Method for producing 1b or 1d omega-5 gliadin-deleted wheat

Abstract

The present invention relates to a method for producing 1B or 1D omega-5 gliadin-deleted wheat and wheat produced thereby, and, specifically, to a method for producing and selecting 1B or 1D omega-5 gliadin gene-deleted wheat by using radiation. The method for producing 1B or 1D omega-5 gliadin-deleted wheat, according to the present invention, enables the production of a radiation breeding-based non-GMO mutant wheat or wheat breeding parental line while retaining agronomic traits similar to those of a wild-type wheat variety, and thus wheat with reduced toxicity to wheat-dependent exercise-induced anaphylaxis (WDEIA) can be produced for use in the production of processed wheat foods and the like, or a parental line for breeding wheat varieties with reduced toxicity to WDEIA can be produced.

Description

Method for producing wheat deficient in 1B or 1D omega-5 gliadin

[0001] The present invention relates to a method for producing wheat with a 1B or 1D omega-5 gliadin deficiency and wheat produced thereby, specifically to a method for producing wheat with a 1B or 1D omega-5 gliadin gene deficiency using radiation and selecting the same.

[0002]

[0003] Wheat (Triticum aestivum) is an annual plant belonging to the genus Triticum of the family Gramineae, and is also known as wheat. It is cultivated worldwide and ranks second in global grain production, following corn. Wheat is the second most consumed crop after rice; while the annual per capita consumption is over 30 kg and the national total is approximately 4 million tons, the country currently relies heavily on imports. Wheat has long, slender leaves, hollow stems, and ears containing 20 to 100 flowers. Wheat is used for a variety of purposes, including bread, noodles, cakes, and crackers.

[0004] Wheat consists of 13–17% seed coat, 2–3% embryo, and 81–84% endosperm, and due to gluten, a storage protein in the endosperm, it possesses processing properties such as bread, ramen, and snacks. Gluten proteins are divided into soluble gliadin and insoluble glutenin based on their solubility in aqueous alcohol solutions. Most gliadins exist as monomers and are classified into ω-5 gliadin, ω-1,2 gliadin, α- / β-gliadin, and γ-gliadin groups based on their mobility on A-PAGE (Acid-PAGE) or SDS-PAGE at low pH. Among the total gliadin proteins, α- / β-gliadin and γ-gliadin are the major proteins, accounting for 28–33% and 23–31%, respectively, while ω-1,2 gliadin and ω-5 gliadin account for 4–7% and 3–6%, respectively. In particular, ω-5 gliadin is known to be the central antigen for wheat-dependent exercise-induced anaphylaxis (WDEIA), a severe food allergy that can lead to death in severe cases. Symptoms occur when physical exercise is performed after consuming wheat-containing foods, and it primarily affects adults.

[0005] Recent research has revealed that the omega-5 gliadin protein in wheat seeds exists in a major form at the Gli-B1 locus on chromosome 1B and in a minor form at the Gli-D1 locus on chromosome 1D.

[0006]

[0007] The present invention aims to solve the aforementioned problem and other related problems.

[0008] One exemplary objective of the present invention is

[0009] (a) a step of irradiating the wheat with radiation; and

[0010] (b) a step of selecting wheat having one or more deletions selected from a group consisting of 1B omega-5 gliadin and 1D omega-5 gliadin genes;

[0011] The present invention provides a method for producing mutant wheat, comprising

[0012] Another exemplary objective of the present invention is to provide mutant wheat produced by the above-described manufacturing method.

[0013] Another exemplary purpose of the present invention is

[0014] (a) a step of irradiating the wheat with radiation; and

[0015] (b) a step of selecting wheat having one or more deletions selected from a group consisting of 1B omega-5 gliadin and 1D omega-5 gliadin genes;

[0016] The present invention provides a method for producing a wheat breeding parent including

[0017] Another exemplary objective of the present invention is to provide a wheat breeding parent produced by the above-described manufacturing method.

