mutation A342C.

[0093] FIG. 12D is a graphical representation of the predicted RNA fold for X RNA attached with NiV 325-360 with the mutation A342LI.

[0094] FIG. 12E is a graphical representation of the predicted RNA fold for X RNA attached with NiV 325-360 with the mutation A343G.

[0095] FIG. 12F is a graphical representation of the predicted RNA fold for X RNA attached with NiV 325-360 with the mutation A343C.

[0096] FIG. 12G is a graphical representation of the predicted RNA fold for X RNA attached with NiV 325-360 with the mutation A343LI.

[0097] FIG. 12H is a graphical representation of the predicted RNA fold for X RNA attached with NiV 325-360 with the mutation A344G.

[0098] FIG. 121 is a graphical representation of the predicted RNA fold for X RNA attached with NiV 325-360 with the mutation A344C.

[0099] FIG. 12J is a graphical representation of the predicted RNA fold for X RNA attached with NiV 325-360 with the mutation A344U.

[0100] FIG. 13A is an image of a PCR gel showing quality control validation of X + RSV constructs. DNA integrity for X + RSV 1 -48 (X 1 -48) and X + RSV 189-236(X 189-236) was confirmed by 1 % agarose gel electrophoresis.

[0101] FIG. 13B is a set of graphs showing quality control validation of X + RSV constructs. RNA quality from these constructs was determined using a Bioanalyzer with Small RNA kits.

[0102] FIG. 14A is a schematic showing the timeline for in vitro stimulation of A549 cells with RSV stem loops. Docket No.: 020846 / WO

[0103] FIG. 14B is a set of qPCR graphs measuring IFNB1 (left) and IL29 (right) RNA 6 hours post transfection with 1 pmol of IVT RNA (control, X 189-236 (RSV-), X 1 -48 (RSV+)).

[0104] FIG. 15A is a schematic showing the timeline for X + RSV 1-48 to activate the innate immune response in mice.

[0105] FIG. 15B is a set of qPCR graphs showing expression of IFNB1 (top), IL1B (bottom, left), and MX1 (bottom, right) RNA. Empty LNPs and payloads with RNAs were injected subcutaneously into the footpad of mice. Sixteen hours after injection, RNA was collected and measured by qPCR.

[0106] FIG. 16A is a schematic of the timeline for X + RSV 1 -48 inoculation, treatment, and survival.

[0107] FIG. 16B is a graph showing a tumor growth curve from mice inoculated with B16 tumor cells and treated with empty LNPs, and PNPs with a payload containing RNAs, which were inoculated intratumorally. Measurements of tumor growth were performed every 2-3 days.

[0108] FIG. 16C is a graph showing a tumor growth curve from mice inoculated with B16 tumor cells and treated with empty LNPs, LNPs with a payload containing RNAs (X 189-236 or X 1 -48), and DDO268, which were inoculated intratumorally. Measurements of tumor growth were performed every 2-3 days.

[0109] DETAILED DESCRIPTION OF THE DISCLOSURE

[0110] The present disclosure is based, at least in part, on the discovery that an RNA structure and specific sequences have been identified as potent immunostimulatory molecules. Herein are identified key nucleotides for immunostimulatory activity along with several small synthetic versions of immunostimulatory molecules that serve as immunostimulants in several platforms. The disclosed molecules have been tested upon transfection into cell lines in vitro and also as immunostimulants co-packaged with mRNA vaccines administered to mice. The addition of these RNAs improve the development of certain types of antibodies and promote the development of cellular immunity by stimulating a robust type I interferon response.

[0111] In one aspect, the immunostimulatory composition may include an immunostimulatory RNA sequence, an inert RNA sequence (X RNA), and a lipid nanoparticle (LNP).

[0112] In one aspect, the immunostimulatory composition may comprise an inert RNA Docket No.: 020846 / WQ sequence. The inert RNA sequence may be the inert X RNA from the hepatitis C virus (SEQ ID NO: 20) sequence:

[0113] GUGGCUCCAUCUUAGCCCUAGUCACGGCUAGCUGUGAAAGGUCCGUG AGCCGCUUGACUGCAGAGAGUGCUGAUACUGGCCUCUCUGCAGAUCA AGU

[0114] In one aspect, the immunostimulatory RNA sequence may comprise at least one RNA stem loop. In another aspect, the RNA stem loop may have a CAA motif or an adenine (A)- rich sequence at the tip of the loop.

[0115] In one aspect, the immunostimulatory RNA sequence may be from a virus. In another aspect, the RNA sequence may be derived from a copy-back viral genome (cbVG). In another aspect, the RNA sequence may be derived from a Sendai Virus (SeV), a human respiratory syncytial virus (RSV), and Nipah virus (NiV). In another aspect, the RNA sequence may be truncated or mutated. In one aspect, the immunostimulatory RNA sequence may be selected from Table 1 . Table 1 : cbVG RNA sequences Docket No.: 020846 / WO

[0116] In one aspect, the immunostimulatory composition may comprise the inert X RNA and a portion of an RSV, NiV, or SeV sequence. In some aspects, the sequence may be X RNA and a portion of a RSV, NiV, and SeV cbVG. In some aspects, the immunostimulatory composition comprising the inert X RNA and the cbVG sequence may be selected from Table 2.

[0117] Table 2: X RNA + cbVG sequence Docket No.: 020846 / WO

[0118] In one aspect, the immunostimulatory composition may activate RIG-1 when administered to a subject. In another aspect, the immunostimulatory composition may activate the IFN signaling pathway. In another aspect, the immunostimulatory composition may increase IFNB1, MX1, IL1B, and CXCL10 expression.

[0119] MODULATION AGENTS

[0120] As described herein, gene and / or associated protein expression has been implicated in various diseases, disorders, and conditions. As such, modulation of gene and protein expression can be used for treatment of such conditions. A modulation agent can modulate response, such as by inducing or inhibiting gene and / or protein expression signaling. Modulation can comprise modulating protein expression on cells, modulating the quantity of gene / protein expressing cells, or modulating the quality of gene / protein expressing cells.

[0121] Modulation agents can be any composition or method that modulates expression on cells. For example, a modulation agent can be an activator, an inhibitor, an agonist, or an antagonist. As another example, the modulation can be the result of gene editing. The modulation agent can be an RNA sequence. Docket No.: 020846 / WO

[0122] A modulation agent can be an antibody (e.g., a monoclonal antibody). A modulating agent can be an agent that induces or inhibits progenitor cell differentiation into gene / protein expressing cells.

[0123] CHEMICAL AGENT

[0124] Examples of immunostimulatory agents are described herein, and can include one or more RNA molecules. Pharmaceutically acceptable salts, solvates, polymorphs, tautomers, prodrugs, analogs, stereoisomers, or optionally substituted analogs thereof are also contemplated herein where applicable.

[0125] The formulas, analogs, and R groups can be optionally substituted or functionalized with one or more groups independently selected from the group consisting of hydroxyl; Ci- walkyl hydroxyl; amine; Ci- carboxylic acid; Ci- carboxyl; straight chain or branched Ci- walkyl, optionally containing unsaturation; a C2- cycloalkyl optionally containing unsaturation or one oxygen or nitrogen atom; straight chain or branched Ci-walkyl amine; heterocyclyl; heterocyclic amine; and aryl comprising a phenyl; heteroaryl containing from 1 to 4 N, 0, or S atoms; unsubstituted phenyl ring; substituted phenyl ring; unsubstituted heterocyclyl; and substituted heterocyclyl, wherein the unsubstituted phenyl ring or substituted phenyl ring can be optionally substituted with one or more groups independently selected from the group consisting of hydroxyl; Ci-walkyl hydroxyl; amine; Ci-wcarboxyl; Ci-wcarboxylic acid; Ci- wcarboxyl; straight chain or branched Ci-walkyl, optionally containing unsaturation; straight chain or branched Ci-walkyl amine, optionally containing unsaturation; a C2-wcycloalkyl optionally containing unsaturation or one oxygen or nitrogen atom; straight chain or branched Ci-walkyl amine; heterocyclyl; heterocyclic amine; aryl comprising a phenyl; and heteroaryl containing from 1 to 4 N, 0, or S atoms; and the unsubstituted heterocyclyl or substituted heterocyclyl can be optionally substituted with one or more groups independently selected from the group consisting of hydroxyl; Ci-ioalkyl hydroxyl; amine; Ci-wcarboxylic acid; Ci- wcarboxyl; straight chain or branched Ci-walkyl, optionally containing unsaturation; straight chain or branched Ci-walkyl amine, optionally containing unsaturation; a C2-wcycloalkyl optionally containing unsaturation or one oxygen or nitrogen atom; heterocyclyl; straight chain or branched Ci-walkyl amine; heterocyclic amine; and aryl comprising a phenyl; and heteroaryl containing from 1 to 4 N, 0, or S atoms. Any of the above can be further optionally substituted.

[0126] The term “imine” or “imino”, as used herein, unless otherwise indicated, can include a Docket No.: 020846 / WO functional group or chemical compound containing a carbon-nitrogen double bond. The expression “imino compound”, as used herein, unless otherwise indicated, refers to a compound that includes an “imine” or an “imino” group as defined herein. The “imine” or “imino” group can be optionally substituted.

[0127] The term “hydroxyl”, as used herein, unless otherwise indicated, can include -OH. The “hydroxyl” can be optionally substituted.

[0128] The terms “halogen” and “halo”, as used herein, unless otherwise indicated, include a chlorine, chloro, Cl; fluorine, fluoro, F; bromine, bromo, Br; or iodine, iodo, or I.

[0129] The term “acetamide”, as used herein, is an organic compound with the formula CH3CONH2. The “acetamide” can be optionally substituted.

[0130] The term “aryl”, as used herein, unless otherwise indicated, include a carbocyclic aromatic group. Examples of aryl groups include, but are not limited to, phenyl, benzyl, naphthyl, or anthracenyl. The “aryl” can be optionally substituted.

[0131] The terms “amine” and “amino”, as used herein, unless otherwise indicated, include a functional group that contains a nitrogen atom with a lone pair of electrons and wherein one or more hydrogen atoms have been replaced by a substituent such as, but not limited to, an alkyl group or an aryl group. The “amine” or “amino” group can be optionally substituted.

[0132] The term “alkyl”, as used herein, unless otherwise indicated, can include saturated monovalent hydrocarbon radicals having straight or branched moieties, such as but not limited to, methyl, ethyl, propyl, butyl, pentyl, hexyl, octyl groups, etc. Representative straightchain lower alkyl groups include, but are not limited to, -methyl, -ethyl, -n-propyl, -n-butyl, -n- pentyl, -n-hexyl, -n-heptyl and -n-octyl; while branched lower alkyl groups include, but are not limited to, -isopropyl, -sec-butyl, -isobutyl, -tert-butyl, -isopentyl, 2-methylbutyl, 2- methylpentyl, 3-methylpentyl, 2,2-dimethylbutyl, 2,3-dimethylbutyl, 2,2-dimethylpentyl, 2,3- dimethylpentyl, 3,3-dimethylpentyl, 2,3,4-trimethylpentyl, 3-methylhexyl, 2,2-dimethylhexyl, 2,4-dimethylhexyl, 2,5-dimethylhexyl, 3,5-dimethylhexyl, 2,4-dimethylpentyl, 2-methylheptyl, 3-methylheptyl, unsaturated C1-10 alkyls include, but are not limited to, -vinyl, -allyl, -1-butenyl, -2-butenyl, -isobutylenyl, -1 -pentenyl, -2-pentenyl, -3-methyl-1 -butenyl, -2-methyl-2-butenyl, -2,3-dimethyl-2-butenyl, 1 -hexyl, 2-hexyl, 3-hexyl, -acetylenyl, -propynyl, -1-butynyl, -2- butynyl, -1 -pentynyl, -2-pentynyl, or -3-methyl-1 butynyl. An alkyl can be saturated, partially saturated, or unsaturated. The “alkyl” can be optionally substituted.

