Method for incubating self-assembled organic material crystals based on double emulsion droplets

Abstract

Disclosed in the present invention is a method for incubating self-assembled organic material crystals based on double emulsion droplets. W / O / W double emulsion droplets having uniform size are prepared by means of a microfluidic chip. During the preparation process of the double emulsion droplets, a self-assembled organic material solution is used as an internal aqueous phase solution, an intermediate oil phase solution is a water-insoluble solution, and a solution containing a relatively high salt concentration serves as an external aqueous phase solution to perform encapsulation of the self-assembled organic material solution, thereby preventing the self-assembled organic material from being released into the external aqueous phase solution. The double emulsion droplets loaded with the self-assembled organic material solution are incubated. By means of the concentration difference between the external aqueous phase solution and the internal aqueous phase solution, under the influence of osmotic pressure, water molecules in the internal aqueous phase solution migrate to the external aqueous phase, and thus the concentration of the self-assembled organic material in the double emulsion droplets also increases accordingly, thereby promoting the growth of self-assembled organic material crystals. Finally, the self-assembled organic material crystals having uniform size are obtained inside the double emulsion droplets, and each double emulsion droplet contains a single self-assembled organic material crystal.

Description

An incubation method for self-assembled organic material crystals based on dual emulsion droplets Technical Field

[0001] This invention relates to the fields of droplet microfluidics and crystal materials, specifically to an incubation method for self-assembled organic material crystals based on dual emulsion droplets. Background Technology

[0002] Self-assembling organic materials are a class of organic materials with self-assembly capabilities, which can assemble into periodic array structures and then into organic material crystals. DNA, as one of the self-assembling organic materials, can participate in the construction of nanostructures as a programmable self-assembly unit. DNA-based structural DNA nanotechnology has been widely applied in fields such as biology, biosensing, and drug delivery (Huating Kong, et al. Exploring the Potential of Three-Dimensional DNA Crystals in Nanotechnology: Design, Optimization, and Applications. Adv Sci. 2023, 10(24):e2302021. doi:10.1002 / advs.202302021.). Among them, DNA crystal preparation involves periodically arranging and assembling designed DNA molecules to construct three-dimensional DNA crystals. The DNA crystals serve as periodic molecular scaffolds, loading and collecting the required guest molecules through precise arrangement.

[0003] Currently, there are two main methods for preparing DNA crystals: the hanging drop method and the sitting drop method. Chinese patent document CN117384231A discloses a method for preparing engineered DNA crystals using the hanging drop method. However, this method produces DNA crystals with uncontrollable quantity and wide size distribution, making it difficult to obtain DNA crystals with controllable quantity and uniform size. The preparation of DNA crystals with controllable quantity and uniform size will further expand the application of DNA crystals in controlled drug loading and release, as well as in nanostructure engineering. The shortcomings of current methods for preparing self-assembled organic material crystals prompt us to seek a better technical method to prepare self-assembled organic material crystals with controllable and uniform size.

[0004] Droplet microfluidics is a technique that has emerged in recent years to manipulate microdroplets with volumes ranging from tens of picoliters to hundreds of nanoliters through microchannels. The microdroplets prepared using this technique are characterized by their small size, uniformity, independence, stability, controllability, and large specific surface area, making them promising for applications and research in chemistry, biomedicine, and new materials. Research has shown that dual-emulsion droplets prepared using droplet microfluidics can serve as microreaction containers for nanoliter-level chemical and biological microreactions. Therefore, this invention proposes using dual-emulsion droplets produced by droplet microfluidics as incubation containers to prepare self-assembled organic material crystals. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides an incubation method for self-assembled organic material crystals based on dual emulsion droplets. By increasing the salt concentration in the aqueous phase outside the dual emulsion droplets, water molecules migrate within the aqueous phase solution, thereby increasing the concentration of self-assembled organic materials in the aqueous phase, promoting the assembly of self-assembled organic materials into crystals, and achieving the goal of controllable crystal size for the self-assembled organic materials.

[0006] An incubation method for self-assembled organic material crystals based on dual emulsion droplets includes the following steps:

[0007] (1) A self-assembled organic material and a soluble salt are prepared into an inner aqueous phase solution, an insoluble substance and an insoluble organic solvent are prepared into an intermediate oil phase solution, and the soluble salt is prepared into an outer aqueous phase solution, wherein...

