Crispr / CAS9 variants
Patent Information
- Application Number
- PCT/SG2026/050096
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-02-20
- Filing Date
- 2026-02-20
- Publication Date
- 2026-08-27
Smart Images

Figure SG2026050096_27082026_PF_FP_ABST
Abstract
Description
DESCRIPTIONTITLE OF THE INVENTION: CRISPR / CAS9 VARIANTSFIELD OF THE INVENTION
[0001] The invention generally relates to the field of molecular biology and genetic engineering. In particular, the invention relates to methods of reducing the immunogenicity of a CRISPR-associated protein 9 (Cas9) and the Cas9 variants produced therefrom.BACKGROUND OF THE INVENTION
[0002] The field of therapeutic genome editing has been revolutionized by the recent progresses in CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats-associated protein 9). This technology has shown great promises in the treatment of wide range of human monogenetic diseases. Additionally, significant progress has been achieved in enhancing the CRISPR / Cas9 system as a viable treatment option for infectious diseases, autoimmune disorders, and cancers. However, the clinical translation of this technology suffers important hurdles. One of the key challenges is the induction of the immune system in response to CRISPR / Cas9, which is recognized as a foreign protein. The introduction of CRISPR / Cas9 carries the risk of potentially triggering cellular immunity through cytotoxic T-cells, resulting in severe adverse reactions and the destruction of therapeutically corrected cells, thereby undermining the effectiveness of the treatment and the safety of the patient.
[0003] There is thus a need for a CRISPR / Cas9 with reduced immunogenicity that overcomes the drawbacks of the prior art. Furthermore, other desirable features and characteristics will become apparent from the subsequent detailed description and the appended claims, taken in conjunction with the accompanying drawings and this background of the disclosure.SUMMARY OF THE INVENTION
[0004] In one aspect, the present invention provides a Cas9 variant comprising an amino acid sequence having at least 95% sequence identity to a wild-type Cas9 sequence set forth in SEQ ID NO: 1, wherein the Cas9 variant has a reduced immunogenicity compared to the wild-type Cas9, wherein the Cas9 variant comprises at least one immunoreceptor tyrosinebased inhibitory motif (ITIM) located between position 971 and position 1019 of SEQ ID NO:1, the ITIM having an amino acid sequence of X1X2YX3X4X5, wherein X₁ is selected from the group consisting of V, L, I and S, wherein each of X₂, X₃ and X₄ are independently selected from any amino acid, and wherein X₅ is selected from the group consisting of L, V and I.
[0005] In one embodiment, the Cas9 variant as described herein comprises one or more amino acid substitutions at one or more positions of SEQ ID NO: 1 selected from the group consisting of K999, K1014, R1019, Q971 and R976, wherein the amino acid substitution at position K999 is selected from the group consisting of K999S, K999I, K999L and K999V, wherein the amino acid substitution at position K1014 is selected from the group consisting of K1014T, K1014S, K1014L, K1014I and K1014V, wherein the amino acid substitution at position R1019 is selected from the group consisting of R1019I, R1019L and R1019V, wherein the amino acid substitution at position Q971 is selected from the group consisting of Q971 V, Q971S, Q971L and Q971I, and wherein the amino acid substitution at position R976 is selected from the group consisting of R976V, R976S, R976L and R976I.
[0006] In one embodiment, the amino acid substitution is K999S.
[0007] In one embodiment, the amino acid substitutions are K999S, K1014T and R1019I.
[0008] In one embodiment, the amino acid substitutions are K999S, K1014L and R1019V.
[0009] In one embodiment, the amino acid substitutions are K999S, K1014I and R1019V.
[0010] In one embodiment, the Cas9 variant as described herein further comprises an immunoreceptor tyrosine-based switch motif (ITSM) located between position 999 and position 1019 of SEQ ID NO: 1, the ITSM having the sequence of TX₁YX₂X₃X₄, wherein each of X₁, X₂ and X₃ are independently selected from any amino acid, and wherein X₄ is selected from the group consisting of V and I.