[0133] The term “carboxyl”, as used herein, unless otherwise indicated, can include a Docket No.: 020846 / WO functional group consisting of a carbon atom double bonded to an oxygen atom and single bonded to a hydroxyl group (-COOH). The “carboxyl” can be optionally substituted.

[0134] The term “carbonyl”, as used herein, unless otherwise indicated, can include a functional group consisting of a carbon atom double-bonded to an oxygen atom (C=O). The “carbonyl” can be optionally substituted.

[0135] The term “alkenyl”, as used herein, unless otherwise indicated, can include alkyl moieties having at least one carbon-carbon double bond wherein alkyl is as defined above and including E and Z isomers of said alkenyl moiety. An alkenyl can be partially saturated or unsaturated. The “alkenyl” can be optionally substituted.

[0136] The term “alkynyl”, as used herein, unless otherwise indicated, can include alkyl moieties having at least one carbon-carbon triple bond wherein alkyl is as defined above. An alkynyl can be partially saturated or unsaturated. The “alkynyl” can be optionally substituted.

[0137] The term “acyl”, as used herein, unless otherwise indicated, can include a functional group derived from an aliphatic carboxylic acid, by removal of the hydroxyl (-OH) group. The “acyl” can be optionally substituted.

[0138] The term “alkoxyl”, as used herein, unless otherwise indicated, can include O-alkyl groups wherein alkyl is as defined above and O represents oxygen. Representative alkoxyl groups include, but are not limited to, -O-methyl, -O-ethyl, -O-n-propyl, -O-n-butyl, -O-n- pentyl, -O-n-hexyl, -O-n-heptyl, -O-n-octyl, -O-isopropyl, -O-sec-butyl, -O-isobutyl, -O-tert- butyl, -O-isopentyl, -O-2-methylbutyl, -O-2-methylpentyl, -O-3-methylpentyl, -0-2,2- dimethylbutyl, -0-2,3-dimethylbutyl, -0-2,2-dimethylpentyl, -0-2,3-dimethylpentyl, -0-3,3- dimethylpentyl, -0-2,3,4-trimethylpentyl, -O-3-methylhexyl, -0-2,2-dimethylhexyl, -0-2,4- dimethylhexyl, -0-2,5-dimethylhexyl, -0-3,5-dimethylhexyl, -O-2,4dimethylpentyl, -0-2- methylheptyl, -0-3-methylheptyl, -O-vinyl, -O-allyl, -0-1-butenyl, -0-2-butenyl, -0- isobutylenyl, -0-1 -pentenyl, -0-2-pentenyl, -0-3-methyl-1 -butenyl, -O-2-methyl-2-butenyl, - O-2,3-dimethyl-2-butenyl, -0-1 -hexyl, -0-2-hexyl, -0-3-hexyl, -O-acetylenyl, -O-propynyl, - 0-1-butynyl, -0-2-butynyl, -0-1 -pentynyl, -0-2-pentynyl and -0-3-methyl-1-butynyl, -0- cyclopropyl, -O-cyclobutyl, -O-cyclopentyl, -O-cyclohexyl, -O-cycloheptyl, -O-cyclooctyl, -0- cyclononyl and -O-cyclodecyl, -O-CH2-cyclopropyl, -O-CH2-cyclobutyl, -O-CH2-cyclopentyl, - O-CH2-cyclohexyl, -O-CH2-cycloheptyl, -O-CH2-cyclooctyl, -0- CH2-cyclononyl, -O-CH2- cyclodecyl, -O-(CH2)2-cyclopropyl, -O-(CH2)2-cyclobutyl, -O-(CH2)2-cyclopentyl, -O-(CH2)2- cyclohexyl, -O-(CH2)2-cycloheptyl, -O-(CH2)2-cyclooctyl, -O-(CH2)2-cyclononyl, or -O-(CH2)2- Docket No.: 020846 / WO cyclodecyl. An alkoxyl can be saturated, partially saturated, or unsaturated. The “alkoxyl” can be optionally substituted.

[0139] The term “cycloalkyl”, as used herein, unless otherwise indicated, can include an aromatic, a non-aromatic, saturated, partially saturated, or unsaturated, monocyclic or fused, spiro or unfused bicyclic or tricyclic hydrocarbon referred to herein containing a total of from 1 to 10 carbon atoms (e.g., 1 or 2 carbon atoms if there are other heteroatoms in the ring), preferably 3 to 8 ring carbon atoms. Examples of cycloalkyls include, but are not limited to, C3-10 cycloalkyl groups include, but are not limited to, -cyclopropyl, -cyclobutyl, -cyclopentyl, -cyclopentadienyl, -cyclohexyl, -cyclohexenyl, -1 ,3-cyclohexadienyl, -1 ,4-cyclohexadienyl, - cycloheptyl, -1 ,3-cycloheptadienyl, -1 ,3,5-cycloheptatrienyl, -cyclooctyl, and cyclooctadienyl. The term “cycloalkyl” also can include -lower alky l-cycloalkyl, wherein lower alkyl and cycloalkyl are as defined herein. Examples of -lower alkyl-cycloalkyl groups include, but are not limited to, -CH2-cyclopropyl, -CH2-cyclobutyl, -CH2-cyclopentyl, -CH2- cyclopentadienyl, -CH2-cyclohexyl, -CH2-cycloheptyl, or -CH2-cyclooctyl. The “cycloalkyl” can be optionally substituted. A “cycloheteroalkyl”, as used herein, unless otherwise indicated, can include any of the above with a carbon substituted with a heteroatom (e.g., O, S, N).

[0140] The term “heterocyclic” or “heteroaryl”, as used herein, unless otherwise indicated, can include an aromatic or non-aromatic cycloalkyl in which one to four of the ring carbon atoms are independently replaced with a heteroatom from the group consisting of 0, S, and N. Representative examples of a heterocycle include, but are not limited to, benzofuranyl, benzothiophene, indolyl, benzopyrazolyl, coumarinyl, isoquinolinyl, pyrrolyl, pyrrolidinyl, thiophenyl, furanyl, thiazolyl, imidazolyl, pyrazolyl, triazolyl, quinolinyl, pyrimidinyl, pyridinyl, pyridonyl, pyrazinyl, pyridazinyl, isothiazolyl, isoxazolyl, (1 ,4)-dioxane, (1 ,3)-dioxolane, 4,5- dihydro-1 H-imidazolyl, or tetrazolyl. Heterocycles can be substituted or unsubstituted. Heterocycles can also be bonded at any ring atom (i.e., at any carbon atom or heteroatom of the heterocyclic ring). A heterocyclic can be saturated, partially saturated, or unsaturated. The “heterocyclic” can be optionally substituted.

[0141] The term “indole”, as used herein, is an aromatic heterocyclic organic compound with formula C8H7N. It has a bicyclic structure, consisting of a six-membered benzene ring fused to a five-membered nitrogen-containing pyrrole ring. The “indole” can be optionally substituted.

[0142] The term “cyano”, as used herein, unless otherwise indicated, can include a -CN Docket No.: 020846 / WO group. The “cyano” can be optionally substituted.

[0143] The term “alcohol”, as used herein, unless otherwise indicated, can include a compound in which the hydroxyl functional group (-OH) is bound to a carbon atom. In particular, this carbon center should be saturated, having single bonds to three other atoms. The “alcohol” can be optionally substituted.

[0144] The term “solvate” is intended to mean a solvate form of a specified compound that retains the effectiveness of such compound. Examples of solvates include compounds of the present disclosure in combination with, for example, water, isopropanol, ethanol, methanol, dimethylsulfoxide (DMSO), ethyl acetate, acetic acid, or ethanolamine.

[0145] The term “mmol”, as used herein, is intended to mean millimole. The term “equiv”, as used herein, is intended to mean equivalent. The term “mL”, as used herein, is intended to mean milliliter. The term “g”, as used herein, is intended to mean gram. The term “kg”, as used herein, is intended to mean kilogram. The term “pg”, as used herein, is intended to mean micrograms. The term “h”, as used herein, is intended to mean hour. The term “min”, as used herein, is intended to mean minute. The term “M”, as used herein, is intended to mean molar. The term "pL", as used herein, is intended to mean microliter. The term “pM”, as used herein, is intended to mean micromolar. The term “nM”, as used herein, is intended to mean nanomolar. The term “N”, as used herein, is intended to mean normal. The term “amu”, as used herein, is intended to mean atomic mass unit. The term “°C”, as used herein, is intended to mean degree Celsius. The term “wt / wt”, as used herein, is intended to mean weight / weight. The term “v / v”, as used herein, is intended to mean volume / volume. The term “MS”, as used herein, is intended to mean mass spectroscopy. The term “HPLC”, as used herein, is intended to mean high performance liquid chromatograph. The term “RT”, as used herein, is intended to mean room temperature. The term "e.g.", as used herein, is intended to mean example. The term “N / A”, as used herein, is intended to mean not tested.

[0146] As used herein, the expression “pharmaceutically acceptable salt” refers to pharmaceutically acceptable organic or inorganic salts of a compound of the present disclosure. Preferred salts include, but are not limited, to sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, acid phosphate, isonicotinate, lactate, salicylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p- Docket No.: 020846 / WO toluenesulfonate, or pamoate (i.e., 1 ,1'-methylene-bis-(2-hydroxy-3-naphthoate)) salts. A pharmaceutically acceptable salt may involve the inclusion of another molecule such as an acetate ion, a succinate ion, or another counterion. The counterion may be any organic or inorganic moiety that stabilizes the charge on the parent compound. Furthermore, a pharmaceutically acceptable salt may have more than one charged atom in its structure. In instances where multiple charged atoms are part of the pharmaceutically acceptable salt, the pharmaceutically acceptable salt can have multiple counterions. Hence, a pharmaceutically acceptable salt can have one or more charged atoms and / or one or more counterion. As used herein, the expression “pharmaceutically acceptable solvate” refers to an association of one or more solvent molecules and a compound of the present disclosure. Examples of solvents that form pharmaceutically acceptable solvates include, but are not limited to, water, isopropanol, ethanol, methanol, DMSO, ethyl acetate, acetic acid, and ethanolamine. As used herein, the expression “pharmaceutically acceptable hydrate” refers to a compound of the present disclosure, or a salt thereof, that further can include a stoichiometric or non- stoichiometric amount of water bound by non-covalent intermolecular forces.

[0147] MOLECULAR ENGINEERING

[0148] The following definitions and methods are provided to better define the present disclosure and to guide those of ordinary skill in the art in the practice of the present disclosure. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art.

[0149] The term “transfection,” as used herein, refers to the process of introducing nucleic acids into cells by non-viral methods. The term “transduction,” as used herein, refers to the process whereby foreign DNA is introduced into another cell via a viral vector.

[0150] The terms "heterologous DNA sequence", "exogenous DNA segment", or "heterologous nucleic acid”, “transgene”, “exogenous polynucleotide” as used herein, each refers to a sequence that originates from a source foreign (e.g., non-native) to the particular host cell or, if from the same source, is modified from its original form. Thus, a heterologous gene in a host cell includes a gene that is endogenous to the particular host cell but has been modified through, for example, the use of DNA shuffling or cloning. The terms also include non-naturally occurring multiple copies of a naturally occurring DNA sequence. Thus, the terms refer to a DNA segment that is foreign or heterologous to the cell, or homologous to the cell but in a position within the host cell nucleic acid in which the element is not ordinarily Docket No.: 020846 / WO found. Exogenous DNA segments are expressed to yield exogenous polypeptides. A "homologous" DNA sequence is a DNA sequence that is naturally associated with a host cell into which it is introduced.

