Method for identifying bacterial strain

A PCR-based method using species-specific and repetitive sequence primers improves the accuracy of bacterial strain identification by analyzing the base length of amplified nucleic acids, addressing inefficiencies in existing nucleotide sequence-based methods.

WO2026141350A1PCT designated stage Publication Date: 2026-07-02KIRIN HOLDINGS KK
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/044956
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-12-25
Filing Date
2025-12-23
Publication Date
2026-07-02

AI Technical Summary

Technical Problem

Existing methods for identifying bacterial strains based on nucleotide sequences are inefficient and lack specificity, particularly for strains like Lactococcus lactis and Lactobacillus paracasei, necessitating improved PCR techniques for accurate identification.

Method used

A method involving the use of at least one set of primers specific to the bacterial species' genome sequence and at least two sets of primers for amplifying repetitive sequences, combined with PCR, to identify bacterial strains by analyzing the base length of amplified nucleic acids.

Benefits of technology

This approach enhances the accuracy and specificity of bacterial strain identification, particularly for Lactococcus lactis and Lactobacillus paracasei, by leveraging the unique nucleotide sequences and repetitive patterns in their genomes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JPOXMLDOC01-APPB-T000001
    Figure JPOXMLDOC01-APPB-T000001
  • Figure JPOXMLDOC01-APPB-T000002
    Figure JPOXMLDOC01-APPB-T000002
  • Figure JPOXMLDOC01-APPB-T000003
    Figure JPOXMLDOC01-APPB-T000003
Patent Text Reader

Abstract

Disclosed is a method for identifying an evaluation target bacterium as a specific bacterial strain, the method comprising the following steps A and B: [step A] a step for performing PCR using a nucleic acid derived from the evaluation target bacterium as a template and using each of at least one set of primers that amplify a genome sequence specific to a bacterial species to which the specific bacterial strain belongs; and [step B] a step for performing PCR using a nucleic acid derived from the evaluation target bacterium as a template and using each of at least two sets of primers that amplify a repeating sequence present in the genome of the bacterial species to which the specific bacterial strain belongs.
Need to check novelty before this filing date? Find Prior Art

Description

Method for identifying bacterial strains

[0001] The present disclosure relates to a method for identifying bacterial strains.

[0002] The identification of bacterial strains is important in the analysis of various compositions containing bacteria. For example, in food and beverages containing bacteria, the identification of bacterial strains is useful in quality control and confirmation of stability in products. Also, for example, the identification of bacterial strains contained in waste is important for managing the abundance of harmful bacteria in the waste. The identification of bacterial strains is generally performed based on the nucleotide sequence of nucleic acids. In such a method, the nucleotide sequence of nucleic acids derived from bacteria is analyzed by sequencing the sequence of nucleic acids derived from bacteria or amplifying the sequence of nucleic acids derived from bacteria, and the bacterial strain is identified (Non-Patent Document 1). Regarding the identification of bacterial strains based on the nucleotide sequence of nucleic acids, for example, Patent Document 1 discloses a DNA probe for identifying a bacterial strain of Lactobacillus helveticus, which is characterized by containing a DNA fragment capable of forming a hybrid with the DNA of a strain of the species L. helveticus.

[0003] Japanese Patent Application Laid-Open No. 03-236799

[0004] Padmini Ramachandran et al., "Development of a tiered multilocus sequence typing scheme for members of the Lactobacillus acidophilus complex", Appl Environ Microbiol. 79(23): 7220-8 (2013).

[0005] An object of the present disclosure is to provide a method for identifying bacterial strains.

[0006] The inventors of the present invention have found that when using at least one set of primer sets for amplifying a genomic sequence specific to the bacterial species to which a predetermined bacterial strain belongs and at least two sets of primer sets for amplifying repetitive sequences present in the genome of the bacterial species to which a predetermined bacterial strain belongs, the bacterium to be evaluated can be identified as a predetermined bacterial strain by polymerase chain reaction (PCR).

