Amplification or detection of target material using primer and nanoparticle chain reaction

Abstract

The present disclosure relates to: a composition for amplifying or detecting a target material using a primer and nanoparticle chain reaction; and a method therefor. Specifically, the present disclosure introduces a primer to significantly reduce a false-positive rate for detecting a target material, and designs a sequence capable of capturing the primer and the target material by dividing a region into nanoparticles and substrate particles, thereby amplifying the target material within a short time using a nanoparticle chain reaction.

Description

Amplification or detection of target substances using primers and nanoparticle chain reactions

[0001] [Cross-reference to related applications]

[0002] This application claims priority to Korean Patent Application No. 10-2024-0202349 filed on December 31, 2024, the entire contents of which are incorporated by reference into this application.

[0003] The present invention relates to a composition for amplifying or detecting a target substance using a primer and a nanoparticle chain reaction, a kit including the same, and a method for amplifying or detecting a target substance using the same.

[0004]

[0005] Nucleic acid amplification technology is a technique primarily used in the fields of molecular biology and biotechnology that enables the detection and analysis of small amounts of nucleic acids. The most widely used method for nucleic acid amplification is PCR (Polymerase Chain Reaction), which analyzes DNA / RNA using thermostable enzymes. PCR is a process in which double-stranded DNA is denatured into single-stranded DNA under high temperature conditions, and then the temperature is lowered to allow primers to bind to the single strand, while the thermostable enzyme Taq polymerase extends it back into double-stranded DNA; this process is repeated.

[0006] However, when nanoparticles are used to amplify target substances using a chain reaction, the use of polymerase, which is essential in PCR technology, is not required, making management and application easier.

[0007] Accordingly, the inventors aimed to develop a technology that lowers the false positive rate for target substance detection and achieves higher selectivity and amplification efficiency for target sequences in relation to a known target substance detection technology utilizing a nanoparticle chain reaction.

[0008]

[0009] In one aspect, the object of the present invention is a composition for amplifying or detecting a target substance in a separated sample, wherein the composition comprises a primer, a nanoparticle, and a substrate particle, (a) the nanoparticle comprises one or more partial double-stranded oligonucleotides, and the partial double-stranded oligonucleotides comprise (1) a template strand comprising: (i) a target-cloning site complementary to the target-cloning strand, and (ii) a target-cloning binding site complementary to a portion (first region) of the target-cloning strand; and (2) the first region; The present invention provides a composition comprising: (b) a target-cloning strand having a sequence identical to a portion (second region) of a target oligonucleotide; wherein the target-cloning site of the template strand and the target-cloning strand are complementarily bound to form a double strand, and the target-cloning binding site is single strand, and one end of the template strand is immobilized on the surface of the nanoparticle, and (b) the substrate particle has one or more target-capture strands immobilized on its surface having a sequence complementary to the second region.

[0010] In another aspect, the object of the present invention is to provide a kit for detecting a target substance comprising a composition for amplifying or detecting a target substance within the separated sample.

[0011] In another aspect, the object of the present invention is a method for amplifying or detecting a target substance in a separated sample, wherein the method comprises: (A) mixing a substrate particle comprising a target oligonucleotide, a primer, and one or more target-capture strands, wherein a portion of the target oligonucleotide is hybridized with the primer, and another portion of the target oligonucleotide is hybridized with a portion of the substrate particle; (B) adding a nanoparticle to the mixture obtained in step (A) to form a substrate particle-nanoparticle complex, wherein, prior to the addition of the nanoparticle, an unhybridized portion of the primer is hybridized with a portion of the nanoparticle; and (C) a step of dehybridizing the complex, disassembling the complex, or both to release a target cloning strand; wherein the target oligonucleotide comprises a sequence of a second region, the substrate particle has one or more target-capture strands immobilized on its surface that have a sequence complementary to the second region, the primer comprises a sequence complementary to a portion of the target oligonucleotide that is different from the sequence of the second region, and has a sequence identical to a portion of the first region of the target-cloning strand, the nanoparticle comprises one or more partial double-stranded oligonucleotides, and the partial double-stranded oligonucleotide comprises (1) a template strand comprising: (i) a target-cloning site complementary to the target-cloning strand, and (ii) a target-cloning binding site complementary to a portion (first region) of the target-cloning strand;and (2) a target-cloning strand comprising a sequence of a first region and a second region, wherein the target-cloning site of the template strand and the target-cloning strand are complementarily coupled to form a double strand, the target-cloning binding site is a single strand, and one end of the template strand is immobilized on the surface of the nanoparticle.

[0012]

[0013] In one aspect, the present invention relates to a composition for amplifying or detecting a target substance in a separated sample, wherein the composition comprises a primer, a nanoparticle, and a substrate particle, (a) the nanoparticle comprises one or more partial double-stranded oligonucleotides, and the partial double-stranded oligonucleotides comprise (1) a template strand comprising: (i) a target-cloning site complementary to the target-cloning strand, and (ii) a target-cloning binding site complementary to a portion (first region) of the target-cloning strand; and (2) the first region; The composition provides a target-cloning strand comprising a sequence identical to a portion (second region) of a target oligonucleotide, wherein the target-cloning site of the template strand and the target-cloning strand are complementarily bound to form a double strand, and the target-cloning binding site is single strand, and one end of the template strand is immobilized on the surface of the nanoparticle, and (b) the substrate particle has one or more target-capture strands immobilized on its surface, the target-cloning strand comprising a sequence complementary to the second region.

[0014] In an exemplary embodiment, the primer may be characterized as being a partial double-stranded complex that binds complementarily to a portion of the target oligonucleotide to form sticky ends at both ends.

[0015] In an exemplary embodiment, the primer is a single-stranded oligonucleotide and may sequentially comprise the following sequence and region: (a) a sequence identical to a portion of the first region of the target-cloning strand; (b) a sequence complementary to a portion of the target oligonucleotide.

[0016] In an exemplary embodiment, the primer is a single-stranded bispecific oligonucleotide and may sequentially comprise the following sequences and regions: (a) a sequence identical to a portion of the first region of the target-cloning strand; (b) a sequence complementary to a portion of the target oligonucleotide (third region); (c) a linker region; and (d) a sequence complementary to another portion of the target oligonucleotide (fourth region).

[0017] In an exemplary embodiment, the linker region may be a polydeoxyinosine linker.

[0018] In an exemplary embodiment, the nanoparticles may comprise one or more selected from the group consisting of gold, silver, silica, platinum, copper, or gold, silver, platinum, and copper.

[0019] In an exemplary embodiment, the composition may be used for diagnosing sexually transmitted diseases.

[0020] In an exemplary embodiment, the sexually transmitted disease may be a sexually transmitted disease derived from an infection of Mycoplasma genitalium or Chlamydia trachomatis.

[0021] In another aspect, the present invention provides a kit for detecting a target substance comprising a composition for amplifying or detecting a target substance within the separated sample.

[0022] In an exemplary embodiment, the concentration of the target substance in the sample may be 5 aM to 100 aM.