[0151] Sequences described herein can also be the reverse, the complement, or the reverse complement of the nucleotide sequences described herein. The RNA goes in the reverse direction compared to the DNA, but its base pairs still match (e.g., G to C). The reverse complementary RNA for a positive strand DNA sequence will be identical to the corresponding negative strand DNA sequence. Reverse complement converts a DNA sequence into its reverse, complement, or reverse-complement counterpart. (

[0152] Complementarity is a property shared between two nucleic acid sequences (e.g., RNA, DNA), such that when they are aligned antiparallel to each other, the nucleotide bases at each position will be complementary. Two bases are complementary if they form Watson- Crick base pairs. Expression vector, expression construct, plasmid, or recombinant DNA construct is generally understood to refer to a nucleic acid that has been generated via human intervention, including by recombinant means or direct chemical synthesis, with a series of Docket No.: 020846 / WO specified nucleic acid elements that permit transcription or translation of a particular nucleic acid in, for example, a host cell. The expression vector can be part of a plasmid, virus, or nucleic acid fragment. Typically, the expression vector can include a nucleic acid to be transcribed operably linked to a promoter.

[0153] An “expression vector”, otherwise known as an “expression construct”, is generally a plasmid or virus designed for gene expression in cells. The vector is used to introduce a specific gene into a target cell, and can commandeer the cell's mechanism for protein synthesis to produce the protein encoded by the gene. Expression vectors are the basic tools in biotechnology for the production of proteins. The vector is engineered to contain regulatory sequences that act as enhancer and / or promoter regions and lead to efficient transcription of the gene carried on the expression vector. The goal of a well-designed expression vector is the efficient production of protein, and this may be achieved by the production of significant amount of stable messenger RNA, which can then be translated into protein. The expression of a protein may be tightly controlled, and the protein is only produced in significant quantity when necessary through the use of an inducer, in some systems however the protein may be expressed constitutively. As described herein, Escherichia coli is used as the host for protein production, but other cell types may also be used.

[0154] In molecular biology, an “inducer” is a molecule that regulates gene expression. An inducer can function in two ways, such as:

[0155] (i) By disabling repressors. The gene is expressed because an inducer binds to the repressor. The binding of the inducer to the repressor prevents the repressor from binding to the operator. RNA polymerase can then begin to transcribe operon genes. An operon is a cluster of genes that are transcribed together to give a single messenger RNA (mRNA) molecule, which therefore encodes multiple proteins.

[0156] (ii) By binding to activators. Activators generally bind poorly to activator DNA sequences unless an inducer is present. An activator binds to an inducer and the complex binds to the activation sequence and activates target gene. Removing the inducer stops transcription. Because a small inducer molecule is required, the increased expression of the target gene is called induction.

[0157] Repressor proteins bind to the DNA strand and prevent RNA polymerase from being able to attach to the DNA and synthesize mRNA. Inducers bind to repressors, causing them to change shape and preventing them from binding to DNA. Therefore, they allow Docket No.: 020846 / WO transcription, and thus gene expression, to take place.

[0158] For a gene to be expressed, its DNA sequence (or polynucleotide sequence) must be copied (in a process known as transcription) to make a smaller, mobile molecule called messenger RNA (mRNA), which carries the instructions for making a protein to the site where the protein is manufactured (in a process known as translation). Many different types of proteins can affect the level of gene expression by promoting or preventing transcription. In prokaryotes (such as bacteria), these proteins often act on a portion of DNA known as the operator at the beginning of the gene. The promoter is where RNA polymerase, the enzyme that copies the genetic sequence and synthesizes the mRNA, attaches to the DNA strand.

[0159] Some genes are modulated by activators, which have the opposite effect on gene expression as repressors. Inducers can also bind to activator proteins, allowing them to bind to the operator DNA where they promote RNA transcription. Ligands that bind to deactivate activator proteins are not, in the technical sense, classified as inducers, since they have the effect of preventing transcription.

[0160] A “promoter” is generally understood as a nucleic acid control sequence that directs transcription of a nucleic acid. An inducible promoter is generally understood as a promoter that mediates transcription of an operably linked gene in response to a particular stimulus. A promoter can include necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element. A promoter can optionally include distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription.

[0161] A “ribosome binding site”, or “ribosomal binding site (RBS)”, refers to a sequence of nucleotides upstream of the start codon of an mRNA transcript that is responsible for the recruitment of a ribosome during the initiation of translation. Generally, RBS refers to bacterial sequences, although internal ribosome entry sites (IRES) have been described in mRNAs of eukaryotic cells or viruses that infect eukaryotes. Ribosome recruitment in eukaryotes is generally mediated by the 5' cap present on eukaryotic mRNAs.

[0162] A ribosomal skipping sequence (e.g., 2A sequence such as furin-GSG-T2A) can be used in a construct to prevent covalently linking translated amino acid sequences.

[0163] A "transcribable nucleic acid molecule" as used herein refers to any nucleic acid molecule capable of being transcribed into an RNA molecule. Methods are known for Docket No.: 020846 / WO introducing constructs into a cell in such a manner that the transcribable nucleic acid molecule is transcribed into a functional mRNA molecule that is translated and therefore expressed as a protein product. Constructs may also be constructed to be capable of expressing antisense RNA molecules, in order to inhibit translation of a specific RNA molecule of interest. For the practice of the present disclosure, conventional compositions and methods for preparing and using constructs and host cells are well known to one skilled in the art (see e.g., Sambrook and Russel (2006) Condensed Protocols from Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, ISBN-10: 0879697717; Ausubel et al. (2002) Short Protocols in Molecular Biology, 5th ed., Current Protocols, ISBN- 10: 0471250929; Sambrook and Russel (2001 ) Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Laboratory Press, ISBN-10: 0879695773; Elhai, J. and Wolk, C. P. 1988. Methods in Enzymology 167, 747-754).

[0164] The “transcription start site” or "initiation site" is the position surrounding the first nucleotide that is part of the transcribed sequence, which is also defined as position +1 . With respect to this site all other sequences of the gene and its controlling regions can be numbered. Downstream sequences (i.e., further protein encoding sequences in the 3' direction) can be denominated positive, while upstream sequences (mostly of the controlling regions in the 5' direction) are denominated negative.

[0165] "Operably-linked" or "functionally linked" refers preferably to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a regulatory DNA sequence is said to be "operably linked to" or "associated with" a DNA sequence that codes for an RNA or a polypeptide if the two sequences are situated such that the regulatory DNA sequence affects expression of the coding DNA sequence (i.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Coding sequences can be operably-linked to regulatory sequences in sense or antisense orientation. The two nucleic acid molecules may be part of a single contiguous nucleic acid molecule and may be adjacent. For example, a promoter is operably linked to a gene of interest if the promoter regulates or mediates transcription of the gene of interest in a cell.

[0166] A "construct" is generally understood as any recombinant nucleic acid molecule such as a plasmid, cosmid, virus, autonomously replicating nucleic acid molecule, phage, or linear or circular single-stranded or double-stranded DNA or RNA nucleic acid molecule, derived Docket No.: 020846 / WO from any source, capable of genomic integration or autonomous replication, comprising a nucleic acid molecule where one or more nucleic acid molecule has been operably linked.

[0167] A construct of the present disclosure can contain a promoter operably linked to a transcribable nucleic acid molecule operably linked to a 3' transcription termination nucleic acid molecule. In addition, constructs can include but are not limited to additional regulatory nucleic acid molecules from, e.g., the 3'-untranslated region (3' UTR). Constructs can include but are not limited to the 5' untranslated regions (5' UTR) of an mRNA nucleic acid molecule which can play an important role in translation initiation and can also be a genetic component in an expression construct. These additional upstream and downstream regulatory nucleic acid molecules may be derived from a source that is native or heterologous with respect to the other elements present on the promoter construct.

[0168] The term "transformation" refers to the transfer of a nucleic acid fragment into the genome of a host cell, resulting in genetically stable inheritance. Host cells containing the transformed nucleic acid fragments are referred to as "transgenic" cells, and organisms comprising transgenic cells are referred to as "transgenic organisms".

[0169] "Transformed," "transgenic," and "recombinant" refer to a host cell or organism such as a bacterium, cyanobacterium, animal, or a plant into which a heterologous nucleic acid molecule has been introduced. The nucleic acid molecule can be stably integrated into the genome as generally known in the art and disclosed (Sambrook 1989; Innis 1995; Gelfand 1995; Innis & Gelfand 1999). Known methods of PCR include, but are not limited to, methods using self-replicating primers, paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially mismatched primers, and the like. The term "untransformed" refers to normal cells that have not been through the transformation process.

[0170] "Wild-type" refers to a virus or organism found in nature without any known mutation.

[0171] Design, generation, and testing of the variant nucleotides, and their encoded polypeptides, having the above-required percent identities and retaining a required activity of the expressed protein is within the skill of the art. For example, directed evolution and rapid isolation of mutants can be according to methods described in references including, but not limited to, Link et al. (2007) Nature Reviews 5(9), 680-688; Sanger et al. (1991 ) Gene 97(1 ), 119-123; Ghadessy et al. (2001 ) Proc Natl Acad Sci USA 98(8) 4552-4557. Thus, one skilled in the art could generate a large number of nucleotide and / or polypeptide variants having, for Docket No.: 020846 / WO example, at least 95-99% identity to the reference sequence described herein and screen such for desired phenotypes according to methods routine in the art.

[0172] Nucleotide and / or amino acid sequence identity percent (%) is understood as the percentage of nucleotide or amino acid residues that are identical with nucleotide or amino acid residues in a candidate sequence in comparison to a reference sequence when the two sequences are aligned. To determine percent identity, sequences are aligned and if necessary, gaps are introduced to achieve the maximum percent sequence identity. Sequence alignment procedures to determine percent identity are well known to those of skill in the art. Often publicly available computer software such as BLAST, BLAST2, ALIGN2, or Megalign (DNASTAR) software is used to align sequences. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared. When sequences are aligned, the percent sequence identity of a given sequence A to, with, or against a given sequence B (which can alternatively be phrased as a given sequence A that has or comprises a certain percent sequence identity to, with, or against a given sequence B) can be calculated as: percent sequence identity = X / Y100, where X is the number of residues scored as identical matches by the sequence alignment program's or algorithm's alignment of A and B and Y is the total number of residues in B. If the length of sequence A is not equal to the length of sequence B, the percent sequence identity of A to B will not equal the percent sequence identity of B to A. For example, the percent identity can be at least 80% or about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%.

[0173] Substitution refers to the replacement of one amino acid with another amino acid in a protein or the replacement of one nucleotide with another in DNA or RNA. Insertion refers to the insertion of one or more amino acids in a protein or the insertion of one or more nucleotides with another in DNA or RNA. Deletion refers to the deletion of one or more amino acids in a protein or the deletion of one or more nucleotides with another in DNA or RNA. Generally, substitutions, insertions, or deletions can be made at any position so long as the required activity is retained.

[0174] “Point mutation” refers to when a single base pair is altered. A point mutation or substitution is a genetic mutation where a single nucleotide base is changed, inserted, or Docket No.: 020846 / WO deleted from a DNA or RNA sequence of an organism's genome. Point mutations have a variety of effects on the downstream protein product — consequences that are moderately predictable based upon the specifics of the mutation. These consequences can range from no effect (e.g., synonymous mutations) to deleterious effects (e.g., frameshift mutations), with regard to protein production, composition, and function. Point mutations can have one of three effects. First, the base substitution can be a silent mutation where the altered codon corresponds to the same amino acid. Second, the base substitution can be a missense mutation where the altered codon corresponds to a different amino acid. Or third, the base substitution can be a nonsense mutation where the altered codon corresponds to a stop signal. Silent mutations result in a new codon (a triplet nucleotide sequence in RNA) that codes for the same amino acid as the wild type codon in that position. In some silent mutations the codon codes for a different amino acid that happens to have the same properties as the amino acid produced by the wild type codon. Missense mutations involve substitutions that result in functionally different amino acids; these can lead to alteration or loss of protein function. Nonsense mutations, which are a severe type of base substitution, result in a stop codon in a position where there was not one before, which causes the premature termination of protein synthesis and can result in a complete loss of function in the finished protein.

