Methods for sex-sorting insects

Endogenous sex-specific gene expression systems, using intronic sequences, address the limitations of traditional GSSs by ensuring stable sex-sorting and improved fitness in insect populations, enhancing the efficiency and simplicity of SIT operations.

WO2026143166A1PCT designated stage Publication Date: 2026-07-02RGT UNIV OF CALIFORNIA +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/061221
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-12-23
Filing Date
2025-12-23
Publication Date
2026-07-02

AI Technical Summary

Technical Problem

Traditional genetic sexing strains (GSSs) for insect population control, such as the VIENNA 8 strain, face issues like male semi-sterility, female developmental delays, and susceptibility to phenotype loss due to recombination, complicating mass rearing and increasing operational complexity and cost in sterile insect technique (SIT) facilities.

Method used

Employing an endogenous sex-specific gene expression system, utilizing intronic sequences from genes like tra and dsx, to create cisgenic GSSs that enable sex-sorting without exogenous elements, ensuring stable phenotypic expression and improved fitness, as demonstrated in the IMPERIAL and SEPARATOR strains.

Benefits of technology

The endogenous sex-specific gene expression system achieves stable 1:1 sex ratios, improved fitness, and reduced operational complexity by avoiding translocation-induced semi-sterility and exogenous elements, making it suitable for large-scale SIT applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025061221_02072026_PF_FP_ABST
    Figure US2025061221_02072026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention provides methods of sex-sorting a plurality of insects based on sex-specific gene expression.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] METHODS FOR SEX-SORTING INSECTS

[0002] The present invention provides a method of sex-sorting a plurality of insects based on sexspecific gene expression.

[0003] Background

[0004] Genetic sexing strains (GSSs) have been developed in multiple insect species of economic significance to allow easier male and female separation necessary for efficient population control. Specifically, GSSs are used within sterile insect technique (SIT) programmes which work via frequent releases of sterilised insects into the wild for temporary population control (Hendrichs & Robinson, 2009; Knippling, 1955; Krafsur, 1998). Male-only releases, aided by GSS implementation, strongly succour in released fly dispersal and their mating frequency with wild females, thus enhancing SIT success (Franz et al., 2021; Hendrichs et al., 1995; Rendon et al., 2004). Vast efforts have focused on GSS generation in mosquito disease vectors and agricultural fruit fly pests to avoid labour-intensive sex-sorting by eliminating the females from the released population early on in the life cycle (Isasawin et al., 2014; McCombs & Saul, 1995; McInnis et al., 2004; Meza et al., 2020; Ramírez-Santos et al., 2021; Robinson, 2002).

[0005] The traditional GSS approach requires two key attributes: a selectable marker and a Y-chromosome or male-determining locus linkage from which it needs to be expressed (Franz et al., 2021). Classical GSSs rely on bidirectional translocations of phenotypic marker(s) from one of the autosomes onto the Y chromosome. In an autosomal mutant background, this accumulates to a male-only wild-type phenotype (Franz et al., 2021). A primary example of a traditional GSS is the VIENNA 8 strain developed in the tephritid fruit fly pest Ceratitis capitata (Mediterranean fruit fly or medfly), which increasingly threatens the agricultural industry with its expanding global distribution and vast host range (Papadopoulos, 2014; White & Elsom-Harris, 1992). VIENNA 8, similarly to its predecessor VIENNA 7, relies on a radiation-induced simultaneous translocation of wp gene and temperature sensitive lethal (tsi) genes onto the Y-chromosome which are involved in pupal colouration and heat tolerance respectively (Sollazzo et al., 2023; Ward et al., 2021). Whilst the former, wp, has been characterised in multiple tephritids, the latter, tsi, remains to be identified in C. capitata and its relatives. As the VIENNA 8 strain has a wp and tsi double-mutant background, the white-pupaed females die upon embryonic heat exposure, whilst the brown-pupaed males persevere into adulthood (Franz et al., 2021; Sollazzo et al., 2022). Across the Tephritidae family, such traditional GSSs have been successfully developed in multiple species, although only those developed in capitata and Anastrepha ludens have been implemented on a SIT facility scale(Caceres, 2002; Quintero-Fong et al., 2018). Other traditional examples tested on a larger scale include the eye colour phenotype-dependent Aedes aegypti GSSs (Koskinioti et al., 2020).

[0006] The VIENNA 8 strain has multiple drawbacks, including male semi-sterility due to aneuploidy and female-specific developmental delays, which create obstacles for mass rearing (Augustinos et al., 2017; Cáceres, 2002; Cáceres et al., 2023; Franz et al., 2021). Furthermore, the VIENNA 8 strain is infrequently susceptible to phenotype loss via recombination, which requires an extra filtering step at SIT facilities (Fisher & Caceres, 2000; Franz et al., 2021). These recombination events that disrupt the linkage between the Y-chromosome and the sexing components occur at a low but non-zero frequency per generation. On a per-individual basis these events are infrequent; however, at the scale of mass-rearing billions of insects, even rare recombination events give rise to a non-negligible number of recombinant individuals with incorrect phenotypes. Because such recombinants can compromise the integrity of the sexing system if they are allowed to accumulate, SIT facilities are required to implement an additional filter rearing system to detect and remove them from production batches. This extra filtering step increases operational complexity, labour and cost, and introduces an additional failure mode compared to a more genetically stable system. Accordingly, even though recombination is infrequent on a per-generation basis, the VIENNA 8 strain still presents a significant practical problem in large-scale SIT operations, which motivates the need for alternative, more stable strategies for SIT-mediated population control.

[0007] Accordingly, there is a need for an alternative strategy for SIT-mediated population control.

[0008] Brief summary of the disclosure

[0009] The invention is based on the surprising finding that a sex-specific gene expression system composed exclusively of endogenous elements (e.g., from Ceratitis capitata) can be used to sex-sort insects, without exogenous elements. The beneficial effects observed when an endogenous sex-specific gene expression system is used to sex-sort insects are particularly surprising.

[0010] Endogenous sex-specific intronic sequences have previously been used for sex-specific marker expression. The C. capitata and the A. ludens sex-specific tra intron, a master gene of tephritid female sex determination, has previously been used for female-specific fluorescence marker expression in a Sexing Element Produced by Alternative RNA-splicing of Transgenic Observable reporter (SEPARATOR) system (Davydova et al., 2023; Fu et al., 2007; Ogaugwu et al., 2013; Pane et al., 2002; Peng et al., 2015; Schetelig et al., 2012). However, prior to thepresent invention, there was no suggestion in the field that sex-specific intronic sequences could be used to control selectable marker expression without: (a) heterologous coding sequences (e.g. fluorescent markers or toxic effectors) and / or (b) non-endogenous regulatory elements.

[0011] Use of an endogenous sex-specific gene expression system in a method to sex-sort insects is associated with: (i) improved phenotypic stability, as shown in our Examples by fully penetrant, generation-stable pupal colour dimorphism and consistent 1:1 sex ratios, (ii) improved general fitness and thus suitability for large-scale SIT applications, demonstrated in our examples with overall egg-to-adult survival and adult performance comparable to wild-type but superior to the VIENNA 8 strain, (iii) a more time-effective route both to strain generation (single targeted cisgenic knock-in rather than stochastic translocation schemes) and to operational mass-rearing (sex separation without embryonic heat-shock or antibiotics), (iv) the absence of translocation-induced semi-sterility, a genetically simple and homozygous architecture that facilitates colony maintenance and quality control, and (v) the avoidance of exogenous gene products, which may further improve biological performance and simplify deployment.

[0012] In particular, the inventors have demonstrated that sex-specific intronic sequences (e.g. tra intronic sequence or dsx intronic sequence) from endogenous sex-determination genes (e.g., tra or dsx) can be used as sex-specific splicing modules to control endogenous selectable marker gene expression, without exogenous elements.

[0013] The invention is demonstrated in the cisgenic GSS “IMPERIAL” strain, in which insertion of an endogenous transformer (tra) sex-specific intronic sequence into the endogenous white pupae (wp) locus converts wp into a female-specific marker under its native promoter while avoiding foreign coding sequences in the final integrant. Avoidance of foreign coding sequences in the final integrant is advantageous because it minimises the genetic and physiological deviation of the strain from wild-type, thereby reducing the likelihood of fitness costs or unintended phenotypic effects associated with continuous expression of non-endogenous proteins (e.g. fluorescent markers or toxic effectors). It also avoids introducing novel proteins into the environment, which can simplify biosafety assessment and regulatory approval, and reduces the risk of transgene silencing mechanisms that are often triggered by strongly heterologous expression cassettes.

[0014] The method of sex-sorting insects can therefore use a female-specific intronic sequence for the establishment of cisgenic GSSs, entirely without exogenous elements. It may particularlyuse the endogenous transformer (tra) sex-specific intronic sequence to improve the phenotypic stability of the endogenous white pupae (wp) locus, as demonstrated herein. It may particularly use the endogenous transformer tra) sex-specific intronic sequence to improve the general fitness of the C. capitata strain, as demonstrated herein.

[0015] The inventors have demonstrated, in the cisgenic IMPERIAL strain referred to above, complete concordance between sex and pupal colour and a stable 1:1 sex ratio over multiple generations, with overall fitness comparable to the wild-type progenitor and improved performance relative to the classical VIENNA 8 GSS.

[0016] The inventors have further demonstrated that the C. capitata male-specific dsx intronic sequence can be used in the SEPARATOR system for male-specific expression of a fluorescence marker, with adult sex ratios remaining at approximately 1:1 and at least one line with acceptable fitness for SIT-type applications.

[0017] As such, a male-specific splicing intronic sequence, such as the dsx intronic sequence, could be integrated into the endogenous wp gene for its male-specific rescue, resulting in a golden-brown pupal pigmentation, thereby creating an endogenous male-specific marker.

[0018] The technical rationale is that the male-specific SEPARATOR system is expressly designed to test whether the C. capitata dsx intronic segment behaves as a portable sex-specific splicing module, independent of its native genomic context. In the SEPARATOR construct, the truncated dsx intronic sequence is removed from its endogenous locus and placed within a heterologous coding sequence (DsRed) under a heterologous promoter. The fact that this cassette nonetheless exhibits fully penetrant male-specific splicing and marker expression demonstrates that the dsx intronic sequence alone carries sufficient cis-acting information to impose male-specific splicing in a new genomic and transcriptional context.

[0019] In parallel, the same application discloses that an endogenous tra intronic sequence can: (i) drive female-specific fluorescence in a transgenic SEPARATOR configuration, and (ii) produce robust female-specific rescue of the endogenous wp gene in the cisgenic IMPERIAL strain. In other words, the tra intronic sequence is shown to function as a context-independent sex-specific splicing module that can be moved from a heterologous reporter cassette into an endogenous locus while preserving its sex-specific behaviour. A person skilled in the art, reading these results together, would understand that the invention does not rely on any special property of tra per se, but on the more general concept that sex-specific intronic sequences from core sex-determination genes (such as tra and dsx) can be used as portable splicing modules. Since the dsx intronic sequence has already been shown in theSEPARATOR construct to confer male-specific splicing in a heterologous coding sequence and promoter context, the skilled person would reasonably expect that inserting the same dsx intronic sequence into the endogenous wp locus, following the same design principles as used for the tra-wp IMPERIAL allele (male isoform restoring the reading frame, female isoform disrupting it), would yield male-specific endogenous selectable marker expression. Thus, the male-specific SEPARATOR system experimentally validates the dsx intronic sequence as a suitable module for use in the cisgenic GSS architecture described in the application.

[0020] The method of sex-sorting insects could therefore also use a male-specific intronic sequence for the establishment of an endogenous sex-specific gene expression system, entirely without exogenous elements. It may also particularly use the endogenous double-sex (dsx) sex-specific intronic sequence to improve the phenotypic stability of the endogenous white pupae (wp) locus, as demonstrated herein. It may particularly use the endogenous doublesex (dsx) sex-specific intronic sequence to improve the general fitness of the C. capitata strain, as demonstrated herein.

[0021] It is acknowledged that the sex-determination pathway based on transformer (tra) and the use of a sex-specifically spliced intronic sequence is conserved at the mechanistic level within the Tephritidae family, although the underlying intronic sequences are not necessarily conserved between individual tephritid species.

[0022] As set out in the description, the invention is not limited to the specific Ceratitis capitata tra intronic sequence exemplified, but extends to functionally equivalent sex-specifically spliced tra intronic sequences from other tephritid species employing the same conserved mechanism. In tephritid fruit flies, including Ceratitis, Bactrocera and Anastrepha, sex determination is based on a tra-tra2-dsx cascade that is conserved at the mechanistic level, even though the underlying intronic DNA sequences are highly diverged between species. In this pathway, the transformer (tra) gene acts as a binary switch and “memory device” for sex determination. In females, maternally provided Tra protein initiates female-specific alternative splicing of zygotic tra pre-mRNA, producing a full-length functional Tra protein; this Tra protein, together with Tra-2, maintains its own female-specific splicing via positive feedback (auto-regulation) and directs female-specific splicing of the downstream effector doublesex (dsx), resulting in female-specific Dsx isoforms and female development. In males, a primary male-determining signal prevents activation of this auto-regulatory loop, so tra pre-mRNA is spliced into a non-functional male-specific isoform (containing premature stop codons) and no functional Tra protein is produced. In the absence of Tra / Tra-2, dsx pre-mRNA is spliced into the default male-specific isoform, leading to male development.This model has been experimentally demonstrated in C. capitata (Cctra) where tra is regulated by sex-specific alternative splicing and acts as a memory device for sexual fate, and where Tra / Tra-2 control sex-specific splicing of dsx (Pane A, Salvemini M, Delli Bovi P, Polito C, Saccone G. The transformer gene in Ceratitis capitata provides a genetic basis for selecting and remembering the sexual fate. Development. 2002;129(15):3715-3725. doi: 10.1242 / dev.129.15.3715).

[0023] It has been extended to multiple Anastrepha species, in which tra shows the same exon-intron organisation and sex-specific splicing pattern (functional Tra only in females), despite divergence at the primary sequence level. (Ruiz MF, Milano A, Salvemini M, Eirin-Lopez JM, Perondini ALP, et al. (2007) The Gene Transformer of Anastrepha Fruit Flies (Diptera, Tephritidae) and Its Evolution in Insects. PLOS ONE 2(11): e1239. https: / / doi.org / 10.1371 / journal.pone.0001239)

[0024] A broader review of this conserved “Tra ON / OFF - DsxF / DsxM’’ relay as a common mechanism in holometabolous insects, including Tephritidae, is provided by Bopp et al. (2013 / 2014) (Bopp D, Saccone G, Beye M. Sex determination in insects: variations on a common theme. Sex Dev. 2014;8(1-3):20-28. doi: 10.1159 / 000356458).

[0025] Additional functional work on tephritid tra-2 further supports this conserved mechanism, showing that Tra-2 is required both for tra auto-regulation and for female-specific splicing of dsx pre-mRNA in tephritids. (Sarno F, Ruiz MF, Eirin-Lopez JM, Perondini AL, Selivon D, Sanchez L. The gene transformer-2 of Anastrepha fruit flies (Diptera, Tephritidae) and its evolution in insects. BMC Evol Biol. 2010 May 13;10:140. doi: 10.1186 / 1471-2148-10-140. PMID: 20465812; PMCID: PMC2885393.)

[0026] Collectively, these studies demonstrate that, across the Tephritidae, the logic of the pathway (Tra ON in females, OFF in males; Tra / Tra-2 controlling sex-specific dsx splicing) is conserved, even though the detailed intronic sequences of tra differ between species. This is the mechanistic conservation herein, and it underpins the extension of the present invention from the specific C. capitata tra intronic sequence exemplified to functionally equivalent sex-specifically spliced tra intronic sequences from other tephritid species.

[0027] The functional interchangeability of tephritid tra intronic sequences has previously been experimentally demonstrated. In Davydova S., Liu J., Kandul N. P. et al. (“Next-generation genetic sexing strain establishment in the agricultural pest Ceratitis capitata”, Scientific Reports 13, 19866 (2023)), two SEPARATOR constructs were engineered in C. capitata using either the endogenous C. capitata tra intronic sequence or the heterologous Anastrephaludens tra intronic sequence. Both constructs mediated fully penetrant, sex-specific splicing of the reporter and enabled accurate sex-sorting in C. capitata, thereby confirming that tra intronic sequences from different tephritid genera can function in a cross-species context despite primary-sequence divergence. It is well known that the sex-determination pathway is highly conserved across the tephritid family. As such, the sex-sorting system of the present invention is applicable across the tephritid family, advantageously in tephritid pests for which pre-existing methods for sexing do not exist.

[0028] The present invention provides a method of sex-sorting a plurality of insects based on sexspecific gene expression, the method comprising:

[0029] (a) generating an exogenous nucleic acid molecule comprising an endogenous sexspecific splicing module;

[0030] (b) delivering the exogenous nucleic acid molecule into an insect from the plurality of insects, wherein the endogenous sex-specific splicing module is introduced into a selectable marker gene within the genome of the insect by using a gene-editing agent;

[0031] (c) detecting sex-specific gene expression of the selectable marker gene; and

[0032] (d) sorting the insect from the plurality of insects based on the detecting of the sex-specific gene expression in step (c),

[0033] (e) repeating steps (b)-(d) for the plurality of insects and thereby sex-sorting the plurality of insects based on sex-specific gene expression.

[0034] Suitably, the exogenous nucleic acid molecule comprises a promoter region.

[0035] Suitably, the promoter region comprises an Opie2 promoter.

[0036] Suitably, the endogenous sex-specific splicing module comprises an endogenous sex-specific intronic sequence.

[0037] Suitably, the endogenous sex-specific intronic sequence is an endogenous transformer (tra) intronic sequence.

[0038] Suitably, the endogenous transformer (tra) intronic sequence comprises a nucleic acid sequence of SEQ ID NO: 1.

[0039] Suitably, the endogenous sex-specific intronic sequence is an endogenous doublesex (dsx) intronic sequence.Suitably, the endogenous doublesex (dsx) intronic sequence comprises a nucleic acid sequence of SEQ ID NO: 4.

[0040] Suitably, the selectable marker gene is the white pupae (wp) gene.

[0041] Suitably, the gene-editing agent comprises CRISPR / Cas9 components.

[0042] Suitably, the exogenous nucleic acid molecule is delivered into the insect at the embryo stage of development of the insect.

[0043] Suitably, the insect is sorted as male based on the expression of the selectable marker gene. Suitably, the insect is sorted as female based on the expression of the selectable marker gene. Suitably, the insect is part of the Tephritidae family.

[0044] Suitably, the insect is part of the Anastrepha species, preferably Anastrepha ludens.

[0045] Suitably, the insect is a Ceratitis capitata (Mediterranean fruit fly).

[0046] Throughout the description and claims of this specification, the words “comprise” and “contain” and variations of them mean “including but not limited to”, and they are not intended to (and do not) exclude other moieties, additives, components, integers or steps.

[0047] Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

[0048] Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith.

[0049] Various aspects of the invention are described in further detail below.

[0050] Brief description of the Figures

[0051] Embodiments of the invention are further described hereinafter with reference to the accompanying drawings, in which:

[0052] Figure 1 shows the design behind the cisgenic IMPERIAL strain. (A) A simplified diagram showcasing the Imperial strain generation and its underlaying mechanism. The knock-in,mediated via homology-directed repair was performed into the Benakeion wild-type strain. Due to the presence of premature stop codons in the male-specific exons, the males are phenotypically white-pupaed, whilst in females, gene rescue occurs resulting in a brownpupae phenotype (E1-E4, Exons 1-4; LHA, left homology arm; MFS, Major Facilitator Superfamily; RHA, right homology arm; tra, transformer, wp, white pupae). (B) A graphic summary of Imperial strain establishment via outcrosses to the irradiation-generated homozygous recessive white pupae mutant (wp- / -) strain (KI, knock-in).

[0053] Figure 2 shows characterisation of the cisgenic IMPERIAL sexing strain. (A) Stack graphs displaying pupal colour and adult phenotypes in IMPERIAL and VIENNA 8 strains for five consecutive generations (F2-F6). Chi-squared test significance levels are indicated as follows: p < 0.05 = *, p < 0.01 = **, p < 0.001 = ***. (B) Bar charts showing egg-adult survival of the Imperial strain compared to both its parental wild-type Benakeion, and VIENNA 8 strains, completed in biological triplicates. Egg-adult survival was measured using 5-hour collections of eggs and their subsequent hatching rates, hatched larval-pupal recovery rates, and pupal-adult recovery rates. Bar levels represent mean values, whilst individual replicate values are shown with dots. Dunn's test significance levels are indicated as follows: p < 0.05 = *, p < 0.01 = **. (C) Survival curves (Kaplan-Meier) of adult males and females from IMPERIAL, VIENNA 8 and wild-type Benakeion strains. The 95% confidence intervals are displayed using pale shading for each test group. (D) Proportion of eclosing males and females from IMPERIAL, VIENNA 8 and wild-type Benakeion strains measured daily from age-matched triplicate 24-hour egg collections. Dots represent mean values of the replicates and standard error is indicated using whiskers. (A-D) were constructed in RStudio.

[0054] Figure 3 shows that white pupae is spliced sex-specifically in the IMPERIAL strain. (A) The diagram showing the white pupae gene in the genome of the transformer (tra) intronic sequence knock-in strain with forward and reverse primers labelled as F and R, accordingly (Table 5). (B) The annotated electrophoresis gel of the PCR products using primers from (A). The PCR was performed on genomic and complementary DNA templates from wild-type and Imperial adults. The DNA ladder and the negative control were run in the first and tenth wells, respectively.

[0055] Figure 4 shows white pupae genotyping for homozygous IMPERIAL strain generation. The diagrams depict the genotyping strategy to distinguish the three possible alleles, used at every generation from G2 until G7.

[0056] Figure 5 shows doublesex- based male-specific SEPARATOR strain performance. (A) A schematic representation of the male-specific Sexing Element Produced by Alternative RNA-splicing of a Transgenic Observable Reporter (SEPARATOR) (795Q) construct containing a truncated Ceratitis capitata doublesex (Ccdsx) intronic sequence fragment. (B) Representative images of the homozygous 795Q-harbouring flies (795Q-S1) alongside a wildtype (WT) control during development (bp, base pairs; Ex, exon; F Ex, female-specific exon; M Ex, male-specific exon; pBac, piggyBac).

[0057] Figure 6 shows fitness attributes of the male-specific SEPARATOR strains. (A-E) Bar charts depicting the survival of eggs laid within a 5-hour period at the following developmental checkpoints: (A) egg laying counts, (B) egg hatching, (C) hatched larval-pupal, (D) pupal-adult and (E) total egg-adult recovery rates. (A-E) Parental crosses were set up with 10 male and 20 female homozygous siblings (795Q-S1, -s2 and -w1) in three biological replicates, alongside equivalent wild-type (WT) controls. Bar levels and dots represent mean triplicate values and raw values of each replicate, respectively. Dunn’s test significance levels for comparisons with WT are indicated as follows: p < 0.05 = *, p < 0.01 = **. (F) A stack graph showcasing the distributions of homozygous 795Q-S1, -s2 and -w1 populations by fluorescence and sex. No DsRed+ / GFP+females or DsRed- / GFP+males were identified (n = 1,462). All chi-squared test significance levels exceeded the p-value of 0.05. (G) Kaplan-Meier survival curves of the homozygous males and females from 795Q-harbouring strains (795Q-s1, -s2, -w1) with age-matched WT controls.

[0058] Figure 7 shows Oxford Nanopore genome sequencing of the white pupae genomic site. Diagrams depicting the nanopore sequencing reads (top grey) aligning to the white pupae genomic location (dark grey) with the tra intronic sequence inserted in the IMPERIAL strain.

[0059] Figure 8 shows RNA sequencing alignments to the wp genomic locus. A zoomed-out genome browser view of the white pupae genomic locus and gene structure (dark grey bars on bottom). RNAseq reads were aligned (light grey bars) for the female samples (27023- 27025) and the male samples (27026-27028). The inserted tra intronic sequence is indicated in dotted grey box.

[0060] Figure 9 shows Medfly RNAseq Clustering and Principal Component Analysis.

[0061] Figure 10 shows statistical analysis of adult longevity and eclosion times by strain and sex via Cox PH models. (Cl = confidence interval; HR = hazard ratio; WT = wild-type).

[0062] The patent, scientific and technical literature referred to herein establish knowledge that was available to those skilled in the art at the time of filing. The entire disclosures of the issued patents, published and pending patent applications, and other publications that are cited herein are hereby incorporated by reference to the same extent as if each was specifically andindividually indicated to be incorporated by reference. In the case of any inconsistencies, the present disclosure will prevail.

[0063] Various aspects of the invention are described in further detail below.

[0064] Detailed Description

[0065] The present invention provides a method of sex-sorting a plurality of insects based on sexspecific gene expression.

[0066] As used herein, “gene expression’’ refers to the biosynthesis or production of a gene product. Gene expression includes the processes of transcription and / or translation to produce the gene product. A gene product may be a protein product or an RNA product. Typically, the gene product is a functional molecule, preferably a functional protein.

[0067] As used herein, the term “sex-specific gene expression” refers to the differential expression of genes and the production of their corresponding proteins in a sex-specific manner. For example, either a male insect or a female insect may express a gene and the other sex may not.

[0068] In one aspect, the sex-specific gene expression generates a cisgenic genetic sexing strain (GSS). As used herein, “cisgenesis” or “cisgenic” refers to genetic modification of an insect, insect cell, or insect genome in which all components (e.g., promoter, donor nucleic acid, selection gene) have only insect origins (i.e., no non- insect origin components are used). In one aspect, a modified tephritid insect, tephritid insect cell, ortephritid insect genome provided is cisgenic.

[0069] As used herein, the term “sex-specific gene expression system” refers to a gene to be expressed together with any genes and DNA sequences which are required for expression of said gene to be expressed, wherein the gene is differentially expressed in a sex specific manner. In one example, the sex-specific gene expression system comprises a sex-specific splicing module, that is spliced differentially in males than females, and a selectable marker gene. Preferably, the sex-specific splicing module is spliced differentially in male insects than female insects. Suitably, the sex-specific splicing module may be introduced into a selectable marker gene within the genome of the insect to form the sex-specific gene expression system. Suitably, the sex-specific gene expression system is endogenous. Suitably, the endogenous sex-specific splicing module is introduced into an endogenous selectable marker gene within the genome of the insect to form the endogenous sex-specific gene expression system. Inone example, the sex-specific gene expression system is female-specific. In another example, the sex-specific gene expression system is male-specific.

[0070] As used herein, the term “exogenous” or “non-endogenous” can be used interchangeably and refer to a substance which is not found naturally in the host organism and / or which is not found in a host organism in its natural habitat, or in its normal environmental conditions, but can be introduced into a host cell by one or more genetic, biochemical or other methods.

[0071] As used herein, the term “endogenous” or “non-exogenous” can be used interchangeably and refer to a substance that is normally present in a particular cell at a particular developmental stage under particular environmental conditions. Non-limiting examples of an endogenous substance, for example, may be a selectable marker gene, transcription factor or enzyme or any other type of naturally expressed gene or protein.

[0072] As used herein “nucleic acid sequence”, “polynucleotide”, “nucleic acid” and “nucleic acid molecule” are used interchangeably to refer to an oligonucleotide sequence or polynucleotide sequence. The nucleotide sequence may be of genomic, synthetic or recombinant origin, and may be double-stranded or single-stranded (representing the sense or antisense strand). The term "nucleotide sequence" includes genomic DNA, cDNA, synthetic DNA, and RNA (e.g. mRNA) and analogs of the DNA or RNA generated, e.g., by the use of nucleotide analogs. Unless otherwise indicated, nucleic acid molecules are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. It is to be understood that this invention is not limited to the particular methodology, protocols, and reagents described, as these may vary, depending upon the context they are used by those of skill in the art.

[0073] As used herein, the term “sterile insect technique (SIT)” refers to a biological method of insect control in which a plurality of sterilized insects is released into the wild to reduce mating between fertile wild counterparts.

[0074] As used herein, the term “phenotypic stability” refers to the inherited tendency to maintain the same phenotype. Phenotypic stability can be measured at least using the methods provided in Example 1.2. As used herein, the term “improved phenotypic stability” refers to fully penetrant, generation-stable pupal colour dimorphism and more consistent 1:1 sex ratios across multiple generations.

[0075] As used herein, the term “general fitness” refers to insect survival during development and upon adulthood, and pupal eclosion time. General fitness can be measured at least using the methods provided in Example 1.4. As used herein, the term “improved general fitness” refersto higher egg-to-adult survival rates, increased adult longevity, and reduced developmental discrepancy between the sexes.

[0076] As used herein, the term “translocation-induced semi-sterility” refers to the disruption of meiosis due to chromosome translocation, resulting in aneuploidy and thus reduced fertility i.e., semi-sterility. The present invention advantageously does not use translocation-induced semi-sterility, thereby providing genetically simple and homozygous architecture that facilitates colony maintenance and quality control.

[0077] Generating

[0078] The present invention provides a method of sex-sorting a plurality of insects based on sexspecific gene expression, the method comprising:

[0079] (a) generating an exogenous nucleic acid molecule comprising an endogenous sexspecific splicing module.

[0080] As used herein, the term “exogenous nucleic acid” or “non-endogenous nucleic acid” can be used interchangeably and refer to a nucleic acid which is not found naturally in the host organism but can be introduced into a host cell by one or more genetic, biochemical or other methods. In one example, the exogenous nucleic acid molecule may comprise a heterologous-coding sequence. In one example, the exogenous nucleic acid may comprise an endogenous sex-specific splicing module and a gene editing agent.