[0023] In another aspect, the present invention relates to a method for amplifying or detecting a target substance in a separated sample, wherein the method comprises: (A) mixing a substrate particle comprising a target oligonucleotide, a primer, and one or more target-capture strands, wherein a portion of the target oligonucleotide is hybridized with the primer, and another portion of the target oligonucleotide is hybridized with a portion of the substrate particle; (B) adding a nanoparticle to the mixture obtained in step (A) to form a substrate particle-nanoparticle complex, wherein, prior to the addition of the nanoparticle, an unhybridized portion of the primer is hybridized with a portion of the nanoparticle; and (C) a step of dehybridizing the complex, disassembling the complex, or both to release a target cloning strand; wherein the target oligonucleotide comprises a sequence of a second region, the substrate particle has one or more target-capture strands immobilized on its surface that have a sequence complementary to the second region, the primer comprises a sequence complementary to a portion of the target oligonucleotide that is different from the sequence of the second region, and has a sequence identical to a portion of the first region of the target-cloning strand, the nanoparticle comprises one or more partial double-stranded oligonucleotides, and the partial double-stranded oligonucleotide comprises (1) a template strand comprising: (i) a target-cloning site complementary to the target-cloning strand, and (ii) a target-cloning binding site complementary to a portion (first region) of the target-cloning strand;and (2) a target-cloning strand comprising a sequence of a first region and a second region, wherein the target-cloning site of the template strand and the target-cloning strand are complementarily coupled to form a double strand, and the target-cloning binding site is a single strand, and one end of the template strand is immobilized on the surface of the nanoparticle.;

[0024] In an exemplary embodiment, the target-cloning strand released in step (C) becomes the next target for amplification, and steps (D) to (F) below may be repeated one or more times: (D) adding the target-cloning strand to the substrate particle to hybridize a portion of the target-cloning strand (second region) with the target-capture strand of the substrate particle; (E) adding one or more of the nanoparticles to the mixture obtained in step (D) to form a complex between the substrate particle and the nanoparticle, wherein a portion of the target-cloning strand (first region) and a portion of the nanoparticle are hybridized; (F) performing dehybridizing of the partial double-stranded oligonucleotide of the nanoparticle, disassembling of the complex, or both to release the target-cloning strand.

[0025] In an exemplary embodiment, the substrate particles and nanoparticles may be of two or more different target oligonucleotides and may be characterized by amplifying or detecting two or more target substances.

[0026]

[0027] The composition and method for nucleic acid amplification or detection according to the present invention exhibit excellent detection specificity for target sequences following the introduction of primers, and since the false positive rate for target detection is low even when the concentration of the target sequence in the sample is low, the detection limitations of conventional nucleic acid amplification / detection technologies can be overcome. Furthermore, the introduction of primers facilitates the detection of target substances having long oligonucleotide sequences. In the case of conventional nucleic acid amplification or detection methods using nanoparticle chain reaction, a target-cloning strand that is entirely complementary to a portion of the template strand of the nanoparticle is used, and since the sequences of the target-cloning strand and the target substance must be entirely identical, the length of the target-cloning strand may be limited to a specific length or less. However, when a primer composition is introduced, the need for the sequences of the target-cloning strand and the target substance to be entirely identical is eliminated, making it possible to detect target substances having sequences longer than the target-cloning strand without extending the sequence of the target-cloning strand.

[0028] The composition and method of the present invention have high target selectivity and improved amplification efficiency.

[0029] Specifically, the composition and method of the present invention can further enhance binding selectivity toward a target by utilizing a dual-specificity oligonucleotide primer (DPO (Dual Priming Oligonucleotide) primer) and enable rapid nucleic acid amplification through a nanoparticle chain reaction. While the dual-specificity oligonucleotide improves binding selectivity toward a target by introducing a primer, it has the disadvantage of low target amplification efficiency due to the weak binding affinity of the linker region within the primer. However, by introducing a nanoparticle chain reaction, nucleic acid amplification efficiency can be increased, thereby overcoming the disadvantage of the dual-specificity oligonucleotide primer.

[0030]

[0031] Figure 1a illustrates the case where both the substrate particle and the nanoparticle form a bond to the DPO (Dual Priming Oligonucleotide) primer-target sequence complex (nanoparticle-substrate particle complex), Figure 1b shows the complementary regions of each sequence divided in the case where the nanoparticle-substrate particle complex is formed (for example, regions a and a* are regions that are complementary to each other, and the direction of all arrows indicates the 5' to 3' direction of the oligonucleotide), and Figure 1c shows the names of each region or each strand of the oligonucleotide contained within the substrate particle and the nanoparticle in the case where the nanoparticle-substrate particle complex is formed.

[0032] Figure 2 illustrates the principle of forming a particle aggregate using a DPO primer.

[0033] Figure 3 illustrates the specific structures of the DPO primer and target oligonucleotide for binding to the magnetic particle-NCR probe.

[0034] Figure 4 illustrates a case showing that a probe can selectively bind based on whether there is a mismatch in the target sequence, based on a DPO primer.

[0035] Figure 5 illustrates the driving principle of the first cycle for detecting a target substance by introducing a DPO primer, and the second and subsequent cycles for amplifying the target-cloning strand using an NCR nanoparticle chain reaction.

[0036] Figure 6 is an experimental result confirming that the DPO primer and the target sequence formed adhesive ends.

[0037] Figure 7 is an experimental result confirming that a positive fluorescence signal can be detected when all four driving elements (target, DPO primer, magnetic bead, and NCR probe) constituting DPO-NCR are satisfied.

[0038] Figure 8 shows the experimental results confirming the selectivity of DPO primers for mismatch sequences.

[0039] Figure 9 illustrates the results of a comparative experiment on the NCR reaction when using a DPO primer versus a conventional primer, and the structures when using a conventional primer and a DPO primer.

[0040] Figure 10 illustrates the DNA amplification cycle of the NCR assay.

[0041] Figure 11 shows the experimental results of fluorescence signal detection using conventional primers according to the NCR cycle.

[0042] Figure 12 shows the experimental results of fluorescence signal detection using DPO primers according to target concentration.

[0043] Figure 13 shows the experimental results of positive and negative signal detection using DPO primers.

[0044]

[0045] The present invention will be described in more detail below.

[0046]

[0047] Definition of Terms

[0048] In this specification, the term “target material” refers to a substance to be finally amplified or detected in the composition, kit, and / or method for amplification and detection provided in this specification, and may be selected from all substances having biological activity. For example, the target material may be one or more selected from the group consisting of an organism to be amplified or detected (various eukaryotic or prokaryotic cells; e.g., viruses, bacteria, fungi, etc.) or a biologically active substance, e.g., nucleic acid molecules (e.g., whole genome (DNA or RNA), genome fragment, gene, gene fragment, siRNA, miRNA, biomarker, other DNA or RNA fragments, etc.), proteins, peptides, polymers, small molecule chemicals (e.g., chemical drugs containing one or more selected from the group consisting of various metal ions, organic compounds, etc.), but is not limited thereto. For example, the bioactive substances such as nucleic acid molecules, proteins, and peptides may be derived from the organisms described above (e.g., viruses, bacteria, fungi, etc.), but are not limited thereto, and may be recombinantly or chemically synthesized.

[0049] In this specification, the term “sample” may mean any biological and / or environmental sample for which the presence and / or level of a target substance is to be measured. For example, biological samples may be selected from the group consisting of cells, tissues, blood, lymph, saliva, sputum, nasal discharge, urine, feces, and other body fluids isolated from a subject (patient), but are not limited thereto. The subject may include, but is not limited to, humans, livestock (e.g., cattle, pigs, horses, sheep, goats, dogs, cats, etc.), and birds (chickens, ducks, geese, turkeys, ostriches, quail, etc.).

[0050] In this specification, the term “target oligonucleotide” means an oligonucleotide to be directly detected by the first cycle of the chain reaction provided in this specification, and is also referred to as a “target strand,” and the two terms are interchangeable with equivalent meanings. In one example, where the term target oligonucleotide is a nucleic acid molecule, it may be the whole (where said nucleic acid molecule is a DNA fragment and / or an RNA fragment) or a part thereof (the sequence to be amplified; e.g., a part unique to said nucleic acid molecule).

[0051] In this specification, the term “primer” refers to a single-stranded oligonucleotide for forming a conjugate with the target substance and nanoparticles provided herein to more specifically capture the target substance. The primer may comprise a nucleic acid sequence complementary to a portion of the target-cloning binding region and a nucleic acid sequence complementary to at least one region of the target oligonucleotide. The primer is an essential component in the first cycle for the detection and amplification of the target substance and is required for the formation of a nanoparticle-substrate particle conjugate.