[0008] (2) The inner aqueous phase solution, the intermediate oil phase solution and the outer aqueous phase solution obtained in step (1) are respectively introduced into the corresponding channels of the microfluidic chip to obtain a double emulsion droplet loaded with self-assembled organic material;

[0009] (3) After water migration, the double emulsion droplets loaded with self-assembled organic materials obtained in step (2) are incubated to obtain self-assembled organic material crystals based on double emulsion droplets.

[0010] In this invention, uniform W / O / W (water-in-oil-in-water) biemulsion droplets are prepared using a microfluidic chip. During the preparation of the biemulsion droplets, a self-assembled organic material solution is used as the inner aqueous phase solution, the intermediate oil phase solution is a non-water-soluble solution, and an outer aqueous phase solution with a high salt concentration is used to encapsulate the self-assembled organic material solution, preventing the self-assembled organic material from being released into the outer aqueous phase solution. The biemulsion droplets containing the self-assembled organic material solution are then incubated.

[0011] By utilizing the concentration difference between the external and internal aqueous solutions, water molecules in the internal aqueous solution migrate to the external aqueous solution under the influence of osmotic pressure. The concentration of self-assembled organic material in the double emulsion droplet gradually increases to the crystallization concentration of the self-assembled organic material. This process promotes the growth of self-assembled organic material crystals. When the volume ratio of the core droplet before and after water migration is the same as the salt concentration ratio of the external and internal aqueous solutions before water migration, the degree of water migration in the double emulsion droplet reaches saturation, which can achieve the maximum degree of crystallization of self-assembled organic material in the double emulsion droplet. Finally, uniformly sized self-assembled organic material crystals are obtained in the double emulsion droplet, and the ratio of single self-assembled organic material crystals in a single double emulsion droplet is high.

[0012] In this invention, the diameter of the core droplet of the double emulsion droplet obtained in step (2) can be controlled, thereby controlling the diameter of the core droplet of the double emulsion droplet after water migration, and thus controlling the size range of the self-assembled organic material crystals obtained, so that the size of the self-assembled organic material crystals is controllable, and the self-assembled organic material crystals of different sizes obtained can be used for controllable drug loading and release and for nanostructure engineering.

[0013] Preferably, the self-assembling organic material is a water-soluble organic material that can be assembled into a periodic structure crystal, such as DNA strands, block copolymers, supramolecular polymers, proteins, etc., which have self-assembly properties or can form a periodic structural arrangement after being synthesized and modified.

[0014] More preferably, the self-assembled organic material is a DNA chain, which is a combination of a central chain (L chain), a side chain (M chain), and a corner chain (S chain).

[0015] In this invention, the DNA strand can be three different DNA strands: a central strand (L strand), a side strand (M strand), and a corner strand (S strand) (the nucleotide sequences of the DNA strands are shown in SEQ ID NO. 1–3 or SEQ ID NO. 6–8). As shown in Figures 1 and 9, the three different DNA strands constitute a triangular tensile structural unit. The side strand (M strand) extends in three double helix directions, the central strand (L strand) with a triple repeat sequence is located in the center of the structural unit, and the corner strand (S strand) is located at the double helix end of the structural unit and pairs with the side strand (M strand). Based on the above-mentioned triangular tensile structural unit, this invention can periodically assemble and arrange uniform three-dimensional DNA crystals through complementary pairing of two base vacancies.

[0016] More preferably, the self-assembled organic material is a DNA chain, and the DNA chain is a self-assembled Z-chain.

[0017] In this invention, the DNA strand can also be the same self-assembled Z-strand (nucleotide sequence as shown in SEQ ID NO.4 or SEQ ID NO.5), and the two identical self-assembled Z-strands are paired with each other to form the structural motifs shown in Figures 5 and 7.

[0018] More preferably, the DNA chain is a central chain L chain with nucleotide sequence SEQ NO.1, a side chain M chain with nucleotide sequence SEQ NO.2, and a corner chain S chain with nucleotide sequence SEQ NO.3.