[0081] As used herein, the term “heterologous” refers to a nucleotide or polypeptide sequence that is not found in the native nucleic acid or protein, respectively. For example, in a chimeric Cas9 / Csn1 protein, the RNA-binding domain of a naturally-occurring bacterial Cas9 / Csn1 polypeptide (or a variant thereof) may be fused to a heterologous polypeptide sequence (i.e. a polypeptide sequence from a protein other than Cas9 / Csn1 or a polypeptide sequence from another organism). The heterologous polypeptide sequence may exhibit an activity (e.g., enzymatic activity) that will also be exhibited by the chimeric Cas9 / Csn1 protein (e.g., methyltransferase activity, acetyltransferase activity, kinase activity, ubiquitinating activity, etc.). A heterologous nucleic acid sequence may be linked to a naturally-occurring nucleic acid sequence (or a variant thereof) (e.g., by genetic engineering) to generate a chimeric nucleotide sequence encoding a chimeric polypeptide. As another example, in a fusion variant Cas9 site-directed polypeptide, a variant Cas9 site-directed polypeptide may be fused to a heterologous polypeptide (i.e. a polypeptide other than Cas9), which exhibits an activity that will also be exhibited by the fusion variant Cas9 site-directed polypeptide. A heterologous nucleic acid sequence may be linked to a variant Cas9 site-directed polypeptide (e.g., by geneticengineering) to generate a nucleotide sequence encoding a fusion variant Cas9 site-directed polypeptide.

[0082] Suitably, the exogenous nucleic acid molecule comprises a promoter region. As used herein, the term “promoter” or “promoter sequence" refers a DNA region that determines the initiation site of transcription of a gene and directly regulates the frequency of transcription, and is a base sequence to which RNA polymerase usually binds to initiate transcription. In one example, the promoter region comprises an Opie2 promoter.

[0083] The term “Opie2 promoter” refers to the OplE2 (Opie2) immediate-early promoter derived from an Orgyia pseudotsugata baculovirus, which is widely used in insect expression systems as a strong constitutive promoter.

[0084] A nucleic acid molecule, such as a plasmid containing a gene of interest and an associated gene-editing component, may be generated using standard molecular assembly principles. In some embodiments, the plasmid backbone is selected to include replication, maintenance, or selection features appropriate for the intended host system, and one or more nucleic acid sequences — such as coding regions, regulatory elements, or gene-editing modules — are incorporated into the backbone through established recombinant nucleic acid construction methodologies. The resulting construct may include promoters, guide sequences, or other regulatory motifs arranged to enable controlled activity of the encoded elements when introduced into a suitable biological context. The assembled plasmid can be validated by non-destructive analytical methods to confirm incorporation and orientation of the desired sequences and may be maintained or propagated using conventional nucleic-acid-handling systems that preserve its structural integrity and functional configuration.

[0085] In some embodiments, the exogenous nucleic acid molecule is generated by standard, routine molecular cloning steps: the promoter, sex-specific intronic module and selectable marker are PCR-amplified or synthesised, and assembled into a chosen plasmid.

[0086] “Splicing” is the cellular process of RNA splicing, where introns are removed from a pre-mRNA molecule and the exons are joined together to produce a mature mRNA molecule.

[0087] As used herein, the term “splicing module” refers to a polynucleotide comprising an intronic sequence that undergoes differential splicing (e.g., stage-specific, sex-specific, tissuespecific, germline-specific etc. splicing) and thus creates a different transcript depending on the particular context. The splicing module may be incorporated into a vector and introduced into an insect.As used herein, the term “intronic sequence” refers to a nucleic acid sequence associated with a gene, wherein the sequence, together with a spliceosome, mediates alternative splicing of a RNA product of said gene. The term “intronic sequence” may encompass endogenous equivalents. As used herein, the term “intronic sequence” refers to a nucleic acid sequence that may contain multiple introns that join multiple exons to form a polypeptide encoding nucleic acid. Preferably, the intronic sequence, together with the spliceosome, mediates splicing of an RNA transcript of the associated gene (pre-mRNA) to produce an mRNA coding for a functional protein and mediates alternative splicing of said RNA transcript to produce at least one alternative mRNA coding for a non-functional protein in its endogenous locus.

[0088] In other words, as used herein, the term “intronic sequence” (including the tra and dsx modules) refers to a nucleic acid region that participates in pre-mRNA splicing. In many embodiments of the present invention, the “intronic sequence” forms part of a sex-specific alternative splicing module. The “intronic sequence” comprises at least one splice donor site and one splice acceptor site (and optionally one or more branch points and / or internal exons); is removed, in whole or in part, from the precursor transcript in at least one sex-specific splice isoform; and is sufficient, when inserted into a heterologous coding sequence, to confer a sex-specific splicing pattern on that transcript. The term “intronic sequence” includes full-length introns, truncated introns, and intron-containing fragments that may encompass one or more short exonic segments flanking or embedded within the intron, provided that the resulting module retains its sex-specific splicing behaviour.

[0089] The spliceosome is a protein-RNA complex comprising proteins and small nuclear ribonucleoproteins (snRNPs). The spliceosome comprises U1, U2, U4, U5 and U6 snRNPs. As used herein, the term “exon” refers to the sequence of DNA that is present in the final, mature messenger RNA transcript. In other words, an exon is not spliced out of the messenger RNA by the spliceosome.

[0090] As used herein, the term "intron" refers to a gene region provided as an intervening sequence that is present in DNA and included in a primary transcript, but not included in the final functional mature RNA, and removed by splicing. Introns typically consist of the following features (given here as the sense DNA sequence 5' to 3'); in RNA thymine (T) will be replaced by uracil (U)):

[0091] a. 5' end (known as the splice “donor”): GT (or possibly GC)

[0092] b. 3' end (known as the splice “acceptor”): AGc. Upstream / 5' of the acceptor (known as the “branch point”): A-polypyrimidine tract, i.e. AYYYYY... Yn

[0093] The terminal nucleotides of exons immediately adjacent to the 5' intronic splice “donor” and the 3' intronic splice “acceptor” are typically G. In one example, the sex-specific splicing module is immediately adjacent, in the 3' direction, the start codon, so that the G of the ATG is 5' to the start (5' end) of the sex-specific splicing module. This may be advantageous as it allows the G of the ATG start codon to be the 5' G flanking sequence to the sex-specific splicing module. Alternatively, the sex-specific splicing module is 3' to the start codon but within 10,000 exonic bp, 9,000 exonic bp, 8,000 exonic bp, 7,000 exonic bp, 6,000 exonic bp, 5,000 exonic bp, 4,000 exonic bp, exonic 3,000 bp, exonic 2000, bp, or 1000 exonic bp, preferably 500 exonic bp, preferably 300 exonic bp, preferably 200 exonic bp, preferably 150 exonic bp, preferably 100 exonic bp, more preferably 75 exonic bp, more preferably 50 exonic bp, more preferably 30 exonic bp, more preferably 20 exonic bp, and most preferably 10 or even 5, 4, 3, 2, or 1 exonic bp. Preferably, branch points are included in each sex-specific intronic sequence, as described above. A branch point is the sequence to which the splice donor is initially joined which shows that splicing occurs in two stages, in which the 5' exon is separated and then is joined to the 3' exon.

[0094] The sequences provided can tolerate some sequence variation and still splice correctly. There are a few nucleotides known to be important. These are the ones required for all splicing. The initial GU and the final AG of the intron are particularly important and therefore preferred, as discussed elsewhere, though ~5% of introns start GC instead. This consensus sequence is preferred, although it applies to all splicing, not specifically to alternative splicing.

[0095] As used herein, the term “sex-specific splicing module” refers to a polynucleotide comprising a sex-specific intronic sequence which undergoes differential splicing in a sex-specific manner and thus creates a different transcript in females than males. The sex-specific splicing module may be incorporated into a vector and introduced into an insect. The sex-specific splicing module is spliced in a sex-specific manner such that the endogenous selectable marker gene is expressed in a sex-specific manner. In one example, the sex-specific splicing module is endogenous.

[0096] As used herein, the term “endogenous sex-specific splicing module” refers to a sex-specific splicing module as defined herein that consists of endogenous elements, as defined herein, and does not contain exogenous elements. In one example, the endogenous sex-specific splicing module regulates the alternative splicing by means of both intronic and exonic nucleotides.Y1

[0097] It will be understood that in alternative splicing, sequences may be intronic under some circumstances (i.e., in some alternative splicing variants where introns are spliced out), but exonic under other. In another example, the endogenous sex-specific splicing module may be an endogenous sex-specific intronic sequence. In other words, it is preferred that said endogenous sex-specific splicing module is substantially derived from polynucleotides that form part of an intron and are thus excised from the primary transcript by splicing, such that these nucleotides are not retained in the mature mRNA sequence. Exonic sequences may be involved in the mediation of the control of alternative splicing, but it is preferred that at least some intronic sequences are involved in the mediation of the alternative splicing. The endogenous sex-specific splicing module may be removed from the pre-RNA, by splicing, or retained so as to encode a fusion protein of at least a portion of the selectable marker gene to be differentially expressed. The fusion protein may be a truncated version of the full-length protein of the selectable marker gene to be differentially expressed. The fusion protein may be a non-functional protein of the selectable marker gene to be differentially expressed. Preferably, the endogenous sex-specific splicing module does not result in a frameshift in the splice variant produced. Preferably, this is a splice variant encoding a full-length functional protein. In one example, the endogenous sex-specific splicing module may be retained so as to encode a fusion protein of at least a portion of the selectable marker gene to be differentially expressed by female-specific splicing. In one example, the endogenous sex-specific splicing module may be retained so as to encode a fusion protein of at least a portion of the selectable marker gene to be differentially expressed by male-specific splicing. In one example, the endogenous sex-specific splicing module may be removed from the pre-RNA, by femalespecific splicing. In one example, the endogenous sex-specific splicing module may be removed from the pre-RNA, by male-specific splicing.

[0098] Interaction of the endogenous sex-specific splicing module with cellular splicing machinery, e.g., the spliceosome, leads to or mediates the removal of a series of, preferably, at least 50 consecutive nucleotides from the endogenous selectable marker gene and ligation (splicing) together of nucleotide sequences that were consecutive in the primary transcript. Said series of at least 50 consecutive nucleotides comprises an endogenous intronic sequence comprised within the sex-specific splicing module. This mediation acts in a sex-specific, preferably, female-specific, manner such that equivalent primary transcripts in different sexes, and optionally also in different stages, tissue types, etc., tend to remove introns of different size or sequence, or in some cases may remove an intron in one case but not another. In another example, interaction of the endogenous sex-specific splicing module with cellular splicing machinery, e.g., the spliceosome, leads to or mediates the incorporation of aseries of, preferably, at least 50 consecutive nucleotides of the endogenous sex-specific intronic sequence and ligation (splicing) together of nucleotide sequences that were not consecutive in the selectable marker gene transcript (because they, or their complement if the antisense sequence is considered, were not consecutive in the original template sequence from which the primary transcript was transcribed). Said series of at least 50 consecutive nucleotides comprises an endogenous intronic sequence or portion thereof comprised within the sex-specific splicing module. This phenomenon, the removal of introns of different size or sequence in different circumstances, or the differential removal of introns of a given size or sequence, in different circumstances, is known as alternative splicing. Alternative splicing is a well-known phenomenon in nature, and many instances are known.

[0099] Where mediation of alternative splicing is sex-specific, it is preferred that the splice variant encoding a functional protein to be expressed in an organism is the F1 splice variant, i.e., a splice variant where the F denotes it is found only or predominantly in females, although this is not essential.

[0100] When exonic nucleotides are to be removed, then these must be removed in multiples of three (entire codons), if it is desired to avoid to avoid a frameshift, but as a single nucleotide or multiples of two (that are not also multiples of three) if it is desired to induce a frameshift. It will be appreciated that if only one or certain multiples of two nucleotides are removed, then this could lead to a completely different protein sequence being encoded at or around the splice junction of the mRNA.

[0101] In one example, sequences are included in a hybrid or recombinant sequence which are derived from naturally occurring endogenous intronic sequences which are themselves subject to alternative splicing, in their native or original context. Therefore, an intronic sequence may be considered as one that comprises an intron in at least one alternative splicing variant of the natural analogue. Thus, sequences corresponding to single contiguous stretches of naturally occurring intronic sequence are envisioned, but also hybrids of such sequences, including hybrids from two different naturally occurring intronic sequences, and also sequences with deletions or insertions relative to single contiguous stretches of naturally occurring intronic sequence, and hybrids thereof. Said sequences derived from naturally occurring intronic sequences may themselves be associated, in the invention, with sequences not themselves part of any naturally occurring intron. If such sequences are transcribed, and preferably retained in the mature RNA in at least one splice variant, they may then be considered exonic.It will also be appreciated that reference to a “frame shift” could also refer to the direct coding of a stop codon, which is also likely to lead to a non-functioning protein as would a disruption of the spliced mRNA sequence caused by insertion or deletion of nucleotides. Production from different splice variants of two or more different proteins or polypeptide sequences of differential function is also envisioned, in addition to the production of two or more different proteins or polypeptide sequences of which one or more has no predicted or discernable function. Also envisioned is the production from different splice variants of two or more different proteins or polypeptide sequences of similar function, but differing subcellular location, stability or capacity to bind to or associate with other proteins or nucleic acids. In one example, the frame shift refers to the direct coding of a stop codon within the tra intronic sequence.

[0102] Preferred examples of this include a modified dsx intronic sequence. In this instance, it may be preferable to delete, as done in Example 2, amounts from alternatively spliced intronic sequences, e.g., 90% or more of an intronic sequence in some cases, whilst still retaining the alternative splicing function. Thus, whilst large deletions are envisioned, it is also envisaged that smaller, e.g., even single nucleotide insertions, substitutions or deletions are also preferred.

[0103] Suitably, the endogenous sex-specific splicing module provided herein comprises an endogenous sex-specific intronic sequence. In one example, the endogenous sex-specific splicing module comprises an endogenous transformer (tra) intronic sequence. In one example, the endogenous sex-specific splicing module comprises an endogenous doublesex (dsx) intronic sequence. In one example, the endogenous sex-specific splicing module comprises a nucleic acid sequence of SEQ ID NO: 1. In one example, the endogenous sexspecific splicing module comprises a nucleic acid sequence of SEQ ID NO: 4. In one example, the endogenous sex-specific splicing module consists of an endogenous sex-specific intronic sequence. In one example, the endogenous sex-specific splicing module consists of an endogenous transformer (tra) intronic sequence. In one example, the endogenous sexspecific splicing module consists of an endogenous doublesex (dsx) intronic sequence. In one example, the endogenous sex-specific splicing module consists of a nucleic acid sequence of SEQ ID NO: 1. In one example, the endogenous sex-specific splicing module consists of a nucleic acid sequence of SEQ ID NO: 4.

[0104] As used herein, the term “endogenous sex-specific intronic sequence” refers to a sex-specific intronic sequence as defined herein that is endogenous, as defined herein, and is not exogenous, as defined herein. In one example, the endogenous sex-specific intronicsequence provides for sufficient female-specificity of the expression of the selectable marker gene. In another example, the endogenous sex-specific intronic sequence provides for sufficient male-specificity of the expression of the selectable marker gene. In the present invention, the endogenous sex-specific intronic sequence comprises at least one splice acceptor site and at least one splice donor site. The number of donor and acceptor sites may vary, depending on the number of segments of sequence that are to be spliced together. As mentioned above, in the present invention, the manner or mechanism of alternative splicing is sex-specific, preferably female-specific, and any suitable endogenous sex-specific intronic sequence may be used. Suitably, the endogenous sex-specific intronic sequence is an endogenous transformer (tra) intronic sequence. Suitably, the endogenous transformer (tra) intronic sequence comprises a nucleic acid sequence of SEQ ID NO: 1. The Ceratitis capitata transformer (tra) intronic sequence was first described by Pane et al. (2002, Development 129:3715-3725). In insects, the transformer (tra) protein exhibits sexspecific expression patterns. In particular, tra is predominantly expressed in females and functions as a regulator of alternative splicing, thereby enabling sex-specific expression of a coding sequence. This mechanism facilitates sex-specific differential protein production such that a protein is expressed exclusively or at substantially higher levels in females compared to males, or alternatively, expressed exclusively or at substantially higher levels in males compared to females. The mechanism for achieving this sex-specific alternative splicing mediated by the tra protein is known and is discussed, for instance, in Pane et al. (2002).

[0105] It will be appreciated that homologues of the Ceratitis capitata tra intronic sequence from the transformer gene exist in other species, and these can be easily identified in said species and also in their various genera. Thus, when reference is made to tra it will be appreciated that this also relates to its endogenous equivalents or tra homologues in other species. Thus, in some embodiments each of the alternative splicing mechanisms is independently derived from the Ceratitis capitata tra intronic sequence or from another ortholog or homolog. In some embodiments, the ortholog or homologue is from an arthropod, such as an insect of the order Diptera, such as a tephritid.

[0106] The term “tra intronic sequence” is used herein in a functional sense to denote a sex-specifically spliced intronic sequence from a transformer (tra) gene or its ortholog / homologue in a given species.For cisgenic embodiments, the tra intronic sequence is endogenous to the host insect, i.e. it is derived from the tra ortholog present in the genome of that species, so that the exogenous nucleic acid molecule consists exclusively of sequences that are native to the host.

[0107] The endogenous transformer {tra) intronic sequence is spliced in a sex-specific manner such that the endogenous selectable marker gene is expressed in a sex-specific manner. In one example, the endogenous transformer {tra) intronic sequence is spliced in a sex-specific manner such that the endogenous selectable marker gene (e.g. wp gene) is expressed in a female-specific manner.

[0108] The splicing pattern in tra in particular is well conserved, with those transcripts found in males containing additional exonic material relative to the female transcript, such that these transcripts do not encode full-length, functional tra protein. By contrast, the female transcript does encode full-length, functional tra protein; this transcript is substantially female-specific at most life-cycle stages, though it is speculated that very early embryos of both sexes may contain a small amount of this transcript. As used herein, "tra intronic sequence’’ refers to the sequence spliced out of the female transcript, but not the male-specific or non-sex-specific transcripts and includes the full intronic sequence with its splice sites i.e., the splice sites are not external to the intronic sequence. Thus, the version of this sequence found in the tra gene is the tra intronic sequence.

[0109] By “derived” it will be understood that, using reference to the tra intronic sequence, this refers to sequences that approximate to or replicate exactly the tra intronic sequence, as described in the art, in this case by Pane et al. (2002), supra. However, it will be appreciated that, as these are intronic sequences, that some nucleotides can be added or deleted or substituted without a substantial loss in function.

[0110] If more than one endogenous sex-specific intronic sequence is incorporated into a sex-specific gene expression system of the invention, the endogenous sex-specific intronic sequence may be the same or different.

[0111] The exact length of the endogenous sex-specific intronic sequence derived from the tra intronic sequence is not essential, provided that it is capable of mediating alternative splicing. In this regard, it is thought that around 55 to 60 nucleotides is the minimum length for a modified tra intronic sequence, although the wild type tra intronic sequence from C. capitata is in the region of 1345 nucleotides long.

[0112] Suitably, the endogenous sex-specific intronic sequence is an endogenous doublesex {dsx) intronic sequence.As used herein, doublesex (dsx) refers to a gene in both male and female insects, such as Tephritidae, that is subject to alternative splicing, specifically sex-specific splicing. Dsx is the conserved transducer of the Tephritidae sex determination cascade and comprises an intronic region (LOC101461992).

[0113] It will be appreciated that homologues of the Ceratitis capitata dsx intronic sequence from the doublesex gene exist in other species, and these can be easily identified in said species and also in their various genera. Thus, when reference is made to dsx it will be appreciated that this also relates to its endogenous equivalents or dsx homologues in other species. Thus, in some embodiments each of the alternative splicing mechanisms is independently derived from the Ceratitis capitata dsx intronic sequence or from another ortholog or homolog. In some embodiments, the ortholog or homologue is from an arthropod, such as an insect of the order Diptera, such as a tephritid.

[0114] The term “dsx intronic sequence” is used herein in a functional sense to denote a sex-specifically spliced intronic sequence from a doublesex (dsx) gene or its ortholog / homologue in a given species.

[0115] For cisgenic embodiments, the dsx intronic sequence is endogenous to the host insect, i.e. it is derived from the dsx ortholog present in the genome of that species, so that the exogenous nucleic acid molecule consists exclusively of sequences that are native to the host.

[0116] As used herein, the endogenous doublesex (dsx) intronic sequence refers to a truncated form of the dsx intronic region to 1,895 bp, encompassing three exons and two introns.

[0117] In one example, the endogenous sex-specific intronic sequence comprises at least a fragment of the doublesex (dsx) gene derived from an arthropod, such as a tephritid. In one example, the endogenous sex-specific intronic sequence comprises at least a fragment of the doublesex (dsx) gene derived from a tephritid. In one example, the dsx gene is derived from a species of the Order Diptera, such as, but not limited to those of the genus Aedes, Anopheles, Cochliomyia, Culex, Drosophila, Glossina, Lucilia, Lutzomyia, Ceratitis, Bactrocera, Anastrepha, Mayetiola, Megaselia, Musca, Phlebotomus and Rhagoletis. In some embodiments, the dsx genes are independently derived from Aedes aegypti, Anopheles spp., Anopheles gambiae, Anastrepha spp., Ceratitis capitata, Bactrocera oleae, Bactrocera dorsalis, Bactrocera zonata, Bactrocera correcta, Bactrocera tryoni, Ceratitis rosa, Cochliomyia homnivorax, Cochliomyia macellaria, Culex quinquefasciatus, Drosophila Americana, Drosophila erecta, Drosophila hydei, Drosophila mauritania, Drosophila melanogaster, Drosophila sechellia, Drosophila simulans, Drosophila virilis, Glossinamorsitans, Lucilia cuprina, Lucilia sericata, Lutzomyia longipalpis, Mayetiola destructor, Megaselia scalaris, Musca domestica, and Phlebotomus papatasi. In one example, the dsx gene is derived from Ceratitis capitata.

[0118] In one embodiment, the endogenous doublesex (dsx) intronic sequence comprises (from 5' to 3’): at least a portion of an exon 3 of dsx, preferably the entire exon, an intron 3, preferably the entire intron, exon 4, a truncated intron 4 of dsx comprising at least a 5' terminal fragment of the dsx intron 4 that contains at least a portion of the 5' end of intron 4 and a 3' fragment of the dsx intron 4 that contains at least a portion of the 3' end of intron 4, preferably wherein intron 4 is truncated to 1400 bp, at least a portion of an exon 5 of dsx, preferably the entire exon 5. Suitably, the endogenous doublesex (dsx) intronic sequence comprises a nucleic acid sequence of SEQ ID NO: 4.

[0119] The endogenous doublesex (dsx) intronic sequence is spliced in a sex-specific manner such that the endogenous selectable marker gene is expressed in a sex-specific manner. In one example, the endogenous doublesex (dsx) intronic sequence is spliced in a sex-specific manner such that the endogenous selectable marker gene (e.g. wp gene) is expressed in a male-specific manner.

[0120] As used herein, the terms “endogenous equivalents” refer to any mutant or variant of reference nucleotide or protein sequences, having substantially equivalent biological activity thereto. Preferably, the mutant or variant has at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 99%, preferably at least 99.9%, and most preferably at least 99.99% sequence identity with the reference sequences. However, it will be understood that despite the above sequence homology, certain elements, in particular the flanking nucleotides and splice branch site must be retained, for efficient functioning of the system. In other words, whilst portions may be deleted or otherwise altered, alternative splicing functionality or activity, to at least 30%, preferably 50%, preferably 70%, more preferably 90%, and most preferably 95% compared to the wild type should be retained. This could be increased compared to the wild type, as well, by suitably engineering the sites that bind alternative splicing factors or interact with the spliceosome, for instance. Endogenous equivalents preferably have identical or corresponding nucleic acid sequences and functional characteristics of the transformer intronic sequence or the double-sex intronic sequence as described herein. It is known that there is functional interchangeability of tephritid tra intronic sequences and it has been confirmed that tra intronic sequences from different tephritid genera can function in a cross-species context despite primary-sequence divergence. It is also known that there is functional interchangeability of tephritid dsx intronic sequences and it has been confirmed thatdsx intronic sequences from different tephritid genera can function in a cross-species context despite primary-sequence divergence. In one non-limiting example, functional homologues have identical or corresponding amino acid sequences and functional characteristics of the transformer (tra) intronic sequence. In another non-limiting example, functional homologues have identical or corresponding amino acid sequences and functional characteristics of the double-sex (dsx) intronic sequence.

[0121] As used herein, the term “endogenous sex-specific gene expression system” refers to a sexspecific gene expression system without exogenous elements so that only endogenous elements are used to control expression of the gene expression system. Particularly, an endogenous gene expression system does not comprise (a) heterologous coding sequences (e.g. fluorescent markers or toxic effectors) and / or (b) exogenous regulatory elements. In one example, sex-specific intronic sequences are used to control expression of the selectable marker gene. Suitably, the endogenous gene expression system comprises an endogenous sex-specific splicing module within an endogenous selectable marker gene (i.e. a selectable marker present in the genome). Suitably, an endogenous sex-specific splicing module is introduced into a selectable marker gene within the genome of an insect to form an endogenous sex-specific gene expression system.

[0122] Delivery

[0123] The present invention provides a method of sex-sorting a plurality of insects based on sexspecific gene expression, the method comprising:

[0124] (a) generating an exogenous nucleic acid molecule comprising an endogenous sexspecific splicing module;

[0125] (b) delivering the exogenous nucleic acid molecule into an insect from the plurality of insects.

[0126] Suitably, the exogenous nucleic acid molecule is delivered into the insect at the embryo stage of development of the insect.

[0127] “Delivering” refers to the process by which a compound, molecule, or nucleic acid is brought into contact with, introduced into, or made available to a target cell, tissue, organism, or environment in a manner that allows it to exert its intended function. The term encompasses any means (biological, chemical, or physical) by which the material is transported or transferred to the target.The present method includes introducing a nucleic acid molecule into an insect during its embryonic stage using a biological delivery system. In certain embodiments, the nucleic acid is associated with a viral, bacterial, or symbiont-derived vector capable of interacting with early developmental tissues. The vector may incorporate regulatory elements suitable for activity in embryonic cells, allowing the nucleic acid to be maintained, expressed, or otherwise functionally engaged within the developing organism. Delivery during the embryonic period enables contact with undifferentiated or rapidly dividing cells, facilitating broad distribution throughout subsequent developmental stages.

[0128] In some embodiments, an insect-specific viral vector may be employed to convey the nucleic acid into the embryo. Such vectors can include naturally occurring insect-infecting viruses that are adapted to enter embryonic tissues or extracellular environments surrounding the embryo. The nucleic acid may be integrated into the viral genome or contained in an associated construct compatible with viral replication mechanisms. Introduction of these viral particles to the embryo allows the vector to access permissive embryonic cells and transfer the nucleic acid in a manner that supports early-stage activity or inheritance.

[0129] In additional embodiments, the nucleic acid may be delivered using engineered endosymbiotic microorganisms capable of associating with insect embryos. Certain insect species exhibit vertical transmission of symbionts, and such symbionts may be modified to carry nucleic acid sequences of interest. When introduced into or allowed to associate with the embryo, the symbiont can enter or remain within embryonic tissues and provide the nucleic acid either directly or through expression of biomolecules that interact with host developmental processes. This approach leverages natural host-symbiont relationships to achieve species-specific delivery.

[0130] Further embodiments relate to particulate or formulation-based systems capable of contacting or surrounding the insect embryo and facilitating stable association of the nucleic acid with early-stage cells. These systems may include lipid-based carriers, polymeric matrices, or other biocompatible materials designed to protect the nucleic acid and allow passive uptake by the embryo. Such formulations may be adapted to developmental characteristics of the species, enabling delivery without reliance on physical manipulation of the embryo while maintaining compatibility with normal development.

[0131] In other embodiments, the nucleic acid may be provided using intermediary biological vectors capable of interacting with or depositing materials into the embryo during natural reproductive or developmental cycles. These intermediaries may include parasitoid-associated systems, reproductive tract microbiota, or other organisms or structures that interface with embryos aspart of their life cycle. By associating the nucleic acid with such intermediaries, targeted transmission into embryonic tissues can be achieved in a species- and stage-specific manner. In the exemplified embodiments, the exogenous nucleic acid molecule is delivered to the insect by direct microinjection into early embryos (pre-blastoderm eggs) of the target species. The nucleic acid is carried on standard plasmid vectors, such as: a piggyBac donor plasmid containing the promoter-sex-specific intron-marker cassette, combined with a separate helper plasmid encoding piggyBac transposase; and / or a CRISPR / HDR donor plasmid bearing homology arms flanking the endogenous target locus, used together with a Cas9-gRNA ribonucleoprotein complex. These plasmid vectors are propagated in E. coli, purified using conventional plasmid preparation methods, and injected into the embryo using standard microinjection procedures that are routine for tephritid genetic transformation.