[0011] For example, Cas9 variants #2, 5, 7 and 11-21 comprise an ITSM motif in addition to the ITIM motif by virtue of the K1014T substitution. In these variants, the ITSM motifs are located between positions 999-1019 of SEQ ID NO: 1.
[0012] In one embodiment, the Cas9 variant as described herein comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 2 to 80.
[0013] In another aspect, the present invention provides a nucleic acid construct comprising a polynucleotide sequence encoding the Cas9 variant as described herein.
[0014] In one embodiment, the polynucleotide sequence comprises a sequence selected from the group consisting of SEQ ID NOs 82 to 160.
[0015] In another aspect, the present invention provides the Cas9 variant as described herein or the nucleic acid construct as described herein for use in treating a genetic disorder.
[0016] In another aspect, the present invention provides a use of the Cas9 variant as described herein or the nucleic acid construct as described herein in the manufacture of a medicament for treating a genetic disorder.
[0017] In another aspect, the present invention provides a method of treating a genetic disorder comprising administering to a subject a composition comprising the Cas9 variant as described herein or the nucleic acid construct as described herein.
[0018] In another aspect, the present invention provides a pharmaceutical composition comprising (a) a therapeutically effective amount of the Cas9 as described herein or the nucleic acid construct as described herein and (b) one or more pharmaceutically acceptable carriers and / or diluents.
[0019] In another aspect, the present invention provides a method for reducing the immunogenicity of a Cas9 protein, the method comprising introducing one or more amino acid substitutions with reference to a wild-type Cas9 sequence set forth in SEQ ID NO: 1 to form a Cas9 variant, wherein the Cas9 variant comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 1, wherein the introduction of the one or more amino acid substitutions results in the Cas9 variant comprising at least one immunoreceptor tyrosinebased inhibitory motif (ITIM) located between position 971 and position 1019 of SEQ ID NO: 1, the ITIM having an amino acid sequence of X1X2YX3X4X5, wherein Xi is selected from the group consisting of V, L, I and S, wherein each of X2, X3 and X4 are independently selected from any amino acid, and wherein X₅ is selected from the group consisting of L, V and I.
[0020] In one embodiment, the one or more amino acid substitutions are introduced at one or more positions of SEQ ID NO: 1 selected from the group consisting of K999, K1014, R1019, Q971 and R976, wherein the amino acid substitution at position K999 is selected from the group consisting of K999S, K999I, K999L and K999V, wherein the amino acid substitution at position K1014 is selected from the group consisting of K1014T, K1014S, K1014L, K1014I and K1014V, wherein the amino acid substitution at position R1019 is selected from the group consisting of R1019I, R1019L and R1019V, wherein the amino acid substitution at position Q971 is selected from the group consisting of Q971V, Q971S, Q971L and Q971I, wherein the amino acid substitution at position R976 is selected from the group consisting of R976V, R976S, R976L and R976I.
[0021] In one embodiment, the amino acid substitution is K999S.
[0022] In one embodiment, the amino acid substitutions are K999S, K1014T and R1019I.
[0023] In one embodiment, the amino acid substitutions are K999S, K1014L and R1019V.
[0024] In one embodiment, the amino acid substitutions are K999S, K1014I and R1019L.
[0025] In one embodiment, the introduction of the one or more amino acid substitutions results in the Cas9 variant further comprising an immunoreceptor tyrosine-based switch motif (ITSM) located between position 999 and position 1019 of SEQ ID NO: 1, the ITSM having the sequence of TX₁YX₂X₃X₄, wherein each of X₁, X₂ and X₃ are independently selected from any amino acid, and wherein X₄ is selected from the group consisting of V and I.