[0052] In this specification, the term “dual-specificity oligonucleotide primer” means that among the primers, a nucleic acid sequence complementary to a part of the target-cloning binding region, a nucleic acid sequence complementary to at least two regions of the target oligonucleotide, and a linker region are included. The dual-specificity oligonucleotide primer may include, sequentially based on the single-strand 5' of the primer, 1) a nucleic acid sequence complementary to a part of the target-cloning binding region, 2) a nucleic acid sequence complementary to a part of the target oligonucleotide (referred to as the third region), 3) a linker region, and 4) a nucleic acid sequence complementary to another part of the target oligonucleotide (referred to as the fourth region). Additionally, the nucleic acid sequences at both ends separated based on the linker region of the dual-specificity oligonucleotide primer may each have different Tm specificities in terms of annealing specificity for the target sequence. As such, the term “double specificity” is used to describe a unique feature in which the annealing specificity for a target sequence is determined doubly by splitting two sites (a 5’-high Tm specificity site and a 3’-low Tm specificity site). Generally, the annealing specificity of a primer or probe is determined by a continuous base sequence. In contrast, the hybridization specificity of the double-specificity oligonucleotide primer is determined doubly by two sites (a 5’-high Tm specificity site and a 3’-low Tm specificity site) split by the splitting site, and these three sites exist on a single oligonucleotide sequence. The double specificity and Tm specificity of the double-specificity oligonucleotide primer have already been identified in a known patent specification (Korean Patent Publication No. 10-2009-0005183).

[0053] In this specification, the term “linker region” refers to a region that does not form a bond with the target oligonucleotide, and upon hybridization of the dual-specificity oligonucleotide primer with the target oligonucleotide, a non-base-pair bubble structure is formed, splitting into two ends based on the linker region to enable binding with the target oligonucleotide.

[0054] In this specification, the term “template strand” refers to a single-stranded oligonucleotide used as a template for target oligonucleotide amplification in the NCR technology provided herein, and may include a target-cloning site having a nucleic acid sequence complementary to a portion of the target oligonucleotide sequence and the full-length sequence of the target-cloning strand, and a target-cloning binding site having a nucleic acid sequence complementary to a portion of the target-cloning strand and a portion of the primer. The template strand may be an oligonucleotide of length 10-1000 nt, 10-500 nt, 10-200 nt, 10-100 nt, 10-90 nt, 10-80 nt, 10-70 nt, 10-60 nt, 10-55 nt, 10-50 nt, or 10-45 nt, but is not limited thereto.

[0055] In this specification, the term “target-cloning strand” refers to a single-stranded oligonucleotide having a portion of the amplification target sequence of a target oligonucleotide and capable of hybridizing (complementary binding) with the target-cloning site of a template strand. The target-cloning strand is a target for amplification in the second or subsequent cycles of the chain reaction provided herein.

[0056] In this specification, the term “target-capturing strand” refers to a single-stranded oligonucleotide having a nucleic acid sequence complementary to a portion of the target oligonucleotide and the target-cloning strand, which functions to capture a target oligonucleotide or a target-cloning strand in a substrate particle. Since sequences complementary to a portion of the target-cloning strand are present in both the target-capturing strand and the template strand, an amplification reaction is possible in the second or subsequent cycles of a nanoparticle chain reaction solely by adding nanoparticles containing a partially double-stranded oligonucleotide.

[0057] In this specification, the phrase “a nucleic acid molecule or protein has a specific nucleic acid sequence or amino acid sequence” may mean that it includes said sequence or is essentially composed of said sequence.

[0058]

[0059] In one aspect, the present invention relates to a composition for amplifying or detecting a target substance in a separated sample, wherein the composition comprises a primer, a nanoparticle, and a substrate particle, (a) the nanoparticle comprises one or more partial double-stranded oligonucleotides, and the partial double-stranded oligonucleotides comprise (1) a template strand comprising: (i) a target-cloning site complementary to the target-cloning strand, and (ii) a target-cloning binding site complementary to a portion (first region) of the target-cloning strand; and (2) the first region; The composition provides a target-cloning strand comprising a sequence identical to a portion (second region) of a target oligonucleotide, wherein the target-cloning site of the template strand and the target-cloning strand are complementarily bound to form a double strand, and the target-cloning binding site is single strand, and one end of the template strand is immobilized on the surface of the nanoparticle, and (b) the substrate particle has one or more target-capture strands immobilized on its surface, the target-cloning strand comprising a sequence complementary to the second region.

[0060] The above nanoparticles comprise one or more (e.g., two or more or multiple) partially double-stranded oligonucleotides on their surface. The partially double-stranded oligonucleotides may be fixed (attached) to the surface of the nanoparticles directly or through a linker (first linker) at one end of the template strand (e.g., the end connected to the target-cloning binding site and the other end of the two ends of the target-cloning site within the template strand).

[0061] In other words, the nanoparticle may have, on its surface, (1) a template strand comprising: (i) a target-cloning site fixed to the surface directly or through a linker (a first linker); and (ii) a target-cloning binding site connected to one end of the target-cloning site (e.g., a different end from the end fixed to the nanoparticle surface); and (2) a (complementary) target-cloning strand capable of hybridizing with the target-cloning site of the template strand. In this case, the target-cloning site of the template strand and the target-cloning strand hybridize to form a partially double-stranded oligonucleotide having a partially double-stranded structure, and the target-cloning binding site of the template strand may be in an exposed form. The target-cloning binding site has a region capable of hybridizing with the target-cloning strand and also capable of hybridizing with the primer.

[0062] The number of partial double-stranded oligonucleotides immobilized (attached) to the surface of each of the above nanoparticles may be 1 or more, 2 or more, 10 or more, 20 or more, 50 or more, 70 or more, 100 or more, 120 or more, 150 or more, or 170 or more, but is not limited thereto.

[0063] The above nanoparticles may be made of a material capable of being visible (e.g., naked-eye-detectable) and / or conjugated to biomolecules (e.g., nucleic acid molecules, antibodies, etc.), such as metals like gold (e.g., gold nanoparticles), silver (e.g., silver nanoparticles), platinum, copper, alloys (e.g., containing two or more selected from the group consisting of gold, silver, platinum, copper, etc.), silica, hydrogels, carbon nanotubes, quantum dots, etc., but are not limited thereto. Additionally, for example, the above nanoparticles may be made visible by a fluorescent label contained in an oligonucleotide bound to the surface. The size (average diameter) of the above nanoparticles may be 1 to 1000 nm, 1 to 500 nm, 1 to 200 nm, 1 to 100 nm, 10 to 1000 nm, 10 to 500 nm, 10 to 200 nm, or 10 to 100 nm, but is not limited thereto. The above nanoparticles are not subject to any particular restrictions on their structure and / or shape, and may, for example, have a solid structure, a core-shell structure, a hollow structure, etc., and / or have a circular, elliptical, tubular, polygonal structure, etc., but are not limited thereto. Depending on the type of nanoparticle, the level of biomolecular binding, amplification, and / or visibility may be controlled.

[0064] The above nanoparticles can be used as probes (NCR probes) for detecting or amplifying target oligonucleotides and / or target-cloning strands.

[0065] If the target substance is a substance other than a nucleic acid molecule, the nanoparticle may additionally include a binding substance for the target substance in addition to the partially double-stranded oligonucleotide described above. The binding substance for the target substance may be one or more selected from the group consisting of antibodies, aptamers, small molecule chemicals, etc., capable of binding (e.g., specific binding) to a portion of the target substance.

[0066] The above substrate particle refers to any type of particle having a surface capable of immobilizing a target substance or a capture substance of a target-cloning strand (e.g., oligonucleotides, antibodies, peptides, polymer compounds, etc.).

[0067] The above substrate particle has one or more (e.g., two or more or multiple) target-capturing strands (or target-capturing oligonucleotides) immobilized (attached, adhered) on its surface, having sequences that are hybridizable or complementary to a portion of the target oligonucleotide. Additionally, the sequences that are hybridizable or complementary to the portion of the target oligonucleotide may simultaneously be hybridizable or complementary to a portion of the target-cloning strand. The target-capturing strands may be immobilized (attached) on the surface of the substrate particle directly or through a linker (second linker).