[0132] As used herein, the term “insect” means a small animal with three body parts, six legs, and usually antennae and wings. The terms “insect” or “pest" can be used interchangeably. “Insect” may refer to an insect of the order Diptera. In one example, the insect is a species of the Order Diptera, such as, but not limited to those of the genus Aedes, Anopheles, Cochliomyia, Culex, Drosophila, Glossina, Lucilia, Lutzomyia, Ceratitis, Bactrocera, Anastrepha, Mayetiola, Megaselia, Musca, Phlebotomus and Rhagoletis. In some examples, the insect is a Aedes aegypti, Anopheles spp., Anopheles gambiae, Anastrepha spp., Ceratitis capitata, Bactrocera oleae, Bactrocera dorsalis, Bactrocera zonata, Bactrocera correcta, Bactrocera tryoni, Ceratitis rosa, Cochliomyia homnivorax, Cochliomyia macellaria, Culex quinquefasciatus, Drosophila Americana, Drosophila erecta, Drosophila hydei, Drosophila mauritania, Drosophila melanogaster, Drosophila sechellia, Drosophila simulans, Drosophila virilis, Glossina morsitans, Lucilia cuprina, Lucilia sericata, Lutzomyia longipalpis, Mayetiola destructor, Megaselia scalaris, Musca domestica, and Phlebotomus papatasi. In one example, the insect is part of the Tephritidae family. In one example, the insect is part of the Anastrepha species, preferably Anastrepha ludens. In one example, the insect is a Ceratitis capitata (Mediterranean fruit fly).

[0133] As used herein, the term “plurality of insects” refers to at least two insects from the same species. Suitably, the “plurality of insects” may be at least three insects, at least four insects, at least five insects, at least ten insects, at least twenty insects, at least 50 insects, at least 100 insects, at least 150 insects, at least 200 insects, at least 500 insects, at least 1000 insects, at least 10,000 insects, at least 100,000 insects. In one example, the plurality of insects are part of the Tephritidae family. In one example, the plurality of insects are part ofT1

[0134] the Anastrepha species, preferably Anastrepha ludens. In one example, the plurality of insects are Ceratitis capitata (Mediterranean fruit fly).

[0135] Gene-editing

[0136] The present invention provides a method of sex-sorting a plurality of insects based on sexspecific gene expression, the method comprising:

[0137] (a) generating an exogenous nucleic acid molecule comprising an endogenous sexspecific splicing module;

[0138] (b) delivering the exogenous nucleic acid molecule into an insect from the plurality of insects, wherein the endogenous sex-specific splicing module is introduced into a selectable marker gene within the genome of the insect by using a gene-editing agent.

[0139] As used herein, the term “introduced into’’ refers to insertion of the nucleic acid sequence of the endogenous sex-specific splicing module into a selectable marker gene within the genome of the host organism. Suitably, the endogenous sex-specific splicing module is introduced within an exon of a selectable marker gene.

[0140] In the context of the invention, the endogenous sex-specific splicing module is preferably inserted within the coding region of a selectable marker gene, most suitably within an internal exon rather than in untranslated regions. The insertion site is chosen so that in one sex-specific splice isoform, the intron (and any sex-specific exonic segments linked to it) is removed in a way that restores a continuous open reading frame, yielding a functional marker protein; and in the opposite sex-specific isoform, retention of one or more exonic segments and / or premature stop codons within the module disrupts the open reading frame and produces a non-functional protein.

[0141] Thus, the intronic module can be inserted at any position within the marker coding sequence where this frame-restoration / frame-disruption logic can be implemented, typically in the 5' or central portion of an internal exon of the selectable marker.

[0142] In the IMPERIAL strain, the endogenous C. capitata tra intronic sequence was inserted into the third coding exon of the white pupae (wp) gene (LOC101451947), which encodes part of the conserved Major Facilitator Superfamily (MFS) transporter domain. More specifically, the intron module was integrated at the CRISPR / Cas9 cleavage site defined by the gRNA-Ccwp (5'-GAACGTAAAGCGATTGGCGAGGG-3', SEQ ID NO: 17, including the PAM), i.e. at the Cas9 cut three nucleotides upstream of the NGG PAM within exon 3. This position lies in theMFS transmembrane domain-encoding region of wp, and the precise genomic coordinates and flanking sequences of the insertion are defined by the left and right homology arms. In the female splice isoform, removal of the tra intronic sequence restores an essentially intact wp open reading frame across exon 3, rescuing the MFS transporter function and yielding brown pupae. In the male splice isoform, sex-specific retention of additional exonic / stop-containing segments within the tra module disrupts the wp coding sequence at this same site within the MFS domain, resulting in a non-functional transporter and hence the white pupae phenotype.

[0143] As used herein, the term “selectable marker gene” refers to a gene endogenous to the host organism (e.g. insect) that comprises a coding sequence for a protein or polypeptide, i.e., at least one exon, and preferably two or more exons, capable of encoding a polypeptide, such as a protein or fragment thereof and that has an identifiable phenotype.

[0144] In the endogenous sex-specific gene expression system, the different exons of the selectable marker gene are differentially spliced together in a sex-specific manner to provide alternative mRNAs. Preferably, said alternative spliced mRNAs have different coding potential, i.e., encode different proteins or polypeptide sequences. Thus, the expression of the coding sequence is regulated by alternative splicing, preferably sex-specific splicing. Non-limiting examples of selectable marker genes include the white pupae (wp) gene, the yellow (y) gene, the ebony (e) gene, and the temperature-sensitive lethal (tsl) gene.

[0145] The white pupae (wp) gene is a recessive gene in fruit flies (Tephritidae) that when expressed shows a brown pupae phenotype (wild-type). In other words, when the white pupae (wp) gene is expressed to produce a functional protein, a brown phenotype is shown. Mutations in the wp gene cause the pupae to be white instead of the normal brown and hence can act as a visible selectable marker. For example, the wp gene has been extensively used for genetic pest control to create genetic sexing strains (GSS) where females express the white pupae trait, while males remain brown, making it easy to separate sexes for sterile insect technique (SIT) programs.

[0146] The Ceratitis capitata white pupae (wp) gene is defined by its NCBI Gene locus, LOC101451947, which encodes a predicted Major Facilitator Superfamily (MFS) transporter located on chromosome 5 and functionally validated as wp in Ward et al. 2021 (Nat Commun 12:491).In one example, the endogenous sex-specific splicing module of the invention causes the endogenous intronic sequence comprised within the endogenous sex-specific splicing module to be spliced out (in a sex-specific manner) from the selectable marker gene transcript, or from pre-mRNA of the selectable marker gene transcript such that selectable marker gene expression results in a functional protein. In another example, the endogenous sex-specific splicing module of the invention causes sex-specific splicing that results in retention of the endogenous intronic sequence comprised within the endogenous sex-specific splicing module in the selectable marker gene transcript, or in pre-mRNA of the selectable marker gene transcript such that selectable marker gene expression results in a non-functional protein (e.g. truncated protein). Suitably the endogenous sex-specific splicing module may be comprised within exons. In one example, insertion of the endogenous sex-specific splicing module, comprising an endogenous transformer (tra) sex-specific intronic sequence, into the endogenous white pupae (wp) locus converts wp into a female-specific marker.

[0147] In one example, the endogenous sex-specific tra intronic sequence is introduced into the wp gene within the genome of the insect. In one example, the endogenous sex-specific tra intronic sequence is introduced into the MFS domain of the wp gene within the genome of the insect. In one example, the endogenous sex-specific tra intronic sequence is directly “introduced into” the wp locus by homology-directed repair (HDR)-dependent knock-in by CRISPR / Cas9. In one example, the endogenous sex-specific dsx intronic sequence is introduced into the wp gene within the genome of the insect. In one example, the endogenous sex-specific dsx intronic sequence is introduced into the MFS domain of the wp gene within the genome of the insect. In one example, the endogenous sex-specific dsx intronic sequence is directly “introduced into” the wp locus by homology-directed repair (HDR)-dependent knock-in by CRISPR / Cas9.

[0148] Following is a description of various non-limiting examples of methods and gene-editing agents that can be used according to specific embodiments of the present disclosure.

[0149] As used herein, the term “gene-editing agent” refers to engineered endonucleases or artificially engineered nucleases which typically cut and create specific double-stranded breaks (DSBs) at a desired location(s) in the genome, which are then repaired by cellular endogenous processes such as, homologous recombination (HR) or non-homologous endjoining (NHEJ). In one example, the gene-editing agent repairs the double-stranded break by homology-directed repair (HDR).As used herein, the term “recombination” refers to a process of exchange of genetic information between two polynucleotides.

[0150] As used herein, the term “homology-directed repair (HDR)” refers to the specialized form of DNA repair that takes place, for example, during repair of double-strand breaks in cells. This process requires nucleotide sequence homology, uses a “donor” molecule to template repair a “target” molecule (i.e., the one that experienced the double-strand break), and leads to the transfer of genetic information from the donor to the target. Homology-directed repair may result in an alteration of the sequence of the target molecule (e.g., insertion, deletion, mutation), if the donor polynucleotide differs from the target molecule and part or all of the sequence of the donor polynucleotide is incorporated into the target DNA. In some embodiments, the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide integrates into the target DNA.

[0151] As used herein, the term “non-homologous end joining (NHEJ)” refers to the repair of doublestrand breaks in DNA by direct ligation of the break ends to one another without the need for a homologous template (in contrast to homology-directed repair, which requires a homologous sequence to guide repair). NHEJ often results in the loss (deletion) of nucleotide sequence near the site of the double-strand break. NHEJ directly joins the DNA ends in a doublestranded break (DSB) with or without minimal ends trimming, while HR utilizes a homologous donor sequence as a template (i.e. the sister chromatid formed during S-phase) for regenerating / copying the missing DNA sequence at the break site. In order to introduce specific nucleotide modifications to the genomic DNA, a donor DNA repair template containing the desired sequence must be present during HR (exogenously provided single stranded or double stranded DNA).

[0152] Genome editing cannot be performed using traditional restriction endonucleases since most restriction enzymes recognize a few base pairs on the DNA as their target and these sequences often will be found in many locations across the genome resulting in multiple cuts which are not limited to a desired location. To overcome this challenge and create site-specific single- or doublestranded breaks (DSBs), several distinct classes of nucleases have been discovered and bioengineered to date. These include the CRISPR / Cas9 system.

[0153] In one example, the gene-editing agent comprises CRISPR / Cas9 components.

[0154] As used herein, “CRISPR / Cas9 components”, “CRISPR-Cas system”, and “CRISPR” are used interchangeably and encompass all CRISPR and Cas9 variants. Bacteria and archea containendogenous RNA-based adaptive immune systems that can degrade nucleic acids of invading phages and plasmids. These systems consist of clustered regularly interspaced short palindromic repeat (CRISPR) nucleotide sequences that produce RNA components and CRISPR associated (Cas) genes that encode protein components. The CRISPR RNAs (crRNAs) contain short stretches of homology to the DNA of specific viruses and plasmids and act as guides to direct Cas nucleases to degrade the complementary nucleic acids of the corresponding pathogen. Studies of the type II CRISPR / Cas system of Streptococcus pyogenes have shown that three components form an RNA / protein complex and together are sufficient for sequence-specific nuclease activity: the Cas9 nuclease, a crRNA containing base pairs of homology to the target sequence, and a trans-activating crRNA (tracrRNA) (Jinek et al. Science (2012) 337: 816-821).

[0155] It was further demonstrated that a synthetic chimeric guide RNA (sgRNA) composed of a fusion between crRNA and tracrRNA could direct Cas9 to cleave DNA targets that are complementary to the crRNA in vitro. It was also demonstrated that transient expression of Cas9 in conjunction with synthetic sgRNAs can be used to produce targeted double-stranded breaks (DSBs) in a variety of different species (Cho et al., 2013; Cong et al., 2013; DiCarlo et al., 2013; Hwang et al., 2013a, b; Jinek et al., 2013; Mali et al., 2013).

[0156] The CRISPR / Cas system for genome editing contains two distinct components: a sgRNA and an endonuclease e.g. Cas9.

[0157] The sgRNA (also referred to herein as short guide RNA (sgRNA)) is typically a 20- nucleotide sequence encoding a combination of the target homologous sequence (crRNA) and the endogenous bacterial RNA that links the crRNA to the Cas9 nuclease (tracrRNA) in a single chimeric transcript. The gRNA / Cas9 complex is recruited to the target sequence by the basepairing between the sgRNA sequence and the complement genomic DNA. For successful binding of Cas9, the genomic target sequence must also contain the correct Protospacer Adjacent Motif (PAM) sequence immediately following the target sequence. The binding of the gRNA / Cas9 complex localizes the Cas9 to the genomic target sequence so that the Cas9 can cut both strands of the DNA causing a double-strand break (DSB). The double stranded breaks (DSBs) produced by CRISPR / Cas can undergo homologous recombination or NHEJ and are susceptible to specific sequence modification during DNA repair.

[0158] The Cas9 nuclease has two functional domains: RuvC and HNH, each cutting a different DNA strand. When both of these domains are active, the Cas9 causes double strand breaks (DSBs) in the genomic DNA.A significant advantage of CRISPR / Cas is that the high efficiency of this system is coupled with the ability to easily create synthetic sgRNAs. This creates a system that can be readily modified to target modifications at different genomic sites and / or to target different modifications at the same site. Additionally, protocols have been established which enable simultaneous targeting of multiple genes. The majority of cells carrying the mutation present biallelic mutations in the targeted genes. However, apparent flexibility in the base-pairing interactions between the sgRNA sequence and the genomic DNA target sequence allows imperfect matches to the target sequence to be cut by Cas9.

[0159] Modified versions of the Cas9 enzyme containing a single inactive catalytic domain, either RuvC- or HNH-, are called 'nickases'. With only one active nuclease domain, the Cas9 nickase cuts only one strand of the target DNA, creating a single-strand break or 'nick'. A single-strand break, or nick, is mostly repaired by single strand break repair mechanism involving proteins such as but not only, PARP (sensor) and XRCC1 / LIG III complex (ligation). If a single strand break (SSB) is generated by topoisomerase I poisons or by drugs that trap PARP1 on naturally occurring SSBs then these could persist and when the cell enters into S-phase and the replication fork encounter such SSBs they will become single ended DSBs which can only be repaired by HR. However, two proximal, opposite strand nicks introduced by a Cas9 nickase are treated as a double strand break, in what is often referred to as a 'double nick' CRISPR system. A double-nick, which is basically non-parallel DSB, can be repaired like other DSBs by HR or NHEJ depending on the desired effect on the gene target and the presence of a donor sequence and the cell cycle stage (HR is of much lower abundance and can only occur in S and G2 stages of the cell cycle). Thus, if specificity and reduced off-target effects are crucial, using the Cas9 nickase to create a double-nick by designing two sgRNAs with target sequences in close proximity and on opposite strands of the genomic DNA would decrease off-target effect as either sgRNA alone will result in nicks that are not likely to change the genomic DNA, even though these events are not impossible.

[0160] Additional variants of Cas9 which may be used by some embodiments of the invention include, but are not limited to, CasX and Cpf1. CasX enzymes comprise a distinct family of RNA-guided genome editors which are smaller in size compared to Cas9 and are found in bacteria (which is typically not found in humans), hence, are less likely to provoke the immune system / response in a human. Also, CasX utilizes a different PAM motif compared to Cas9 and therefore can be used to target sequences in which Cas9 PAM motifs are not found [see Liu JJ et al., Nature. (2019) 566(7743):218-223.]. Cpfl, also referred to as Cas12a, is especially advantageous for editing AT rich regions in which Cas9 PAMs (NGG) are much less abundant[see Li T et al., Biotechnol Adv. (2019) 37(1):21-27; Murugan K et al., Mol Cell. (2017) 68(1):15-25],

[0161] In one example, the CRISPR system may be fused with various effector domains, such as DNA cleavage domains. The DNA cleavage domain can be obtained from any endonuclease or exonuclease. Non-limiting examples of endonucleases from which a DNA cleavage domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases (see, for example, New England Biolabs Catalog or Belfort et al. (1997) Nucleic Acids Res.). In exemplary embodiments, the cleavage domain of the CRISPR system is a Fokl endonuclease domain or a modified Fokl endonuclease domain. In addition, the use of Homing Endonucleases (HE) is another alternative. Hes are small proteins (< 300 amino acids) found in bacteria, archaea, and in unicellular eukaryotes. A distinguishing characteristic of Hes is that they recognize relatively long sequences (14-40 bp) compared to other sitespecific endonucleases such as restriction enzymes (4-8 bp). Hes have been historically categorized by small conserved amino acid motifs. At least five such families have been identified: LAGLIDADG; GIY-YIG; HNH; His-Cys Box and PD-(D / E)xK, which are related to EdxHD enzymes and are considered by some as a separate family. At a structural level, the HNH and His-Cys Box share a common fold (designated BBa-metal) as do the PD-(D / E)xK and EdxHD enzymes. The catalytic and DNA recognition strategies for each of the families vary and lend themselves to different degrees to engineering fora variety of applications. See e g. Methods Mol Biol. (2014) 1123:1-26. Exemplary Homing Endonucleases which may be used according to some embodiments of the invention include, without being limited to, l-Crel, I-Tevl, l-Hmul, l-Ppol and l-Ssp68031.

[0162] Other versions of CRISPR which may be used according to some embodiments of the invention include genome editing using components from CRISPR systems together with other enzymes to directly introduce a nucleic acid molecule into cellular DNA or RNA.

[0163] In one example, the gene-editing agent is a DNA or RNA-editing agent.

[0164] Exemplary enzymes include, but are not limited to, DNA methyltransferases, methylases, acetyltransferases. More specifically, exemplary enzymes include e.g. DNA (cytosine-5)-methyltransferase 3A (DNMT3a), Histone acetyltransferase p300, Ten-eleven translocation methylcytosine dioxygenase 1 (TET1), Lysine (K)-specific demethylase 1A (LSD1) and Calcium and integrin binding protein 1 (CIB1).In addition to the catalytically disabled nuclease, the DNA or RNA editing agents of the invention may also comprise a nucleobase deaminase enzyme and / or a DNA glycosylase inhibitor.

[0165] In one example, the DNA or RNA editing agents comprise BEI (APOBEC1-XTEN-dCas9), BE2 (APOBEC1-XTEN-dCas9-UGI) or BE3 (APOBEC-XTENdCas9(A840H)-UGI), along with sgRNA. APOBEC1 is a deaminase full length or catalytically active fragment, XTEN is a protein linker, UGI is uracil DNA glycosylase inhibitor to prevent the subsequent U: G mismatch from being repaired back to a C: G base pair and dCas9 (A840H) is a nickase in which the dCas9 was reverted to restore the catalytic activity of the HNH domain which nicks only the non-edited strand, simulating newly synthesized DNA and leading to the desired U: A product. Additional enzymes which can be used for base editing according to some embodiments of the invention are specified in Rees and Liu, Nature Reviews Genetics (2018) 19:770-788, incorporated herein by reference in its entirety.

[0166] There are a number of publicly available tools available to help choose and / or design target sequences as well as lists of bioinformatically determined unique sgRNAs for different genes in different species such as, but not limited to, the Feng Zhang lab's Target Finder, the Michael Boutros lab's Target Finder (E-CRISP), the RGEN Tools: Cas-OFFinder, the CasFinder: Flexible algorithm for identifying specific Cas9 targets in genomes and the CRISPR Optimal Target Finder.

[0167] In order to use the CRISPR system, both sgRNA and a Cas endonuclease (e.g. Cas9, Cpfl, CasX) should be expressed or present (e.g., as a ribonucleoprotein complex) in a target cell. The insertion vector can contain both cassettes on a single plasmid or the cassettes are expressed from two separate plasmids. CRISPR plasmids are commercially available such as the px330 plasmid from Addgene (75 Sidney St, Suite 550A Cambridge, MA 02139). Use of clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)-guide RNA technology and a Cas endonuclease for modifying plant genomes are also at least disclosed by Svitashevet al., 2015, Plant Physiology, 169 (2): 931-945; Kumar and Jain, 2015, J Exp Bot 66: 47-57; and in U. S. Patent Application Publication No. 20150082478, which is specifically incorporated herein by reference in its entirety. Cas endonucleases that can be used to effect DNA editing with sgRNA include, but are not limited to, Cas9, Cpfl, CasX (Zetsche et al., 2015, Cell. 163(3)759-71), C2c1, C2c2, and C2c3 (Shmakov et al., Mol Cell.

[0168] 2015 Nov 5;60(3):385-97).As used herein, the term “vector” refers to a nucleic acid sequence capable of transporting another nucleic acid sequence to which it has been operably linked. The vector can be capable of autonomous replication or it can integrate into a host DNA. The vector may include restriction enzyme sites for insertion of recombinant DNA and may include one or more selectable markers or suicide genes. The vector can be a nucleic acid sequence in the form of a plasmid, a bacteriophage or a cosmid.

[0169] As used herein, the term "cell" is interchangeable with “host cell”, “modified cell”, or “insect cell” and includes any cell into which the exogenous nucleic acid or vector described herein may be introduced. Once an exogenous nucleic acid or vector has been introduced into the cell, it may be referred to as a “modified cell” herein. Once the exogenous nucleic acid or vector, is introduced into the host cell or the insect cell, the resultant modified cell should be capable of sex-specific gene expression of the selectable marker gene.

[0170] " Hit and run" or "in-out"- involves a two-step recombination procedure. In the first step, an insertion-type vector containing a dual positive / negative selectable marker cassette is used to introduce the endogenous sex-specific splicing module alteration. The insertion vector contains a single continuous region of homology to the targeted locus and is modified to carry the endogenous sex-specific splicing module. This targeting construct is linearized with a restriction enzyme at a one site within the region of homology, introduced into the cells, and positive selection is performed to isolate homologous recombination mediated events. The DNA carrying the homologous sequence can be provided as a plasmid, single or double stranded oligo. These homologous recombinants contain a local duplication that is separated by intervening vector sequence, including the selection cassette. In the second step, targeted clones are subjected to negative selection to identify cells that have lost the selection cassette via intra-chromosomal recombination between the duplicated sequences. The local recombination event removes the duplication and, depending on the site of recombination, the allele either retains the introduced endogenous sex-specific splicing module or reverts to wild type. The end result is the introduction of the the endogenous sex-specific splicing module without the retention of any exogenous sequences.

[0171] The "double-replacement" or "tag and exchange" strategy - involves a two-step selection procedure similar to the hit and run approach, but requires the use of two different targeting constructs. In the first step, a standard targeting vector with 3' and 5' homology arms is used to insert a dual positive / negative selectable cassette near the location where the mutation is to be introduced. After the system components have been introduced to the cell and positive selection applied, HR mediated events could be identified. Next, a second targeting vectorthat contains a region of homology with the the endogenous sex-specific splicing module is introduced into targeted clones, and negative selection is applied to remove the selection cassette and introduce the endogenous sex-specific splicing module. The final allele contains the the endogenous sex-specific splicing module while eliminating unwanted exogenous sequences.

[0172] Suitably, the gene-editing agent is a DNA-editing agent.

[0173] Suitably, the gene-editing agent comprises a DNA targeting module (e.g., gRNA).

[0174] Suitably, the gene-editing agent comprises an endonuclease.

[0175] Suitably, the gene-editing agent comprises a nuclease (e.g. an endonuclease) and a DNA targeting module (e.g., sgRNA).

[0176] Suitably, the gene-editing agent is CRISPR / endonuclease.

[0177] Suitably, the gene-editing agent is CRISPR / Cas, e.g. sgRNA and Cas9.

[0178] Suitably, the gene-editing agent is a CRISPR / Cas9 as disclosed, for example, in WO 2019 / 058255.

[0179] Suitably, the endogenous sex-specific splicing module is introduced into a selectable marker gene within the genome of the insect by CRISPR / Cas9-mediated homology-directed repair. Suitably, the gene-editing agent comprises CRISPR / Cas9 components.

[0180] Suitably, the gene-editing agent is linked to a reporter for monitoring expression in a cell (e.g. eukaryotic cell).

[0181] Suitably, the reporter is a fluorescent reporter protein.

[0182] As used herein, the term "a fluorescent protein" refers to a polypeptide that emits fluorescence and is typically detectable by flow cytometry, microscopy or any fluorescent imaging system, therefore can be used as a basis for selection of cells expressing such a protein. Examples of fluorescent proteins that can be used as reporters are, without being limited to, the Green Fluorescent Protein (GFP), the Blue Fluorescent Protein (BFP) and the red fluorescent proteins (e.g. dsRed, mCherry, RFP). A non-limiting list of fluorescent or other reporters includes proteins detectable by luminescence (e.g. luciferase) or colorimetric assay (e.g. GUS). According to a specific embodiment, the fluorescent reporter is a red fluorescent protein (e.g. dsRed, mCherry, RFP) or GFP. A review of new classes of fluorescent proteins andapplications can be found in Trends in Biochemical Sciences [Rodriguez, Erik A.; Campbell, Robert E.; Lin, John Y.; Lin, Michael Z.; Miyawaki, Atsushi; Palmer, Amy E.; Shu, Xiaokun; Zhang, Jin; Tsien, Roger Y. " The Growing and Glowing Toolbox of Fluorescent and Photoactive Proteins". Trends in Biochemical Sciences. Doi: 10.1016 / j.tibs.2016.09.010], Suitably, the reporter is an endogenous gene of an insect.

[0183] Suitably, the reporter is the white pupae (wp) gene of Ceratitis capitata. In the IMPERIAL cisgenic GSS, the endogenous wp locus is edited to include a sex-specifically spliced intronic module, and the resulting male / female-specific pupal colour phenotypes are used as a direct, visually scorable read-out of the underlying genotype. In these embodiments, wp functions as both a selectable marker and an endogenous reporter gene.

[0184] Suitably, the reporter is an antibiotic selection marker. Examples of antibiotic selection markers that can be used as reporters are, without being limited to, neomycin phosphotransferase II (nptll) and hygromycin phosphotransferase (hpt). Additional marker genes which can be used in accordance with the present teachings include, but are not limited to, gentamycin acetyltransferase (accC3) resistance and bleomycin and phleomycin resistance genes.

[0185] It will be appreciated that the enzyme NPTII inactivates by phosphorylation a number of aminoglycoside antibiotics such as kanamycin, neomycin, geneticin (or G418) and paromomycin. Of these, kanamycin, neomycin and paromomycin are used in a diverse range of plant species, and G418 is routinely used for selection of transformed mammalian cells. According to another embodiment, the reporter is a toxic selection marker. An exemplary toxic selection marker that can be used as a reporter is, without being limited to, allyl alcohol selection using the Alcohol dehydrogenase (ADH1) gene. ADH1, comprising a group of dehydrogenase enzymes which catalyse the interconversion between alcohols and aldehydes or ketones with the concomitant reduction of NAD+ or NADP+, breaks down alcoholic toxic substances within tissues. Insects harbouring reduced ADH1 expression exhibit increase tolerance to allyl alcohol. Accordingly, insects with reduced ADHI are resistant to the toxic effect of allyl alcohol.

[0186] Regardless of the gene-editing agent used, the method of the invention is employed such that the endogenous sex-specific splicing module is introduced into a selectable marker gene within the genome of the insect.

[0187] DetectionThe present invention provides a method of sex-sorting a plurality of insects based on sexspecific gene expression, the method comprising:

[0188] (a) generating an exogenous nucleic acid molecule comprising an endogenous sex-specific splicing module;

[0189] (b) delivering the exogenous nucleic acid molecule into an insect from the plurality of insects, wherein the endogenous sex-specific splicing module is introduced into a selectable marker gene within the genome of the insect by using a gene-editing agent; and

[0190] (c) detecting sex-specific gene expression of the selectable marker gene.

[0191] As used herein, “detecting of the sex-specific gene expression of the selectable marker gene” refers to “identifying” the phenotype of the selectable marker gene.

[0192] In one example, “detecting of the sex-specific gene expression of the selectable marker gene” refers to detecting the pupae colour, preferably wherein male pupae are white and the female pupae are brown.

[0193] The phenotype of an insect, including but not limited to pupal colour, may be detected using visual or automated assessment methods. In some embodiments, the phenotype is evaluated by direct visual inspection, where an observer identifies the colour category or shade exhibited by the pupa. In other embodiments, detection may be performed using computer-based systems such as imaging devices, machine-learning classifiers, or colour-analysis software capable of distinguishing phenotypic variations from digital images. Additional sensing approaches, including optical, spectrometric, or other non-contact measurement techniques, may also be employed to characterise the pupal colour in an objective and reproducible manner.

[0194] In the exemplified embodiments, the “detecting” step is carried out in a very simple, practical manner. Pupae are collected on a white tray or Petri dish under uniform illumination and are scored by direct visual inspection, where an operator classifies each pupa as “white" or “brown” (or equivalent colour categories) and separates them manually (e.g. using forceps or by tipping them into different collection containers). In larger-scale settings, the same colour difference can be detected by camera-based systems positioned over a moving belt, with a simple software threshold on pupal colour (e.g. light vs dark) used to trigger mechanical sorting into separate output streams.The present invention provides a method of sex-sorting a plurality of insects based on sexspecific gene expression, the method comprising:

[0195] (a) generating an exogenous nucleic acid molecule comprising an endogenous sex-specific splicing module;

[0196] (b) delivering the exogenous nucleic acid molecule into an insect from the plurality of insects, wherein the endogenous sex-specific splicing module is introduced into a selectable marker gene within the genome of the insect by using a gene-editing agent;

[0197] (c) detecting sex-specific gene expression of the selectable marker gene; and

[0198] (d) sorting the insect from the plurality of insects based on the detecting of the sex-specific gene expression in step (c).

[0199] As used herein, the term “sex-sorting” refers to the separation of male insects from female insects.

