Method for producing 1,4-butanediol using 1,4-butanediol-producing microorganism
Culturing microorganisms in a pH-controlled medium enhances 1,4-butanediol production through enzymatic pathways, addressing supply and yield challenges in chemical processes and reducing environmental impact.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- DAESANG CORP
- Filing Date
- 2025-12-16
- Publication Date
- 2026-07-02
Abstract
Description
Method for producing 1,4-butanediol using 1,4-butanediol-producing microorganisms
[0001] The present invention relates to a method for producing 1,4-butanediol using 1,4-butanediol-producing microorganisms.
[0002] 1,4-butanediol is used throughout the chemical industry as a solvent, polymer intermediate, and fine chemical intermediate. 1,4-butanediol is primarily produced through a process of reacting acetylene with formaldehyde followed by the addition of hydrogen. It can also be produced from maleic anhydride and propylene oxide, but there are problems such as disruptions in raw material supply and increased production costs due to unstable international oil prices, as well as greenhouse gases and waste generation resulting from the use of fossil fuels.
[0003] To complement these chemical production processes, low-cost and eco-friendly processes for the biological production of 1,4-butanediol using biomass as a raw material are currently being developed. Generally, 1,4-butanediol is produced through α-ketoglutarate or succinyl-CoA during the metabolic processes of microorganisms. However, the microbial production process for 1,4-butanediol has limitations, such as the generation of unnecessary byproducts in addition to 1,4-butanediol during metabolic processes and relatively low production yields. Therefore, to overcome these limitations, continuous efforts are required to develop microorganisms capable of producing 1,4-butanediol at high yields using genetic engineering techniques and to find optimal microbial culture conditions to increase the production yield of 1,4-butanediol.
[0004] [Prior Art Literature]
[0005] [Patent Literature]
[0006] European Registered Patent No. 3050970
[0007] European Registered Patent No. 2782893
[0008] The present invention aims to provide a method for producing 1,4-butanediol using 1,4-butanediol-producing microorganisms.
[0009] One aspect of the present invention provides a method for producing 1,4-butanediol, comprising the steps of: culturing a microorganism that produces 1,4-butanediol from glutamic acid in a medium having a pH of 4.9 to 6.4; and recovering 1,4-butanediol from the microorganism or the medium in which the microorganism is cultured.
[0010] The term “microorganism” as used in this invention refers to a prokaryotic cell or a eukaryotic organism, and includes bacteria, yeast, fungi, etc.
[0011] The “microorganism producing 1,4-butanediol from glutamic acid” used in the present invention refers to a microorganism that produces 1,4-butanediol through stepwise enzymatic reactions using glutamic acid as a starting material, and includes the glutamic acid-1,4-butanediol pathway. The glutamic acid-1,4-butanediol pathway undergoes stepwise enzymatic reactions such as converting glutamic acid into 4-aminobutyric acid, converting 4-aminobutyric acid into succinate semialdehyde, converting succinate semialdehyde into 4-hydroxybutyric acid, and converting 4-hydroxybutyric acid into 1,4-butanediol.
[0012] According to one embodiment of the present invention, the microorganism may include an enzymatic reaction that converts glutamic acid to 4-aminobutyric acid, an enzymatic reaction that converts 4-aminobutyric acid to succinate semialdehyde, an enzymatic reaction that converts succinate semialdehyde to 4-hydroxybutyric acid, and an enzymatic reaction that converts 4-hydroxybutyric acid to 1,4-butanediol.
[0013] According to one embodiment of the present invention, the enzymatic reaction that converts the glutamic acid into 4-aminobutyric acid may be carried out by glutamate decarboxylase.
[0014] The glutamate decarboxylase mentioned above is an enzyme that catalyzes a reaction to produce 4-aminobutyric acid by removing a carboxyl group of glutamate, and may be a polypeptide encoded by the gadB gene that has glutamate decarboxylase activity, but is not limited thereto.
[0015] For example, the glutamate decarboxylase above may be derived from Escherichia coli and may be encoded by the nucleotide sequence of SEQ ID NO. 1.
