Use of s100a8 / a9 and complement 3 inhibitor in preparation of drug for treating or preventing cachexia

Abstract

The present invention relates to the use of an s100a8 / a9 and complement 3 inhibitor in the preparation of a drug for treating or preventing cachexia. The treatment or prevention of cachexia comprises increasing the body weight, lean body mass and fat mass, and increasing food intake in a cachectic subject, or preventing fat mass consumption, slowing the rate of body weight loss, the rate of fat mass loss and the rate of lean body mass loss, counteracting anorexia, muscle strength loss, fatigue and body weight loss, or improving abnormal biochemical results. Provided is a new understanding for the mechanism of energy balance regulation in cancer cachexia, with an emphasis on the effects of S100a8 / a9 and C3 in cancer cachexia. The inhibition of S100a8 / a9 and complement 3 can promote fat recovery and increase food intake. Particularly, it is verified that an S100a8 / a9 inhibitor can prevent body weight loss, especially adipose tissue loss, in a cachectic subject, and significantly increases food intake in the subject.

Description

Use of S100A8 / A9 and complement 3 inhibitors in the preparation of drugs for the treatment or prevention of cachexia Technical Field

[0001] This invention relates to the field of pharmaceutical applications, specifically providing the use of s100a8 / a9 and complement 3 inhibitors in the preparation of medicaments for the treatment or prevention of cachexia. Background Technology

[0002] Cancer cachexia is a common complication of cancer, characterized by significant weight loss, particularly the loss of fat and muscle tissue, along with weakness, fatigue, and other symptoms; it is a wasting syndrome. It typically occurs in the later stages of cancer and is associated with tumor growth. Cancer cachexia not only affects a patient's nutritional status but also leads to decreased immune function, muscle atrophy, and energy metabolism disorders, making it a life-threatening condition. Clinical observations show that cancer cachexia is often accompanied by the loss of fat mass, and this process often takes precedence over muscle loss. Nevertheless, the specific mechanisms of cancer cachexia, especially the regulatory mechanisms of energy balance, remain not fully understood, and therefore there is currently no cure.

[0003] A key characteristic of cancer cachexia is energy imbalance, typically manifested as insufficient food intake or excessive energy expenditure. However, despite significant fat loss, many patients with cancer cachexia do not exhibit the typical increase in appetite or decrease in energy expenditure, a phenomenon that remains poorly understood. Research suggests that complex changes in metabolic function may occur in cachexia patients, with tumor metabolism, fat metabolism, and interactions with other tissues likely playing significant roles. Tumors not only obtain nutrients from the host's food intake but may also meet their growth needs by consuming the host's fat and other tissues.

[0004] Furthermore, previous studies have found that although reduced fat mass is one of the main characteristics of cancer cachexia, fat loss does not trigger an increase in food intake or a decrease in energy expenditure similar to that caused by ordinary energy deficiency. This suggests that there are certain compensatory mechanisms in the metabolic process of cancer cachexia, which may involve interactions between different tissues, including the complex relationship between tumors and other metabolic organs such as brown adipose tissue (BAT).

[0005] Current treatment options for cancer cachexia mainly fall into the following categories:

[0006] 1. Nutritional support and appetite stimulation therapy

[0007] Oral nutritional supplements: Patients often experience insufficient nutrient intake due to decreased appetite. Nutritional supplements (such as high-calorie, high-protein liquid foods) can help improve their nutritional status. Common nutritional supplements include liquid beverages and weight-gain powders.

[0008] Appetite stimulants, such as methadone and Dronabinol, improve patients’ nutritional intake and reduce weight loss by promoting appetite.

[0009] High-protein, high-energy diet: Since cachexia leads to the consumption of protein and fat, supplementing with a high-protein diet (such as foods rich in omega-3 fatty acids) can help slow down weight loss, especially muscle loss.

[0010] 2. Drug treatment

[0011] Several drugs are currently used to treat cancer cachexia. These drugs typically slow the progression of cachexia by reducing inflammation, regulating metabolism, or improving appetite.

[0012] Anti-inflammatory drugs: Because the inflammatory response plays an important role in cancer cachexia, some anti-inflammatory drugs are used to relieve symptoms. For example, drugs such as lopinavir and cimetidine have been studied for their ability to inhibit the production of pro-inflammatory cytokines, thereby alleviating tumor-induced metabolic disorders.

[0013] Steroid medications: such as prednisone and methylprednisolone, are used to alleviate weight loss, improve appetite, and reduce patient symptoms.

[0014] Anti-tumor drugs: Drugs such as methadone and docetaxel can help treat cachexia by relieving inflammation or reducing tumor-induced metabolic abnormalities.

[0015] 3. Hormone replacement therapy

[0016] Leptin and Insulin: Leptin is a hormone secreted by adipose tissue and plays an important role in the regulation of body weight and appetite. Regulation of leptin levels can be used to improve cancer cachexia. Insulin analogues and insulin sensitizers have also been explored as therapeutic agents in some studies.

[0017] Androgen therapy: Androgens, such as testosterone, are also used as a treatment for cancer cachexia because they help increase muscle mass and improve appetite.

[0018] 4. Antitumor-related metabolic regulation

[0019] AMPK signaling pathway: AMP-activated protein kinase (AMPK) plays an important role in the regulation of energy metabolism. By regulating the AMPK signaling pathway, muscle mass can be increased, fat consumption can be reduced, and metabolic homeostasis can be restored.

[0020] 5. Antioxidants and anti-inflammatory treatment

[0021] Antioxidants: Due to the increased oxidative stress during cancer cachexia, antioxidants (such as vitamin C, vitamin E, N-acetylcysteine, etc.) have been proposed to reduce oxidative stress, thereby protecting tissues from damage.

[0022] Immunosuppression and anti-inflammatory therapy: Cancer cachexia is often accompanied by chronic low-grade inflammation. Immunosuppressive therapy (such as the use of TNF-α antibodies, IL-6 inhibitors, etc.) may help alleviate the symptoms of cachexia.

[0023] 6. Interventions for muscle mass and function

[0024] Exercise and physical therapy: Regular, moderate physical activity and exercises that strengthen muscles can help alleviate muscle loss and improve patients' functional status and quality of life.