[0200] As used herein, “sorting” the insect from the plurality of insects refers to the separation of the insect from the plurality of insects based on the sex of the insect. Due to sex-specific expression of the selectable marker gene in the insect of step (c), the insect has a detectable sex-specific phenotype i.e., the phenotype differs between male and female insects. Thereby, the sex of the insect can be identified based on the detectable sex-specific phenotype. In one example, the expression of the selectable marker gene in step (c) is male-specific. In one example, the expression of the selectable marker gene in step (c) is female-specific. In one example, “sorting” the insect from the plurality of insects refers to separating white pupae from brown pupae, preferably wherein male pupae are white and female pupae are brown.

[0201] Suitably, the method comprises sorting the insect from the plurality of insects as male based on the expression of the selectable marker gene in step (c).

[0202] Suitably, the method comprises sorting the insect from the plurality of insects as female based on the expression of the selectable marker gene in step (c).

[0203] The present invention provides a method of sex-sorting a plurality of insects based on sexspecific gene expression, the method comprising:

[0204] (a) generating an exogenous nucleic acid molecule comprising an endogenous sexspecific splicing module;(b) delivering the exogenous nucleic acid molecule into an insect from the plurality of insects, wherein the endogenous sex-specific splicing module is introduced into a selectable marker gene within the genome of the insect by using a gene-editing agent;

[0205] (c) detecting sex-specific gene expression of the selectable marker gene; and

[0206] (d) sorting the insect from the plurality of insects based on the detecting of the sex-specific gene expression in step (c),

[0207] (e) repeating steps (b)-(d) for the plurality of insects and thereby sex-sorting the plurality of insects based on sex-specific gene expression.

[0208] The repeating step (e) may be repeated for each insect in the plurality of insects so that the entire plurality of insects has been sex-sorted based on sex-specific gene expression.

[0209] Throughout the description and claims of this specification, the words “comprise” and “contain” and variations of them mean “including but not limited to”, and they are not intended to (and do not) exclude other moieties, additives, components, integers or steps.

[0210] Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

[0211] Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith.

[0212] T erms such as "a", "an" and "the" are not intended to refer to only a singular entity, but include the general class of which a specific example may be used for illustration. The terminology herein is used to describe specific embodiments of the invention, but their usage does not delimit the invention, except as outlined in the claims.

[0213] Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. For example, Singleton and Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d Ed., John Wiley and Sons, NY (1994); and Hale and Marham, The Harper Collins Dictionary of Biology, Harper Perennial, NY (1991) provide those of skill in the art with a general dictionary of many of the terms used in the invention.Although any methods and materials similar or equivalent to those described herein find use in the practice of the present invention, the preferred methods and materials are described herein.

[0214] Accordingly, the terms defined immediately below are more fully described by reference to the Specification as a whole. Also, as used herein, the singular terms "a", "an," and "the" include the plural reference unless the context clearly indicates otherwise.

[0215] Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. It is to be understood that this invention is not limited to the particular methodology, protocols, and reagents described, as these may vary, depending upon the context they are used by those of skill in the art.

[0216] Aspects of the invention are demonstrated by the following non-limiting examples.

[0217] EXAMPLES A Novel CRISPR-Engineered Medfly Genetic Sexing Strain

[0218] Serafima Davydova1$, Junru Liu2$, Nikolay P. Kandul2, Igor Antoshechkin3, Jonathan Mann1, W. Evan Braswell4, Omar S. Akbari2*, Angela Meccariello1*

[0219] 1. Department of Life Sciences, Imperial College London, London, SW7 2AZ, United Kingdom 2. School of Biological Sciences, Department of Cell and Developmental Biology, University of California, San Diego, La Jolla, CA 92093, United States of America

[0220] 3. Division of Biology and Biological Engineering, California Institute of Technology, Pasadena, CA 91125, United States of America

[0221] 4. USDA APHIS PPQ Science & Technology Insect Management and Molecular Diagnostic Laboratory, 22675 North Moorefield Road, Edinburg, Texas, 78541, United States of America * Corresponding authors: Angela Meccariello, Ph. D. Email: a.meccariello@imperial.ac.uk

[0222]

[0223] Omar S. Akbari, Ph. D. Email: oakbari@ucsd.edu

[0224] $ These authors contributed equally: Serafima Davydova and Junru Liu

[0225] Running title: Engineered Genetic Sexing Strain for the Medfly

[0226] Keywords: CRISPR / Cas9; Sex Specific Alternative Splicing; Genetic Sexing Strains, MedflyAbstract

[0227] Insect pest population control via sterile insect technique severely benefits from separation by sex priorto release. To simplify this process, traditional genetics has been deployed to develop genetic sexing strains (GSSs) for several disease vectors and agricultural pests of vast economic significance, although very few are applied in the field due to associated fitness costs and instability. Despite industry-wide circulation, thecurrently utilised Ceratitis capitata (Mediterranean fruit fly or medfly) GSS VIENNA 8 similarly has its drawbacks. In this study we generated a cisgenic GSS using CRISPR / Cas9-mediated homology-directed repair knock-in for pupal colour-based sex-sorting using C. capitata as our model. To achieve this, we used the sex-specifically spliced intron of the endogenous transformer gene, which was inserted into the pupal colouration-implicated white pupae. Characterisation of the herein generated IMPERIAL cisgenic GSS against wild-type and VIENNA 8 strains showcased its phenotypic stability and overall good fitness. Transferal of this novel approach to related global fruit fly pests may aid more efficient and economically suitable agricultural pest control.

[0228] Main text

[0229] Genetic sexing strains (GSSs) have been developed in multiple insect species of economic significance to allow easier male and female separation necessary for efficient population control. Specifically, GSSs are used within sterile insect technique (SIT) programmes which work via frequent releases of sterilised insects into the wild for temporary population control (Hendrichs & Robinson, 2009; Knippling, 1955; Krafsur, 1998). Male-only releases, aided by GSS implementation, strongly succour in released fly dispersal and their mating frequency with wild females, thus enhancing SIT success (Franz et al., 2021; Hendrichs et al., 1995; Rendon et al., 2004). Vast efforts have focused on GSS generation in mosquito disease vectors and agricultural fruit fly pests to avoid labour-intensive sex-sorting by eliminating the females from the released population early on in the life cycle (Isasawin et al., 2014; McCombs & Saul, 1995; McInnis et al., 2004; Meza et al., 2020; Ramírez-Santos et al., 2021; Robinson, 2002).

[0230] The traditional GSS approach requires two key attributes: a selectable marker and a Y-chromosome or male-determining locus linkage from which it needs to be expressed (Franz et al., 2021). A primary example of a traditional GSS is the VIENNA 8 strain developed in the tephritid fruit fly pest Ceratitis capitata (Mediterranean fruit fly or medfly) which increasingly threatens the agricultural industry with its expanding global distribution and vast host range (Papadopoulos, 2014; White & Elsom-Harris, 1992). VIENNA 8, similarly to its predecessor VIENNA 7, relies on a radiation-induced simultaneous translocation of wp gene and temperature sensitive lethal (tsf) genes onto the Y-chromosome which are involved in pupalcolouration and heat tolerance respectively (Sollazzo et al., 2023; Ward et al., 2021). Whilst the former, wp, has been characterised in multiple tephritids, the latter, tsl, remains to be identified in C. capitata and its relatives. As the VIENNA 8 strain has a wp and tsl doublemutant background, the white-pupaed females die upon embryonic heat exposure, whilst the brown-pupaed males persevere into adulthood (Franz et al., 2021; Sollazzo et al., 2022). Across the Tephritidae family, such traditional GSSs have been successfully developed in multiple species, although only those developed in capitata and Anastrepha ludens have been implemented on a SIT facility scale (Caceres, 2002; Quintero-Fong et al., 2018). Other traditional examples tested on a larger scale include the eye colour phenotype-dependent Aedes aegypti GSSs (Koskinioti et al., 2020).

[0231] In parallel to similar GSSs in other tephritid species, the VIENNA 8 strain is infrequently susceptible to phenotype loss via recombination which requires an extra filtering step at SIT facilities (Fisher & Caceres, 2000; Franz et al., 2021). Furthermore, they have notable reductions in fertility which creates obstacles for mass rearing (Augustinos et al., 2017; Caceres, 2002). To elevate GSS fitness, multiple transgenic approaches have been engineered for female exclusion either through a selectable phenotypic marker orfemale-specific lethality in the medfly and other fruit fly species (Buchman & Akbari, 2019; Condon et al., 2007; Davydova et al., 2023; Fu et al., 2007; Heindrich & Scott, 2000; Kandul et al., 2020; Liu et al., 2024; Ogaugwu et al., 2013; Schetelig et al., 2016; Schetelig et al., 2021; Scolari et al., 2008). Abundantly, a sex-specific intron from the transformer (tra) gene has been implemented in the medfly for female-specific transgene expression from the autosomes (Davydova et al., 2023; Fu et al., 2007; Ogaugwu et al., 2013). Most recently this was completed for female-specific fluorescence marker expression in a Sexing Element Produced by Alternative RNA-splicing of Transgenic Observable reporter (SEPARATOR) system in which both the C. capitata and newly the A. ludens tra introns were used (Davydova et al., 2023). Collectively, using the intron of tra, a mastergene of tephritid female sex determination (Pane etal., 2002; Peng etal., 2015; Schetelig et al., 2012), results in extremely robust desired phenotypes, rendering it suitable for further use in cisgenic GSSs which have not been developed previously.

[0232] To engineer a novel cisgenic GSS (CGSS) without exogenous elements, a sex-specific expression of the wp selectable marker was achieved through sex-specific splicing of the tra intron. This was attained through a homology-directed repair (HDR)-dependent knock-in of the tra intron directly into the wp locus of wild-type Benakeion medfly embryos, feasible due to recent success of CRISPR / Cas9-mediated HDR in the species (Aumann et al., 2020; Aumann et al., 2018; Meccariello et al., 2024). The knock-in construct (1167A) was engineered using the endogenous transformer (tra) intron, which was placed between thehomology arms of each approximately 700 bp in length. The anticipated outcome, similarly to SEPARATOR was female-specific gene expression, whereby males and females harbouring two copies of the fra-containing wp gene would have white and brown pupae phenotypes accordingly (Fig. 1A). As the wp mutation is recessive in nature, the knock-in strain, hereupon named IMPERIAL, was generated using backcrosses to the irradiation-generated white pupae knock-out (wp- / -) strain at GO and G1 ( g ) We briefly confirmed successful knock-in of the tra intron (wpK / + / ) in all obtained brown-pupaed G2 females using amplicon sequencing of the integration site. A homozygous wpK / +line was established at G7 (FO) after crossing sibling white-pupaed males with brown-pupaed, genotyping all parents and screening the whole

[0233]

[0234] To verify the sex-sorting suitability of the strain, phenotypic pupae colour stability and sex ratios of the IMPERIAL strain were examined alongside the existing VIENNA 8 GSS, in which males and females emerge from brown and white pupae accordingly. For five consecutive generations (F2-F6), pupae and adult phenotypes were recorded for IMPERIAL (pupae n = 4147; adult n = 4074) and VIENNA 8 (pupae n = 1386; adult n = 1227) strains in parallel, maintained under the same conditions. As anticipated, in the wpKI+ / +IMPERIAL strain all females emerged from brown pupae and all males emerged from white pupae (Fig. 2A). The reverse phenotypes were universally observed amongst individuals from the VIENNA 8 strain. Altogether, the proportion of adult females in the IMPERIAL strain (mean = 49.8%) exceeded that of the VIENNA 8 strain (mean = 37.4%). Whilst populations within every generation of the IMPERIAL strain adhered to the expected 1:1 male: female sex ratio (chi-square goodness of fit tests), the VIENNA 8 did not at F2, F4 and F5 (Fig. 2A). In sum these results confirm the phenotypic stability of the IMPERIAL strain which, dissimilarly to VIENNA 8, consistently confines to the expected 1:1 male: female sex ratio.

[0235] To better understand differences in the tra intron-dependent wp splicing in males and females of the wpKI+ / +IMPERIAL strain, we performed reverse-transcription PCR (RT-PCR) on genomic and complementary DNA templates from adult flies (Fig. 3). A single female band was amplified from the cDNA template, corresponding to a transcript with the fully spliced-out tra intron (Pane et al., 2002), which was confirmed via sequencing. Male cDNA banding entirely consisted of larger fragments from which two unique male isoforms with premature stop codons were isolated via clonal sequencing, both containing sequences of the two male-specific exons. These results are suggestive of functional White pupae protein production in females andablation of its translation in males. >

[0236]

[0237]

[0238] The IMPERIAL sexing strain was further compared to its parental wild-type Benakeion and VIENNA 8 strains in terms of general fitness, and thus suitability for larger-scale employment. First, a standard egg-adult survival assay utilising sibling crosses was conducted whereby rates of egg laying, egg hatching, hatched larvae-pupae recovery, pupae-adult recovery, and total egg-adult recovery were assessed (Fig. 2A). Kruskal-Wallis and sequential Dunn’s tests were performed as means of statistical analysis. Notably, egg production within the measured time period was significantly elevated in the IMPERIAL strain comparedto both wild-type and VIENNA 8 strains (p < 0.05*). Hatching rate in VIENNA 8 was significantly lower than in wild-type (p = 0.0036**), although insignificant reductions in the IMPERIAL strain were also observed (p = 0.0899). We recorded the highest larval-pupal survival in the IMPERIAL strain, which was significantly raised compared to VIENNA 8 (p = 0.0036**). In line with the earlier phenotypic stability experiments, the pupal-adult recovery rates were significantly lower in the VIENNA 8 strain, compared to both wild-type and IMPERIAL strains (p< 0.05*). Overall egg-adult survival was significantly reduced in VIENNA 8 when assessed against wild-type (p = 0.0127*) and IMPERIAL (p = 0.0368*) strains alike. Egg-adult survival in wild-type and IMPERIAL strains, however, was statistically similar (p = 0.3274), indicative of good fitness in the IMPERIAL strain.

[0239] We also explored adult longevity with virgin males and females restricted to separate husbandry under regular lab conditions (Fig.2C). Highest survival was observed in wild-type females, whilst the shortest longevity belonged to VIENNA 8 females. Pairwise comparisons via log-rank tests were performed between strains, and the combinations of stain and sex (Tables 1 and 2). Altogether, VIENNA 8 had significant reductions in longevity compared to both wild-type (p = 0.0022**) and IMPERIAL (p = 0.0048**) strains. Wild-type Benakeion and IMPERIAL strains with the same genetic background, on the other hand, did not have a significant difference between one another (p = 0.3920). Amongst females, significant differences were recorded for VIENNA 8 against both wild-type (p < 0.0001****) and IMPERIAL (p < 0.0001****) strains, while male comparisons between strains were statistically insignificant. These results are suggestive of comparable longevity of the males and importantly females from the IMPERIAL strain with wild-type.

[0240] Table 1 Statistical analysis of adult longevity by strain.

[0241] P-values for strain-by-strain pairwise log-rank test comparisons for adult longevity with Bonferroni corrections.

[0242]

[0243] Table 2 Statistical analysis of adult longevity by strain and sex.

[0244] P-values for pairwise log-rank test comparisons by sex and strain for adult longevity with Bonferroni corrections.

[0245]

[0246] A delay in white-pupaed female development has been documented in the VIENNA 8 strain (Cacares et al., 2023). To determine whether similar issues occur in the white-pupaed males of the IMPERIAL strain, we compared pupal eclosion times from age-matched egg collections by sex. The development times were significantly different by strain and sex (nested ANOVA, F = 178.6, p < 0.0001****) (Fig. 2D). The time for wild-type males (mean = 18.60 days) and females (mean = 18.75 days) to reach adulthood were statistically similar to IMPERIAL males (mean = 18.51 days) and females (mean = 18.59 days) (Table 3). Flies from the VIENNA 8 strain were significantly slower to eclose, with means of 20.11 and 24.00 days for males and females accordingly. Whilst there may be differences in acclimation of the VIENNA 8 to a newer laboratory environment, in comparison to the other two strains, there was a significant difference between VIENNA 8 males and females (p < 0.0001****), which is absent in both wild-type (p = 0.94854) and IMPERIAL (p = 0.99781) strains. The observed trends strongly indicate that the IMPERIAL strain does not experience a developmental discrepancy between sexes, present in the current VIENNA 8 GSS.Table 3 Statistical analysis of pupal eclosion times by strain and sex.

[0247] P-values for pairwise comparisons of post hoc T ukey HSD test after nested ANOVA by strain and sex.

[0248]

[0249] The mating preferences of females towards the IMPERIAL, Benakeion and VIENNA 8 strains were assessed through simultaneous allowing of mating between males from all three strains with females from the irradiation-generated wp- / - strain. Due to the recessive nature of the wp mutation, the father(s) were easily ‘revealed’ through pupal colour and corresponding adult phenotype screening (Table 4). The most common parentage belonged to wild-type male(s) (36.93%), followed by equal parentage by IMPERIAL male(s) (28.41%) and VIENNA 8 male(s) (28.41%). We also observed progeny with mixed strain paternity at a low frequency (6.25%). This data indicates that the pupal colour of the IMPERIAL males does not disadvantage their mating success in respect to brown-pupaed VIENNA 8 males.

[0250] Table 4 Mating preference of female towards wild-type, IMPERIAL and VIENNA 8 strains.

[0251] Males from the three tested strains were collectively released to mate with females from the recessive homozygous white pupae mutant (wp- / -) strain. Adult progeny from individual females was scored by pupal colour and corresponding adult phenotypes.Paternity Count Percentage (%) Wild-type mate(s) 65 36.93 Imperial mals(s) 50 28.41 VIENNA 8 mals(s) 50 28.41 Wild-type * Imperial male(s) 0 0

[0252] Wild-type + VIENNA 8 maie(s) 3 1.70 imperial + VIENNA 8 maie(s) 8 4.55

[0253]

[0254] Total _ _ 100

[0255] Here, we describe an entirely novel CRISPR / Cas9-generated cisgenic GSS, for the agricultural pest giant C. capitata using the wp gene involved in pupal pigmentation (Ward et al., 2021). Although multiple robust next-generation GSS approaches have been established in the medfly to date (Condon et al., 2007; Davydova et al., 2023; Fu et al., 2007; Scolari et al., 2008), the herein-established IMPERIAL strain is the first to exclusively encompass endogenous elements. Our approach uses the sex-specific intron of tra, a gene responsible for female-specific fate induction in the Tephritidae fruit fly family and beyond, making it an appealing target for cross-species application (Bopp et al., 2014, Saccone, 2022). Importantly, the Y-chromosome-independent GSS approach highlighted herein is timeeffective as it only requires comprehensible cross completion for line establishment. Via CRISPR / Cas9-mediated HDR, recently optimised in the species (Aumann et al., 2020; Aumann et al., 2018; Meccariello et al., 2024), we integrated the tra intron into the wp gene to achieve its expression in females exclusively, resulting in a brown-pupae phenotype. Due to sex-specific splicing (Fig. 3), males in the strain do not translate White pupae successfully. Specifically, this is caused by the inclusion of early termination codons upon transcription which leads to a white-pupae phenotype.

[0256] Characterisation of the IMPERIAL strain revealed that its fitness is comparative to its ancestral wild-type strain from which it was generated. This included survival during development and upon adulthood, as well as eclosion time comparison between males and females (Fig. 2). Despite statistically similar egg-adult survival, however, the IMPERIAL strain egg hatching rates was insignificantly reduced. In all abovementioned assessments the VIENNA 8 strain performance indicated greater fitness costs than in the herein generated strain, although mating competitiveness was similar between the two GSSs (Table 4). To explore the fitness of the IMPERIAL strain in further detail, and hence its suitability for SIT implementation, larger scale trials need to be performed. Among all males and females screened in the process of line characterisation in this study, no reverse phenotypes were observed, suggestive of vast line stability. Furthermore, similarly to wild-type flies, the males and females are consistently distributedin equal proportions in the IMPERIAL strain (Fig. 2A). This highlights the limited effect of the whitepupae phenotype on the male survival to adulthood in our GSS, opening a possibility for its efficient facility- based rearing. In theory, the sex-sorting of this strain can be performed at pupal developmental stage using automated machinery, already employed, and optimised at SIT capitata facilities. Thus, with its stability and cisgenic nature, our system could be an advantageous and cost-effective alternative for currently used strategies in SIT-mediated population control.

[0257] The latest reiteration of the traditional GSSs, VIENNA 8, possesses a heat sensitivity component via the tsl gene (Sollazzo et al., 2023). As its wild-type copy is expressed from the Y-chromosome in an autosomally-mutant tsl (tsl- / -) background, only males are tolerant to heat (Franz et al., 2021). To improve our system further, a heat-inducible component can be added to the IMPERIAL strain. This will additionally allow for a thorough investigation of the fitness costs in VIENNA 8 observed in this work. Once tsl locus is characterised in full, alternative iterations of the tra intron for functional male-specific splicing, or entirely different sex-specific introns (Pane et al., 2002; Saccone et al., 2008) can be used for its expression.

[0258] Supplementary materials

[0259] Materials & Methods

[0260] Plasmid design and construction

[0261] We used Gibson enzymatic assembly to build the 1167A plasmid, which contains C. capitata MFS transporter Exon 3 (LOC101451947), the tra intron and Opie2-DsRed outside the homology arms. A pre-existing plasmid containing piggyBac flanks, with an Opie2 promoter regulating dsRed, was linearized by Ndel and Kpnl to clone 1167A. The MFS transporter Exon3 was amplified into two fragments from C. capitata genomic DNA using primer pairs 1167A. C1F and c2R, as well as 1167A. C5F and c6R(Table5). The CctraF intron was amplified from 795H1 (Addgene #205482) using primer pair 1167A. C3F and c4R, then inserted inside of the MFS exon 3 coding sequence (Table 5).

[0262] Table 5 Primer summary.

[0263] Sequences of primers used for construct cloning and cisgenic strain characterisation

[0264]

[0265] C. capitata maintenance

[0266] All fly stains were reared under standard lab conditions described previously (Meccariello et al, 2021). A carrot-based diet was provided for larval development (Sollazzo etal, 2022) and a 1:1 yeast: glucose mix was given to adult flies. The Benakeion wild-type strain was supplied by the Saccone Lab (University of Naples “Federico II”), whilst irradiation-generated white pupae - / - (wp- / -) (Ward et al., 2021) and VIENNA 8 D53- strains were obtained from the FAO / IAEA Centre of Nuclear Techniques in Food and Agriculture (■q^Seibersdorfq^, Austria).

[0267] C. capitata germline transformation

[0268] Microinjections of the 1167A plasmid were performed into embryos of the wild-type Benakeion strain. The plasmid (250 ng / pl) was injected alongside a pre-assembled ribonucleoprotein (RNP) complex of Cas9 protein (200 ng / pl) (PNA Bio) and presynthesized gRNA-wp (100 ng / pl) (Synthego) (Meccariello et al., 2024).

[0269] line establishment

[0270] The cross scheme for G0-G3 line generation is summarized in Fig. 1. The injected GOs were reciprocally crossed to the characterized irradiation-generated wp- / - strain (Ward et al., 2021). The resulting G1 progeny was separated by pupal colour, and all males emerging from white pupae were backcrossed in pools to the females from the irradiation-generated wp- / - strain. AtG2, the brown pupae were isolated, and all 10 female adults from the same parental G1 cross were collectively crossed to five sibling white-pupaed males. After mating, genomic DNA (gDNA) was individually extracted from G2 brown-pupaed females using an altered phenol-chloroform protocol (Holmes & Bonner, 1973). The knock-in site was amplifiedusing Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs®) with genome-specific 1167A_F and 1167A_R primers (Table 5) designed in Geneious Prime 2023.1.2. To confirm the initial integration, the PCR products were purified via Monarch® PCR & DNA Cleanup Kit (New England Biolabs®) and analysed via Oxford Nanopore sequencing (Full Circle Labs).

[0271] Over the course of the following 4 generations (G3-G6) multiple sibling crosses were performed in parallel and the parental genotypes were verified. Hereby three possible alleles were differentiated: 1) the irradiation-generated wp- / - 2) the intron-less wp- / - with indels and 3) the tra intron knock-in (Fig, 4) For this, a multiplex 3-primer PCR was designed using a forward (1167A_F) binding upstream of the integration site, a reverse (1167A_R) downstream of the integration site and a second reverse (8kb_B_R) binding to the irradiation-generated wp- / - inserted sequence (Fig. 4).

[0272] Verification of genome integration in the homozygous strain

[0273] To verify the insertion site in the wpKI+ / +IMPERIAL strain, we conducted Oxford Nanopore genomic DNA sequencing. Genomic DNA was extracted from four knock-in adult males and four knock-in adult females using the Blood & Cell Culture DNA Midi Kit (Qiagen).

[0274] PCT tra intron splicing confirmation

[0275] In parallel, single males and females were separately collected for gDNA and RNA extractions. gDNA was extracted as detailed above. RNA was extracted via an adapted TRIzol® (Ambion)-chloroform-based protocol (Chomczynski & Mackey, 19 S). CDNA was synthesised from total RNA using Maxima H Minus First Strand cDNA Synthesis Kit with dsDNase (ThermoFisher) according to the instructions provided by the manufacturer. Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs®) was used for PCR amplification from gDNA and cDNA templates using the 1167_F_V1 splicing and 1167A_R primer pair (Table 5|. Bands amplified from cDNA of the IMPERIAL strain were purified using a Monarch® DNA Gel Extraction Kit (New England Biolabs®) and Sanger sequenced (Genewiz Inc.). Male cDNA PCR reaction was additionally subjected to Sanger sequencing post-PCR product cloning using the StrataClone PCR Cloning Kit (Agilent) whereby different isoforms were isolated.

[0276] RNA sequencing

[0277] To confirm the sex-specific expression of the wp gene, we performed Illumina RNA sequencing. Total RNA was extracted from mature wpKI+ / +adult males and females from theIMPERIAL strain in three biological replicates (six samples) using the miRNeasy Tissue / Cells Advanced Mini Kit (Qiagen), following the manufacturer’s protocol. Genomic DNA was removed using the gDNA eliminator column included with the kit. RNA integrity was testing with the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies).

[0278]

[0279] Stability assay

[0280] From G3 until G7 all pupae were separated by colour and corresponding adults were scored by sex. When the homozygosity of the IMPERIAL strain was verified at G7 (FO), alongside the VIENNA 8 strain, for 5 consecutive generations (F2-F6) eggs were collected five days after eclosion and raised under regular conditions until pupal stage of development. Brown and white pupae were then separated, and the sex of all adults from each pool was recorded. Egg-adult survival assay

[0281] Sibling crosses of 10 males and 20 females were set up in triplicates simultaneously for the IMPERIAL, VIENNA 8, and wild-type Benakeion strains. Egg numbers and their hatching rates were determined as described previously (Davydova; et al, 2023). Specifically, five days after eclosion, all eggs laid within a 5-hour period were collected and unhatched eggs were counted twice four days apart using Fiji (Abramoff et al.r2004). Pupal and adult recovery rates were determined thereafter.

[0282] Adult longevity assay

[0283] Age-matched adults from the wild-type Benakeion, IMPERIAL and VIENNA 8 D53- strains were separated by sex upon eclosion and placed into cages of 10 individuals. Three male and three female replicates were set up simultaneously for each strain; and maintained under standard conditions thereafter. Daily, dead flies were counted and removed from the cages for 30 consecutive days.

[0284] Mating-preference assay

[0285] 270 females from the irradiation-generated wp- / - strain (Ward et al., 2021) were simultaneously placed together with 45 males from each of the Benakeion, IMPERIAL and VIENNA 8 D53- strains for a total of a 1:2 male: female ratio. The flies were left to mate for four full days, after which females were separated into individual small cages. Upon oviposition, eggs were collected and reared normally until pupation. In the cases where white and brown pupae were present, they were separated by colour. Adults eclosing from both mixed and brown pupae-only collections were screened by sex.Eclosion assay

[0286] 24-hour egg collections were made from sibling crosses of 10 males and 20 females of the IMPERIAL, VIENNA 8, and wild-type Benakeion strains, set up in parallel triplicates. The offspring were reared under normal conditions until pupation, whereby IMPERIAL and VIENNA 8 pupae were sorted by colour. The eclosing adults were therein scored by sex every day.

[0287] Figure generation and statistical analyses

[0288]

[0289] Chi-squared tests were used for sex ratio and pupal colour analysis. Egg-adult survival was assessed using Kruskal-Wallis and Dunn’s tests. Longevity data was plotted and analysed using survival and survminer packages. Eclosion rates were assessed using nested ANOVA by strain, with sex added in as an extra factor. Pairwise comparisons were conducted via a post hoc Tukey HSD test thereafter. Microsoft PowerPoint and Inkscape 1.3.2 (Harrington & Engeten, 2004) were used to create construct and fly-centred diagrams.

[0290] Data availability

[0291] Complete plasmid sequence is available at Addgene.org (#218233). The raw data used for figure generation is provided in the Source data files.

[0292]

[0293] ^^Mfhe herein-generated knock-in strain is available upon request from A. M.

[0294]

[0295] Acknowledgement

[0296] This work was supported by cooperative agreements (23-8130-1007-IA and AP23PPQS& T00C108) between the United States Department of Agriculture (USDA) — Animal and Plant Health Inspection Service (APHIS) — Plant Protection and Quarantine (PPQ) and Imperial College London and University of California — San Diego, respectively. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U. S. Department of Agriculture, an equal opportunity employer. J. M. is supported by funding that was provided by the European Union’s Horizon Europe Research and Innovation Programme REACT (Grant agreement 101059523).

[0297] Competing interests

[0298] O. S. A is a founder of Agragene, Inc. and Synvect, Inc. with equity interest. N. P. K is a founder of Synvect, Inc. with equity interest. The terms of this arrangement have been reviewedand approved by the University of California, San Diego in accordance with its conflict-of-interest policies. All other authors declare no competing interests.