[0016] According to one embodiment of the present invention, the enzymatic reaction for converting the 4-aminobutyric acid into succinate semialdehyde may be carried out by 4-aminobutyrate aminotransferase.
[0017] The above 4-aminobutyrate aminotransferase is an enzyme that catalyzes the amination reaction of 4-aminobutyric acid, and may be a polypeptide encoded by the gabT gene that has 4-aminobutyrate aminotransferase activity, but is not limited thereto.
[0018] For example, the above 4-aminobutyrate aminotransferase may be derived from Corynebacterium glutamicum and may be encoded by the nucleotide sequence of SEQ ID NO. 2.
[0019] According to one embodiment of the present invention, the enzymatic reaction that converts the succinate semialdehyde into 4-hydroxybutyric acid may be carried out by alcohol dehydrogenase.
[0020] The above alcohol dehydrogenase is an enzyme that catalyzes the reaction of oxidizing alcohol to aldehyde, and may be a polypeptide encoded by the yqhD gene that has alcohol dehydrogenase activity, but is not limited thereto.
[0021] For example, the above alcohol dehydrogenase may be derived from Escherichia coli and may be encoded by the nucleotide sequence of SEQ ID NO. 3.
[0022] According to one embodiment of the present invention, the enzymatic reaction converting the 4-hydroxybutyric acid to 1,4-butanediol may be carried out by a carboxylic acid reductase and / or an alcohol dehydrogenase.
[0023] The above carboxylic acid reductase is an enzyme that catalyzes the reduction of the carboxyl group of 4-hydroxybutyric acid and is activated by 4'-phosphopantetheinyl transferase encoded by the sfp gene. The above carboxylic acid reductase may be a polypeptide encoded by the car gene and having carboxylic acid reductase activity, but is not limited thereto.
[0024] For example, the above-mentioned carboxylic acid reductase may be derived from Mycobacterium abscessus and may be encoded by the nucleotide sequence of SEQ ID NO. 4.
[0025] The microorganism that produces 1,4-butanediol from glutamic acid according to the present invention may have an enzyme or a gene encoding the same that is involved in the enzymatic reaction of converting glutamic acid to 4-aminobutyric acid, the enzymatic reaction of converting 4-aminobutyric acid to succinate semialdehyde, the enzymatic reaction of converting succinate semialdehyde to 4-hydroxybutyric acid, and the enzymatic reaction of converting 4-hydroxybutyric acid to 1,4-butanediol (inherent gene), or may have been introduced from another bacterium or strain (external gene), and each gene may be modified to control the activity of the enzyme or the ability to produce 1,4-butanediol, but is not limited thereto.
[0026] In addition, for the microorganism producing 1,4-butanediol from glutamic acid according to the present invention, a recombinant vector may be used for the introduction or modification of an enzyme or a gene encoding the same that is involved in the enzymatic reaction of converting glutamic acid to 4-aminobutyric acid, the enzymatic reaction of converting 4-aminobutyric acid to succinate semialdehyde, the enzymatic reaction of converting succinate semialdehyde to 4-hydroxybutyric acid, and the enzymatic reaction of converting 4-hydroxybutyric acid to 1,4-butanediol.
[0027] As used in the present invention, the term "vector" refers to any type of nucleic acid sequence carrier structure used as a means to deliver and express a target gene in a target cell (host cell). Unless otherwise noted, the vector may mean a structure in which a carried nucleic acid sequence is inserted into the host cell genome to be expressed and / or expressed independently. Such a vector comprises an essential regulatory element operably linked to enable the expression of the gene insertion, where "operably linked" means that the target gene and its regulatory sequence are linked in a manner in which they are functionally coupled to enable gene expression, and the "regulatory element" comprises a promoter for performing transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.
[0028] The vector used in the present invention is not particularly limited as long as it is capable of replicating within a host cell, and any vector known in the art may be used. Examples of such vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors, but are not limited thereto.
[0029] The above vector can typically be constructed as a vector for cloning or as a vector for expression. The vector for expression may be a conventional one used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and may be constructed through various methods known in the art.