[0025] Muscle protectants, such as clenostan (Clenbuterol), can stimulate muscle growth and reduce muscle atrophy. Studies have shown that they can effectively address muscle wasting in cancer cachexia.

[0026] 7. Multidisciplinary combined treatment

[0027] Treatment of cancer cachexia typically requires a comprehensive approach, combining nutritional support, medication, physical therapy, and psychological support. For example, a combination of cancer treatment, anti-cachexia therapy, and rehabilitation training can improve a patient's physical strength, appetite, quality of life, and survival.

[0028] There are also some newly developed drugs, such as those targeting GDF-15 and MC4R, but they have not yet been launched globally.

[0029] Although various treatments for cancer cachexia exist, most fail to address the underlying causes of the disease. Existing treatments often only alleviate symptoms, slow weight loss, or improve appetite, but struggle to fundamentally improve metabolic disorders or halt further muscle and fat loss. Furthermore, most drug treatments have side effects, and clinical outcomes vary from person to person. Therefore, the treatment of cancer cachexia remains a pressing medical challenge. Summary of the Invention

[0030] Because a comprehensive understanding of the various metabolic disorders in cancer cachexia is currently lacking, especially the mechanisms by which specific molecular pathways regulate food intake, fat quality, and energy balance, the development of novel molecular targets and therapeutic strategies to modulate these disorders is crucial for the treatment of cancer cachexia.

[0031] The first aspect of the present invention provides the use of an s100a8 / a9 inhibitor or complement 3 inhibitor in the preparation of a medicament for the treatment or prevention of cachexia.

[0032] Furthermore, the cachexia described is tumor cachexia.

[0033] Furthermore, the tumors in the tumor cachexia are selected from liver cancer, lung cancer, colon adenocarcinoma, colon cancer, pancreatic cancer, gastroesophageal cancer, head and neck cancer, colon cancer, blood cancer, breast cancer, and prostate cancer.

[0034] Furthermore, the treatment or prevention of cachexia includes increasing the weight, lean body mass, and fat mass of cachexia subjects, increasing food intake, or preventing fat loss, slowing the rate of weight loss, slowing the rate of fat loss, slowing the rate of lean body mass loss, resisting anorexia, resisting muscle weakness, resisting fatigue, resisting weight loss, and improving abnormal biochemical results.

[0035] Further, the S100a8 / a9 inhibitor is an antisense nucleic acid of S100a8 / a9, an S100a8 / a9 specific antibody, an antigen-binding fragment of an S100a8 / a9 specific antibody, a small molecule compound, the S100a8 / a9 Crispri system, the S100a8 / a9 CRISPR-Cas9 system, siRNA, shRNA, miRNA, a small molecule ligand that binds to S100a8 / a9, an S100a8 / a9 gene transcription inhibitor, or an inhibitor of downstream molecules of the S100a8 / a9 signaling pathway, such as TLR4, the RAGE receptor, and the inflammatory pathway mediated by them; wherein the small molecule compound is selected from paquinnimo.

[0036] Furthermore, the complement 3 inhibitor is a complement 3 antisense nucleic acid, a complement 3 specific antibody, an antigen-binding fragment of a complement 3 specific antibody, a small molecule compound, a complement 3 CRISPR system, a complement 3 CRISPR-Cas9 system, siRNA, shRNA, miRNA, or a small molecule ligand that binds to complement 3; in one specific embodiment, the C3 knockdown AAV shRNA sequence is GCCCGTGATTCACCAAGAAAT, and the AAV serotype is 9.

[0037] A second aspect of the present invention provides a pharmaceutical composition for treating or preventing cachexia, comprising a first active ingredient for treating or preventing cachexia and a pharmaceutically acceptable carrier;

[0038] The first active ingredient used to treat or prevent cachexia is an S100A8 / A9 inhibitor and / or a complement 3 inhibitor.

[0039] Furthermore, the cachexia described is tumor cachexia.

[0040] Furthermore, the tumors in the tumor cachexia are selected from liver cancer, lung cancer, colon adenocarcinoma, colon cancer, pancreatic cancer, gastroesophageal cancer, head and neck cancer, colon cancer, blood cancer, breast cancer, and prostate cancer.

[0041] Furthermore, the treatment or prevention of cachexia involves increasing the weight, lean body mass, and fat mass of cachexia subjects, increasing food intake, or preventing fat loss, slowing the rate of weight loss, slowing the rate of fat loss, slowing the rate of lean body mass loss, resisting anorexia, resisting muscle weakness, resisting fatigue, resisting weight loss, and improving abnormal biochemical results.

[0042] Further, the S100a8 / a9 inhibitor is an antisense nucleic acid of S100a8 / a9, an S100a8 / a9 specific antibody, an antigen-binding fragment of an S100a8 / a9 specific antibody, a small molecule compound, the S100a8 / a9 Crispri system, the S100a8 / a9 CRISPR-Cas9 system, siRNA, shRNA, miRNA, a small molecule ligand S100a8 / a9 gene transcription inhibitor that binds to S100a8 / a9, or an inhibitor of downstream molecules of the S100a8 / a9 signaling pathway, such as TLR4, the RAGE receptor, and the inflammatory pathways they mediate; wherein the small molecule compound is selected from paquinimo.

[0043] Further, the complement 3 inhibitor is a complement 3 antisense nucleic acid, a complement 3 specific antibody, an antigen-binding fragment of a complement 3 specific antibody, a small molecule compound, a complement 3 CRISPR system, a complement 3 CRISPR-Cas9 system, siRNA, shRNA, miRNA, or a small molecule ligand that binds to complement 3; further, the shRNA sequence is GCCCGTGATTCACCAAGAAAT; or the C3 knockdown AAV shRNA sequence is GCCCGTGATTCACCAAGAAAT, and the AAV serotype is 9.

[0044] Furthermore, in the pharmaceutical composition, the active ingredient for treating or preventing cachexia accounts for 1 wt% to 99 wt% of the total weight of the pharmaceutical composition.