[0026] In one embodiment, the Cas9 variant comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 2 to 80.BRIEF DESCRIPTION OF THE DRAWINGS
[0027] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:
[0028] Fig. 1 shows the functional evaluation of CRISPR / Cas9 variants. Plasmids encoding CRISPR / Cas9 variants and gRNA were transfected into HEK293AAV cells. Genomic DNA was isolated 72 h after transfection. Indel frequencies were analysed by targeted deep sequencing. Cas9_variant#1, Cas9_variant#2 and Cas9_variant#3 have similar on-target activity. For Cas9_variant#4, Cas9_variant#5, Cas9_variant#6 and Cas9_variant#7, their endonucleolytic activity is modestly reduced, but can potentially retain target binding function useful for Cas9-fusions that depend on the nucleic acid-binding function of Cas9 instead of its endonucleolytic activity, such as base editors, prime editors, or other Cas9-based epigenetic modifiers. Indel formation frequencies are shown as mean ± SD (triplicates, n=1 ), statistical tests are one-way ANOVA: ns: not significant, ****p < 0.0001.
[0029] Fig. 2 shows the modulation of the immune response by CRISPR / Cas9 variants. Adult male C57BL / 6 mice were treated intravenously with 1 x 1010GCs with dual AAV-DJ vectors encoding WT CRISPR / Cas9 (n=3) or CRISPR / Cas9_variant#1 (n=5) or CRISPR / Cas9_variant#2 (n=5). 3 months later, animals were euthanized, and spleens were collected and stimulated 48 hours with WT CRISPR / Cas9. (A) experimental procedure, (B) Analysis of T cell responses in splenocytes measured by IFN-y ELISpot, (C) Frequency of CD4+ CD25+ FoxP3+ Tregs. Data are shown as mean ± SEM, statistical tests are one-way ANOVA: ns: not significant, *p < 0.05, **p < 0.01.
[0030] Fig. 3 shows the evaluation of Cas9 variant editing efficiency at the EMX1 locus. HEK293T cells were co-transfected with Cas9 variant (350 ng) and E / WX1-targeting gRNA (125 ng, gagtccgagcagaagaagaa) (SEQ ID NO: 162) plasmids via Lipofectamine 3000. Genomic DNA was harvested 72h post-transfection for targeted deep sequencing. Librarieswere prepared via nested PCR to incorporate Illumina adapters and sequenced on an iSeq 100. Data were analyzed using CRISPResso. Data are presented as mean ± SD. Statistical significance was determined by one-way ANOVA followed by Dunnett’s multiple comparisons test against the WT control (* p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).DETAILED DESCRIPTION OF THE INVENTION
[0031] The recent advancement in CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats-associated protein 9) have revolutionized the field of therapeutic genome editing. This technology holds immense potential for addressing a wide range of untreated genetic diseases and complex disorders.
[0032] One of the undesirable consequences of delivering CRISPR / Cas9 is the inadvertent, but unavoidable, transduction of antigen-presenting cells (APCs), leading to the presentation of expressed CRISPR / Cas9 and the activation of cellular immunity. Almost all cells of the body, including treated cells, can present antigens to the immune system. We disrupted the antigen-presentation of CRISPR / Cas9 by engineering an inhibitory motif within the Cas9 protein (mimicking the intracellular tail of immune inhibitory receptors).
[0033] The immune system incorporates inhibitory immune receptors as a mechanism to prevent excessive stimulation. Most of these inhibitory receptors contain intracellular inhibitory motifs, typically based on the immunoreceptor tyrosine-based inhibitory motif (ITIM -V / L / I / S / XYXX / LA / / I, X for any amino acid). Additionally, a subset of receptors, such as PD-1, possess an additional tyrosine-based structural motif called the immunoreceptor tyrosinebased switch motif (ITSM - TXYXXV / I). The combination of ITIM and ITSM motifs in these receptors synergistically induces the immune inhibitory effect. Some pathogens take advantage of these immune inhibitory receptors by binding to these ITIM-bearing receptors.
