Novel therapeutic modality for the treatment of diseases associated with vascular and / or lymphatic disorders
Patent Information
- Application Number
- PCT/EP2026/054629
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-02-21
- Filing Date
- 2026-02-19
- Publication Date
- 2026-08-27
Smart Images

Figure EP2026054629_27082026_PF_FP_ABST
Abstract
Description
[0001] NOVEL THERAPEUTIC MODALITY FOR THE TREATMENT OF DISEASES ASSOCIATED WITH VASCULAR AND / OR LYMPHATIC DISORDERS
[0002] DESCRIPTION
[0003] Technical field of the invention
[0004] The present invention concerns new vectorised VEGF isoforms (AAV-VEGFNF) for use in the treatment of diseases associated with vascular and / or lymphatic disorders, as stand-alone or in combination with an ASO-based therapy (e.g. an exon skipping therapy).
[0005] In the description below, references in square brackets ([ ]) refer to the list of references at the end of the text.
[0006] State of the art
[0007] Vascular and lymphatic disorders encompass a wide range of diseases characterized by impaired blood vessel formation, dysfunctional lymphatic drainage, or both, leading to severe clinical manifestations such as tissue edema, chronic inflammation, fibrosis, and organ dysfunction.
[0008] Muscular dystrophy (MD) is a group of diseases (e.g. Duchenne MD, Becker MD, myotonic dystrophy, facioscapulohumeral MD, limb-girdle MD, oculopharyngeal MD, Emery-Dreifuss MD, etc.) that cause progressive weakness and loss of muscle mass. In MD, abnormal genes (mutations) interfere with the production of proteins needed to form healthy muscle. There are many kinds of muscular dystrophy. Symptoms of the most common variety begin in childhood, mostly in boys. Other types do not surface until adulthood. There is no cure for muscular dystrophy, but medications and therapy can help manage simptoms and slow the course of the disease. Among these, Duchenne Muscular Dystrophy (DMD) stands out as a devastating neuromuscular disorder caused by mutations in the dystrophin gene, resulting in progressive muscle degeneration, respiratory failure, and cardiomyopathy. Despite the use of corticosteroids to slow disease progression, there is no cure for DMD, and current treatments fail to address the underlying genetic defect or the secondary vascular and lymphatic abnormalities, such as impaired angiogenesis and edema, which exacerbate muscle degeneration.Similarly, Peripheral Arterial Disease (PAD), characterized by narrowed or blocked arteries, often leads to pain, ulcers, and limb amputation. Although surgical and pharmacological interventions exist, many patients experience limited improvement due to the formation of poorly functional blood vessels. High-dose VEGF-A therapies, tested in clinical trials, have shown limited efficacy because they promote immature, leaky blood vessels lacking proper pericyte coverage.
[0009] Lymphedema, resulting from impaired lymphatic drainage, causes chronic swelling, fibrosis, and increased infection risk. Current therapies, such as compression garments and manual lymphatic drainage, provide only symptomatic relief without addressing the underlying lymphatic dysfunction. VEGF-C and VEGF-D, which promote lymphatic vessel growth, have been tested but have not yet demonstrated significant long-term benefits.
[0010] Chronic Venous Insufficiency (CVI), marked by venous valve dysfunction, leads to blood pooling, venous hypertension, and tissue damage. Existing treatments, including compression therapy and vein ablation, often fail to prevent disease progression or recurrence, highlighting the need for therapies that restore venous valve function or promote healthy angiogenesis.
[0011] Fibrotic disorders, such as pulmonary and liver fibrosis, involve excessive extracellular matrix deposition, leading to tissue scarring and organ dysfunction. Vascular and lymphatic abnormalities often contribute to disease progression, yet current antifibrotic therapies only slow progression without addressing these defects.
[0012] Antisense oligonucleotides (ASOs) have emerged as a promising therapeutic strategy for genetic diseases like DMD. ASOs modulate pre-mRNA splicing to restore the production of functional proteins, such as truncated but functional dystrophin in DMD. However, their application is limited by significant challenges. In this context, the Inventors have been actively working on the development of more potent ASOs. They have previously demonstrated the superiority and the therapeutic potential of ASO made of tricyclo-DNA (tcDNA) for the treatment of DMD [2,3] and other neuromuscular and neurodegenerative disorders [4,5], Notably, tcDNA-ASO showed unique pharmacological properties and unprecedented uptake in many tissues after systemic administration in various mouse models, including effective delivery to the heart and the ability to cross the blood brain barrier at low levels. More recently, they have shown that conjugation of palmitic acid further enhances the therapeutic potential of tcDNA-ASO (5-50-fold increase) offering promising tools for the systemic treatment of DMD [6,7].
[0013] Delivery remains a major hurdle, as only about 1% of systemically administered ASOs reach target tissues like skeletal and cardiac muscles. The poor biodistribution of ASOs to target tissues is not only influenced by their intrinsic properties but also by the pathological features of dystrophic muscles, such as impaired angiogenesis and altered vasculature. Indeed, notable alterations such as swollen and pale endothelial cells were described and aberrations in blood vessel structure were demonstrated in muscle biopsies from DMD patients [8], The analysis of vasculature in muscle tissues of mdx mice, the most commonly used mouse model of DMD revealed marked decrease in their vasculature compared to wild-type animals [9,10], This altered microvasculature may significantly contribute to the poor distribution of ASO to muscle tissues and ultimately limit ASO therapeutic potential.
[0014] To address these limitations, complementary strategies targeting angiogenesis and lymphatic function have been explored. Vascular endothelial growth factor A (VEGFA) has previously been proposed to enhance muscle vasculature, reduce local inflammation and improve DMD phenotype
[0011] , VEGF is a potent pro-angiogenic molecule, stimulating the migration, proliferation, and survival of endothelial cells. VEGF is acting mostly through VEGFR-2 pathway. Local administration of high doses of VEGFA has been extensively tested in phase ll / lll clinical trials for the treatment of peripheral arterial diseases without major improvements
[0012] , The main concern is the formation of poorly functional blood vessels that are not efficiently covered with pericytes, which impairs the long-term potency of this approach. Nevertheless, VEGFA treatment improved muscle function to some extent in mdx mice [13,14], However, these studies did not specifically determine the quality of blood vessels within the treated muscles. Moreover, DMD muscles are also characterized by oedema fibrosis due to increased cytoplasmic Na+ levels
[0015] , Oedema is directly linked to defect in lymphatic vessels. Therefore, clinical trials tested the effects of VEGFC orVEGFD, the main drivers of lymphatic vessels, for the treatment of limb lymphoedema-[15,16]. These two growth factors have not been tested in DMD models yet.
[0015] Recently, the Inventors identified a novel human VEGF isoform (VEGF222NF isoform) with much higher functional angiogenesis properties than VEGFA [17, 18], This VEGF222NF isoform results from a consensus splice acceptor site located 21 bp upstream of the conventional AG splice acceptor site in the seventh intron (togetherwith the presence of a consensus pyrimidine tract and a consensus branch site). The insertion of these 23 bp (including AG), creates a new open reading frame allowing the translation to occur in the domain considered as the 3’ untranslated region (3’UTR) of the VEGF mRNA. The mRNA resulting from this alternative splicing, codes for a new VEGF isoform of 248 amino acids from the initiation methionine having a NF domain at its C-terminal end. According to the international nomenclature, removal of the signal peptide gives rise to the VEGF222 New Form : VEGF222NF isoform. This isoform is expressed in healthy tissues and is associated with the formation of more functional blood and lymphatic vessels.
[0016] There is still a need to treat these debilitating diseases without the current drawbacks and limitations.
[0017] Description of the invention
[0018] The Inventors hypothesized that the treatment of such diseases with strategies to improve vascular and lymphatic function, and possibly by combining ASO-based therapies, may have a potential to overcome current limitations and provide more effective treatments for these debilitating diseases. “ASO-based therapy” also referred to as “antisense therapy” is a form a treatment that uses antisense oligonucleotides (ASOs) that modulate the expression of a target messenger RNA (mRNA).