[0175] Generally, conservative substitutions can be made at any position so long as the required activity is retained. So-called conservative exchanges can be carried out in which the amino acid which is replaced has a similar property as the original amino acid, for example, the exchange of Glu by Asp, Gin by Asn, Vai by lie, Leu by He, and Ser by Thr. For example, amino acids with similar properties can be Aliphatic amino acids (e.g., Glycine, Alanine, Valine, Leucine, Isoleucine); hydroxyl or sulfur / selenium-containing amino acids (e.g., Serine, Cysteine, Selenocysteine, Threonine, Methionine); Cyclic amino acids (e.g., Proline); Aromatic amino acids (e.g., Phenylalanine, Tyrosine, Tryptophan); Basic amino acids (e.g., Histidine, Lysine, Arginine); or Acidic and their Amide (e.g., Aspartate, Glutamate, Asparagine, Glutamine). Deletion is the replacement of an amino acid by a direct bond. Positions for deletions include the termini of a polypeptide and linkages between individual protein domains. Insertions are introductions of amino acids into the polypeptide chain, a direct bond formally being replaced by one or more amino acids. An amino acid sequence can be modulated with the help of art-known computer simulation programs that can produce Docket No.: 020846 / WO a polypeptide with, for example, improved activity or altered regulation. On the basis of these artificially generated polypeptide sequences, a corresponding nucleic acid molecule coding for such a modulated polypeptide can be synthesized in-vitro using the specific codon-usage of the desired host cell.

[0176] “Highly stringent hybridization conditions” are defined as hybridization at 65 °C in a 6 X SSC buffer (i.e. , 0.9 M sodium chloride and 0.09 M sodium citrate). Given these conditions, a determination can be made as to whether a given set of sequences will hybridize by calculating the melting temperature (Tm) of a DNA duplex between the two sequences. If a particular duplex has a melting temperature lower than 65°C in the salt conditions of a 6 X SSC, then the two sequences will not hybridize. On the other hand, if the melting temperature is above 65 °C in the same salt conditions, then the sequences will hybridize. In general, the melting temperature for any hybridized DNA:DNA sequence can be determined using the following formula: Tm = 81.5 °C + 16.6(log [Na+]) + 0.41 (fraction G / C content) - 0.63(% formamide) - (600 / I). Furthermore, the Tm of a DNA: DNA hybrid is decreased by 1-1 ,5°C for every 1 % decrease in nucleotide identity (see e.g., Sambrook and Russel, 2006).

[0177] Host cells can be transformed using a variety of standard techniques known to the art (see e.g., Sambrook and Russel (2006) Condensed Protocols from Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, ISBN-10: 0879697717; Ausubel et al. (2002) Short Protocols in Molecular Biology, 5th ed., Current Protocols, ISBN-10: 0471250929; Sambrook and Russel (2001 ) Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Laboratory Press, ISBN-10: 0879695773; Elhai, J. and Wolk, C. P. 1988. Methods in Enzymology 167, 747-754). Such techniques include, but are not limited to, viral infection, calcium phosphate transfection, liposome-mediated transfection, microprojectile- mediated delivery, receptor-mediated uptake, cell fusion, electroporation, and the like. The transformed cells can be selected and propagated to provide recombinant host cells that comprise the expression vector stably integrated in the host cell genome. Docket No.: 020846 / WO Docket No.: 020846 / WO

[0178] Exemplary nucleic acids that may be introduced to a host cell include, for example, DNA sequences or genes from another species, or even genes or sequences which originate with or are present in the same species, but are incorporated into recipient cells by genetic engineering methods. The term “exogenous” is also intended to refer to genes that are not normally present in the cell being transformed, or perhaps simply not present in the form, structure, etc., as found in the transforming DNA segment or gene, or genes which are normally present and that one desires to express in a manner that differs from the natural expression pattern, e.g., to over-express. Thus, the term “exogenous” gene or DNA is intended to refer to any gene or DNA segment that is introduced into a recipient cell, regardless of whether a similar gene may already be present in such a cell. The type of DNA included in the exogenous DNA can include DNA that is already present in the cell, DNA from another individual of the same type of organism, DNA from a different organism, or a DNA generated externally, such as a DNA sequence containing an antisense message of a gene, or a DNA sequence encoding a synthetic or modified version of a gene.

[0179] Host strains developed according to the approaches described herein can be evaluated by a number of means known in the art (see e.g., Studier (2005) Protein Expr Purif. 41 (1 ), 207-234; Gellissen, ed. (2005) Production of Recombinant Proteins: Novel Microbial Docket No.: 020846 / WO and Eukaryotic Expression Systems, Wiley-VCH, ISBN-10: 3527310363; Baneyx (2004) Protein Expression Technologies, Taylor & Francis, ISBN-10: 0954523253).

[0180] Methods of down-regulation or silencing genes are known in the art. For example, expressed protein activity can be down-regulated or eliminated using antisense oligonucleotides (ASOs), protein aptamers, nucleotide aptamers, and RNA interference (RNAi) (e.g., small interfering RNAs (siRNA), short hairpin RNA (shRNA), single guide RNA (sgRNA), and micro RNAs (miRNA) (see e.g., Rinaldi and Wood (2017) Nature Reviews Neurology 14, describing ASO therapies; Fanning and Symonds (2006) Handb Exp Pharmacol. 173, 289-303G, describing hammerhead ribozymes and small hairpin RNA; Helene, et al. (1992) Ann. N.Y. Acad. Sci. 660, 27-36; Maher (1992) Bioassays 14(12): 807- 15, describing targeting deoxyribonucleotide sequences; Lee et al. (2006) Curr Opin Chem Biol. 10, 1-8, describing aptamers; Reynolds et al. (2004) Nature Biotechnology 22(3), 326 - 330, describing RNAi; Pushparaj and Melendez (2006) Clinical and Experimental Pharmacology and Physiology 33(5-6), 504-510, describing RNAi; Dillon et al. (2005) Annual Review of Physiology 67, 147-173, describing RNAi; Dykxhoorn and Lieberman (2005) Annual Review of Medicine 56, 401 -423, describing RNAi). RNAi molecules are commercially available from a variety of sources (e.g., Ambion, TX; Sigma Aldrich, MO; Invitrogen). Several siRNA molecule design programs using a variety of algorithms are known to the art (see e.g., Cenix algorithm, Ambion; BLOCK-iT™ RNAi Designer, Invitrogen; siRNA Whitehead Institute Design Tools, Bioinformatics & Research Computing). Traits influential in defining optimal siRNA sequences include G / C content at the termini of the siRNAs, Tm of specific internal domains of the siRNA, siRNA length, position of the target sequence within the CDS (coding region), and nucleotide content of the 3' overhangs.

[0181] GENOME EDITING

[0182] As described herein, gene and / or protein expression signals can be modulated (e.g., reduced, eliminated, or enhanced) using genome editing.

[0183] As described herein, activity, signals, expression, or function can be modulated (e.g., reduced, eliminated, or enhanced) using genome editing (e.g., upregulate, downregulate, overexpress, underexpress, express (e.g., transgenic expression), knock in, knock out, knockdown). Docket No.: 020846 / WO

[0184] Processes for genome editing are well known; see e.g., Aldi 2018 Nature Communications 9(1911 ). Except as otherwise noted herein, therefore, the process of the present disclosure can be carried out in accordance with such processes.

[0185] For example, genome editing can comprise CRISPR / Cas9, CRISPR-Cpf1 , TALEN, or ZNFs. Adequate blockage of gene / protein expression / signaling by genome editing can result in protection from autoimmune or inflammatory diseases.

[0186] As an example, clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) systems are a new class of genome-editing tools that target desired genomic sites in mammalian cells. Recently published type II CRISPR / Cas systems use Cas9 nuclease that is targeted to a genomic site by complexing with a synthetic guide RNA that hybridizes to a 20-nucleotide DNA sequence and immediately preceding an NGG motif recognized by Cas9 (thus, a (N)2oNGG target DNA sequence). This results in a double-strand break three nucleotides upstream of the NGG motif. The double strand break instigates either non-homologous end-joining, which is error-prone and conducive to frameshift mutations that knock out gene alleles, or homology-directed repair, which can be exploited with the use of an exogenously introduced double-strand or single-strand DNA repair template to knock in or correct a mutation in the genome. Thus, genomic editing, for example, using CRISPR / Cas systems could be useful tools for therapeutic applications to target cells by the removal or addition of signals (e.g., activate (e.g., CRISPRa), upregulate, overexpress, downregulate).

[0187] For example, the methods as described herein can comprise a method for altering a target polynucleotide sequence in a cell comprising contacting the polynucleotide sequence with a clustered regularly interspaced short palindromic repeats-associated (Cas) protein.

[0188] GENE THERAPY AND GENOME EDITING

[0189] Gene therapies can include inserting a functional gene with a viral vector. Gene therapies are rapidly advancing.

[0190] There has recently been an improved landscape for gene therapies. For example, in the first quarter of 2019, there were 372 ongoing gene therapy clinical trials (Alliance for Regenerative Medicine, 5 / 9 / 19).

[0191] Any vector known in the art can be used. For example, the vector can be a viral vector selected from retrovirus, lentivirus, herpes, adenovirus, adeno-associated virus (AAV), rabies, Ebola, lentivirus, or hybrids thereof. Docket No.: 020846 / WO

[0192] Gene therapy strategies.

[0193] Gene therapy can allow for the constant delivery of the enzyme directly to target organs and eliminates the need for weekly infusions. Also, correction of a few cells could lead to the enzyme being secreted into the circulation and taken up by their neighboring cells (cross-correction), resulting in widespread correction of the biochemical defects. As such, the number of cells that must be modified with a gene transfer vector is relatively low.

[0194] Genetic modification can be performed either ex vivo or in vivo. The ex vivo strategy is based on the modification of cells in culture and transplantation of the modified cell into a patient. Cells that are most commonly considered therapeutic targets for monogenic Docket No.: 020846 / WO diseases are stem cells. Advances in the collection and isolation of these cells from a variety of sources have promoted autologous gene therapy as a viable option.

[0195] The use of endonucleases for targeted genome editing can solve the limitations presented by the usual gene therapy protocols. These enzymes are custom molecular scissors, allowing cutting DNA into well-defined, perfectly specified pieces, in virtually all cell types. Moreover, they can be delivered to the cells by plasmids that transiently express the nucleases, or by transcribed RNA, avoiding the use of viruses.

[0196] FORMULATION

[0197] The agents and compositions described herein can be formulated by any conventional manner using one or more pharmaceutically acceptable carriers or excipients as described in, for example, Remington’s Pharmaceutical Sciences (A.R. Gennaro, Ed.), 21st edition, ISBN: 0781746736 (2005), incorporated herein by reference in its entirety. Such formulations will contain a therapeutically effective amount of a biologically active agent described herein, which can be in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the subject.

[0198] The term "formulation" refers to preparing a drug in a form suitable for administration to a subject, such as a human. Thus, a "formulation" can include pharmaceutically acceptable excipients, including diluents or carriers.

