Ssdna aptamers for malaria detection and their use in diagnostic compositions

Abstract

The present invention relates to ssDNA aptamers speciically binding to Plasmodium lactate dehydrogenase (LDH). The invention provides ssDNA aptamers having the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, which are capable of binding LDH from at least Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, and Plasmodium malariae. The aptamers enable in vitro detection of malaria independently of the infecting Plasmodium species and may be used in diagnostic compositions, kits, and biosensor-based detection systems.

Description

[0001] ssDNA Aptamers for Malaria Detection and Their Use in Diagnostic Compositions, Kits, and Biosensors

[0002] Technical field

[0003]

[0001] The present invention relates to nucleic acid-based diagnostics, specifically to ssDNA aptamers that bind to Plasmodium lactate dehydrogenase (LDH). The invention further concerns the use of these aptamers in diagnostic compositions, kits, biosensors, and in vitro malaria detection assays.

[0004] Background art

[0005]

[0002] Malaria is caused by the Plasmodium parasite, which has several species. Plasmodium falciparum is the most virulent and widespread species, responsible for the majority of malaria-related deaths. Plasmodium vivax and Plasmodium ovale cause a milder form of malaria, but these species are known for causing relapses due to their characteristic dormant stages in the liver. Plasmodium malariae causes a chronic infection associated with long-term complications.

[0006]

[0003] According to the World Health Organization (WHO), in 2022, there were an estimated 249 million malaria cases and 608,000 deaths across 85 countries worldwide. The WHO African Region bears an overwhelmingly large portion of the global malaria burden. Children under five years of age accounted for about 80% of all malaria deaths in the region. Malaria is primarily transmitted to humans through the bites of infected female Anopheles mosquitoes. However, blood transfusion and contaminated needles may also transmit malaria. The first symptoms may be mild, resembling many febrile illnesses, making malaria difficult to recognize. If left untreated, P. falciparum malaria can progress to severe illness and death within 24 hours. Thus, rapid diagnostic tests (RDTs) are of high importance for providing fast and accurate diagnosis, particularly in settings where microscopy is unavailable or unreliable. For effective diagnosis of all malaria cases, the chosen diagnostic method must be both sensitive and accessible at the point of care. Current RDTs rely on antibodies and enable qualitative detection of P. falciparum histidine-rich protein 2 (PfHRP2) and Plasmodium spp. lactate dehydrogenase (pLDH) [1],

[0004] It has been reported that false-negative HRP2-based rapid diagnostic test (HRP- RDT) results can arise due to HRP2 / 3 deletions, high parasitemia, or low parasite density. Thus, lactate dehydrogenase (LDH) is considered a more suitable antigen for RDTs. However, antibody-based RDTs are not ideal in cases of low parasitemia due to their limited sensitivity and specificity [2], [3], Aptamers are short, single-stranded DNA or RNA molecules that can selectively bind to specific targets. In comparison to antibodies, aptamers offer several advantages. Aptamers are synthetically produced, more cost- effective, and demonstrate lower batch-to-batch variability. Importantly, aptamers are highly stable even at elevated temperatures and have an extended shelflife. Moreover, they can be easily modified to meet specific application needs [4] .

[0007]