[0019] ASOs are short (about 10 to 50-nucleotide long), single- or double-stranded nucleotide sequences, designed to bind to a corresponding segment of a target nucleic acid. ASOs act through a variety of mecanisms including (but not limited to) knockdown of the pre-m RNA, direct steric blocking and splice modulation (exon-slipping, exon-inclusion, splicing correction). ASOs generally incorporate sugar-modified nucleotides that increase in thermodynamic stability, render nuclease resistance, and improve pharmacokinetic / pharmacodynamic profiles. Non-exhaustive examples of sugar-modified nucleotides include 2'-modification analogs - such as 2'-O-methyl (2-OMe), 2'-O-methoxyethyl (2-MOE), 2’-deoxy-2’-fluoro-arabinonucleosides - and 2', 4'-bridged nucleic acid (BNA) analogs - such as locked nucleic acid (LNA) - and 2-0,4'-C-ethylene-bridged nucleic acid (ENA)
[0025] , Non-exhaustive examples of other modified ASOs are also peptide nucleic acids (PNAs), hexitol nucleic acids (HNAs), phosphorodiamidate morpholino (PMOs) and tricycloDNA (tcDNA) (used as an example herein).Therefore to test their hypothesis, the Inventors used a new VEGF isoform comprising the domain NF (VEGF-NF isoform), preferably the human new VEGF222NF isoform (or its murin equivalent VEGF234NF isoform), in particular together with an ASO-based therapy, e.g. an exon skipping therapy, not only to improve the overall therapeutic benefit but also to synergise the effects of ASO. The increase in vascularisation but more importantly the higher quality of the new blood vessels induced by the VEGF222NF isoform should not only decrease fibrosis and improve muscle function but also improve the effective delivery of ASO to the target muscles and therefore lead to higher restoration of dystrophin. Moreover, the development of lymphatic vessels that prevent the development of oedema should also delay or prevent muscle degeneration.
[0020] The Inventors thus unexpectedly demonstrated with the mdx model that this new VEGF-NF isoform of VEGF, VEGF222NF isoform
[0017] (or equivalent VEGF234NF isoform), can restore a much higher quality functional vascular system in dystrophic muscles than VEGFA which has shown a certain toxicity, and can also significantly improve the distribution of ASOs to target muscles and thus the therapeutic potential of an ASO-based therapy such as the exon skipping approach. The VEGF222NF isoform has far superior functional angiogenesis properties to VEGFA, and is also associated with the formation of more functional lymphatic vessel.
[0021] To this aim, in a preliminary study, the Inventors cloned VEGF-NF isoforms (e.g. VEGF222NF isoform) into an AAV vector (adeno-associated virus) enabling particularly efficient gene transfer into muscles in order to overexpress this isoform in the muscles of mdx dystrophic mice. They demonstrated that injection of this vectorised VEGF isoform restored the average number of vessels per fibre to levels similar to wild-type mice. In addition, when treated in combination with ASOs, they observed an increase in exon skipping levels in muscles pre-treated with these vectorised VEGF isoforms; this led to a more effective restoration of dystrophin than ASO treatment alone.
[0022] Then, with the aim of carrying out systemic treatments of mdx dystrophic mice, the inventors cloned murine VEGF and VEGF-NF isoforms into AAV vectors (murine VEGF234NF isoform corresponding to human VEGF222NF isoform, and murine VEGFA164 isoform corresponding to human VEGFA165 isoform) and performed a dose response study. The results indicate that intravenous injection of AAV-VEGF-NF induces overexpression of CD31 and LYVE-1 in dystrophic muscles in a dose-dependent manner, suggesting neosynthesis of blood and lymphatic vessels respectively. Immunofluorescent staining on muscle sections demonstrated an improvement in the number of vessels per muscle fibre, as well as an improvement in the size of the fibres, which are typically much smaller in dystrophic muscles. Injections of AAV-VEGFA control vectors also demonstrated an effect on the expression of CD31 and LYVE-1 but encountered a problem of tolerability since high doses of AAV-VEGFA vector caused the death of the mice unlike same high doses of AAV-VEGFNF.
[0023] It is to be noted that the results obtained in the mdx mouse model of Duchenne muscular dystrophy (DMD) are not limited to this rare genetic muscle disorder, but highlight vascular, lymphatic, and fibrotic mechanisms common to many chronic diseases. Endothelial dysfunction, tissue hypoperfusion, chronic inflammation, and progressive fibrosis observed in DMD are also central features of pathologies such that Peripheral Arterial Disease (PAD), Lymphedema, lymphedema associated with treatment of breast cancer, Chronic Venous Insufficiency (CVI), amyotrophic lateral sclerosis (ALS) and various organ fibrosis. Thus, the mdx mouse model is a relevant system for studying cross-cutting therapeutic targets affecting the vasculotissue couple, with a potential for generalization to other pathological contexts characterized by vascular and / or lymphatic disorders.
[0024] An object of the present invention is therefore an adeno-associated virus (AAV) vector comprising an isoform of VEGF having a NF domain at its C-terminal end (VEGF-NF isoform), wherein said NF domain comprises or consists of the nucleotide sequence CCTTTGTTTTCCATTTCCCTCAG (SEQ ID NO: 1) or GCCTGGGGAGGCTGCTTGCCTTCACTGCCAGGCTCCCGTGGCCCTAACCCCCT GCCTCTCTTTGCCATTTCCCATAG (SEQ ID NO: 2), and said AAV-VEGFNF having pro-vascular and pro-lymphangiogenic activities.
[0025] According to a particular embodiment of the AAV-VEGFNF vector of the present invention, the VEGF-NF isoform comprises a nucleotide sequence having at least 80% identity with the nucleotide sequence ATGAACTTTCTGCTGTCTTGGGTGCATTGGAGCCTTGCCTTGCTGCTCTACCTC CACCATGCCAAGTGGTCCCAGGCTGCACCCATGGCAGAAGGAGGAGGGCAGA ATCATCACGAAGTGGTGAAGTTCATGGATGTCTATCAGCGCAGCTACTGCCATC CAATCGAGACCCTGGTGGACATCTTCCAGGAGTACCCTGATGAGATCGAGTACA TCTTCAAGCCATCCTGTGTGCCCCTGATGCGATGCGGGGGCTGCTGCAATGAC GAGGGCCTGGAGTGTGTGCCCACTGAGGAGTCCAACATCACCATGCAGATTATGCGGATCAAACCTCACCAAGGCCAGCACATAGGAGAGATGAGCTTCCTACAGC ACAACAAATGTGAATGCAGACCAAAGAAAGATAGAGCAAGACAAGAAAATCCCT GTGGGCCTTGCTCAGAGCGGAGAAAGCATTTGTTTGTACAAGATCCGCAGACGT GTAAATGTTCCTGCAAAAACACAGACTCGCGTTGCAAGGCGAGGCAGCTTGAGT TAAACGAACGTACTTGCAGCCTTTGTTTTCCATTTCCCTCAGATGTGACAAGCCG AGGCGGTGAGCCGGGCAGGAGGAAGGAGCCTCCCTCAGGGTTTCGGGAACCA GATCTCTCACCAGGAAAGACTGATACAGAACGATCGATACAGAAACCACGCTGC CGCCACCACACCATCACCATCGACAGAACAGTCCTTAATCCAGAAACCTGA
[0026] (SEQ ID NO: 3) or at least 80% identity with the nucleotide sequence ATGAACTTTCTGCTCTCTTGGGTGCACTGGACCCTGGCTTTACTGCTGTACCTC CACCATGCCAAGTGGTCCCAGGCTGCACCCACGACAGAAGGAGAGCAGAAGTC CCATGAAGTGATCAAGTTCATGGATGTCTACCAGCGAAGCTACTGCCGTCCGAT TGAGACCCTGGTGGACATCTTCCAGGAGTACCCCGACGAGATAGAGTACATCTT CAAGCCGTCCTGTGTGCCGCTGATGCGCTGTGCAGGCTGCTGTAACGATGAAG CCCTGGAGTGCGTGCCCACGTCAGAGAGCAACATCACCATGCAGATCATGCGG ATCAAACCTCACCAAAGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAGC AGATGTGAATGCAGACCAAAGAAAGACAGAACAAAGCCAGAAAATCACTGTGAG CCTTGTTCAGAGCGGAGAAAGCATTTGTTTGTCCAAGATCCGCAGACGTGTAAA TGTTCCTGCAAAAACACAGACTCGCGTTGCAAGGCGAGGCAGCTTGAGTTAAAC GAACGTACTTGCAGGCCTGGGGAGGCTGCTTGCCTTCACTGCCAGGCTCCCGT GGCCCTAACCCCCTGCCTCTCTTTGCCATTTCCCATAGATGTGACAAGCCAAGG CGGTGAGCCAGGCTGCAGGAAGGAGCCTCCCTCAGGGTTTCGGGAACCAGAC CTCTCACCGGAAAGACCGATTAACCATGTCACCACCACGCCATCATCGTCACCG TTGACAGAACAGTCCTTAATCCAGAAAGCCTGA (SEQ ID NO: 4). In particular the AAV vector of the present invention comprises the human VEGF222NF isoform of sequence SEQ ID NO: 3 (AAV-VEGF222NF) or the murine VEGF234NF isoform of sequence SEQ ID NO: 4 (AAV-VEGF234NF).