[0019] In a specific embodiment of the present invention, when the self-assembled organic material is a DNA chain (the central chain L chain with the nucleotide sequence of SEQ NO.1, the side chain M chain with the nucleotide sequence of SEQ NO.2, and the corner chain S chain with the nucleotide sequence of SEQ NO.3), a DNA crystal with controllable size can be obtained by controlling the initial concentration of the self-assembled material and the initial salt concentration ratio of the internal and external phase aqueous solutions, or by adjusting the initial diameter of the core droplet.

[0020] More preferably, the concentration of the central L-chain in the inner aqueous phase solution is 6-12 μM, and the salt concentration ratio of the outer aqueous phase solution to the inner aqueous phase solution is not less than 20:1.

[0021] In a specific embodiment of the present invention, when the ratio of the concentration of the central L-chain in the inner aqueous solution to the salt concentration of the inner and outer aqueous solutions is within the above-mentioned range, their product can exceed the self-assembly crystallization concentration of the DNA chain, thereby obtaining a double emulsion droplet with a high crystal content, which is close to 100%, and the ratio of a single DNA crystal in a single double emulsion droplet is more than 80%, and can reach up to about 98%.

[0022] Preferably, in the inner aqueous phase solution and the outer aqueous phase solution, the soluble salt is one of potassium salt, sodium salt, magnesium salt, and ammonium salt.

[0023] Preferably, both the inner aqueous phase solution and the outer aqueous phase solution further include a buffer solution and a surfactant.

[0024] In the aforementioned internal aqueous phase solution and external aqueous phase solution,

[0025] More preferably, the buffer solution is a TAE buffer solution.

[0026] In this invention, the TAE buffer is a buffer solution composed of tris-hydroxymethylaminomethane (Tris base), acetic acid, and ethylenediaminetetraacetic acid (EDTA).

[0027] More preferably, the surfactant is polyvinyl alcohol, sodium dodecyl sulfate, or Tween 80.

[0028] Preferably, the non-water-soluble substance is at least one of silicone oil, mineral oil, and liposomes.

[0029] Preferably, the microfluidic chip is made of glass, polydimethylsiloxane, or plastic.

[0030] The microfluidic chip used in this invention includes an input channel for a three-phase solution and an output channel, and can be used to prepare W / O / W type double emulsion droplets loaded with self-assembled organic materials.

[0031] Preferably, the size of the self-assembled organic material crystal based on dual emulsion droplets is 15–60 μm.

[0032] In this invention, the size of the self-assembled organic crystal is controlled by the initial concentration of the self-assembly material, the initial salt concentration ratio of the internal and external aqueous solutions, or by adjusting the diameter of the initial core droplet, thereby obtaining self-assembled organic material crystals with controllable size.

[0033] Preferably, the crystal content of the incubated double emulsion droplets is ≥95%.

[0034] In this invention, when in step (1) When the value is much greater than the crystallization concentration of the self-assembled organic material, the crystal content of the incubated double emulsion droplets is ≥95%, and can even reach 100%.

[0035] Preferably, in the incubated double emulsion droplets, the ratio of a single self-assembled organic material crystal within a single double emulsion droplet is ≥80%.

[0036] In this invention, the ratio of a single self-assembled organic material crystal within a single double emulsion droplet after incubation is high, which can improve single crystal manipulation and utilization, making the crystal more controllable and concentrated when used for drug loading and release.

[0037] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0038] This invention utilizes a dual-emulsion droplet as an incubation container to prepare self-assembled organic material crystals. By controlling the concentration of the encapsulated self-assembled organic material, the salt concentration in the outer and inner aqueous solutions, and the size of the core droplet of the initial dual-emulsion droplet, self-assembled organic material crystals of different sizes can be prepared. The dual-emulsion droplets prepared by this incubation method have a high crystal content, with a single crystal ratio of ≥80% in a single droplet. This can improve single crystal manipulation and utilization, making the crystals more controllable and concentrated when used for drug loading and release. Attached Figure Description

[0039] Figure 1 is a schematic diagram of the triangular tensile structural unit of the DNA crystal in Example 1.

[0040] Figure 2 shows an image of the prepared biemulsion droplets loaded with self-assembled organic materials.