[0018]

[0019] The technical problems to be solved according to the technical concept of the invention disclosed in this specification are not limited to those for solving the problems mentioned above, and other unmentioned problems will be clearly understood by a person skilled in the art from the description below.

[0020]

[0021] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions provided below.

[0022] As one embodiment for achieving the above objective, the present invention

[0023] (a) a step of irradiating the wheat with radiation; and

[0024] (b) a step of selecting wheat having one or more deletions selected from a group consisting of 1B omega-5 gliadin and 1D omega-5 gliadin genes;

[0025] A method for producing mutant wheat comprising

[0026] In step (a) of the present invention, the wheat may be of the Butte 86 variety, but is not limited thereto.

[0027] In step (a) of the present invention, the 'radiation' may specifically be gamma rays, and the gamma rays may irradiate at a rate of 50 Gy to 150 Gy, specifically at a rate of 50 to 55, 55 to 60, 60 to 65, 65 to 70, 70 to 75, 75 to 80, 80 to 85, 85 to 90, 90 to 95, 95 to 100, 100 to 105, 105 to 110, 110 to 115, 115 to 120, 120 to 125, 125 to 130, 130 to 135, 135 to 140, 140 to 145, or 145 to 150 Gy, and more specifically It may involve irradiating 100 Gy, but is not limited to this.

[0028] In step (b) of the present invention, the 1B omega-5 gliadin gene may have the nucleotide sequence of SEQ ID NO. 1, and the 1D omega-5 gliadin gene may have the nucleotide sequence of SEQ ID NO. 2.

[0029] In step (b) of the present invention, the 'deletion' refers to a state in which gene expression becomes difficult or impossible due to damage to the gene sequence, and includes abnormal expression patterns. The deletion may involve damage to part or all of the DNA sequence, and includes the destruction of gene function due to deletion, alteration, or insertion of the sequence.

[0030] In step (b) of the present invention, the ‘selection’ may utilize a mutant lineage selection method commonly used in the art, specifically, gene copy number variation (CNV), RP-UPLC (Reverse Phase Ultra Performance Liquid Chromatography), 2-dimensional electrophoresis (2-DE), Neutral pH Polyacrylamide Gel Electrophoresis (NuPAGE), 2D immunoblots, or a genome-specific primer platform, but is not limited thereto.

[0031] Specifically, in step (b) above, the screening may be performed by performing PCR with primer pairs represented by SEQ ID NOs 3 and 4 or SEQ ID NOs 5 and 6, or by analyzing gene copy number variations with primer pairs represented by SEQ ID NOs 4 and 7 or SEQ ID NOs 5 and 8.

[0032] In one embodiment of the present invention, mutant wheat produced by the above manufacturing method was deposited at the National Institute of Agricultural Sciences Agricultural Genetic Resources Center (KACC) on August 20, 2024, and accession numbers KACC 88010BP and KACC 88011BP were assigned to two lines with a single deletion of the 1B omega-5 gliadin gene, and accession numbers KACC 88012BP and KACC 88013BP were assigned to two lines with a single deletion of the 1D omega-5 gliadin gene.

[0033] As another embodiment for achieving the above objective, the present invention provides mutant wheat produced by the above manufacturing method.

[0034] In the present invention, the mutant wheat may be deficient in 1B omega-5 gliadin or 1D omega-5 gliadin, and the deficiency includes cases where 1B omega-5 gliadin or 1D omega-5 gliadin is not produced at all or the production amount is reduced, as well as cases where incomplete or inactive proteins are produced.

[0035] In the present invention, the mutant wheat may have reduced toxicity to wheat-dependent exercise-induced anaphylaxis (WDEIA).

[0036] In the present invention, the mutant wheat may be used in the manufacture of wheat processed foods, and the wheat processed foods may be one or more selected from the group consisting of wheat flour, bread, noodles, cookies, and confectionery, but are not limited thereto.