[0299] References

[0300] 1. Hendrichs, J. & Robinson, A. (2009) Sterile insect technique. In: Encyclopedia of insects. Elsevier. 953-957.

[0301] 2. Knipling, E. F. (1955) Possibilities of insect control or eradication through the use of sexually sterile males. Journal of Economic Entomology. 48 (4), 459-462.

[0302] 3. Krafsur, E. S. (1998) Sterile insect technique for suppressing and eradicating insect population: 55 years and counting. Journal of Agricultural Entomology. 15 (4), 303-317. 4. Franz, G., Bourtzis, K. & Caceres, C. (2021) Practical and operational genetic sexing systems based on classical genetic approaches in fruit flies, an example for other species amenable to large-scale rearing for the sterile insect technique. In: Sterile Insect Technique., CRC Press. 575-604.

[0303] 5. Hendrichs, J., Franz, G. & Rendon, P. (1995) Increased effectiveness and applicability of,the sterile insect technique through male-only releases for control of Mediterranean fruit flies during fruiting seasons. Journal of Applied Entomology. 119 (1-5), 371-377.

[0304] 6. Rendon, P., McInnis, D., Lance, D. & Stewart, J. (2004) Medfly (Diptera: Tephritidae) genetic sexing: large-scale field comparison of males-only and bisexual sterile fly releases in Guatemala. Journal of Economic Entomology. 97 (5), 1547-1553.

[0305] 7. Isasawin, S., Aketarawong, N., Lertsiri, S. & Thanaphum, S. (2014) Development of a genetic sexing strain in Bactrocera carambolae (Diptera: Tephritidae) by introgression of sex sorting components from B. dorsalis, Salaya1 strain. BMC Genetics. 15, 1-11.

[0306] 8. McCombs, S. D. & Saul, S. H. (1995) Translocation-based genetic sexing system for the oriental fruit fly (Diptera: Tephritidae) based on pupal color dimorphism. Annals of the Entomological Society of America. 88 (5), 695-698.

[0307] 9. McInnis, D. O., Tam, S., Lim, R., Komatsu, J., Kurashima, R. & Albrecht, C. (2004) Development of a pupal color-based genetic sexing strain of the melon fly, Bactrocera cucurbitae (Coquillett) (Diptera: Tephritidae). Annals of the Entomological Society of America.

[0308] 97 (5), 1026-1033.10. Meza, J. S., Bourtzis, K., Zacharopoulou, A., Gariou-Papalexiou, A. & Caceres, C. 2020) Development and characterization of a pupal-colour based genetic sexing strain of Anastrepha fraterculus sp. 1 (Diptera: Tephritidae). BMC Genetics. 21 (2), 1-9.

[0309] 11. Ramirez-Santos, E., Rendon, P., Gouvi, G., Zacharopoulou, A., Bourtzis, K., Caceres, C. & Bloem, K. (2021) A novel genetic sexing strain of Anastrepha ludens for cost-effective sterile insect technique applications: improved genetic stability and rearing efficiency. Insects. 12 (6), 499.

[0310] 12. Robinson, A. S. (2002) Genetic sexing strains in medfly, Ceratitis capitata, sterile insect technique programmes. Genetica. 116 (1), 5-13.

[0311] 13. Papadopoulos, N. T. (2014) Fruit fly invasion: historical, biological, economic aspects and management. Trapping and the Detection, Control, and Regulation of Tephritid Fruit Flies: Lures, Area-Wide Programs, and Trade Implications. 219-252.

[0312] 14. White, I. M. & Elson-Harris, M. M. (1992) Fruit flies of economic significance: their identification and bionomics. CAB international. xii+-601.

[0313] 15. Sollazzo, G., Gouvi, G., Nikolouli, K., Aumann, R. A., Djambazian, H., Whitehead, M. A., Berube, P., Chen, S., Tsiamis, G., Darby, A. C., Ragoussis, J., Schetelig, M. F. & Bourtzis, K. (2023) Genomic and cytogenetic analysis of the Ceratitis capitata temperature-sensitive lethal region. G3: Genes, Genomes, Genetics. Jkad074.

[0314] 16. Ward, C. M., Aumann, R. A., Whitehead, M. A., Nikolouli, K., Leveque, G., Gouvi, G., Fung, E., Reiling, S. J., Djambazian, H., Hughes, M. A., Whiteford, S., Caceres-Barrios, C., Nguyen, T. N. M., Choo, A., Crisp, P., Sim, S. B., Geib, S. M., Marec, F., Hacker, I., Ragoussis, J., Darby, A. C., Bourtzis, K., Baxter, S. W. & Schetelig, M. F. (2021) White pupae phenotype of tephritids is caused by parallel mutations of a MFS transporter. Nature Communications.

[0315] 12 (1), 491.

[0316] 17. Sollazzo, G., Gouvi, G., Nikolouli, K., Martinez, E. I. C., Schetelig, M. F. & Bourtzis, K. (2022) Temperature sensitivity of wild-type, mutant and genetic sexing strains of Ceratitis capitata. Insects. 13 (10), 943.

[0317] 18. Caceres, C. (2002) Mass rearing of temperature sensitive genetic sexing strains in the Mediterranean fruit fly (Ceratitis capitata). Genetica. 116 (1), 107-116.

[0318] 19. Quintero-Fong, L., Toledo, J., Ruiz-Montoya, L., Rendon, P., Orozco-Davila, D., Valle-Mora, J. and Liedo, P., 2018. Demography of a genetic sexing strain of Anastrepha ludens(Diptera: Tephritidae): effects of selection based on mating performance. Agricultural and Forest Entomology, 20 (1), 1-8.

[0319] 20. Koskinioti, P., Augustinos, A. A., Carvalho, D. O., Misbah-ul-Haq, M., Pillwax, G., de la Fuente, L. D., Salvador-Herranz, G., Herrero, R. A. & Bourtzis, K. (2021) Genetic sexing strains for the population suppression of the mosquito vector Aedes aegypti. Philosophical Transactions of the Royal Society B. 376 (1818), 20190808.

[0320] 21. Fisher, K. & Caceres, C. (2000) A filter rearing system for mass reared genetic sexing strains of Mediterranean fruit fly (Diptera: Tephritidae). In Area-wide Control of Fruit Flies and Other Insect Pests (ed. Tan, K. H.) 543-550 (Penerbit Universiti Sains Malaysia, 2000). 22. Augustinos, A. A., Targovska, A., Cancio-Martinez, E., Schorn, E., Franz, G., Caceres, C., Zacharopoulou, A. & Bourtzis, K. (2017) Ceratitis capitata genetic sexing strains: laboratory evaluation of strains from mass-rearing facilities worldwide. Entomologia Experimentalis Et Applicata. 164 (3), 305-317.

[0321] 23. Buchman, A. & Akbari, O. S. (2019) Site-specific transgenesis of the Drosophila melanogaster Y-chromosome using CRISPR / Cas9. Insect Molecular Biology. 28 (1), 65-73.

[0322] 24. Condon, K. C., Condon, G. C., Dafa’alla, T. H., Fu, G., Phillips, C. E., Jin, L. Gong, P. & Alphey, L. (2007) Genetic sexing through the use of Y-linked transgenes. Insect Biochemistry and Molecular Biology. 37 (11), 1168-1176.

[0323] 25. Davydova, S., Liu, J., Kandul, N. P., Braswell, W. E., Akbari, O. S. & Meccariello, A. (2023) Next-generation genetic sexing strain establishment in the agricultural pest Ceratitis capitata. Scientific Reports. 13 (1), 19866.

[0324] 26. Fu, G., Condon, K. C., Epton, M. J., Gong, P., Jin, L., Condon, G. C., Morrison, N. I., Dafa'alla, T. H. & Alphey, L. (2007) Female-specific insect lethality engineered using alternative splicing. Nature Biotechnology. 25 (3), 353-357.

[0325] 27. Heinrich, J. C. & Scott, M. J. (2000) A repressible female-specific lethal genetic system for making transgenic insect strains suitable for a sterile-release program. Proceedings of the National Academy of Sciences. 97 (15), 8229-8232.

[0326] 28. Kandul, N. P., Liu, J., Hsu, A. D., Hay, B. A. & Akbari, O. S. (2020) A drug-inducible sex-separation technique for insects. Nature Communications. 11 (1), 2106.29. Liu, J., Rayes, D. & Akbari, O. S. (2024) A fluorescent sex-sorting technique for insects with the demonstration in Drosophila melanogaster. GEN Biotechnology. 3 (1), 35-44.

[0327] 30. Ogaugwu, C. E., Schetelig, M. F. & Wimmer, E. A. (2013) Transgenic sexing system for Ceratitis capitata (Diptera: Tephritidae) based on female-specific embryonic lethality. Insect Biochemistry and Molecular Biology. 43 (1), 1-8.

[0328] 31. Schetelig, M. F., Targovska, A., Meza, J. S., Bourtzis, K. & Handler, A. M. (2016) Tetracycline-suppressible female lethality and sterility in the Mexican fruit fly, Anastrepha ludens. Insect Molecular Biology. 25 (4), 500-508.

[0329] 32. Schetelig, M. F., Schwirz, J. & Yan, Y. (2021) A transgenic female killing system for the genetic control of Drosophila suzukii. Scientific Reports. 11 (1), 12938.

[0330] 33. Scolari, F., Schetelig, M. F., Bertin, S., Malacrida, A. R., Gasperi, G. & Wimmer, E. A. (2008) Fluorescent sperm marking to improve the fight against the pest insect Ceratitis capitata (Wiedemann; Diptera: Tephritidae). New Biotechnology. 25 (1), 76-84.

[0331] 34. Pane, A., Salvemini, M., Bovi, P. D., Polito, C. & Saccone, G. (2002) The transformer gene in Ceratitis capitata provides a genetic basis for selecting and remembering the sexual fate. Development. 129 (15), 3715-3725.

[0332] 35. Peng, W., Zheng, W., Handler, A. M. & Zhang, H. (2015) The role of the transformer gene in sex determination and reproduction in the tephritid fruit fly, Bactrocera dorsalis Hendel). Genetica. 143 717-727.

[0333] 36. Schetelig, M. F. & Handler, A. M. (2012) A transgenic embryonic sexing system for Anastrepha suspensa (Diptera: Tephritidae). Insect Biochemistry and Molecular Biology. 42 (10), 790-795.

[0334] 37. Aumann, R. A., Hacker, I. & Schetelig, M. F. (2020) Female-to-male sex conversion in Ceratitis capitata by CRISPR / Cas9 HDR-induced point mutations in the sex determination gene transformer-2. Scientific Reports. 10 (1), 18611.

[0335] 38. Aumann, R. A., Schetelig, M. F. & Hacker, I. (2018) Highly efficient genome editing by homology-directed repair using Cas9 protein in Ceratitis capitata. Insect Biochemistry and Molecular Biology. 101 85-93.

[0336] 39. Meccariello, A., Hou, S., Davydova, S., Fawcett, J. D., Siddall, A., Leftwich, P. T., Krsticevic, F., Papathanos, P. A. & Windbichler, N. (2024) Gene drive and genetic sexconversion in the global agricultural pest Ceratitis capitata. Nature Communications. 15 (1), 372.

[0337] 40. Caceres, C., Bourtzis, K., Gouvi, G., Vreysen, M. J., Bimbile Somda, N. S., Hejnickova, M., Marec, F. & Meza, J. S. (2023) Development of a novel genetic sexing strain of Ceratitis capitata based on an X-autosome translocation. Scientific Reports. 13 (1), 16167.

[0338] 41. Bopp, D., Saccone, G. & Beye, M. (2014) Sex determination in insects: variations on a common theme. Sexual Development. 8 (1-3), 20-28.

[0339] 42. Saccone, G. (2022) A history of the genetic and molecular identification of genes and their functions controlling insect sex determination. Insect Biochemistry and Molecular Biology.151 103873.

[0340] 43. Saccone, G., Salvemini, M., Pane, A. & Polito, L. C. (2008) Masculinization of XX Drosophila transgenic flies expressing the Ceratitis capitata Doublesex M isoform. International Journal of Developmental Biology. 52 (8).

[0341] Supplementary references

[0342] 1. Meccariello, A., Krsticevic, F., Colonna, R., Del Corsano, G., Fasulo, B., Papathanos, P. A. & Windbichler, N. (2021) Engineered sex ratio distortion by X-shredding in the global agricultural pest Ceratitis capitata. BMC Biology. 19 (1), 1-14.

[0343] 2. Sollazzo, G., Gouvi, G., Nikolouli, K., Martinez, E. I. C., Schetelig, M. F. & Bourtzis, K. (2022) Temperature sensitivity of wild-type, mutant and genetic sexing strains of Ceratitis capitata. Insects. 13 (10), 943.

[0344] 3. Ward, C. M., Aumann, R. A., Whitehead, M. A., Nikolouli, K., Leveque, G., Gouvi, G., Fung, E., Reiling, S. J., Djambazian, H., Hughes, M. A., Whiteford, S., Caceres-Barrios, C., Nguyen, T. N. M., Choo, A., Crisp, P., Sim, S. B., Geib, S. M., Marec, F., Hacker, I., Ragoussis, J., Darby, A. C., Bourtzis, K., Baxter, S. W. & Schetelig, M. F. (2021) White pupae phenotype of tephritids is caused by parallel mutations of a MFS transporter. Nature Communications. 12 (1), 491.

[0345] 4. Meccariello, A., Hou, S., Davydova, S., Fawcett, J. D., Siddall, A., Leftwich, P. T., Krsticevic, F., Papathanos, P. A. & Windbichler, N. (2024) Gene drive and genetic sex conversion in the global agricultural pest Ceratitis capitata. Nature Communications. 15 (1), 372.5. Holmes, D. S. & Bonner, J. (1973) Preparation, molecular weight, base composition, and secondary structure of giant nuclear ribonucleic acid. Biochemistry. 12 (12), 2330-2338. 6. Chomczynski, P. & Mackey, K. (1995) Substitution of chloroform by bromo-chloropropane in the single-step method of RNA isolation. Analytical Biochemistry. 225 (1), 163-164.

[0346] 7. Davydova, S., Liu, J., Kandul, N. P., Braswell, W. E., Akbari, O. S. & Meccariello, A. (2023) Next-generation genetic sexing strain establishment in the agricultural pest Ceratitis capitata. Scientific Reports. 13 (1), 19866.

[0347] 8. Abramoff, M. D., Magalhaes, P. J. & Ram, S. J. (2004) Image processing with Imaged. Biophotonics International. 11 (7), 36-42.

[0348] 9. Harrington, B. & Engelen, J. (2004) Inkscape. URL: Hitp: / Www. Inkscape. Orcs.

[0349] EXAMPLES

[0350] Example 1 - IMPERIAL cisgenic GSS

[0351] Insect pest population control via sterile insect technique severely benefits from separation by sex priorto release. To simplify this process, traditional genetics has been deployed to develop genetic sexing strains (GSSs) for several disease vectors and agricultural pests of vast economic significance, although very few are applied in the field due to associated fitness costs and instability. Despite industry-wide circulation, thecurrently utilised Ceratitis capitata (Mediterranean fruit fly or medfly) GSS VIENNA 8 similarly has its drawbacks. Described herein, the inventors generated a cisgenic GSS using CRISPR / Cas9-mediated homology-directed repair knock-in for pupal colour-based sex-sorting using C. capitata as the model. To achieve this, the inventors used the sex-specifically spliced intronic sequence of the endogenous transformer gene, which was inserted into the pupal colouration-implicated white pupae. Characterisation of the herein generated IMPERIAL cisgenic GSS against wild-type and VIENNA 8 strains showcased its phenotypic stability and overall good fitness. Transferal of this novel approach to related global fruit fly pests can aid more efficient and economically suitable agricultural pest control.

[0352] Example 1.1 - Generating the novel cisgenic GSS (CGSS)

[0353] To engineer a novel cisgenic GSS (CGSS) without exogenous elements, a sex-specific expression of the wp selectable marker was achieved through sex-specific splicing of the tra intronic sequence. This was attained through a homology-directed repair (HDR)-dependent knock-in of the tra intronic sequence directly into the wp locus of wild-typeBenakeion medfly embryos, where CRISPR / Cas9-mediated HDR in the species has been previously shown (Aumann et al., 2020; Aumann et al., 2018; Meccariello et al., 2024). The knock-in construct (1167A) was engineered using the endogenous transformer (tra) intronic sequence, which was placed between the homology arms of each approximately 700 bp in length. The anticipated outcome was female-specific gene expression, whereby males and females harbouring two copies of the fra-containing wp gene would have white and brown pupae phenotypes accordingly (Fig. 1A). As the wp mutation is recessive in nature, the knock-in strain, hereupon named IMPERIAL, was generated using backcrosses to the irradiation-generated white pupae knock-out (wp- / -) strain at GO and G1 (Fig. 1 B). The inventors confirmed successful knock-in of the tra intronic sequence (wpw+ / ) in all obtained brown-pupaed G2 females using amplicon sequencing of the integration site. A homozygous wpKI* / +line was established at G7 (F0) after crossing sibling white-pupaed males with brown-pupaed, genotyping all parents and screening the whole progeny at every intermediate generation. To verify the integration in the wpKI+ / +IMPERIAL strain, genomic DNA from males and females was sequenced.

[0354] Example 1.2 - Robust phenotypic stability of the IMPERIAL strain compared to the VIENNA 8 strain.

[0355] To verify the sex-sorting suitability of the strain, phenotypic pupae colour stability and sex ratios of the IMPERIAL strain were examined alongside the existing VIENNA 8 GSS, in which males and females emerge from brown and white pupae accordingly. For five consecutive generations (F2-F6), pupae and adult phenotypes were recorded for IMPERIAL (pupae n = 4147; adult n = 4074) and VIENNA 8 (pupae n = 1386; adult n = 1227) strains in parallel, maintained under the same conditions.

[0356] As anticipated, in the wpKI+ / +IMPERIAL strain all females emerged from brown pupae and all males emerged from white pupae (Fig. 2A). The reverse phenotypes were universally observed amongst individuals from the VIENNA 8 strain. Altogether, the proportion of adult females in the IMPERIAL strain (mean = 49.8%) exceeded that of the VIENNA 8 strain (mean = 37.4%). Whilst populations within every generation of the IMPERIAL strain adhered to the expected 1: 1 male: female sex ratio (chi-square goodness of fit tests), the VIENNA 8 did not at F2, F4 and F5 (Fig. 2A). These results confirm the phenotypic stability of the IMPERIAL strain which, dissimilarly to VIENNA 8, consistently confines to the expected 1:1 male: female sex ratio.K / + / + Example 1.3 - Confirmation of tra intron-dependent wp sex-specific splicing the wp IMPERIAL strain.

[0357] To better understand differences in the tra intron-dependent wp splicing in males and females of the wpKM+IMPERIAL strain, the inventors performed reverse-transcription PCR (RT-PCR) on genomic and complementary DNA templates from adult flies (Fig. 3). A single female band was amplified from the cDNA template, corresponding to a transcript with the fully spliced-out tra intronic sequence, which was confirmed via sequencing. Male cDNA banding entirely consisted of larger fragments from which two unique male isoforms with premature stop codons were isolated via clonal sequencing, both containing sequences of the two malespecific exons. These results demonstrate functional White pupae protein production in females and ablation of its translation in males. Further investigation into wp splicing of the IMPERIAL strain was conducted using RNAseq. As expected, all three female libraries had multiple reads that spanned the junction splicing the tra intronic sequence. In contrast, the three male libraries had no such reads, indicating that the intronic sequence is spliced in females and not in males. As expected, the clustering and principal component analyses indicated a close relationship of samples by sex.

[0358] Example 1.4 - Comparison of the general fitness of the IMPERIAL strain with the VIENNA 8 and wild-type Benakeion strains.

[0359] The IMPERIAL sexing strain was further compared to its parental wild-type Benakeion and VIENNA 8 strains in terms of general fitness, and thus suitability for larger-scale employment. First, a standard egg-adult survival assay utilising sibling crosses was conducted whereby rates of egg laying, egg hatching, hatched larvae-pupae recovery, pupae-adult recovery, and total egg-adult recovery were assessed (Fig. 2A). Kruskal-Wallis and sequential Dunn’s tests were performed as means of statistical analysis. Advantageously, egg production within the measured time period was significantly elevated in the IMPERIAL strain compared to both wild-type and VIENNA 8 strains (p < 0.05*). Hatching rate in VIENNA 8 was significantly lower than in wild-type (p = 0.0036**). In contrast, the hatching rate in the IMPERIAL strain advantageously had insignificant reductions compared to in wild-type (p = 0.0899). Surprisingly, the inventors recorded the highest larval-pupal survival in the IMPERIAL strain, which advantageously was significantly raised compared to VIENNA 8 (p = 0.0036**). In line with the phenotypic stability experiments of Example 1.2, the pupal-adult recovery rates were significantly lower in the VIENNA 8 strain, compared to both wild-type and IMPERIAL strains (p < 0.05*). Overall egg-adult survival was significantly reduced in VIENNA 8 when assessed against wild-type (p = 0.0127*) and IMPERIAL (p = 0.0368*)strains alike. Surprisingly, egg-adult survival in wild-type and IMPERIAL strains, was statistically similar (p= 0.3274), advantageously confirming good fitness in the IMPERIAL strain. The inventors also explored adult longevity with virgin males and females restricted to separate husbandry under regular lab conditions (Fig. 2C). Highest survival was observed in wild-type females, whilst the shortest longevity belonged to VIENNA 8 females. Pairwise comparisons via log-rank tests were performed between strains, and the combinations of strain and sex (Tables 1 and 2). Altogether, VIENNA 8 had significant reductions in longevity compared to both wild-type (p = 0.0022**) and IMPERIAL (p - 0.0048**) strains. Surprisingly, wild-type Benakeion and IMPERIAL strains with the same genetic background, on the other hand, did not have a significant difference between one another (p = 0.3920). Amongst females, significant differences were recorded for VIENNA 8 against both wild-type (p < 0.0001****) and IMPERIAL (p < 0.0001****) strains, while male comparisons between strains were statistically insignificant. These results demonstrate comparable longevity of the males and importantly females from the IMPERIAL strain with wild-type, thereby confirming the improved general fitness of the IMPERIAL strain compared to VIENNA 8.

[0360] Table 1 Statistical analysis of adult longevity by strain. P-values for strain-by-strain pairwise log-rank test comparisons for adult longevity with Bonferroni corrections.

[0361] WfcMype 1 IMPERIAL | VIENNA 8

[0362] 0< W22** IMPERIL CLOtW*

[0363]

[0364] Table 2 Statistical analysis of adult longevity by strain and sex. P-values for pairwise logrank test comparisons by sex and strain for adult longevity with Bonferroni corrections.

[0365]

[0366] A delay in white-pupaed female development has been previously documented in the VIENNA 8 strain (Cacares et al., 2023). To determine whether similar issues occur in the white-pupaed males of the IMPERIAL strain, the inventors compared pupal eclosion times from age-matched egg collections by sex. The development times were significantly different by strain and sex (nested ANOVA, F = 178.6, p < 0.0001****) (Fig. 2D). The time for wild-type males (mean = 18.60 days) and females (mean = 18.75 days) to reach adulthood were statistically similar to IMPERIAL males (mean = 18.51 days) and females (mean = 18.59 days) (Table 3). Flies from the VIENNA 8 strain were significantly slower to eclose, with means of 20.11 and 24.00 days for males and females accordingly. There was a significant difference between VIENNA 8 males and females (p < 0.0001****), which, in comparison, is absent in both wild-type (p = 0.94854) and IMPERIAL (p = 0.99781) strains. The observed trends demonstrate that the IMPERIAL strain advantageously does not experience a developmental discrepancy between sexes, present in the current VIENNA 8 GSS, thereby confirming its improved general fitness.

[0367] Table 3 Statistical analysis of pupal eclosion times by strain and sex. P-values for pairwise comparisons of post hoc T ukey HSD test after nested ANOVA by strain and sex.Strain

[0368] VSEHNA8 WskMypa

[0369] Vi£N«A8 WfeMype BSPERtAL

[0370]

[0371] Example 1.5 - Comparison of the mating preferences of females towards the IMPERIAL, Benakeion and VIENNA 8 strains.

[0372] The mating preferences of females towards the IMPERIAL, Benakeion and VIENNA 8 strains were assessed. Males from the three tested strains were collectively released to mate with females from the recessive irradiation-generated homozygous white pupae mutant (wp- / -) strain. Adult progeny from individual females was scored by pupal colour and corresponding adult phenotypes. Due to the recessive nature of the wp mutation, the father(s) were easily ‘revealed’ through pupal colour and corresponding adult phenotype screening (Table 4). The most common parentage belonged to wild-type male(s) (36.93%), followed by equal parentage by IMPERIAL male(s) (28.41%) and VIENNA 8 male(s) (28.41%). The inventors also observed progeny with mixed strain paternity at a low frequency (6.25%). This data demonstrates that the pupal colour of the IMPERIAL males does not disadvantage their mating success in respect to brown-pupaed VIENNA 8 males.

[0373] Table 4 Mating preference of female towards wild-type, IMPERIAL and VIENNA 8 strains.

[0374] Paternity Count Percentage (%) Wild-type mate(s) 65 36.93 imperial male(s) SO 28.41 VIENNA 8 male(s) 50 28.41 Wiki-type * Imperial male(s) 0 0

[0375] Wild-type + VIENNA 8 mate(s) 3 1.70 imperial * VIENNA 8 male(s) 8 4.55

[0376]

[0377] Total 17S 100Discussion

[0378] Described herein is an entirely novel method of sex-sorting a plurality of insects based on sex-specific gene expression. Using this method, the inventors produced a novel CRISPR / Cas9-generated cisgenic GSS, for the agricultural pest giant C. capitata using the wp gene involved in pupal pigmentation (Ward et al., 2021). Although multiple robust nextgeneration GSS approaches have been established in the medfly to date (Condon et al., 2007; Davydova et al., 2023; Fu et al., 2007; Scolari et al., 2008), the IMPERIAL strain described herein is the first to exclusively encompass endogenous elements. The inventors’ approach uses the sex-specific intronic sequence of tra, a gene responsible for femalespecific fate induction in the Tephritidae fruit fly family and beyond, making it an appealing target for cross-species application (Bopp et al., 2014, Saccone, 2022). Advantageously, the Y-chromosome-independent GSS approach ofthe present invention is time-effective as it only requires comprehensible cross completion for line establishment. Previous studies have optimised CRISPR / Cas9-mediated HDR in the species (Aumann et al., 2020; Aumann et al., 2018; Meccariello et al., 2024). Using this gene editing system, the inventors created a novel GSS approach by integrating the tra intronic sequence into the wp gene to achieve its expression in females exclusively, resulting in a brown-pupae phenotype. Due to sex-specific splicing (Fig. 3), males in the strain do not translate White pupae successfully. Specifically, this is caused by the inclusion of early termination codons upon transcription which leads to a white-pupae phenotype.

[0379] Characterisation of the IMPERIAL strain revealed that surprisingly, its fitness is advantageously comparative to its ancestral wild-type strain from which it was generated. This included survival during development and upon adulthood, as well as eclosion time comparison between males and females (Fig. 2). In all abovementioned assessments, the VIENNA 8 strain performance was shown to have much reduced fitness compared to the strain generated by the present invention, IMPERIAL (Table 4). Among all males and females screened in the process of line characterisation in the above-mentioned experiments, no reverse phenotypes were observed, which demonstrates the vast line stability of the IMPERIAL strain provided herein. Furthermore, similarly to wild-type flies, the males and females are consistently distributed in equal proportions in the IMPERIAL strain (Fig. 2A). This highlights the limited effect of the white-pupae phenotype on the male survival to adulthood in the claimed GSS, advantageously showing its applicability for efficient facility-based rearing. The inventors have demonstrated that the sex-sorting of this strain can be performed at pupal developmental stage using automated machinery, already employed, and optimised at SIT capitata facilities. Thus, with its stability and cisgenicnature, the invention provided herein is an advantageous and cost-effective alternative for currently used strategies in SIT-mediated population control.

[0380] Materials and Methods

[0381] Plasmid design and construction

[0382] The inventors used Gibson enzymatic assembly to build the 1167A plasmid, which contains C. capitata MFS transporter Exon 3 (LOCI 01451947), the tra intronic sequence and Opie2-DsRed outside the homology arms. A pre-existing plasmid containing piggyBac flanks, with an Opie2 promoter regulating dsRed, was linearized by Ndel and Kpnl to clone 1167A. The MFS transporter Exon3 was amplified into two fragments from C. capitata genomic DNA using primer pairs 1167A. C1F and c2R, as well as 1167A. C5F and c6R (Table 5). The CctraF intron was amplified from 795H1 (Addgene #205482) using primer pair 1167A. C3F and c4R, then inserted inside of the MFS exon 3 coding sequence (Table 5).