[0045] Furthermore, the pharmaceutical dosage form of the pharmaceutical composition is an oral preparation, an injection, a topical preparation, a preparation for local ocular administration, a preparation for local oral administration, a preparation for rectal administration, a preparation for intrapulmonary or intranasal administration, a preparation for parenteral administration, or a sustained-release or controlled-release drug.

[0046] Furthermore, the pharmaceutical composition is a formulation for intracerebral administration, or the pharmaceutical composition is capable of delivering the first active ingredient across the blood-brain barrier.

[0047] Furthermore, the pharmaceutical composition further includes a second active ingredient for treating or preventing cachexia, the second active ingredient including nutritional supplements, appetite stimulants, anti-inflammatory drugs, steroid drugs, antitumor drugs, hormones, antitumor-related metabolic regulators, antioxidants, immunosuppressants, muscle protectants, GDF-15 target drugs, and MC4R target drugs.

[0048] Furthermore, the appetite stimulants are selected from methadone and monosialotetrahexosylganglioside; the anti-inflammatory drugs are selected from ibuprofen, codeine, and cimetidine; the steroid drugs are selected from prednisone and methylprednisolone; the antitumor drugs are selected from docetaxel; the hormones are selected from leptin, insulin, or testosterone; the antitumor-related metabolic regulators are selected from AMPK signaling pathway inhibitors; the antioxidants are selected from vitamin C, vitamin E, and N-acetylcysteine; the immunosuppressants are selected from TNF-α antibodies and IL-6 inhibitors; and the muscle protectant is ruvastatin.

[0049] A third aspect of the present invention provides the use of the pharmaceutical composition described in the second aspect of the present invention in the preparation of a medicament for treating or preventing cachexia.

[0050] The fourth aspect of the present invention provides a method for treating or preventing cachexia, comprising administering to a subject at least one of an s100a8 / a9 inhibitor, a complement 3 inhibitor, and the pharmaceutical composition described in the second part.

[0051] Furthermore, the method of administration is injection, preferably intracerebral injection, or intravenous injection, and the s100a8 / a9 inhibitor, complement 3 inhibitor, or the pharmaceutical composition of the second part is capable of crossing the blood-brain barrier.

[0052] Furthermore, the subjects mentioned include humans or animals.

[0053] Furthermore, the animals include rodents and primates, preferably mice, rats, rabbits, and monkeys.

[0054] A fifth aspect of the present invention provides a method for screening candidate drugs for the treatment or prevention of cachexia, comprising testing whether the drug to be screened can inhibit the expression of S100a8 / a9 and / or complement 3, and selecting the drug to be screened that can inhibit the expression of S100a8 / a9 and / or complement 3 as a candidate drug for the treatment or prevention of cachexia; or

[0055] This includes testing whether the drug to be screened can bind to S100a8 / a9 and / or complement 3, and using the drugs to be screened that can bind to S100a8 / a9 and / or complement 3 as candidate drugs for the treatment or prevention of cachexia.

[0056] The sixth aspect of the present invention provides the use of S100a8 / a9, complement 3, and other related sites in the s100a8 / a9-complement 3 pathway as therapeutic or drug delivery targets for the treatment or prevention of cachexia. Beneficial effects

[0057] This invention provides a novel understanding of the mechanisms regulating energy balance in cancer cachexia, focusing on the roles of S100a8 / a9 and C3. Studies have shown that inhibiting S100a8 / a9 and C3 can promote fat recovery and increase food intake. Specifically, the S100a8 / a9 inhibitor paquinimo was demonstrated to prevent weight loss, particularly in adipose tissue, and significantly increase food intake in subjects. Attached Figure Description

[0058] Figure 1 illustrates the establishment of a mouse cancer cachexia model and its effects on body weight, fat weight, non-fat weight, and food intake. In the figure, A is a schematic diagram of the experimental design; B, C, D, and E represent the changes in mouse body weight, tumor weight, fat weight, non-fat weight, and food intake, respectively; and F represents the cumulative changes in food intake over 10 days and 7 days.

[0059] Figure 2 shows the changes in body weight, fat weight, non-fat weight, and food intake in MC38 cancer cachexia mice. A, B, C, and D represent the changes in mouse body weight, tumor weight, fat weight, and non-fat weight, respectively; E represents the changes in cumulative food intake in the 10 days and 7 days prior to mouse sacrifice.

[0060] Figure 3 shows the effects of cancer cachexia on body composition in a paired diet experiment; A is a schematic diagram of the experimental design; B shows the changes in fat weight in mice; C shows the changes in fat weight in mice before sacrifice; D shows the changes in non-fat tissue in mice; E shows the changes in non-fat weight in mice before sacrifice.

[0061] Figure 4 shows the effects of S100a8 / a9 inhibitor administration on body weight, food intake, fat weight, and non-fat weight in cancer-malignant mice. In the figure, A is a schematic diagram of the experimental design; B represents changes in mouse body weight; C represents changes in cumulative food intake; D represents changes in mouse fat weight; and E represents changes in the main body components of the mice.

[0062] Figure 5 shows the effects of acute and chronic administration of the S100a8 / a9 recombinant protein on body weight, food intake, fat weight, and non-fat weight in cancer cachexia mice. In the figures, A is a schematic diagram of the experimental design; B shows the change in food intake after acute administration; C shows the change in food intake 24 hours after acute administration; D shows the change in body weight compared to baseline after chronic administration; E shows the cumulative food intake of mice 7 days before sacrifice after chronic administration; and F shows the changes in major body composition of mice after chronic administration.

[0063] Figure 6 shows the results of the complement 3 assay. A is the transcriptome KEGG pathway enrichment map; B is a schematic diagram of whole-brain C3 immunofluorescence staining and hypothalamic C3 protein levels; C is a schematic diagram of the experimental design; D is the Western blot experiment; E is the mouse body weight change; F is the change in cumulative food intake of mice; G is the change in mouse fat weight; and H is the change in other body components of mice. Detailed Implementation

[0064] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below, but should not be construed as limiting the scope of the present invention.

[0065] the term

[0066] In this invention, the term "cachexia" or "cancer cachexia" refers to metabolic disorder symptoms caused by cancer, which are usually manifested as significant weight loss, especially the loss of lean body mass and fat.