[0005] Few single -stranded DNA (ssDNA) aptamer candidates for Plasmodium spp. LDH have been reported in the literature. Reported aptamers generally exhibit limited species coverage and insufficient affinity, restricting their applicability in universal malaria diagnostics. Aptamer 2008 targets P. falciparum with a dissociation constant (Kd) of 42 nM, as determined by isothermal titration calorimetry (ITC). Aptamer pL-1 targets P. falciparum and P. vivax, with Kd values of 38.7 nM and 16.8 nM, respectively, as determined by a fluorescence-based method and Kd values of 6.2 n and KD 2.9 nM, as determined by enzyme-linked oligonucleotide assay ( ELONA) [5], Aptamer LDHpll recognizes P. falciparum and P. vivax, with Kd values of 321.2 nM and 41.4 nM, respectively, as determined by ELONA [6], [7], [8] . The reported aptamer candidates exhibit relatively low affinity for their targets, which may limit their application in aptamer-based sensors due to reduced sensitivity. Moreover, aptamers capable of recognizing P. ovale and P. malariae have not been reported in the literature to date. To address this, the inventors performed protein systematic evolution of ligands by exponential enrichment (protein SELEX) to identify pan-malaria aptamers capable of recognizing the three most common and infectious malaria-causing species: P. falciparum, P. vivax, and P. ovale. Since P. malariae infections often result in low parasitemia levels and frequently occur as mixed infections with P. falciparum or P. vivax, aptamer selection specifically targeting P. malariae LDH was not performed. However, the cross-reactivity of aptamers with P. malariae was evaluated [9].

[0006] In summary, despite the availability of some aptamer candidates in the literature, there remains a need for aptamers with higher affinity and broader species recognition across clinically relevant Plasmodium species, enabling universal malaria detection. The aptamers disclosed in this invention could provide enhanced sensitivity and wider detection coverage of Plasmodium species, enabling the development of an aptamer-based malaria biosensor or rapid diagnostic test (aptasensor) for use in endemic regions or as needed in non-endemic areas.

[0008] Summary of invention

[0009]

[0007] The present invention relates to ssDNA aptamers having the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2, which are capable of binding lactate dehydrogenase [LDH] from Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, and Plasmodium malariae. The aptamers enable in vitro detection of malaria independently of the infecting Plasmodium species and may be used in diagnostic compositions, kits, and biosensorbased detection systems.

[0010] Brief Description of Drawings

[0011]

[0008] Fig. 1 is a diagram depicting the relationship between the aptamer concentration and optical density measurement, representing the binding interaction of the disclosed aptamers with P. vivax LDH (Pv-LDH) by ELONA; greenBl aptamer specific to integrin- l included as a negative control

[0010] ;

[0012] Fig. 2 is a diagram depicting the relationship between the Pv-LDHl aptamer (Seq ID NO: 1) concentration and optical density measurement, representing the binding interaction of the disclosed aptamers with P. falciparum, P. vivax, P. ovale and P. malariae LDH by ELONA;

[0013] Fig. 3 is a diagram depicting the relationship between the Pv-LDH2 aptamer (Seq ID NO: 2) concentration and optical density measurement, representing the binding interaction of the disclosed aptamers with P. falciparum, P. vivax, P. ovale and P. malariae LDH by ELONA.Detailed Description of the Invention

[0014]

[0009] The aptamers are initially selected from a randomized single-stranded DNA (ssDNA) library (sequence = 5-FAM-ATCCAGAGTGACGCAGCA- NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN- TGGACACGGTGGCTTAGT) with a molecular weight [MW] of 23.5 kDa. His-tagged magnetic beads are used to capture His-tagged Pv-LDH.

[0015]

[0010] The randomized aptamer library is folded by heating and cooling at room temperature. The folded aptamers are added to the His-tagged bead-protein complex and incubated to allow aptamers to bind to the LDH protein. After incubation, the solution containing bead-protein-aptamer complexes is split into three tubes to perform a variable number of washing steps, initially 1-3 washes. The number of washing steps is adjusted in each selection cycle. Washing is performed using magnetic separation. Bound aptamers are eluted from the bead-protein complex.

[0016] [Oil] Preparative PCR is performed using the eluate and the number of cycles identified as optimal during PCR optimization. Eluates from each washing step are amplified by PCR to determine the optimal number of washing steps per cycle and to optimize the number of PCR amplification cycles. For PCR optimization in each SELEX cycle, 6, 8, 10, 12, and 14 cycles are tested. A 3% agarose gel electrophoresis is used to evaluate the integrity of aptamer bands and to select the optimal number of washing steps and PCR cycles for preparative PCR.