[0383] Table 5 Primer summary. Sequences of primers used for construct cloning and cisgenic strain characterisation

[0384] Purpose Primer Primer Sequence (5’-3’) SEQ ID name NO: gDNA 1167. s CTG C ATACTG TG AG TG G AATT AC AATG GTCTG G 5 sequenci 1F

[0385] ng pre1167. S GCAGGTGATAAGGAAGAGCACGGAGCC 6 cloning 2R

[0386] 1167A. CTTAAAACAAACTTATAATATAACCCATATGCACGAC 7 C1F ACGAATTGCCAAAGCAATGTTCG

[0387] Cloning 1167A. AAGAAAAAAATATGC I I I I AAAATTACCAATCGCTTTA 8 C2R CGTTCTGGTTCCTTGAGTGTGG

[0388] 1167A. AACGTAAAGCGATTGGTAATTTTAAAAGCATAI I I I I I 9 c3F TCTTTGAAATTCATAAGTTATC

[0389] 1167A. TGGTACGATCGCCCTCACCTATAGATACCATAGATG 10 c4R TATGGATTAGTATCATATACATAC

[0390] 1167A. TCCATACATCTATGGTATCTATAGGTGAGGGCGATC 11 c5F GTACCAAAGATGGCAAAAAGATTG

[0391] 1167A. AATTCAACGCACACTTATTACGTGAGGTACCGAAGC 12 C6R AGGTGATAAGGAAGAGCACGGAGC

[0392] Genotypi 1167A_ CGAGTTGGATTATGGTGATAAGGCT 13 ng PCR F

[0393] 1167A_ CACCGCTGTTGTAGAATCGTTATC 14 R

[0394] 8kb_B_ CATAGATGCTTATGTTGTTGTAAAGGCA 15 R

[0395] Splicing 1167A_ CACTCAAGGAACCAGAACGTAAAG 16 PCR F_V1_s

[0396]

[0397] plicingC. capitata maintenance

[0398] All fly stains were reared under standard lab conditions described previously (Meccariello et al, 2021). A carrot-based diet was provided for larval development (Sollazzo et al., 2022) and a 1:1 yeast: glucose mix was given to adult flies. The Benakeion wild-type strain was supplied by the Saccone Lab (University of Naples “Federico II”), whilst irradiation-generated white pupae - / - (wp- / -) (Ward et al., 2021) and VIENNA 8 D53- strains were obtained from the FAO / IAEA Centre of Nuclear Techniques in Food and Agriculture (ffiSeibersdorf0^, Austria).

[0399] C. capitata germline transformation

[0400] Microinjections of the 1167A plasmid were performed into embryos of the wild-type Benakeion strain. The plasmid (250 ng / pl) was injected alongside a pre-assembled ribonucleoprotein (RNP) complex of Cas9 protein (200 ng / l) (PNA Bio) and presynthesized gRNA-wp (100 ng / pl) (Synthego) (Meccariello et al., 2024).

[0401] wpKI+ / +line establishment

[0402] The cross scheme for G0-G3 line generation is summarized in Fig. 1. The injected GOs were reciprocally crossed to the characterized irradiation-generated wp- / - strain (Ward et al., 2021). The resulting G1 progeny was separated by pupal colour, and all males emerging from white pupae were backcrossed in pools to the females from the irradiation-generated wp- / - strain. At G2, the brown pupae were isolated, and all 10 female adults from the same parental G1 cross were collectively crossed to five sibling white-pupaed males. After mating, genomic DNA (gDNA) was individually extracted from G2 brown-pupaed females using an altered phenol-chloroform protocol (Holmes & Bonner, 1973). The knock-in site was amplified using Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs®) with genome-specific 1167A_F and 1167A_R primers (Table 5) designed in Geneious Prime 2023.1.2. To confirm the initial integration, the PCR products were purified via Monarch® PCR & DNA Cleanup Kit (New England Biolabs®) and analysed via Oxford Nanopore sequencing (Full Circle Labs).

[0403] Over the course of the following 4 generations (G3-G6) multiple sibling crosses were performed in parallel and the parental genotypes were verified. Hereby three possible alleles were differentiated: 1) the irradiation-generated wp- / - 2) the intron-less wp- / - with indels and 3) the tra intronic sequence knock-in (Fig. 4). For this, a multiplex 3-primer PCR was designed using a forward (1167A_F) binding upstream of the integration site, a reverse (1167A_R) downstream of the integration site and a second reverse (8kb_B_R) binding to the irradiation-generated wp- / - inserted sequence (Fig. 4).Verification of genome integration in the homozygous strain

[0404] To verify the insertion site in the wpKI+ / +IMPERIAL strain, the inventors conducted Oxford Nanopore genomic DNA sequencing. Genomic DNA was extracted from four knock-in adult males and four knock-in adult females using the Blood & Cell Culture DNA Midi Kit (Qiagen). PCT tra intronic sequence splicing confirmation

[0405] In parallel, single males and females were separately collected for gDNA and RNA extractions. gDNA was extracted as detailed above. RNA was extracted via an adapted TRIzol® (Ambion)-chloroform-based protocol (Chomczynski & Mackey, 1995).cDNA was synthesised from total RNA using Maxima H Minus First Strand cDNA Synthesis Kit with dsDNase (ThermoFisher) according to the instructions provided by the manufacturer. Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs®) was used for PCR amplification from gDNA and cDNA templates using the 1167_F_V1 splicing and 1167A_R primer pair (Table 5). Bands amplified from cDNA of the IMPERIAL strain were purified using a Monarch® DNA Gel Extraction Kit (New England Biolabs®) and Sanger sequenced (Genewiz Inc.). Male cDNA PCR reaction was additionally subjected to Sanger sequencing post-PCR product cloning using the StrataClone PCR Cloning Kit (Agilent) whereby different isoforms were isolated.

[0406] RNA sequencing

[0407] To confirm the sex-specific expression of the wp gene, the inventors performed Illumina RNA sequencing. Total RNA was extracted from mature wpKI+ / + adult males and females from the IMPERIAL strain in three biological replicates (six samples) using the miRNeasy Tissue / Cells Advanced Mini Kit (Qiagen), following the manufacturer’s protocol. Genomic DNA was removed using the gDNA eliminator column included with the kit. RNA integrity was tested with the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies).

[0408] Male (ID# 27026-27028) and female (ID# 27023-27025) libraries with three replicates each were sequenced to an approximate depth of 20M paired-end reads. The reads were aligned with STAR (https: / / ithub.com / ai6xdobin / STAR) to the EGII-3.2.1 genome assembly (https: / www-ncbi.nim.nih.gov / datasets / geno e / GCA 905071925.1 / ), into which traF intron was inserted at the white pupae locus (GCA_905071925.1_EGII-3.2.1_genomic.traF-intron.fna). To generate a more complete annotation file, the inventors transferred the Cea p_2.1 annotations (https: / / www ncbi.nim.nih.gov / datasets / qenQme / GCA 000347755.4 / )to the EGII-3.2.1 genome by aligning Ccap_2.1 transcript sequences with BLAT and parsing the alignments to generate a GTF file, which was used for all subsequent analysis steps. Gene abundances were quantified with featurecounts (https:-7subread.sourc-3forqe.net / feat reCounts.htmh, count data were converted to TPM and FPKM values and combined using Perl scripts. Gene annotations were downloaded from EnsembIMetazoa using the BioMart tool (https: / / etazoa.ensembl.org / Ceratjtis capitate gca000347755v4 / lnfo / lndex) and added to the quantification data. TPM values were used to perform PCA and clustering analyses in R to identify possible sample outliers. Replicates for each sex clustered together as expected and displayed high correlations between each other without obvious outliers. To visualize splicing of the traF intron within the white pupae locus (LOC101451947), BAM files produced by STAR were imported into IGV (https: / / igv.org / doc / desktop / ).

[0409] Stability assay

[0410] From G3 until G7 all pupae were separated by colour and corresponding adults were scored by sex. When the homozygosity of the IMPERIAL strain was verified at G7 (FO), alongside the VIENNA 8 strain, for 5 consecutive generations (F2-F6) eggs were collected five days after eclosion and raised under regular conditions until pupal stage of development. Brown and white pupae were then separated, and the sex of all adults from each pool was recorded. Egg-adult survival assay

[0411] Sibling crosses of 10 males and 20 females were set up in triplicates simultaneously for the IMPERIAL, VIENNA 8, and wild-type Benakeion strains. Egg numbers and their hatching rates were determined as described previously (Davydova et al., 2023). Specifically, five days after eclosion, all eggs laid within a 5-hour period were collected and unhatched eggs were counted twice four days apart using Fiji (Abramoff et al., 2004). Pupal and adult recovery rates were determined thereafter.

[0412] Adult longevity assay

[0413] Age-matched adults from the wild-type Benakeion, IMPERIAL and VIENNA 8 D53- strains were separated by sex upon eclosion and placed into cages of 10 individuals. Three male and three female replicates were set up simultaneously for each strain; and maintained under standard conditions thereafter. Daily, dead flies were counted and removed from the cages for 30 consecutive days.Mating-preference assay

[0414] 270 females from the irradiation-generated wp- / - strain (Ward et al., 2021) were simultaneously placed together with 45 males from each of the Benakeion, IMPERIAL and VIENNA 8 D53- strains for a total of a 1:2 male: female ratio. The flies were left to mate for four full days, after which females were separated into individual small cages. Upon oviposition, eggs were collected and reared normally until pupation. In the cases where white and brown pupae were present, they were separated by colour. Adults eclosing from both mixed and brown pupae-only collections were screened by sex.

[0415] Eclosion assay

[0416] 24-hour egg collections were made from sibling crosses of 10 males and 20 females of the IMPERIAL, VIENNA 8, and wild-type Benakeion strains, set up in parallel triplicates. The offspring were reared under normal conditions until pupation, whereby IMPERIAL and VIENNA 8 pupae were sorted by colour. The eclosing adults were therein scored by sex every day.

[0417] Figure generation and statistical analyses

[0418] All statistical analysis and plot generation was performed in RStudio. Chi-squared tests were used for sex ratio and pupal colour analysis. Egg-adult survival was assessed using Kruskal-Wallis and Dunn’s tests. Longevity data was plotted and analysed using survival and survminer packages. Eclosion rates were assessed using nested ANOVA by strain, with sex added in as an extra factor. Pairwise comparisons were conducted via a post hoc Tukey HSD test thereafter. Microsoft PowerPoint and Inkscape 1.3.2 (Harrington & Engelen, 2004) were used to create construct and fly-centred diagrams.

[0419] References

[0420] 1. Hendrichs, J. & Robinson, A. (2009) Sterile insect technique. In: Encyclopedia of insects. Elsevier. 953-957.

[0421] 2. Knipling, E. F. (1955) Possibilities of insect control or eradication through the use of sexually sterile males. Journal of Economic Entomology. 48 (4), 459-462.

[0422] 3. Krafsur, E. S. (1998) Sterile insect technique for suppressing and eradicating insect population: 55 years and counting. Journal of Agricultural Entomology. 15 (4), 303-317.4. Franz, G., Bourtzis, K. & Caceres, C. (2021) Practical and operational genetic sexing systems based on classical genetic approaches in fruit flies, an example for other species amenable to large-scale rearing for the sterile insect technique. In: Sterile Insect Technique., CRC Press. 575-604.

[0423] 5. Hendrichs, J., Franz, G. & Rendon, P. (1995) Increased effectiveness and applicability of the sterile insect technique through male-only releases for control of Mediterranean fruit flies during fruiting seasons. Journal of Applied Entomology. 119 (1-5), 371-377.

[0424] 6. Rendon, P., McInnis, D., Lance, D. & Stewart, J. (2004) Medfly (Diptera: Tephritidae) genetic sexing: large-scale field comparison of males-only and bisexual sterile fly releases in Guatemala. Journal of Economic Entomology. 97 (5), 1547-1553.

[0425] 7. Isasawin, S., Aketarawong, N., Lertsiri, S. & Thanaphum, S. (2014) Development of a genetic sexing strain in Bactrocera carambolae (Diptera: Tephritidae) by introgression of sex sorting components from B. dorsalis, Salaya1 strain. BMC Genetics. 15, 1-11.

[0426] 8. McCombs, S. D. & Saul, S. H. (1995) Translocation-based genetic sexing system for the oriental fruit fly (Diptera: Tephritidae) based on pupal color dimorphism. Annals of the Entomological Society of America. 88 (5), 695-698.

[0427] 9. McInnis, D. O., Tam, S., Lim, R., Komatsu, J., Kurashima, R. & Albrecht, C. (2004) Development of a pupal color-based genetic sexing strain of the melon fly, Bactrocera cucurbitae (Coquillett) (Diptera: Tephritidae). Annals of the Entomological Society of America.

[0428] 97 (5), 1026-1033.

[0429] 10. Meza, J. S., Bourtzis, K., Zacharopoulou, A., Gariou-Papalexiou, A. & Caceres, C. (2020) Development and characterization of a pupal-colour based genetic sexing strain of Anastrepha fraterculus sp. 1 (Diptera: Tephritidae). BMC Genetics. 21 (2), 1-9.

[0430] 11. Ramirez-Santos, E., Rendon, P., Gouvi, G., Zacharopoulou, A., Bourtzis, K., Caceres, C. & Bloem, K. (2021) A novel genetic sexing strain of Anastrepha ludens for cost-effective sterile insect technique applications: improved genetic stability and rearing efficiency. Insects. 12 (6), 499.

[0431] 12. Robinson, A. S. (2002) Genetic sexing strains in medfly, Ceratitis capitata, sterile insect technique programmes. Genetica. 116 (1), 5-13.13. Papadopoulos, N. T. (2014) Fruit fly invasion: historical, biological, economic aspects and management. Trapping and the Detection, Control, and Regulation of Tephritid Fruit Flies: Lures, Area-Wide Programs, and Trade Implications. 219-252.

[0432] 14. White, I. M. & Elson-Harris, M. M. (1992) Fruit flies of economic significance: their identification and bionomics. CAB international. xii+-601.

[0433] 15. Sollazzo, G., Gouvi, G., Nikolouli, K., Aumann, R. A., Djambazian, H., Whitehead, M. A., Berube, P., Chen, S., Tsiamis, G., Darby, A. C., Ragoussis, J., Schetelig, M. F. & Bourtzis, K. (2023) Genomic and cytogenetic analysis of the Ceratitis capitata temperature-sensitive lethal region. G3: Genes, Genomes, Genetics. Jkad074.

[0434] 16. Ward, C. M., Aumann, R. A., Whitehead, M. A., Nikolouli, K., Leveque, G., Gouvi, G., Fung, E., Reiling, S. J., Djambazian, H., Hughes, M. A., Whiteford, S., Caceres-Barrios, C., Nguyen, T. N. M., Choo, A., Crisp, P., Sim, S. B., Geib, S. M., Marec, F., Hacker, I., Ragoussis, J., Darby, A. C., Bourtzis, K., Baxter, S. W. & Schetelig, M. F. (2021) White pupae phenotype of tephritids is caused by parallel mutations of a MFS transporter. Nature Communications.

[0435] 12 (1), 491.

[0436] 17. Sollazzo, G., Gouvi, G., Nikolouli, K., Martinez, E. I. C., Schetelig, M. F. & Bourtzis, K. (2022) Temperature sensitivity of wild-type, mutant and genetic sexing strains of Ceratitis capitata. Insects. 13 (10), 943.

[0437] 18. Caceres, C. (2002) Mass rearing of temperature sensitive genetic sexing strains in the Mediterranean fruit fly (Ceratitis capitata). Genetica. 116 (1), 107-116.

[0438] 19. Quintero-Fong, L., Toledo, J., Ruiz-Montoya, L., Rendon, P., Orozco-Davila, D., Valle-Mora, J. and Liedo, P., 2018. Demography of a genetic sexing strain of Anastrepha ludens (Diptera: Tephritidae): effects of selection based on mating performance. Agricultural and Forest Entomology, 20 (1), 1-8.

[0439] 20. Koskinioti, P., Augustinos, A. A., Carvalho, D. O., Misbah-ul-Haq, M., Pillwax, G., de la Fuente, L. D., Salvador-Herranz, G., Herrero, R. A. & Bourtzis, K. (2021) Genetic sexing strains for the population suppression of the mosquito vector Aedes aegypti. Philosophical Transactions of the Royal Society B. 376 (1818), 20190808.

[0440] 21. Fisher, K. & Caceres, C. (2000) A filter rearing system for mass reared genetic sexing strains of Mediterranean fruit fly (Diptera: Tephritidae). In Area-wide Control of Fruit Flies and Other Insect Pests (ed. Tan, K. H.) 543-550 (Penerbit Universiti Sains Malaysia, 2000).22. Augustinos, A. A., Targovska, A., Cancio-Martinez, E., Schorn, E., Franz, G., Caceres, C., Zacharopoulou, A. & Bourtzis, K. (2017) Ceratitis capitata genetic sexing strains: laboratory evaluation of strains from mass-rearing facilities worldwide. Entomologia Experimentalis Et Applicata. 164 (3), 305-317.

[0441] 23. Buchman, A. & Akbari, O. S. (2019) Site-specific transgenesis of the Drosophila melanogaster Y-chromosome using CRISPR / Cas9. Insect Molecular Biology. 28 (1), 65-73.

[0442] 24. Condon, K. C., Condon, G. C., Dafa’alla, T. H., Fu, G., Phillips, C. E., Jin, L. Gong, P. & Alphey, L. (2007) Genetic sexing through the use of Y-linked transgenes. Insect Biochemistry and Molecular Biology. 37 (11), 1168-1176.

[0443] 25. Davydova, S., Liu, J., Kandul, N. P., Braswell, W. E., Akbari, O. S. & Meccariello, A. (2023) Next-generation genetic sexing strain establishment in the agricultural pest Ceratitis capitata. Scientific Reports. 13 (1), 19866.

[0444] 26. Fu, G., Condon, K. C., Epton, M. J., Gong, P., Jin, L., Condon, G. C., Morrison, N. I., Dafa'alla, T. H. & Alphey, L. (2007) Female-specific insect lethality engineered using alternative splicing. Nature Biotechnology. 25 (3), 353-357.

[0445] 27. Heinrich, J. C. & Scott, M. J. (2000) A repressible female-specific lethal genetic system for making transgenic insect strains suitable for a sterile-release program. Proceedings of the National Academy of Sciences. 97 (15), 8229-8232.

[0446] 28. Kandul, N. P., Liu, J., Hsu, A. D., Hay, B. A. & Akbari, O. S. (2020) A drug-inducible sex-separation technique for insects. Nature Communications. 11 (1), 2106.

[0447] 29. Liu, J., Rayes, D. & Akbari, O. S. (2024) A fluorescent sex-sorting technique for insects with the demonstration in Drosophila melanogaster. GEN Biotechnology. 3 (1), 35-44.

[0448] 30. Ogaugwu, C. E., Schetelig, M. F. & Wimmer, E. A. (2013) Transgenic sexing system for Ceratitis capitata (Diptera: Tephritidae) based on female-specific embryonic lethality. Insect Biochemistry and Molecular Biology. 43 (1), 1-8.

[0449] 31. Schetelig, M. F., Targovska, A., Meza, J. S., Bourtzis, K. & Handler, A. M. (2016) Tetracycline-suppressible female lethality and sterility in the Mexican fruit fly, Anastrepha ludens. Insect Molecular Biology. 25 (4), 500-508.

[0450] 32. Schetelig, M. F., Schwirz, J. & Yan, Y. (2021) A transgenic female killing system for the genetic control of Drosophila suzukii. Scientific Reports. 11 (1), 12938.33. Scolari, F., Schetelig, M. F., Bertin, S., Malacrida, A. R., Gasperi, G. & Wimmer, E. A. (2008) Fluorescent sperm marking to improve the fight against the pest insect Ceratitis capitata (Wiedemann; Diptera: Tephritidae). New Biotechnology. 25 (1), 76-84.

[0451] 34. Pane, A., Salvemini, M., Bovi, P. D., Polito, C. & Saccone, G. (2002) The transformer gene in Ceratitis capitata provides a genetic basis for selecting and remembering the sexual fate. Development. 129 (15), 3715-3725.

[0452] 35. Peng, W., Zheng, W., Handler, A. M. & Zhang, H. (2015) The role of the transformer gene in sex determination and reproduction in the tephritid fruit fly, Bactrocera dorsalis (Hendel). Genetica. 143 717-727.

[0453] 36. Schetelig, M. F. & Handler, A. M. (2012) A transgenic embryonic sexing system for Anastrepha suspensa (Diptera: Tephritidae). Insect Biochemistry and Molecular Biology. 42 (10), 790-795.

[0454] 37. Aumann, R. A., Hacker, I. & Schetelig, M. F. (2020) Female-to-male sex conversion in Ceratitis capitata by CRISPR / Cas9 HDR-induced point mutations in the sex determination gene transformer-2. Scientific Reports. 10 (1), 18611.

[0455] 38. Aumann, R. A., Schetelig, M. F. & Hacker, I. (2018) Highly efficient genome editing by homology-directed repair using Cas9 protein in Ceratitis capitata. Insect Biochemistry and Molecular Biology. 101 85-93.

[0456] 39. Meccariello, A., Hou, S., Davydova, S., Fawcett, J. D., Siddall, A., Leftwich, P. T., Krsticevic, F., Papathanos, P. A. & Windbichler, N. (2024) Gene drive and genetic sex conversion in the global agricultural pest Ceratitis capitata. Nature Communications. 15 (1), 372.

[0457] 40. Caceres, C., Bourtzis, K., Gouvi, G., Vreysen, M. J., Bimbile Somda, N. S., Hejnickova, M., Marec, F. & Meza, J. S. (2023) Development of a novel genetic sexing strain of Ceratitis capitata based on an X-autosome translocation. Scientific Reports. 13 (1), 16167.

[0458] 41. Bopp, D., Saccone, G. & Beye, M. (2014) Sex determination in insects: variations on a common theme. Sexual Development. 8 (1-3), 20-28.

[0459] 42. Saccone, G. (2022) A history of the genetic and molecular identification of genes and their functions controlling insect sex determination. Insect Biochemistry and Molecular Biology.151 103873.43. Saccone, G., Salvemini, M., Pane, A. & Polito, L. C. (2008) Masculinization of XX Drosophila transgenic flies expressing the Ceratitis capitata Doublesex M isoform. International Journal of Developmental Biology. 52 (8).

[0460] 44. Meccariello, A., Krsticevic, F., Colonna, R., Del Corsano, G., Fasulo, B., Papathanos, P. A. & Windbichler, N. (2021) Engineered sex ratio distortion by X-shredding in the global agricultural pest Ceratitis capitata. BMC Biology. 19 (1), 1-14.

[0461] 45. Sollazzo, G., Gouvi, G., Nikolouli, K., Martinez, E. I. C., Schetelig, M. F. & Bourtzis, K. (2022) Temperature sensitivity of wild-type, mutant and genetic sexing strains of Ceratitis capitata. Insects. 13 (10), 943.

[0462] 46. Ward, C. M., Aumann, R. A., Whitehead, M. A., Nikolouli, K., Leveque, G., Gouvi, G., Fung, E., Reiling, S. J., Djambazian, H., Hughes, M. A., Whiteford, S., Caceres-Barrios, C., Nguyen, T. N. M., Choo, A., Crisp, P., Sim, S. B., Geib, S. M., Marec, F., Hacker, I., Ragoussis, J., Darby, A. C., Bourtzis, K., Baxter, S. W. & Schetelig, M. F. (2021) White pupae phenotype of tephritids is caused by parallel mutations of a MFS transporter. Nature Communications.

[0463] 12 (1), 491.

[0464] 47. Meccariello, A., Hou, S., Davydova, S., Fawcett, J. D., Siddall, A., Leftwich, P. T., Krsticevic, F., Papathanos, P. A. & Windbichler, N. (2024) Gene drive and genetic sex conversion in the global agricultural pest Ceratitis capitata. Nature Communications. 15 (1), 372.

[0465] 48. Holmes, D. S. & Bonner, J. (1973) Preparation, molecular weight, base composition, and secondary structure of giant nuclear ribonucleic acid. Biochemistry. 12 (12), 2330-2338. 49. Chomczynski, P. & Mackey, K. (1995) Substitution of chloroform by bromo- chloropropane in the single-step method of RNA isolation. Analytical Biochemistry. 225 (1), 163-164.

[0466] 50. Davydova, S., Liu, J., Kandul, N. P., Braswell, W. E., Akbari, O. S. & Meccariello, A. (2023) Next-generation genetic sexing strain establishment in the agricultural pest Ceratitis capitata. Scientific Reports. 13 (1), 19866.

[0467] 51. Abramoff, M. D., Magalhaes, P. J. & Ram, S. J. (2004) Image processing with Imaged. Biophotonics International. 11 (7), 36-42.

[0468] 52. Harrington, B. & Engelen, J. (2004) Inkscape. URL: Http: / sVww. Inkscape. Org.Example 2 - a novel male-specific SEPARATOR system

[0469] Sterile insect technique (SIT) programmes benefit from male selection for efficient population control of insect pest populations. Tephritidae fruit flies, key subjects of global SIT efforts, progressively threaten the fruit and vegetable sectors of the agricultural industry. The medfly, which belongs to the Tephritidae fruit fly family, is one of the most ferocious agricultural pests with over 350 host species and a growing global distribution (EPPO, 2025; Szyniszewska et al., 2024). Although tephritid genetic sex-sorting approaches exist, they are challenging to replicate in all species of interest. Furthermore, they are associated with genetic instability and fitness issues. Hence, genetically-engineered alternatives are being increasingly developed to address these concerns. Fluorescence-based positive selection of males through malespecific gene expression is limited to testis-marking using the p-2-tubulin promoter (Scolari et al., 2008). Additionally, previously developed positive male selection systems relying on the sex-specific splicing of the doublesex (dsx) gene is limited to only Drosophila melanogaster, Aedes aegypti and Anopheles stephensi, with no such system developed for any tephritid pests (Kandul et al., 2020; Weng et al., 2023, 2024).

[0470] Herein, by utilising the sex-specifically spliced intronic sequence of the doublesex (dsx) gene, the inventors established a dominant positive male selection-based sex-sorting system in tephritid pests, the polyphagous and widely distributed Mediterranean fruit fly, Ceratitis capitata, as proof-of-principle. The inventors observed that 100% of individuals exhibited the desired fluorescence phenotypes, kicking in upon pupation. The generated cfcx-dependent sex-sorting approach is aimed at easy cross-species replication in related tephritid pests because of the highly conserved nature of the sex-determination pathway across the family. As such, this sex-sorting system advantageously can be applied in agricultural pests for which pre-existing methods for sexing do not exist.

[0471] The inventors investigated the sex-specific splicing of the endogenous dsx gene (Saccone et al., 2008) to create a C. capitata Sexing Element Produced by Alternative RNA-splicing of a Transgenic Observable Reporter (SEPARATOR) system, which features positive male selection via fluorescent marker expression. The inventors initially selected the potential malespecific intronic sequence of the dsx gene and developed a piggyBac-mediated system with male-only expression of a red fluorescent protein, DsRed. The inventors then examined the phenotypic outcomes of the system and further characterised the established SEPARATOR strains through fitness analysis.

[0472] Example 2.1 - Engineering a male-specific SEPARATOR in C. capitataTo establish a sex-sorting system with a positive male selection attribute, the inventors first needed to identify an intronic sequence suitable for male-only expression of an exogenous selectable marker. The inventors hence selected the intronic region of the endogenous dsx gene (LOC101461992), the conserved transducer of the Tephritidae sex determination cascade (Bopp et al., 2014). To reduce the cargo load, the dsx ‘intron’ was truncated to 1,895 bp, encompassing three exons and two introns (Fig. 5A). This sequence was engineered into the 795Q piggyBac construct immediately downstream of the DsRed ATG start codon (Fig.

[0473] 5A). The cassette further included a constitutive Hr5-IE1-eGFP-Sv40 fluorescent marker, the expression of which was anticipated to recur in both sexes from early development and onwards. The 795Q donor plasmid was microinjected into the germline of wild-type (WT) C. capitata embryos. G1 marker-positive individuals were used to establish three independent strains (795Q-S1, -s2 and -w1). Whole genome sequencing was briefly performed to identify their underlying piggyBac insertions. Homozygosity was sufficiently obtained and maintained for all three strains.

[0474] Example 2.2 - Fluorescence manifestation in the male-specific SEPARATOR strains A strong GFP signal first appeared in late-stage embryos and persisted into adulthood in all three isolated homozygous 795Q-harbouring strains. DsRed fluorescence, on the other hand, was exclusively visible at pupal and adult stages of the life cycle, and only in male individuals. The intensity of the DsRed signal varied across the three independent strains, with males from the 795Q-w1 strain exhibiting weaker fluorescence compared to their counterparts from the remaining two strains (795Q-S1 and -s2). It is important to note that regardless of the integration nature, DsRed fluorescence was difficult to identify in heterozygous males until eclosion.

[0475] To denote the splicing patterns of DsRed on a molecular level, RNAseq analysis was performed on homozygous males (n = 3) and females (n = 3) from the 795Q-S2 strain.

[0476] Example 2.3 - Male-specific SEPARATOR strains have variable fitness levels

[0477] The inventors then carried out a series of life history assessments to determine the relative fitness of 795Q-expressing strains. First, the inventors analysed egg-adult survival amongst the homozygous strains by establishing triplicate sibling crosses of 10 males and 20 females (Kruskal-Wallis and post-hoc Dunn’s tests). Upon oviposition, their progeny were monitored at three developmental checkpoints: larval hatching, pupation and adult eclosion (Table 6, Fig.

[0478] 6A-E). Overall egg-adult survival was significantly reduced in one out of three 795Q-expressing strains, 795Q-S2 (p = 0.0087**, Dunn’s test, Fig. 6E). This was particularlyexacerbated during larval hatching (p = 0.0271*, Dunn’s test, Fig. 6B) and larval-pupal recovery (p = 0.0271*, Dunn’s test, Fig. 6C). The survival of the 795Q-w1 strain was significantly decreased compared to WT at the pupal-adult eclosion stage (p = 0.0447*, Dunn’s test, Fig. 6D). The egg-adult survival of both 795Q-S1 and 795Q-w1 strains, however, did not exhibit statistically significant reductions from WT (pS1 = 0.3670, pS2 = 0.2485, Dunn’s tests, Fig. 6E). These results suggest that the nature of the 795Q integration site affects general fitness of transgenic flies.