[0027] According to a particular embodiment of the AAV vector of the invention, the AAV is for example an AAV9, AAVMYO, MyoAAV2A, MyoAAV4A [19,20], AAV6
[0021] , AAV8
[0022] , AAVrh74
[0023] , or AAVpol
[0024] vector.
[0028] Another object of the present invention is a nucleic acid encoding the AAV vector of the present invention.
[0029] Another object of the present invention is the AAV vector of the present invention for use as a drug.Another object of the present invention is the AAV vector of the present invention for use in the treatment of diseases associated with vascular and / or lymphatic disorders, wherein said diseases are selected from the group consisting of muscular dystrophy (MD) (e.g. Duchenne MD, Becker MD, myotonic dystrophy, facioscapulohumeral MD, limb-girdle MD, oculopharyngeal MD, Emery-Dreifuss MD, etc), Peripheral Arterial Disease (PAD), Lymphedema, lymphedema associated with treatment of breast cancer, Chronic Venous Insufficiency (CVI), amyotrophic lateral sclerosis (ALS) and fibrotic disorders including pulmonary fibrosis, kidney fibrosis and liver fibrosis.
[0030] According to a particular embodiment of the present invention, the muscular dystrophy is the Duchenne muscular dystrophy (DMD).
[0031] Another objet of the present invention is the AAV vector of the present invention for use in the combined treatment (co-treatment) of a diseases associated with vascular and lymphatic disorders as mentioned above, in particular of the Duchenne muscular dystrophy (DMD), with an ASO-based therapy, e.g. an exon skipping therapy (using ASO treatment).
[0032] According to a particular embodiment of the present invention, the ASO-based therapy uses an ASO that can be modified chemically with a range of modifications including (but not limited to) tcDNA, 2’OMe, 2-MOE , 2’-fluoro, ENAs, LNAs, PNAs, 2’-deoxy-2’-fluoro-arabinonucleosides, HNAs, PMOs. For example, the ASO is a tcDNA.
[0033] For example, the treatment with an AAV vector of the present invention is carried out before the ASO-based therapy (e.g. exon skipping therapy) to improve its efficacy.
[0034] Brief description of the figures
[0035] Figure 1 represents angiogenesis improvement after AAV-VEGF222NF intramuscular injection. A) Timeline of the injection protocol. Groups of male mdx mice received a single intramuscular injection of AAV9 encoding the VEGF222NF isoform (1E+11 vg / muscle) or PBS in the tibilais anterior muscle. Four weeks after this pretreatment, mice were injected intravenously with ASO (50 mg / kg / week) or PBS during 4 weeks. Age-matched C57BL / 10 wild-type mice were used as controls (WT). One week after the last injection, tissues were collected as described in the material and method. B) Quantification of the mean number of blood vessels per myofiber (**p<0.01 ; ***p<0.001 analyzed by one-way ANOVA). C) Distribution of the percentage of fibers as a function of the number of associated blood vessels. D) Quantification by qPCR ofexon 23 skipping in TA muscle. E) Quantification of dystrophin expression by westernblot (WB) on TA lysates. F) Representation of the percentage of fibers as a function of diameter including several intervals. The data regarding angiogenesis and fiber size were obtained through laminin and CD31 co-staining of tibialis anterior (TA) crosssections.
[0036] Figure 2 represents the dose-finding evaluation to determine the optimal intravenous injection doses and the uses derived from them. A) Quantification by qPCR of the absolute number of VEGFA164 or VEGF234NF isoform copies in TA lysates. B) qPCR quantification of CD31 expression after VEGF injections. C) Flow cytometry quantification of endothelial cells in the gluteus muscle. D) Distribution of the percentage of fibers as a function of the number of associated blood vessels. E) On the left graph, representation of the percentage of fibers as a function of diameter including several intervals. On the right graph (inset from left graph), representation of the percentage of fibers as a function of diameter focusing on fibers sized 500-1000 pm2. F) Percentage of centronucleated fibers in the different groups. WT mice are not presented because of the absence of centronucleated fibers. (*p<0.05 ; **p<0.01 ; ****p<0.0001 analyzed by one-way ANOVA) (G) VEGF (1E+13A) and VEGFNF (3E+13 NF) protein concentration measured by ELISA on GAS protein lysates, analyzed by one-way ANOVA. (H-J) Analysis of potential pro-lymphangiogenic activity of VEGFA and VEGFNF. (H) Fluorescence microscopy of beads for control (CTRL) and VEGFNF-treated conditions (VEGF-NF). (I) Number of sprout-positive beads for PBS and after stimulation with VEGF-A, VEGF-C or VEGF-NF. n=3 per group. (***p<0.001, analyzed by one-way ANOVA). (J) Lyve-1 expression quantification by qPCR in tibialis anterior muscles injected with PBS or AAV-VEGF222NF. n=4 per group. ($ p=0.0578, analyzed by t-test). Results are expressed as the mean ± SEM.
[0037] Figure 3 represents angiogenesis improvement and lymphangiogenic potential after AAV-VEGF234NF injection (A) Timeline of the injection protocol. Groups of 7-10 week-old male mdx mice were injected intravenously with a single dose of AAV9 encoding the VEGF234NF isoform (NF) or an AAV9-scramble (scramble) as control (3E+13 vg / kg) (n=4-5 mice per group). Four weeks after this pre-treatment, AAV9-scramble and AAV9-VEGF234NF-treated mice were injected intravenously with ASO (50 mg / kg / week: ASO, NF+ASO) or PBS (NF) during 12 weeks. Age-matched C57BL / 10 wild-type mice were used as controls (WT). One week after the last injection,tissues were collected as described in the material and method section. Quantification of the expression of total VEGFNF (B), 234NF (C), CD31 (D) orVEGFR3 (E) by qPCR in TA muscles.
[0038] Figure 4 represents impact of angiogenesis improvement on exon skipping and dystrophin expression (A) Quantification of ASO in TA (tibialis anterior), GAS (gastrocnemius), QUAD (quadriceps), TRI (triceps) and DIA (diaphragm) after 12 weeks of ASO treatment. (***p<0.001 analyzed by two-way ANOVA). (B) Quantification by qPCR of exon 23 skipping in different muscles. The table below indicates the values and the fold changes of exon skipping between the two groups per tissue. (*p<0.05 analyzed by two-way ANOVA). (C) Quantification of dystrophin expression by western-blot (WB). The table below indicates the fold change of dystrophin expression between the two groups per tissue (*p<0.05 analyzed by two-way ANOVA). (D) Representative WB from diaphragm lysates. A standard curve of 0%, 5%, 15% and 20% was made from pooled lysates from C57BI10 (WT) and mdx for each tissue.
[0039] Figure 5 represents functional improvement after VEGF234NF isoform and ASO treatment in mdx mice (A) Maximal distance run in meters on a treadmill. (B) Maximal speed reached by animals during the treadmill test. (C) Latency for each animal to fall from the inverted grid. (D) Quantification by western-blot of myomesin-3 in serum after normalization to scramble group. Myomesin 3 is undetectable in the serum of WT mice.
[0040] (E-G) Quantification of the expression of Troponin T (E), PGC1a (F) and von Willebrand factor (G) by qPCR. (*p<0.05 ; ***p<0.001 ; ****p<0.0001 , analyzed by oneway ANOVA).