[0041] Figure 3 shows an image of the DNA crystal based on double emulsion droplets prepared in Example 1.

[0042] Figure 4 shows an image of a single DNA crystal contained in a single double emulsion droplet prepared in Example 1.

[0043] Figure 5 is a schematic diagram of the structural building blocks of the DNA crystal in Example 11.

[0044] Figure 6 shows an image of the DNA crystal based on double emulsion droplets prepared in Example 11.

[0045] Figure 7 is a schematic diagram of the structural building blocks of the DNA crystal in Example 12.

[0046] Figure 8 shows an image of the DNA crystal based on double emulsion droplets prepared in Example 12.

[0047] Figure 9 is a schematic diagram of the triangular tensile structural unit of the DNA crystal in Example 13.

[0048] Figure 10 shows an image of the DNA crystal based on double emulsion droplets prepared in Example 13.

[0049] Figure 11 shows an image of the DNA crystal prepared by the hanging drop method in Comparative Example 1.

[0050] Figure 12 shows the DNA crystal incubation images based on double emulsion droplets in Examples 1-4 and Comparative Example 2. In the figure, i-v are the DNA crystal images prepared in Comparative Example 2 and Examples 1-4, respectively, and vi is a statistical graph of DNA crystal size, droplet crystal content, and the ratio of single crystals in a single droplet in Examples 1-4.

[0051] Figure 13 shows the DNA crystal incubation images based on double emulsion droplets in Examples 1 and 5-8, where i-v are images of DNA crystals prepared in Examples 1 and 5-8 respectively, and vi is a statistical chart of DNA crystal size, droplet crystal content, and the ratio of a single crystal in a single droplet in Examples 1 and 5-8.

[0052] Figure 14 shows the DNA crystal incubation images based on double emulsion droplets for Examples 1, 9 and 10, and Comparative Examples 3 and 4. In the figures, i to v are images of DNA crystals prepared for Comparative Examples 3 and 4, Examples 9, 1 and 10, respectively, and vi is a statistical chart of DNA crystal size, droplet crystal content, and the ratio of single crystals in a single droplet for Examples 1, 9 and 10.

[0053] Figure 15 is a statistical chart showing the DNA crystal size, crystal content of the droplets, and the percentage of single crystals in a single droplet based on double emulsion droplets in Examples 11-13. Detailed Implementation

[0054] The present invention will be further described in detail below with reference to the embodiments, but the implementation of the present invention is not limited to the following embodiments.

[0055] All raw materials used in this invention are commercially available.

[0056] In specific embodiments of the present invention, DNA strands are used as self-assembling organic materials, and all DNA strands are synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0057] Preparation of TAE buffer stock solution (50×TAE buffer): Add 242g (2mol) of Tris and 37.2g (0.1mol) of disodium Na2EDTA to 800mL of deionized water and stir until fully dissolved. Add 57.1mL of acetic acid, and then add deionized water to a final volume of 1L.

[0058] Example 1

[0059] Central chain L-chain: ACACCGTACACCGTACACCGT (SEQ ID NO.1);

[0060] Edge chain M chain: GAGCAGCCTGTACGGACATCA (SEQ ID NO.2);

[0061] Angular chain S chain: TCTGATGTGGCTGC (SEQ ID NO.3).

[0062] In this embodiment, the central chain L chain, the side chain M chain and the corner chain S chain can form a triangular tensioned structural unit as shown in Figure 1. At 20°C, the self-assembly crystallization concentration of this structural unit in water is approximately 120 μM.

[0063] (1) Mix the three DNA strands (central strand L, side strand M, and corner strand S) in a 1:3:3 ratio to ensure that the concentration of the central strand L (i.e., the concentration of the triangular tensile structure motif, as shown in Figure 1) is 8 μM, and add buffer containing 1×TAE and 25 mM magnesium acetate (i.e., 1×TAE / Mg). 2+A DNA solution was obtained by dissolving a 0.2% polyvinyl alcohol (PVA) solution in 0.2% polyvinyl alcohol (PVA). The DNA solution was then transferred into a PCR apparatus and cooled from 95°C to 20°C at a rate of 0.6°C / min to obtain the inner aqueous phase solution. An intermediate oil phase solution was obtained by mixing 50 cSt dimethyl silicone oil and polydimethylsiloxane (PDMS) at an 8:2 ratio. The outer aqueous phase solution contained 20×TAE buffer and 0.5M magnesium acetate (i.e., 20×TAE / Mg). 2+ ) 2.5% PVA aqueous solution.