[0007] This disclosure relates, for example, to: <A1> A method for identifying a bacterium to be evaluated as a predetermined bacterial strain, comprising the following steps A and B: [Step A] Performing PCR using nucleic acid derived from the bacterium to be evaluated as a template, using each of at least one set of primers that amplify a genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs; [Step B] Performing PCR using nucleic acid derived from the bacterium to be evaluated as a template, using each of at least two sets of primers that amplify a repeat sequence present in the genome of the bacterial species to which the predetermined bacterial strain belongs; <A2> The method according to <A1>, wherein each of the PCRs in step A and step B is performed separately in a reaction solution containing only one set of primers; <A3> The method according to <A1> or <A2>, wherein in step A, each of the at least one set of primers is only one set of primers; <A4> The method according to any one of <A1> to <A3>, wherein in step B, the at least two sets of primers are only two sets of primers; <A5> The method according to any one of <A1> to <A4>, wherein the PCR step included in the above method is only step A and step B, in step A each of the at least one set of primers is only one set of primers, and in step B the at least two sets of primers are only two sets of primers. <A6> The method according to any one of <A1> to <A5>, further comprising identifying the bacteria to be evaluated as the predetermined bacterial strain using the base length of the nucleic acid amplified by the PCR in step B as an indicator. <A7> The method according to any one of <A1> to <A6>, wherein the genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs is a base sequence specifically present in the 16S rRNA gene of the bacterial species. <A8> The method according to any one of <A1> to <A7>, wherein the predetermined bacterial strain is a lactic acid bacterium. <A9> The method according to any one of <A1> to <A8>, wherein the predetermined bacterial strain belongs to the genus Lactococcus or Lactobacillus.<A10> The method according to any one of <A1> to <A9>, wherein the bacterial species to which the specified bacterial strain belongs is Lactococcus lactis subspecies lactis. <A11> The method according to any one of <A1> to <A10>, wherein the at least one set of primers used in step A includes a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted or added nucleotides is 0 or more and 3 or less nucleotides relative to the nucleotide sequence represented by SEQ ID NO: 1, and a primer consisting of a nucleotide sequence of 28 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted or added nucleotides is 0 or more and 3 or less nucleotides relative to the nucleotide sequence represented by SEQ ID NO: 2. <A12> The method according to any one of <A1> to <A11>, wherein the at least two sets of primer sets used in step B above include a primer set comprising a primer of 35 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted or added bases is 0 or more and 3 or less in length, and a primer set comprising a nucleotide sequence of 32 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted or added bases is 0 or more and 3 or less in length, and a primer set comprising a nucleotide sequence of 32 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted or added bases is 0 or more and 3 or less in length, and a primer set comprising a nucleotide sequence of 31 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted or added bases is 0 or more and 3 or less in length, in relation to the nucleotide sequence represented by SEQ ID NO: 6.<A13> The at least one set of primers used in step A above includes a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more and 3 or less nucleotides relative to the nucleotide sequence represented by SEQ ID NO: 1, and a primer consisting of a nucleotide sequence of 28 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides relative to the nucleotide sequence represented by SEQ ID NO: 2, and the at least two sets of primers used in step B above are The method according to any one of <A1> to <A12>, comprising: a primer consisting of a nucleotide sequence of 35 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by SEQ ID NO: 3; a primer set consisting of a nucleotide sequence of 32 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by SEQ ID NO: 4; a primer set consisting of a nucleotide sequence of 32 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by SEQ ID NO: 5; and a primer set consisting of a nucleotide sequence of 31 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by SEQ ID NO: 6.<A14> The method according to any one of <A1> to <A13>, which includes identifying the bacterium to be evaluated as Lactococcus lactis subsp. lactis JCM 5805 if all of the following conditions (X1), (X2), and (X3) are met: (X1) A primer set comprising a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 nucleotides, and a primer consisting of a nucleotide sequence of 28 nucleotides or less, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 nucleotides, contains nucleic acids with a nucleotide length of 250 bp to 350 bp; (X2) A nucleic acid amplified by a primer set consisting of a primer of 35 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 3, and a primer of 32 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 4, contains nucleic acids with a nucleotide length of 200 bp to 350 bp; (X3) A nucleic acid amplified by a primer set consisting of a primer of 32 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 5, and a primer of 31 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 6, contains nucleic acids with a nucleotide length of 250 bp to 400 bp. <A15> The method according to any one of <A1> to <A14>, wherein the specified bacterial strain is Lactococcus lactis subspecies lactis JCM 5805. <A16> The method according to any one of <A1> to <A9>, wherein the bacterial species to which the specified bacterial strain belongs is Lactobacillus paracasei.<A17> The method according to any one of <A1> to <A9> and <A16>, wherein the primer set used in step A above comprises a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of nucleotides substituted, deleted, inserted or added to the nucleotide sequence represented by SEQ ID NO: 7 is 0 or 3 or less, and a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of nucleotides substituted, deleted, inserted or added to the nucleotide sequence represented by SEQ ID NO: 8 is 0 or 3 or less. <A18> The method according to any one of <A1> to <A9> and <A16> to <A17>, wherein the at least two sets of primer sets used in step B above include a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which contains a nucleotide sequence in which the total number of substituted, deleted, inserted or added nucleotides is 0 or more and 3 or less in length, and a primer consisting of a nucleotide sequence of 32 nucleotides or less, which contains a nucleotide sequence in which the total number of substituted, deleted, inserted or added nucleotides is 0 or more and 3 or less in length, and a primer consisting of a nucleotide sequence of 30 nucleotides or less, which contains a nucleotide sequence in which the total number of substituted, deleted, inserted or added nucleotides is 0 or more and 3 or less in length, and a primer consisting of a nucleotide sequence of 32 is used in step B above.<A19> The at least one set of primers used in step A above includes a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more and 3 or less nucleotides relative to the nucleotide sequence represented by SEQ ID NO: 7, and a primer set consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides relative to the nucleotide sequence represented by SEQ ID NO: 8, and the at least two sets of primers used in step B above are The method according to any one of <A1> to <A9> and <A16> to <A18>, comprising: a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more and 3 or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more and 3 or less in length, which includes a primer set consisting of a nucleotide sequence of 32 nucleotides or less nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more and 3 or less in length, which includes a primer set consisting of a primer set according to any one of <A1> to <A9> and <A16> to <A18>.<A20> The method according to any one of <A1> to <A9> and <A16> to <A19>, which includes identifying the bacterium to be evaluated as Lactobacillus paracasei KW3110 when all of the following conditions (Y1), (Y2), and (Y3) are met: (Y1) A primer set comprising a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 in length, and a primer consisting of a nucleotide sequence of 30 nucleotides or less, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 in length, and containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 in length, contains nucleic acids with a nucleotide length of 450 bp to 550 bp; (Y2) The nucleic acid amplified by the primer set consisting of a primer of 30 base sequences or less in length, containing a base sequence in which the total number of substituted, deleted, inserted, or added bases is between 0 and 3 relative to the base sequence represented by Sequence ID No. 9, and a primer of 32 base sequences or less in length, containing a base sequence in which the total number of substituted, deleted, inserted, or added bases is between 0 and 3 relative to the base sequence represented by Sequence ID No. 10, contains nucleic acids with a base length of 330 bp to 500 bp; (Y3) The nucleic acid amplified by the primer set consisting of a primer of 30 base sequences or less in length, containing a base sequence in which the total number of substituted, deleted, inserted, or added bases is between 0 and 3 relative to the base sequence represented by Sequence ID No. 11, and a primer of 32 base sequences or less in length, containing a base sequence in which the total number of substituted, deleted, inserted, or added bases is between 0 and 3 relative to the base sequence represented by Sequence ID No. 12, contains nucleic acids with a base length of 300 bp to 450 bp as the most amplified nucleic acid. <A21> The method according to any one of <A1> to <A9> and <A16> to <A20>, wherein the specified bacterial strain is Lactobacillus paracasei KW3110.<A22> A method for analyzing a composition containing bacteria, comprising determining that the composition is a composition containing the predetermined bacterial strain when the bacteria contained in the composition are identified as the predetermined bacterial strain by identification according to any one of the methods described in <A1> to <A21>. <B1> A kit for identifying a bacterium to be evaluated as a predetermined bacterial strain, comprising at least one set of primers for amplifying a genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs, and at least two sets of primers for amplifying repetitive sequences present in the genome of the bacterial species to which the predetermined bacterial strain belongs. <B2> The kit according to <B1>, wherein the predetermined bacterial strain is a lactic acid bacterium. <B3> The kit according to <B1> or <B2>, wherein the predetermined bacterial strain belongs to the genus Lactococcus or Lactobacillus. <B4> A kit according to any one of <B1> to <B3>, wherein the bacterial species to which the specified bacterial strain belongs is Lactococcus lactis subspecies lactis. <B5> A kit according to any one of <B1> to <B4>, wherein the specified bacterial strain is Lactococcus lactis subspecies lactis JCM 5805.<B6> A set of primers that amplifies a genome sequence specific to the bacterial species to which the specified bacterial strain belongs includes a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which contains a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more and 3 or less in length, and a primer consisting of a nucleotide sequence of 28 nucleotides or less, which contains a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more and 3 or less in length A kit according to any one of <B1> to <B5>, comprising at least two sets of primers for amplifying repetitive sequences present in the genome of the bacterial species to which the above-mentioned specified bacterial strain belongs, each set comprising: a primer consisting of a nucleotide sequence of 35 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by Sequence ID No. 3; and a primer consisting of a nucleotide sequence of 32 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by Sequence ID No. 4; and a primer set consisting of a nucleotide sequence of 32 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by Sequence ID No. 5; and a primer consisting of a nucleotide sequence of 31 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by Sequence ID No. 6. <B7> A kit according to any one of <B1> to <B3>, wherein the bacterial species to which the specified bacterial strain belongs is Lactobacillus paracasei. <B8> A kit according to any one of <B1> to <B3> and <B7>, wherein the specified bacterial strain is Lactobacillus paracasei KW3110.<B9> A set of primers that amplifies a genome sequence specific to the bacterial species to which the specified bacterial strain belongs comprises a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 7, and a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 8, A kit according to any one of <B1> to <B3> and <B7> to <B8>, comprising at least two sets of primers for amplifying repetitive sequences present in the genome of the bacterial species to which the above-mentioned specified bacterial strain belongs, each set comprising a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 to 3 nucleotides or less relative to the nucleotide sequence represented by SEQ ID NO: 9, and a primer consisting of a nucleotide sequence of 32 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 to 3 nucleotides or less relative to the nucleotide sequence represented by SEQ ID NO: 10, and a primer set consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 to 3 nucleotides or less relative to the nucleotide sequence represented by SEQ ID NO: 12. <B10> A kit in which all primers included in the primer set are artificial nucleic acids, as described in any one of <B1> to <B9>. <C1> A primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added bases is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 1. <C2> A primer consisting of a nucleotide sequence of 28 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added bases is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 2. <C3> A primer consisting of a nucleotide sequence of 35 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added bases is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 3.<C4> A primer consisting of a nucleotide sequence of 32 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 4. <C5> A primer consisting of a nucleotide sequence of 32 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 5. <C6> A primer consisting of a nucleotide sequence of 31 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 6. <C7> A primer consisting of a nucleotide sequence of 30 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 7. <C8> A primer consisting of a nucleotide sequence of 30 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 8. <C9> A primer consisting of a nucleotide sequence of 30 nucleotides or less in length, containing a nucleotide sequence in which the total number of nucleotides substituted, deleted, inserted, or added to the nucleotide sequence represented by Sequence ID No. 9 is between 0 and 3. <C10> A primer consisting of a nucleotide sequence of 32 nucleotides or less in length, containing a nucleotide sequence in which the total number of nucleotides substituted, deleted, inserted, or added to the nucleotide sequence represented by Sequence ID No. 10 is between 0 and 3. <C11> A primer consisting of a nucleotide sequence of 30 nucleotides or less in length, containing a nucleotide sequence in which the total number of nucleotides substituted, deleted, inserted, or added to the nucleotide sequence represented by Sequence ID No. 11 is between 0 and 3. <C12> A primer consisting of a nucleotide sequence of 32 nucleotides or less in length, containing a nucleotide sequence in which the total number of nucleotides substituted, deleted, inserted, or added to the nucleotide sequence represented by Sequence ID No. 12 is between 0 and 3. <C13> A primer consisting of the nucleotide sequence represented by Sequence ID No. 1. <C14> A primer consisting of the nucleotide sequence represented by Sequence ID No. 2. <C15> A primer consisting of the nucleotide sequence represented by Sequence ID No. 3. <C16> A primer consisting of the nucleotide sequence represented by Sequence ID No. 4. <C17> A primer consisting of the nucleotide sequence represented by Sequence ID No. 5. <C18> A primer consisting of the nucleotide sequence represented by Sequence ID No. 6. <C19> A primer consisting of the nucleotide sequence represented by Sequence ID No. 7.<C20> A primer consisting of the nucleotide sequence represented by Sequence ID No. 8. <C21> A primer consisting of the nucleotide sequence represented by Sequence ID No. 9. <C22> A primer consisting of the nucleotide sequence represented by Sequence ID No. 10. <C23> A primer consisting of the nucleotide sequence represented by Sequence ID No. 11. <C24> A primer consisting of the nucleotide sequence represented by Sequence ID No. 12. <D1> A primer set consisting of a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 1, and a primer consisting of a nucleotide sequence of 28 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 2. <D2> A primer set consisting of a primer consisting of a nucleotide sequence of 35 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 4, and a primer consisting of a nucleotide sequence of 32 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 4. <D3> A primer set comprising a primer consisting of a nucleotide sequence of 32 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 5, and a primer consisting of a nucleotide sequence of 31 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 6. <D4> A primer set comprising a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 7, and a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 8.<D5> A primer set comprising a primer of 30 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 9, and a primer of 32 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 10. <D6> A primer set comprising a primer of 30 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 11, and a primer of 32 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 12. <D7> A primer set comprising a primer of the nucleotide sequence represented by Sequence ID No. 1 and a primer of the nucleotide sequence represented by Sequence ID No. 2. <D8> A primer set comprising a primer of the nucleotide sequence represented by Sequence ID No. 3 and a primer of the nucleotide sequence represented by Sequence ID No. 4. <D9> A primer set comprising a primer consisting of the nucleotide sequence represented by Sequence ID No. 5 and a primer consisting of the nucleotide sequence represented by Sequence ID No. 6. <D10> A primer set comprising a primer consisting of the nucleotide sequence represented by Sequence ID No. 7 and a primer consisting of the nucleotide sequence represented by Sequence ID No. 8. <D11> A primer set comprising a primer consisting of the nucleotide sequence represented by Sequence ID No. 9 and a primer consisting of the nucleotide sequence represented by Sequence ID No. 10. <D12> A primer set comprising a primer consisting of the nucleotide sequence represented by Sequence ID No. 11 and a primer consisting of the nucleotide sequence represented by Sequence ID No. 12. <E1> The use of at least one set of primers that amplifies a genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs, in order to identify a bacterium to be evaluated as a predetermined bacterial strain, wherein at least one set of primers that amplifies a genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs is used in combination with at least two sets of primers that amplify repetitive sequences present in the genome of the bacterial species to which the predetermined bacterial strain belongs.<E2> The use of at least two sets of primers that amplify repetitive sequences present in the genome of the bacterial species to which the predetermined bacterial strain belongs, in order to identify the bacteria to be evaluated as a predetermined bacterial strain, wherein the at least two sets of primers that amplify repetitive sequences present in the genome of the bacterial species to which the predetermined bacterial strain belongs are used in combination with at least one set of primers that amplify genomic sequences specific to the bacterial species to which the predetermined bacterial strain belongs. <E3> The use of a combination of at least one set of primers that amplify genomic sequences specific to the bacterial species to which the predetermined bacterial strain belongs, and at least two sets of primers that amplify repetitive sequences present in the genome of the bacterial species to which the predetermined bacterial strain belongs, in order to identify the bacteria to be evaluated as a predetermined bacterial strain. <E4>The use according to any one of <E1> to <E3>, comprising the following steps A and B: [Step A] A step of performing PCR using nucleic acid derived from the bacteria to be evaluated as a template, using each of at least one set of primers that amplify a genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs; [Step B] A step of performing PCR using nucleic acid derived from the bacteria to be evaluated as a template, using each of at least two sets of primers that amplify a repeat sequence present in the genome of the bacterial species to which the predetermined bacterial strain belongs; <E5>The use according to any one of <E1> to <E4>, wherein each of the PCRs in Step A and Step B is performed separately in a reaction solution containing only one set of primers. <E6>The use according to any one of <E1> to <E5>, wherein in Step A, each of the at least one set of primers is only one set of primers. <E7>The use according to any one of <E1> to <E6>, wherein in Step B, the at least two sets of primers are only two sets of primers. <E8> The use according to any one of <E1> to <E7>, wherein the PCR step included in the above method consists only of step A and step B, in step A each of the at least one set of primers is a set of only one primer, and in step B each of the at least two sets of primers is a set of only two primers.<E9> The use according to any one of <E1> to <E8>, comprising identifying the bacteria to be evaluated as the predetermined bacterial strain using the base length of the nucleic acid amplified by the PCR in step B as an indicator. <E10> The use according to any one of <E1> to <E9>, wherein the genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs is a base sequence specifically present in the 16S rRNA gene of the bacterial species. <E11> The method according to any one of <E1> to <E10>, wherein the predetermined bacterial strain is a lactic acid bacterium. <E12> The method according to any one of <E1> to <E11>, wherein the predetermined bacterial strain belongs to the genus Lactococcus or Lactobacillus. <E13> The use according to any one of <E1> to <E12>, wherein the bacterial species to which the specified bacterial strain belongs is Lactococcus lactis subspecies lactis. <E14> The use according to any one of <E1> to <E13>, wherein the at least one set of primers used in step A includes a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted or added nucleotides is 0 or more to the nucleotide sequence represented by Sequence ID No. 1 is 3 or less, and a primer consisting of a nucleotide sequence of 28 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted or added nucleotides is 0 or more to the nucleotide sequence represented by Sequence ID No. 2 is 3 or less.<E15> The use according to any one of <E1> to <E14>, wherein the at least two sets of primer sets used in step B above include a primer consisting of a nucleotide sequence of 35 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted or added nucleotides is 0 or more and 3 or less in length, and a primer consisting of a nucleotide sequence of 32 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted or added nucleotides is 0 or more and 3 or less in length, and a primer consisting of a nucleotide sequence of 32 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted or added nucleotides is 0 or more and 3 or less in length, and a primer consisting of a nucleotide sequence of 31 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted or added nucleotides is 0 or more and 3 or less in length, and is used according to any one of <E1> to <E14>.<E16> The at least one set of primers used in step A above includes a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more and 3 or less nucleotides relative to the nucleotide sequence represented by SEQ ID NO: 1, and a primer consisting of a nucleotide sequence of 28 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides relative to the nucleotide sequence represented by SEQ ID NO: 2, and the at least two sets of primers used in step B above are The use described in any one of <E1> to <E15> includes a primer consisting of a nucleotide sequence of 35 nucleotides or less in length, which contains a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by Sequence ID No. 3, and a primer set consisting of a nucleotide sequence of 32 nucleotides or less in length, which contains a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by Sequence ID No. 4, and a primer set consisting of a nucleotide sequence of 32 nucleotides or less in length, which contains a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by Sequence ID No. 5, and a primer set consisting of a nucleotide sequence of 31 nucleotides or less, which contains a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by Sequence ID No. 6.Use according to any one of <E1> to <E16>, including identifying the bacterium to be evaluated as Lactococcus lactis subsp. lactis JCM 5805 if all of the following conditions (X1), (X2), and (X3) are met: (X1) A primer set comprising a primer consisting of a nucleotide sequence of 30 nucleotides or less in length containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 nucleotides relative to the nucleotide sequence represented by SEQ ID NO: 1, and a primer consisting of a nucleotide sequence of 28 nucleotides or less containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 nucleotides relative to the nucleotide sequence represented by SEQ ID NO: 2, wherein the nucleic acid amplified by the primer set contains nucleic acid with a nucleotide length of 250 bp to 350 bp; (X2) A nucleic acid amplified by a primer set consisting of a primer of 35 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 3, and a primer of 32 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 4, contains nucleic acids with a nucleotide length of 200 bp to 350 bp; (X3) A nucleic acid amplified by a primer set consisting of a primer of 32 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 5, and a primer of 31 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 6, contains nucleic acids with a nucleotide length of 250 bp to 400 bp. <E18> The use according to any one of <E1> to <E17>, wherein the specified bacterial strain is Lactococcus lactis subspecies lactis JCM 5805. <E19> The use according to any one of <E1> to <E12>, wherein the bacterial species to which the specified bacterial strain belongs is Lactobacillus paracasei.<E20> The use according to any one of <E1> to <E12> and <E19>, wherein the primer set used in step A above includes a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of nucleotides substituted, deleted, inserted or added to the nucleotide sequence represented by Sequence ID No. 7 is 0 or 3 or less, and a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of nucleotides substituted, deleted, inserted or added to the nucleotide sequence represented by Sequence ID No. 8 is 0 or 3 or less. <E21> The use according to any one of <E1> to <E12> and <E19> to <E20>, wherein the at least two sets of primer sets used in step B above include a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted or added nucleotides is 0 or more and 3 or less in length, and a primer consisting of a nucleotide sequence of 32 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted or added nucleotides is 0 or more and 3 or less in length, and a primer consisting of a nucleotide sequence of 30 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted or added nucleotides is 0 or more and 3 or less in length, and a primer consisting of a nucleotide sequence of 32 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted or added nucleotides is 0 or more and 3 or less in length, and a primer using any one of <E1> to <E12> and <E19> to <E20>.<E22> The at least one set of primers used in step A above includes a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more and 3 or less nucleotides relative to the nucleotide sequence represented by SEQ ID NO: 7, and a primer set consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides relative to the nucleotide sequence represented by SEQ ID NO: 8, and the at least two sets of primers used in step B above are The use described in any one of <E1> to <E12> and <E19> to <E21> includes a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which contains a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by Sequence ID No. 9, and a primer set consisting of a nucleotide sequence of 32 nucleotides or less in length, which contains a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by Sequence ID No. 10, and a primer set consisting of a nucleotide sequence of 30 nucleotides or less in length, which contains a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by Sequence ID No. 11, and a primer set consisting of a nucleotide sequence of 32 nucleotides or less in length, which contains a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by Sequence ID No. 12.Use according to any one of <E1> to <E12> and <E19> to <E22>, including identifying the above-mentioned bacterium as Lactobacillus paracasei KW3110 if all of the following conditions (Y1), (Y2), and (Y3) are met: (Y1) A primer set comprising a primer consisting of a nucleotide sequence of 30 nucleotides or less in length containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 in relation to the nucleotide sequence represented by Sequence ID No. 7, and a primer consisting of a nucleotide sequence of 30 nucleotides or less in length containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 in relation to the nucleotide sequence represented by Sequence ID No. 8, wherein the nucleic acid amplified by the primer set contains nucleic acid with a nucleotide length of 450 bp to 550 bp; (Y2) The nucleic acid amplified by the primer set consisting of a primer of 30 base sequences or less in length, containing a base sequence in which the total number of substituted, deleted, inserted, or added bases is between 0 and 3 relative to the base sequence represented by Sequence ID No. 9, and a primer of 32 base sequences or less in length, containing a base sequence in which the total number of substituted, deleted, inserted, or added bases is between 0 and 3 relative to the base sequence represented by Sequence ID No. 10, contains nucleic acids with a base length of 330 bp to 500 bp; (Y3) The nucleic acid amplified by the primer set consisting of a primer of 30 base sequences or less in length, containing a base sequence in which the total number of substituted, deleted, inserted, or added bases is between 0 and 3 relative to the base sequence represented by Sequence ID No. 11, and a primer of 32 base sequences or less in length, containing a base sequence in which the total number of substituted, deleted, inserted, or added bases is between 0 and 3 relative to the base sequence represented by Sequence ID No. 12, contains nucleic acids with a base length of 300 bp to 450 bp as the most amplified nucleic acid. <E24> The use according to any one of <E1> to <E12> and <E19> to <E23>, wherein the specified bacterial strain is Lactobacillus paracasei KW3110. <E25> The use according to any one of <E1> to <E24> for analyzing a composition containing bacteria.<E26> The use according to <E25>, which includes determining that the composition is a composition containing the predetermined bacterial strain when the bacteria contained in the composition are identified as the predetermined bacterial strain.

[0008] This disclosure provides a method for identifying bacterial strains. Furthermore, this disclosure provides kits, primers, and primer sets useful for identifying bacterial strains.