[0030] The “recombinant vector” used in the present invention may be constructed using a prokaryotic or eukaryotic cell as a host, and may be capable of replication independently of the host cell’s genome or may be sealed to the genome itself. The host cell is capable of replication by the vector and may include a replication origin, which is a specific nucleotide sequence at which replication is initiated. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it generally includes a potent promoter capable of proceeding transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. When the host is a eukaryotic cell, the replication origins included in the vector that operate in eukaryotic cells include, but are not limited to, f1 replication origins, SV40 replication origins, pMB1 replication origins, adeno replication origins, AAV replication origins, and BBV replication origins. In addition, promoters derived from the genome of mammalian cells (e.g., metallothionine promoters) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, HSV tk promoter) may be used and generally have a polyadenylation sequence as a transcription termination sequence.
[0031] The above-mentioned recombinant vector may include a selection marker, which is intended to select transformants (host cells) transformed by the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, the selection of transformed cells is possible. Representative examples of the selection marker include ampicillin, kanamycin, streptomycin, and chloramphenicol, but are not limited thereto.
[0032] A transformant can be produced by inserting the above-mentioned recombinant vector into a host cell, and the transformant may be obtained by introducing the recombinant vector into a suitable host cell. Any host cell known in the art may be used as a cell capable of stably and continuously cloning or expressing the above-mentioned expression vector.
[0033] When transforming a prokaryotic cell to produce a recombinant microorganism, various intestinal bacteria such as Escherichia coli (E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, E. coli XL1-Blue), Corynebacterium, Bacillus (Bacillus subtilis, Bacillus thuringiensis), Salmonella typhimurium, Serratia marcescens, and Pseudomonas (Pseudomonas) may be used as host cells, but are not limited thereto.
[0034] When transforming into a eukaryotic cell to produce a recombinant microorganism, host cells such as yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc., may be used, but are not limited thereto.
[0035] As used in this invention, “transformation” refers to a phenomenon in which external DNA is introduced into a host cell to artificially induce a genetic change, and “transformant” refers to a host cell into which external DNA is introduced to stably maintain the expression of a target gene.
[0036] The above transformation may be performed by selecting a vector introduction technique suitable for the host cell to express the target gene or a recombinant vector containing it within the host cell. For example, vector introduction may be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene may be included without limitation, whether inserted into the chromosomes of the host cell or located extrachromosomally, as long as it can be expressed within the host cell.
[0037] The above transformant comprises cells that have been transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used interchangeably with recombinant host cells, recombinant cells, or recombinant microorganisms.
[0038] The genes inserted into the recombinant vector for transformation of the present invention can be introduced into a host cell, such as a microorganism of the genus Corynebacterium, through homologous recombination crossing.
[0039] According to one embodiment of the present invention, the microorganism may be of the genus Corynebacterium.
[0040] Specifically, the microorganisms that produce 1,4-butanediol from the glutamic acid are of the genus Corynebacterium, including Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, and Corynebacterium Corynebacterium stationis, Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale (Corynebacterium renale), Corynebacterium pollutisoli,It may be, but is not limited to, Corynebacterium imitans, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacterium pseudopelargi, Corynebacterium flavescens, etc.
[0041] For example, the microorganism mentioned above may be Corynebacterium glutamicum.
[0042] The step of culturing microorganisms that produce 1,4-butanediol from glutamic acid in a medium with a pH of 4.9 to 6.4 in the present invention can improve the 1,4-butanediol production ability of microorganisms by optimally controlling the pH conditions of the culture medium.
[0043] Specifically, the culture medium for the microorganism that produces 1,4-butanediol from the glutamic acid has a pH of 4.9 to 6.4, and considering normal microbial growth conditions, the 1,4-butanediol production yield may be increased compared to when the 1,4-butanediol-producing microorganism is cultured in a medium with a pH of 7.2.
[0044] More specifically, in the medium with a pH of 4.9 to 6.4, compared to conventional pH conditions, the production of 1,4-butanediol by microorganisms producing 1,4-butanediol from glutamic acid increases by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or increases by 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, It may be increased by 9.5 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times, but is not limited thereto.