[0041] Figure 6 represents impact of the combined treatment on muscle histopathology (A) Representation of the percentage of fibers as a function of diameter including several intervals. Fiber sizes were measured laminin staining of gastrocnemius muscle sections. (B) Mean area of the fiber size in the different groups. (C-D) Focus on the percentage of fiber muscles with a diameter comprised between 0 and 500pm2(C) or 2500 to 3000 pm2(D). (E) Percentage of centronucleated fibers in the different groups. WT mice are not presented because of the absence of centronucleated fibers. (F) Percentage of fibrosis found in different groups measured from Sirius red staining. (G) Quantification collagen 1 alphal subunit (Col1a1) and connective tissue growth factor (CTGF) expression by qPCR. (*p<0.05 ; **p<0.01 ; ***p<0.001 ; ****p<0.0001 analyzed by one-way or two-way ANOVA).Figure 7 represents safety assessment. Serum quantification of renal and liver toxicity markers including urea, total bilirubin, creatinine, alkaline phosphatase (ALP), alanine transaminase (ALT), aspartate aminotransferase (AST). (*p<0.05; **p<0.01; ***p<0.001 analysed by one-way ANOVA).
[0042] EXAMPLES
[0043] EXAMPLE 1 : MATERIALS AND METHODS
[0044] Antisense oligonucleotides and animal experiments
[0045] Animal care and experiments adhered to national and European legislation, ARRIVE guidelines, and were approved by the French government (APAFiS #6518). Mdx (C57BL / 10ScSc-Dmdmdx / J) mice were bred at the Plateforme 2Care (Universite de Versailles Saint Quentin) and maintained under standard conditions.
[0046] TcDNA-ASO targeting the donor splice site of exon 23 of the mouse dystrophin pre-mRNA (sequence 5’-CCTCGGCTTACCT-3’) (SEQ ID NO: 5) were synthesized by SQY Therapeutics (Montigny le Bretonneux, France). Palmitic acid was conjugated at the 5’end of a full PO-tcDNA via a C6-amino linker and a phosphorothioate bond as previously described [6],
[0047] In the preliminary intramuscular study, groups of male mdx mice received a single intramuscular injection of AAV9 encoding the VEGF222NF isoform (5E+11 vg / muscle) or PBS in the tibilais anterior muscle. Four weeks after this pre-treatment, mice were injected intravenously with ASO (50 mg / kg / week) or PBS during 4 weeks. Age-matched C57BL / 10 wild-type mice were used as controls (WT). One week after the last ASO injection, mice were euthanized by cervical dislocation, muscle and tissues were snap-frozen in liquid nitrogen-cooled isopentane and stored at -80°C.
[0048] In the dose finding study, groups of male mdx mice received a single intravenous injection of AAV9 encoding the VEGFA isoform (1E+12 vg / kg, 5E+12 vg / kg or 1E+13 vg / kg) orthe VEGF234NF isoform (1E+12 vg / kg, 5E+12 vg / kg, 1E+13 vg / kg or3E+13 vg / kg) (N=3-4 mice per group). Eight weeks after the injections mice were euthanized by cervical dislocation, muscle and tissues were snap-frozen in liquid nitrogen-cooled isopentane and stored at -80°C.
[0049] In the combined therapeutic study, groups of 7-10 week-old male mdx mice were injected intravenously with a single dose AAV9 encoding the VEGF234NF isoform oran AAV9-scramble as control (3E+13 vg / kg). Fourweeks after this pre-treatment, mice were injected intravenously with ASO (50 mg / kg / week) or saline during 12 weeks. Age-matched C57BL / 10 wild-type mice were used as controls. One week after the last ASO injection, mice were euthanized by cervical dislocation, muscle and tissues were snap-frozen in liquid nitrogen-cooled isopentane and stored at -80°C.
[0050] Functional analysis
[0051] Muscle function. Muscle function of mdx mice was evaluated by measuring TA muscle contraction in situ in response to nerve stimulation. Mice were anaesthetized under isoflurane throughout the experiment. Body temperature was maintained at 37°C using radiant heat. The knee and foot were fixed with pins and clamps, and the distal tendon of the muscle was attached to the lever arm of a servo-motor system using a silk ligature. The sciatic nerve was crushed proximally and stimulated distally by a bipolar silver electrode using supramaximal 0.1 ms-duration square-wave pulses. We measured the absolute maximal isometric tetanic force (P0) generated during isometric contractions in response to electrical stimulation (frequency 75-150Hz, stimulation train 500ms). P0 was determined at L0 (length at which maximal tension was obtained during the tetanus). Absolute maximal isometric force was normalized to muscle mass as an estimate of specific maximal force (sPO), that is, specific force.
[0052] Fragility was estimated from the force decline resulting from lengthening contraction-induced injury. The sciatic nerve was stimulated 700ms (150Hz stimulation frequency). A maximal isometric contraction of the TA muscle was initiated during the first 500ms. Then, muscle lengthening (10% L0) at a velocity of 5.5mm / s was imposed during the last 200ms. All isometric contractions were made at an initial length, L0. Nine lengthening contractions of the TA muscles were performed, each separated by a 60s rest period. Maximal isometric force was measured 1min after each lengthening contraction and expressed as a percentage of the initial maximal isometric force. Measurements for both tibialis anterior muscles per mouse is shown. The experimenter was blinded to the treatment group when performing the measurements.
[0053] Treadmill. Mice were first acclimatized for 30min in the room of experiment before each session. During 3 days before testing, they were placed on a switched-off treadmill for 30 seconds followed by a warm-up at 20cm / s for 5min. For the test session, mice were placed on the treadmill and the test started at the lowest speed of 5cm / s to allow a warm-up (3min). Speed was then increased by 1cm / s every 30seconds until exhaustion. Exhaustion was defined as the moment when the mouse would not continue running on the treadmill for 20s despite gentle nudges to make it do so. At the end of the running test exercise, the total distance run was measured for each mouse.
[0054] Inverted arid. Mice were first acclimatized for 30min in the room of experiment before each session. They were placed on a grid which was turned over before the timer was started. Each mice is evaluated 3 times with 300s of rest between each test. The duration of each test cannot exceed 120s and the latency to fall was recorded.
[0055] ASO quantification by fluorescent hybridization assay
[0056] Using the Precellys (Bertin Instruments, France), tissues were homogenized in lysis buffer (100mmol / l T ris-HCI, pH 8.5, 200mmol / l NaCI, 5mmol / l EDTA, 0.2% sodium dodecyl sulfate) containing 2mg / ml of proteinase K (Invitrogen) to a final concentration of 50mg tissue / ml of buffer. After an overnight incubation at 55°C, lysate was centrifugated at 7000rpm and the supernatant was collected.
[0057] A hybridization assay with a molecular beacon probe was used to perform quantification of ASO, as previously described [6], Briefly, 10pl of tissue lysates were incubated with a 5’Cy3-DNA complementary probe conjugated with HBQ quencher at 3’ in a black non-binding 96-well plates (Fisher Scientific). PBS was added to a final volume of 10OpI per well and fluorescence was measured on a spectrophotometer (Ex 544nm / Em 590nm using FluoStar Omega). The amount of tcDNA in tissues was determined using a standard curve build on the measurement of known tcDNA quantities dissolved in the respective tissue lysates of mock-injected animals.
[0058] RNA analysis
[0059] Total RNA was isolated from snap-frozen muscle tissues using TRIzol reagent according to the manufacturer's instructions (ThermoFisher Scientific, USA).
[0060] Exon 23 skipping levels were quantified by ddPCR QX 200 (Biorad). Briefly, 1 pg of RNA was retro-transcribed using Luna Script RT SuperMix kit (New England Biolabs) and 100ng of cDNA were used to perform the ddPCR analysis. The Supermix for probes (no dUTP) was added to cDNA with probes designed to recognize the exon 23-24 junction and exon 22-24 junction (previously described in [6], Droplets were generated thanks to the QX200 Droplet Generator according to recommendations ofthe manufacturer. After sealing the plate and running PCR, the plate was read by the QX200 Droplet Reader.
[0061] Quantification of markers of fibrosis, inflammation and angiogenesis was performed by qPCR on the same cDNA (dilution 1 / 10) using the iTaq Universal SYBER Green supermix (Biorad). The sequences of all qPCR primers and probes are provided in table 1 below.