[0064] (2) The inner aqueous phase solution, intermediate oil phase solution and outer aqueous phase solution obtained in step (1) are respectively introduced into the corresponding channels of the glass capillary microfluidic chip, and the self-assembled organic material is encapsulated into the W / O / W type double emulsion droplet to obtain a double emulsion droplet loaded with DNA solution. The diameter of the core droplet of the double emulsion droplet is 160μm, as shown in Figure 2. The double emulsion droplet has a core-shell structure, in which the core is the inner aqueous phase solution, the shell is the intermediate oil phase solution, and the external liquid phase environment of the double emulsion droplet is the outer aqueous phase solution.

[0065] (3) The double emulsion droplets loaded with DNA solution obtained in step (2) were placed in a constant temperature chamber at 20°C for water migration. The diameter of the core droplet of the double emulsion droplet after water migration was 60 μm. The volume ratio of the core droplet before and after water migration was the same as the salt concentration ratio of the outer aqueous phase solution and the inner aqueous phase solution, that is, the water migration ratio was 20:1. Then, the droplets were incubated at 20°C for 72 h to obtain DNA crystals based on double emulsion droplets (Figure 3). It can be seen that a single double emulsion droplet contains a single DNA crystal (Figure 4).

[0066] Example 2

[0067] The preparation method is the same as in Example 1, except that the concentration of the triangular tension structure unit is 6 μM.

[0068] Example 3

[0069] The preparation method is the same as in Example 1, except that the concentration of the triangular tension structure unit is 10 μM.

[0070] Example 4

[0071] The preparation method is the same as in Example 1, except that the concentration of the triangular tension structure unit is 12 μM.

[0072] Example 5

[0073] The preparation method is the same as in Example 1, except that the core droplet diameter of the water-migrated double emulsion droplet is 100 μm and the water migration ratio is 20:1.

[0074] Example 6

[0075] The preparation method is the same as in Example 1, except that the core droplet diameter of the water-migrated double emulsion droplet is 110 μm and the water migration ratio is 20:1.

[0076] Example 7

[0077] The preparation method is the same as in Example 1, except that the core droplet diameter of the water-migrated double emulsion droplet is 130 μm and the water migration ratio is 20:1.

[0078] Example 8

[0079] The preparation method is the same as in Example 1, except that the core droplet diameter of the water-migrated double emulsion droplet is 150 μm and the water migration ratio is 20:1.

[0080] Example 9

[0081] The preparation method is the same as in Example 1, except that the concentrations of TAE and magnesium acetate in the external aqueous solution are 15 × TAE / Mg. 2+ .

[0082] Example 10

[0083] The preparation method is the same as in Example 1, except that the concentrations of TAE and magnesium acetate in the external aqueous solution are 25 × TAE / Mg. 2+ .

[0084] Example 11

[0085] Self-assembled chain Z-chain: CGACGCGTGGCGCCGC (SEQ ID NO.4)

[0086] The preparation method is the same as in Example 1, except that the added DNA strand is a self-assembled Z-strand, and the concentration of the self-assembled Z-strand is 10 μM (two self-assembled Z-strands form a structural motif as shown in Figure 5 through base pairing, and the concentration of the structural motif is 5 μM).

[0087] DNA crystals based on double emulsion droplets were prepared (Figure 6), in which a single DNA crystal can be seen in a single double emulsion droplet.

[0088] Example 12

[0089] Self-assembled chain Z-chain: GGACAGCTGGGAG (SEQ ID NO.5)

[0090] The preparation method is the same as in Example 1, except that the added DNA strand is a self-assembled Z-strand, and the concentration of the self-assembled Z-strand is 50 μM (two self-assembled Z-strands form a structural motif as shown in Figure 7 through base pairing, and the concentration of the structural motif is 25 μM).