[0009] This figure shows the results of PCR performed using primer set 1 on nucleic acids extracted from dried bacterial cells and tablets in Example 1. 1 shows the results for Lactococcus lacticis subsp. lacticis JCM5805 cells, 2 shows the results for Lactococcus lacticis subsp. lacticis JCM5805 contained in tablets, 3 shows the results for Lactococcus lacticis subsp. lacticis ATCC7962 cells, 4 shows the results for Lactococcus lacticis subsp. lacticis ATCC15577 cells, and 5 shows the results for Lactococcus lacticis subsp. Figure 1 shows the results for Lactis JCM7638, 6 shows the results for Lactococcus lactis subsp. lactis ATCC29146, 7 shows the results for Lactococcus lactis subsp. cremoris JCM20076, 8 shows the results for Lactobacillus rhamnosus ATCC53103, and 9 shows the results for Lactobacillus paracasei KW3110. In Example 1, the band detected in Figure 1 was Lactococcus lactis subsp. This figure shows the results of PCR performed using primer set 2 on nucleic acids extracted from five strains of Lactis lactic acid bacteria. 1 shows the results for the bacterial cells of Lactococcus lactic acid bacteria subsp. lacticis JCM5805, 2 shows the results for Lactococcus lacticis subsp. lacticis JCM5805 contained in tablets, 3 shows the results for the bacterial cells of Lactococcus lacticis subsp. lacticis ATCC7962, and 4 shows the results for Lactococcus lacticis subsp. The results for Lactis ATCC15577 are shown, 5 shows the results for Lactococcus lacticis subsp. lacticis JCM7638, and 6 shows the results for Lactococcus lacticis subsp. lacticis ATCC29146.This figure shows the results of PCR performed using primer set 3 on nucleic acids extracted from five strains of Lactococcus lactic acid bacteria, from which a band was detected in Figure 1, in Example 1. 1 shows the results for the bacterial cells of Lactococcus lactic acid bacteria JCM5805, 2 shows the results for Lactococcus lactic acid bacteria JCM5805 contained in tablets, 3 shows the results for the bacterial cells of Lactococcus lactic acid bacteria ATCC7962, and 4 shows the results for Lactococcus lactic acid bacteria ATCC7962. The results for Lactis ATCC15577 are shown, 5 shows the results for Lactococcus lacticis subsp. lacticis JCM7638, and 6 shows the results for Lactococcus lacticis subsp. lacticis ATCC29146. This figure shows the results of PCR performed on nucleic acids extracted from tablets containing Lactobacillus paracasei KW3110 in Example 2 using primer sets 4 to 6. 1 shows the results of PCR performed using primer set 4, 2 shows the results of PCR performed using primer set 5, and 3 shows the results of PCR performed using primer set 6. This figure shows the results of PCR performed on nucleic acids extracted from dried Lactobacillus paracasei JCM 1109 cells using primer sets 4 to 6 in Example 2. Figure 1 shows the results of PCR performed using primer set 4, figure 2 shows the results of PCR performed using primer set 5, and figure 3 shows the results of PCR performed using primer set 6. This figure shows the results of PCR performed on nucleic acids extracted from dried Lactobacillus paracasei JCM 1133 cells using primer sets 4 to 6 in Example 2. Figure 1 shows the results of PCR performed using primer set 4, figure 2 shows the results of PCR performed using primer set 5, and figure 3 shows the results of PCR performed using primer set 6.This figure shows the results of PCR performed on nucleic acids extracted from dried bacterial cells of Lactobacillus paracasei ATCC 25302 in Example 2, using primer sets 4 to 6. Figure 1 shows the results of PCR performed using primer set 4, Figure 2 shows the results of PCR performed using primer set 5, and Figure 3 shows the results of PCR performed using primer set 6. This figure shows the results of PCR performed on nucleic acids extracted from dried bacterial cells of Lactobacillus casei JCM 1134 in Example 2, using primer sets 4 to 6. Figure 1 shows the results of PCR performed using primer set 4, Figure 2 shows the results of PCR performed using primer set 5, and Figure 3 shows the results of PCR performed using primer set 6.

[0010] The following describes the forms by which this disclosure can be implemented, but this disclosure should not be construed as being limited to the following embodiments.

[0011] <Bacteria>

[0012] The bacteria relating to this disclosure may be, for example, useful bacteria, and may be bacteria useful for administration to humans. The bacteria relating to this disclosure may be, for example, Gram-positive bacteria or Gram-negative bacteria. In one embodiment, the bacteria relating to this disclosure may be lactic acid bacteria.

[0013] Lactic acid bacteria are bacteria that produce lactic acid as a metabolite. Examples of lactic acid bacteria include the genera Oenococcus, Bifidobacterium, Weissella, Tetragenococcus, Lactococcus, Leuconostoc, and Pedi. Examples include bacteria of the genera Ococcus, Streptococcus, Enterococcus, Lactobacillus, acetic acid bacteria, Hendrickxia (formerly classified as a Bacillus), and Bacillus.

[0014] In this specification, the genus Lactobacillus includes bacteria that were classified under the genus Lactobacillus before the reclassification of the genus Lactobacillus. For example, following the reclassification of the genus Lactobacillus, the genera Acetilactobacillus, Agrilactobacillus, Amyloractobacillus, Apiractobacillus, and Bomby Lactobacillus genus, Companilactobacillus genus, Delaglioa genus, Fructilactobacillus genus, Furfurilactobacillus ) genus, Holzapfelia genus, Lacticaseibacillus genus, Lactiplantibacillus genus, Lapidilactobacillus genus, Latilactobacillus genus, Lentilactobacillus genus, Leviractobacillus genus, Ligilactobacillus genus, Limosilactobacillus genus This includes bacteria classified into genera such as Liquoricolactobacillus, Loigolactobacillus, Paralactobacillus, Paucilactobacillus, Schleiferilactobacillus, and Secundilactobacillus.

[0015] Among the above, the bacteria include those of the genera Oenococcus, Bifidobacterium, Lentilactobacillus, Weissella, Tetragenococcus, and Lactococcus. The bacteria are preferably of the genus Leuconostoc, Pediococcus, Enterococcus, Lactobacillus, and Lactiplantibacillus, with Lactococcus and Lactobacillus being more preferred.

[0016] While not limited to specific species, the genus Oenococcus includes, for example, Oenococcus oeni. A specific example of an Oenococcus species is Oenococcus oeni JCM 6125.

[0017] The genus Bifidobacterium is not particularly limited, but examples include Bifidobacterium animalis subspecies lactis, Bifidobacterium pseudolongum, Bifidobacterium bifidum, Bifidobacterium breve, and Bifidobacterium longum subspecies longum. Examples include Bifidobacterium longum and Bifidobacterium longum subspecies infantis. Specific examples of Bifidobacterium species include Bifidobacterium animalis subspecies lactis JCM 10602, Bifidobacterium animalis subspecies lactis BB-12, Bifidobacterium longum subspecies infantis JCM 1222, Bifidobacterium longum subspecies infantis M-63, Bifidobacterium longum subspecies longum BB536, Bifidobacterium longum subspecies longum N61, Bifidobacterium bifidum OLB 6378, Bifidobacterium breve M-16V, Bifidobacterium breve MCC 1274, and Bifidobacterium pseudolongum Examples include JCM 1205.

[0018] Weissella species are not limited to those listed, but examples include Weissella paramesenteroides and Weissella viridescens. Specific examples of Weissella species include Weissella paramesenteroides JCM 9890 and Weissella viridescens JCM 1174.

[0019] While not particularly limited, examples of Tetragenococcus species include Tetragenococcus halophyllus. Specific examples of Tetragenococcus species include Tetragenococcus halophyllus NRIC 0098 and Tetragenococcus halophyllus No. 1.

[0020] The genus Lactococcus is not particularly limited, but examples include Lactococcus lactis, Lactococcus lactis subsp. lactis, Lactococcus garvieae, Lactococcus lactis subsp. cremoris, and Lactococcus lactis subsp. heldniae. Examples include *Lactococcus hordniae* and *Lactococcus plantarum*.

[0021] Specific examples of Lactococcus species include Lactococcus lactis subspecies lactis JCM 5805, Lactococcus lactis subspecies lactis NBRC 12007, Lactococcus lactis subspecies lactis NRIC 1150, Lactococcus lactis subspecies lactis JCM 20101, Lactococcus lactis subspecies lactis JCM 7638, Lactococcus lactis subspecies lactis ATCC 7963, Lactococcus lactis subspecies lactis ATCC 7962, Lactococcus lactis subspecies lactis ATCC 29146, Lactococcus lactis subspecies lactis ATCC 27861, Lactococcus lactis subspecies lactis ATCC 19435, Lactococcus lactis subspecies lactis ATCC 15577, Lactococcus lactis subspecies lactis ATCC 15346, Lactococcus lactis subspecies lactis ATCC 13675, Lactococcus lactis subspecies lactis ATCC 12929, Lactococcus lactis subspecies lactis ATCC 11955, Lactococcus lactis subspecies lactis ATCC 11454, Lactococcus lactis subspecies lactis ATCC 11007, Lactococcus garvieae NBRC Examples include Lactococcus lactis subspecies cremoris JCM 100934, Lactococcus lactis subspecies cremoris JCM 16167, Lactococcus lactis subspecies cremoris JCM 20076, Lactococcus lactis subspecies cremoris NBRC 100676, Lactococcus lactis subspecies heldniae JCM 1180, Lactococcus lactis subspecies heldniae JCM 11040, and Lactococcus plantarum JCM 11056.

[0022] Examples of Leuconostoc species include Leuconostoc carnosum and Leuconostoc lactis. Specific examples of Leuconostoc species include Leuconostoc carnosum JCM 9695 and Leuconostoc lactis NBRC 12455.

[0023] The genus Pediococcus is not particularly limited, but examples include Pediococcus acidilactis, Pediococcus pentosaceus, Pediococcus cellicola, Pediococcus claussenii, Pediococcus damnosus, and Pediococcus etanoridurans. Examples include *Pediococcus ethanolidurans*, *Pediococcus inopinatus*, *Pediococcus parvulus*, and *Pediococcus stilesii*. Specific examples of *Pediococcus* species include *Pediococcus acidilactici* JCM 8797, *Pediococcus acidilactici* K15, and *Pediococcus damnosus* JCM 5886.

[0024] Examples of Streptococcus species include, but are not limited to, Streptococcus thermophilus. Specific examples of Pediococcus species include Streptococcus thermophilus SBC 8781.

[0025] Enterococcus species are not particularly limited, but examples include Enterococcus alcedinis and Enterococcus faecalis. A specific example of an Enterococcus species is Enterococcus faecalis EC-12.

[0026] The genus Lactobacillus is not particularly limited, but examples include Lactobacillus paracasei, Lactobacillus delbrüeckii, Lactobacillus casei, Lactobacillus fructivorans, Lactobacillus hilgardii, Lactobacillus rhamnosus, and Lactobacillus gasseri. Examples include Lactobacillus gasseri, Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus parakefili, Lactobacillus plantarum, and Lactobacillus pentosus.

[0027] Specific examples of Lactobacillus species include Lactobacillus paracasei (Lacticaseibacillus in the new classification) KW3110, Lactobacillus paracasei MCC 1849, Lactobacillus paracasei K71, Lactobacillus paracasei JCM 1109, Lactobacillus paracasei JCM 1133, Lactobacillus paracasei ATCC 25302, Lactobacillus paracasei K-2, Lactobacillus rhamnosus GG, Lactobacillus rhamnosus CRL 1505, Lactobacillus rhamnosus ATCC 53103, Lactobacillus gasseri SBT 2055, Lactobacillus gasseri OLL 2716, and Lactobacillus gasseri Examples include PA-3, Lactobacillus acidophilus L-92, Lactobacillus casei subspecies casei 327, Lactobacillus casei Shirota (reclassified as Lacticaceibacillus in the new classification), Lactobacillus casei JCM 1134, Lactobacillus bulgaricus OLL 1073R-1, Lactobacillus bulgaricus 2038, Lactobacillus parakefiri (reclassified as Lentilactobacillus in the new classification) JCM 8573, Lactobacillus plantarum (reclassified as Lactipruntilabacillus in the new classification) L-137, Lactobacillus pentosa (reclassified as Lactipruntilabacillus in the new classification) ONRICb 0240, and Lactobacillus delbruecki NBRC 13953.

[0028] While not particularly limited, examples of fungi belonging to the genus Hendrickxia include Hendrickxia coagulans (also known as Bacillus coagulans). Specific examples of Hendrickxia fungi include Hendrickxia (Bacillus) coagulans SANK 70258 and Hendrickxia (Bacillus) coagulans BC99.

[0029] The acetic acid bacteria are not particularly limited, but examples include bacteria of the genus Gluconacetobacter, Acetobacter, and Gluconobacter. In one embodiment, bacteria of the genus Gluconacetobacter are mentioned, in another embodiment, Gluconacetobacter hanzenii is mentioned, and in yet another embodiment, Gluconacetobacter hanzenii GK-1 is mentioned.

[0030] In addition to the above, the bacteria that are the target substance in one embodiment may be of the genera Akkermansia, Bacteroides, Blautia, Clostridium, Collinsella, Faecalibacterium, Faecalatena, Lacrimispora, Paeniclostridium, Parabacteroides, or Roseburia.

[0031] Specific examples of fungi belonging to the genus Akkermansia include Akkermansia muciniphila JCM 30893.

[0032] Specific examples of Bacteroides species include Bacteroides caccae JCM 9498T, Bacteroides fragilis JCM 11019T, Bacteroides fragilis JCM 11017, Bacteroides fragilis JCM 17586, Bacteroides fragilis JCM 17587, Bacteroides ovatus JCM 5824T, Bacteroides setaiotaomicron ATCC 29148T, Bacteroides setaiotaomicron ATCC 29741, Bacteroides setaiotaomicron ATCC 12290, Bacteroides uniformis JCM 5828T, and Bacteroides uniformis Examples include JCM 13286, Bacteroides uniformis JCM 13287, and Bacteroides uniformis JCM 13288.

[0033] Specific examples of Blautia species include Blautia acetategigens JCM 34803T, Blautia ammonialitica JCM 34802T, Blautia algi JCM 31394T, Blautia caecimulis JCM 34498T, Blautia coccoides JCM 1395T, Blautia fexis JCM 17205T, Blautia gluceracea JCM 17039T, Blautia hansenii JCM 14655, Blautia hansenii JCM 35484, Blautia hominis JCM 32276T, Blautia hydrogenotropica JCM 31266, and Blautia liqualis. Examples include JCM 34225T, Brautia lutii JCM 17040T, Brautia obeum JCM 31340, Brautia producta JCM 1471T, Brautia pseudococcoides JCM 35243T, Brautia cinckii JCM 14657T, Brautia vexlerae JCM 31267, and Brautia vexlerae JCM 35486.

[0034] Specific examples of Clostridium species include Clostridium butyricum JCM NT, Clostridium nexile JCM 31500T, and Clostridium cymbiosum JCM 1297T.

[0035] Specific examples of the genus Collinsella include Collinsella aerofasciens JCM 10188T, Collinsella intestinalis JCM 10643T, Collinsella stercolis JCM 10641T, and Collinsella tanakaei JCM 16071T.

[0036] Specific examples of bacteria belonging to the genus Faecalibacterium include Faecalibacterium hattleyi JCM 39210, Faecalibacterium longum JCM 39208, Faecalibacterium prausnizzi JCM 31915, Faecalibacterium prausnizzi JCM 39207, and Faecalibacterium prausnizzi JCM 39209.

[0037] Specific examples of bacteria belonging to the genus Faecalicatena include Faecalicatena oroticum JCM 1429T.

[0038] Specific examples of bacteria belonging to the genus Lacrimispora include Lacrimispora celerecrescent JCM 15734T, Lacrimispora sphenoides JCM 1415T, and Lacrimispora xylanoritica JCM 15735T.

[0039] Specific examples of bacteria belonging to the genus Paeniclostridium include Paeniclostridium sorderii JCM 3814T.

[0040] Specific examples of bacteria belonging to the genus Parabacteroides include Parabacteroides merdae JCM 9497T.

[0041] Specific examples of bacteria belonging to the genus Roseburia include Roseburia hominis JCM 17582, Roseburia intestinalis JCM 17583, and Roseburia inulinovorans JCM 17584.

[0042] The bacterial strains listed above can be obtained from public depositary institutions, etc. For example, the JCM strain can be obtained from the Microbial Materials Development Laboratory, BioResource Center, RIKEN (3-1-1 Takanodai, Tsukuba, Ibaraki Prefecture, Japan), the NBRC strain from the Biological Genetic Resources Division, National Institute of Technology and Evaluation (2-5-8 Kazusa-Kamatari, Kisarazu, Chiba Prefecture, Japan), the NRIC strain from the Strain Preservation Room, Tokyo University of Agriculture (1-1-1 Sakuragaoka, Setagaya-ku, Tokyo, Japan), and the ATCC strain from the American Type Culture Collection (USA).