[0068] The number of target-capture strands immobilized (attached) to the surface of each substrate particle must be sufficiently large to cover the number of nanoparticles. For example, the number of target-capture strands included per substrate particle is 10 or more, 50 or more, 10 2 More than 10 3 More than 10 5 More than 10 6 More than 10 7 One or more, or 10 8There may be more than one, but it is not limited to this.

[0069] The above substrate particles may be made of a solid material, and in order to facilitate the collection / purification of the composite formed with the above nanoparticles, they may be one or more selected from the group consisting of magnetic particles, beads (e.g., magnetic beads, etc.), but are not limited thereto. In one example, the above substrate particles may be made of materials such as metals (e.g., gold nanoparticles), silver (e.g., silver nanoparticles), platinum, copper, alloys (e.g., including two or more selected from the group consisting of gold, silver, platinum, copper, etc.), silica, hydrogel, carbon nanotubes, quantum dots, etc., but are not limited thereto. Furthermore, the size (average diameter) of the above substrate particles must be sufficiently larger than that of the above nanoparticles, and may be at least 2 times, at least 5 times, at least 10 times, at least 20 times, at least 30 times, at least 40 times, or at least 50 times the size (average diameter) of the nanoparticles, for example, 0.1 to 100 The size may be μm, 0.1 to 50 μm, 0.1 to 20 μm, 0.1 to 10 μm, 0.1 to 8 μm, 0.1 to 5 μm, 0.1 to 3 μm, 0.5 to 100 μm, 0.5 to 50 μm, 0.5 to 20 μm, 0.5 to 10 μm, 0.5 to 8 μm, 0.5 to 5 μm, 0.5 to 3 μm, 1 to 100 μm, 1 to 50 μm, 1 to 20 μm, 1 to 10 μm, 1 to 8 μm, 1 to 5 μm, or 1 to 3 μm, but is not limited thereto. The substrate particles are not subject to any particular restrictions on their structure and / or shape, and may be, for example, a solid structure, a core-shell structure, or a hollow structure. It may have a back, and / or may have a circular, elliptical, tubular, polygonal structure, etc., but is not limited thereto.

[0070] If the target substance is a substance other than a nucleic acid molecule, the substrate particle may additionally include a capture substance for the target substance in addition to the target-capture strand described above. The capture substance for the target substance may be one or more selected from the group consisting of antibodies, aptamers, small molecule chemicals, etc., capable of binding (e.g., specific binding) to a portion of the target substance. In this case, the capture substance for the target substance included in the substrate particle and the binding substance for the target substance included in the nanoparticle may bind to different sites of the target substance. That is, in the target substance, the binding sites of the capture substance and the binding substance may not overlap with each other.

[0071] The above-mentioned region or area may be a single-stranded nucleic acid sequence.

[0072] The first region is the same sequence as a part of the target-cloning strand and a part of the primer. A sequence complementary to the first region exists in two or more different regions of the template strand. In FIG. 1b, the first region corresponds to region a, and the region complementary to the first region corresponds to a*.

[0073] The second region is a sequence identical to a part of the target-cloning strand and a part of the target oligonucleotide that is different from the sequence of the first region. A sequence complementary to the second region is present in a part of the template strand and a part of the target-capture strand. In FIG. 1b, the second region corresponds to region b, and the region complementary to the second region corresponds to b*.

[0074] In an exemplary embodiment, the primer may be characterized as being a partial double-stranded complex that binds complementarily to a portion of the target oligonucleotide to form sticky ends at both ends. For example, as shown in FIG. 3, when the primer and the target oligonucleotide are hybridized (forming a double strand), some regions from the 5' end of the primer and the target oligonucleotide remain in a single-stranded form, thereby forming sticky ends.

[0075] In an exemplary embodiment, the primer is a single-stranded oligonucleotide and may sequentially comprise the following sequence and region: (a) a sequence identical to a portion of the first region of the target-cloning strand; (b) a sequence complementary to a portion of the target oligonucleotide.

[0076] For example, the above (b) of the primer may be designed to include a sequence complementary to the following third region and / or fourth region.

[0077] In an exemplary embodiment, the primer is a single-stranded bispecific oligonucleotide and may sequentially comprise the following sequences and regions: (a) a sequence identical to a portion of the first region of the target-cloning strand; (b) a sequence complementary to a portion of the target oligonucleotide (third region); (c) a linker region; and (d) a sequence complementary to another portion of the target oligonucleotide (fourth region).

[0078] The third and fourth regions each represent distinct sequences identical to a part of the target oligonucleotide. Additionally, the third and fourth regions can be distinguished separately by forming a target oligonucleotide region (corresponding to region d in Fig. 1b) that does not bind to the primer due to the linker region (corresponding to region f in Fig. 1b). In Fig. 1b, the third region corresponds to region c, and the region complementary to the third region corresponds to c*. Also, in Fig. 2, the fourth region corresponds to region e, and the region complementary to the fourth region corresponds to region e*.

[0079] In an exemplary embodiment, the linker region may be a polydeoxyinosine linker. It has been confirmed that a non-base pair bubble can be formed by using the polydeoxyinosine linker. The polydeoxyinosine linker may mean a plurality of deoxyinosines bonded together. Additionally, it may include, for example, a linker bonded with 2-10, 2-8, 3-7, or 4-6 deoxyinosines, but is not limited thereto.

[0080] The inventors have conducted target substance detection experiments using conventional primers and DPO primers individually through examples. Both primers exhibited excellent detection reactions for target substances, and it was confirmed that the false positive rate of the DPO primer was significantly lower compared to the conventional primer. The above-mentioned conventional primer refers to a primer commonly used in the industry.

[0081] In an exemplary embodiment, the nanoparticles may comprise one or more selected from the group consisting of gold, silver, silica, platinum, copper, or gold, silver, platinum, and copper.

[0082] In an exemplary embodiment, the composition may be used for diagnosing sexually transmitted diseases.

[0083] In an exemplary embodiment, the sexually transmitted disease may be a sexually transmitted disease derived from an infection of Mycoplasma genitalium or Chlamydia trachomatis.

[0084] The inventors have conducted nucleic acid sequence detection and amplification reaction experiments to confirm whether the isolated samples are infected with Mycoplasma genitalium and Chlamydia trachomatis as described in the following examples. Sequence number in Table 1 is a sequence designed to confirm whether the samples are infected with Mycoplasma genitalium, and sequence number in Table 2 is a sequence designed to confirm whether the samples are infected with Chlamydia trachomatis, and the uses of the sequences are described in Tables 1 and 2, respectively.

[0085]

[0086] In another aspect, the present invention provides a kit for detecting a target substance comprising a composition for amplifying or detecting a target substance within the separated sample.

[0087] In an exemplary embodiment, the concentration of the target substance in the sample may be 5 aM to 100 aM. For example, the concentration of the target substance in the sample may be 5 aM or more, 5.5 aM or more, 6 aM or more, 6.5 aM or more, 7 aM or more, 7.5 aM or more, 8 aM or more, 8.5 aM or more, 9 aM or more, 9.5 aM or more, or 10 aM or more, but is not limited thereto. In addition, the concentration of the target substance in the sample may be 100 aM or less, 95 aM or less, 90 aM or less, 85 aM or less, 80 aM or less, 75 aM or less, 70 aM or less, 65 aM or less, 60 aM or less, 55 aM or less, 50 aM or less, 45 aM or less, 40 aM or less, 35 aM or less, 30 aM or less, 25 aM or less, 20 aM or less, or 15 aM or less, but is not limited thereto.