[0045] For example, when microorganisms that produce 1,4-butanediol from glutamic acid are cultured in a medium with a pH of 4.9 to 6.4, the production of 1,4-butanediol can be increased by more than 1 time compared to a medium with a pH of 7.2, specifically by 3 to 30 times (preferably 5 to 20 times).
[0046] The above culture may be carried out according to appropriate media and culture conditions known in the art, and a person skilled in the art can easily adjust and use the media and culture conditions. Specifically, the media may be liquid media, but is not limited thereto. The culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination thereof, but is not limited thereto.
[0047] According to one embodiment of the present invention, the medium must satisfy the requirements of a specific strain in an appropriate manner and may be appropriately modified by a person skilled in the art. For culture media for microorganisms of the genus Corynebacterium, reference may be made to the known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but is not limited thereto.
[0048] According to one embodiment of the present invention, the culture medium may contain various carbon sources, nitrogen sources, and trace element components. Carbon sources that may be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that may be used include peptone, yeast extract, meat broth, malt extract, corn steep liquid, soybean meal, and urea or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that may be used may include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts. Additionally, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but are not limited thereto. Furthermore, essential growth substances such as amino acids and vitamins may be included. In addition, suitable precursors may be used in the culture medium. The medium or individual components may be added to the culture solution in a batch or continuous manner in a manner suitable for the culture process, but are not limited thereto.
[0049] According to one embodiment of the present invention, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the microbial culture medium in an appropriate manner during cultivation. Additionally, bubble formation can be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester during cultivation. Furthermore, oxygen or an oxygen-containing gas (e.g., air) can be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium can typically be 20 to 45°C, for example, 25 to 40°C. The cultivation period can continue until a desired amount of useful material is obtained, for example, 10 to 160 hours.
[0050] In the step of recovering 1,4-butanediol from the cultured microorganism or a culture medium containing the same in the present invention, 1,4-butanediol produced from the medium may be collected or recovered using a suitable method known in the art according to the culture method. For example, methods such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), and chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but are not limited thereto.
[0051] According to one embodiment of the present invention, the step of recovering the 1,4-butanediol may involve removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.
[0052] According to one embodiment of the present invention, the step of recovering the 1,4-butanediol may include a process of purifying the 1,4-butanediol.
[0053] The method for producing 1,4-butanediol according to the present invention can efficiently produce 1,4-butanediol by culturing microorganisms that produce 1,4-butanediol from glutamic acid under optimal medium conditions.
[0054] The present invention will be described in more detail below. However, this description is provided merely as an example to aid in understanding the invention, and the scope of the invention is not limited by this exemplary description.
[0055]
[0056] Example 1. Production of 1,4-butanediol-producing microorganisms
[0057] 1-1. Construction of Vectors for gadB, gabT, yqhD, car, and sfp Gene Introduction
[0058] A pathway for the biosynthesis of 1,4-butanediol from glutamic acid was constructed by introducing the gadB, gabT, yqhD, car, and sfp genes into Corynebacterium glutamicum ATCC13032.
[0059] Chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 1 and 2, 3 and 4, 7 and 8, 33 and 34, 35 and 36, and 37 and 8, respectively, to obtain fragments containing the gabT gene. DNA of pCES208H36EcGADmut (ACS Omega. 2022 Aug 23; 7(33): 29106-29115.) containing the gadB gene (derived from Escherichia coli) was amplified by PCR using primers 5 and 6, respectively, using a template. The PCR products obtained therefrom were amplified by crossover PCR and then inserted into the restriction enzyme HindIII and XbaI sites of the pK19mobSacB vector (ATCC, 87098). This vector was named pk19mobsacB-gadB(E89Q,△452-466)gabT.
[0060] Chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 9 and 10, primers 11 and 12, and primers 15 and 16, respectively, using the ATCC13032 template. Chromosomal DNA of Escherichia coli K-12 MG1655, which inherently contains the yqhD gene, was amplified by PCR using primers 13 and 14, respectively, using the chromosomal DNA of Escherichia coli K-12 MG1655 as a template. The resulting PCR products were amplified by crossover PCR and then inserted into the restriction enzyme HindIII and XbaI sites of the pK19mobSacB vector. This vector was named pk19mobsacB-yqhD.