[0067] In this invention, the term "S100 a8 / a9" refers to the human S100 calcium-binding protein A8 / A9 complex.

[0068] In this invention, the term "tumor-free weight" refers to the subject's actual weight minus the tumor weight.

[0069] In this invention, the term "lean tissue" refers to the sum of all tissues that do not contain fat, mainly including muscle tissue, bone tissue, and internal organs.

[0070] "Pharmaceutical composition" refers to a composition containing an active ingredient and a pharmaceutically acceptable carrier or excipient.

[0071] "Pharmaceutical acceptable carriers or excipients" include, but are not limited to, any adjuvant, carrier, excipient, gliding agent, sweetener, diluent, preservative, dye / coloring agent, flavor enhancer, surfactant, wetting agent, dispersant, suspending agent, stabilizer, isotonic agent, solvent or emulsifier that has been approved by the Food and Drug Administration for acceptable use in humans or livestock.

[0072] "Effective dose" or "therapeutic effective dose" refers to the dose that, when administered to a subject in need, produces relief or treatment for a disease state, symptom, or disorder. The amount of the compounds of the present invention will vary depending on factors such as: the compound and its biological activity, the composition used for administration, the time of administration, the route of administration, the rate of compound excretion, the duration of treatment, the type and severity of the disease state or symptom being treated, the drugs used in combination with or in conjunction with the compounds of the present invention, and the patient's age, weight, general health, sex, and diet. Those skilled in the art can determine such a therapeutically effective dose by conventional means based on their own knowledge, prior art, and the content of this invention.

[0073] Unless otherwise stated, the term "treating" as used herein means reversing, alleviating, inhibiting the progression of, or preventing the impairment or condition to which the term applies, or one or more symptoms of such impairment or condition. In some embodiments, the term "treating" is intended to mean administering an inhibitor of S100a8 / a9 or a complement 3 inhibitor to alleviate or eliminate symptoms of cachexia, reverse a trend of weight loss, and reduce lean body mass and fat content.

[0074] "Prevention" or "preventing" refers to treatments that prevent cancer patients from developing cachexia before it occurs, thus delaying or reversing the onset of cachexia.

[0075] The terms "subject" or "patient" refer to an animal, such as a mammal (including a human), that has been or will be a subject of treatment, observation, or experimentation. The methods described herein can be used for human treatment and / or veterinary applications. In some embodiments, the subject is a mammal (or patient). In some embodiments, the subject (or patient) is a human, livestock (e.g., dogs and cats), farm animals (e.g., cattle, horses, sheep, goats, and pigs), and / or laboratory animals (e.g., mice, rats, hamsters, guinea pigs, pigs, rabbits, cats, dogs, and monkeys). In some embodiments, the subject (or patient) is a human.

[0076] Drug dosage form

[0077] The pharmaceutical compositions of the present invention can be formulations suitable for oral administration and can be presented in discrete unit form, such as capsules, pouches, or tablets, each containing a predetermined amount of the active ingredient; as powder or granules; as a solution or suspension in an aqueous or non-aqueous liquid; or as an oil-in-water emulsion or a water-in-oil emulsion. Alternatively, they can be prepared into oral administration formulations using other known techniques.

[0078] Tablets are prepared by compression or molding, optionally containing one or more excipients. Compressed tablets can be prepared by compressing a free-flowing form of active ingredient, such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, preservative, surfactant, or dispersant, in a suitable machine. Molded tablets can be prepared by molding a mixture of powdered active ingredients moistened with an inert liquid diluent in a suitable machine. Tablets may optionally be coated or scored and optionally formulated to provide a slow or controlled release of the active ingredient therefrom.

[0079] The pharmaceutical compositions of the present invention can be topical formulations such as ointments for local administration. For infections of the eyes or other external tissues such as the mouth and skin, the formulation is preferably a topical ointment or cream containing an active ingredient. When formulated as an ointment, the active ingredient can be used with a paraffin or water-miscible ointment base. Alternatively, the active ingredient can be formulated as a cream with an oil-in-water cream base. If desired, the topical formulation may include compounds that enhance the absorption or penetration of the active ingredient through the skin or other affected areas. Examples of such skin penetration enhancers include dimethyl sulfoxide and related analogues. The oil phase of the emulsions of the present invention can be composed of known ingredients in a known manner. The oil phase may contain only emulsifiers, but it may also contain at least one emulsifier with fats or oils, or with a mixture of both fats and oils. Preferably, hydrophilic emulsifiers are included together with lipophilic emulsifiers that act as stabilizers. Oils and fats are also preferred.

[0080] The pharmaceutical compositions of the present invention may be in the form of sterile injectable formulations, such as sterile aqueous or oily suspensions for injection.

[0081] The pharmaceutical compositions of the present invention may be formulations suitable for topical ocular administration, including eye drops, wherein the active ingredient is dissolved or suspended in a suitable carrier, particularly an aqueous solvent for the active ingredient.

[0082] The pharmaceutical compositions of the present invention can be formulations suitable for topical oral administration, including tablets containing an active ingredient in a flavoring matrix, typically sucrose and gum arabic or tragacanth; tablets containing an active ingredient in an inert matrix such as gelatin and glycerin or sucrose and gum arabic; and mouthwashes containing an active ingredient in a suitable liquid carrier.

[0083] The pharmaceutical compositions of the present invention can be formulations for rectal administration, which can be presented as suppositories having a suitable matrix containing, for example, cocoa butter or salicylates.

[0084] The pharmaceutical compositions of the present invention can be formulations suitable for intrapulmonary or intranasal administration. Such formulations typically have a particle size in the range of 0.1-500 micrometers, such as 0.5, 1, 30, 35 micrometers, etc., and are administered via rapid inhalation through the nasal passage or oral inhalation to reach the alveoli. The active ingredients of the present invention have a size suitable for intrapulmonary or intranasal administration, and can be used for intrapulmonary or intranasal administration, for example, as inhalers.

[0085] The pharmaceutical compositions of the present invention may be formulations suitable for parenteral administration, including aqueous and non-aqueous sterile injectable solutions, which may contain antioxidants, buffers, antibacterial agents and solutes that make the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions that may contain suspending agents and thickeners.