[0088]

[0089] In another aspect, the present invention relates to a method for amplifying or detecting a target substance in a separated sample, wherein the method comprises: (A) mixing a substrate particle comprising a target oligonucleotide, a primer, and one or more target-capture strands, wherein a portion of the target oligonucleotide is hybridized with the primer, and another portion of the target oligonucleotide is hybridized with a portion of the substrate particle; (B) adding a nanoparticle to the mixture obtained in step (A) to form a substrate particle-nanoparticle complex, wherein, prior to the addition of the nanoparticle, an unhybridized portion of the primer is hybridized with a portion of the nanoparticle; and (C) a step of dehybridizing the complex, disassembling the complex, or both to release a target cloning strand; wherein the target oligonucleotide comprises a sequence of a second region, the substrate particle has one or more target-capture strands immobilized on its surface that have a sequence complementary to the second region, the primer comprises a sequence complementary to a portion of the target oligonucleotide that is different from the sequence of the second region, and has a sequence identical to a portion of the first region of the target-cloning strand, the nanoparticle comprises one or more partial double-stranded oligonucleotides, and the partial double-stranded oligonucleotide comprises (1) a template strand comprising: (i) a target-cloning site complementary to the target-cloning strand, and (ii) a target-cloning binding site complementary to a portion (first region) of the target-cloning strand;and (2) a target-cloning strand comprising a sequence of a first region and a second region, wherein the target-cloning site of the template strand and the target-cloning strand are complementarily coupled to form a double strand, and the target-cloning binding site is a single strand, and one end of the template strand is immobilized on the surface of the nanoparticle.;

[0090] In step (C) above, the dehybridizing of the complex and / or the disassembling of the complex (sandwich complex assembly) (e.g., by the dehybridizing) may be performed by conventional dehybridizing means. For example, the dehybridizing may be performed by one or more selected from the group consisting of increasing pH (e.g., basic conditions), increasing temperature (e.g., increasing to a range of 50 to 100°C, 52 to 100°C, 55 to 100°C, 50 to 90°C, 52 to 90°C, etc.) compared to the hybridization reaction, and decreasing salt concentration. For example, in the embodiments of the present invention, the salt solution was replaced with distilled water and the temperature was lowered, but it is not limited thereto. Through this process, the hybridized target oligonucleotide, hybridized primer, and / or hybridized target-cloning strand (having identical nucleic acid sequences) are each dehybridized and released in a single-strand form. Additionally, during this process, the binding (hybridization) between the target oligonucleotide, primer, nanoparticle, substrate particle, and primer is also decomposed due to dehybridization, causing the nanoparticle and substrate particle that were forming a complex through the target oligonucleotide and primer to separate (release). The target-cloning strand and nanoparticle released in this manner can be used in subsequent cycles.

[0091] In the above method, after step (B), a step of separating, collecting, and / or concentrating the complex may be additionally included (B-1), wherein step (C) may be performed on the separated, collected, and / or concentrated complex. The separation, collection, and / or concentrating of the complex may be performed by applying a magnetic field (e.g., using a magnet; if the substrate particles are magnetic particles), and / or centrifugation, but is not limited thereto, and may be performed by a conventional method appropriately selected considering the material and characteristics of the particles used.

[0092] In an exemplary embodiment, the target-cloning strand released in step (C) becomes the next target for amplification, and steps (D) to (F) below may be repeated one or more times: (D) adding the target-cloning strand to the substrate particle to hybridize a portion of the target-cloning strand (second region) with the target-capture strand of the substrate particle; (E) adding one or more of the nanoparticles to the mixture obtained in step (D) to form a complex between the substrate particle and the nanoparticle, wherein a portion of the target-cloning strand (first region) and a portion of the nanoparticle are hybridized; (F) performing dehybridizing of the partial double-stranded oligonucleotide of the nanoparticle, disassembling of the complex, or both to release the target-cloning strand.

[0093] The target-cloning strand released in a single-strand form in step (C) above is used again as a target for amplification in step (D), and the nanoparticle released in step (C) is used as an NCR probe to perform the next cycle. At this time, one target-cloning strand is amplified by the number of target-cloning strands contained in one nanoparticle, and in the next cycle, the step proceeds with nanoparticles bound to one substrate particle equal to the number of target-cloning strands released. Therefore, one released target-cloning strand is amplified by a number obtained by multiplying the number of target-cloning strands contained per nanoparticle by the number of cycles.

[0094] The number of target-cloning strands (m) per nanoparticle may be 2 or more, 10 or more, 20 or more, 50 or more, 70 or more, 100 or more, 120 or more, 150 or more, or 170 or more, but is not limited thereto. Additionally, for example, the number of cycles (n) may be 1 to 20 times, 1 to 15 times, 1 to 10 times, 1 to 5 times, 2 to 20 times, 2 to 15 times, 2 to 10 times, 2 to 5 times, 3 to 20 times, 3 to 15 times, 3 to 10 times, or 3 to 5 times, but is not limited thereto.

[0095] In an exemplary embodiment, the substrate particles and nanoparticles may be of two or more different target oligonucleotides and may be characterized by amplifying or detecting two or more target substances.

[0096] The above method can be applied to the multiple detection and / or amplification of two or more different target substances by using two or more types of nanoparticles for different target substances.

[0097] The present invention may provide a composition, kit, and / or method capable of simultaneously amplifying and detecting two or more target substances (target nucleic acid molecules) by using two or more nanoparticles comprising template strands and target-cloning strands for different target substances (target nucleic acid molecules), primers for different target substances (target nucleic acid molecules), and / or two or more substrate particles comprising target-capture strands for different target substances (target nucleic acid molecules). In the multiple detection / amplification, if one or more of the two or more target substances is a substance other than a nucleic acid molecule, the nanoparticles may additionally comprise a binding substance for said target substance other than a nucleic acid molecule. In this case, the concentration of said target substance in the sample is as described above.

[0098]

[0099] Examples

[0100] 1. Preparation of materials

[0101] 50 nm citric acid-stabilized gold nanoparticles were purchased from BBI Solutions (Cardiff, UK). Dynabeads™ Myone™ Carboxylic Acid was purchased from Thermo Fisher Scientific (Waltham, MA, USA). All chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA) and used as is without further purification. Oligonucleotides were purchased from Integrated DNA Technologies, Inc. Distilled water was obtained using a Millipore system (>18.0 MΩ, Milli-Q) and used for all experiments. Perfect Hyb™ Plus Hybridization Buffer (Sigma-Aldrich) and 2x PBS Buffer were mixed in a 1:3 ratio, and the mixture was used as the hybridization buffer in NCR analysis.

[0102] The DNA sequences designed for the detection and experiment of Mycoplasma Genitalium and Chlamydia trachomatis are shown in Table 1 and Table 2, respectively.

[0103]

[0104] Sequence Number Synthetic oligonucleotides Sequences (5' → 3') Sequence Number 1 Synthetic target strand (target substance) ACTTGTATTCAGTAATTAAAACCCACGGAAATGATGAGATTTTTATTGGTTCTACSH-A 10 -[Sequence No. 2]Template strandSH-A 10- GCGTGATGTTAGGACAATTACTGAATACAAAGTGCGTGATGTTAGGAC[SEQ ID No. 3]-TAMRAtcDNA strand ACTTTGTATTCAGTAATTGTCCTAACATCACGC-TAMRA SEQ ID No. 4 Toehold strand GCGTGATGTTAGGACAATTACTGAATACAAAGT[SEQ ID No. 5] -(C2H4O)6- NH2 Magnetic beads strand AATTACTGAATACAAAGTAAAAAAAAAA-(C2H4O)6- NH2[SEQ ID No. 6]-IIIII-[SEQ ID No. 7] DPO Primer strand (Example 1) GTCCTAACATCACGCGTAGAACCAAT IIIII TCTCATCATTTCCGTGGGTTTT SEQ ID No. 8 Conventional Primer strand (Example 2) GTCCTAACATCACGCGTAGAACCAAT AAAAA TCTCATCATTTCCGTGGGTTTT SEQ ID No. 9 Synthetic target strand (1 mismatch relative to target substance) ACTTTGTATTCAGTAATTAAAACCCACGGAAATGATGAGATTTTTATTGGATCTAC Sequence No. 10 Synthetic target strand (2 mismatch relative to target substance) ACTTTGTATTCAGTAATTAAAACCCACGGAAATGATGAGATTTTTATTAGTTATAC Sequence No. 11 Synthetic target strand (3 mismatch relative to target substance) ACTTTGTATTCAGTAATTAAAACCCACGGAAATGATGAGATTTTTAATGTTTATAC