[0061] Chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 17 and 18, primers 19 and 20, and primers 23 and 24, respectively. The E. coli expression vector pKE112CAR3pptase (Polymers (Basel). 2019 11(7):1184), containing the car gene (derived from Mycobacterium abscessus), was amplified by PCR using primers 21 and 22, respectively, using the car gene as a template. The PCR products obtained were amplified by crossover PCR and then inserted into the restriction enzyme HindIII and XbaI sites of the pK19mobSacB vector. This vector was named pk19mobsacB-car.
[0062] To insert the sfp gene required to activate the enzymatic activity of the CAR gene, the chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 25 and 26, 27 and 28, and 31 and 32, respectively. The E. coli expression vector pKE112CAR3pptase (Polymers (Basel). 2019 11(7):1184), containing the sfp gene (derived from Bacillus subtilis), was amplified by PCR using primers 29 and 30, respectively, using a template. The PCR products obtained therefrom were amplified by crossover PCR and then inserted into the restriction enzyme HindIII and XbaI sites of the pK19mobSacB vector. This vector was named pk19mobsacB-sfp.
[0063] Here, the Wizard Genomic DNA Purification Kit (Promega) was used to extract chromosomal DNA from each bacterium. The nucleotide sequences of the amplified gadB, gabT, yqhD, car, and sfp genes are shown in Table 1 below, and the primers used for PCR are shown in Table 2 below. PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc.) in the presence of 1 unit of PrimeSTAR Max DNA Polymerase (Takara, Japan) by adding 1 pM of oligonucleotide and 10 ng of template DNA to a reaction mixture containing 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP).
[0064] The pk19mobsacB-gadB(E89Q,△452-466)gabT, pk19mobsacB-yqhD, pk19mobsacB-car, and pk19mobsacB-sfp vectors, constructed using NEBuilder HiFi DNA Assembly Master Mix (NEB) and restriction enzymes HindIII (NEB) and XbaI (NEB), were each transformed into E. coliDH5a (HIT Competent cells™, Cat No. RH618) and plated on LB-agar plates containing 50 μg / ml kanamycin, and incubated at 37°C for 24 hours. The final colonies formed were isolated to confirm that the insert was present in the vector, and the vector was isolated and used to prepare a mutant strain of Corynebacterium glutamicum with the glutamic acid-1,4-butanediol pathway introduced.