[0199] The term "pharmaceutically acceptable" as used herein can describe substances or components that do not cause unacceptable losses of pharmacological activity or unacceptable adverse side effects. Examples of pharmaceutically acceptable ingredients can be those having monographs in United States Pharmacopeia (USP 29) and National Formulary (NF 24), United States Pharmacopeial Convention, Inc, Rockville, Maryland, 2005 ("USP / NF"), or a more recent edition, and the components listed in the continuously updated Inactive Ingredient Search online database of the FDA. Other useful components that are not described in the USP / NF, etc., may also be used.

[0200] The term “pharmaceutically acceptable excipient,” as used herein, can include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic, or absorption delaying agents. The use of such media and agents for pharmaceutically active substances is well known in the art (see generally Remington’s Pharmaceutical Sciences (A.R. Gennaro, Ed.), 21 st edition, ISBN: 0781746736 (2005)). Except insofar as any conventional media or agent is incompatible with an active ingredient, its use in the Docket No.: 020846 / WO therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

[0201] A "stable" formulation or composition can refer to a composition having sufficient stability to allow storage at a convenient temperature, such as between about 0 °C and about 60 °C, for a commercially reasonable period of time, such as at least about one day, at least about one week, at least about one month, at least about three months, at least about six months, at least about one year, or at least about two years.

[0202] The formulation should suit the mode of administration. The agents of use with the current disclosure can be formulated by known methods for administration to a subject using several routes which include, but are not limited to, parenteral, pulmonary, oral, topical, intradermal, intratumoral, intranasal, inhalation (e.g., in an aerosol), implanted, intramuscular, intraperitoneal, intravenous, intrathecal, intracranial, intracerebroventricular, subcutaneous, intranasal, epidural, intrathecal, ophthalmic, transdermal, buccal, and rectal. The individual agents may also be administered in combination with one or more additional agents or together with other biologically active or biologically inert agents. Such biologically active or inert agents may be in fluid or mechanical communication with the agent(s) or attached to the agent(s) by ionic, covalent, Van der Waals, hydrophobic, hydrophilic, or other physical forces.

[0203] Controlled-release (or sustained-release) preparations may be formulated to extend the activity of the agent(s) and reduce dosage frequency. Controlled-release preparations can also be used to affect the time of onset of action or other characteristics, such as blood levels of the agent, and consequently, affect the occurrence of side effects. Controlled- release preparations may be designed to initially release an amount of an agent(s) that produces the desired therapeutic effect, and gradually and continually release other amounts of the agent to maintain the level of therapeutic effect over an extended period of time. In order to maintain a near-constant level of an agent in the body, the agent can be released from the dosage form at a rate that will replace the amount of agent being metabolized or excreted from the body. The controlled-release of an agent may be stimulated by various inducers, e.g., change in pH, change in temperature, enzymes, water, or other physiological conditions or molecules.

[0204] Agents or compositions described herein can also be used in combination with other therapeutic modalities, as described further below. Thus, in addition to the therapies Docket No.: 020846 / WO described herein, one may also provide to the subject other therapies known to be efficacious for treatment of the disease, disorder, or condition.

[0205] THERAPEUTIC METHODS

[0206] Also provided is a process of treating, preventing, or reversing viral infection in a subject in need thereof via administration of a therapeutically effective amount of an immunostimulatory agent / molecule, so as to increase type I immune response and / or increase IFN expression.

[0207] Methods described herein are generally performed on a subject in need thereof. A subject in need of the therapeutic methods described herein can be a subject having, diagnosed with, suspected of having, or at risk for developing a viral infection. A determination of the need for treatment will typically be assessed by a history, physical exam, or diagnostic tests consistent with the disease or condition at issue. Diagnosis of the various conditions treatable by the methods described herein is within the skill of the art. The subject can be an animal subject, including a mammal, such as horses, cows, dogs, cats, sheep, pigs, mice, rats, monkeys, hamsters, guinea pigs, and humans or chickens. For example, the subject can be a human subject.

[0208] Generally, a safe and effective amount of immunostimulatory agent is, for example, an amount that would cause the desired therapeutic effect in a subject while minimizing undesired side effects. In various embodiments, an effective amount of immunostimulatory agent described herein can substantially inhibit, slow the progress of, or limit the development of a viral infection.

[0209] According to the methods described herein, administration can be parenteral, pulmonary, oral, topical, intradermal, intramuscular, intraperitoneal, intravenous, intratumoral, intrathecal, intracranial, intracerebroventricular, subcutaneous, intranasal, epidural, ophthalmic, buccal, or rectal administration.

[0210] When used in the treatments described herein, a therapeutically effective amount of immunostimulatory agent can be employed in pure form or, where such forms exist, in pharmaceutically acceptable salt form and with or without a pharmaceutically acceptable excipient. For example, the compounds of the present disclosure can be administered, at a reasonable benefit / risk ratio applicable to any medical treatment, in a sufficient amount to increase type I immune response and / or increase IFN expression.

[0211] The amount of a composition described herein that can be combined with a Docket No.: 020846 / WO pharmaceutically acceptable carrier to produce a single dosage form will vary depending upon the subject or host treated and the particular mode of administration. It will be appreciated by those skilled in the art that the unit content of agent contained in an individual dose of each dosage form need not in itself constitute a therapeutically effective amount, as the necessary therapeutically effective amount could be reached by administration of a number of individual doses.

[0212] Toxicity and therapeutic efficacy of compositions described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals for determining the LDso (the dose lethal to 50% of the population) and the EDso, (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index that can be expressed as the ratio LD50 / ED50, where larger therapeutic indices are generally understood in the art to be optimal.

[0213] The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the subject; the time of administration; the route of administration; the rate of excretion of the composition employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts (see e.g., Koda-Kimble et al. (2004) Applied Therapeutics: The Clinical Use of Drugs, Lippincott Williams & Wilkins, ISBN 0781748453; Winter (2003) Basic Clinical Pharmacokinetics, 4thed., Lippincott Williams & Wilkins, ISBN 0781741475; Sharqel (2004) Applied Biopharmaceutics & Pharmacokinetics, McGraw- Hill / Appleton & Lange, ISBN 0071375503). For example, it is well within the skill of the art to start doses of the composition at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose may be divided into multiple doses for purposes of administration. Consequently, single dose compositions may contain such amounts or submultiples thereof to make up the daily dose. It will be understood, however, that the total daily usage of the compounds and compositions of the present disclosure will be decided by an attending physician within the scope of sound medical judgment.

[0214] Again, each of the states, diseases, disorders, and conditions, described herein, as well as others, can benefit from compositions and methods described herein. Generally, Docket No.: 020846 / WO treating a state, disease, disorder, or condition includes reversing or delaying the appearance of clinical symptoms in a mammal that may be afflicted with or predisposed to the state, disease, disorder, or condition but does not yet experience or display clinical or subclinical symptoms thereof. Treating can also include inhibiting the state, disease, disorder, or condition, e.g., arresting or reducing the development of the disease or at least one clinical or subclinical symptom thereof. Furthermore, treating can include relieving the disease, e.g., causing regression of the state, disease, disorder, or condition or at least one of its clinical or subclinical symptoms. A benefit to a subject to be treated can be either statistically significant or at least perceptible to the subject or a physician.

[0215] Administration of immunostimulatory agent(s) can occur as a single event or over a time course of treatment. For example, immunostimulatory agent(s) can be administered daily, weekly, bi-weekly, or monthly. For treatment of acute conditions, the time course of treatment will usually be at least several days. Certain conditions could extend treatment from several days to several weeks. For example, treatment could extend over one week, two weeks, or three weeks. For more chronic conditions, treatment could extend from several weeks to several months or even a year or more.

[0216] Treatment in accord with the methods described herein can be performed prior to or before, concurrent with, or after conventional treatment modalities for viral infection.

[0217] An immunostimulatory agent can be administered simultaneously or sequentially with another agent, such as an antibiotic, an anti-inflammatory, or another agent. For example, an immunostimulatory agent can be administered simultaneously with another agent, such as an antibiotic or an anti-inflammatory. Simultaneous administration can occur through administration of separate compositions, each containing one or more of an immunostimulatory agent, an antibiotic, an anti-inflammatory, or another agent. Simultaneous administration can occur through administration of one composition containing two or more of an immunostimulatory agent, an antibiotic, an anti-inflammatory, or another agent. An immunostimulatory agent can be administered sequentially with an antibiotic, an anti-inflammatory, or another agent. For example, an immunostimulatory agent can be administered before or after administration of an antibiotic, an anti-inflammatory, or another agent.

[0218] Active compounds are administered at a therapeutically effective dosage sufficient to treat a condition associated with a condition in a patient. For example, the efficacy of a Docket No.: 020846 / WO compound can be evaluated in an animal model system that may be predictive of efficacy in treating the disease in a human or another animal, such as the model systems shown in the examples and drawings.

[0219] An effective dose range of a therapeutic can be extrapolated from effective doses determined in animal studies for a variety of different animals. In general, a human equivalent dose (HED) in mg / kg can be calculated in accordance with the following formula (see e.g., Reagan-Shaw et al., FASEB J., 22(3):659-661 , 2008, which is incorporated herein by reference):

[0220] HED (mg / kg) = Animal dose (mg / kg) x (Animal Km / Hurnan Km)

[0221] Use of the Km factors in conversion results in more accurate HED values, which are based on body surface area (BSA) rather than only on body mass. Km values for humans and various animals are well known. For example, the Km for an average 60 kg human (with a BSA of 1 .6 m2) is 37, whereas a 20 kg child (BSA 0.8 m2) would have a Km of 25. Km for some relevant animal models are also well known, including: mice Km of 3 (given a weight of 0.02 kg and BSA of 0.007); hamster Km of 5 (given a weight of 0.08 kg and BSA of 0.02); rat Km of 6 (given a weight of 0.15 kg and BSA of 0.025) and monkey Km of 12 (given a weight of 3 kg and BSA of 0.24).

[0222] Precise amounts of the therapeutic composition depend on the judgment of the practitioner and are peculiar to each individual. Nonetheless, a calculated HED dose provides a general guide. Other factors affecting the dose include the physical and clinical state of the patient, the route of administration, the intended goal of treatment, and the potency, stability, and toxicity of the particular therapeutic formulation.

[0223] The actual dosage amount of a compound of the present disclosure or composition comprising a compound of the present disclosure administered to a subject may be determined by physical and physiological factors such as type of animal treated, age, sex, body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the subject and on the route of administration. These factors may be determined by a skilled artisan. The practitioner responsible for administration will typically determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject. The dosage may be adjusted by the individual physician in the event of any complication.

[0224] In some embodiments, the immunostimulatory agent may be administered in an Docket No.: 020846 / WO amount from about 1 mg / kg to about 100 mg / kg, or about 1 mg / kg to about 50 mg / kg, or about 1 mg / kg to about 25 mg / kg, or about 1 mg / kg to about 15 mg / kg, or about 1 mg / kg to about 10 mg / kg, or about 1 mg / kg to about 5 mg / kg, or about 3 mg / kg. In some embodiments, a immunostimulatory agent / molecule such as a compound described herein may be administered in a range of about 1 mg / kg to about 200 mg / kg, or about 50 mg / kg to about 200 mg / kg, or about 50 mg / kg to about 100 mg / kg, or about 75 mg / kg to about 100 mg / kg, or about 100 mg / kg.

[0225] The effective amount may be less than 1 mg / kg / day, less than 500 mg / kg / day, less than 250 mg / kg / day, less than 100 mg / kg / day, less than 50 mg / kg / day, less than 25 mg / kg / day or less than 10 mg / kg / day. It may alternatively be in the range of 1 mg / kg / day to 200 mg / kg / day.