[0105] Synthetic oligonucleotides Sequences (5' →3')SH-A 10 -[Sequence No. 12]Template strandSH-A 10- CCTTAACTAGCGGTAACTGAAAACTGCGTCCCTTAACTAGCGGTA[SEQ ID No. 13]-FAM tcDNA strand GACGCAGTTTTCAGTTACCGCTAGTTAAGG-FAM SEQ ID No. 14 Toehold strand CCTTAACTAGCGGTAACTGAAAACTGCGTC[SEQ ID No. 15] -(C2H4O)6- NH2 Magnetic beads strand ACTGAAAACTGCGTCAAAAAAAAAA-(C2H4O)6- NH2[SEQ ID No. 16]-IIIII-[SEQ ID No. 17] DPO Primer strand (Example 3)GTCCTAACATCACGCGTAGAACCAAT IIIII TCTCATCATTTCCGTGGGTTTT

[0106] Meanwhile, since the target-cloning binding site included in the template strand is complementary to a portion of the target-cloning strand, unwanted hybridization may occur between the target-cloning strand and the target-cloning binding site. This can generate an inactive NCR probe that fails to function properly and can severely degrade the selectivity and sensitivity of the NCR assay. Therefore, the design is configured to form an active NCR probe by inducing toehold-mediated displacement through the addition of target complements (toehold sequences), thereby removing the target-cloning strand after the second cycle that was unintentionally hybridized to the target-cloning binding site of the template strand, and completely exposing the target-cloning binding site of the template strand to open the target-cloning binding site for binding with the target. The difference in selectivity of the NCR probe due to the addition of toehold sequences has already been identified in a known patent specification (Korean Patent Publication No. 10-2023-0065838).

[0107]

[0108] 2. Preparation of magnetic particles (substrate particles)

[0109] The carboxylic acid-functionalized magnetic particles (1 μm) were thoroughly shaken for 1 minute before use. 100 μl of the magnetic particles were transferred to a new tube. The magnetic particles were suspended in 50 μl of 0.1 M 2-[N-morpholino]ethanesulfonic acid (MES) buffer (pH 4.8). A mixture of 5' amine-modified oligonucleotide (10 nmol) and 8 μl of N-ethyl-N'-[3-dimethylaminopropyl]carbodiimide hydrochloride (240 mg / ml) in 0.1 M MES (pH 4.8) was added to the washed magnetic particle solution. After incubating at room temperature for 3 hours with stirring, the magnetic particles were washed with 0.25M Tris buffer (pH 8) containing 10% Tween 20 buffer for 30 minutes with stirring at room temperature, and then dispersed in hybridization buffer.

[0110]

[0111] 3. Preparation of NCR probes (nanoparticles)

[0112] Thiolized template DNA was used to modify the template DNA on the surface of 50 nm gold nanoparticles. 34.1 fmol of 50 nm AuNP solution and 3.0 nmol of thiol template DNA were mixed with 40 nmol of Tris(2-carboxyethyl)phosphine (TCEP) to a final volume of 40 μl. Subsequently, 600 μl of 1-butanol was added to the mixture and vigorously stirred for 5 seconds until the color of the dispersion solution changed from red to clear. Then, 60 μl of 2xPBS buffer was added to the mixture and vigorously stirred for 5 seconds. The DNA-modified AuNPs were washed 5 times by centrifuging with 0.01% (vol / vol) SDS at 10,000 rpm for 90 seconds, and then redispersed in 1xPBS buffer containing 0.01% (vol / vol) SDS. Template strand-modified gold nanoparticles were incubated with excess target cloning strands (900 pmole) in 1xPBS buffer containing 0.01% (vol / vol) SDS at 85°C for 10 minutes, and then cooled to room temperature for 4 hours. The excess target cloning strands were removed by centrifugation (5500 rpm, 3 minutes 30 seconds). Excess tohold strands (5400 pmole) in 1xPBS buffer containing 0.01% (vol / vol) SDS were added to the same tube and incubated at room temperature for 3 hours. After successive hybridization, the NCR probes were washed three times by centrifugation (5500 rpm, 3 minutes) and redispersed in 1xPBS buffer containing 0.01% (vol / vol) SDS. The NCR probe was washed once by centrifugation (5500 rpm, 3 min), heated at 50°C for 5 min, washed twice under the same conditions, and finally redispersed in 1xPBS buffer containing 0.01% (vol / vol) SDS.

[0113]

[0114] 4. Preparation of Clinical Samples

[0115] Genital swabs were prepared by collecting specimens from patients with sexually transmitted diseases (Mycoplasma genitalium, Chlamydia trachomatis) or normal controls. These samples were then subjected to nucleic acid extraction using an automated MagNA Pure 96 platform (Roche, Basel, Switzerland) with DNA and Virus NA small-volume kits according to the manufacturer's protocol. Briefly, 200 μL of each sample was transferred to a processing cartridge, and an empty cartridge, reagent tray, pipette tips in a holder, elution plates, and glass magnetic particles were additionally loaded. During the "Pathogen Universal 200" protocol, each sample was treated with 250 μL of lysis / binding buffer and magnetic particles to ensure that the nucleic acids efficiently bound to the beads. The samples were then purified via a magnetic separator, washed to remove contaminants, and eluted in 100 μL of buffer for the recovery of high-purity nucleic acids.

[0116]

[0117] 5. Fluorescence measurement

[0118] To prepare for fluorescence detection, prior to the dehybridization step of the final DPO-NCR assay, the sample from the mixing tube was dispersed in 60 µl of distilled water and incubated at 90°C for 3 minutes. The solution was collected using a magnetic separator and transferred to another empty tube. The dehybridized solution sample, free of magnetic particles, was centrifuged at 9,000 rpm for 90 seconds to remove gold nanoparticles. 50 µl of the supernatant was taken and added to a black 96-well plate (SPL Life Science, South Korea). Fluorescence intensity was measured using a fluorescence spectrometer (Synergy™ H1, BioTek Instruments, Inc).

[0119]

[0120] [Experimental Results]

[0121] 1. DPO-NCR driving element verification experiment

[0122] 1-1. Confirmation of adhesive end formation

[0123] Polyacrylamide gel electrophoresis was performed to verify the formation of adhesive ends. A 15% (w / v) polyacrylamide gel was prepared using 30% (w / v) acrylamide / Bis solution, deionized water, 5X TBE (Tris-Borate-EDTA) buffer, ammonium persulfate, and TEMED (tetramethylethylenediamine). 2 μl of 10 μM DPO primer and 2 μl of 100 nM target strand were mixed and incubated at 45°C for 30 minutes. Each sample containing a loading dye was added to each well of a 1.5 mm thick gel. To determine the DNA molecular weight on the gel, a 20 bp DNA ladder was loaded into another well. Electrophoresis was performed by applying an electric field (130 V) to the gel for 70 minutes using a power supply. After electrophoresis, the gel was stained with SYBR Green I (Lonza) for 10 minutes, and the gel was imaged using a gel imager with UV photoexcitation at 306 nm.

[0124] Through gel electrophoresis results, it was confirmed that DNA double strands were well formed, with the total base length increasing only in the samples cultured with DPO primers and target strands (Fig. 6).