[0479] Table 6 Egg-adult survival assay counts

[0480] Replicate # Eggs Hatched eggs Total pupae count Total Adults 1 99 75 73 72 WT 2 145 113 110 107

[0481] 3 57 53 49 48 1 138 126 118 111 795Q-w1 2 214 188 156 145

[0482] 3 203 169 149 144 1 196 175 159 157 795Q-S1 2 182 136 129 126

[0483] 3 159 127 125 124 1 185 129 120 118 795Q-S2 2 174 90 71 68

[0484]

[0485] 3 155 63 49 46

[0486] Adult sex ratios were checked for the presence of unexpected fluorescence phenotypes (Fig.

[0487] 6F). This was also used to investigate whether 795Q-harbouring populations suffered from male-specific lethality during development. The transgenic cohorts were exclusively comprised of DsRed+ / GFP+ males and DsRed- / GFP+ females (Table 7) and did not deviate from the expected 1:1 male: female ratios (p > 0.05, χ2tests). Collectively, this data confirmed that homozygous males survived to adulthood at the anticipated rate and hence high phenotypic stability.

[0488] Table 7 Fluorescence phenotypes of the transgenic cohorts; n = 1,462.

[0489] Construct Strain DsRed+ / GFP+ DsRed+ / GFP+ DsRed- / GFP+ o DsRed- o? / GFP+ $ 795Q 795Q- s1 303 0 0 312

[0490]

[0491] 795Q- 230 0 0 225

[0492] S2

[0493] 795Q- 194 0 0 198

[0494]

[0495] w1

[0496] Longevity of newly eclosed adults from the three transgenic strains (795Q-S1, -s2 and -w1) and WT was further analysed, whereby newly eclosed virgin males and females were monitored until their death (Table 8). Notably, the strain was a significant predictor of survival (Fig. 6G). Notably, 795Q-S2 strain suffered significant reductions in longevity compared to WT (795Q-S1 - WT: HR = 0.7387, z = -1.598, p = 0.11; 795Q-S2 - WT: HR = 0.438, z = -4.216, p = 2.48e-05****; 795Q-W1 - WT: HR = 1.033, z = 0.178, p = 0.859; Cox-PH models). Sex and strain origin were additionally significant co-predictors of fly survival (Table 9). This was specifically notable amongst the 795Q-S2 males (795Q-S2 males - WT males: HR = 0.1879, z =-4.828, p = 1.38e-06****). Similar to the egg-adult survival data, these results are reflective of the influence of the piggyBac construct integration of the fitness outcomes.

[0497] The variable fitness observed among the male-specific SEPARATOR strains is primarily attributable to random piggyBac integration sites and to the presence of a large, heterologous transgenic cassette expressed under a constitutive promoter. The cassette may disrupt different endogenous loci and / or regulatory regions and imposes a continuous expression burden that can differ depending on the integration site.

[0498] By contrast, in the envisaged cisgenic architecture in which a dsx intronic sequence flanked by homology arms is inserted into the endogenous wp gene, the modification is site-specific (at a defined locus that is known to tolerate intronic sequence insertion, as demonstrated by the tra-based IMPERIAL allele), is under the native wp promoter and regulatory context, and is restricted to a compact intronic module composed of endogenous sequences, without additional heterologous coding regions.

[0499] On this basis, the inventors do not anticipate the same degree of position-effect-driven variability in fitness for a wp::dsx cisgenic construct as was observed for the random piggyBac SEPARATOR lines. Rather, the inventors would expect fitness outcomes to be broadly comparable to those of the tra-based IMPERIAL strain (i.e. close to wild-type under laboratory conditions), although, as with any genome edit, minor locus-specific effects on fitness cannot be entirely excluded and can be empirically assessed during strain development.

[0500] Table 8 Adult longevity of the three transgenic strains (795Q-S1, -s2 and -w1) and WT; N = 3, n = 30 / sex / strain, ntotal = 240.57?

[0501] 0; ■ 71 '~0: ■ i ””3i'”ii’”i..... —

[0502] —

[0503]

[0504] "id

[0505] Table 9 Cox PH model-based statistical analysis of adult longevity.

[0506] Comparison Hazard Ratio Confidence Interval z-value p-value 795Q-S1 $ - WT $ 0.728 0.4254, 1.246 -1.158 0.247 795Q-S2? - WT $ 0.5539 0.3201, 0.9584 -2.112 0.0347* 795Q-W1 | - WT $ 1.007 0.6068, 1.671 0.026 0.979 795Q-S1 $ - WT $ 0.6441 0.3739, 1.109 -1.586 0.113 795Q-S2 ♂ - WT ♂ 0.1879 0.09533, 0.3704 -4.828 1.38e-06**** 795Q-W1 o' - WT 0 1.049 0.626, 1.757 0.18 0.857 WT ♀ - WT ♂ 1.5894 0.9216, 2.741 1.666 0.0957 795Q-S1? - 795Q-S1 J 1.746 1.015, 3.005 2.013 0.0441* 795Q-S2 $ - 795Q-S2 J 4.681 2.35, 9.323 4.39 1.13e-05**** 795Q-W1 $ - 795Q-W1 1.502 0.8739, 2.582 1.472 0.141

[0507]

[0508] The inventors examined the mating preference of WT females towards homozygous 795Q-harbouring males in comparison to their WT male siblings. Hence, in conjunction with seven WT males, seven 795Q-S1 males were released into a cage with 28 WT females (N = 3, nfemales = 84). Mated females were separated into individual cages, and their offspring were screened for GFP fluorescence. In case all individuals were entirely GFP+ orGFP-, fatherhood was attributed to 795Q-S1 and WT males, accordingly. Cumulatively, WT-only paternity was identified in 54.41% of populations (ntotal = 68; Table 10), seconded by cohorts fathered by transgenic flies exclusively (33.82%). The inventors concluded that the remaining populations(11.77%) possessed mixed parentage due to the simultaneous presence of both GFP+ and GFP- phenotypes.

[0509] Table 10 Offspring phenotypes of the mating preference assay of females towards male-specific SEPARATOR and wild-type males.

[0510] By-Replicate

[0511] Counts

[0512] Paternity 1 2 3 Cumulative Counts Cumulative Percentage (%)

[0513] WT male(s) 14 11 12 37 54.41

[0514] 795Q-S1 male(s) 7 8 8 23 33.82

[0515] WT + 795Q-S1 male(s) 3 3 2 8 11.77

[0516] Total 24 22 22 68 100

[0517]

[0518] Discussion

[0519] The inventors generated and characterised a novel sex-sorting strategy in C. capitata based on positive male selection, apparent from pupation onwards. To attain this, the inventors incorporated a truncated version of the endogenous dsx intronic sequence (Saccone et al., 2008). Unlike the fra-based female-specific sex-sorting equivalents, a male-specific SEPARATOR, established presently, negates the possibility of accidental female selection in case of fluorescence marker mutation (Liu et al., 2024, 2025; Weng et al., 2023, 2024). This is because null DsRed mutations would exclusively prevent the affected males from being selected for release. During this work, no reverse fluorescence phenotypes were observed, confirming overall dsx intronic sequence splicing stability. Cumulatively, the SEPARATOR approach still enables effective production of male-only populations, aimed at upscaled SIT releases.

[0520] Due to the use of a piggyBac-based construct design in this study, the inventors tested three strains with independent genomic integrations of the 795Q cassette. As such, the inventors hoped to compensate for any potential position-dependent effects on DsRed expression. The inventors noted that one of the three strains (795Q-w1) was characterised by a weakened red fluorescence signal at pupation and adulthood alike. The remaining two strains (795Q-S1 and -s2), however, exhibited elevated fluorescence at both stages of the life cycle. This stands in contrast with the female-specific fra-based SEPARATOR system built in C. capitata, whereby DsRed fluorescence was consistent across independent strains with the same traintronic sequence origin (Davydova et al., 2023). Overall, three independent homozygous lines were show to exhibit fully penetrant male-specific DsRed expression from the pupal stage onward, with females remaining DsRed-negative and adult sex ratios remaining at approximately 1:1. RNA-seq analysis confirmed that the male-specific phenotype results from sex-specific alternative splicing of the dsx intronic sequence, and life-history assays identified at least one line with acceptable fitness for SIT-type applications (Fig. 6).

[0521] The system built herein can support the success of genetically-engineered population control alternatives requiring sex-sorting. Namely, male- and female-specific SEPARATOR strains may aid the parental cross-completion in precision-guided SIT (pgSIT) systems (Kandul et al., 2019). The outstanding advantage over, for example, female-lethality systems (Fu et al., 2007), is that the undesired sex would not be irreversibly discarded but instead would be reused for further reciprocal crosses. The male-specific SEPARATOR can serve as the basis for the establishment of endogenous sex-specific gene expression systems (cisgenic GSSs), entirely without exogenous elements (Davydova et al., 2025b). As such, the dsx intronic sequence can be integrated into the wp gene for its male-specific rescue, resulting in a golden-brown pupal pigmentation. This will also ensure a WT phenotype in the released males. Malespecific intronic sequences can be additionally used to induce male-only heat tolerance through the rescue of tsl (Aumann et al., 2025). The male-specific SEPARATOR constructed in this study is the first splicing-based system for positive male selection in any tephritid species. The C. capitata dsx intronic sequence or its endogenous equivalents is applicable for male-only fluorescent marker expression in related tephritid pests. Hence the method provided can be used in species currently with underperforming GSSs, or those lacking sex-sorting systems entirely, for positive male selection.

[0522] Materials and Methods

[0523] Construct design and generation

[0524] The fragments constituting the truncated dsx intronic sequence were amplified using primers. The 795Q construct was cloned using a pre-existing piggyBac backbone.

[0525] C. capitata rearing

[0526] The ancestral WT Benakeion (Saccone Lab, University of Naples “Federico II”) and transgenic strains were housed under standard laboratory conditions of 26°C, 12-hour on: 12-hour off light cycle, and 65% relative humidity. All fluorescence screening was performed using the MVX-ZB10 Macro Zoom Fluorescence Microscope System (Olympus). Fly imaging wasfacilitated by the cellSens software. Adults were maintained using demineralised water and an equally-proportioned yeast-sugar mixture, while larvae were grown on a carrot-based diet described previously (Sollazzo et al., 2022).

[0527] Transgenic strain isolation

[0528] Early WT medfly embryos were subjected to microinjections of the 795Q construct (500 ng / ml) along with a helper plasmid expressing a hyperactive piggyBac transposase (300 ng / ml; Eckerman et al., 2018) in a manner outlined earlier (Davydova et al., 2025a). The surviving GOs were reciprocally backcrossed to the WT strain in pools of up to 10 males and 20 females. Transgenic G1 individuals were identified upon pupation via fluorescence screening for the GFP transformation marker. GFP and DsRed signatures were verified at adulthood, after which selected G1s were separately mated with 10 WT flies of the opposite sex. Markerpositive G2 flies were sibling-crossed, and homozygous strains (795Q-S1, -s2 and -w1) were obtained following sibling crosses of their homozygous G3 offspring. The resulting transgenic strains were subsequently maintained through sibling crosses involving 10 males and 20 females.

[0529] Verification of piggyBac insertions

[0530] To determine the integration sites of the 795Q piggyBac cassette, genomic DNA (gDNA) from adults of the transgenic strains was analysed using Oxford Nanopore sequencing. gDNA was first extracted from single adults from each of the 795Q-S1, -s2 and -w1 strains using the Blood & Cell Culture DNA Midi Kit (Qiagen).

[0531] dsx intronic sequence splicing analysis

[0532] Illumina RNAseq was conducted in triplicate to denote the splicing patterns of the DsRed marker within the 795Q cassette. MiRNeasy Tissue / Cells Advanced Mini Kit (Qiagen) was used to extract total RNA and remove gDNA from three male and three female samples (795Q-s1). RNA quality and quantity were verified via the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies).

[0533] Egg-adult survival assay

[0534] To infer general line fitness, the homozygous 795Q-S1, -s2 and -w1 strains were assessed for egg-adult survival against WT controls, as detailed previously (Davydova et al., 2025a). Triplicate crosses of 10 males and 20 females were established upon eclosion for each of the tested strains. Five days later, unhatched eggs, laid within a 5-hour window, were countedusing Fiji (Schindelin et al., 2012). This was initially conducted on the day of oviposition, and secondly, four days later, to extrapolate hatching rates. Counts of pupae and adults were subsequently noted.

[0535] Sex-sorting assay

[0536] The potential presence of DsRed+ / GFP+ female and / or DsRed- / GFP+ male phenotypes was investigated. For this purpose, the homozygous G4 progeny of the 795Q-s1, -s2 and -w1 strains were reared under standard conditions until eclosion. In adulthood, entire populations were scored by sex and fluorescence (RFP and GFP).

[0537] Adult longevity assay

[0538] The potential effects of transgene expression on adult fitness were verified via a longevity assay. Newly-emerged homozygous males and females from the 795Q-S1, -s2 and -w1 strains were confined to separate cages in age-equivalent triplicates of 10, simultaneously with WT controls. Cumulatively, 30 sexually naive flies of each sex were thus tested for each strain. Fly survival was recorded daily until all individuals had died. Adult food and water supplies were regularly replenished.

[0539] Mating preference assay

[0540] To address the mating desirability of transgenic males, 28 newly eclosed WT females were placed into a cage, also housing seven WT and seven 795Q-S1 males (1:2 male: female ratio). Four days later, females were briefly anesthetised with CO2 and separated into Drosophila vials containing adult diet, a source of water and a net for oviposition. All eggs laid by single females were collected and raised under standard rearing conditions. Larvae were screened for GFP fluorescence, whereby fatherhood was determined as follows: WT (all larvae are GFP-), 795Q-s1 (all larvae are GFP+) or mixed (mixed GFP signatures). This experiment was conducted in biological triplicates.

[0541] Statistics and visualisation

[0542] Schematic diagrams were created using Inkscape 1.3.2 (Harrington & Engelen, 2004). R (version 4.4.2) and the RStudio extension were implemented for data visualisation and statistical analyses. Adult longevity data were processed using the ‘survival’ and ‘survminer’ R packages and subsequently the ‘coxme’ R package for Cox PH model-based statistical analysis. All other plots were generated using the ‘ggplot2’ R package. Egg-adult survival wasanalysed with the ‘dunn.test’ R package. Microsoft PowerPoint was used to assemble imagebased figures.

[0543] References

[0544] Ant, T., Koukidou, M., Rempoulakis, P., Gong, H. F., Economopoulos, A., Vontas, J. & Alphey, L. (2012) Control of the olive fruit fly using genetics-enhanced sterile insect technique. BMC Biology. 10, 1-8.

[0545] Augustinos, A. A., Targovska, A., Cancio-Martinez, E., Schorn, E., Franz, G., Caceres, C., Zacharopoulou, A. & Bourtzis, K. (2017) Ceratitis capitata genetic sexing strains: laboratory evaluation of strains from mass-rearing facilities worldwide. Entomologia Experimentalis Et Applicata. 164 (3), 305-317.

[0546] Aumann, R. A., Gouvi, G., Gregoriou, M., Rehling, T., Sollazzo, G., Bourtzis, K. & Schetelig, M. F. (2025) Decoding and engineering temperature-sensitive lethality in Ceratitis capitata for pest control. PNAS. 122 (28) e2503604122.

[0547] Bopp, D., Saccone, G. & Beye, M. (2014) Sex determination in insects: variations on a common theme. Sexual Development. 8 (1-3), 20-28.

[0548] Caceres, C. (2002) Mass rearing of temperature sensitive genetic sexing strains in the Mediterranean fruit fly (Ceratitis capitata). Genetica. 116 (1), 107-116.

[0549] Caceres, C., Bourtzis, K., Gouvi, G., Vreysen, M. J., Bimbile Somda, N. S., Hejnickova, M., Marec, F. & Meza, J. S. (2023) Development of a novel genetic sexing strain of Ceratitis capitata based on an X-autosome translocation. Scientific Reports. 13 (1), 16167.

[0550] Davydova, S., Liu, J., Liu, Y., Prince, K., Mann, J., Kandul, N. P., Braswell, W. E., Champer, J., Akbari, O. S. & Meccariello, A. (2025a) A self-limiting sterile insect technique alternative for Ceratitis capitata. BMC Biology. 23, 97.

[0551] Davydova, S., Liu, J., Kandul, N. P., Antoshechkin, I., Mann, J., Braswell, W. E., Akbari, O. S. & Meccariello, A. (2025b) Generating cisgenic sexing strains in insect pests. 21 April 2025, PREPRINT (Version 1). Available at Research Square: https: / / doi. Org / 10.21203 / rs.3. rs-6449302 / vl.

[0552] Davydova, S., Liu, J., Kandul, N. P., Braswell, W. E., Akbari, O. S. & Meccariello, A. (2023) Next-generation genetic sexing strain establishment in the agricultural pest Ceratitis capitata. Scientific Reports. 13 (1), 19866.Eckermann, K. N., Ahmed, H. M., KaramiNejadRanjbar, M., Dippel, S., Ogaugwu, C. E., Kitzmann, P., Isah, M. D. & Wimmer, E. A. (2018) Hyperactive piggyBactransposase improves transformation efficiency in diverse insect species. Insect Biochemistry and Molecular Biology. 98 16-24.

[0553] EPPO (2025) EPPO Global Database, https: / / gd.eppo.int [access date: 03.11.2025] FAO / IAEA (2021) World-Wide Directory of SIT Facilities. https: / / nucleus-qa.iaea.org / sites / naipc / dirsit / SitePages / AII%20Facilities.aspx [access date: 03.11.2025] Franz, G., Bourtzis, K. & Caceres, C. (2021) Practical and operational genetic sexing systems based on classical genetic approaches in fruit flies, an example for other species amenable to large-scale rearing for the sterile insect technique. In: Sterile Insect Technique. 575-604. Fu, G., Condon, K. C., Epton, M. J., Gong, P., Jin, L. Condon, G. C., Morrison, N. I., Dafa'alla, T. H. & Alphey, L. (2007) Female-specific insect lethality engineered using alternative splicing. Nature Biotechnology. 25 (3), 353-357.

[0554] Hacker, I., Bourtzis, K. & Schetelig, M. F. (2021) Applying modern molecular technologies in support of the sterile insect technique. In: Sterile insect technique. 657-702.

[0555] Harrington, B. & Engelen, J. (2004) Inkscape. URL: Http: / / Www. Inkscape. Org.

[0556] Hendrichs, J., Franz, G. & Rendon, P. (1995) Increased effectiveness and applicability of the sterile insect technique through male-only releases for control of Mediterranean fruit flies during fruiting seasons. Journal of Applied Entomology. 119 (1-5), 371-377.

[0557] Isasawin, S., Aketarawong, N., Lertsiri, S. & Thanaphum, S. (2014) Development of a genetic sexing strain in Bactrocera carambolae (Diptera: Tephritidae) by introgression of sex sorting components from B. dorsalis, Salaya1 strain. BMC Genetics. 15, 1-11.

[0558] Isasawin, S., Aketarawong, N. & Thanaphum, S. (2012) Characterization and evaluation of microsatellite markers in a strain of the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae), with a genetic sexing character used in sterile insect population control. European Journal of Entomology. 109 (3) 331-338.

[0559] Kandul, N. P., Liu, J., Hsu, A. D., Hay, B. A. & Akbari, O. S. (2020) A drug-inducible sex-separation technique for insects. Nature Communications. 11 (1), 2106.Kandul, N. P„ Liu, J., Sanchez C, H. M„ Wu, S. L., Marshall, J. M. & Akbari, O. S. (2019) Transforming insect population control with precision-guided sterile males with demonstration in flies. Nature Communications. 10 (1), 1-12.

[0560] Klassen, W., Curtis, C. F. & Hendrichs, J. (2021) History of the sterile insect technique. In: Sterile Insect Technique, CRC Press. 1-44.

[0561] Knipling, E. F. (1955) Possibilities of insect control or eradication through the use of sexually sterile males. Journal of Economic Entomology.48 (4), 459-462.

[0562] Krafsur, E. S. (1998) Sterile insect technique for suppressing and eradicating insect population: 55 years and counting. Journal of Agricultural Entomology. 15 (4), 303-317. Leftwich, P. T., Koukidou, M., Rempoulakis, P., Gong, H., Zacharopoulou, A., Fu, G., Chapman, T., Economopoulos, A., Vontas, J. & Alphey, L. (2014) Genetic elimination of fieldcage populations of Mediterranean fruit flies. Proceedings of the Royal Society B: Biological Sciences.281 (1792), 20141372.

[0563] Liu, J., Rayes, D. & Akbari, O. S. (2024) A fluorescent sex-sorting technique for insects with the demonstration in Drosophila melanogaster. GEN Biotechnology. 3 (1), 35-44.

[0564] Liu, J., Rayes, D., Yang, M. & Akbari, O. S. (2025) Fluorescent-based sex-separation technique in major invasive crop pest, Drosophila suzukii. GEN Biotechnology. 4 (1), 29-36. McCombs, S. D. & Saul, S. H. (1995) Translocation-based genetic sexing system for the oriental fruit fly (Diptera: Tephritidae) based on pupal color dimorphism. Annals of the Entomological Society of America. 88 (5), 695-698.

[0565] McInnis, D. O., Tam, S., Lim, R., Komatsu, J., Kurashima, R. & Albrecht, C. (2004) Development of a pupal color-based genetic sexing strain of the melon fly, Bactrocera cucurbitae (Coquillett) (Diptera: Tephritidae). Annals of the Entomological Society of America.97 (5), 1026-1033.

[0566] Meza, J. S., Bourtzis, K., Zacharopoulou, A., Gariou-Papalexiou, A. & Caceres, C. (2020) Development and characterization of a pupal-colour based genetic sexing strain of Anastrepha fraterculus sp. 1 (Diptera: Tephritidae). BMC Genetics. 21 (2), 1-9.

[0567] Pane, A., Salvemini, M., Bovi, P. D., Polito, C. & Saccone, G. (2002) The transformer gene in Ceratitis capitata provides a genetic basis for selecting and remembering the sexual fate. Development. 129 (15), 3715-3725.Rempoulakis, P., Taret, G., Haq, I.U., Wornayporn, V., Ahmad, S., Sto Tomas, U., Dammalage, T., Gembinsky, K., Franz, G., Caceres, C. & Vreysen, M. J. (2016) Evaluation of quality production parameters and mating behavior of novel genetic sexing strains of the Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae). PLoS One. 11 (6), e0157679.

[0568] Rendon, P., McInnis, D., Lance, D. & Stewart, J. (2004) Medfly (Diptera: Tephritidae) genetic sexing: large-scale field comparison of males-only and bisexual sterile fly releases in Guatemala. Journal of Economic Entomology. 97 (5), 1547-1553.

[0569] Ruiz, M. F„ Milano, A., Salvemini, M., Eirfn-Lopez, J. M., Perondini, A. L., Selivon, D., Polito, C., Saccone, G. & Sanchez, L. (2007) The gene transformer of Anastrepha fruit flies (Diptera, Tephritidae) and its evolution in insects. PLoS One. 2 (11), e1239.

[0570] Saccone, G., Salvemini, M., Pane, A. & Polito, L. C. (2008) Masculinization of XX Drosophila transgenic flies expressing the Ceratitis capitata Doublesex M isoform. International Journal of Developmental Biology. 52 (8), 1051-1057.

[0571] Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S. & Schmid, B., Tinevez, J-Y., White, D. J., Hartenstein, V., Eliceiri, K., Tomancak, P. & Cardona, A. (2012) Fiji: an open-source platform for biological-image analysis. Nature Methods. 9 (7), 676-682.

[0572] Scolari, F., Schetelig, M. F., Bertin, S., Malacrida, A. R., Gasperi, G. & Wimmer, E. A. (2008) Fluorescent sperm marking to improve the fight against the pest insect Ceratitis capitata (Wiedemann; Diptera: Tephritidae). New Biotechnology. 25 (1), 76-84.

[0573] Sollazzo, G., Gouvi, G., Nikolouli, K., Martinez, E. I. C., Schetelig, M. F. & Bourtzis, K. (2022) Temperature sensitivity of wild-type, mutant and genetic sexing strains of Ceratitis capitata. Insects. 13 (10), 943.

[0574] Szyniszewska, A. M., Bieszczak, H., Kozyra, K., Papadopoulos, N. T., De Meyer, M., Nowosad, J., Ota, N. & Kriticos, D. J. (2024) Evidence that recent climatic changes have expanded the potential geographical range of the Mediterranean fruit fly. Scientific Reports.

[0575] 14 (1), 2515.

[0576] Ward, C. M., Aumann, R. A., Whitehead, M. A., Nikolouli, K., Leveque, G., Gouvi, G., Fung, E., Reiling, S. J., Djambazian, H., Hughes, M. A., Whiteford, S., Caceres-Barrios, C., Nguyen, T. N. M., Choo, A., Crisp, P., Sim, S. B., Geib, S. M., Marec, F., Hacker, I., Ragoussis, J.,Darby, A. C., Bourtzis, K., Baxter, S. W. & Schetelig, M. F. (2021) White pupae phenotype of tephritids is caused by parallel mutations of a MFS transporter. Nature Communications. 12 (1), 491.

[0577] Weng, S., Antoshechkin, I., Marois, E. & Akbari, O. S. (2023) Efficient sex separation by exploiting differential alternative splicing of a dominant marker in Aedes aegypti. PLoS Genetics. 19 (11), e1011065.

[0578] Weng, S. C., Chen, F., Li, M., Lee, S., Gerry, C., Turksoy, D. C. & Akbari, O. S. (2024) Establishing a dominant early larval sex-selection strain in the Asian malaria vector Anopheles stephensi. Infectious Diseases of Poverty. 13 (1), 83.

[0579] Zepeda-Cisneros, C. S., Meza Hernandez, J. S., Garcia-Martinez, V., Ibanez-Palacios, J., Zacharopoulou, A. & Franz, G. (2014) Development, genetic and cytogenetic analyses of genetic sexing strains of the Mexican fruit fly, Anastrepha ludens Loew (Diptera: Tephritidae). BMC Genetics. 15, 1-11.

[0580] The reader's attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference.

[0581] All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and / or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and / or steps are mutually exclusive.

[0582] Each feature disclosed in this specification (including any accompanying claims, abstract and drawings), may be replaced by alternative features serving the same, equivalent, or similar purpose, unless expressly stated otherwise. Thus, unless expressly stated otherwise, each feature disclosed is one example only of a generic series of equivalent or similar features. The invention is not restricted to the details of any foregoing embodiments. The invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one, or any novel combination, of the steps of any method or process so disclosed.Numbered paragraphs

[0583] Paragraph 1. A method of sex-sorting a plurality of insects based on sex-specific gene expression, the method comprising:

[0584] (a) generating an exogenous nucleic acid molecule comprising an endogenous sex-specific gene expression system;

[0585] (b) delivering the exogenous nucleic acid molecule into an insect from the plurality of insects, wherein the exogenous nucleic acid molecule comprises a promoter region, a sex-specific splicing module, and a selectable marker gene, wherein the exogenous nucleic acid molecule is introduced into a genome of the insect by using a gene-editing agent;

[0586] (c) detecting sex-specific gene expression of the selective marker gene; and (d) sorting the insect from the plurality of insects based on the detecting of the sexspecific gene expression in step (c),

[0587] thereby sex-sorting the insect based on the sex-specific gene expression.

[0588] Paragraph 2. The method of paragraph 1, wherein the promoter region comprises an Opie2 promoter.

[0589] Paragraph 3. The method of paragraph 1 or 2, wherein the sex-specific splicing module comprises an endogenous sex-specific intronic sequence.

[0590] Paragraph 4. The method of paragraph 3, wherein the endogenous sex-specific intronic sequence comprises an endogenous transformer (tra) intron.

[0591] Paragraph 5. The method of any one of paragraphs 1 -4, wherein the selectable marker gene comprises a white pupae (wp) gene.

[0592] Paragraph 6. The method of any one of paragraphs 1-5, wherein the gene-editing agent comprises CRISPR / Cas9 components.

[0593] Paragraph 7. The method of any one of paragraphs 1 -6, wherein the exogenous nucleic acid molecule is delivered into the insect at the embryo stage of development of the insect.

[0594] Paragraph 8. The method of any one of paragraphs 1 -7, wherein the insect is sorted as male based on the expression of the selectable marker gene.Paragraph 9. The method of any one of paragraphs 1-7, wherein the insect is sorted as female based on the expression of the selectable marker gene.

[0595] Paragraph 10. The method of any one of paragraphs 1-8, wherein the insect is a Ceratitis capitata (Mediterranean fruit fly).