[0226] In other non-limiting examples, a dose may also comprise from about 1 micro- gram / kg / body weight, about 5 microgram / kg / body weight, about 10 microgram / kg / body weight, about 50 microgram / kg / body weight, about 100 microgram / kg / body weight, about 200 microgram / kg / body weight, about 350 microgram / kg / body weight, about 500 microgram / kg / body weight, about 1 milligram / kg / body weight, about 5 milligram / kg / body weight, about 10 milligram / kg / body weight, about 50 milligram / kg / body weight, about 100 milligram / kg / body weight, about 200 milligram / kg / body weight, about 350 milligram / kg / body weight, about 500 milligram / kg / body weight, to about 1000 mg / kg / body weight or more per administration, and any range derivable therein. In non-limiting examples of a derivable range from the numbers listed herein, a range of about 5 mg / kg / body weight to about 100 mg / kg / body weight, about 5 microgram / kg / body weight to about 500 milligram / kg / body weight, etc., can be administered, based on the numbers described above.

[0227] CELL THERAPY

[0228] Cells generated according to the methods described herein can be used in cell therapy. Cell therapy (also called cellular therapy, cell transplantation, or cytotherapy) can be a therapy in which viable cells are injected, grafted, or implanted into a patient in order to effectuate a medicinal effect or therapeutic benefit. For example, transplanting T-cells capable of fighting cancer cells via cell-mediated immunity can be used in the course of immunotherapy, grafting stem cells can be used to regenerate diseased tissues, or transplanting beta cells can be used to treat diabetes. Docket No.: 020846 / WO

[0229] Stem cell and cell transplantation has gained significant interest by researchers as a potential new therapeutic strategy for a wide range of diseases, in particular for degenerative and immunogenic pathologies.

[0230] Allogeneic cell therapy or allogenic transplantation uses donor cells from a different subject than the recipient of the cells. A benefit of an allogeneic strategy is that unmatched allogenic cell therapies can form the basis of "off the shelf" products.

[0231] Autologous cell therapy or autologous transplantation uses cells that are derived from the subject’s own tissues. It could also involve the isolation of matured cells from diseased tissues, to be later re-implanted at the same or neighboring tissues. A benefit of an autologous strategy is that there is limited concern for immunogenic responses or transplant rejection.

[0232] Xenogeneic cell therapies or xenotransplantation uses cells from another species. For example, pig derived cells can be transplanted into humans. Xenogeneic cell therapies can involve human cell transplantation into experimental animal models for assessment of efficacy and safety or enable xenogeneic strategies to humans as well.

[0233] ADMINISTRATION

[0234] Agents and compositions described herein can be administered according to methods described herein in a variety of means known to the art. The agents and composition can be used therapeutically either as exogenous materials or as endogenous materials. Exogenous agents are those produced or manufactured outside of the body and administered to the body. Endogenous agents are those produced or manufactured inside the body by some type of device (biologic or other) for delivery within or to other organs in the body.

[0235] As discussed above, administration can be parenteral, pulmonary, oral, topical, intradermal, intratumoral, intranasal, inhalation (e.g., in an aerosol), implanted, intramuscular, intraperitoneal, intravenous, intrathecal, intracranial, intracerebroventricular, subcutaneous, intranasal, epidural, intrathecal, ophthalmic, transdermal, buccal, and rectal.

[0236] Agents and compositions described herein can be administered in a variety of methods well known in the arts. Administration can include, for example, methods involving oral ingestion, direct injection (e.g., systemic or stereotactic), implantation of cells engineered to secrete the factor of interest, drug-releasing biomaterials, polymer matrices, gels, permeable membranes, osmotic systems, multilayer coatings, microparticles, implantable matrix devices, mini-osmotic pumps, implantable pumps, injectable gels and hydrogels, Docket No.: 020846 / WO liposomes, micelles (e.g., up to 30 pm), nanospheres (e.g., less than 1 pm), microspheres (e.g., 1-100 pm), reservoir devices, a combination of any of the above, or other suitable delivery vehicles to provide the desired release profile in varying proportions. Other methods of controlled-release delivery of agents or compositions will be known to the skilled artisan and are within the scope of the present disclosure.

[0237] Delivery systems may include, for example, an infusion pump which may be used to administer the agent or composition in a manner similar to that used for delivering insulin or chemotherapy to specific organs or tumors. Typically, using such a system, an agent or composition can be administered in combination with a biodegradable, biocompatible polymeric implant that releases the agent over a controlled period of time at a selected site. Examples of polymeric materials include polyanhydrides, polyorthoesters, polyglycolic acid, polylactic acid, polyethylene vinyl acetate, and copolymers and combinations thereof. In addition, a controlled release system can be placed in proximity of a therapeutic target, thus requiring only a fraction of a systemic dosage.

[0238] Agents can be encapsulated and administered in a variety of carrier delivery systems. Examples of carrier delivery systems include microspheres, hydrogels, polymeric implants, smart polymeric carriers, and liposomes (see generally, Uchegbu and Schatzlein, eds. (2006) Polymers in Drug Delivery, CRC, ISBN-10: 0849325331 ). Carrier-based systems for molecular or biomolecular agent delivery can: provide for intracellular delivery; tailor biomolecule / agent release rates; increase the proportion of biomolecule that reaches its site of action; improve the transport of the drug to its site of action; allow colocalized deposition with other agents or excipients; improve the stability of the agent in vivo, prolong the residence time of the agent at its site of action by reducing clearance; decrease the nonspecific delivery of the agent to nontarget tissues; decrease irritation caused by the agent; decrease toxicity due to high initial doses of the agent; alter the immunogenicity of the agent; decrease dosage frequency; improve taste of the product; or improve shelf life of the product.

[0239] SCREENING

[0240] Also provided are screening methods.

[0241] The subject methods find use in the screening of a variety of different candidate molecules (e.g., potentially therapeutic candidate molecules). Candidate substances for screening according to the methods described herein include, but are not limited to, fractions of tissues or cells, nucleic acids, polypeptides, siRNAs, antisense molecules, aptamers, Docket No.: 020846 / WO ribozymes, triple helix compounds, antibodies, and small (e.g., less than about 2000 MW, or less than about 1000 MW, or less than about 800 MW) organic molecules or inorganic molecules including but not limited to salts or metals.

[0242] Candidate molecules encompass numerous chemical classes, for example, organic molecules, such as small organic compounds having a molecular weight of more than 50 and less than about 2,500 Daltons. Candidate molecules can comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl, or carboxyl group, and usually at least two of the functional chemical groups. The candidate molecules can comprise cyclical carbon or heterocyclic structures and / or aromatic or polyaromatic structures substituted with one or more of the above functional groups.

[0243] A candidate molecule can be a compound in a library database of compounds. One of skill in the art will be generally familiar with, for example, numerous databases for commercially available compounds for screening (see e.g., ZINC database, UCSF, with 2.7 million compounds over 12 distinct subsets of molecules; Irwin and Shoichet (2005) J Chem Inf Model 45, 177-182). One of skill in the art will also be familiar with a variety of search engines to identify commercial sources or desirable compounds and classes of compounds for further testing (see e.g., ZINC database; eMolecules.com; and electronic libraries of commercial compounds provided by vendors, for example, ChemBridge, Princeton BioMolecular, Ambinter SARL, Enamine, ASDI, Life Chemicals, etc.).

[0244] Candidate molecules for screening according to the methods described herein include both lead-like compounds and drug-like compounds. A lead-like compound is generally understood to have a relatively smaller scaffold-like structure (e.g., molecular weight of about 150 to about 350 kD) with relatively fewer features (e.g., less than about 3 hydrogen donors and / or less than about 6 hydrogen acceptors; hydrophobicity character xlogP of about -2 to about 4). In contrast, a drug-like compound is generally understood to have a relatively larger scaffold (e.g., molecular weight of about 150 to about 500 kD) with relatively more numerous features (e.g., less than about 10 hydrogen acceptors and / or less than about 8 rotatable bonds; hydrophobicity character xlogP of less than about 5) (see e.g., Lipinski (2000) J. Pharm. Tox. Methods 44, 235-249). Initial screening can be performed with lead-like compounds.

[0245] When designing a lead from spatial orientation data, it can be useful to understand Docket No.: 020846 / WO that certain molecular structures are characterized as being “drug-like”. Such characterization can be based on a set of empirically recognized qualities derived by comparing similarities across the breadth of known drugs within the pharmacopoeia. While it is not required for drugs to meet all, or even any, of these characterizations, it is far more likely for a drug candidate to meet with clinical success if it is drug-like.

[0246] Several of these “drug-like” characteristics have been summarized into the four rules of Lipinski (generally known as the “rules of fives” because of the prevalence of the number 5 among them). While these rules generally relate to oral absorption and are used to predict the bioavailability of a compound during lead optimization, they can serve as effective guidelines for constructing a lead molecule during rational drug design efforts such as may be accomplished by using the methods of the present disclosure.

[0247] The four “rules of five” state that a candidate drug-like compound should have at least three of the following characteristics: (i) a weight less than 500 Daltons; (ii) a log of P less than 5; (iii) no more than 5 hydrogen bond donors (expressed as the sum of OH and NH groups); and (iv) no more than 10 hydrogen bond acceptors (the sum of N and O atoms). Also, drug-like molecules typically have a span (breadth) of between about 8A to about 15A.

[0248] KITS

[0249] Also provided are kits. Such kits can include an agent or composition described herein and, in certain embodiments, instructions for administration. Such kits can facilitate performance of the methods described herein. When supplied as a kit, the different components of the composition can be packaged in separate containers and admixed immediately before use. Components include, but are not limited to immunostimulatory agents / molecules described herein. Such packaging of the components separately can, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the composition. The pack may, for example, comprise metal or plastic foil such as a blister pack. Such packaging of the components separately can also, in certain instances, permit long-term storage without losing activity of the components.

[0250] Kits may also include reagents in separate containers such as, for example, sterile water or saline to be added to a lyophilized active component packaged separately. For example, sealed glass ampules may contain a lyophilized component and in a separate ampule, sterile water, sterile saline each of which has been packaged under a neutral nonreacting gas, such as nitrogen. Ampules may consist of any suitable material, such as glass, Docket No.: 020846 / WO organic polymers, such as polycarbonate, polystyrene, ceramic, metal, or any other material typically employed to hold reagents. Other examples of suitable containers include bottles that may be fabricated from similar substances as ampules and envelopes that may consist of foil-lined interiors, such as aluminum or an alloy. Other containers include test tubes, vials, flasks, bottles, syringes, and the like. Containers may have a sterile access port, such as a bottle having a stopper that can be pierced by a hypodermic injection needle. Other containers may have two compartments that are separated by a readily removable membrane that upon removal permits the components to mix. Removable membranes may be glass, plastic, rubber, and the like.

[0251] In certain embodiments, kits can be supplied with instructional materials. Instructions may be printed on paper or another substrate, and / or may be supplied as an electronic- readable medium or video. Detailed instructions may not be physically associated with the kit; instead, a user may be directed to an Internet web site specified by the manufacturer or distributor of the kit.

[0252] A control sample or a reference sample as described herein can be a sample from a healthy subject or sample, a wild-type subject or sample, or from populations thereof. A reference value can be used in place of a control or reference sample, which was previously obtained from a healthy subject or a group of healthy subjects or a wild-type subject or sample. A control sample or a reference sample can also be a sample with a known amount of a detectable compound or a spiked sample.

[0253] Compositions and methods described herein utilizing molecular biology protocols can be according to a variety of standard techniques known to the art (see e.g., Sam brook and Russel (2006) Condensed Protocols from Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, ISBN-10: 0879697717; Ausubel et al. (2002) Short Protocols in Molecular Biology, 5th ed., Current Protocols, ISBN-10: 0471250929; Sambrook and Russel (2001 ) Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Laboratory Press, ISBN-10: 0879695773; Elhai, J. and Wolk, C. P. 1988. Methods in Enzymology 167, 747-754; Studier (2005) Protein Expr Purif. 41 (1 ), 207-234; Gellissen, ed. (2005) Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems, Wiley-VCH, ISBN-10: 3527310363; Baneyx (2004) Protein Expression Technologies, Taylor & Francis, ISBN-10: 0954523253).