[0091] DNA crystals based on double emulsion droplets were prepared (Figure 8), in which a single DNA crystal can be seen in a single double emulsion droplet.

[0092] Example 13

[0093] Central Chain L-Chain:

[0094] CGGTATTCACCACGATGCGGTATTCACCACGATGCGGTATTCACCACGATG (SEQ ID NO. 6);

[0095] Edge chain M chain:

[0096] GAAAAACACTGCCTGAATACCGCATCGTGGACTGACTCAAAA(SEQ ID NO.7);

[0097] Angular chain S chain: TCTTTTGAGTCAGTGGCAGTGTTTT (SEQ ID NO.8).

[0098] The preparation method is the same as in Example 1, except that the added DNA strand is the DNA strand of SEQ ID NO. 6 to 8, and the concentration of the central strand L (i.e. the concentration of the triangular tensile structure unit, which is shown in Figure 9) is 2 μM.

[0099] DNA crystals based on double emulsion droplets were prepared (Figure 10), in which a single DNA crystal can be seen in a single double emulsion droplet.

[0100] Comparative Example 1: Preparation of DNA crystals using the hanging drop method

[0101] DNA crystals were prepared using the conventional hanging drop method, with the same DNA strands as in Example 1. A 10 μL hanging drop solution was prepared, containing a central L-strand concentration of 12 μM, TAE buffer, and magnesium acetate at concentrations of 1×TAE and 25 mM magnesium acetate. The 10 μL hanging drop solution was then subjected to the same annealing procedure as in Example 1, adsorbed onto a coverslip, and suspended on a 24-well plate. A 0.6 mL ammonium sulfate (1.7 M) solution was placed below the plate, and the plate was incubated at 20 °C for 72 hours. The DNA crystals in the hanging drop are shown in Figure 11.

[0102] Comparative Example 2

[0103] The preparation method is the same as in Example 1, except that the concentration of the triangular tension structure unit is 4 μM.

[0104] Comparative Example 3

[0105] The preparation method is the same as in Example 1, except that the concentrations of TAE and magnesium acetate in the external aqueous solution are 5 × TAE / Mg. 2+ .

[0106] Comparative Example 4

[0107] The preparation method is the same as in Example 1, except that the concentrations of TAE and magnesium acetate in the external aqueous solution are 10 × TAE / Mg. 2+ .

[0108] Sample Analysis

[0109] The crystal incubation conditions of Examples 1-13 and Comparative Examples 1-4 were observed, and the crystal data (crystal size, droplet crystal content, and ratio of a single crystal in a single droplet) were statistically analyzed. The results are shown in Figures 12-15.

[0110] Figure 12 shows the incubation images of DNA crystals based on dual emulsion droplets in Examples 1-4 and Comparative Example 2. In Figure 6, i-v represent the incubation images of DNA crystals prepared in Examples 2 and Examples 1-4, respectively. In Comparative Example 2, due to the low concentration of the triangular tensile structural units, the concentration multiplied by the salt concentration ratio of the outer and inner aqueous phase solutions did not reach the self-assembly crystallization concentration of the DNA strand; therefore, no DNA crystals were observed. In Examples 1-4, DNA crystals were observed after 72 hours of incubation. As shown in vi in ​​Figure 12, the size range of the DNA crystals incubated in Examples 1-4 was 19.4±0.9μm to 26.4±0.6μm. The dual emulsion droplets exhibited a high crystal content, with each droplet containing over 80% of a single crystal, reaching a maximum of 98.6%±0.9%.

[0111] Figure 13 shows DNA crystal incubation images based on dual emulsion droplets in Examples 1, 5-8. As shown in i-v of Figure 13, DNA crystals can be observed in Examples 1, 5-8. As shown in vi of Figure 13, the size range of DNA crystals incubated in Examples 1-4 is 21.6±0.6μm to 56.8±2.6μm. The crystal content of the dual emulsion droplets can reach 100%, and the ratio of a single crystal in a single droplet is over 90%.