[0065] 서열번호유전자 및 염기서열 (5'-3')1Escherichia coli유래, gadB 유전자AAGTACAGAACGCCTCTTACCAGGTTGCCGCTTATCTGGCGGATGAAATCGCCAAACTGGGGCCGTATGAGTTCATCTGTACGGGTCGCCCGGACGAAGGCATCCCGGCGGTTTGCTTCAAACTGAAAGATGGTGAAGATCCGGGATACACCCTGTATGACCTCTCTGAACGTCTGCGTCTGCGCGGCTGGCAGGTTCCGGCCTTCACTCTCGGCGGTGAAGCCACCGACATCGTGGTGATGCGCATTATGTGTCGTCGCGGCTTCGAAATGGACTTTGCTGAACTGTTGCTGGAAGACTACAAAGCCTCCCTGAAATATCTCAGCGATCACTGA2Corynebacterium glutamicum유래, gabT 유전자AGACCCGCGCGCAAGAAATCGAGACCATCATCCGCGATGAATTCGCGCAGCTGAGTGCCTTCCCGGAGGTCGCCGAAATCCGCGGCCGCGGAGCAATGATGGCCATTGAGCTTATCGACGCTACCGGCCGCCCGAACGCAGCTTTAACCGCCGCAGTGGCTGCGCGCGCAAAAGCTGAAGGTGTGCTGCTGCTGACTTGCGGCACCGATGGCAACGTCATCCGCCTGCTGCCACCACTGGTCATTGCAGAGGACACTCTCCGTGATGGTCTTCAGGTGTTAGTCGCAGCCCTAGAGCGCGAAACCGCGCACCAGAAGGTGGGCTAA3Escherichia coli유래, yqhD 유전자CCCACCTCTCCGACTACGGTCTGGACGGCAGCTCCATCCCGGCTTTGCTGAAAAAACTGGAAGAGCACGGCATGACCCAACTGGGCGAAAATCATGACATTACGTTGGATGTCAGCCGCCGTATATACGAAGCCGCCCGCtaa4Mycobacterium abscessus유래,car 유전자TTCTATGAATTGGATGCCGACGGCAATCGGCAGCGCGCTCACTATGACGGTGTGCCCGGCGATTTCACCGCCGCATCGATCACCGCCATCGGCGGTGTGAACGTGGTAGACGGTTACCGCAGCTTCGACGTGTTCAACCCGCACCATGACGGTGTCTCGATGGATACCTTCGTCGACTGGCTGATCGACGCAGGCTACAAGATCGCGCGGATCGACGATTACGACCAGTGGCTCGCCCGGTTCGAGCTGGCCCTCAAGGGATTGCCCGAGCAGCAGCGGCAACAGTCGGTGTTGCCACTTCTCAAGATGTACGAGAAGCCGCAACCGGCGATCGACGGAAGTGCACTTCCGACCGCAGAATTCAGTCGCGCCGTGCACGAGGCGAAGGTCGGAGACAGCGGTGAGATACCGCACGTCACCAAGGAGCTGATCCTCAAGTACGCCAGCGATATTCAGCTGTTGGGCCTGGTGTAG5Bacillus subtilis유래,sfp 유전자ATGAAGATTTACGGAATTTATATGGACCGCCCGCTTTCACAGGAAGAAAATGAACGGTTCATGTCTTTCATATCACCTGAAAAACGGGAGAAATGCCGGAGATTTTATCATAAAGAAGATGCTCACCGCACCCTGCTGGGAGATGTGCTCGTTCGCTCAGTCATAAGCAGGCAGTATCAGTTGGACAAATCCGATATCCGCTTTAGCACGCAGGAATACGGGAAGCCGTGCATCCCTGATCTTCCCGACGCTCATTTCAACATTTCTCACTCCGGACGCTGGGTCATTTGCGCGTTTGATTCACAGCCGATCGGCATAGATATCGAAAAAACGAAACCGATCAGCCTTGAGATCGCCAAGCGCTTCTTTTCAAAAACAGAGTACAGCGACCTTTTAGCAAAAGACAAGGACGAGCAGACAGACTATTTTTATCATCTATGGTCAATGAAAGAAAGCTTTATCAAACAGGAAGGCAAAGGCTTATCGCTTCCGCTTGATTCCTTTTCAGTGCGCCTGCACCAGGACGGACAAGTATCCATTGAGCTTCCGGACAGCCATTCCCCATGCTATATCAAAACGTATGAGGTCGATCCCGGCTACAAAATGGCTGTATGCGCCGCACACCCTGATTTCCCCGAGGATATCACAATGGTCTCGTACGAAGAGCTTTTATAA,
[0066] Sequence Number Primer Name Primer Sequence (5'-3') 6 Primer 1aacagctatgaccatgattacgccaCAAGGATTACGAGCTCGTTGGTGAG 7 Primer 2CTTCGGATCTAAACGATCTGGGCTTTTACCTTCGTTTCGC 8 Primer 3CGAAGGTAAAAGCCCAGATCGTTTAGATCCGAAGGAAAAC 9 Primer 4ACTTGCTTCTTATCCATTGTATGTCCTCCTGGACTTCGTG 10 Primer 5AGTCCAGGAGGACATACAATGGATAAGAAGCAAGTAACGG 11 Primer 6gcagctaagtagggtTCAGTGATCGCTGAGATATTTCAGG 12 Primer 7CTCAGCGATCACTGACAAAAAGCCGGACCCTTGCTTTAAG 13 Primer 8ggtacccggggatcctctagTGCTCATGCAGTACCTGC 14 Primer 9TGATTACGCCAAGCTGGGCGATGGCGGCGAATCCG15 Primer 10CCTTCGGATCTAAACGATCTTTCCTTAAGTGCTGATTCGC16 Primer 11GCGAATCAGCACTTAAGGAAAGATCGTTTAGATCCGAAGG17 Primer 12CAGATTAAAGTTGTTcatTGTATGTCCTCCTGGACTTCG18 Primer 