[0086] The pharmaceutical compositions of the present invention are formulated in single-dose or multi-dose containers (e.g., sealed ampoules and vials) and can be stored under freeze-drying (lyophilization) conditions, requiring only the addition of a sterile liquid carrier (e.g., water for injection) immediately before use. Immediate-use solutions and suspensions are prepared from the aforementioned types of sterile powders, granules, and tablets. Preferred single-dose formulations are those containing the active ingredient at the daily dose or a unit daily sub-dose or a suitable portion thereof as described above.

[0087] The pharmaceutical composition of the present invention may be a veterinary composition comprising at least one active ingredient as defined above and a veterinary carrier.

[0088] The compounds of the present invention are used to provide controlled-release pharmaceutical formulations containing one or more of the active ingredients of the present invention as active ingredients, wherein the release of the active ingredient is controlled and modulated to allow for less frequent administration or to improve the pharmacokinetic or toxicological characteristics of a given active ingredient.

[0089] Combination therapy

[0090] In addition to containing an S100A8 / A9 inhibitor or a complement 3 inhibitor as a first active ingredient, the pharmaceutical composition of the present invention may also contain other second active ingredients for treating or preventing cachexia. The first and second active ingredients are used in combination or synergistically to treat or prevent cachexia.

[0091] The first and second active ingredients in the pharmaceutical composition of the present invention can also be administered to a patient simultaneously or sequentially in unit dosage form. Combination therapy can be administered as a simultaneous or sequential regimen. When administered sequentially, the combination can be given in two or more doses.

[0092] Combination therapy can provide “synergistic effects” and “synergistic enhancement effects”, meaning that the effect obtained when used together is greater than the sum of the effects of using the compounds alone. Synergistic effects can be obtained when the active ingredients: (1) are co-formulated and administered or delivered simultaneously in a combination formulation; (2) are delivered alternately or in parallel as separate formulations; or (3) are administered through other regimens.

[0093] Example 1: Establishment of an animal model of cancer cachexia and study of its body composition.

[0094] 1.1 Body composition study of animal models of cancer cachexia

[0095] Male C57BL / 6 mice were used. The mice were subcutaneously injected with 100 μL of phosphate-buffered saline (PBS) and tumor cells on the right side. The tumor cells were mouse colon 38 adenocarcinoma (MC38) and Lewis lung cancer (LLC), respectively. The tumor cell injection consisted of 1 × 10⁻⁶ cells. 6 LLC cells, 2 × 10 6 LLC cells, 1×10 6 MC38 cells and 2×10 6 MC38 cells. Mice were injected with 100 μL PBS as a non-tumor bearing (NTB) control group (Figure 1A).

[0096] When tumor cells were transplanted, the viability of the tumor cells was higher than 95%. From baseline to mouse sacrifice, food intake and body weight were monitored in all tumor and non-tumor groups, with body weight further subdivided into fat weight and non-fat weight, and the survival time of LLC mice was recorded (Figure 1A).

[0097] The results showed that in mice transplanted with LLC cells (LLC mice), body weight tended to stabilize when tumor weight was included, but from about 14 days post-transplantation, tumor-free body weight (i.e., body weight minus tumor weight) decreased significantly (Figure 1B). Tumors grew approximately 8 days post-transplantation and exhibited exponential growth after 18 days (Figure 1C). Mice injected with higher concentrations of tumor cells (2 × 10⁻⁶) showed… 6 The tumor grew relatively slowly and died between 42 and 45 days post-transplantation. By the second week post-transplantation, the amount of fat had significantly decreased, to 1×10⁻⁶. 6 The LLC group (reduced by 35%) saw a reduction exceeding 2×10 6Group (reduced by 20%) (Fig. 1D). Non-fat weight (i.e., lean tissue) initially increased with tumor growth, but after subtracting tumor weight, lean tissue weight decreased significantly (Fig. 1E). Cumulative food intake was significantly reduced in both injection groups (Fig. 1F). For mice transplanted with MC38 tumor cells (MC38 mice), body weight (Fig. 2A), tumor growth (Fig. 2B), fat and lean tissue weight (Fig. 2C and Fig. 2D), and food intake (Fig. 2E) followed a similar pattern, but tumor development was slower, indicating a precancerous cachexia stage.

[0098] Based on the above results, it can be seen that cancer cachexia leads to reduced food intake, weight loss, and loss of fat weight and non-fat weight (i.e., lean tissue).

[0099] 2×10 6 LLC cachectic mice began to show significant weight loss and a decrease in fat mass of more than 20% two weeks after inoculation with tumor cells, indicating that the mice inoculated with LLC cells developed cachectic symptoms two weeks later.

[0100] In addition, the developmental progress results of the two different tumor injection concentration groups showed 1×10 6 The LLC group showed faster tumor progression than 2×10⁻⁶. 6 LLC group. To obtain a longer observation period for cachexia, the trial was continued with 2×10 6 The LLC group conducted the test.

[0101] Furthermore, subsequent experiments selected 10% of body weight as the ethical endpoint for tumor weight. Based on the above development process, it can be seen that the ethical focus is on 4 weeks after LLC tumor transplantation (Figure 1D and Figure 2B).

[0102] 1.2 Investigating the effect of food intake on body composition through paired experiments

[0103] Whether the changes in body composition in the above 1.1 experiment were caused by cachexia or by changes in food intake could not be determined through the above experiment. Therefore, a paired experiment was conducted to further investigate the effect of food intake on body composition.

[0104] In this study, mice were randomly assigned to tumor-bearing (TB), non-tumor-bearing (NTB), and paired feeding (PF) groups according to their body weight (Figure 3A).

[0105] Two groups of tumor-bearing mice were divided into two groups. Each group received a subcutaneous injection of 100 μL of phosphate-buffered saline (PBS) on the right side. The PBS contained 2 × 10⁻⁶ mg / L of PBS. 6 LLC cells and 2 × 10 6 One MC38 cell.

[0106] The non-tumor-bearing (NTB) group mice were injected subcutaneously with 100 μL of PBS on the right side.