[0037] Specifically, the flour may be manufactured in the form of strong flour, weak flour, medium flour, semolina, gluten flour, whole wheat flour, and whole wheat flour, etc., the bread may be manufactured in the form of sliced ​​bread, baguette, croissant, and bagel, etc., the noodles may be manufactured in the form of ramen, spaghetti, udon, and noodles, etc., and the snacks may be manufactured in the form of crackers, cakes, donuts, and muffins, etc., but are not limited thereto.

[0038] As another embodiment for achieving the above objective, the present invention

[0039] (a) a step of irradiating the wheat with radiation; and

[0040] (b) a step of selecting wheat having one or more deletions selected from a group consisting of 1B omega-5 gliadin and 1D omega-5 gliadin genes;

[0041] A method for producing a wheat breeding parent including

[0042] The above 'wheat', 'radiation', '1B omega-5 gliadin gene', '1D omega-5 gliadin gene', 'deletion', and 'selection' are as described above.

[0043] The term 'wheat breeding parent' in the present invention refers to a parent line used in the crossbreeding process to develop a new variety, and is a wheat line used to transmit the genetic characteristics of the plant to its offspring in order to research and mass-produce varieties with specific traits. In the present invention, the wheat breeding parent may be used for the breeding of wheat having genetic characteristics in which the 1B omega-5 gliadin or 1D omega-5 gliadin gene is deficient.

[0044] As another embodiment for achieving the above objective, the present invention provides a wheat breeding parent produced by the above manufacturing method.

[0045] The above breeding parent may be used for breeding wheat varieties deficient in 1B omega-5 gliadin or 1D omega-5 gliadin, and the above breeding parent may be used for breeding wheat varieties with reduced toxicity to wheat-dependent exercise-induced anaphylaxis (WDEIA).

[0046] The above breeding parent may be used for breeding wheat varieties deficient in 1B omega-5 gliadin and 1D omega-5 gliadin, and the above breeding wheat varieties deficient in 1B omega-5 gliadin and 1D omega-5 gliadin refers to a wheat variety in a double deletion state in which both 1B omega-5 gliadin and 1D omega-5 gliadin genes are deficient, obtained by crossing a wheat breeding parent in a single deletion state in which the 1B omega-5 gliadin gene or the 1D omega-5 gliadin gene of the present invention is deficient.

[0047]

[0048] The method for producing wheat deficient in 1B or 1D omega-5 gliadin according to the present invention can produce a radiation-based Non-GMO mutant wheat or a breeding parent of wheat that possesses agricultural traits similar to wild-type wheat varieties, and thereby has the effect of producing wheat with reduced toxicity to wheat-dependent exercise-induced anaphylaxis (WDEIA) to be used in the manufacture of wheat processed foods, or producing a parent for breeding wheat varieties with reduced toxicity to wheat-dependent exercise-induced anaphylaxis.

[0049]

[0050] Figure 1 shows the results of performing PCR on a mutant population using 1B or 1D omega-5 gliadin gene-specific PCR primers.

[0051] Figure 2 shows the results of performing RP-UPLC on selected 1B or 1D omega-5 gliadin gene single deletion lines.

[0052] Figure 3 shows the results of analyzing gene copy number variation for selected 1B omega-5 gliadin gene single deletion lines.

[0053] Figure 4 shows the results of analyzing gene copy number variation for selected 1D omega-5 gliadin gene single deletion lines.

[0054] Figure 5 shows the results of performing two-dimensional electrophoresis (top) and a 2-D immune response using specific antibodies (bottom) on selected 1B or 1D omega-5 gliadin gene single deletion lines.

[0055] Figure 6 shows the results of a germination test performed on selected 1B or 1D omega-5 gliadin gene single deletion lines.

[0056] Figure 7 shows the results of comparing wild-type Butte 86 and selected 1B or 1D omega-5 gliadin gene single deletion lines with agronomic traits.

[0057]

[0058] The present invention will be explained in more detail below through the following examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples.