13GTCCAGGAGGACATACAatgAACAACTTTAATCTGCACAC19 Primer 14TCAGAACCTGTAGGTCttaGCGGGCGGCTTCGTATATACG20 Primer 15CGAAGCCGCCCGCtaaGACCTACAGGTTCTGACAATTTAAATCTC21 Primer 16CCGGGGATCCTCTAGCTGGGACTTCAGCAACATCG22 Primer 17aacagctatgaccatgattacgccaTCCGACCTGGCCGGTGATGG23 Primer 18agctaagtagggtGAGCCAAGATTAGCGCTGAAAAGTAGC24 Primer 19GCGCTAATCTTGGCTCaccctacttagctgccaattattc25 PrimerPrimer 20ggagatcgtttcagtcatgggtaaaaaatcctttcgtagg26 Primer 21aaggattttttacccatgactgaaacgatctccacagcgg27 Primer 22GTCTGTAATCAGCGTCCTActacaccaggcccaacagctg28 Primer 23ttgggcctggtgtagTAGGACGCTGATTACAGACGTGTCC29 Primer 24ggtacccggggatcctctagTCTGCTCTAAAGAGCGGCGGGTGG30 Primer 25gaccaTGATTACGCCAAGCTCGACGCAGAAGGTGTGATCC31 Primer 26aattggcagctaagtagggtTTAGCCCACCTTCTGGTGCG32 Primer 27CAGAAGGTGGGCTAAaccctacttagctgccaattattcc33 Primer 28TAAATTCCGTAAATCTTCATgggtaaaaaatcctttcgta34 Primer 29aaggatttttttacccATGAAGATTTACGGAATTTATATGG35 Primer 30TCACGGCAAAGCGAGGTACTTATAAAAGCTCTTCGTACG36 Primer 31CGTACGAAGAGCTTTTATAAGTACCTCGCTTTGCCGTGAC37 Primer 32ggtacCCGGGGATCCTCTAGCGAAGCTTGCCGTGTGCAGG38 Primer 33TCTCAGCGATCACTGAaccctacttagctgccaattattc39 Primer 34GTATGAGAGATCTTCCACgggtaaaaaatcctttcgtagg40 Primer 35aaggatttttttacccGTGGAAGATCTCTCATACCGCATCC41 Primer 36CAAGGGTCCGGCTTTTTGTTAGCCCACCTTCTGGTGCGCG42Primer 37CAGAAGGTGGGCTAACAAAAAGCCGGACCCTTGCTTTAAG
[0067]
[0068] 1-2. Production of microorganisms with introduced gadB, gabT, yqhD, car, and sfp genes
[0069] Using an electrophorator (BIO-RAD), the pk19mobsacB-gadB(E89Q,△452-466)gabT vector prepared in Example 1-1 was introduced into a competent cell Corynebacterium glutamicum ATCC13032 strain by electroporation, then plated on 2YT KM AGAR medium (containing 2YT AGAR and kanamycin 30 mg / L) and cultured in a 30°C incubator for 2 days to obtain colonies. Among the colonies in which primary homologous recombination was induced, those confirmed by PCR were cultured in 2YT liquid medium (containing 16 g / L tryptophan, 10 g / L yeast extract, and 5 g / L NaCl) for 12 hours, and then plated onto 2YT Sucrose AGAR medium (containing 100 g / L 2YT AGAR and sucrose) to remove antibiotic markers through secondary homologous recombination. The selected colonies were finally confirmed to have the gadB and gabT genes introduced as intended through PCR and sequencing analysis.
[0070] Subsequently, the above process was carried out sequentially using the pk19mobsacB-yqhD, pk19mobsacB-car, and pk19mobsacB-sfp vectors produced in Example 1-1 above to produce a Corynebacterium glutamicum mutant strain in which the gadB, gabT, yqhD, car, and sfp genes were introduced to establish a pathway for producing 1,4-butanediol from glutamic acid.