[0043] Furthermore, Lactobacillus paracasei KW3110 is deposited as FERM BP-08634 at the Patent Organism Depository Center of the National Institute of Advanced Industrial Science and Technology (AIST) (1-1-1 Higashi, Tsukuba, Ibaraki Prefecture, Japan, Central Building 6) (currently, the Patent Organism Depository Center of the National Institute of Technology and Evaluation (NITE-IPOD) (2-5-8 Kazusa Kamatari, Kisarazu, Chiba Prefecture, Japan, Room 120)), which is the international depositary authority under the Budapest Convention for the Deposit of Patent Microorganisms (Deposit date: February 20, 2004). In addition, a derivative strain of Lactobacillus paracasei KW3110 is deposited at the same Patent Organism Depository Center as FERM BP-08635 (Deposit date: February 20, 2004).

[0044] Lactococcus lactis subsp. lactis JCM 5805 can be obtained from the RIKEN BioResource Center, Microbial Materials Development Laboratory as described above. However, in the present invention, the same strain of Lactococcus lactis subsp. lactis JCM 5805 stored in a preservation institution other than the RIKEN BioResource Center, Microbial Materials Development Laboratory can be used. Specifically, the same strain of Lactococcus lactis subsp. lactis JCM 5805 can be obtained from the Biological Resource Division of the National Institute of Technology and Evaluation (2-5-8 Kazusa Kamashima, Kisarazu City, Chiba Prefecture, Japan), the Strain Preservation Laboratory of Tokyo University of Agriculture (1-1-1 Sakuraoka, Setagaya Ward, Tokyo, Japan), and the American Type Culture Collection (USA), etc. Lactococcus lactis subsp. lactis JCM 5805 is deposited in the American Type Culture Collection as Lactococcus lactis subsp. lactis ATCC 9936 and Lactococcus lactis subsp. lactis ATCC 19435.

[0045] <Base sequence represented by SEQ ID NO: X or its mutant sequence> In the base sequence represented by SEQ ID NO: X (number) or its mutant sequence, the mutation with respect to the base sequence represented by SEQ ID NO: X may be, for example, base substitution, base deletion, base insertion, or base addition. The base to be substituted, deleted, inserted, or added may be a natural or unnatural nucleobase, but may be, for example, a natural nucleobase, and in one aspect, may be adenine, cytosine, guanine, thymine, or uracil.

[0046] The nucleotide sequence represented by Sequence ID X or its variant sequence may be, for example, a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides relative to the nucleotide sequence represented by Sequence ID X is 0 or more and 3 or less; preferably, a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides relative to the nucleotide sequence represented by Sequence ID X is 0 or more and 2 or less; more preferably, a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides relative to the nucleotide sequence represented by Sequence ID X is 0 or more and most preferably a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides relative to the nucleotide sequence represented by Sequence ID X is 0 (i.e., no substitutions, deletions, insertions, or additions). Here, a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides relative to the nucleotide sequence represented by Sequence ID X is 0 means a nucleotide sequence in which no mutation has been introduced relative to the nucleotide sequence represented by Sequence ID X. In other words, the nucleotide sequence represented by Sequence ID X or its variant sequence may most preferably be the nucleotide sequence represented by Sequence ID X. Furthermore, the substitution, deletion, insertion, or addition of bases to the base sequence represented by Sequence ID X is preferably performed on a base sequence excluding 6 to 10 bases from the 3' end of the base sequence represented by Sequence ID X, more preferably on a base sequence excluding 7 to 9 bases from the 3' end, and most preferably on a base sequence excluding 8 bases from the 3' end.

[0047] The base sequence represented by SEQ ID No. X (a number) or its variant sequence may be, for example, a base sequence having a sequence identity of 80% or more, 85% or more, 88% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% with the base sequence represented by SEQ ID No. X. In one aspect, the base sequence represented by SEQ ID No. X or its variant sequence may be a base sequence having a sequence identity of 90% or more with the base sequence represented by SEQ ID No. X. In a preferred aspect, it may be a base sequence having a sequence identity of 94% or more with the base sequence represented by SEQ ID No. X. In the most preferred aspect, it may be a base sequence having a sequence identity of 100% with the base sequence represented by SEQ ID No. X. In these cases, the base sequence represented by SEQ ID No. X (a number) or its variant sequence has a sequence identity with the base sequence represented by SEQ ID No. X that is not less than the above lower limit, and there may be no mutation in the bases corresponding to 6 or more, 10 or less, 7 or more, 9 or less, or 8 bases from the 3'-end of the base sequence represented by SEQ ID No. X. The sequence identity may be either local homology or global homology, and can be calculated according to a conventional method, and the determination method is not particularly limited. The sequence identity can be calculated, for example, as local homology using BLAST (Basic Local Alignment Search Tool).

[0048] <Additional Sequence> In the present disclosure, a base sequence (base sequence Q) within Y (a number) base lengths including a certain base sequence (base sequence P) means that the base sequence Q is the base sequence P or a base sequence to which an additional sequence is added so that the full length is within Y base lengths with respect to the base sequence P. The additional sequence in this case is not particularly limited. The bases constituting the additional sequence may be natural or unnatural nucleobases, and may be, for example, natural nucleobases. In one aspect, they may be adenine, cytosine, guanine, thymine, or uracil. Also, the additional sequence may be added only to the 5'-end of the base sequence P, only to the 3'-end of the base sequence P, or to both the 5'-end and 3'-end of the base sequence P. The additional sequence may preferably be added only to the 5'-end of the base sequence P.

[0049] The base length of base sequence Q, which contains base sequence P and is within Y base length, may be, for example, less than or equal to Y base length, and may be less than or equal to Y-2 base length, less than or equal to Y-4 base length, less than or equal to Y-6 base length, and preferably less than or equal to Y-7 base length, less than or equal to Y-8 base length, or less than or equal to Y-9 base length. In a particularly preferred embodiment, the base length of base sequence Q, which contains base sequence P and is within Y base length, may be less than or equal to Y-10 base length. In the most preferred embodiment, the base length of base sequence Q, which contains base sequence P and is within Y base length, may be the same as the base length of base sequence P. In other words, in the most preferred embodiment, base sequence Q, which contains base sequence P and is within Y base length, may be base sequence P. In these cases, base sequence Q contains base sequence P, has a base length less than or equal to the above upper limit, and may not have mutations in the bases corresponding to 6 to 10, 7 to 9, or 8 bases from the 3' end of the base sequence represented by sequence number P.

[0050] <Primers and Primer Sets> The primers relating to this disclosure may be, for example, DNA primers or RNA primers, and in one embodiment may be DNA primers. A DNA primer means a primer made of deoxyribonucleic acid (DNA), for example, a primer made of single-stranded DNA. An RNA primer means a primer made of ribonucleic acid (RNA), for example, a primer made of single-stranded RNA.

[0051] The primers relating to this disclosure may be, for example, primers consisting of a nucleotide sequence that includes at least a portion of a non-natural nucleotide sequence, and in one embodiment they may be primers consisting of a non-natural nucleotide sequence, and in a preferred embodiment they may be artificial nucleic acids. Artificial nucleic acids may be, for example, artificially designed and synthesized nucleic acids. Nucleic acids can be synthesized organically using, for example, a nucleic acid synthesizer, according to methods commonly used by those skilled in the art, or they can be synthesized using enzymatic reactions or biosynthesized. Primers can also be obtained by commissioning their manufacture to a company that provides contract manufacturing services for nucleic acid synthesis.

[0052] The base length of the primer may be, for example, 15 bases or more, 17 bases or more, or 18 bases or more, and may also be 35 bases or less, 32 bases or less, 29 bases or less, 27 bases or less, or 25 bases or less, and these upper and lower limits can be freely combined. The base length of the primer may be, for example, 15 bases or more and 35 bases or less, 15 bases or more and 32 bases or less, 15 bases or more and 29 bases or less, 15 bases or more and 27 bases or less, 15 bases or more and 25 bases or less, 17 bases or more and 35 bases or less, 17 bases or more and 32 bases or less, 17 bases or more and 29 bases or less, 17 bases or more and 27 bases or less, 17 bases or more and 25 bases or less, 18 bases or more and 35 bases or less, 18 bases or more and 32 bases or less, 18 bases or more and 29 bases or less, 18 bases or more and 27 bases or less, or 18 bases or more and 25 bases or less.

[0053] In this disclosure, a primer set means a set of forward primers and reverse primers used in one type of PCR. In this disclosure, in "at least N primer sets," "N or more primer sets," "N primer sets," and "only N primer sets" (where N is an integer of 2 or more), each set of primers is a set in which the nucleotide sequences of the forward primer and / or reverse primer are different from each other.

[0054] <PCR> In this disclosure, when performing PCR using a nucleic acid as a template, the nucleic acid used as the template is preferably DNA.

[0055] The PCR method relating to this disclosure is not particularly limited and can be carried out according to the methods commonly used by those skilled in the art. For example, PCR may involve a template nucleic acid, a forward primer, a reverse primer, deoxynucleoside triphosphates (dNTPs) corresponding to each nucleic acid base, DNA polymerase, and magnesium ions (Mg 2+PCR can be carried out by repeatedly subjecting a reaction mixture containing at least one of the following in the buffer to temperatures at which DNA denatures (e.g., around 90-98°C), temperatures at which primers complementarily bind to single-stranded DNA (annealing) (e.g., around 50-65°C), and temperatures at which DNA polymerase elongates the DNA strand (e.g., around 68-80°C). Reagents used in PCR are widely available to the general public from suppliers.

[0056] In this disclosure, the amplification of a certain base sequence by PCR means that the nucleic acid having said base sequence and the nucleic acid having a base sequence complementary to said base sequence are amplified by PCR.

[0057] <Steps A and B> The first embodiment of the present disclosure relates to a method for identifying a bacterial strain. The identification method of the first embodiment is a method for identifying a bacterium to be evaluated as a predetermined bacterial strain, and includes the following steps A and B. The order of steps A and B is not particularly limited and may be performed at different times or simultaneously. The identification method of this embodiment may be an in vitro method. [Step A] A step of performing PCR using nucleic acid derived from the bacterium to be evaluated as a template, using each of at least one set of primers that amplify a genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs. [Step B] A step of performing PCR using nucleic acid derived from the bacterium to be evaluated as a template, using each of at least two sets of primers that amplify a repeat sequence present in the genome of the bacterial species to which the predetermined bacterial strain belongs.

[0058] In the identification method of this embodiment, in step A, it is possible to identify that the bacteria to be evaluated belong to a bacterial species (Species) to which a predetermined bacterial strain (Strain) belongs, and further in step B, it is possible to identify that the bacteria to be evaluated is a predetermined bacterial strain (Strain) within that bacterial species (Species).

[0059] Step A is a step in which PCR is performed using nucleic acid derived from the bacterium to be evaluated as a template, using at least one set of primers that amplify genome sequences specific to the bacterial species to which a given bacterial strain belongs. In the PCR in Step A, genome sequences specific to the bacterial species to which the given bacterial strain belongs are amplified. Therefore, for example, in the PCR performed in Step A, the bacterium from which the amplified template nucleic acid occurred can be identified as a bacterium of the bacterial species to which the given bacterial strain belongs. Also, for example, in the PCR performed in Step A, the bacterium from which the amplified template nucleic acid having a predetermined base length occurred can be identified as a bacterium of the bacterial species to which the given bacterial strain belongs.

[0060] The genome sequence specific to the bacterial species to which a given bacterial strain belongs only needs to be specific to that bacterial species. The base length (bp) of the genome sequence specific to the bacterial species to which a given bacterial strain belongs may be, for example, 50 bp or more, 100 bp or more, 200 bp or more, or 300 bp or more, and may also be 10,000 bp or less, 3,000 bp or less, or 2,000 bp or less. These upper and lower limits can be freely combined, and the base length (bp) of the genome sequence specific to the bacterial species to which a given bacterial strain belongs may be, for example, 50 bp to 10,000 bp, 50 bp to 3,000 bp, 50 bp to 2,000 bp, 100 bp to 10,000 bp, 100 bp to 3,000 bp, 100 bp to 2,000 bp, 200 bp to 10,000 bp, 200 bp to 3,000 bp, 200 bp to 2,000 bp, 300 bp to 10,000 bp, 300 bp to 3,000 bp, or 300 bp to 2,000 bp.

[0061] In one embodiment, a genome sequence specific to the bacterial species to which a given bacterial strain belongs may be a nucleotide sequence specifically present in the 16S rRNA (16S ribosomal RNA) gene of that bacterial species. The 16S rRNA gene is a gene region present in the bacterial genomic DNA that encodes 16S rRNA, a small subunit of the ribosome. The 16S rRNA gene includes evolutionarily conserved regions as well as variable regions that have different variations for each bacterial species. Therefore, it is possible to identify a bacterial species based on the bacterial species specificity of the variable region. The nucleotide sequence specifically present in the 16S rRNA gene of a bacterial species may, for example, include at least a portion of the nucleotide sequence of the variable region.

[0062] The genome sequence specific to the bacterial species to which the predetermined bacterial strain amplified in step A belongs is not limited to a genome sequence specific to a single cell species in the latest bacterial classification, but may also be a genome sequence specific to two or more closely related cell species, such as those that were previously considered the same cell species. For example, since Lactobacillus paracasei and Lactobacillus casei are closely related bacterial species that were previously classified under one category, the genome sequence that Lactobacillus paracasei and Lactobacillus casei have in common, and that bacteria with distantly related taxonomic lines (e.g., Lactobacillus delbrueckii) do not have, can be said to be the bacterial species specific genome sequence amplified in step A.

[0063] Each of the at least one set of primers used in step A may consist of only one set of primers. In other words, in step A, only one set of primers that amplifies a genome sequence specific to the bacterial species to which a given bacterial strain belongs may be used. The inventors have found that even when only one set of primers that amplifies a genome sequence specific to the bacterial species to which a given bacterial strain belongs is used, the bacteria under evaluation can be identified as bacteria of the bacterial species to which the given bacterial strain belongs.

[0064] Step B is a step in which PCR is performed using nucleic acid derived from the bacterium to be evaluated as a template, using at least two sets of primers that amplify repetitive sequences present in the genome of the bacterial species to which the specified bacterial strain belongs.

[0065] Repetitive sequences are known to be universally present in the genomes of organisms such as bacteria, regardless of region. It is known that the number of repeats in a bacterial genome varies from strain to strain, even within the same bacterial species. Therefore, for example, in PCR in step B, bacterial strains can be identified using the base length of the amplified nucleic acid as an indicator. For instance, a bacterium from which a template nucleic acid of a predetermined base length was amplified may be identified as a predetermined bacterial strain. In this case, the amplified nucleic acid may be only one base length, or it may be two or more base lengths. If nucleic acids of two or more base lengths are amplified, the bacterial strain may be identified based on the combination of base lengths of the amplified nucleic acids. Thus, the identification method of this embodiment may include identifying the bacteria to be evaluated as a predetermined bacterial strain using the base length of the nucleic acid amplified in PCR in step B as an indicator.