[0125]

[0126] 1-2. Verification of 4 types of drive elements

[0127] To verify the DPO-NCR driving element, Perfect Hyb™ Plus Hybridization buffer was prepared by mixing it with 2xPBS buffer at a ratio of 1:3 prior to amplification. For hybridization, tubes containing the mixed elements were prepared as specified in Fig. 7. At this time, 100 μl of 10 nM target strand, 1 μl of 10 μM DPO primer, and 5 μl of magnetic particles (2.5 mg / ml) were mixed and incubated at 45°C for 10 minutes. 20 μl of NCR probe was added to the mixing tube and incubated at 45°C for 15 minutes. The magnetic particles were washed three times with hybridization buffer using a magnetic separator, dispersed in 50 μl of distilled water, and dehybridized by incubating at 90°C for 3 minutes. Subsequently, only the supernatant was separated using a centrifuge, and fluorescence measurements were performed. Experimental results confirmed that fluorescence was detected only in the tube containing all four types of driving elements (Fig. 7).

[0128]

[0129] 2. Primer Selectivity Verification Experiment

[0130] 2-1. Confirmation of Selectivity of DPO Primers for Mismatched Target Sequences

[0131] To confirm the high selectivity of the DPO-NCR platform, assay results were examined based on the number of base mismatch sequences. Prior to amplification, Perfect Hyb™ Plus Hybridization buffer was prepared by mixing it with 2xPBS buffer at a ratio of 1:3. For hybridization, tubes containing the mixed components were prepared as specified in Figure 7. At this time, 100 μl of 1 nM target strand or mismatch sequence strand, 1 μl of 10 μM DPO primer, and 5 μl of magnetic particles (2.5 mg / ml) were mixed and incubated at 45°C for 10 minutes. 20 μl of NCR probe was added to the mixing tube and incubated at 45°C for 15 minutes. The magnetic particles were washed three times with hybridization buffer using a magnetic separator, dispersed in 50 μl of distilled water, and dehybridized by incubating at 90°C for 3 minutes. Afterward, the supernatant was separated using a centrifuge, and fluorescence measurements were performed. The experimental results confirmed that a selectively high positive signal was detected only in the target strand compared to the mismatch sequence (Fig. 8).

[0132]

[0133] 2-2. Verification of Selectivity for Conventional Primers and DPO Primers

[0134] To verify the contribution of DPO primers to selectivity in the DPO-NCR platform, a selectivity comparison experiment was conducted with a conventional primer in which the inosine sequence of the DPO primer portion was modified to a general complementary sequence. Before amplification, Perfect Hyb™ Plus Hybridization buffer was prepared by mixing it with 2xPBS buffer at a ratio of 1:3. For hybridization, tubes containing the mixed elements were prepared as specified in Figure 7. At this time, 100 μl of 1 nM target strand, 1 μl of 10 μM DPO primer, and 5 μl of magnetic particles (2.5 mg / ml) were mixed and incubated at 45°C for 10 minutes. 20 μl of NCR probe was added to the mixing tube and incubated at 45°C for 15 minutes. The magnetic particles were washed three times with hybridization buffer using a magnetic separator, dispersed in 50 μl of distilled water, and dehybridized by incubating at 90°C for 3 minutes. Afterward, only the supernatant was separated using a centrifuge, and fluorescence measurements were performed. The experimental results confirmed high selectivity for mismatch sequences in the presence of DPO primers compared to conventional primers (Fig. 9).

[0135]

[0136] 3. Experiment on Improvement of NCR Probe Amplification Efficiency Following Primer Introduction

[0137] 3-1. Verification of Existing NCR Probe Amplification Efficiency

[0138] Prior to amplification, Perfect Hyb™ Plus Hybridization buffer was prepared by mixing it with 2xPBS buffer at a ratio of 1:3. For hybridization, 100 μl of target cloning strand and 5 μl of magnetic particles (2.5 mg / ml) were mixed and incubated at room temperature for 10 minutes. 20 μl of NCR probe was added to the mixing tube and incubated at room temperature for 15 minutes. The magnetic particles were washed three times with hybridization buffer using a magnetic separator, dispersed in 50 μl of distilled water, and dehybridized by incubating at 90°C for 3 minutes. For the next cycle analysis, rehybridization buffer was added to increase the salt concentration and incubated for 10 minutes. 20 μl of NCR probe was added and incubated for 20 minutes. It was confirmed that higher fluorescence sensitivity was observed in the analyte as the process of washing and releasing nucleic acids was repeated (Fig. 11).

[0139]

[0140] 3-2. Verification of NCR probe amplification efficiency using DPO primers

[0141] Before amplification, Perfect Hyb™ Plus Hybridization buffer was prepared by mixing it with 2xPBS buffer in a 1:3 ratio. For hybridization, 100 μl of target strand, 0.1 femtomolar DPO primer (Example 1), and 5 μl of magnetic particles (2.5 mg / ml) were mixed and incubated at 45°C for 10 minutes. 20 μl of NCR probe was added to the mixing tube and incubated at 45°C for 15 minutes. The magnetic particles were washed three times with hybridization buffer using a magnetic separator, dispersed in 50 μl of distilled water, and dehybridized by incubating at 90°C for 3 minutes. For the next cycle analysis, rehybridization buffer was added to increase the salt concentration and incubated for 10 minutes. 20 μl of NCR probe was added and incubated for 20 minutes. The observable fluorescence signal was enhanced by repeating the washing and nucleic acid release process for 3 cycles. Experimental results showed that the fluorescence intensity was significantly higher in the target strand compared to the non-target (NTC) or mismatched target strand, and that the fluorescence signal tended to increase in a concentration-dependent manner as the target concentration increased (Fig. 12).

[0142]

[0143] Clinical samples derived from patients diagnosed with Mycoplasma Genitalium sexually transmitted disease and normal control samples were applied to the DPO-NCR assay. For the assay, analyte sample (2 μl) and 10 picomoles of DPO primer (Example 1) were incubated at 90°C for 3 minutes, followed by the addition of 100 μl of hybridization buffer and incubation at room temperature for 10 minutes. Magnetic particles (5 μl; 2.5 mg / ml) were incubated at room temperature for 20 minutes, after which the supernatant was removed. NCR probes (20 μl) were added to the mixture tube and incubated at room temperature for 20 minutes. The magnetic particles were washed three times using a magnetic separator and hybridization buffer, dispersed in 50 μl of distilled water, and incubated at 90°C for 3 minutes for dehybridization. In the next cycle, rehybridization buffer was added to increase the salt concentration, followed by incubation for 10 minutes. NCR probe (20 μl) was added and incubated for 20 minutes. For the clinical sample experiment, a total of 2 cycles were performed. The experimental results showed higher fluorescence sensitivity in positive samples compared to negative samples, confirming that the patient group and normal control group could be effectively distinguished (Fig. 13).

[0144]

[0145] Clinical samples derived from patients diagnosed with Chlamydia trachomatis sexually transmitted disease and normal control samples were applied to the DPO-NCR assay. For the assay, analyte sample (2 μl) and 10 picomoles of DPO primer (Example 3) were incubated at 90°C for 3 minutes, followed by the addition of 100 μl of hybridization buffer and incubation at room temperature for 10 minutes. Magnetic particles (10 μl; 2.5 mg / ml) were incubated at room temperature for 20 minutes, after which the supernatant was removed. NCR probes (20 μl) were added to the mixture tube and incubated at room temperature for 20 minutes. The magnetic particles were washed three times using a magnetic separator and hybridization buffer, dispersed in 50 μl of distilled water, and incubated at 90°C for 3 minutes for dehybridization. In the next cycle, rehybridization buffer was added to increase the salt concentration, followed by incubation for 10 minutes. An NCR probe (20 μl) was added and incubated for 20 minutes. To detect clinical samples, the washing and nucleic acid release process was repeated 2 cycles to enhance the observable fluorescence signal. The experimental results showed higher fluorescence sensitivity in positive samples compared to negative samples, confirming that the patient group and normal control group could be effectively distinguished (Fig. 13).