[0107] Two paired feeding groups were formed by subcutaneously injecting 100 μL of PBS on the right side and giving the same amount of food as the two tumor-bearing mice the day before, in order to control changes in body composition caused by reduced food intake.

[0108] The experiment lasted for 4 weeks after tumor transplantation. During this period, body weight and food intake were measured daily, body composition was measured weekly, grip strength was tested, and fresh fecal samples were collected. Glucose tolerance and insulin tolerance were assessed 2–3 weeks after tumor transplantation. Oxygen consumption and activity levels were measured 3 weeks after transplantation using a calorimetric system (TSE PhenoMaster, TSE Systems, Germany). 4 weeks after tumor transplantation, mice were euthanized by carbon dioxide asphyxiation, and tissues from several mice were rapidly collected, weighed, rapidly frozen in liquid nitrogen, and stored at -80°C. Blood samples were placed on ice for at least 30 minutes, then centrifuged at 3500 rpm for 30 minutes at 4°C to collect serum. The serum was rapidly frozen in liquid nitrogen and stored at -80°C. Blood was collected from another mouse using 0.9% saline and fixed systemically in 4% paraformaldehyde. Tissue was obtained and fixed overnight in 4% paraformaldehyde at 4°C. The following day, paraformaldehyde was replaced with a freshly prepared 30% sucrose solution, and the tissue was fixed by immersing it in the solution at 4°C for 24–48 hours.

[0109] The results confirmed that, compared with the NTB group, the PF group did not show a significant change in fat mass. However, 4 weeks after tumor transplantation, the fat mass of the tumor group mice and LLC mice decreased by 2-fold. Similarly, a decrease in fat mass was also observed in MC38 mice, but this was not observed in the corresponding PF and NTB groups (Figures 3B and 3C).

[0110] This result demonstrates that changes in food intake caused by cancer cachexia do not affect the decrease in fat quality within cancer cachexia. As for non-adipose tissue, i.e., lean tissue, the PF group showed a significant reduction in lean body mass compared to NTB, indicating that food intake plays a role in the reduction of lean body mass (Figures 3D and 3E).

[0111] In summary, the paired diet trial showed that the reduction in fat in cancer cachexia was not caused by decreased food intake, but by cancer cachexia itself, while the reduction in lean tissue was partly related to decreased food intake.

[0112] Preliminary experimental results show that cancer cachexia is mainly characterized by weight loss, primarily a significant reduction in fat and lean tissue. Weight loss is significantly correlated with patient survival in cachexia; reports indicate that cachexia patients who experience a weight loss exceeding 5% within 6 months, accompanied by decreased appetite, will have a survival period of no more than 3 months.

[0113] The results of Example 1 show that, in order to prolong the survival time of patients with cancer cachexia, weight can be increased in two ways, thereby extending the survival time of cachexia patients. First, increase food intake. The experimental results above show that the decrease in lean body mass is related to food intake; if food intake can be increased, lean tissue can be partially restored. Second, prevent the reduction of fat mass. The experimental results above show that the weight loss caused by cachexia is not related to the decrease in food intake, but the mechanism by which the extra fat consumption is regulated is not disclosed or reported in the prior art. Therefore, if the extra fat consumption caused by cachexia can be reduced, the weight of cachexia patients can be increased, thereby achieving weight recovery and slowing down the rate of weight loss.

[0114] Example 2: Therapeutic effect of S100a8a9 inhibitor on cachectic mice

[0115] The inventors unexpectedly discovered that the S100a8a9 site may be associated with weight loss caused by cachexia. First, they investigated whether the S100a8a9-specific inhibitor, palquinimod (also known as Mrp14 inhibitor, ABR215757), could restore some weight in cachexia mice or delay the weight loss caused by cachexia.

[0116] Paquinnimo is a specific inhibitor of S100a8a9 that can cross the blood-brain barrier to exert its effects on the brain. Paquinnimo was diluted in a mixture of 10% DMSO, 40% PEG400, 5% Tween 80, and 45% Saline as the treatment group, and a mixture of 10% DMSO, 40% PEG400, 5% Tween 80, and 45% Saline as the control group.

[0117] Mice were used as experimental animals and divided into two groups: a treatment group (Mrp-IP) and a control group (Ctrl-IP). Both groups were injected with LLC tumor cells, with the day of tumor injection designated as day 0. From day 1 to day 28, the treatment group received daily intraperitoneal injections of the treatment drug containing psaquinimo, while the control group received daily injections of the control drug, for a total of 28 days. The injection dose was 10 mg psaquinimo per kilogram of body weight. Mice were sacrificed on day 28. During this period, food intake and body weight were monitored, and the weight of fat and lean tissue at dissection was measured (Figure 4A).

[0118] The results showed that, compared with the control group, the tumor-free body weight of mice in the treatment group increased significantly by 2g (approximately 7% of their total body weight) (Figure 4B), especially the fat weight, which increased by about 1g (Figure 4D). Among the fat, subcutaneous fat showed the greatest increase, with a statistically significant difference. Furthermore, in the last 5 days of the study, the cumulative food intake of the treatment group was approximately 2.5g higher than that of the control group (Figure 4C). Lean tissue, particularly the mouse skeleton, increased significantly (Figure 4E).

[0119] In conclusion, palquinimo can effectively alleviate energy imbalances associated with cancer cachexia, increase food intake and thus increase lean tissue weight, while reducing fat loss. In these two ways, it slows down the weight loss process in cachexia patients and prolongs their lives.

[0120] Example 3: Acute and chronic experiments to verify the effect of S100a8a9 recombinant protein on cachexia mice

[0121] For the acute administration experiment: 19-week-old male C57BL / 6N mice were paired by body weight and divided into a saline group and an s100a8a9 recombinant protein group. Anesthetized mice were fixed in a stereotaxic apparatus, and a catheter was implanted intracranially for subsequent acute administration; simultaneously, LLC tumor cells were transplanted into all mice (Figure 5A). 24-25 days post-tumor transplantation, LLC mice were injected with either recombinant protein S100a8a9 (rmS100a8a9) or saline, and hourly food intake was measured over 12 hours. Before the experiment, the original diet was replaced with the same but fresh diet. Results showed that mice injected with saline showed a high interest in the fresh diet in the first hour, consuming significantly more food than mice injected with rmS100a8a9 (Figures 5B and 5C). After 7-8 hours, mice injected with rmS100a8a9 gradually began to eat (Figure 5B). Within 24 hours, food intake in the rmS100a8a9 group was significantly lower than in the saline group (Figure 5C).