[0062] Table 1: Probes sequences used in taqman or syber assays
[0063] > >
[0064]
[0065]
[0066] Western blot analysis
[0067] Muscle sections were collected during cryosection then homogenized with the Precellys24 (Bertin Instruments, France) in RIPA buffer with 5% SDS and protease inhibitor. After denaturation and centrifugation, supernatant was collected and total protein concentration was determined with the BCA Protein Assay Kit (ThermoFisher Scientific, USA). For the Western-Blot, 25pg of protein were loaded onto NuPAGE 3-8% Tris-Acetate Protein gels (Invitrogen), following manufacturer instructions. Dystrophin protein was stained using Every Blot Blocking Buffer (Biorad). The membrane was labelled with NCL-DYS1 primary monoclonal antibody (NCL-DYS1; Novocastra, Newcastle, UK, dilution 1 / 1000) and hVin-1 primary antibody (Sigma, dilution 1 / 25000), followed by incubation with a goat anti-mouse secondary antibody (IRDye 800CW Goat anti-mouse IgG, Li-Cor, Germany, dilution 1 / 2000). Bands were visualized using the Odyssey CLx system (Li-Cor, Germany) and quantification was done using the Empiria Studio software (Li-Cor, Germany) based on a standard curve made from pooled lysates from C57BL10 (WT) and mdx control for each tissues.
[0068] For myomesin-3 detection, mouse sera were diluted at 1:20 before loading onto 3-8% Criterion™ XT Tris-Acetate Protein Gel, following manufacturer’s instructions (Biorad, France). Myomesin-3 protein was stained using the iBind™ Flax Western Device (Fisher Scientific) and by incubating the nitrocellulose membrane with MYOM3 primary rabbit polyclonal antibody (MYOM3, Proteintech, Manchester, UK dilution 1 / 1000), followed by incubation with a goat anti-rabbit secondary antibody (IRDye 800CW Goat anti-rabbit IgG, Li-Cor, Germany, dilution 1 / 2000). Bands were visualized using the Odyssey Imaging System (Biosciences, Lincoln, USA). Signals intensity in treated samples were normalized to total protein staining (Revert 700 Total Protein Stain (Li-Cor Biosciences GmbH, Germany), then quantified and normalized to signals from PBS control mice signals using the Image Studio software (Li-Cor, Germany).
[0069] VEGF quantification by ELISA
[0070] Tissue VEGF protein levels were quantified using the Quantikine Mouse VEGF ELISA kit (MMV00, R&D Systems, Minneapolis, MN, USA), according to the manufacturer’sinstructions. Samples were homogenized in lysis buffer containing 50 mM Tris-HCI (pH 7.4), 250 mM NaCI, 5 mM EDTA, 1% Triton X-100, and a protease inhibitor cocktail. Following centrifugation, the supernatants were collected, and total protein concentrations were determined using the BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, USA). VEGF levels were normalized to total protein content and expressed as pg / pg of total protein.
[0071] Immunohistochemistry analysis
[0072] Sections of 10pm at 120pm intervals were cut and examined for dystrophin, laminin, CD31 and aSMA expression using the rabbit polyclonal antibody dystrophin (dilution 1 :500; cat. number RB-9024-P ThermoScientific), which was then detected by Goat Anti-rabbit IgG (H+L), F(ab')2 Fragment (Alexa Fluor® 488 Conjugate, dilution 1 / 500), the rabbit polyclonal antibody laminin (dilution 1:200; Sigma ref: L9393-2ML) which was then detected by Goat Anti-rabbit IgG (H+L), F(ab')2 Fragment (Alexa Fluor® 488 Conjugate, dilution 1 / 1000), the rat anti-CD31 antibody (dilution 1:1000, BD Pharmingen, 550274) which was then detected by Goat Anti-rat IgG (H+L), (Alexa Fluor® 555 Conjugate, dilution 1 / 1000), respectively. Images were taken at equivalent exposure times and analyzed with Imaged software.
[0073] Prior to Picro-sirus Red staining, frozen sections (10pm) were allowed to air-dry for one hour at room temperature and incubated in xylene for ten minutes to prevent the overstaining of red fibers. Subsequently, the sections were hydrated in an ethanol gradient (100%, 80%, 40%) for 30 seconds each, followed by a 1-minute incubation in dH2O. Thereafter, the sections were stained with Picro-sirius Red (Abeam AB246832) for 1 hour. Following the staining procedure, the sections were rinsed twice for two minutes each with 0.1 N HCI, then rapidly rinsed with dH2O. They were subsequently dehydrated in an ethanol gradient (70%, 80%, 100%) for 30 seconds, 30 seconds and one minute, respectively. The sections were then cleared with xylene for two minutes and cover-slipped with Vectamount® permanent mounting medium.
[0074] Images of the sections were captured using a Leica DFC7000 T camera head attached to a Leica DM IL microscope and analysed using Imaged 1.54d software.
[0075] Flow cytometry analysis
[0076] Gluteal muscles from each mouse were harvested and maintained on ice in Hank’s Balanced Salt Solution (HBSS) supplemented with 0.2% bovine serum albumin(BSA) (HBSS+). The tissues were finely minced (<2 mm) and enzymatically digested in a solution containing Dispase II (0.89 U / mL), Collagenase A (100 pg / mL), CaCI2 (50 mM), MgCI2 (1 M), and DNase I at 37°C with gentle agitation (40-50 rpm) for 1.5 h. The resulting cell suspension was filtered sequentially through 100 pm and 70 pm cell strainers and resuspended in HBSS+. Cells were centrifuged and resuspended in PBS for viability assessment using a LIVE / DEAD staining kit and incubated for 3 min at room temperature (RT) before washing. Fixation was performed using 4% PFA for 15-20 min at RT, followed by three washes with HBSS+. Cells were then resuspended in HBSS+ and stored overnight at 4°C. For immunolabeling, cells were incubated on ice with Donkey Normal Serum (5%) for 5 min. Primary antibodies (anti-CD31-PE (15268509 FISHER) and anti-CD45-FITC (TNB35-0451 -U100)) were added at a 1 :200 dilution and incubated for 30 min at RT in the dark. After washing, cells were resuspended in HBSS+ containing 2 mM EDTA. Appropriate unstained and isotype control samples were included. Flow cytometry analysis was performed using a fluorescence-activated cell sorter (FACS), with all samples kept on ice prior to acquisition
[0077] LEC sprouting assay
[0078] Human LEC sprouting was assessed using a 3D fibrin matrix. Briefly, LECs were aggregated onto gelatin-coated microcarrier beads (250 beads per 2x105 cells) by incubation overnight at 37° C in Microvascular Endothelial Cell Growth Medium (PELOBiotech, Planegg / Martinsried, Germany). The following day, LEC-coated beads were embedded in a fibrin matrix composed of bovine fibrinogen and thrombin. After polymerization, human fibroblasts (FHN, 20,000 cells / well) were seeded on top of the polymerized gels in endothelial cell medium without VEGF, and treatments with recombinant human VEGF-A, VEGF-C or VEGF-NF (200 ng / mL) were applied. After 6-7 days of incubation, samples were fixed with 4% paraformaldehyde for 1 h at room temperature, permeabilized with 0.5% Triton X-100 in PBS for 45 min, and stained overnight at 4° C with Alexa Fluor 488-conjugated phalloidin. Sprouting was quantified using fluorescence microscopy as sprout-positive beads per well.
[0079] Serum analysis
[0080] Analysis of serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), bilirubin, creatinine, urea and albumin levels wereperformed by the pathology laboratory at Mary Lyon Centre, Medical Research Council, Harwell, Oxfordshire, UK.
[0081] Statistical analysis
[0082] All in vivo data were analysed with the Graph Pad Prism8 software (San Diego, California, USA) and expressed as means ± S.E.M. The “n” refers to the number of mice per group.
[0083] Group comparisons were performed using one and two-way analysis of variance (ANOVA) with repeated-measure comparisons when needed. To compare the overall effect of 2 treatments across the different tissues, the 2 groups were directly compared using a two-way ANOVA and the P value of the treatment effect is indicated in the figure legend. The Kruskal-Wallis test was used to compare groups that do not follow a normal distribution (assessed with the Shapiro- Wilk test). Significant levels were set at *p < 0.05, **p < 0.01 , ***p < 0.001 , ****p<0.0001.