[0596] Sequences

[0597] Description SEQ Sequence (5’ to 3’)

[0598] ID NO:

[0599] tra intronic 1 GTAATTTTAAAAGCATAT I I I I I I CTTTGAAATTCATAAGTTAT sequence CAATTATCGATGGAAATGTATTCTATGGAGAACGTTTTACCC [origin: C. GATGAATGGGTGCAAAAATTATTTTACCTTCAAATCTACAATC capitata] AACACACGCTAACTTTTGTGACTTGATCAACTCTCACCTGGA AAAGCAACCAACTACAATCAACATTCTATGGGATAATCGACA AGTGAGTAAAATTATAGCCGGACCTCTTAGTACAGTGTATTT AAAAGG G G AATAATATTCTATCAATAG G AATAAAAATAAG GT CAGCAGCCATGACTTTTCCATCATTTTGAATATACCTTATTTG TTTCGGGATTAATTGGGGGTCGGAAATCCTCTTGAATTCAGA AACGGGAACCGGAGGAAGGTGCCGGTCTTTCAGAAAGCTGT GAAAAATACCAACATTTCTGCTGCCAAGAGCTCAATAAGAAG TTTCAAAAATTGTCTTGGATGTTGCAGCTGTGGCTGCTAAGT AATAAGACATCTATTAGTATCTAGATTTGTTAGACCATTTAAC ATAGTGTTTTAAACGATGGGGTTAATAGATGAGGGTTAAGAA GCTAGTTATATTACTGTTGCTGTAACGCCTTCAATTGTCGGT TACAGAGCAAACATTATTGAATGTTAATGTAAAGAGTTTATTT GTTTTCTAGTAAACATATAGCGATTGGTTAGTAATCACTAATA GAAAI I I I I CA I AAG I A I CAAAAAAG I AAACC I C I I I I I CAGT CTATGTAATAAGTAAACCAAGGAAAGGGAAAATATCTACAAT CAACAAGCCATTGTTGCAGCAACAAAGCAACTGAAACTACAA TCAACATTCAATAAACTTGGGTAATTTGGAATTTAATTCTCTG GGACACCTGTGGATTACAACAATCAACTCGAAACTTATTATA CAATGTAAATAAAAATTGATATGCATACATGAAGATCAAGTGA AATTCCATTTAGAATCAAT I I I I I I CGAATATTAAGTTTCTTGC TTTAATTTATCTGAAAGTAAATAGACATTCCAAATTCAAGTTA ACAAATTAATAATGAATTGACTAGTGATTTTTAAGAGAAAAAG ATAAGATTTAAAAAAGGAAAGCCTTTCTTGATAAATTTTTGAA CCACTTTATGCCGTTTCAATCATAAAAAC I I I IAAGAACACAT GACTGGTAAAATTAATTTAAAACAAATTTAAAI I I I CAACGTA ACATTCAACAAAAATGGTGAAAACTATCACGGAAATTGTTAAT ATTAATATGTCCCAAAAATAGCCTTTGTATGTATATGATACTA ATCCATACATCTATGGTATCTATAG LHA-tra 2 CTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAAT intron-RHA TTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCG GCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGT

[0600] [MA1]wp TGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGA gene: ACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAG Homology GGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTT arm left TTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAA

[0601]

[0602] AGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCG[MA2] tra- AACGTG G CG AG AAAGG AAG G G AAG AAAGCG AAAG G AG CGG intronF GCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGT [MA3]wp AACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGC gene: GCGTCCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGG homology GCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCG arm right AAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCC AGGG I l l i CCCAGTCACGACGTTGTAAAACGACGGCCAGTA Synthetic GATTAACCCTAGAAAGATAATCATATTGTGACGTACGTTAAA construct GATAATCATGCGTAAAATTGACGCATGTG 1 1 1 IATCGGTCTG TATATCGAGGTTTATTTATTAATTTGAATAGATATTAAGTTTTA TTATATTTACACTTACATACTAATAATAAATTCAACAAACAATT TATTTATGTTTATTTATTTATTAAAAAAAAACAAAACTTTCGTT GATAGAAGCATCCTCATCACAAGATGATAATAAGTATACCAT CTTAGCTGGCTTCGGTTTATATGAGACGAGAGTAAGGGGTC CGTCAAAACAAAACATCGATGTTCCCACTGGCCTGGAGCGA CTG 1 1 1 1 1 CAGTACTTCCGGTATCTCGCGTTTGTTTGCCTGC AGGTCACGTAATAAGTGTGCGTTGAATTTATTCGCAAAAACA TTGCATATTTTCGGCAAAGTAAAATTTTGTTGCATACCTTATC AAAAAATAAGTG CTG CATAC 1 1 1 1 1 AGAGAAACCAAATAATTT TTTATTGCATACCCG 1 1 1 1 1 AATAAAATACATTGCATACCCTC TTTTAATAAAAAATATTGCATACTTTGACGAAACAAATTTTCG TTGCATACCCAATAAAAGATTATTATATTGCATACCCGTTTTT AATAAAATACATTGCATACCCTCTTTTAATAAAAAATATTGCA TACGTTGACGAAACAAATTTTCGTTGCATACCCAATAAAAGA TTATTATATTGCATACCTTTTCTTGCCATACCATTTAGCCGAT CAATTGGCGCGCCTCCTGACCGTCCATCGCAATAAAATGAG CCATTATGAGATCGAAAGGGTCTACGAAAATCCGTTCGGAAA AAATCAGAAAATCATCAAAGCCGAATATAATTAAAATGTATTA CTAGCTAAAGAAATCATCACTAATATAGAATGTAGAATGAAC CATGTATATAGATACTAATGTATCGTAAGACTTTCAAAAGTCT ACAAGACATTAAATGACAAGTTGACTTTAAATTTCAAATAAAT AATTT ATTTTTTCT AT AAG C AATAAC ATTTTTG CTAAATTAAG A CTTGGTAATTAGGTAATACTATTGTTGTTCTATGGAATATTCG ATCGAAACATTCTTATCAGTCTCAAAAACTTAAAACAAACTTA TAATATAACCCATATGCACGACACGAATTGCCAAAGCAATGT TCGCTGGTAAAAGAAGAAGATAGGTAGGCATATTGTAATTTA AATAAATATTTCACTTTTAGATTTGAAAAATTTCTTTATTTGTA CTTACAGTTGTCTTGCTTTGACATATAATGAAACTGCATACTG TGAGTGGAATTACAATGGTCTGGGTATTGATTATCAAATACT TGCTGGTCCCACCTTCATATTGGTTTTCACAATTGCTGGTGT TTTTATGGGTTTCGCTGCAGATAAATATAATCGCGTTAAAATG TTAACAGTTTGTACATTGAI 1 1 1 1 GCAGTAGCCATTATATTAC AAGGTACCGTAGAAGCGTACTGGCAGCTGTTGCTGTTGCGT ATGGTCATGGCGTTGGGGTAAGCGC I l l i CTCTTAATAATAA GAAATAACAACAGATTTATTAATTTCTCTACTTCCCCAACAGT GAATCCGGTTGCAACCCACTGGCTACAGGCATTATGTCCGA CATTTTTCCCGAAAATAAGCGCGCCCTTGTTATGGCCATTTT CAACTGGGGCATCTATGGTGGTTATGGCATTGCTTTTCCCGT GGGTCGTTATATTACCAAATCGAATTTCTTCAACCTTGGCTG GCGTATGTGCTATTTGGGCACTGGTG I l l i GGCTGTATTGCT GGCCGCACTCACAGGCACCACACTCAAGGAACCAGAACGTA AAGCGATTGGTAATTTTAAAAGCATAI 1 1 1 1 1 1 CTTTGAAATT

[0603]

[0604] CATAAGTTATCAATTATCGATGGAAATGTATTCTATGGAGAACGTTTTACCCGATGAATGGGTGCAAAAATTATTTTACCTTCAAA TCTACAATCAACACACGCTAACTTTTGTGACTTGATCAACTCT CACCTGGAAAAGCAACCAACTACAATCAACATTCTATGGGAT AATCGACAAGTGAGTAAAATTATAGCCGGACCTCTTAGTACA GTGTATTTAAAAGGGGAATAATATTCTATCAATAGGAATAAAA ATAAGGTCAGCAGCCATGACTTTTCCATCATTTTGAATATAC CTTATTTGTTTCGGGATTAATTGGGGGTCGGAAATCCTCTTG AATTCAGAAACGGGAACCGGAGGAAGGTGCCGGTCTTTCAG AAAGCTGTGAAAAATACCAACATTTCTGCTGCCAAGAGCTCA ATAAGAAGTTTCAAAAATTGTCTTGGATGTTGCAGCTGTGGC TGCTAAGTAATAAGACATCTATTAGTATCTAGATTTGTTAGAC CATTTAACATAGTGTTTTAAACGATGGGGTTAATAGATGAGG GTTAAGAAGCTAGTTATATTACTGTTGCTGTAACGCCTTCAAT TGTCGGTTACAGAGCAAACATTATTGAATGTTAATGTAAAGA GTTTATTTGTTTTCTAGTAAACATATAGCGATTGGTTAGTAAT CACTAATAGAAATTTTTCATAAGTATCAAAAAAGTAAACCTCT TTTTCAGTCTATGTAATAAGTAAACCAAGGAAAGGGAAAATA TCTACAATCAACAAGCCATTGTTGCAGCAACAAAGCAACTGA AACTACAATCAACATTCAATAAACTTGGGTAATTTGGAATTTA ATTCTCTGGGACACCTGTGGATTACAACAATCAACTCGAAAC TTATTATACAATGTAAATAAAAATTGATATGCATACATGAAGA TCAAGTGAAATTCCATTTAGAATCAA I I I I I I I CGAATATTAA GTTTCTTGCTTTAATTTATCTGAAAGTAAATAGACATTCCAAA TTCAAGTTAACAAATTAATAATGAATTGACTAGTGA I I I I I AA GAGAAAAAGATAAGATTTAAAAAAGGAAAGCCTTTCTTGATA AATTTTTGAACCACTTTATGCCGTTTCAATCATAAAAACTTTT AAGAACACATGACTGGTAAAATTAATTTAAAACAAATTTAAAT TTTCAACGTAACATTCAACAAAAATGGTGAAAACTATCACGG AAATTGTTAATATTAATATGTCCCAAAAATAGCCTTTGTATGT ATATGATACTAATCCATACATCTATGGTATCTATAGGTGAGG GCGATCGTACCAAAGATGGCAAAAAGATTGGTTTGTGGAAA GTCTTGGCCAATCCTGCTATGATCATGTTGATGATTGCTGCT TCCATTCGTCACTCTGG CG G CATG ACTTTCG CTTATAATG CC GATTTATACTACAACACTTATTTCCCAGATGTTGATCTTGGCT GGTGGTTGTTCGCTGTGACCATTGGTATTGGTAGTGTTGGT GTAGTTGTTGGTGGTGTTGTTTCTGATAAAATTGTCGCTAAG ATGGGCATAAGATCACGCGCATTGGTACTTGCTGTGAGTCA ACTGATTGCCACTTTGCCTGC I l l i GGCTCCGTATACTATGA TCCACTATGGGCTATGATTACCTTGGGTTGTAGTTATTTCTTC GCTGAGATGTGGTTCGGCATTGTGTTTGCGATCGTTGTGGA AATTGTACCGTTGCAAGTGCGCTCTTCAACAATTGGCGTATT CCTATTTGTGATGAACAACGTTGGAGGAAATTTGCCAATTCT CTTGGATCCTGTAGCAAAAATGATTGGCTTCCGTGAGGCGTT TATGATC I I I IATGCTGGTTTCTATGGCATAAGTAAGTTTGAG TTGTTGAAAAATTCTATATATGTATGTATATACATATGTGCAT GCTTTATTTATTGTGTATATTCTTAAATTCTTAGGCTCCGTGC TCTTCCTTATCACCTG CTTC

[0605] Exogenous 3 CTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAAT nucleic acid TTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCG molecule GCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGT [1167A TGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGA plasmid] ACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAG

[0606]

[0607] GGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAA AGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCG AACGTG G CG AG AAAGG AAG G G AAG AAAGCG AAAG G AG CGG GCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGT AACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGC GCGTCCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGG GCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCG AAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCC AGGG I l l i CCCAGTCACGACGTTGTAAAACGACGGCCAGTA GATTAACCCTAGAAAGATAATCATATTGTGACGTACGTTAAA GATAATCATGCGTAAAATTGACGCATGTG 1 1 1 IATCGGTCTG TATATCGAGGTTTATTTATTAATTTGAATAGATATTAAGTTTTA TTATATTTACACTTACATACTAATAATAAATTCAACAAACAATT TATTTATGTTTATTTATTTATTAAAAAAAAACAAAACTTTCGTT GATAGAAGCATCCTCATCACAAGATGATAATAAGTATACCAT CTTAGCTGGCTTCGGTTTATATGAGACGAGAGTAAGGGGTC CGTCAAAACAAAACATCGATGTTCCCACTGGCCTGGAGCGA CTG 1 1 1 1 1 CAGTACTTCCGGTATCTCGCGTTTGTTTGCCTGC AGGTCACGTAATAAGTGTGCGTTGAATTTATTCGCAAAAACA TTGCATATTTTCGGCAAAGTAAAATTTTGTTGCATACCTTATC AAAAAATAAGTG CTG CATAC 1 1 1 1 1 AGAGAAACCAAATAATTT TTTATTGCATACCCGTTTTTAATAAAATACATTGCATACCCTC TTTTAATAAAAAATATTGCATACTTTGACGAAACAAATTTTCG TTGCATACCCAATAAAAGATTATTATATTGCATACCCG 1 1 1 1 1 AATAAAATACATTGCATACCCTCTTTTAATAAAAAATATTGCA TACGTTGACGAAACAAATTTTCGTTGCATACCCAATAAAAGA TTATTATATTGCATACCTTTTCTTGCCATACCATTTAGCCGAT CAATTGGCGCGCCTCCTGACCGTCCATCGCAATAAAATGAG CCATTATGAGATCGAAAGGGTCTACGAAAATCCGTTCGGAAA AAATCAGAAAATCATCAAAGCCGAATATAATTAAAATGTATTA CTAGCTAAAGAAATCATCACTAATATAGAATGTAGAATGAAC CATGTATATAGATACTAATGTATCGTAAGACTTTCAAAAGTCT ACAAGACATTAAATGACAAGTTGACTTTAAATTTCAAATAAAT AATTT ATTTTTTCT AT AAG C AATAAC ATTTTTG CTAAATTAAG A CTTGGTAATTAGGTAATACTATTGTTGTTCTATGGAATATTCG ATCGAAACATTCTTATCAGTCTCAAAAACTTAAAACAAACTTA TAATATAACCCATATGCACGACACGAATTGCCAAAGCAATGT TCGCTGGTAAAAGAAGAAGATAGGTAGGCATATTGTAATTTA AATAAATATTTCACTTTTAGATTTGAAAAATTTCTTTATTTGTA CTTACAGTTGTCTTGCTTTGACATATAATGAAACTGCATACTG TGAGTGGAATTACAATGGTCTGGGTATTGATTATCAAATACT TGCTGGTCCCACCTTCATATTGGTTTTCACAATTGCTGGTGT TTTTATGGGTTTCGCTGCAGATAAATATAATCGCGTTAAAATG TTAACAGTTTGTACATTGATTTTTGCAGTAGCCATTATATTAC AAGGTACCGTAGAAGCGTACTGGCAGCTGTTGCTGTTGCGT ATGGTCATGGCGTTGGGGTAAGCGC I l l i CTCTTAATAATAA GAAATAACAACAGATTTATTAATTTCTCTACTTCCCCAACAGT GAATCCGGTTGCAACCCACTGGCTACAGGCATTATGTCCGA CAI 1 1 1 I CCCGAAAATAAGCGCGCCCTTGTTATGGCCATTTT CAACTGGGGCATCTATGGTGGTTATGGCATTGCTTTTCCCGT GGGTCGTTATATTACCAAATCGAATTTCTTCAACCTTGGCTG GCGTATGTGCTATTTGGGCACTGGTG I l l i GGCTGTATTGCT

[0608]

[0609] GGCCGCACTCACAGGCACCACACTCAAGGAACCAGAACGTAAAGCGATTGGTAATTTTAAAAGCATAI 1 1 1 1 1 1 CTTTGAAATT CATAAGTTATCAATTATCGATGGAAATGTATTCTATGGAGAAC GTTTTACCCGATGAATGGGTGCAAAAATTATTTTACCTTCAAA TCTACAATCAACACACGCTAACTTTTGTGACTTGATCAACTCT CACCTGGAAAAGCAACCAACTACAATCAACATTCTATGGGAT AATCGACAAGTGAGTAAAATTATAGCCGGACCTCTTAGTACA GTGTATTTAAAAGGGGAATAATATTCTATCAATAGGAATAAAA ATAAGGTCAGCAGCCATGACTTTTCCATCATTTTGAATATAC CTTATTTGTTTCGGGATTAATTGGGGGTCGGAAATCCTCTTG AATTCAGAAACGGGAACCGGAGGAAGGTGCCGGTCTTTCAG AAAGCTGTGAAAAATACCAACATTTCTGCTGCCAAGAGCTCA ATAAGAAGTTTCAAAAATTGTCTTGGATGTTGCAGCTGTGGC TGCTAAGTAATAAGACATCTATTAGTATCTAGATTTGTTAGAC CATTTAACATAGTGTTTTAAACGATGGGGTTAATAGATGAGG GTTAAGAAGCTAGTTATATTACTGTTGCTGTAACGCCTTCAAT TGTCGGTTACAGAGCAAACATTATTGAATGTTAATGTAAAGA GTTTATTTGTTTTCTAGTAAACATATAGCGATTGGTTAGTAAT CACTAATAGAAA 1 1 1 1 1 CATAAGTATCAAAAAAGTAAACCTCT TTTTCAGTCTATGTAATAAGTAAACCAAGGAAAGGGAAAATA TCTACAATCAACAAGCCATTGTTGCAGCAACAAAGCAACTGA AACTACAATCAACATTCAATAAACTTGGGTAATTTGGAATTTA ATTCTCTGGGACACCTGTGGATTACAACAATCAACTCGAAAC TTATTATACAATGTAAATAAAAATTGATATGCATACATGAAGA TCAAGTGAAATTCCATTTAGAATCAA 1 1 1 1 1 1 1 CGAATATTAA GTTTCTTGCTTTAATTTATCTGAAAGTAAATAGACATTCCAAA TTCAAGTTAACAAATTAATAATGAATTGACTAGTGA 1 1 1 1 1 AA GAGAAAAAGATAAGATTTAAAAAAGGAAAGCCTTTCTTGATA AATTTTTGAACCACTTTATGCCGTTTCAATCATAAAAACTTTT AAGAACACATGACTGGTAAAATTAATTTAAAACAAATTTAAAT TTTCAACGTAACATTCAACAAAAATGGTGAAAACTATCACGG AAATTGTTAATATTAATATGTCCCAAAAATAGCCTTTGTATGT ATATGATACTAATCCATACATCTATGGTATCTATAGGTGAGG GCGATCGTACCAAAGATGGCAAAAAGATTGGTTTGTGGAAA GTCTTGGCCAATCCTGCTATGATCATGTTGATGATTGCTGCT TCCATTCGTCACTCTGG CG G CATG ACTTTCG CTTATAATG CC GATTTATACTACAACACTTATTTCCCAGATGTTGATCTTGGCT GGTGGTTGTTCGCTGTGACCATTGGTATTGGTAGTGTTGGT GTAGTTGTTGGTGGTGTTGTTTCTGATAAAATTGTCGCTAAG ATGGGCATAAGATCACGCGCATTGGTACTTGCTGTGAGTCA ACTGATTGCCACTTTGCCTGC I l l i GGCTCCGTATACTATGA TCCACTATGGGCTATGATTACCTTGGGTTGTAGTTATTTCTTC GCTGAGATGTGGTTCGGCATTGTGTTTGCGATCGTTGTGGA AATTGTACCGTTGCAAGTGCGCTCTTCAACAATTGGCGTATT CCTATTTGTGATGAACAACGTTGGAGGAAATTTGCCAATTCT CTTGGATCCTGTAGCAAAAATGATTGGCTTCCGTGAGGCGTT TATGATC I 1 1 IATGCTGGTTTCTATGGCATAAGTAAGTTTGAG TTGTTGAAAAATTCTATATATGTATGTATATACATATGTGCAT GCTTTATTTATTGTGTATATTCTTAAATTCTTAGGCTCCGTGC TCTTCCTTATCACCTGCTTCGGTACCTCACGTAATAAGTGTG CGTTGAATTTATTCGCAAAAACATTGCATATTTTCGGCAAAGT AAAATTTTGTTGCATACCTTATCAAAAAATAAGTGCTGCATAC

[0610] I l l i 1 AGAGAAACCAAA 1 AA 1 I l l i IAI I GCAI ACCUG I 1 1 1 IA

[0611]

[0612] ATAAAATACATTGCATACCCTCTTTTAATAAAAAATATTGCATACTTTGACGAAACAAATTTTCGTTGCATACCCAATAAAAGATT ATTATATTGCATACCCG 1 1 1 1 1 AATAAAATACATTGCATACCC TCTTTTAATAAAAAATATTGCATACGTTGACGAAACAAATTTT CGTTGCATACCCAATAAAAGATTATTATATTGCATACCTTTTC TTGCCATACCATTTAGCCGATCAATTCCGCGGCATACTCGGT GGCCTCCCCACCACCAAC 1 1 1 1 1 1 GCACTGCAAAAAAACACG CTTTTGCACGCGGGCCCATACATAGTACAAACTCTACGTTTC GTAGACTATTTTACATAAATAGTCTACACCGTTGTATACGCTC CAAATACACTACCACACATTGAACCTTTTTGCAGTGCAAAAA AGTACGTGTCGGCAGTCACGTAGGCCGGCCTTATCGGGTC GCGTCCTGTCACGTACGAATCACATTATCGGACCGGACGAG TGTTGTCTTATCGTGACAGGACGCCAGCTTCCTGTGTTGCTA ACCGCAGCCGGACGCAACTCCTTATCGGAACAGGACGCGC CTCCATATCAGCCGCGCGTTATCTCATGCGCGTGACCGGAC ACGAGGCGCCCGTCCCGCTTATCGCGCCTATAAATACAGCC CGCAACGATCTGGTAAACACAGTTGAACAGCATCTGTTACAG CGACACAACATGAGCCGGTCCAACAACGCCAACGCGCCCA CGCCATCCAACCGCCGCCGCAACCTGTCTCTGGTGATGGTG CG CTCCTCCAAG AACGTC ATCAAG G AGTTCATG CG CTTCAA GGTGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAG ATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCCAC AACACCGTGAAGCTGAAGGTGACCAAGGGCGGCCCCCTGC CCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTACGGC TCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTA CAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGC GTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCC AGGACTCCTCCCTGCAGGACGGCTGCTTCATCTACAAGGTG AAGTTCATCGGCGTGAACTTCCCCTCCGACGGCCCCGTAAT GCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCGC CTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACA AGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGA GTTCAAGTCCATCTACATGGCCAAGAAGCCCGTGCAGCTGC COG GCTACTACTACGTG G ACTCCAAG CTG G ACATCACCTCC CACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGCAC CGAGGGCCGCCACCACCTGTTCCTGTAGGACTCTAGATCAT AATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAA AACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAAT GCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTT AC AAATAAAG C AATAG C ATC AC AAATTTC AC AAATAAAG C ATT

[0613] 1 1 1 1 1 CACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAAT GTATCTTAAAGCTTGTCGACGATGTAGGTCACGGTCTCGAA GCCGCGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCC GGGCGCGTACTCCACCTCACCCATCTGGTCCATCATGATGA ACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAACGCGCG GCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCG GTGGTCACGGTGAGCACGGGACGTGCGACGGCGTCGGCG GGTGCGGATACGCGGGGCAGCGTCAGCGGGTTCTCGACGG TCACGGCGGGCATGTCGACAGATATCTATAACAAGAAAATAT ATATATAATAAGTTATCACGTAAGTAGAACATGAAATAACAAT ATAATTATCGTATGAGTTAAATCTTAAAAGTCACGTAAAAGAT AATCATGCGTCATTTTGACTCACGCGGTCGTTATAGTTCAAA ATCAGTGACACTTACCGCATTGACAAGCACGCCTCACGGGA

[0614]

[0615] GCTCCAAGCGGCGACTGAGATGTCCTAAATGCACAGCGACGGATTCGCGCTATTTAGAAAGAGAGAGCAATATTTCAAGAATG CATGCGTCAATTTTACGCAGACTATCTTTCTAGGGTTAATCC CTTTAGTGAGGGTTAATTTCGAGCTTGGCGTAATCATGGTCA TAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCA CACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGG TGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTC ACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGC ATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCG TATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGC GCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTC AAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACG CAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAG GAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGC TCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGT CAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGC GTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGA CCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCG GGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCT CAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGC ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGT AACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCG CCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGA GGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCT AACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCT CTG CTG AAG CCAGTTACCTTCGG AAAAAG AGTTG GTAGCTC TTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTT TTGTTTG CAAG CAG C AG ATTACG CGCAG AAAAAAAG G ATCTC AAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGT GGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTAT CAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAG TTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGAC AGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATC TGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTG TAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAG TGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAG ATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGC AGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATT AATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAAT AGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGT GTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTC CCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCA AAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGA AGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGC ACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTT TCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAG TGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACG GGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCAT CATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTT ACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCAC CCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTG GGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGA ATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTT

[0616]

[0617] TTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGG GGTTCCGCGCACATTTCCCCGAAAAGTGCCAC

[0618] Dsx intronic 4 GTAAGTGTCGTTTTCAATTTCCCTCTTTCCTAGT I I I I I AGTT sequence CTAAAC I I I IAI G I I IAI G I I I I I I I I I CAAU I I l l i I GTTGTG [origin: C. TAATAAAATGTCAATAATGAAACTATTTTAGGCCAACATGTCG capitata] TAAATGAGTACTCCCGTCAACATAATTTGAATATATTTGACGG GGGTGAACTGCGCAGTACGACTCGGCAATGTGGATGATAAT TTTTAGCTTAACAACGTAACAAGTTATGATTACAATTCAAGTA AATTAAATTAATTTTTAAAGTTTAACAAAGACGTCACTTTAATC GAATGAAAAGTAGATTAAAACTTATAGTTATAGAGTACTTTCC ATACCAAAACCAAATCAAAATCTATGAATGCTATTACTTGAAC CAGTTAAATTCTAATCAAGTTTTAAAAAGTCTCTAGATAATCT TGTTTAAAGTAGCAGAAAAATAAAACTTCATTCTTGAAAATGC ATTTGGAAAAGTGTTATAAAATAGTGTTTGAAATTAAACTACA ATCAACATACTTTTG G G AACAG CTCTTCAATCAAC ATACCAG ATGGACGCATACACACCAATAATTCTGCAATCAACAAACCCA GGCGGATAI I I I GAGTTTCTTCAGCAAACAATCCATATCATTT GGGCCGTCTGATGTCTCGATGTTAAACATTTCTGCAATCAAC AAACAAAGTACATCCTTACAACACCCAGGCAATGATGTTAAA GGTCATGCCGTCGTATACAGACACACATATAAAAAGGCGCA GTAAATATAATGACTAAGCTGTTGAATTTTTATAAATAAAATAT AATTACAATCAGTTTGG I I I I I I I I I CTAATTACGTTGTTTTAA TCAATTTAGTTCATGTAAGCCTAGGCACCAGCAAAGCGGAGT TGATTTGCATCA

[0619] gRNA-Ccwp 17 GAACGTAAAGCGATTGGCGAGGG

[0620] (including the

[0621] PAM), i.e. at

[0622] the Cas9 cut

[0623] three

[0624] nucleotides

[0625] upstream of

[0626] the NGG

[0627] PAM within

[0628]

[0629] exon 3.

Claims

Claims1. A method of sex-sorting a plurality of insects based on sex-specific gene expression, the method comprising:(a) generating an exogenous nucleic acid molecule comprising an endogenous sexspecific splicing module;(b) delivering the exogenous nucleic acid molecule into an insect from the plurality of insects, wherein the endogenous sex-specific splicing module is introduced into a selectable marker gene within the genome of the insect by using a gene-editing agent;(c) detecting sex-specific gene expression of the selectable marker gene;(d) sorting the insect from the plurality of insects based on the detecting of the sex-specific gene expression in step (c); and(e) repeating steps (b)-(d) for the plurality of insects and thereby sex-sorting the plurality of insects based on sex-specific gene expression.

2. The method of claim 1, wherein the exogenous nucleic acid molecule comprises a promoter region.

3. The method of claim 2, wherein the promoter region comprises an Opie2 promoter.

4. The method of any preceding claim, wherein the endogenous sex-specific splicing module comprises an endogenous sex-specific intronic sequence.

5. The method of claim 4, wherein the endogenous sex-specific intronic sequence is an endogenous transformer (tra) intronic sequence.

6. The method of claim 5, wherein the endogenous transformer (tra) intronic sequence comprises a nucleic acid sequence of SEQ ID NO:

17. The method of claim 4, wherein the endogenous sex-specific intronic sequence is an endogenous doublesex (dsx) intronic sequence.

8. The method of claim 7, wherein the endogenous doublesex (dsx) intronic sequence comprises a nucleic acid sequence of SEQ ID NO: 4.

9. The method of any preceding claim, wherein the selectable marker gene is the white pupae (wp) gene.

10. The method of any preceding claim, wherein the gene-editing agent comprises CRISPR / Cas9 components.

11. The method of any preceding claim, wherein the exogenous nucleic acid molecule is delivered into the insect at the embryo stage of development of the insect.

12. The method of any one of claims 1-11, wherein the insect is sorted as:i) male based on the expression of the selectable marker gene; orii) female based on the expression of the selectable marker gene.

13. The method of any preceding claim, wherein the insect is part of the Tephritidae family.

14. The method of any preceding claim, wherein the insect is part of the Anastrepha species, preferably Anastrepha ludens.

15. The method of any one of claims 1-13, wherein the insect is a Ceratitis capitata (Mediterranean fruit fly).