[0122] These results suggest that acute injection of rmS100a8a9 can suppress food intake (Figure 5C), indicating that the S100a8a9 site is associated with food intake in cachectic mice.

[0123] For chronic administration trials: Since cancer cachexia is a progressive disease and the increase in S100a8 / a9 is a persistent phenomenon, rmS100a8a9 or saline was subsequently delivered to mice continuously over a long period using an osmotic micropump (OMP).

[0124] Nineteen-week-old male C57BL / 6N mice were paired by body weight and divided into a saline group and an s100a8a9 recombinant protein group. Anesthetized mice were fixed in a stereotaxic apparatus, and a brain infusion kit (Alzet) connected to an osmotic pump (infusion rate 0.11 ml / h, for 4 weeks, Alzet) was implanted into the right lateral ventricle (relative to Bregma: lateral ventricle 1 mm, anterior and posterior ventricles -0.2 mm, dorsoventral ventricle -2.3 mm). Saline or recombinant protein s100a8a9 (21 μg / 110 μL, R&D system) was filled into the osmotic pump, followed by 110 μL of saline. Body weight and food intake were recorded daily throughout the experiment. Fat weight and lean tissue weight were recorded at dissection (Figure 5A).

[0125] The results showed that, compared with the saline group, long-term exposure to rmS100a8a9 resulted in a weight loss of approximately 3g in mice (Fig. 5D) and a cumulative food intake reduction of approximately 4g over the past 7 days (Fig. 5E). Furthermore, since the cachectic mice already had a drastically reduced fat mass, the use of rmS100a8a9 to worsen the condition did not lead to a greater reduction in fat; however, lean tissue, particularly the skeletal structure, was significantly reduced (Fig. 5F), which was related to the reduced food intake.

[0126] The results of Example 4 show that upregulation of S100a8a9 is associated with weight loss caused by cachexia. It can simultaneously inhibit food intake, thereby reducing lean tissue mass, and also burn additional fat. Combining the results of Example 3, it is clear that S100a8a9 is associated with weight loss caused by cachexia, and inhibiting this site can alleviate weight loss, reduced food intake, and fat consumption caused by cachexia.

[0127] Example 5: Study on the relationship between complement 3 (C3) and cachexia at downstream sites related to S100a8a9.

[0128] KEGG analysis revealed that the regulation of the inflammatory response was most significantly altered in the hypothalamus of cachectic mice, with S100a8 / a9 and C3 being key participants in this pathway (Figure 6A). Furthermore, volcano plot analysis showed that S100a8 / a9 was the most significantly upregulated gene (Figure 6A).

[0129] First, the location of C3 was confirmed by comparing the immunofluorescence staining of brain sections from different groups of mice. Specifically, the immunofluorescence staining of whole brain sections from NTB mice and LLC mice in Example 1 was compared (Figure 6B).

[0130] The results showed that, compared with NTB mice, C3 was mainly highly expressed in the arcuate nucleus (ARC) of the hypothalamus in LLC mice, mainly co-localized with microglia, and less expressed in astrocytes and neurons (Figure 6B).

[0131] Simultaneously, C3 protein expression levels were analyzed using protein imprinting. The results showed that, compared with NTB mice, LLC mice had significantly higher levels of C3 protein in the hypothalamus (Figure 6B).

[0132] To determine whether C3 promotes negative energy balance in LLC cachectic mice, adenovirus-associated viruses (AAVs) shC3-AAVs were designed to knock down C3. Three weeks before transplantation of LLC tumor cells, shC3-AAVs were injected into the hypothalamus of mice to knock down C3. The shRNA sequence in shC3-AAVs is GCCCGTGATTCACCAAGAAAT.

[0133] The results showed that shC3-AAVs significantly reduced C3 (Figure 6D).

[0134] Notably, LLC mice injected with shC3-AAVs into the hypothalamus showed that shC3-AAVs significantly blocked cachexia-induced weight loss (Fig. 6E) and decreased food intake (Fig. 6F), without affecting tumor quality (Fig. 6E). Compared with the control group, shC3-AAVs injection into the hypothalamus of LLC mice significantly prevented the reduction of adipose and lean tissue, especially muscle and ketone bodies. Analysis of peripheral and subcutaneous fat showed that fat mass increased by more than half after hypothalamic injection of shC3-AAVs in LLC mice. Intestinal weight was also restored in shC3-hypo-injected mice, suggesting that intestinal integrity and absorbability may be improved.

[0135] The results showed that C3 plays a key role in promoting cachexia-induced fat reduction and food intake reduction, and its knockdown in the hypothalamus effectively alleviated these effects; inhibiting this site can alleviate cachexia-induced weight loss, reduced food intake and fat consumption.

Claims

1. Use in the preparation of a medicament for the treatment or prevention of cachexia by an s100a8 / a9 inhibitor or complement 3 inhibitor.

2. The use according to claim 1, characterized in that, The cachexia mentioned is tumor cachexia; Preferably, the tumor in the tumor cachexia is selected from liver cancer, lung cancer, colon adenocarcinoma, colon cancer, pancreatic cancer, gastroesophageal cancer, head and neck cancer, colon cancer, blood cancer, breast cancer, and prostate cancer.

3. The use according to claim 1, characterized in that, The treatment or prevention of cachexia involves increasing the weight, lean body mass, and fat mass of cachectic subjects, increasing food intake, or preventing fat loss, slowing the rate of weight loss, slowing the rate of fat loss, slowing the rate of lean body mass loss, resisting anorexia, resisting muscle weakness, resisting fatigue, resisting weight loss, and improving abnormal biochemical results.