[0084] EXAMPLE 2 : RESULTS
[0085] Preliminary study: intramuscular injections of AAV-VEGF222NF
[0086] A preliminary study was conducted in which the VEGF222NF isoform was cloned into an AAV9 vector (adeno-associated virus of serotype 9) which enables the efficient transfer of the gene into muscles, with the aim of overexpressing this isoform. The resulting AAV-VEGF222NF vector was thus injected intramuscularly (5E+11 vg) in the tibialis anterior (TA) as a pre-treatment. After 4 weeks, the mice were administered an ASO-based therapy (50 mg / kg / week) aimed at restoring the expression of dystrophin intravenously once a week for 4 weeks as illustrated in figure 1A. After tissue collection, TA cross-sections were performed in order to stain blood vessels and myofibers, thereby highlighting the effect of AAV-VEGF222NF on the histopathology of mdx mice muscles. A significant increase was unexpectedly demonstrated in the mean number of blood vessels perfiber in muscles that received the AAV-VEGF222NF. Indeed, while PBS mice exhibited a 27% decrease in blood vessels compared to WT (p<0.01), the injection of the AAV-VEGF222NF restored the mean number of vessels perfiber (p=ns compared to WT) (Fig 1B). Additionally, the distribution of blood vessels per fiber appeared very close to the WT one, with a decrease in the percentage of fibers with less than 4 vessels and an increase in the percentage of fibers with more than 5vessels compared to PBS mice (Fig 1C). Given this amelioration of the angiogenesis, it was assumed that the ASO-based therapy would be more efficient in restoring the dystrophin expression due to an improved biodistribution to the target muscles. The quantification of exon skipping showed an increase of 25% in TA treated with the AAV-VEGF222NF and ASO compared to muscles treated only with ASO (Fig 1D). This resulted in an increase of 20% of dystrophin restoration in muscles treated with AAV-VEGF222NF+ASO (Fig 1E).
[0087] The impact of the VEGF222NF isoform on muscle fiber size, a dystrophic biomarker, was examined. TA muscles from mdx mice indeed exhibit a higher number of small fibers (<500 pm2) and a reduced number of large fibers compared to WT mice, indicative of strong regeneration. Interestingly, the distribution profile of muscles treated with the AAV-VEGF222NF appeared closer to WT profile with a decrease of 15% of small fibers (<500 pm2) and an increase of 6% of the fibers with a diameter comprised between 1500 and 2000 pm2(Fig 1F).
[0088] This preliminary study showed the capacity of VEGF222NF to ameliorate the angiogenesis in TA muscles which resulted in the improvement of dystrophin restoration mediated by exon skipping and the unexpected amelioration of muscle histopathology in mdx mice.
[0089] Dose-finding study: comparison of AAV-VEGF223NF and AAV-VEGFA Then, with the aim of carrying out systemic treatments of mdx dystrophic mice, the murine VEGF234NF isoform (corresponding to human VEGF222NF isoform), and murine VEGFA164 isoform (corresponding to human VEGFA165 isoform) were cloned into AAV vectors. A dose-finding study was first conducted to determine the optimal dose of AAV for systemic injections. Based on classical doses used in clinic, mdx mice received AAV encoding the VEGFA164 isoform at 1E+12vg / kg (A 1E+12), 5E+12vg / kg (A 5E+12), 1E+13vg / kg (A 1E+13) or AAV encoding the VEGF234NF isoform at 1E+12vg / kg (NF 1E+12), 5E+12vg / kg (NF 5E+12), 1E+13vg / kg (NF 1E+13) and 3E+13vg / kg (NF 3E+13). The high dose corresponding to 3E+13vg / kg was not tested with the AAV encoding the VEGFA164 isoform because of toxicity observed already at the dose of 1E+13vg / kg for this isoform, which thus prevents comparison with the AAV encoding the VEGF234NF isoform at 3E+13 vg / kg - a dose at which the VEGF234NF isoform is not toxic.However the expression of the transgene (VEGFA164 or VEGF234NF isoform respectively) was first quantified by qPCR and similar levels of expression were found for the dose of 1E+13vg / kg for the AAV-VEGFA164 and 3E+13 vg / kg for the AAV-VEGF234NF (Fig 2A), which allows the experimental results for both isoforms to be directly comparable. Furthermore, at these above different doses of 3E+13 vg / kg and 1E+13 vg / kg, respectively, it was found that the amount of the VEGF234NF isoform produced at the protein level is not statistically different from that of the VEGFA isoform (Fig 2G) - demonstrated once more that the two doses are directly comparable. Similarly, a significant increase in CD31 expression was obtained in muscles treated with these 2 doses of vectors (Fig 2B). Additionnaly, a flow cytometry analysis was conducted on muscles freshly isolated from the treated mice in order to quantify the number of endothelial cells (Fig 2C). It was found that the dose of 1E+13vg / kg for the VEGFA164 and 3E+13 vg / kg for the VEGF234NF normalized the number of endothelial cells to WT levels in treated muscles, although the effect was more important with VEGF234NF.
[0090] The doses of 1 E+13vg / kf for the AAV-VEGFA164 and 3E+13vg / kg for the AAV-VEGF234NF were selected for further analysis and the distribution of myofibers depending on the number of associated blood vessel was particularly analysed. Both AAVs (A164 and 234NF) were showed to tend to normalize the curve towards WT levels but the VEGF234NF isoform injected muscles were the closest with a peak of 22% of fiber with 5 blood vessels comparable to the WT one, whereas the VEGFA164 isoform also tends to induce extreme vascularization (presence of fibers with 11 or 12 vessels per fiber) which is not physiological and indicates uncontrolled angiogenesis. (Fig 2D). More importantly, when analyzing the fiber size distribution profiles, which are markedly different in mdx muscles compared to WT muscles (Fig 2E), muscles treated with the VEGFA164 isoform appeared worse that control PBS ones with higher number of small fibers (<1000pm2) and lower number of large fibers (>2500pm2). In contrast, muscles treated with the VEGF234NF isoform displayed a profile closer to WT levels suggesting that the histopathological profile is improved and the muscle stabilized with less small fibers and more large fibers. On the contrary, the VEGFA164 isoform worsens the histopathological profile by increasing the number of small fibers (left graph, Fig 2E) which are even more numerous than in the PBS control when focusing on fibers with a diameter of 500 to 1000 pm2(right graph being an inset of left graph, Fig 2E). In line with these results, only the treatment with the VEGF234NFisoform was found to be capable of significantly decreasing the percentage of centronucleated fibers, which is a hallmark of dystrophic muscles (Fig 2F), which, firstly, is not the case for the VEGFA164 isoform and, secondly, was not expected for the VEGF234NF isoform. The VEGF234NF isoform therefore appears more therapeutic than the VEGF164A isoform, despite similar levels of expression detected in injected muscles (Fig 2G, no statistical difference analysed by One-way ANOVA).
[0091] Moreover, the lymphangiogenic potential of each isoform was investigated using a 3D lymphatic endothelial cell (LEC) sprouting assay. Sprouting was quantified by counting sprout-positive beads per condition (Fig 2H-I). It was found that, unlike VEGFA the VEGFNF isoform has a significative prolymphangiogenic activity when compared to control (PBS) and the corresponding activity of the VEGFC isoform. This lymphangiogenic activity was also confirmed in vivo, as Lyvel (Lymphatic vessel endothelial receptor 1 ) mRNA levels were increased in TA muscles injected with AAV9-VEGF222NF compared to PBS-treated controls (Fig 2J).