[0066] The at least two primer sets used in step B may be just two primer sets. In other words, in step B, only two primer sets that amplify repetitive sequences present in the genome of the bacterial species to which the given bacterial strain belongs may be used. The inventors have found that even when only two primer sets that amplify repetitive sequences present in the genome of the bacterial species to which the given bacterial strain belongs are used, the bacteria being evaluated can be identified as belonging to the given bacterial strain.

[0067] In a preferred embodiment of the identification method of this embodiment, each PCR may be performed separately in a reaction solution containing only one set of primers. For example, in a preferred embodiment of the identification method of this embodiment, each PCR in step A and step B may be performed separately in a reaction solution containing only one set of primers. With this configuration, the amplification products resulting from multiple PCRs are not mixed, and bacterial strains can be easily identified based on the base length patterns of the nucleic acids amplified as a result of each PCR.

[0068] In one embodiment, the identification method of this embodiment may involve only steps A and B in which PCR is performed. In other words, in one embodiment, the identification method of this embodiment may not include PCR in steps other than A and B. The inventors have found that even if the PCR is performed only in steps A and B, the bacteria to be evaluated can be identified as a predetermined bacterial strain. In one particular embodiment, the identification method of this embodiment may involve only steps A and B in which PCR is performed, and in step A, each of at least one set of primers may consist of only one set of primers, and in step B, at least two sets of primers may consist of only two sets of primers. In these embodiments, the bacteria to be evaluated can be identified as a predetermined bacterial strain with high efficiency and simplicity.

[0069] <Preparation Step> The identification method of this embodiment may include a step (preparation step) of preparing a sample containing nucleic acids derived from the bacteria to be evaluated before steps A and B. The nucleic acids derived from the bacteria to be evaluated contained in the sample prepared in the preparation step include nucleic acids (e.g., DNA) that serve as templates for PCR in steps A and B.

[0070] The method for preparing the sample in the preparation step is not particularly limited as long as PCR can be performed in steps A and B, and can be carried out by methods commonly used by those skilled in the art. In one embodiment, nucleic acids may be extracted from the bacteria to be evaluated in the preparation step. In other words, the identification method of this embodiment may, in one embodiment, include the extraction of nucleic acids from the bacteria to be evaluated or a step thereof. The method for extracting nucleic acids from the bacteria to be evaluated is not particularly limited as long as the template nucleic acid does not degrade, and can be carried out by methods commonly used by those skilled in the art. Extraction of nucleic acids from the bacteria to be evaluated may include, for example, disrupting the bacterial cell wall and extracting nucleic acids from a solution containing the contents of the bacteria with the disrupted cell wall, and may further include purifying the nucleic acids by separating them as a precipitate. Disruption of the bacterial cell wall may be physical disruption such as bead crushing and ultrasonic irradiation, or chemical disruption by adding surfactants, etc. Extraction of nucleic acids may be, for example, by adding phenol and chloroform to a solution containing the contents of the bacteria and collecting the supernatant (phenol-chloroform extraction). Nucleic acids can be precipitated, for example, by adding a reagent (e.g., sodium acetate) to a solution containing nucleic acids to adjust the pH and ion concentration as needed, and then mixing the solution with isopropanol or ethanol.

[0071] <Evaluation Step> The identification method of this embodiment may include an evaluation step after steps A and B in which the amplification products amplified by each PCR are evaluated. In the evaluation step, the presence or absence and / or base length of the amplification product of step A may be evaluated, and in one embodiment, the base length of the amplification product of step A may be evaluated. In the evaluation step, the base length of the amplification product of step B may be evaluated. In this disclosure, the evaluation of the base length of nucleic acid may be an evaluation of a parameter corresponding to the base length, for example, the molecular weight of nucleic acid may be evaluated.

[0072] The evaluation method for the amplified product in the evaluation process is not particularly limited and can be carried out by methods commonly used by those skilled in the art. The base length of the amplified product may be evaluated by electrophoresis, for example, in which case the base length and amount of the amplified product may be evaluated based on the presence, size, and / or intensity of the band corresponding to the base length of the amplified product. In addition to electrophoresis, the presence or absence of the amplified product can also be evaluated by absorbance and quantitative PCR, for example. As for the quantitative PCR method, a real-time PCR method such as the TaqMan probe method may be used.

[0073] <Identification in Lactococcus lactis subspecies lactis> In one embodiment of the identification method of this embodiment, the bacterial species to which a given bacterial strain belongs may be Lactococcus lactis subspecies lactis. In other words, in one embodiment of the identification method of this embodiment, the given bacterial strain may be a bacterium belonging to Lactococcus lactis subspecies lactis. Hereafter, this embodiment will be referred to as the "first embodiment".

[0074] In the first embodiment, at least one set of primers used in step A may include a primer set comprising a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes the nucleotide sequence represented by SEQ ID NO: 1 or a variant thereof, and a primer consisting of a nucleotide sequence of 28 nucleotides or less in length, which includes the nucleotide sequence represented by SEQ ID NO: 2 or a variant thereof, or may consist only of this primer set. Hereafter, this primer set will also be referred to as "primer set 1". In primer set 1, the primer consisting of a nucleotide sequence of 30 nucleotides or less, which includes the nucleotide sequence represented by SEQ ID NO: 1 or a variant thereof, is a forward primer. Therefore, hereafter, this primer will also be referred to as "forward primer of primer set 1". Also, in primer set 1, the primer consisting of a nucleotide sequence of 28 nucleotides or less, which includes the nucleotide sequence represented by SEQ ID NO: 2 or a variant thereof, is a reverse primer. Therefore, hereafter, this primer will also be referred to as "reverse primer of primer set 1". In one particular embodiment, primer set 1 may be a primer set comprising a primer consisting of the nucleotide sequence represented by SEQ ID NO: 1 and a primer consisting of the nucleotide sequence represented by SEQ ID NO: 2. Sequence ID 1: GTTGGTACTGTACTGACTG Sequence ID 2: TGCTGCTCCCGTAGAG

[0075] In the first embodiment, at least two sets of primer sets used in step B may include a primer set consisting of a nucleotide sequence of 35 nucleotides or less in length, which includes the nucleotide sequence represented by SEQ ID NO: 3 or a variant thereof, and a primer set consisting of a nucleotide sequence of 32 nucleotides or less in length, which includes the nucleotide sequence represented by SEQ ID NO: 4 or a variant thereof. Hereafter, this primer set will also be referred to as "primer set 2". In primer set 2, the primer consisting of a nucleotide sequence of 35 nucleotides or less, which includes the nucleotide sequence represented by SEQ ID NO: 3 or a variant thereof, is a forward primer. Therefore, hereafter, this primer will also be referred to as "forward primer of primer set 2". Also, in primer set 2, the primer consisting of a nucleotide sequence of 32 nucleotides or less, which includes the nucleotide sequence represented by SEQ ID NO: 4 or a variant thereof, is a reverse primer. Therefore, hereafter, this primer will also be referred to as "reverse primer of primer set 2". In one particular embodiment, primer set 2 may be a primer set consisting of a primer consisting of the nucleotide sequence represented by SEQ ID NO: 3 and a primer consisting of the nucleotide sequence represented by SEQ ID NO: 4. Sequence ID 3: GGTCATCATCTCTTTGTAAACTTAGGC Sequence ID 4: TTTTAGGCCATTTTTCTGTCA

[0076] In the first embodiment, at least two sets of primer sets used in step B may include a primer set consisting of a nucleotide sequence of 32 nucleotides or less in length, which includes the nucleotide sequence represented by SEQ ID NO: 5 or a variant thereof, and a primer set consisting of a nucleotide sequence of 31 nucleotides or less in length, which includes the nucleotide sequence represented by SEQ ID NO: 6 or a variant thereof. Hereafter, this primer set will also be referred to as "primer set 3". In primer set 3, the primer consisting of a nucleotide sequence of 32 nucleotides or less, which includes the nucleotide sequence represented by SEQ ID NO: 5 or a variant thereof, is a forward primer. Therefore, hereafter, this primer will also be referred to as "forward primer of primer set 3". Also, in primer set 3, the primer consisting of a nucleotide sequence of 31 nucleotides or less, which includes the nucleotide sequence represented by SEQ ID NO: 6 or a variant thereof, is a reverse primer. Therefore, hereafter, this primer will also be referred to as "reverse primer of primer set 3". In one particular embodiment, primer set 3 may be a primer set consisting of a primer consisting of the nucleotide sequence represented by SEQ ID NO: 5 and a primer consisting of the nucleotide sequence represented by SEQ ID NO: 6. Sequence ID 5: TGATGAAGAGTCCTTGCTGAA Sequence ID 6: ACTGACAGAGCTGCAAATTCAT

[0077] In the first embodiment, the at least two primer sets used in step B may include primer set 2 and primer set 3, or consist only of primer set 2 and primer set 3. In the first embodiment, for example, the at least one primer set used in step A may include primer set 1, and the at least two primer sets used in step B may include primer set 2 and primer set 3. In the first embodiment, in a particular aspect, the PCR steps included in the identification method of this embodiment may consist only of steps A and B, the at least one primer set used in step A may consist only of primer set 1, and the at least two primer sets used in step B may consist only of primer set 2 and primer set 3.

[0078] In one embodiment of the first aspect, the bacterial strain identified by the identification method of this embodiment (i.e., a predetermined bacterial strain) may be Lactococcus lactis subspecies lactis JCM 5805 or a mutant thereof, and in one more preferred aspect, it may be Lactococcus lactis subspecies lactis JCM 5805. In this case, for example, if all of the following conditions (X1), (X2), and (X3) are met, the bacterium to be evaluated may be identified as Lactococcus lactis subsp. lactis JCM 5805. (X1) The nucleic acid amplified by PCR using primer set 1 includes nucleic acids with a base length of 250 bp to 350 bp, preferably including nucleic acids with a base length of 290 bp to 310 bp, and particularly preferably including nucleic acids with a base length of 290 bp to 310 bp as the most amplified nucleic acid. (X2) The nucleic acid amplified by PCR using primer set 2 includes nucleic acids with a base length of 200 bp to 350 bp, preferably including nucleic acids with a base length of 240 bp to 260 bp, and particularly preferably including nucleic acids with a base length of 240 bp to 260 bp as the most amplified nucleic acid. (X3) The nucleic acids amplified by PCR using primer set 3 include nucleic acids with a base length of 250 bp to 400 bp, preferably including nucleic acids with a base length of 310 bp to 330 bp, and particularly preferably including nucleic acids with a base length of 310 bp to 330 bp as the most amplified nucleic acid.

[0079] A mutant strain of Lactococcus lactis subspecies lactis JCM 5805 is acceptable as long as it possesses characteristics that can achieve the objectives of this technology (for example, characteristics that satisfy all of (X1), (X2), and (X3) above). Furthermore, it is preferable that the mutant strain is a bacterium that has the same mycological properties as Lactococcus lactis subspecies lactis JCM 5805.

[0080] Such mutant strains may have sequence identity of 80% or more, 85% or more, 88% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% with a genome sequence specific to the bacterial species to which Lactococcus lactis subspecies lactis JCM 5805 belongs (i.e., Lactococcus lactis subspecies lactis) (e.g., a nucleotide sequence specifically present in the 16S rRNA gene) and / or a repeat sequence present in the genome of Lactococcus lactis subspecies lactis JCM 5805. In one embodiment, the sequence identity may be 90% or more of a nucleotide sequence; in a preferred embodiment, the sequence identity may be 94% or more of a nucleotide sequence; in a more preferred embodiment, the sequence identity may be 96% or more of a nucleotide sequence; in an even more preferred embodiment, the sequence identity may be 98% or more of a nucleotide sequence; and in the most preferred embodiment, the sequence identity may be 99% or more of a nucleotide sequence. In these cases, there may be no mutations in the nucleotides corresponding to 6 to 10, 7 to 9, or 8 nucleotides from the 5' end of the genomic sequence specific to Lactococcus lactis subspecies lactis JCM 5805 and / or the repeat sequences present in the genome of Lactococcus lactis subspecies lactis JCM 5805. Sequence identity can be calculated according to conventional methods as described above, and the method of determination is not particularly limited. Sequence identity can be calculated, for example, using BLAST.

[0081] Furthermore, such mutant strains may be constructed by non-artificially introducing mutations into the above-mentioned Lactococcus lactis subspecies lactis JCM 5805. Alternatively, such mutant strains may be constructed by artificially introducing mutations into the above-mentioned Lactococcus lactis subspecies lactis JCM 5805, for example by introducing mutations into the above-mentioned bacterium by treatment with a mutagens such as UV or DNA alkylating agents, or by introducing mutations into the above-mentioned strain by known genetic engineering methods such as genetic recombination or gene editing represented by CRISPR-Cas9.

[0082] <Identification in Lactobacillus paracasei> In one embodiment of the identification method of this embodiment, the bacterial species to which a given bacterial strain belongs may be Lactobacillus paracasei. In other words, in one embodiment of the identification method of this embodiment, the given bacterial strain may be a bacterium belonging to Lactobacillus paracasei. Hereafter, this embodiment will be referred to as the "second embodiment".