[0071]
[0072] Experimental Example 1. Evaluation of 1,4-Butanediol Production Capacity
[0073] The production of 1,4-butanediol from the 1,4-butanediol-producing microorganisms produced in Example 1 was compared according to differences in pH conditions within the culture medium.
[0074] A microbioreactor (Beckman, Biolector XL) was used for microbial culture. The 1,4-butanediol-producing microorganisms of Example 1 were inoculated into each well of a 48-well Microtiter Flower Plate (Beckman) with 1 mL of butanediol production medium (containing glucose 10%, MgSO4 0.25%, yeast paste 2%, KH2PO4 0.25%, (NH4)2SO4 1.5%, FeSO4 100 ppm, biotin 100 ug / L, nicotinamide 25 ppm, CPN 25 ppm, methionine 0.05%, histidine 0.05%, lysine 0.05%, and tyrosine 0.05%), and cultured for 52 hours in two replicates under different culture pH conditions. After the culture was finished, the culture medium was filtered through a 0.45 μm filter, and the 1,4-butanediol content in the culture medium was analyzed using high-performance liquid chromatography (HPLC) (Agilent, 1260 infinity II) equipped with a column (Avantor HPLC Column Apollo C18). 0.1 M phosphate buffer was used as the mobile phase, and analysis was performed using an RI detector for 15 minutes at a temperature of 40°C and a flow rate of 0.8 mL / min. The results and each culture pH condition are shown in Table 3 below.
[0075] Operating pH Conditions OD 1,4-Butanediol (g / L) 17.26 0.20.3226 0.8 0.37 37.06 0.6 0.35 46 0.5 0.38 56.75 8.7 0.47 65 70.437 6.45 9.72.128 58.11.98 96.15 7.32.24 105 9.12.13 115.85 8.82.38 125 7.32.57 135.55 12.98 145 0.33.1215 5.24 7.82.8 116 46.82.72 17 4.92 9.82.48 18 27.52.55 19 4.6 4.7 0.6 120 4.7 0.48
[0076]
[0077] Conventionally, 1,4-butanediol-producing microorganisms were typically cultured in a medium with a pH of 7.2, taking into account microbial growth conditions. As shown in Table 3 above, it was confirmed that when 1,4-butanediol-producing microorganisms were cultured in a medium with a pH lower than 7.2, specifically in a medium with a pH of 4.9 to 6.4, the production of 1,4-butanediol was improved by at least 5.4 times and up to 9.8 times compared to when cultured in a medium with a pH of 7.2. Meanwhile, it was confirmed that when 1,4-butanediol-producing microorganisms were cultured in a medium with a pH of less than 4.9, 1,4-butanediol was produced at a level similar to that of pH 7.2.
[0078]
[0079] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.
Claims
1. A step of culturing microorganisms that produce 1,4-butanediol from glutamic acid in a medium with a pH of 4.9 to 6.4; and A method for producing 1,4-butanediol comprising the step of recovering 1,4-butanediol from the microorganism or a culture medium in which the microorganism is cultured.
2. In Claim 1, A method comprising the above microorganisms including an enzymatic reaction that converts glutamic acid to 4-aminobutyric acid, an enzymatic reaction that converts 4-aminobutyric acid to succinate semialdehyde, an enzymatic reaction that converts succinate semialdehyde to 4-hydroxybutyric acid, and an enzymatic reaction that converts 4-hydroxybutyric acid to 1,4-butanediol.
3. In Claim 2, The enzymatic reaction converting the above glutamic acid into 4-aminobutyric acid is carried out by glutamic acid decarboxylase, and The enzymatic reaction converting the above 4-aminobutyric acid to succinate semialdehyde is carried out by 4-aminobutyrate aminotransferase, and The enzymatic reaction converting the above succinate semialdehyde to 4-hydroxybutyric acid is carried out by alcohol dehydrogenase, and A method in which the enzymatic reaction converting the above 4-hydroxybutyric acid to 1,4-butanediol is carried out by a carboxylic acid reductase and / or alcohol dehydrogenase.
4. In Claim 1, The above microorganism is of the genus Corynebacterium.