[0059]

[0060] Example 1. Selection of 1B or 1D omega-5 gliadin gene single deletion lines

[0061] The 1B or 1D omega-5 gliadin gene sequence information is as shown in Table 1 below.

[0062]

[0063] 유전자서열 (5' → 3')서열번호1B 오메가-5 글리아딘AACAATTCCACCAACAACAATTACCACAACAACAATTTCCCCAACAACAATTCCCCCAACAGCAATTCCCCCAACAACAACAGTTCCCCCAACAACAACAATTAACGCAACAACAATTCCCCCGGCCACAACAATCCCCTGAACAACAACAATTCCCCCAACAACAATTCCCCCAGCAACCACCACAACAATTCCCCCAACAACAATTTCCAATACCATACCCACCCCAGCAATCACAAGAACCTTCCCCATACCAACAATATCCACAACAACAACCATCTGGGAGCGACGTTATAAGTATCAGTGGCCTATGA11D 오메가-5 글리아딘AGCAACCACAACAACAATTCCCAAAACAACAATTTCCCATACCATACCCACCCCAACAACAATCGCAAGAAGCTTCCCCATACCAACAATACCACAACA ACAACTATCTGGGAGCGACATTATAA2

[0064] Based on sequence information confirmed in Chinese Spring (CS), to breed a population of 1B or 1D omega-5 gliadin gene deletion mutants in Butte 86, seeds were irradiated with gamma rays at 100 Gy at the Advanced Radiation Research Institute of the Korea Atomic Energy Research Institute and sown in a vinyl greenhouse of the Department of Agricultural Life Resources at the National Institute of Agricultural Sciences to secure a population of 5,900 M2 mutant individuals. Genomic DNA was extracted from 5,900 M2 plants using 1B or 1D omega-5 gliadin gene-specific PCR primers, and PCR was performed twice. The primer sequences are shown in Table 2. As a result of PCR, when compared with Butte 86, Chinese Spring (CS), which had both 1B and 1D omega-5 gliadin genes, N1BT1A, N1BT1D, which had a deletion in the 1B omega-5 gliadin gene, and N1DT1A, N1DT1B, which had a deletion in the 1D omega-5 gliadin gene, lines #1347 and #1592 were selected as lines with a single deletion in the 1B omega-5 gliadin gene, and lines #738 and #5879 were selected as lines with a single deletion in the 1D omega-5 gliadin gene (Fig. 1). Selected wheat lines were deposited at the National Institute of Agricultural Sciences Agricultural Genetic Resources Center (KACC) on August 20, 2024, and were assigned accession numbers KACC 88010BP and KACC 88011BP for two lines (#1347 and #1592) with a single deletion of the 1B omega-5 gliadin gene, and accession numbers KACC 88012BP and KACC 88013BP for two lines (#738 and #5879) with a single deletion of the 1D omega-5 gliadin gene.

[0065] Gene Primer Sequence (5' → 3') Sequence No. 1B Omega-5 Gliadin FAGTAGGCTGCTAAGCCCTAGA3RATATTGTTGGTATGGGGAAGG41D Omega-5 Gliadin FACTAGGCAACTAAGCCCTAGA5RGCTTCTTGCGATTGTTGTTGG6

[0066] In addition, the total gliadin protein fractions of selected single deletion lines were analyzed using the RP-UPLC method, and it was confirmed that the 1B or 1D omega-5 gliadin fractions disappeared in the single deletion lines of the 1B or 1D omega-5 gliadin gene, respectively (Fig. 2).

[0067]

[0068] Example 2. Confirmation of 1B or 1D Omega-5 Gliadin Gene Deletion in Selected Lines

[0069] 2.1. Confirmation of Gene Copy Number Variations

[0070] qPCR was performed using the primers shown in Table 3 to investigate gene copy number variation (CNV) of the 1B or 1D omega-5 gliadin gene in the genomes of 1B or 1D omega-5 gliadin gene single deletion lines.