[0017]

[0012] After preparative PCR, DNA is purified using DNA clean-and-concentrate columns. Double-stranded DNA (dsDNA) is obtained, and its concentration is measured. Streptavidin-coated magnetic beads are then used to capture dsDNA. Single-stranded DNA (ssDNA) is eluted using NaOH, and the pH is neutralized with an equivalent amount of HC1. The ssDNA is purified using an oligo purification kit, and its concentration is measured. A final concentration of 100 nM ssDNA is used for the next SELEX cycle. In total, eight SELEX cycles are performed.

[0018]

[0013] To determine the sequences of the selected aptamers, next-generation sequencing (NGS) is performed using Illumina MiSeq. Sample preparation is carried out according to Illumina’s recommendations. After sequencing, the data are processed using Cutadapt toremove constant primer binding sites originating from the initial library. Fastaptamer software is then used to evaluate sequence enrichment over eight selection cycles. The most enriched aptamers are selected for in vitro validation.

[0019]

[0014] Two sequences were identified as a result of SELEX selection against P. vivax LDH (Pv-LDH), designated as Pv-LDHl (SEQ ID NO: 1) and Pv-LDH2 (SEQ ID NO: 2). These sequences are 76 nucleotides long:

[0020] SEQ ID NO: 1

[0021] 5’ - ATCCAGAGTGACGCAGCAACTAGCGGCGGTGGTGTGAAGCGGTTATAGCGGAGAGCTGTGGACA CGGTGGCTTAGT -3’

[0022] SEQ ID NO: 2

[0023] 5’ - ATCCAGAGTGACGCAGCAACTCACGTCGGTAGTGTGAACTGGTTATAGTAGGTGCGACTGGACA CGGTGGCTTAGT - 3’

[0024]

[0015] Binding affinity data demonstrate that aptamers according to SEQ ID NO: 1 and SEQ ID NO: 2 bind LDH from P. falciparum, P. vivax, P. ovale, and P. malariae, while showing no binding to human LDH isoforms. An enzyme-linked oligonucleotide assay (ELONA) was used to determine the sequence specificity and affinity of the aptamers for P. falciparum, P. vivax, P. ovale, and P. malariae LDH. Cross-reactivity with human LDH isoforms A and B was also assessed. The respective His-tagged Plasmodium spp. LDH proteins were immobilized on Ni-NTA HisSorb plates, which were then washed to remove unbound protein. Each selected aptamer stock was folded by heating and subsequently cooled for 5 minutes. The folded aptamers were added to the plates in serial dilutions (1 pM - 0.064 nM), incubated, and washed to remove unbound aptamers. Each well was then incubated with poly-HRP-Streptavidin reagent, followed by washing. Tetramethylbenzidine (TMB) substrate was added and incubated. The reaction was stopped using sulfuric acid, and optical density (OD) was measured at 450 nm. The dissociation constant (Kd) was determined using GraphPad Prism software.

[0025]

[0016] Kd values towards P. falciparum, P. ovale, P. vivax and P. malariae are shown in in Table 1.Table 1

[0026] Dissociation Constants (Kd) of Aptamers for Plasmodium spp. and Human LDH Isoforms

[0027]

[0028]

[0017] Binding affinity data demonstrate that aptamers according to SEQ ID NO: 1 and SEQ ID NO: 2 bind LDH from P. falciparum, P. vivax, P. ovale, and P. malariae, while showing no binding to human LDH isoforms. Sequences Pv-LDH2 (SEQ ID NO: 2) exhibit 1.66-fold higher affinity for Pv-LDH compared to the published aptamer pLl (Kd = 2.9 nM, as determined by ELONA according to published data [5]). Binding assays were performed under standard conditions suitable for assessing aptamer-LDH interactions.

[0029]

[0018] Considering the different Plasmodium spp. LDH recognition capability of the disclosed aptamers, they could be combined in the biosensor to ensure Plasmodium species recognition. Aptamers according to SEQ ID NO: 1 and SEQ ID NO: 2 are suitable for use as capture aptamers and / or detection aptamers in diagnostic systems for detecting Plasmodium infection.