4. The use according to claim 1, characterized in that, The S100a8 / a9 inhibitors include antisense nucleic acids of S100a8 / a9, S100a8 / a9 specific antibodies, antigen-binding fragments of S100a8 / a9 specific antibodies, small molecule compounds, the S100a8 / a9 Crispri system, the S100a8 / a9 CRISPR-Cas9 system, siRNA, shRNA, miRNA, small molecule ligands that bind to S100a8 / a9, S100a8 / a9 gene transcription inhibitors, and inhibitors of downstream molecules of the S100a8 / a9 signaling pathway, such as TLR4, RAGE receptors, and their mediated inflammatory pathways; wherein the small molecule compounds are selected from paquinnimo. The complement 3 inhibitors are complement 3 antisense nucleic acids, complement 3 specific antibodies, antigen-binding fragments of complement 3 specific antibodies, small molecule compounds, complement 3 CRISPR system, complement 3 CRISPR-Cas9 system, siRNA, shRNA, miRNA, small molecule ligands that bind to complement 3, and C3 knockdown AAV. Preferably, the shRNA sequence in C3 knockdown AAV is GCCCGTGATTCACCAAGAAAT, and the AAV serotype is 9.

5. A pharmaceutical composition for treating or preventing cachexia, characterized in that, It includes a primary active ingredient for the treatment or prevention of cachexia and a pharmaceutically acceptable carrier; The first active ingredient used to treat or prevent cachexia is an S100A8 / A9 inhibitor and / or a complement 3 inhibitor. Preferably, the cachexia is tumor cachexia; Preferably, the tumor in the tumor cachexia is selected from liver cancer, lung cancer, colon adenocarcinoma, colon cancer, pancreatic cancer, gastroesophageal cancer, head and neck cancer, colon cancer, hematologic malignancies, breast cancer, and prostate cancer; Preferably, the treatment or prevention of cachexia involves increasing the weight, lean body mass, and fat mass of the cachexia subject, increasing food intake, or preventing fat loss, slowing the rate of weight loss, slowing the rate of fat loss, slowing the rate of lean body mass loss, resisting anorexia, resisting muscle weakness, resisting fatigue, resisting weight loss, and improving abnormal biochemical results. Preferably, the S100a8 / a9 inhibitor is an antisense nucleic acid of S100a8 / a9, an S100a8 / a9 specific antibody, an antigen-binding fragment of an S100a8 / a9 specific antibody, a small molecule compound, the S100a8 / a9 CRISPRi system, the S100a8 / a9 CRISPR-Cas9 system, siRNA, shRNA, miRNA, a small molecule ligand that binds to S100a8 / a9, an S100a8 / a9 gene transcription inhibitor, or an inhibitor of downstream molecules of the S100a8 / a9 signaling pathway such as TLR4, the RAGE receptor, and their mediated inflammatory pathways; wherein the small molecule compound is selected from paquinnimo. Preferably, the complement 3 inhibitor is an antisense nucleic acid of complement 3, a complement 3 specific antibody, an antigen-binding fragment of a complement 3 specific antibody, a small molecule compound, a complement 3 CRISPRi system, a complement 3 CRISPR-Cas9 system, siRNA, shRNA, miRNA, a small molecule ligand that binds to complement 3, or C3 knockdown AAV; More preferably, the shRNA sequence is GCCCGTGATTCACCAAGAAAT; or the shRNA sequence in C3 knockdown AAV is GCCCGTGATTCACCAAGAAAT, and the AAV serotype is 9.

6. The pharmaceutical composition of claim 5, characterized in that, The pharmaceutical dosage form of the pharmaceutical composition is an oral preparation, an injection, a topical preparation, a preparation for local ocular administration, a preparation for local oral administration, a preparation for rectal administration, a preparation for intrapulmonary or intranasal administration, a preparation for parenteral administration, or a sustained-release or controlled-release drug. Preferably, the pharmaceutical composition is a formulation for intracerebral administration, or the pharmaceutical composition is capable of delivering a first active ingredient across the blood-brain barrier; Preferably, the pharmaceutical composition further includes the second active ingredient for treating or preventing cachexia, the second active ingredient including nutritional supplements, appetite stimulants, anti-inflammatory drugs, steroid drugs, antitumor drugs, hormones, antitumor-related metabolic regulators, antioxidants, immunosuppressants, muscle protectants, GDF-15 target drugs, and MC4R target drugs. More preferably, the appetite stimulant is selected from methadone and monosialotetrahexosylganglioside; the anti-inflammatory drug is selected from ibuprofen codeine and cimetidine; the steroid drug is selected from prednisone and methylprednisolone; the antitumor drug is selected from docetaxel; the hormone is selected from leptin, insulin or testosterone; the antitumor-related metabolic regulator is selected from AMPK signaling pathway inhibitors; the antioxidant is selected from vitamin C, vitamin E and N-acetylcysteine; the immunosuppressant is selected from TNF-α antibody and IL-6 inhibitor; and the muscle protectant is ruvastatin.

7. Use of the pharmaceutical composition of claim 5 or 6 in the preparation of a medicament for treating or preventing cachexia.

8. A method for treating or preventing cachexia, characterized in that, It includes administering to the subject an s100a8 / a9 inhibitor, a complement 3 inhibitor, or at least one of the pharmaceutical compositions of claim 5 or 6; Preferably, the method of administration is injection; More preferably, it is administered via intracerebral injection or intravenous injection, and the s100a8 / a9 inhibitor, complement 3 inhibitor, or the pharmaceutical composition of claim 5 or 6 is capable of crossing the blood-brain barrier.

9. A method for screening candidate drugs for the treatment or prevention of cachexia, characterized in that, This includes testing whether the drug under screening can inhibit the expression of S100a8 / a9 and / or complement 3, and using drugs that can inhibit the expression of S100a8 / a9 and / or complement 3 as candidate drugs for the treatment or prevention of cachexia; or This includes testing whether the drug to be screened can bind to S100a8 / a9 and / or complement 3, and using the drugs to be screened that can bind to S100a8 / a9 and / or complement 3 as candidate drugs for the treatment or prevention of cachexia.

10. Use of s100a8 / a9, complement 3, and other sites in the s100a8 / a9-complement 3 pathway as therapeutic or drug delivery targets for the treatment or prevention of cachexia.

Images