[0083] In a second embodiment, the primer set used in step A may include a primer set comprising a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes the nucleotide sequence represented by SEQ ID NO: 7 or a variant thereof, and a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes the nucleotide sequence represented by SEQ ID NO: 8 or a variant thereof, or may consist only of this primer set. Hereafter, this primer set will also be referred to as "primer set 4". In primer set 4, the primer consisting of a nucleotide sequence of 30 nucleotides or less, which includes the nucleotide sequence represented by SEQ ID NO: 7 or a variant thereof, is a forward primer. Therefore, hereafter, this primer will also be referred to as "forward primer of primer set 4". Also, in primer set 4, the primer consisting of a nucleotide sequence of 30 nucleotides or less, which includes the nucleotide sequence represented by SEQ ID NO: 8 or a variant thereof, is a reverse primer. Therefore, hereafter, this primer will also be referred to as "reverse primer of primer set 4". In one particular embodiment, primer set 4 may be a primer set comprising a primer consisting of the nucleotide sequence represented by SEQ ID NO: 7 and a primer consisting of the nucleotide sequence represented by SEQ ID NO: 8. Sequence ID 7: GCAGAGTAACTGTTGTCGGC Sequence ID 8: CCGTCAATTCCTTTGAGTTT

[0084] In a second embodiment, at least two sets of primer sets used in step B may include a primer set comprising a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes the nucleotide sequence represented by SEQ ID NO: 9 or a variant thereof, and a primer set comprising a nucleotide sequence of 32 nucleotides or less in length, which includes the nucleotide sequence represented by SEQ ID NO: 10 or a variant thereof. Hereafter, this primer set will also be referred to as "primer set 5". In primer set 5, the primer consisting of a nucleotide sequence of 30 nucleotides or less, which includes the nucleotide sequence represented by SEQ ID NO: 9 or a variant thereof, is a forward primer. Therefore, hereafter, this primer will also be referred to as "forward primer of primer set 5". Also, in primer set 5, the primer consisting of a nucleotide sequence of 32 nucleotides or less, which includes the nucleotide sequence represented by SEQ ID NO: 10 or a variant thereof, is a reverse primer. Therefore, hereafter, this primer will also be referred to as "reverse primer of primer set 5". In one particular embodiment, primer set 5 may be a primer set comprising a primer consisting of the nucleotide sequence represented by SEQ ID NO: 9 and a primer consisting of the nucleotide sequence represented by SEQ ID NO: 10. Sequence ID 9: TTCGCCCTCTCTTTTCAAAC Sequence ID 10: TTCTGCATATGCTTGAACATT

[0085] In a second embodiment, at least two sets of primer sets used in step B may include a primer set comprising a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes the nucleotide sequence represented by SEQ ID NO: 11 or a variant thereof, and a primer set comprising a nucleotide sequence of 32 nucleotides or less in length, which includes the nucleotide sequence represented by SEQ ID NO: 12 or a variant thereof. Hereafter, this primer set will also be referred to as "primer set 6". In primer set 6, the primer consisting of a nucleotide sequence of 30 nucleotides or less, which includes the nucleotide sequence represented by SEQ ID NO: 11 or a variant thereof, is a forward primer. Therefore, hereafter, this primer will also be referred to as "forward primer of primer set 6". Also, in primer set 6, the primer consisting of a nucleotide sequence of 32 nucleotides or less, which includes the nucleotide sequence represented by SEQ ID NO: 12 or a variant thereof, is a reverse primer. Therefore, hereafter, this primer will also be referred to as "reverse primer of primer set 6". In one particular embodiment, primer set 6 may be a primer set comprising a primer consisting of the nucleotide sequence represented by SEQ ID NO: 11 and a primer consisting of the nucleotide sequence represented by SEQ ID NO: 12. Sequence ID 11: GCTTCTTGGGCCAATCACATC Sequence ID 12: TCTACTCATGAGGCAGCTATTGG

[0086] In a second embodiment, the at least two primer sets used in step B may include primer set 5 and primer set 6, or consist only of primer set 5 and primer set 6. In a second embodiment, for example, the at least one primer set used in step A may include primer set 4, and the at least two primer sets used in step B may include primer set 5 and primer set 6. In a particular aspect of the second embodiment, the PCR steps included in the identification method of this embodiment may consist only of steps A and B, the at least one primer set used in step A may consist only of primer set 4, and the at least two primer sets used in step B may consist only of primer set 5 and primer set 6.

[0087] In one embodiment of the second aspect, the bacterial strain identified by the identification method of this embodiment (i.e., a predetermined bacterial strain) may be Lactobacillus paracasei KW3110 or a mutant thereof, and in one more preferred aspect, it may be Lactobacillus paracasei KW3110. In this case, for example, the bacteria to be evaluated may be identified as Lactobacillus paracasei KW3110 if all of the following conditions (Y1), (Y2), and (Y3) are met. (Y1) The nucleic acid amplified by PCR using primer set 4 includes nucleic acids with a base length of 450 bp to 550 bp, preferably including nucleic acids with a base length of 480 bp to 500 bp, and particularly preferably including nucleic acids with a base length of 480 bp to 500 bp as the most amplified nucleic acid. (Y2) The nucleic acid amplified by PCR using primer set 5 includes nucleic acids with a base length of 330 bp to 500 bp, preferably including nucleic acids with a base length of 380 bp to 400 bp, and particularly preferably including nucleic acids with a base length of 380 bp to 400 bp as the most amplified nucleic acid. (Y3) The nucleic acid amplified by PCR using primer set 6 includes nucleic acids with a base length of 300 bp to 450 bp as the most amplified nucleic acid, preferably including nucleic acids with a base length of 360 bp to 400 bp as the most amplified nucleic acid, and particularly preferably including nucleic acids with a base length of 370 bp to 390 bp as the most amplified nucleic acid.

[0088] The mutant strain of Lactobacillus paracasei KW3110 only needs to have characteristics that can achieve the objectives of this technology (for example, characteristics that satisfy all of (Y1), (Y2), and (Y3) above). Furthermore, it is preferable that the mutant strain is a bacterium that has the same mycological properties as Lactobacillus paracasei KW3110.

[0089] Such mutant strains may have sequence identity of 80% or more, 85% or more, 88% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% with a genome sequence specific to the bacterial species to which Lactobacillus paracasei KW3110 belongs (i.e., Lactobacillus paracasei) (e.g., a nucleotide sequence specifically present in the 16S rRNA gene) and / or a repeat sequence present in the genome of Lactobacillus paracasei KW3110. In one embodiment, the sequence identity may be 90% or more of a nucleotide sequence; in a preferred embodiment, the sequence identity may be 94% or more of a nucleotide sequence; in a more preferred embodiment, the sequence identity may be 96% or more of a nucleotide sequence; in an even more preferred embodiment, the sequence identity may be 98% or more of a nucleotide sequence; and in the most preferred embodiment, the sequence identity may be 99% or more of a nucleotide sequence. In these cases, there may be no mutations in the nucleotides corresponding to 6 to 10, 7 to 9, or 8 nucleotides from the 5' end of the genome sequence specific to Lactobacillus paracasei KW3110 and / or the repeat sequences present in the genome of Lactobacillus paracasei KW3110. Sequence identity can be calculated according to conventional methods as described above, and the method of determination is not particularly limited. Sequence identity can be calculated, for example, using BLAST.

[0090] Such mutant strains may be constructed by non-artificially introducing mutations into the above-mentioned Lactobacillus paracasei KW3110. Alternatively, such mutant strains may be constructed by artificially introducing mutations into the above-mentioned Lactobacillus paracasei KW3110, for example by introducing mutations into the bacterium by treatment with a mutagens such as UV or DNA alkylating agents, or by introducing mutations into the strain by known genetic engineering methods such as genetic recombination or gene editing represented by CRISPR-Cas9.

[0091] <Other Embodiments> Another embodiment of the present disclosure may be each of the primer sets 1 to 6, each of the forward primers of primer sets 1 to 6, and each of the reverse primers of primer sets 1 to 6, as described in the identification method of the first embodiment. Another embodiment of the present disclosure may be a kit containing at least one of these. These can be suitably used in the identification method of the first embodiment. Such primer sets, primers, and kits may be for identifying the bacteria to be evaluated as a predetermined bacterial strain.

[0092] Another embodiment of the present disclosure relates to a kit for identifying a bacterium to be evaluated as a predetermined bacterial strain, comprising at least one set of primers for amplifying a genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs, and at least two sets of primers for amplifying repetitive sequences present in the genome of the bacterial species to which the predetermined bacterial strain belongs. The primer sets and embodiments of the kit according to this embodiment are the same as those described in the identification method of the first embodiment.

[0093] In one embodiment, the kit according to this embodiment may be of the bacterial species to which a predetermined bacterial strain belongs, Lactococcus lactis subspecies lactis. In this case, the predetermined bacterial strain may be Lactococcus lactis subspecies lactis JCM 5805 or a mutant thereof, and in a more preferred embodiment, it may be Lactococcus lactis subspecies lactis JCM 5805. In these cases, in a particular embodiment, the kit may include primer set 1, primer set 2, and primer set 3, or it may consist of primer set 1, primer set 2, and primer set 3.

[0094] In one embodiment, the kit according to this embodiment may be of the bacterial species Lactobacillus paracasei, to which a predetermined bacterial strain belongs. In this case, the predetermined bacterial strain may be Lactobacillus paracasei KW3110 or a mutant thereof, and in a more preferred embodiment, it may be Lactobacillus paracasei KW3110. In these cases, in a particular embodiment, the kit may include primer set 4, primer set 5, and primer set 6, or may consist of primer set 4, primer set 5, and primer set 6.

[0095] A further embodiment of the present disclosure relates to the use of at least one set of primers for amplifying a genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs, in order to identify a bacterium to be evaluated as a predetermined bacterial strain, wherein the at least one set of primers for amplifying a genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs is used in combination with at least two sets of primers for amplifying repetitive sequences present in the genome of the bacterial species to which the predetermined bacterial strain belongs. A further embodiment of the present disclosure relates to the use of at least two sets of primers for amplifying repetitive sequences present in the genome of the bacterial species to which the predetermined bacterial strain belongs, in order to identify a bacterium to be evaluated as a predetermined bacterial strain, wherein the at least two sets of primers for amplifying repetitive sequences present in the genome of the bacterial species to which the predetermined bacterial strain belongs is used in combination with at least one set of primers for amplifying a genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs. Another embodiment of the present disclosure relates to the use of a combination of at least one set of primers that amplifies a genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs, and at least two sets of primers that amplify repetitive sequences present in the genome of the bacterial species to which the predetermined bacterial strain belongs, in order to identify the bacteria to be evaluated as a predetermined bacterial strain. The primer sets and the manner of their use relating to these uses are the same as those described in the identification method of the first embodiment.

[0096] <Method for Analyzing Compositions> Another embodiment of the present disclosure relates to a method for analyzing a composition containing bacteria, the method comprising determining that a composition is a composition containing the predetermined bacterial strain when, by identification according to the identification method of the first embodiment, the bacteria contained in the composition are identified as the predetermined bacterial strain.

[0097] The analytical method of this embodiment may include, in addition to identifying the bacteria contained in the composition as a predetermined bacterial strain by identification according to the identification method of the first embodiment, isolating the bacteria or their nucleic acids from the composition. The method for isolating the bacteria or their nucleic acids from the composition is not particularly limited as long as PCR can be performed in steps A and B, and can be carried out by methods commonly used by those skilled in the art.

[0098] If the composition to be analyzed is a liquid composition (e.g., a beverage composition), the liquid composition or its diluted solution may be subjected to the above-described preparation step as is, or, for example, the liquid composition may be centrifuged and the supernatant discarded to separate the bacteria as a precipitate, and the solution obtained by suspending the bacteria in a buffer (e.g., phosphate buffer) may be subjected to the above-described preparation step.

[0099] Furthermore, if the composition to be analyzed is a solid food composition, pharmaceutical composition, or quasi-drug administered orally, these compositions are designed so that bacteria are released (i.e., bacteria are isolated from the composition) after oral administration by the dissolution of the carrier in the body. In this case, for example, the composition to be analyzed may be added to a solution under substantially the same conditions as the liquid conditions under which the composition dissolves in the body, and the resulting bacterial suspension may be subjected to the above-described preparation step.

[0100] The compositions relating to this disclosure are not particularly limited as long as they contain bacteria. For example, the compositions relating to this disclosure may be food compositions, pharmaceutical compositions, quasi-drugs, bacterial powders (such as dried bacterial cells or powders containing them), additives, or animal feed.

[0101] The compositions relating to this disclosure may be for administration to humans and / or non-human mammals, and in one embodiment may be for administration to humans. In these cases, the form of administration of the composition is not particularly limited, but may be oral administration or oral ingestion. In this disclosure, oral ingestion means that the subject to oral administration actively takes in the composition orally.

[0102] If the composition relating to this disclosure is a food composition, the food composition may contain bacteria in an effective amount. In other words, the food composition may contain bacteria as an active ingredient. Here, "containing in an effective amount" means that when the amount normally consumed in each food composition is ingested, the active ingredient of the present invention is ingested to the extent that the effect related to the intended use of the composition is exerted. Furthermore, the term "food composition" is used to include health foods, functional foods, nutritional supplements, health functional foods (e.g., Foods for Specified Health Uses, Nutritional Functional Foods, Foods with Function Claims), foods for special dietary uses (e.g., foods for infants, foods for pregnant and lactating women, foods for the sick), and supplements. It goes without saying that when the active ingredient of the present invention is ingested by mammals other than humans, the food referred to in this invention is used as feed.

[0103] The form of the "food composition" in the composition relating to this disclosure is not particularly limited, and may be, for example, in the form of a beverage, a semi-liquid or gel-like form, a solid or powder-like form. Furthermore, examples of "supplements" include tablets produced by mixing the active ingredient of the composition of this embodiment with excipients, binders, etc., and then compressing them into tablets; granules produced by granulating the active ingredient of the present invention with excipients, binders, etc.; orally disintegrating tablets; and capsules containing the active ingredient of the present invention enclosed in capsules, etc.

[0104] The food compositions relating to this disclosure are not particularly limited, but include, for example, soft drinks, carbonated drinks, fruit juice drinks, vegetable juice drinks, fruit and vegetable juice drinks, milk and other dairy products, soy milk, dairy beverages, drinkable yogurt, drinkable or stick-type jellies, coffee, cocoa, tea beverages, nutritional drinks, energy drinks, sports drinks, mineral water (including both sparkling and non-sparkling), near water, non-alcoholic beverages such as non-alcoholic beer-flavored beverages; carbohydrate-containing foods and beverages such as rice dishes, noodles, bread or pasta; cheeses, hard or soft yogurts, dairy products such as fresh cream and ice cream made from dairy products and other oils and fats. Products include: Western-style confectionery such as cookies, cakes, and chocolates; Japanese-style confectionery such as manju or yokan; tablet candies such as ramune (refreshing candies); candies, gums, gummies, frozen desserts such as jelly or pudding; and various other confectionery products such as snack foods; alcoholic beverages such as whiskey, bourbon, spirits, liqueurs, wine, fruit wine, sake, Chinese liquor, shochu, beer, non-alcoholic beer with an alcohol content of 1% or less, sparkling wine, other miscellaneous alcoholic beverages, and chuhai; processed foods such as processed egg products, processed seafood or meat products (including offal such as liver) (including delicacies), soups such as miso soup, seasonings such as miso, soy sauce, furikake, and other seasonings, and liquid foods such as concentrated liquid foods.

[0105] Tea beverages include fermented teas, semi-fermented teas, and unfermented teas, such as black tea, green tea, barley tea, brown rice tea, sencha, gyokuro tea, hojicha, oolong tea, turmeric tea, pu-erh tea, rooibos tea, rose tea, chrysanthemum tea, ginkgo leaf tea, and herbal teas (for example, mint tea, jasmine tea).

[0106] Fruits used in fruit juice beverages and beverages containing both fruit and vegetable juices include, for example, apples, oranges, grapes, bananas, pears, peaches, mangoes, acai, blueberries, and plums. Vegetables used in vegetable juice beverages and beverages containing both fruit and vegetable juices include, for example, tomatoes, carrots, celery, pumpkins, cucumbers, and watermelons.

[0107] The pharmaceutical compositions or quasi-drugs relating to this disclosure may be formulated as oral or parenteral preparations. Examples of oral preparations include granules, powders, tablets (including sugar-coated tablets), pills, capsules, syrups, liquids, jellies, emulsions, and suspensions. Examples of parenteral preparations include injectable preparations suitable for local administration (including intradermal, subcutaneous, intramuscular, and intravenous injections), inhalants (e.g., inhaled aerosols, inhaled powders, inhaled solutions), nasal drops (e.g., nasal powders, nasal solutions), ointments, creams, gels, suppositories, patches, and compresses. These preparations may be formulated using pharmaceutically acceptable carriers by methods commonly practiced in the art. Examples of pharmaceutically acceptable carriers include excipients, binders, diluents, additives, fragrances, buffers, thickeners, colorants, stabilizers, emulsifiers, dispersants, suspending agents, and preservatives.