[0030]

[0019] Therefore, disclosed aptamers are useful for detecting Plasmodium spp. LDH in biological samples, enabling the identification of Plasmodium infections. The aptamers may be employed in various diagnostic formats, including but not limited to: ELONA assays, where aptamers are coated onto plates for enzyme-linked detection; lateral flow assays, in which aptamers are immobilized on test strips for rapid malaria testing; biosensors, integrating aptamers with electrochemical or optical readout systems for realtime malaria diagnosis. The use of aptamers in malaria diagnostics offers advantages over antibody-based methods, including higher stability, reduced batch-to-batch variability, and enhanced specificity. These aptamers can be applied to point-of-care testing, laboratory diagnostics, and field-based surveillance of malaria infections.

[0020] The aptamers (SEQ ID NOs: 1-2), which specifically bind to Plasmodium lactate dehydrogenase (LDH), can be incorporated into diagnostic compositions for detecting malaria in biological samples. These compositions may include a single aptamer or a combination of aptamers, depending on the target pathogen. For Plasmodium lactate dehydrogenase (LDH) detection, aptamers (SEQ ID NOs: 1-2) may be included. The diagnostic composition may be formulated as a liquid solution, lyophilized powder, or immobilized on a solid-phase support, depending on the intended assay format. The aptamers may be used individually or as part of a multiplex detection system, optionally in combination with other malaria biomarkers. The composition may further comprise stabilizing agents, buffers, and auxiliary reagents to maintain aptamer functionality.

[0031]

[0021] The invention further provides a diagnostic kit for malaria detection, comprising at least one aptamer capable of binding Plasmodium lactate dehydrogenase (LDH), facilitating the identification of Plasmodium spp. in a biological sample. The kit may include: aptamers in solution or immobilized on a solid support (e.g., microtiter plates, biosensor surfaces, lateral flow membranes); binding and washing buffers to optimize aptamer -target interactions; detection reagents, including enzyme-linked, fluorescent, or electrochemical labels for readout; positive and negative control samples for assay validation. The kit may be configured for enzyme-linked oligonucleotide assays (ELONA), lateral flow tests, biosensors, or other malaria diagnostic platforms. Additionally, in some embodiments, the kit contains Plasmodium lactate dehydrogenase (LDH)-specific aptamers (SEQ ID NOs: 1-2) to enable the detection of multiple malaria species, enhancing diagnostic accuracy.

[0032]

[0022] In another embodiment, the aptamers are integrated into a biosensor for detecting Plasmodium spp. LDH in a biological sample. The biosensor comprises: an immobilized DNA aptamer functionalized on a transducer surface, such as a gold electrode, silicon chip, or optical sensor; a transduction mechanism that generates a measurable signal upon aptamer -target binding, including electrochemical, optical, or piezoelectric detection; a signal processing unit to analyze the response and determine the presence or absence of Plasmodium lactate dehydrogenase (LDH). The biosensor may be implemented in portable malaria diagnostic devices or laboratory-based detection systems. It provides rapid, label-free detection with high specificity, making it suitable for point-of-care applications in endemic regions (Table 2).

[0033]

[0023] Table 2. The characterization of aptamer species recognition and their potential role in a malaria detection biosensor

[0034]

[0035] References

[0036] [1] X. Martianez-Vendrell etal., "Quantification of malaria antigens PfHRP2 and pLDH by quantitative suspension array technology in whole blood, dried blood spot and plasma,” Malar J, vol. 19, no. 1, p. 12, Dec. 2020, doi: 10.1186 / sl2936-019-3083-5.

[0037] [2] D. Nolder etal., "Failure of rapid diagnostic tests in Plasmodium falciparum malaria cases among travelers to the UK and Ireland: Identification and characterisation of the parasites,” International Journal of Infectious Diseases, vol. 108, pp. 137-144, Jul.