[0092] Combined therapy of AAV-VEGFNF and ASO
[0093] Based on the dose-finding study, the dose of 3E+13 vg / kg was selected for the AAV9-VEGF234NF and the dose of 1E+13 vg / kg for the AAV9-VEGFA164, which induced similar expression of VEGFA164 (Fig 2A and G) and thus should enable the experimental results to be directly comparable. However injection of AAV9-VEGFA164 induced severe adverse events leading to the death of several animals and confirmed previous observations during the prelimary study that even this dose of VEGFA was not well tolerated (only 2 mice survived out of a total of 5 mice injected). Injections with this vector were thus stopped for obvious ethical reasons, which prevented the subsequent comparison between VEGF234NF and VEGFA164 isoforms. Further analysis thus compared the following groups of mice: scramble (AAV9-Ctl + PBS), NF (AAV9-234NF + PBS), ASO (AAV9-Ctl + ASO) and NF+ASO (AAV9-234NF + ASO) (Fig 3A). The overexpression of the VEGF234NF isoform (both total NF and specific 234NF) was first validated by qPCR in the muscles of mice treated with the AAV9-234NF, compared to control mdx and WT mice (Fig 3B-C). This overexpression of the VEGF234NF isoform was associated with an overexpression of CD31 , compensating the decreased expression observed in control mdx mice (scramble) (Fig 3D) and suggesting an improved angiogenesis in muscles treated with the AAV9-234NF. Given the lymphangiogenic potential of VEGFNF isoform (shown in Fig 2H-J), it was next11
[0094] investigated whether this isoform can modulate lymphatic vessels in vivo by quantifying VEGFR3 expression, a lymphatic endothelial cell marker, via qPCR. It was found that a significant increase in VEGFR3 expression was observed in the NF+ASO group (Fig 3E), suggesting enhanced lymphatic vessel formation alongside improved blood vascularization.
[0095] To assess the impact of this improved angiogenesis on the exon skipping therapy, the amount of ASO found in muscle tissues at the end of the treatment was first quantified. Significantly higher levels of ASO were found in muscles from mdxmice pre-treated with the AAV9-234NF (Fig 4A) and this led to significantly higher levels of exon skipping in the corresponding muscles (Fig 4B, table below). The pre-treatment with AAV9-234NF increased by approximately 80% the efficacy of exon skipping in skeletal muscles of treated mdx mice. This translated into an increase of about 50% of dystrophin restoration in these muscles, with levels reaching up to 32% of restoration in the gastrocnemius muscle (Fig 4C-D, table below).
[0096] Fonctional benefit of the co-treatment
[0097] In order to assess the therapeutic benefit of the co-treatment, a series of functional tests were performed on the treated mice. The ability of treated mice to sustain continuous exercise over a long period of time using a treadmill exhaustion test was assessed. The mice were placed on the treadmill at a speed of 5cm / s for a three-minute acclimatization period. Thereafter, the speed was increased to 1cm / s every 30 seconds until the mice had reached their exhaustion point and could no longer continue. As previously reported, the distance ran by control mdx mice (scramble) was significantly lower than wild-type (WT) mice (p <0.001) (Fig 5A). An increase in the distance run in mice treated with the ASO alone was observed compared to controls but the improvement was only statistically significant in mice treated with the combined treatment (p<0.05 compared to scramble). This was also the case for the maximum speed achieved by each mouse, where the performance of mice treated with 234NF+ASO was significantly different than controls (Fig 5B).
[0098] To further assess functional improvement, mice were tested on the inverted grid test, which assesses the strength in all four limbs for a maximum period of 120 seconds. The result of this test demonstrates a clear and statistically significant difference in the average time spent on the inverted grid between WT and mdx mice. WT mice exhibited a mean latency to fall of 72 seconds, while mdx mice only remainedon the grid for an average of 24 seconds (p <0.001) (Fig 5C). Regarding the treated groups, only the mice treated with both 234NF and ASO demonstrated a significant increase (p<0.05) in the latency to fall when compared to the scramble group. These results suggest that the combined AAV9-234NF and ASO treatment significantly improves functional outcomes in mdx mice.
[0099] The levels of several biomarkers of dystrophic pathology such as myomesin-3, troponin-T, PGC1a and von Willebrand factor were assessed in the serum and muscles of treated mice. In all cases the combined treatment 234NF+ASO allowed a signification normalization of levels toward WT levels (Fig 5D-G).
[0100] In addition the impact of the NF treatment was assessed on muscle histopathology, starting with the size of muscle fibers in the gastrocnemius muscles of all groups of mice. The fiber size distribution profile in mdx muscles is markedly different from WT muscles as shown in Figure 6A. Muscles from mdx mice indeed exhibit a higher number of small fibers (<500pm2) and a reduced number of large fibers compared to WT mice, indicative of strong regeneration (Fig 6A). Interestingly, the distribution profile of muscles treated with 234NF improved slightly towards the WT profile and was statistically improved in muscles treated with 234NF+ASO (p<0.05).
[0101] 234NF+ASO treatment significantly decreased the number of small fibers (<500pm2) from 40% in scramble mdx mice to 18% in mice treated with 234NF+ASO (p<0.0001) (Fig 6C). Conversely, the number of larger fibers with a diameter between 2500 and 3000pm2increased, exhibiting a distribution pattern closer to that observed in WT mice (Fig 6D). The overall mean area of muscle fibers which is typically reduced in mdx muscles was also significantly increased only with the combined treatment (Fig 6B), highlighting the positive impact of the 234NF+ASO treatment on dystrophic histopathology.
[0102] This positive effect was also demonstrated with the significant reduction in centronucleated fibers, which was already very significant with 234NF treatment alone (Fig. 6E).
[0103] One of the characteristic hallmarks of fibrotic changes in mdx skeletal muscles is the excess deposition of collagens and other extracellular matrix components. Sirius red staining was thus performed to quantify collagen accumulation in muscles from the different treatment groups. A comparison of WT and scramble mdx mice revealed a significant increase in collagen staining in scramble mdx mice (Fig 6F). The administration of ASO and ASO+234NF resulted in a significant reduction of collagencompared to scramble controls (Fig 6F). The expression of fibrosis markers such as collagen I and connective tissue growth factor (CTGF) was further quantified by quantitative PCR (qPCR), and a significant treatment effect was demonstrated for the ASO and ASO+NF groups (Fig 6G).
[0104] Finally, to ensure that the treatment with the AAV9-234NF (NF) or the combination of AAV9-234NF with ASO (NF+ASO) did not induce any specific toxicity, the serum levels of various general biomarkers were analyzed in mdx mice following the different treatments. Quantification of serum urea, bilirubin, albumin and creatinin revealed no significant changes both in ASO and ASO+NF treated mice compared to PBS mice (Fig 7). In contrast and in line with the positive impact of the NF and ASO treatments, reduction in alkaline phosphatase (ALP) and transaminases (ALT and AST) levels were observed in mice treated with NF+ASO.List of references
[0105] 1. Ferlini, A.; Goyenvalle, A.; Muntoni, F. RNA-Targeted Drugs for Neuromuscular Diseases. Science 2021, 371, 29-31, doi:10.1126 / science.aba4515.
[0106] 2. Goyenvalle, A.; Griffith, G.; Babbs, A.; El Andaloussi, S.; Ezzat, K.; Avril, A.; Dugovic, B.; Chaussenot, R.; Ferry, A.; Voit, T.; et al. Functional Correction in Mouse Models of Muscular Dystrophy Using Exon-Skipping Tricyclo-DNA Oligomers. Nature medicine 2015, 21, 270-275, doi:10.1038 / nm.3765.
[0107] 3. Relizani, K.; Griffith, G.; Echevarria, L.; Zarrouki, F.; Facchinetti, P.; Vaillend, C.; Leumann, C.; Garcia, L.; Goyenvalle, A. Efficacy and Safety Profile of Tricyclo-DNA Antisense Oligonucleotides in Duchenne Muscular Dystrophy Mouse Model. Mol Ther Nucleic Acids 2017, 8, 144-157, doi: 10.1016 / j.omtn.2017.06.013.
[0108] 4. Robin, V.; Griffith, G.; Carter, J.-P.L.; Leumann, C.J.; Garcia, L.; Goyenvalle, A. Efficient SMN Rescue Following Subcutaneous Tricyclo-DNA Antisense Oligonucleotide Treatment. Mol Ther Nucleic Acids 2017, 7, 81-89, doi:10.1016 / j.omtn.2017.02.009.
[0109] 5. Imbert, M.; Blandel, F.; Leumann, C.; Garcia, L.; Goyenvalle, A. Lowering Mutant Huntingtin Using Tricyclo-DNA Antisense Oligonucleotides As a Therapeutic Approach for Huntington’s Disease. Nucleic Acid Ther 2019, doi: 10.1089 / nat.2018.0775.