[0108] The composition relating to this disclosure may be bacterial cell powder (dried bacterial cells or powder containing them, etc.). Such bacterial cell powder may be obtained, for example, by culturing, sterilizing, and drying bacteria according to a conventional manufacturing method. Such bacterial cell powder may be used, for example, as a raw material for food compositions, pharmaceutical compositions, or animal feed.

[0109] The bacterial cell powder relating to this disclosure may contain, in addition to bacteria and components derived from the culture medium used during bacterial culture, components that are acceptable as food, pharmaceuticals or animal feed, and may further contain at least one selected from the group consisting of, for example, sugars, proteins, lipids, amino acids, vitamins, minerals, flavonoids, quinones, polyphenols, nucleic acids, fatty acids, acidulants, sweeteners, colorants, flavorings, seasonings, salt, emulsifiers, stabilizers, cooling agents, binders, disintegrants, lubricants, colorants, preservatives, sustained-release regulators, surfactants, and solvents.

[0110] The additives relating to this disclosure may be in accordance with the descriptions of the food composition, feed, quasi-drug, pharmaceutical composition, or bacterial powder described above. If the composition relating to this disclosure is a food additive, it may be used, for example, as a functional ingredient in a functionally labeled food.

[0111] The present disclosure will be described in more detail below with reference to examples, but the present disclosure is not limited to the following examples.

[0112] <Equipment> The equipment used in the example is as follows: ・Vortex mixer: Vortec Genie 2 (Scientific Industries) ・Bead disruptor: FastPrep 24 (MP-Biomedicals) ・PCR thermal cycler: GeneAmp PCR System 9700 (Applied Biosystems) ・Electrophoresis apparatus: 4200 TapeStation (Agilent Technologies)

[0113] <Reagents> The reagents other than primers used in the examples are as follows. Note that the reagents and equipment used in each operation in this disclosure are not limited to those described in this test method, and other generally available equivalent products can also be used for evaluation. ・Sterile water ・MRS medium: Difco Lactobacilli MRS Broth (Becton, Dickinson and Company) ・Phosphate buffer (PBS): PBS tablets (#T900, Takara Bio Inc.) dissolved in 100 mL of ultrapure water per tablet and sterilized by autoclaving ・Lysing Matrix E 500 x 2 mL Tubes: 6914-500, MP-Biomedicals ・DNA extraction buffer: 200 mM Tris-HCl pH 8.0 / 80 mM Mixture of EDTA and 10% SDS in a volume ratio (5:1) • Phenol: Nippon Gene Co., Ltd. • Phenol / Chloroform / Isoamyl Alcohol: Nippon Gene Co., Ltd. • Isopropanol: Fujifilm Wako Pure Chemical Industries, Ltd. • 3M Sodium Acetate Buffer pH 5.2: Nippon Gene Co., Ltd. • Ethanol: Fujifilm Wako Pure Chemical Industries, Ltd. • PCR Reagent: SYBR (Registered Trademark) Premix Ex Taq (Trademark) II (Tli RNaseH Plus) (Takara Bio Inc.) • D1000 Sample buffer: Agilent Technologies, Ltd. • D1000 Ladder: Agilent Technologies, Ltd.

[0114] <Example 1: Identification of Lactococcus lactis subspecies lactis strains> In this example, we verified whether it was possible to distinguish between strains of Lactococcus lactis subspecies lactis contained in dried bacterial cells and tablets.

[0115] [Sample] The sample used in this example is as follows: [Dried bacterial cells] ・Lactococcus lacticis subsp. lacticis ・JCM5805 (manufactured by Kirin Holdings Co., Ltd. Hereafter also referred to as "Lactococcus lacticis subsp. lacticis JCM5805 (bacterial cells)") ・ATCC7962 ・ATCC15577 ・JCM7638 ・ATCC29146 ・Lactococcus lacticis subsp. cremoris ・JCM20076 ・Lactobacillus rhamnosus ・ATCC53103 ・Lactobacillus paracasei ・KW3110 [Tablet] ・Lactococcus lactis subsp. Lactis JCM5805 (Kirin iMUSE Immune Care Supplement (250 mg / tablet, of which over 25 billion plasma lactic acid bacteria (Lactococcus lactis subspecies lactis JCM 5805)), manufactured by Kirin Holdings Co., Ltd. Hereafter also referred to as "Lactococcus lactis subspecies lactis JCM5805 (tablets)").

[0116] Lactococcus lactis subsp. lactis ATCC 7962, Lactococcus lactis subsp. lactis ATCC 15577, Lactococcus lactis subsp. lactis JCM 7638, Lactococcus lactis subsp. lactis ATCC 29146 and Lactococcus lactis subsp. cremoris JCM 20076 was cultured and the bacterial cell powder was prepared under the following conditions. Lactobacillus was suspended in MRS medium and seeded onto MRS agar plate. After culturing at 30°C for 48 hours, colony picking was performed. The collected colonies were seeded onto 10 mL of MRS medium and cultured at 30°C for 24 hours. 1 mL of the cultured bacterial suspension was seeded onto 100 mL of MRS medium and cultured at 30°C for 24 hours. The culture solution was collected, centrifuged and washed twice with ultrapure water, then suspended in 20 mL of ultrapure water, sterilized at 80°C for 30 minutes, and then freeze-dried.

[0117] Lactobacillus rhamnosus ATCC 53103 and Lactobacillus paracasei KW3110 were cultured and cell powders were prepared under the following conditions: Cells with the corresponding cell numbers were suspended in MRS medium and seeded onto MRS agar. After culturing at 37°C for 48 hours, colony picking was performed. The collected colonies were seeded onto 10 mL of MRS medium and cultured at 37°C for 24 hours. 1 mL of the cultured cell suspension was seeded onto 100 mL of MRS medium and cultured at 37°C for 24 hours. The culture solution was collected, centrifuged and washed twice with ultrapure water, then suspended in 20 mL of ultrapure water, sterilized at 80°C for 30 minutes, and then freeze-dried.

[0118] [Preparation of PCR template sample] [Extraction of nucleic acids from tablet sample] Each tablet was suspended in 1 mL of PBS and mixed with a vortex mixer to obtain a lactic acid bacteria suspension. 200 μL of the lactic acid bacteria suspension, 300 μL of DNA extraction buffer, and 500 μL of phenol were added to Lysing Matrix E, and the bacterial cells were disrupted using a bead lysator (FastPrep) to obtain a lysate. The lysate was centrifuged at 12,000 rpm at room temperature for 5 minutes, and the supernatant aqueous layer was collected in a tube. 350 μL of phenol / chloroform / isoamyl alcohol was added to the collected aqueous layer, and after thorough mixing with a vortex mixer, the mixture was centrifuged at 12,000 rpm at room temperature for 5 minutes, and the aqueous layer after centrifugation was collected in a tube. To the recovered aqueous layer, 25 μL of 3M sodium acetate and 250 μL of isopropanol were added and thoroughly mixed using a vortex mixer. The resulting mixture was centrifuged at 15,000 rpm, 4°C, and 15 minutes, and the supernatant was removed. 500 μL of 70% ethanol was added to this mixture. The mixture obtained after the addition was centrifuged at 15,000 rpm, 4°C, and 3 minutes, and the supernatant was removed. The precipitate was then thoroughly dried in the tube. The precipitate was dissolved in 100 μL of sterile water and used as a template sample for PCR.

[0119] [Extraction of nucleic acids from dried bacterial cells] For Lactococcus lacticis subsp. lacticis JCM 5805, spray-dried bacterial cells were weighed, and for other lactic acid bacteria, freeze-dried bacterial cell samples were weighed and prepared to a concentration of 0.1 mg / mL using PBS to obtain lactic acid bacteria suspensions. Subsequent procedures were carried out in the same manner as described in [Extraction of nucleic acids from tablet samples] above.

[0120] [PCR] Using the three primer sets (1-3) listed in Table 1 (synthesized by Fasmac Co., Ltd.) and PCR reagents, reaction solutions with the compositions listed in Table 2 were prepared, and PCR was performed using a PCR thermal cycler under the reaction conditions listed in [PCR Conditions]. Primer set 1 is a primer specific to the 16S rRNA region in the chromosome of Lactococcus lactis subsp. lactis, and it was confirmed in advance that nucleic acids are not amplified in closely related species such as Lactococcus lactis subsp. cremoris, as well as in bacteria of the genera Lactobacillus and Streptococcus. Primer sets 2 and 3 are primers that can amplify the repeat sequences in the chromosome of Lactococcus lactis subsp. lactis. Each primer was pre-dissolved in sterile water to a concentration of 50 μM.

[0121]

[0122]

[0123] [PCR Conditions] ・94°C for 30 seconds ・55°C for 30 seconds ・72°C for 1 minute The above conditions are applied to 25 cycles (dried bacterial cells) or 35 cycles (tablet samples).

[0124] [Electrophoresis] 1 μL of PCR-amplified sample or 1 μL of D1000 Ladder was mixed with 3 μL of D1000 Sample Buffer using a vortex mixer, and then subjected to electrophoresis using a 4200 TapeStation electrophoresis apparatus. After electrophoresis, analysis was performed using TapeStation Analysis software, and the positions of the bands in each sample were recorded. Subsequently, the band size of the sample was confirmed by comparing it with the band positions on the Ladder.

[0125] [Results and Discussion] [Electrophoresis of PCR Samples Using Species-Specific Primers] Figure 1 shows the results of PCR performed on nucleic acids extracted from dried bacterial cells and tablets using primer set 1. In the figure, 1 shows the results for Lactococcus lacticis subsp. lacticis JCM5805 cells, 2 shows the results for Lactococcus lacticis subsp. lacticis JCM5805 contained in tablets, 3 shows the results for Lactococcus lacticis subsp. lacticis ATCC7962 cells, and 4 shows Lactococcus lacticis subsp. The results for Lactis ATCC15577 are shown, 5 shows the results for Lactococcus lactis subsp. lactis JCM7638, 6 shows the results for Lactococcus lactis subsp. lactis ATCC29146, 7 shows the results for Lactococcus lactis subsp. cremoris JCM20076, 8 shows the results for Lactobacillus rhamnosus ATCC53103, and 9 shows the results for Lactobacillus paracasei KW3110. As a result, as shown in Figure 1, a band was detected at approximately 300 bp for all five strains of Lactococcus lactic acid bacteria, specifically Lactococcus lactic acid bacteria. Similarly, a band was detected at the same position in the tablet samples. On the other hand, no band was detected for Lactococcus lactic acid bacteria, Lactobacillus rhamnosus, and Lactobacillus paracasei. Therefore, it was demonstrated that Lactococcus lactic acid bacteria can be identified using primer set 1.

[0126] [Electrophoresis of PCR samples using primers that amplify repeat sequences in chromosomes] Figure 2 shows the results of PCR performed using primer set 2 on nucleic acids extracted from five strains of Lactococcus lactic acid bacteria in which bands were detected in Figure 1. Figure 3 shows the results of PCR performed using primer set 3 on nucleic acids extracted from five strains of Lactococcus lactic acid bacteria in which bands were detected in Figure 1. In these figures, 1 shows the results for the bacterial cells of Lactococcus lactic acid bacteria JCM5805, and 2 shows the results for Lactococcus lactic acid bacteria contained in tablets. The results for Lactis JCM5805 are shown, 3 shows the results for Lactococcus lactis subsp. lactis ATCC7962, 4 shows the results for Lactococcus lactis subsp. lactis ATCC15577, 5 shows the results for Lactococcus lactis subsp. lactis JCM7638, and 6 shows the results for Lactococcus lactis subsp. lactis ATCC29146.

[0127] [Discussion] The lengths of the bands detected from the above results are shown in Table 3. In Table 3, a hyphen (-) indicates no band detection. According to Table 3, the combinations of band lengths detected by PCR using primer sets 1 to 3 differed depending on the bacterial strain. Therefore, it was shown that strains of Lactococcus lacticis subsp. lacticis in tablets and dried bacterial cells can be qualitatively evaluated by PCR using a total of three primer sets: one set of species-specific primers and two sets of primers that amplify repeat sequences in chromosomes. For example, a sample given a PCR template sample in which a band around 300 bp was detected by PCR using primer set 1, a band around 250 bp was detected by PCR using primer set 2, and a band around 320 bp was detected by PCR using primer set 3 can be identified as containing Lactococcus lacticis JCM 5805.

[0128]

[0129] <Example 2: Identification of Lactobacillus paracasei strains> In this example, we verified whether it was possible to distinguish between Lactobacillus paracasei strains contained in dried bacterial cells and tablets.

[0130] [Sample] The samples used in this embodiment are as follows: [Dried bacterial cells] ・Lactobacillus paracasei ・JCM1109 ・JCM1133 ・ATCC25302 ・Lactobacillus casei ・JCM1134 ・Lactobacillus delbrueckii ・NBRC13953 [Tablet] ・Lactobacillus paracasei ・KW3110 (iMUSE eye KW lactic acid bacteria (220 mg / tablet (of which KW lactic acid bacteria 25 mg or more), manufactured by Kirin Holdings Co., Ltd.)

[0131] Lactobacillus paracasei JCM1109, Lactobacillus paracasei JCM1133, Lactobacillus paracasei ATCC25302, Lactobacillus casei JCM1134, and Lactobacillus delbrueckii NBRC13953 were cultured and cell powders prepared under the following conditions. The cells corresponding to the cell numbers were suspended in MRS medium and seeded onto MRS agar. After culturing at 37°C for 48 hours, colony picking was performed. The collected colonies were seeded onto 10 mL of MRS medium and cultured at 37°C for 24 hours. One mL of cultured bacterial suspension was inoculated into 100 mL of MRS medium and incubated at 37°C for 24 hours. The culture solution was collected, centrifuged twice, and washed with ultrapure water. It was then suspended in 20 mL of ultrapure water, sterilized at 80°C for 30 minutes, and then freeze-dried.

[0132] [Preparation of PCR template sample] [Extraction of nucleic acids from tablet sample] Each tablet was suspended in 1 mL of PBS and mixed with a vortex mixer to obtain a lactic acid bacteria suspension. 200 μL of the lactic acid bacteria suspension, 300 μL of DNA extraction buffer, and 500 μL of phenol / chloroform / isoamyl alcohol were added to Lysing Matrix E, and the bacterial cells were disrupted using a bead lysator (FastPrep) to obtain a lysate. The lysate was centrifuged at 12,000 rpm at room temperature for 5 minutes, and the supernatant aqueous layer was collected in a tube. 350 μL of phenol / chloroform / isoamyl alcohol was added to the collected aqueous layer, and after thorough mixing with a vortex mixer, the mixture was centrifuged at 12,000 rpm at room temperature for 5 minutes, and the aqueous layer after centrifugation was collected in a tube. To the recovered aqueous layer, 25 μL of 3M sodium acetate and 250 μL of isopropanol were added and thoroughly mixed using a vortex mixer. The resulting mixture was centrifuged at 15,000 rpm, 4°C, and 15 minutes, and the supernatant was removed. 500 μL of 70% ethanol was added to this mixture. The mixture obtained after the addition was centrifuged at 15,000 rpm, 4°C, and 3 minutes, and the supernatant was removed. The precipitate was then thoroughly dried in the tube. The precipitate was dissolved in 100 μL of sterile water and used as a template sample for PCR.