[0038] 2021, doi: 10.1016 / j.ijid.2021.05.008.

[0039] [3] S. M. Feleke etal., "Field performance of Plasmodium falciparum lactate dehydrogenase rapid diagnostic tests during a large histidine-rich protein 2 deletion survey in Ethiopia,” Malar J, vol. 21, no. 1, p. 236, Aug. 2022, doi: 10.1186 / sl2936- 022-04257-9.

[0040] [4] J. Zhou and J. Rossi, "Aptamers as targeted therapeutics: current potential and challenges,” Nat Rev Drug Discov, vol. 16, no. 3, pp. 181-202, Mar. 2017, doi:

[0041] 10.1038 / nrd.2016.199.

[0042] [5] Y.-W. Cheung, R. M. Dirkzwager, W.-C. Wong, J. Cardoso, J. D rc Neves Costa, and J. A.

[0043] Tanner, "Aptamer-mediated Plasmodium-specific diagnosis of malaria,” Biochimie, vol.

[0044] 145, pp. 131-136, Feb. 2018, doi: 10.1016 / j.biochi.2017.10.017.

[0045] [6] Y.-W. Cheung, J. Kwok, A. W. L. Law, R. M. Watt, M. Kotaka, and J. A. Tanner, "Structural basis for discriminatory recognition of Plasmodium lactate dehydrogenase by a DNAaptamer,” Proc. Natl. Acad. Sci. U.S.A., vol. 110, no. 40, pp. 15967-15972, Oct. 2013, doi: 10.1073 / pnas.1309538110.

[0046] [7] S. Lee, K.-M. Song, W. Jeon, H. Jo, Y.-B. Shim, and C. Ban, "A highly sensitive aptasensor towards Plasmodium lactate dehydrogenase for the diagnosis of malaria,” Biosensors and Bioelectronics, vol. 35, no. 1, pp. 291-296, May 2012, doi:

[0047] 10.1016 / j.bios.2012.03.003.

[0048] [8] K.-A. Frith et al., "Towards development of aptamers that specifically bind to lactate dehydrogenase of Plasmodium falciparum through epitopic targeting,” Malar J, vol.

[0049] 17, no. 1, p. 191, Dec. 2018, doi: 10.1186 / sl2936-018-2336-z.

[0050] [9] S. S. Nundu etal., "Malaria parasite species composition of Plasmodium infections among asymptomatic and symptomatic school-age children in rural and urban areas of Kinshasa, Democratic Republic of Congo,” Malar J, vol. 20, no. 1, p. 389, Dec. 2021, doi: 10.1186 / S12936-021-03919-4.

[0051]

[0010] K. Pleiko et al., "Targeting triple-negative breast cancer cells with a pi-integrin binding aptamer,” Molecular Therapy - Nucleic Acids, vol. 33, pp. 871-884, Sep. 2023, doi: 10.1016 / j.omtn.2023.08.015.

Claims

Claims1. A ssDNA aptamer specifically binding to Plasmodium lactate dehydrogenase (P-LDH), wherein the ssDNA aptamer has a base sequence of SEQ ID NO: 1, or SEQ ID NO: 2 and wherein the ssDNA aptamer is capable of binding LDH from at least the following Plasmodium species: Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, and Plasmodium malariae.

2. A composition for diagnosis of malaria, comprising the ssDNA aptamer of claim 1.

3. A kit for in vitro detecting malaria in a biological sample, the kit comprising at least one ssDNA aptamer according to claim 1.

4. A biosensor for in vitro detecting malaria in a biological sample, the biosensor comprising: (i) at least one immobilized ssDNA aptamer according to claim 1;(ii) a transducer element configured to generate a detectable signal upon aptamer-LDH binding; and (in) a signal processing unit configured to determine the presence or absence of Plasmodium LDH in the biological sample.

5. Use of a ssDNA aptamer according to claim 1 for detecting Plasmodium LDH in a biological sample.

Images