[0254] Definitions and methods described herein are provided to better define the present Docket No.: 020846 / WO disclosure and to guide those of ordinary skill in the art in the practice of the present disclosure. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art.

[0255] In some embodiments, numbers expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth, used to describe and claim certain embodiments of the present disclosure are to be understood as being modified in some instances by the term “about.” In some embodiments, the term “about” is used to indicate that a value includes the standard deviation of the mean for the device or method being employed to determine the value. In some embodiments, the numerical parameters set forth in the written description and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by a particular embodiment. In some embodiments, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the present disclosure are approximations, the numerical values set forth in the specific examples are reported as precisely as practicable. The numerical values presented in some embodiments of the present disclosure may contain certain errors necessarily resulting from the standard deviation found in their respective testing measurements. The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. The recitation of discrete values is understood to include ranges between each value.

[0256] In some embodiments, the terms “a” and “an” and “the” and similar references used in the context of describing a particular embodiment (especially in the context of certain of the following claims) can be construed to cover both the singular and the plural, unless specifically noted otherwise. In some embodiments, the term “or” as used herein, including the claims, is used to mean “and / or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive.

[0257] The terms “comprise,” “have” and “include” are open-ended linking verbs. Any forms or tenses of one or more of these verbs, such as “comprises,” “comprising,” “has,” “having,” “includes” and “including,” are also open-ended. For example, any method that “comprises,” “has” or “includes” one or more steps is not limited to possessing only those one or more Docket No.: 020846 / WO steps and can also cover other unlisted steps. Similarly, any composition or device that “comprises,” “has” or “includes” one or more features is not limited to possessing only those one or more features and can cover other unlisted features.

[0258] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided with respect to certain embodiments herein is intended merely to better illuminate the present disclosure and does not pose a limitation on the scope of the present disclosure otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the present disclosure.

[0259] Groupings of alternative elements or embodiments of the present disclosure disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.

[0260] All publications, patents, patent applications, and other references cited in this application are incorporated herein by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, or other reference was specifically and individually indicated to be incorporated by reference in its entirety for all purposes. Citation of a reference herein shall not be construed as an admission that such is prior art to the present disclosure.

[0261] Having described the present disclosure in detail, it will be apparent that modifications, variations, and equivalent embodiments are possible without departing the scope of the present disclosure defined in the appended claims. Furthermore, it should be appreciated that all examples in the present disclosure are provided as non-limiting examples.

[0262] EXAMPLES

[0263] The following non-limiting examples are provided to further illustrate the present disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent approaches found to function well in the practice of the present disclosure, and thus can be considered to constitute examples of modes for its Docket No.: 020846 / WO practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the present disclosure.

[0264] EXAMPLE 1 - TERMINAL LOOP SEQUENCES IN VIRAL DOUBLE-STRANDED RNAS MODULATE RIG-1 SIGNALING

[0265] This example shows that immune-activating copy-back viral genomes (cbVGs) contain RNA stem loops away from the 5’ end of the RNA that enhance RIG-I signaling and IFN expression. Importantly, the sequence of the terminal loops of the activating motifs impacts the strength of IFN expression. Additionally shown is that synthetic versions of these cbVG-derived stem loops trigger innate immune responses in mice demonstrating their use as immunostimulants in vivo.

[0266] INTRODUCTION

[0267] Retinoic acid-inducible gene I (RIG-I) is an important cytoplasmic sensor of viral infections that initiate the antiviral immune response. The RIG-l-like receptor (RLR) family includes RIG-I, melanoma differentiation-associated protein 5 (MDA5), and laboratory of genetics and physiology 2 (LGP2), which are host proteins that bind to RNAs and initiate the antiviral response. Binding of RLRs by foreign RNA triggers a signaling cascade through the mitochondrial antiviral signaling (MAVS) protein that ends in the expression of antiviral proteins, including type I and III interferons (IFNs). RIG-I contains a C-terminal regulatory domain that recognizes the foreign RNA and drives conformational changes in the protein helicase domain to wrap around the RNA. These conformational changes also release caspase activation and recruitment domains (CARDs) that promote oligomerization of the RIG-I proteins and signaling through MAVS. RLRs recognize unique pathogen associated molecular patterns (PAMPs) found in foreign RNA but not in the host cell RNAs.

[0268] The most well-studied of the RLR PAMPs are within the RNAs that activate RIG-I. The regulatory domain of RIG-I detects terminal 5’ triphosphates on RNA and the detection of this motif can be inhibited by methylation of the 5’ end of the RNA. While ssRNA can activate RIG-I, the highest activation occurs when blunt ended dsRNA contains the 5’ triphosphate. The addition of overhangs to the end of the dsRNA limits activation of RIG-I. RIG-I is activated best by short dsRNA while longer synthetic dsRNAs such as poly l:C (> 500nt in length) Docket No.: 020846 / WO activate MDA5. With these guidelines in place, minimal ligands for activating RIG-1 that contain a short 10 base pair dsRNA stem with a 5’ triphosphate have been synthetically generated. While these studies have provided critical data to identify the motifs that RIG-I will bind to in the RNA, in general, they are not based on RNAs found naturally during viral infections. Further work is thus needed to confirm and identify the characteristics of viral RNAs that activate RIG-I signaling during infection.

[0269] Previously, it was determined that the RNA that most robustly activates RIG-I signaling during Sendai Virus (SeV) infection is a copy-back viral genome (cbVG). CbVGs contain complementary ends predicted to form a blunt-ended dsRNA PAMP with a 5’ triphosphate, characteristic of the canonical RIG-I ligand. However, detailed folding analyses of the most prominent cbVG from SeV (cbVG 546) revealed a much more complex folding of the molecule, including a stem loop that is necessary for strong activation of the RIG-I pathway to stimulate IFN expression. This stem loop is comprised of nucleotides 70-11 of cbVG 546, and when transferred to inert RNAs, it significantly enhanced the immunostimulatory capability of the RNA. Interestingly, the removal of stem loop 70-114 from cbVG 546 severely decreased RIG-I activation even though the cbVG still contained the 5’ triphosphate and blunt-end dsRNA.

[0270] It is unknown how SeV 70-114 enhanced RIG-I activity or whether other RIG-I stimulatory cbVGs contain stem loops similar to SeV 70-114. Therefore, this example sought to determine if other viral cbVGs contain RNA stem loops that can transfer RIG-I stimulatory activity to otherwise inert RNAs and identify features of these RNA stem loops that are necessary for robust RIG-I activation. Here, multiple sequences were identified in cbVGs from human respiratory syncytial virus (RSV) and Nipah virus (NiV) infections that can transfer RIG-I stimulatory activity to the inert X RNA from the hepatitis C virus. Through mutation of the terminal loop sequences of the cbVG-derived RNAs, it was discovered that specific nucleotides in the terminal loop of the RNA are necessary for strong activation of RIG-I signaling in cells. Lastly, in vivo administration of the cbVG-derived RNA loops activated innate immune signaling pathways, suggesting their potential use as immunostimulants for vaccines and immunotherapies.

[0271] RESULTS Docket No.: 020846 / WQ

[0272] RSV and NiV cbVGs stimulate interferon expression

[0273] To identify additional natural RNA stem loops that could activate antiviral innate immune pathways, previously identified cbVGs were selected from either RSV (RSV cbVG 236) and NiV (DI15, here called NiV cbVG 378). First it was determined that if these cbVGs can activate the IFN signaling pathway in human A549 lung cells and found that / n vitro transcribed RNAs of both RSV cbVG 236 and NiV cbVG 378 could stimulate the transcription of type I (JFNB1) and type III (JFNL1) interferons at 6 hours post transfection, but not the hepatitis C virus X region (FIG. 1 A, FIG. 1 B). This IFN activation was largely MAVS-dependent, confirming activation of the RLR signaling, similar to what was reported for SeV cbVG 268, a shortened version of cbVG 546 (FIG. 1 C).

[0274] RSV cbVGs contain immunostimulatory stem loops

[0275] To identify which specific RSV cbVG 236 sequence confers a strong RIG-I stimulatory activity to the molecule, a series of deletions were made in cbVG 236 that either removed internal sequences disrupting the stem loops or removed a complementary end of the cbVG (FIG. 2A). It was found that nucleotides 1-48 and 189-236 in the complementary ends of cbVG 236 contribute to RIG-I activation, as deletion mutants del 1-48 and 189-236 lost immunostimulatory activity (FIG. 2B, Table 3). Interestingly, it was also found that nucleotides 49-100 are necessary for maximum IFN expression. Mutants with deletions in this range (del 49-187 and del 64-187) show reduced stimulation of the IFN response, but del 101-147 and del 137-187 induced strong IFN expression.

[0276] Table 3: Sequences of deletions in RSV cbVG 236. Docket No.: 020846 / WO

[0277] To determine if these RNA sequences can enhance expression of IFNs to an otherwise inert RNA molecule / sequence, the RSV cbVG sequences were transferred to the inert X RNA motif from the hepatitis C virus, ensuring that the overall structures of the final molecules were similar (FIG. 7A). It was found that X-region chimeras carrying RSV cbVG sequences 1-48 or 39-68 induced the highest IFN expression when transfected into A549 cells, but RSV cbVG sequence 189-236 did not significantly enhance IFN expression in this context (FIG. 2C), suggesting that additional features of the 189-236 region participate in inducing IFN expression.

[0278] To determine if specific immunostimulatory stem loops were present within the immunostimulatory sequences, in silico prediction of the RNA stem loops was performed using RNAfold. Since the complement ends of the cbVGs interfere with the in silico folding predictions based on minimal free energy, and it is likely that favorable secondary structures form during RNA synthesis rather than once the entire molecule has been produced, all possible RNA structures were determined on partial cbVGs lacking either the 3’ or 5’ complementary sequences. RSV cbVG 236 was predicted to form five RNA stem loops (FIG. 2D, FIG. 6A) in the absence of 3’-5’ complementation with two of the stem loops (1-34 and 39-68) present within the immunostimulatory sequences. RNA folding of X region + RSV 1- 48 predicted an immunostimulatory stem loop of sequence 1-34 similar to the full length cbVG (FIG. 7A).

[0279] NiV cbVGs contain immunostimulatory stem loops Docket No.: 020846 / WO

[0280] Similar to RSV, a series of deletions were made to remove specific RNA sequences from NiV cbVG 378 and determined which portions of the cbVG are necessary for strong IFN expression. It was found that nucleotides within the complementary ends of the cbVG were necessary for strong expression of IFNs and removal of nucleotides 325-360 also decreased IFN expression (FIG. 3A, FIG. 3B). When attached to the X RNA, it was found that while NiV 325-360 induced IFNB1 and IFNL1 expression, NiV sequences 44-78 and 85-136 induced greater IFN expression (FIG. 3C, Table 4). NiV cbVG 378 is predicted to have eight RNA stem loops (FIG. 3D, FIG. 8A) with stem loops of NiV 44-78 and NiV 85-136 enhancing IFN stimulation when transferred to the inert X RNA. Unexpectedly, deletion of 44-78 or 85-136 sequences did not significantly reduce IFNL1 expression from upon RNA transfection, suggesting that the RNA folds differently in these regions of the complementary ends than what was predicted in silico.