[0133] [Extraction of nucleic acids from dried bacterial cells] The freeze-dried bacterial cell sample was weighed and prepared as a lactic acid bacteria suspension by adjusting the concentration to 0.1 mg / mL using PBS. Subsequent operations were carried out in the same manner as described above for [Extraction of nucleic acids from tablet samples].

[0134] [PCR] Using the three primer sets (4-6) listed in Table 4 (synthesized by Fasmac Co., Ltd.) and PCR reagents, reaction solutions with the compositions listed in Table 5 were prepared, and PCR was performed using a PCR thermal cycler under the reaction conditions listed in [PCR Conditions]. Primer set 4 is a primer specific to the 16S rRNA region in the chromosomes of Lactobacillus paracasei and Lactobacillus casei, and it was confirmed in advance that nucleic acids are not amplified in the closely related species Lactobacillus delbrueckii. Primer sets 5 and 6 are primers that can amplify the repeat sequences in the chromosome of Lactobacillus paracasei. Each primer was pre-dissolved in sterile water to a concentration of 50 μM.

[0135]

[0136]

[0137] [PCR Conditions] ・94°C for 30 seconds ・55°C for 30 seconds ・72°C for 1 minute The above conditions are applied to 25 cycles (dried bacterial cells) or 35 cycles (tablet samples).

[0138] [Electrophoresis] 1 μL of PCR-amplified sample or 1 μL of D1000 Ladder was mixed with 3 μL of D1000 Sample Buffer using a vortex mixer, and then subjected to electrophoresis using a 4200 TapeStation electrophoresis apparatus. After electrophoresis, analysis was performed using TapeStation Analysis software, and the positions of the bands in each sample were recorded. Subsequently, the band size of the sample was confirmed by comparing it with the band positions on the Ladder.

[0139] [Results and Discussion] Figure 4 shows the results of PCR performed on nucleic acids extracted from tablets containing Lactobacillus paracasei KW3110 using primer sets 4-6. Figure 5 shows the results of PCR performed on nucleic acids extracted from dried Lactobacillus paracasei JCM 1109 using primer sets 4-6. Figure 6 shows the results of PCR performed on nucleic acids extracted from dried Lactobacillus paracasei JCM 1133 using primer sets 4-6. Figure 7 shows the results of PCR performed on nucleic acids extracted from dried Lactobacillus paracasei ATCC 25302 using primer sets 4-6. Figure 8 shows the results of PCR performed on nucleic acids extracted from dried bacterial cells of Lactobacillus casei JCM 1134 using primer sets 4 to 6. In these figures, 1 shows the results of PCR performed using primer set 4, 2 shows the results of PCR performed using primer set 5, and 3 shows the results of PCR performed using primer set 6. Table 6 shows the base lengths of the bands detected by PCR in this example.

[0140]

[0141] Let's consider the results above. First, from the PCR results using primer set 4, a band was detected at approximately 490 bp for Lactobacillus paracasei, all four lactic acid bacteria strains, and Lactobacillus casei. On the other hand, no band was detected for Lactobacillus delbrueckii. From the above, it was shown that Lactobacillus paracasei and Lactobacillus casei can be identified using primer set 4. Prior to the advancements in microbial classification methods in 1989, Lactobacillus casei and Lactobacillus paracasei were classified as the same species. Since they share the same base sequence specifically present in the 16S rRNA gene, primer set 4, which is specific to the 16S rRNA region, detects bands at the same position for both Lactobacillus paracasei and Lactobacillus casei.

[0142] Furthermore, as shown in Table 6, the combinations of band lengths detected by PCR using primer sets 4-6 differed depending on the bacterial strain. Therefore, it was demonstrated that strains of Lactobacillus paracasei in tablets and dried bacterial cells can be qualitatively evaluated by PCR using a total of three primer sets: one set of species-specific primers and two sets of primers that amplify repeat sequences in chromosomes. For example, a sample given a PCR template sample in which a band around 490 bp was detected by PCR using primer set 4, a band around 390 bp was detected by PCR using primer set 5, and a band around 380 bp was detected by PCR using primer set 6 can be identified as containing Lactobacillus paracasei KW3110.

Claims

1. A method for identifying a bacterium to be evaluated as a predetermined bacterial strain, comprising the following steps A and B: [Step A] Performing PCR using nucleic acid derived from the bacterium to be evaluated as a template, using each of at least one set of primers that amplify a genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs; [Step B] Performing PCR using nucleic acid derived from the bacterium to be evaluated as a template, using each of at least two sets of primers that amplify repetitive sequences present in the genome of the bacterial species to which the predetermined bacterial strain belongs; 2. The method according to claim 1, wherein the PCR in step A and step B are each carried out separately in a reaction solution containing only one set of primers.

3. The method according to claim 1, wherein in step A, each of the at least one set of primers is a set of only one primer.

4. The method according to claim 1, wherein in step B, the at least two sets of primer sets is only two sets of primer sets.

5. The method according to claim 1, wherein the PCR step included in the method consists only of step A and step B, in step A, each of the at least one set of primers is a set of only one primer, and in step B, the at least two sets of primers are a set of only two primers.

6. The method according to claim 1, further comprising identifying the bacteria to be evaluated as a predetermined bacterial strain using the base length of the nucleic acid amplified by PCR in step B as an indicator.

7. The method according to claim 1, wherein the genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs is a base sequence specifically present in the 16S rRNA gene of the bacterial species.

8. The method according to claim 1, wherein the predetermined bacterial strain is a lactic acid bacterium.

9. The method according to claim 1, wherein the predetermined bacterial strain belongs to the genus Lactococcus or Lactobacillus.

10. The method according to claim 1, wherein the bacterial species to which the predetermined bacterial strain belongs is Lactococcus lactis subspecies lactis.

11. The method according to claim 10, wherein the at least one set of primers used in step A comprises a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of nucleotides substituted, deleted, inserted or added to the nucleotide sequence represented by SEQ ID NO: 1 is 0 or 3 or less, and a primer consisting of a nucleotide sequence of 28 nucleotides or less, which includes a nucleotide sequence in which the total number of nucleotides substituted, deleted, inserted or added to the nucleotide sequence represented by SEQ ID NO: 2 is 0 or 3 or less.

12. The method according to claim 10, wherein the at least two sets of primer sets used in step B include a primer set comprising a primer having a base sequence of 35 bases or less in length, which includes a base sequence in which the total number of substituted, deleted, inserted or added bases is 0 or more and 3 or less in length, and a primer having a base sequence of 32 bases or less, which includes a base sequence in which the total number of substituted, deleted, inserted or added bases is 0 or more and 3 or less in length, and a primer set comprising a base sequence having a base sequence of 32 bases or less, which includes a base sequence in which the total number of substituted, deleted, inserted or added bases is 0 or more and 3 or less in length, and a primer having a base sequence of 31 bases or less, which includes a base sequence in which the total number of substituted, deleted, inserted or added bases is 0 or more and 3 or less in length, in relation to the base sequence represented by sequence number 6.

13. The at least one set of primers used in step A includes a primer consisting of a primer with a base sequence of 30 bases or less in length, which includes a base sequence in which the total number of substituted, deleted, inserted, or added bases is 0 or more and 3 or less in length, and a primer consisting of a base sequence of 28 bases or less, which includes a base sequence in which the total number of substituted, deleted, inserted, or added bases is 0 or more and 3 or less in length, and the at least two sets of primers used in step B are, The method according to claim 10, comprising a primer consisting of a nucleotide sequence of 35 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more and 3 or less in relation to the nucleotide sequence represented by SEQ ID NO: 3; a primer set consisting of a nucleotide sequence of 32 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more and 3 or less in relation to the nucleotide sequence represented by SEQ ID NO: 4; a primer set consisting of a nucleotide sequence of 32 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more and 3 or less in relation to the nucleotide sequence represented by SEQ ID NO: 5; and a primer set consisting of a nucleotide sequence of 31 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more and 3 or less in relation to the nucleotide sequence represented by SEQ ID NO:

6.

14. The method according to claim 13, comprising identifying the bacterium to be evaluated as Lactococcus lactis subsp. lactis JCM 5805 if all of the following conditions (X1), (X2), and (X3) are met: (X1) A nucleic acid amplified by a primer set comprising a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 nucleotides, and a primer consisting of a nucleotide sequence of 28 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 nucleotides, which includes a nucleotide sequence, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 nucleotides, is between 0 and 3 nucleotides, contains nucleic acid with a nucleotide length of 250 bp to 350 bp; (X2) A nucleic acid amplified by a primer set consisting of a primer of 35 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 3, and a primer of 32 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 4, contains nucleic acids with a nucleotide length of 200 bp to 350 bp; (X3) A nucleic acid amplified by a primer set consisting of a primer of 32 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 5, and a primer of 31 nucleotides or less in length, containing a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 6, contains nucleic acids with a nucleotide length of 250 bp to 400 bp.

15. The method according to any one of claims 10 to 14, wherein the predetermined bacterial strain is Lactococcus lactis subspecies lactis JCM 5805.

16. The method according to claim 1, wherein the bacterial species to which the predetermined bacterial strain belongs is Lactobacillus paracasei.

17. The method according to claim 16, wherein the at least one set of primers used in step A comprises a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of nucleotides substituted, deleted, inserted or added to the nucleotide sequence represented by SEQ ID NO: 7 is 0 or 3 or less, and a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of nucleotides substituted, deleted, inserted or added to the nucleotide sequence represented by SEQ ID NO: 8 is 0 or 3 or less.

18. The method according to claim 16, wherein the at least two sets of primer sets used in step B include a primer set comprising a primer of 30 base sequences or less in length, which includes a primer containing a sequence in which the total number of substituted, deleted, inserted or added bases is 0 or more and 3 or less in relation to the nucleotide sequence represented by SEQ ID NO: 9, and a primer set comprising a primer of 32 base sequences or less in length, which includes a sequence in which the total number of substituted, deleted, inserted or added bases is 0 or more and 3 or less in relation to the nucleotide sequence represented by SEQ ID NO: 10, and a primer set comprising a primer of 30 base sequences or less in length, which includes a sequence in which the total number of substituted, deleted, inserted or added bases is 0 or more and 3 or less in relation to the nucleotide sequence represented by SEQ ID NO: 12, and a primer set comprising a primer of 32 base sequences or less in length, which includes a sequence in which the total number of substituted, deleted, inserted or added bases is 0 or more and 3 or less in relation to the nucleotide sequence represented by SEQ ID NO:

12.

19. The at least one set of primers used in step A includes a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of nucleotides substituted, deleted, inserted, or added to the nucleotide sequence represented by SEQ ID NO: 7 is 0 or 3 or less, and a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of nucleotides substituted, deleted, inserted, or added to the nucleotide sequence represented by SEQ ID NO: 8, and the at least two sets of primers used in step B are, The method according to claim 16, comprising a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more and 3 or less in relation to the nucleotide sequence represented by SEQ ID NO: 9; a primer set consisting of a nucleotide sequence of 32 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more and 3 or less in relation to the nucleotide sequence represented by SEQ ID NO: 10; and a primer set consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more and 3 or less in relation to the nucleotide sequence represented by SEQ ID NO: 11; and a primer set consisting of a nucleotide sequence of 32 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more and 3 or less in relation to the nucleotide sequence represented by SEQ ID NO:

12.

20. The method according to claim 19, comprising identifying the bacterium to be evaluated as Lactobacillus paracasei KW3110 if all of the following conditions (Y1), (Y2), and (Y3) are met: (Y1) A nucleic acid amplified by a primer set comprising a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 nucleotides, and a primer consisting of a nucleotide sequence of 30 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 nucleotides, which includes a nucleotide sequence, which includes a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 nucleotides, is between 450 bp and 550 bp; (Y2) The nucleic acid amplified by the primer set consisting of a primer of 30 base sequences or less in length, containing a base sequence in which the total number of substituted, deleted, inserted, or added bases is between 0 and 3 relative to the base sequence represented by Sequence ID No. 9, and a primer of 32 base sequences or less in length, containing a base sequence in which the total number of substituted, deleted, inserted, or added bases is between 0 and 3 relative to the base sequence represented by Sequence ID No. 10, contains nucleic acids with a base length of 330 bp to 500 bp; (Y3) The nucleic acid amplified by the primer set consisting of a primer of 30 base sequences or less in length, containing a base sequence in which the total number of substituted, deleted, inserted, or added bases is between 0 and 3 relative to the base sequence represented by Sequence ID No. 11, and a primer of 32 base sequences or less in length, containing a base sequence in which the total number of substituted, deleted, inserted, or added bases is between 0 and 3 relative to the base sequence represented by Sequence ID No. 12, contains nucleic acids with a base length of 300 bp to 450 bp as the most amplified nucleic acid.

21. The method according to any one of claims 16 to 20, wherein the predetermined bacterial strain is Lactobacillus paracasei KW3110.

22. A method for analyzing a composition containing bacteria, comprising determining that the composition is a composition containing the predetermined bacterial strain when the bacteria contained in the composition are identified as the predetermined bacterial strain by identification according to any one of claims 1 to 14 and 16 to 20.

23. A kit for identifying a bacterium to be evaluated as a predetermined bacterial strain, comprising at least one set of primers for amplifying a genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs, and at least two sets of primers for amplifying repetitive sequences present in the genome of the bacterial species to which the predetermined bacterial strain belongs.

24. The bacterial species to which the predetermined bacterial strain belongs is Lactococcus lactis subspecies lactis, and at least one set of primers for amplifying a genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs includes a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which contains a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 1, and a primer consisting of a nucleotide sequence of 28 nucleotides or less, which contains a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 2, The kit according to claim 23, comprising at least two sets of primers for amplifying repetitive sequences present in the genome of the bacterial species to which the predetermined bacterial strain belongs, the primer set comprising a primer consisting of a nucleotide sequence of 35 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by SEQ ID NO: 3, and a primer consisting of a nucleotide sequence of 32 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by SEQ ID NO: 4, and a primer set comprising a nucleotide sequence of 32 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by SEQ ID NO: 5, and a primer consisting of a nucleotide sequence of 31 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or less to the nucleotide sequence represented by SEQ ID NO:

6.

25. The bacterial species to which the predetermined bacterial strain belongs is Lactobacillus paracasei, and at least one set of primers for amplifying a genome sequence specific to the bacterial species to which the predetermined bacterial strain belongs comprises a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 7, and a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is between 0 and 3 relative to the nucleotide sequence represented by Sequence ID No. 8, The kit according to claim 23, comprising at least two sets of primers for amplifying repetitive sequences present in the genome of the bacterial species to which the predetermined bacterial strain belongs, each set comprising: a primer consisting of a nucleotide sequence of 30 nucleotides or less in length, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more to the nucleotide sequence represented by SEQ ID NO: 9, and a primer consisting of a nucleotide sequence of 32 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more to the nucleotide sequence represented by SEQ ID NO: 10; and a primer set consisting of a nucleotide sequence of 30 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more to the nucleotide sequence represented by SEQ ID NO: 11, and a primer consisting of a nucleotide sequence of 32 nucleotides or less, which includes a nucleotide sequence in which the total number of substituted, deleted, inserted, or added nucleotides is 0 or more to the nucleotide sequence represented by SEQ ID NO: 12.