[0071] Gene Primer Sequence (5' → 3') Sequence No. 1B Omega-5 Gliadin FACAATTTCCAATACCATACCCACC7RATATTGTTGGTATGGGGAAGG41D Omega-5 Gliadin FACTAGGCAACTAAGCCCTAGA5RATTTGCTGTTGTGGGATT8

[0072] As a result, the single deletion line of the 1B omega-5 gliadin gene was close to 0, similar to the negative controls CS-N1BT1A and CS-N1BT1D, which have a deletion in the 1B chromosome, unlike the positive controls Butte 86, Chinese Spring (CS), CS-N1DT1A and CS-N1DT1B, which have a deletion in the 1B chromosome encoding the 1B omega-5 gliadin gene, thus confirming once again that the 1B omega-5 gliadin gene is deleted in these deletion lines (Fig. 3). In addition, unlike the positive controls Butte 86, Chinese Spring (CS), CS-N6BT6A, and CS-N6BT6D, which have a 1D chromosome encoding the 1D omega-5 gliadin gene, the 1D omega-5 gliadin gene single deletion line was close to 0, similar to the negative controls CS-N1DT1A and CS-N1DT1B, which have a deletion in the 1D chromosome, thus confirming once again that the 1D omega-5 gliadin gene is deleted in these deletion lines (Fig. 4).

[0073]

[0074] 2.2. Deletion Confirmation Using Two-Dimensional Electrophoresis and Specific Antibodies

[0075] Two-dimensional electrophoresis (2-DE) analysis of total gluten protein was performed to identify 1B or 1D omega-5 gliadin deletions in 1B or 1D omega-5 gliadin gene single deletion lines.

[0076] When compared with the Butte 86 proteomic map (2D-MS / MS proteomic map) prepared by the collaborating researcher, the ARS group in the United States, using the same method, it was confirmed that spots expected to be 1B or 1D omega-5 gliadins were deleted in the deletion lines, and in a 2-D immune response using ONT18A5, an omega-5 gliadin-specific antibody, it was confirmed that the single deletion line of the 1B omega-5 gliadin gene did not respond to 1B omega gliadin, and the single deletion line of the 1D omega-5 gliadin gene did not respond to 1D omega gliadin (Fig. 5).

[0077]

[0078] Example 3. Germination and agricultural trait testing of 1B or 1D omega-5 gliadin gene-deficient selected lines

[0079] To measure the viability (germination rate) of selected 1B or 1D omega-5 gliadin gene single deletion lines, the Agricultural Microbiology Division of the National Institute of Agricultural Sciences conducted a test using the intercalation method.

[0080] As a result, it was confirmed that 93% of line #1347 and 99% of line #1592, which are single deletions of the 1B omega-5 gliadin gene, germinated, and that 97% of line #738 and 100% of line #5879, which are single deletions of the 1D omega-5 gliadin gene, germinated (Fig. 6). Through this, it was found that the selected single deletion lines can be used commercially for wheat production or utilized for breeding 1B and 1D omega-5 gliadin double deletion lines.

[0081] In addition, when the selected 1B / 1D omega-5 gliadin gene single deletion lines were advanced to the M6 ​​generation in the greenhouse of the Department of Agriculture and Life Sciences, the important agricultural traits—stem length, ear length, tillering number, and 100-grain weight—were measured and found to be almost similar to the wild type Butte 86 (Fig. 7). Through this, it was found that the selected single deletion lines could be used commercially for wheat production or utilized for breeding 1B and 1D omega-5 gliadin gene double deletion lines.

[0082]

[0083] From the foregoing description, those skilled in the art to which the present invention pertains will understand that the present invention may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

[0084]

[0085] [Correction pursuant to Rule 91 12.01.2026]

[0086] [Correction pursuant to Rule 91 12.01.2026]

[0087]

[0088]

Claims

1. (a) A step of irradiating the wheat with radiation; and (b) a step of selecting wheat having one or more deletions selected from a group consisting of 1B omega-5 gliadin and 1D omega-5 gliadin genes; A method for producing mutant wheat comprising 2. In Paragraph 1, A method of manufacturing in which, in step (a) above, the wheat is of the Butte 86 variety.