[0146]

[0147] [National R&D projects that supported this invention]

[0148] [Project No.] 2025-RISE-01-016-01

[0149] [Name of Project Management (Specialized) Agency] Seoul Metropolitan Government

[0150] [Research Project Name] Government Subsidy Project

[0151] [Research Project Title] Seoul National University’s Regional Innovation-Centered University Support System (RISE)_Leading Global Industry-Academic Cooperation

[0152] [Research Period] 2025-06-01 ~ 2025-12-31

[0153]

[0154] [Research and development projects that supported this invention]

[0155] [Project No.] 305-20220051

[0156] [Name of Project Management (Specialized) Agency] Seegene Medical Foundation

[0157] [Research Project Title] Research on the Application of Nanoparticle Chain Reaction Detection Methods for the Diagnosis of Sexually Transmitted Infections

[0158] [Research Period] 2022.11.01 ~ 2024.10.31

[0159]

[0160] [Designed DNA Sequence]

[0161] 1. ACTTTGTATTCAGTAATTAAAACCCACGGAAATGATGAGATTTTTATTGGTTCTAC (Sequence No. 1)

[0162] 2. GCGTGATGTTAGGACAATTACTGAATACAAAGTGCGTGATGTTAGGAC (SEQ ID NO: 2)

[0163] 3. ACTTTGTATTCAGTAATTGTCCTAACATCACGC (Sequence No. 3)

[0164] 4. GCGTGATGTTAGGACAATTACTGAATACAAAGT (Sequence No. 4)

[0165] 5. AATTACTGAATACAAAGTAAAAAAAAAA (Sequence No. 5)

[0166] 6. GTCCTAACATCACGCGTAGAACCAAT (Sequence No. 6)

[0167] 7. TCTCATCATTTCCGTGGGTTTT (Sequence No. 7)

[0168] 8. GTCCTAACATCACGCGTAGAACCAATAAAAATCTCATCATTTCCGTGGGTTTT (Sequence No. 8)

[0169] 9. ACTTTGTATTCAGTAATTAAAACCCACGGAAATGATGAGATTTTTATTGGATCTAC(Sequence No. 9)

[0170] 10. ACTTTGTATTCAGTAATTAAAACCCACGGAAATGATGAGATTTTTATTAGTTATAC(Sequence No. 10)

[0171] 11. ACTTTGTATTCAGTAATTAAAACCCACGGAAATGATGAGATTTTTAATGTTTATAC(Sequence No. 11)

[0172] 12. CCTTAACTAGCGGTAACTGAAAACTGCGTCCCTTAACTAGCGGTA (Sequence No. 12)

[0173] 13. GACGCAGTTTTCAGTTACCGCTAGTTAAGG (Sequence No. 13)

[0174] 14. CCTTAACTAGCGGTAACTGAAAACTGCGTC (Sequence No. 14)

[0175] 15. ACTGAAAACTGCGTCAAAAAAAAAA (Sequence No. 15)

[0176] 16. GTCCTAACATCACGCGTAGAACCAAT (Sequence No. 16)

[0177] 17. TCTCATCATTTCCGTGGGTTTT (Sequence No. 17)

Claims

1. A composition for amplifying or detecting a target substance in a separated sample, The above composition comprises a primer, nanoparticles, and substrate particles, and (a) The nanoparticles comprise one or more partially double-stranded oligonucleotides, and The above partial double-stranded oligonucleotide is (1) Template strand including the following: (i) a target-cloning site complementary to the target-cloning strand, and (ii) a target-cloning binding site complementary to a portion (first region) of the target-cloning strand; and (2) A target-cloning strand comprising the same sequence as the first region; and a part of the target oligonucleotide (second region), and The target-cloning site of the above-mentioned template strand and the above-mentioned target-cloning strand complementarily combine to form a double strand, and the above-mentioned target-cloning binding site is a single strand, and One end of the above-mentioned mold strand is immobilized on the surface of the above-mentioned nanoparticle, and (b) A composition in which the substrate particle has one or more target-capture strands immobilized on its surface, the target-capture strands having a sequence complementary to the second region.

2. In Paragraph 1, A composition characterized in that the primer binds complementarily to a portion of the target oligonucleotide to form a partial double-stranded complex that forms sticky ends at both ends.

3. In Paragraph 1, The above primer is a single-stranded oligonucleotide, and the composition comprises the following sequence and region in sequence. (a) A sequence identical to a portion of the first region of the target-cloning strand; (b) A sequence complementary to a portion of the target oligonucleotide.

4. In Paragraph 1, The above primer is a single-stranded bispecific oligonucleotide, and the composition comprises the following sequence and region in sequence: (a) A sequence identical to a portion of the first region of the target-cloning strand; (b) a sequence complementary to a portion (third region) of the target oligonucleotide; (c) linker region; and (d) A sequence complementary to another part (fourth region) of the above target oligonucleotide.

5. In Paragraph 4, A composition in which the above linker region is a polydeoxyinosine linker.

6. In Paragraph 1, The above-mentioned nanoparticles comprise one or more selected from the group consisting of gold, silver, silica, platinum, copper, or gold, silver, platinum, and copper.

7. In Paragraph 1, The above composition is a composition for diagnosing sexually transmitted diseases.

8. In Paragraph 7, A composition in which the above-mentioned sexually transmitted disease is a sexually transmitted disease derived from an infection of Mycoplasma genitalium or Chlamydia trachomatis.

9. A kit for detecting a target substance comprising the composition of claim 1.

10. In Paragraph 9, A kit in which the concentration of the target substance in the sample is 5 aM to 100 aM.

11. A method for amplifying or detecting a target substance in a separated sample, The above method (A) A step of mixing a substrate particle comprising a target oligonucleotide, a primer, and one or more target-capture strands, wherein a portion of the target oligonucleotide is hybridized with the primer, and another portion of the target oligonucleotide is hybridized with a portion of the substrate particle; (B) a step of adding nanoparticles to the mixture obtained in step (A) above to form a substrate particle-nanoparticle complex, wherein, prior to the addition of the nanoparticles, an unhybridized portion of the primer and a portion of the nanoparticles are hybridized; and (C) a step of dehybridizing the complex, disassembling the complex, or both to release a target cloning strand; comprising, The above target oligonucleotide includes the sequence of a second region, and The above substrate particle has one or more target-capture strands immobilized on its surface, the strands comprising a sequence complementary to the second region, and The primer comprises a sequence complementary to a portion of the target oligonucleotide that is different from the sequence of the second region, and comprises a sequence identical to a portion of the first region of the target-cloning strand below, The above nanoparticles comprise one or more partially double-stranded oligonucleotides, and The above partial double-stranded oligonucleotide is (1) Template strand including the following: (i) a target-cloning site complementary to the target-cloning strand, and (ii) a target-cloning binding site complementary to a portion (first region) of the target-cloning strand; and (2) A target-cloning strand comprising the sequences of the first region and the second region, and The target-cloning site of the above-mentioned template strand and the above-mentioned target-cloning strand complementarily combine to form a double strand, and the above-mentioned target-cloning binding site is a single strand, and A method in which one end of the above-mentioned mold strand is immobilized on the surface of the above-mentioned nanoparticle.

12. In Paragraph 11, A method characterized by the target-cloning strand released in step (C) above becoming the next target for amplification, and repeating steps (D) to (F) below one or more times. (D) A step of hybridizing a portion of the released target-cloning strand (second region) with the target-capture strand of the substrate particle; (E) A step of adding one or more of the nanoparticles to the mixture obtained in step (D) above to form a complex between the substrate particle and the nanoparticle, wherein a portion of the target-cloning strand (first region) and a portion of the nanoparticle are hybridized; (F) A step of dehybridizing the partial double-stranded oligonucleotide of the nanoparticles, disassembling the complex, or both to release the target-cloning strand.

13. In Paragraph 11, A method characterized in that the substrate particles and nanoparticles are of two or more types for different target oligonucleotides, and amplify or detect two or more target substances.

Images