[0110] 6. Relizani, K.; Echevarria, L.; Zarrouki, F.; Gastaldi, C.; Dambrune, C.; Aupy, P.; Haeberli, A.; Komisarski, M.; Tensorer, T.; Larcher, T.; etal. Palmitic Acid Conjugation Enhances Potency of Tricyclo-DNA Splice Switching Oligonucleotides. Nucleic Acids Res 2022, 50, 17-34, doi:10.1093 / nar / gkab1199.
[0111] 7. International Application WO 2022 / 073920
[0112] 8. Miike, T.; Sugino, S.; Ohtani, Y.; Taku, K.; Yoshioka, K. Vascular Endothelial Cell Injury and Platelet Embolism in Duchenne Muscular Dystrophy at the Preclinical Stage. J Neurol Sci 1987, 82, 67-80, doi: 10.1016 / 0022-510x(87)90007-4.
[0113] 9. Matsakas, A.; Yadav, V.; Lorca, S.; Narkar, V. Muscle ERRy Mitigates Duchenne Muscular Dystrophy via Metabolic and Angiogenic Reprogramming. FASEB J 2013, 27, 4004-4016, doi:10.1096 / fj.13-228296.
[0114] 10. Loufrani, L.; Dubroca, C.; You, D.; Li, Z.; Levy, B.; Paulin, D.; Henrion, D. Absence of Dystrophin in Mice Reduces NO-Dependent Vascular Function and Vascular Density: Total Recovery after a Treatment with the AminoglycosideGentamicin. Arterioscler Thromb Vase Biol 2004, 24, 671-676, doi:10.1161 / 01. ATV.0000118683.99628.42.
[0115] 11. Podkalicka, P.; Mucha, O.; Dulak, J.; Loboda, A. Targeting Angiogenesis in Duchenne Muscular Dystrophy. Cell Mol Life Sci 2019, 76, 1507-1528, doi: 10.1007 / S00018-019-03006-7.
[0116] 12. Henry, T.D.; Annex, B.H.; McKendall, G.R.; Azrin, M.A.; Lopez, J. J.; Giordano, F.J.; Shah, P.K.; Willerson, J.T.; Benza, R.L.; Berman, D.S.; et al. The VIVA Trial: Vascular Endothelial Growth Factor in Ischemia for Vascular Angiogenesis. Circulation 2003, 107, 1359-1365, doi:10.1161 / 01.cir.0000061911 ,47710.8a.
[0117] 13. Song, X.; Zhang, Y.; Hou, Z.; Wu, H.; Lu, S.; Tang, J.; Chen, X.; Cui, H.; Li, Y.; Bi, Y.; et al. Adeno-Associated Virus Serotype 9 Mediated Vascular Endothelial Growth Factor Gene Overexpression in Mdx Mice. Exp Ther Med 2018, 15, 1825-1830, doi:10.3892 / etm.2017.5610.
[0118] 14. Xin, C.; Chu, X.; Wei, W.; Kuang, B.; Wang, Y.; Tang, Y.; Chen, J.; You, H.; Li, C.; Wang, B. Combined Gene Therapy via VEGF and Mini-Dystrophin Synergistically Improves Pathologies in Temporalis Muscle of Dystrophin / Utrophin Double Knockout Mice. Hum Mol Genet 2021, 30, 1349-1359, doi:10.1093 / hmg / ddab120.
[0119] 15. Mavrogeni, S.; Papavasiliou, A.; Giannakopoulou, K.; Markousis-Mavrogenis, G.; Pons, M.R.; Karanasios, E.; Nikas, I.; Papadopoulos, G.; Kolovou, G.; Chrousos, G.P. Oedema-Fibrosis in Duchenne Muscular Dystrophy: Role of Cardiovascular Magnetic Resonance Imaging. Eur J Clin Invest 2017, 47, doi:10.1111 / eci.12843. 16. Li, B.; Yang, J.; Wang, R.; Li, J.; Li, X.; Zhou, X.; Qiu, S.; Weng, R.; Wu, Z.; Tang, C.; et al. Delivery of Vascular Endothelial Growth Factor (VEGFC) via Engineered Exosomes Improves Lymphedema. Ann Transl Med 2020, 8, 1498, doi: 10.21037 / atm-20-6605.
[0120] 17. International Application WO 2022 / 090414
[0121] 18. Montemagno et al. A group of novel VEGF splice variants as alternative therapeutic targets in renal carcinoma. Mol Oncol 2023, 17(7): 1379-1401, doi: 10.1002 / 1878-0261.13401.
[0122] 19. Gao et al. Clades of adeno-associated viruses are widely disseminated in human tissues. J Virol 2004, 78(12): 6381-6388, doi: 10.1128 / JVI.78.12.6381 -6388.2004. 20. Ji et al. Comparative in vivo characterization of newly discovered myotropic adeno-associated vectors. Skeletal Muscle 2024, 14: 9, doi: 10.1186 / s13395-024-00341 -7.21. Blankinship et al., Efficient transduction of skeletal muscle using vectors based on adeno-associated virus serotype 6. Mol Ther 2004, 4: 671-678, doi: 10.1016 / j.ymthe.2004.07.016.
[0123] 22. Nam et al. Structure of adeno-associated virus serotype 8, a gene therapy vector. J Virol 2007, 81(22): 12260-12271, doi: 10.1128 / JVI.01304-07.
[0124] 23. Goedeker et al.. Evaluation of rAAVrh74 gene therapy vector seroprevalence by measurement of total binding antibodies in patients with Duchenne muscular dystrophy. Therapeutic Advances in Neurological Disorders. 2023, doi: 10.1177 / 17562864221149781.
[0125] 24. Tulalamba et al. Distinct transduction of muscle tissue in mice after systemic delivery of AAVpol vectors. Gen Ther 2020, 27(3-4): 170-179, doi: 10.1038 / s41434-019-0106-3.
[0126] 25. Khvorova et Watts. The chemical evolution of oligonucleotide therapies of clinical utility. Nat Biotech nol 20 7, 35(3): 238-248, doi: 10.1038 / nbt.3765.
Claims
28CLAIMS1) Adeno-associated virus (AAV) vector comprising an isoform of VEGF having a NF domain at its C-terminal end (VEGFNF), wherein said NF domain comprises the sequence SEQ ID NO: 1 or 2, and having pro-vascular and pro-lymphangiogenic activities.2) AAV vector according to claim 1, wherein the isoform VEGFNF comprises a nucleotide sequence having at least 80% identity with the nucleotide sequence SEQ ID NO: 3 or SEQ ID NO: 4.3) AAV vector according to claim 2, wherein the isoform VEGFNF is the human VEGF222NF of sequence SEQ ID NO: 3 or the murine VEGF234NF of sequence SEQ ID NO: 4.4) AAV vector according to any of claims 1 to 3, wherein the AAV is an AAV9, AAVMYO, MyoAAV2A, MyoAAV4A, AAV6, AAV8, AAVrh74, or AAVpol vector.5) A nucleic acid encoding the AAV vector as defined in any of claims 1 to 4.6) AAV vector according to any of claims 1 to 4, for use as a drug.7) AAV vector according to any of claims 1 to 4, for use in the treatment of diseases associated with vascular and lymphatic disorders, wherein said diseases are selected from the group consisting of muscular dystrophy (MD), Peripheral Arterial Disease (PAD), Lymphedema, lymphedema associated with treatment of breast cancer, Chronic Venous Insufficiency (CVI), amyotrophic lateral sclerosis (ALS) and fibrotic disorders including pulmonary fibrosis, kidney fibrosis and liver fibrosis.8) AAV vector for use according to claim 7, wherein the muscular dystrophy (MD) is the Duchenne muscular dystrophy (DMD).9) AAV vector for use according to claim 7 or 8, wherein the treatment is combined with an ASO-based therapy.10) AAV vector for use according to claim 9, wherein the ASO-based therapy is an exon skipping therapy.11 ) AAV vector for use according to claim 9 or 10, wherein the ASO is chosen from the group consisting of tcDNA, 2’-modified-RNAs such as 2’OMe oligonucleotides, 2’Fluoro, 2’-deoxy-2’-fluoro-arabinonucleosides or 2’MOE oligonucleotides, LNAs, PNAs, HNAs, PMOs.12) AAV vector for use according to claim 11 , wherein the ASO is tcDNA.