3. In Paragraph 1, A manufacturing method in which, in step (a) above, the radiation is gamma rays.

4. In Paragraph 3, A manufacturing method in which the above gamma rays are irradiated at a rate of 50 Gy to 150 Gy.

5. In Paragraph 1, A method of preparation in which, in step (b) above, the 1B omega-5 gliadin gene has the nucleotide sequence of SEQ ID NO.

1.

6. In Paragraph 1, A method of preparation in which, in step (b) above, the 1D omega-5 gliadin gene has the nucleotide sequence of SEQ ID NO.

2.

7. In Paragraph 1, A manufacturing method wherein, in step (b) above, the screening is performed by performing PCR with primer pairs represented by SEQ ID NOs 3 and 4 or SEQ ID NOs 5 and 6.

8. In Paragraph 1, A manufacturing method in which, in step (b) above, the screening is to analyze gene copy number variations using primer pairs represented by SEQ ID NOs 4 and 7 or SEQ ID NOs 5 and 8.

9. Mutant wheat produced by the manufacturing method of any one of paragraphs 1 to 8.

10. In Paragraph 9, The above mutant wheat is a mutant wheat in which 1B omega-5 gliadin or 1D omega-5 gliadin is deficient.

11. In Paragraph 9, The above mutant wheat is a mutant wheat with reduced toxicity to wheat-dependent exercise-induced anaphylaxis (WDEIA).

12. In Paragraph 9, The above mutant wheat is a mutant wheat used in the manufacture of wheat processed foods.

13. In Paragraph 12, The above-mentioned wheat processed food is one or more mutant wheat selected from the group consisting of wheat flour, bread, noodles, cookies, and confectionery. 14.(a) Step of irradiating the wheat with radiation; and (b) a step of selecting wheat having one or more deletions selected from a group consisting of 1B omega-5 gliadin and 1D omega-5 gliadin genes; A method for producing a wheat breeding parent including 15. In Paragraph 14, A method of manufacturing in which, in step (a) above, the wheat is of the Butte 86 variety.

16. In Paragraph 14, A manufacturing method in which, in step (a) above, the radiation is gamma rays.

17. In Paragraph 16, A manufacturing method in which the above gamma rays are irradiated at a rate of 50 Gy to 150 Gy.

18. In Paragraph 14, A method of preparation in which, in step (b) above, the 1B omega-5 gliadin gene has the nucleotide sequence of SEQ ID NO.

1.

19. In Paragraph 14, A method of preparation in which, in step (b) above, the 1D omega-5 gliadin gene has the nucleotide sequence of SEQ ID NO.

2.

20. In Paragraph 14, A manufacturing method wherein, in step (b) above, the screening is performed by performing PCR with primer pairs represented by SEQ ID NOs 3 and 4 or SEQ ID NOs 5 and 6.

21. In Paragraph 14, A manufacturing method in which, in step (b) above, the screening is to analyze gene copy number variations using primer pairs represented by SEQ ID NOs 4 and 7 or SEQ ID NOs 5 and 8.

22. A wheat breeding parent produced by the method of any one of paragraphs 14 to 21.

23. In Paragraph 22, The above breeding parent is a wheat breeding parent used for breeding wheat varieties deficient in 1B omega-5 gliadin or 1D omega-5 gliadin.

24. In Paragraph 22, The above breeding parent is a wheat breeding parent used for breeding wheat varieties with reduced toxicity to wheat-dependent exercise-induced anaphylaxis (WDEIA).

25. In Paragraph 22, The above breeding parent is a wheat breeding parent used for breeding wheat varieties deficient in 1B omega-5 gliadin and 1D omega-5 gliadin.

Images