[0281] Table 4: Sequences of deletions in NiV cbVG 378. Docket No.: 020846 / WO

[0282] Terminal loop sequences are critical for IFN expression

[0283] Next, the characteristics conserved among high immunostimulatory RNA sequences versus lower immunostimulatory sequences were investigated (FIG. 4A). The cbVG RNAs are predicted to form stem loops that are diverse in their size and shape. However, two complementary sequences that are predicted to form loops with the same structure (RSV 1- 34 and RSV 203-236) exhibit different immunostimulatory capabilities (FIG. 2C). No significant differences were observed in the minimum free energy (MFE) between the stem loops, most of which had a predicted MFE between -6 and -10 kcal / mol. Upon observation, it was found that the terminal loops with the higher immunostimulatory activity contain either a CAA motif or poly-A stretch at the tip of the loop (FIG. 4A). In contrast, the low immunostimulatory loops are instead U-rich at the terminal loop residues, except for NiV 324-361 which contains an A-rich terminal loop.

[0284] It was then hypothesized that the terminal loop adenines played a key role in triggering RIG-1 signaling. To test this hypothesis, the terminal loops of the X-RNA attached sequences Docket No.: 020846 / WO were mutated and their ability to induce IFN expression tested. Mutation of the terminal loop sequence did not alter the overall structure of the stem loops (FIG. 9A, FIG. 10A, FIG. 11 A, FIG. 12A). For X + SeV 70-114, it was found that mutation of the A89 or A90 terminal residues greatly reduced IFN activation by the RNA construct, however mutation of the C88 residue did not (FIG. 4B). Mutations in X + RSV 1 -48 showed that A18, but not C17 or A19, was necessary for full IFN activation (FIG. 4C). Additionally, mutation of X + NiV 85-136 showed that both terminal adenines, A111 and A112, were necessary for IFN signaling (FIG. 4D). However, this trend was not observed for the low immunostimulatory X + NiV 324-361 , which did not show a reduction in IFN stimulation upon mutation of the terminal adenines (FIG. 4E). These data suggest that terminal adenines are critical to trigger robust IFN expression and that additional sequence-specific factors impact their stimulatory activity.

[0285] RSV 1-48 activates innate immune signaling in vivo

[0286] Previously, it was found that the SeV cbVG 546 stem loop 70-114 activates a strong type I immune responses in mice when administered alone or within a lipid nanoparticle (LNP). Here, the aim is to determine whether RSV sequence 1-48 similarly activates innate sensors and induces an immune response in vivo. To ensure the RNA constructs were delivered intracellularly to trigger the RIG-I pathway, the X + RSV 1-48 and the control X + RSV 189-236 chimera constructs were packaged into LNPs (FIG. 5A) and the homogeneity of the formulations were confirmed before in vivo administration (FIG. 5B). These formulations were then administered subcutaneously in the footpad of C57BL / 6 mice. After 16 hours, it was found that LNPs containing X + RSV 1-48 induced significantly higher expression of IFNB1, MX1, IL1B, and CXCL10 compared to empty LNPs and X + RSV 189- 236 (FIG. 5C). These data demonstrate that the RSV cbVG-derived 1-48 sequence retains its immunostimulatory activity in vivo when packaged into LNPs and together with data from SeV 70-114 demonstrate that small RNA motifs with terminal loop adenines can serve as potent immunostimulators in mice.

[0287] DISCUSSION

[0288] It was identified that multiple RNA stem loops derived from cbVGs of RSV and NiV that can transfer robust IFN stimulatory capabilities to an inert RNA. One feature of the higher immunostimulatory RNA stem loops is a richness for adenines at the tip of the loop. When Docket No.: 020846 / WO these sequences were mutated, the mutant RNAs stimulated significantly less IFN upon transfection into cells. Upon packaging into lipid nanoparticles, the RSV cbVG-derived stem loop was able to activate innate immune signaling in mice.

[0289] While the enhanced stimulation appears to occur with adenine-rich sequences, it was also observed that a stem loop with 5 adenines (NiV 325-360) did not have decreased IFN activation when the adenines were mutated (FIG. 4E). While an adenine-rich loop has been demonstrated to enhance IFN expression, an exact motif or motifs that make up an optimal terminal loop PAMP are to be determined. Some possibilities are that sequences in the stems of the RNA interact with the loop to alter binding or that host proteins are recognizing a specific RNA motif that is more than adenines.

[0290] One major question that remains is what step of the RIG-1 pathway is impacted by these terminal adenine-rich sequence. The following possibilities for how the terminal loop sequences may alter IFN expression were proposed: 1 ) RIG-I is heavily modulated by phosphorylation and ubiquitination by host proteins, so the terminal loop may recruit or inhibit additional host factors from interacting and altering RIG-I function in cells. 2) MAVS has recently been shown to interact with host RNAs. The terminal sequence may stabilize RIG-I binding to MAVS through RNA / MAVS interactions and enhance downstream signaling to boost IFN expression. 3) The terminal loop adenines may be prone to RNA modifications such as N6 methylation to generate N6 methyladenosine (m6A). m6A RNA modification can alter the stability of the RNA in a cell and modulate the binding of RNA binding proteins. 4) Other unknown host RNA-binding proteins support robust RIG-I signaling. Further investigation will parse out what interactions occur with this terminal loop sequence and why adenine-rich sequences enhance IFN expression from the RIG-I pathway.

[0291] With the advent of mRNA vaccines and the usage of synthetic RNAs as therapeutics, understanding how RNAs can activate innate immunity is crucial to optimizing RNA-based adjuvants and treatments. Synthetic RNAs can act as immune adjuvants during vaccination, and the addition of immunostimulatory stem loops to mRNA vaccines may bypass the need for additional adjuvants such as alum. Although additional work is necessary to assess the immunostimulatory properties of RNA stem loops in vivo, As shown herein, the terminal loop sequence modulates immune activation and enables determination of strategies to tailor the Docket No.: 020846 / WQ immune response not only based on dosage of stimulatory RNA, but on the sequence of attached RNA stem loops.

[0292] MATERIALS AND METHODS

[0293] Cells and Reagents.

[0294] A549 human type II alveolar cells (ATCC, CCL-185) and MAVS-KO A549 cells (gifted from S. Weiss) were cultured at 37°C and 5% CO2 with Dulbecco’s modified Eagle’s media (Thermofisher, 11995065) supplemented with 10% fetal bovine serum (FBS), 1 mM sodium pyruvate, 2 mM L-Glutamine, and 50 mg / mL gentamicin. All cell lines were treated with mycoplasma removal agent (MP Biomedicals, 093050044) and routinely tested for mycoplasma before use.

[0295] In Vitro Transcription of RNA.

[0296] RNAs were cloned into a pSL1180-T7 plasmid that contains T7 promoter at the 5’ end of the RNA sequence and hepatitis D virus ribozyme after the RNA sequence. In vitro transcription was performed with the Megascript T7 Transcription Kit (Thermofisher, AM 1334) and RNA was isolated with LiCI precipitation according to manufacturer’s protocols. Purified RNA was measured by Qubit and tested for quality by Bioanalyzer (Agilent).

[0297] RT-PCR and qPCR.

[0298] A549 cells were transfected with 5 pmol of indicated RNA and Lipofectamine 2000 (Thermofisher, 11668027). After 6 hours, RNA was isolated with Trizol (Thermofisher, 15596026). cDNA was generated with random hexamers using the High-Capacity RNA to cDNA kit (Thermofisher, 4387406) according to the manufacturer’s protocols. For qPCR quantification, cDNA was quantified with Power SYBR Green Mix (Thermofisher, 4367660). IFNL1, IFNB1, IL1B, MX1, and CXCL10 were normalized to a housekeeping index calculated from ACTB and GAPDH genes. Sequences of primers are given in Table 5.

[0299] Table 5: qPCR Primer Sequences Docket No.: 020846 / WO

[0300] Mice.

[0301] C57BL / 6 mice (The Jackson Laboratory) were bred in house. All mice were sex and age matched. Both male and female mice were included in the experiments. Lipid Nanoparticle formulation.

[0302] X + RSV 1-48 and X + RSV 189-236 were encapsulated in the GenVoy Ionizable Lipid Mix (ILM) using a NanoAssemblr Ignite machine (Precision Nanosystems) following the manufacturer’s instructions. Empty LNPs were performed and used as controls. Encapsulation efficiency and RNA concentration were tested by Ribogreen Assay (ThermoFisher). Final particle size was measured by Dynamic Light Scattering.

[0303] Mice immunization.

[0304] Mice were anesthetized with isoflurane and injected subcutaneously (s.c.) into a rear footpad. For immune response studies mice were inoculated with 0.5 pg X 1-48; 0.5 pg x Docket No.: 020846 / WO

[0305] 189-236; Empty LNPs or PBS at a final volume of 30 pl per dose. RNA was extracted from footpad 16 hours after inoculation using TRIzol (Ambion Inc.).

[0306] In Silico RNA Folding Prediction.

[0307] All RNA folding predictions were performed using the University of Vienna RNAfold website with the ViennaRNA Package (Version 2.6.3). Structures shown are the minimum free energy structures.

[0308] Statistical Analysis and Reproducibility.

[0309] All statistics were calculated using GraphPad Prism. Version 9. Specific tests and significance values are indicated in each figure legend. Data reported are biological triplicates unless otherwise stated.

Claims

Docket No.: 020846 / WOCLAIMSWhat is claimed is:1 . An immunostimulatory composition comprising: an immunostimulatory molecule comprising at least one portion of a copy-back viral genome (cbVG); and a lipid nanoparticle.

2. The immunostimulatory composition of claim 1 , wherein the at least one portion of the cbVG is from a virus selected from human respiratory syncytial virus (RSV), Sendai virus (SeV), and Nipah virus (NiV).

3. The immunostimulatory composition of claim 1 , wherein the at least one portion of the cbVG comprises at least one RNA stem loop.

4. The immunostimulatory composition of claim 3, wherein the at least one RNA stem loop comprises one or more regions selected from a CAA motif region and an AAAA adenine rich region.

5. The immunostimulatory composition of claim 1 , wherein the immunostimulatory molecule further comprises a portion of an inert RNA sequence.

6. The immunostimulatory composition of claim 5, wherein the inert RNA sequence is an X RNA sequence.

7. The immunostimulatory composition of claim 6, wherein the X RNA sequence comprises SEQ ID NO: 20.

8. The immunostimulatory composition of claim 2, wherein the at least one portion of the cbVG is selected from SEQ ID NO: 1 , 3-10, 16, 18, 19, and 28-34.Docket No.: 020846 / WO9. The immunostimulatory composition of claim 6, wherein the at least one portion of the cbVG is selected from SEQ ID NO: 21-27 and 35.

10. A method of stimulating an immune system in a subject in need thereof, the method comprising: administering to the subject an immunostimulatory composition, wherein the compositions comprises: an immunostimulatory molecule comprising at least one portion of a copy- back viral genome (cbVG); and a lipid nanoparticle.11 . The method of claim 10, wherein the at least one portion of the cbVG is from a virus selected from human respiratory syncytial virus (RSV), Sendai virus (SeV), and Nipah virus (NiV).

12. The method of claim 10, wherein the at least one portion of the cbVG comprises at least one RNA stem loop.

13. The method of claim 12, wherein the at least one RNA stem loop comprises one or more regions selected from a CAA motif region and an AAAA adenine rich region.

14. The method of claim 10, wherein the immunostimulatory composition activates RIG- 1 signaling.

15. The method of claim 14, wherein activating RIG-1 signaling induces expression of one or more proteins selected from IFNB1, MX1, IL1B, and CXCL10.

16. The method of claim 10, wherein the immunostimulatory molecule further comprises a portion of an inert RNA sequence.

17. The method of claim 16, wherein the inert RNA sequence is an X RNA sequence.Docket No.: 020846 / WO18. The method of claim 15, wherein the X RNA sequence comprises SEQ ID NO: 20.

19. The method of claim 17, wherein the at least one portion of the cbVG is selected from SEQ ID NO: 21-27 and 35.

20. The method of claim 10, wherein the subject has a viral infection.