[0112] Figure 14 shows DNA crystal incubation images based on double emulsion droplets for Examples 1, 9, and 10, and Comparative Examples 3 and 4. As shown in i-v of Figure 14, the salt concentration ratios of the outer and inner aqueous phase solutions in Comparative Examples 3 and 4 are 5 and 10, respectively. The small difference in salt concentration between the inner and outer aqueous phase solutions in Comparative Examples 3 and 4 means that after water migration, the concentration required for self-assembly crystallization of the DNA strand cannot be reached, making it difficult to form DNA crystals. In Example 9, the salt concentration ratio of the outer and inner aqueous phase solutions is 15. After water migration occurs... When the concentration for self-assembly crystallization was just reached, DNA crystals could be observed to incubate in a small number of double emulsion droplets, with a low crystal content. In contrast, the salt concentration ratios of the inner and outer aqueous phases in Examples 1 and 9 were 20 and 25, respectively, and DNA crystals could be observed in both cases, as shown in vi in ​​Figure 14. The size range of the DNA crystals incubated in Examples 1 and 9 was 19.3±0.9μm to 56.8±2.6μm, and the crystal content of the double emulsion droplets could reach 100%, with the ratio of a single crystal in a single droplet exceeding 90%.

[0113] Figure 15 is a statistical chart showing the DNA crystal size, crystal content of the droplets, and the percentage of single crystals in a single droplet based on double emulsion droplets in Examples 11-13. As shown in the figure, the size range of the DNA crystals incubated in Examples 11-13 is 15.81±0.60μm to 20.80±2.01μm. The crystal content of the droplets obtained in Example 12 is >30%, and the crystal content of the droplets obtained in Examples 11 and 13 can reach 100%. The percentage of single crystals in a single droplet obtained in Examples 11-13 is all over 90%.

[0114] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for incubating self-assembled organic material crystals based on dual emulsion droplets, characterized in that, Includes the following steps: (1) A self-assembled organic material and a soluble salt are prepared into an inner aqueous phase solution, an insoluble substance and an insoluble organic solvent are prepared into an intermediate oil phase solution, and the soluble salt is prepared into an outer aqueous phase solution, wherein... (2) The inner aqueous phase solution, the intermediate oil phase solution and the outer aqueous phase solution obtained in step (1) are respectively introduced into the corresponding channels of the microfluidic chip to obtain a double emulsion droplet loaded with self-assembled organic material; (3) After water migration, the double emulsion droplets loaded with self-assembled organic materials obtained in step (2) are incubated to obtain self-assembled organic material crystals based on double emulsion droplets.

2. The incubation method for self-assembled organic material crystals based on dual emulsion droplets according to claim 1, characterized in that, The self-assembling organic material is a water-soluble organic material that can be assembled into a periodic crystal structure.

3. The incubation method for self-assembled organic material crystals based on dual emulsion droplets according to claim 1, characterized in that, In the aforementioned internal aqueous phase solution and external aqueous phase solution, the soluble salt is one of potassium salt, sodium salt, magnesium salt, and ammonium salt.

4. The incubation method for self-assembled organic material crystals based on dual emulsion droplets according to claim 1, characterized in that, Both the internal aqueous phase solution and the external aqueous phase solution further include buffer solution and surfactant.

5. The incubation method for self-assembled organic material crystals based on dual emulsion droplets according to claim 4, characterized in that, The buffer solution is a TAE buffer solution.

6. The incubation method for self-assembled organic material crystals based on dual emulsion droplets according to claim 4, characterized in that, The surfactant is polyvinyl alcohol, sodium dodecyl sulfate, or Tween 80.

7. The incubation method for self-assembled organic material crystals based on dual emulsion droplets according to claim 1, characterized in that, The non-water-soluble substance is at least one of silicone oil, mineral oil, and liposomes.

8. The incubation method for self-assembled organic material crystals based on dual emulsion droplets according to claim 1, characterized in that, The size of the self-assembled organic material crystal based on dual emulsion droplets is 15–60 μm.

9. The incubation method for self-assembled organic material crystals based on dual emulsion droplets according to claim 1, characterized in that, The crystal content of the incubated double emulsion droplets is ≥95%.

10. The incubation method for self-assembled organic material crystals based on dual emulsion droplets according to claim 1, characterized in that, In the incubated double emulsion droplets, the ratio of a single self-assembled organic material crystal within a single double emulsion droplet is ≥80%.

Images