[0034] The present inventors screened CRISPR / Cas9 from Streptococcus pyogenes (SpCas9) and identified specific residues that could potentially be engineered towards immune inhibitory motifs. These variations are within the Cas9 protein itself, not a separate domain fusion that would increase the size of the protein. In addition, it is not obvious a priori that such mutations to the wild type Cas9 would exhibit any change in immunogenic properties, nor is it obvious that these mutations within the protein would retain the function of Cas9 enzyme.
[0035] In various embodiments of the present invention, there is provided the development of novel CRISPR / Cas9 variants that specifically reduce human immune responses against CRISPR / Cas9 protein. The inventors further evaluated the efficacy of engineeredCRISPR / Cas9 variants in mice in vivo. The present study demonstrates that these new compositions of matter reduce cytotoxic T-cell activation and increase generation of immune-tolerance regulatory T-cell (Treg), compared with the wild-type CRISPR / Cas9. The CRISPR / Cas9 of the present embodiments represent deimmunised (immune evasive) CRISPR / Cas9 compositions that reduce the risks of adverse immune reactions and increases treatment efficacy.
[0036] In various embodiments, there are provided methods for engineering an immune evasive CRISPR / Cas9, reducing the immune responses to CRISPR / Cas9 and increasing the frequency of regulatory T-cells following injection with the engineered CRISPR / Cas9 variants. This approach could potentially be applied to other therapeutic proteins, including other CRISPR-Cas9, Cas12, and Cas13 orthologs, and non-CRISPR proteins.
[0037] As used herein, the term “CRISPR / Cas9 system,” “CRISPR / Cas9 system,” or “Cas9 system,” refers to a system capable of altering a target nucleic acid by one of many DNA repair pathways. The CRISPR system may be employed for a variety of genome editing methods including knocking out target genes, activating or repressing target genes, purifying specific regions of DNA and precisely editing DNA and RNA.
[0038] Cas9 (CRISPR associated protein 9) is an RNA-guided DNA nuclease enzyme associated with Streptococcus pyogenes CRISPR immunity system. Cas9 can be used to induce site-directed double strand breaks in DNA, which can lead to gene inactivation or the introduction of heterologous genes through non-homologous end joining and homologous recombination respectively. mRNA systems for expressing Cas9 are commercially available from TriLink Biotechnologies (San Diego, Calif.). The mRNA may be codon optimized for human or other mammalian system. The expressed Cas9 protein may contain a nuclear localization signal at the C-terminus. The RNA encoding Cas9 may be capped and polyadenylated to support expression in mammalian cells, and may contain modifications to reduce immune stimulation. The amino acid sequence and encoding nucleic acid sequence for Cas9 and functional derivatives and homologs (which can be used in accordance with the disclosure) include those described in U. S. Pat. No. 8,697,359, which is hereby incorporated by reference in its entirety.
[0039] The Cas9 may be delivered in conjunction with a gRNA, which directs the Cas9 editing system to the nucleotide sequence recognized by the gRNA. The term “gRNA” is used interchangeably herein with “gRNA” “single gRNA,” and “sgRNA.” In general, a gRNA can be designed to target any nucleotide sequence. The gRNA structure is disclosed in, for example, Ran F A, Genome editing using the CRISPR-Cas9 System, PNAS 8(11):2281-308 (2013); and Pyzocha et al., RNA-guided genome editing of mammalian cells, Methods Mol. Biol.1114:269-77 (2014), which are hereby incorporated by reference in their entirety. Generally for Cas9, gRNAs guide the Cas9 endonuclease to the complementary 20 nucleotide (nt) genomic sequences with a downstream NGG protospacer-adjacent motif (PAM). Cas9 generates double-stranded breaks, which can be repaired by non-homologous end-joining (NHEJ) or homologous recombination (HR). See, for example, US 2014 / 0017212, which is hereby incorporated by reference in its entirety.
[0040] The CRISPR-Cas9 system is further disclosed in U. S. Pat. No. 8,697,359, which is hereby incorporated by reference in its entirety. All downstream applications will apply accordingly.
[0041] In one aspect, the present invention provides a Cas9 variant comprising an amino acid sequence having at least 95% sequence identity to a wild-type Cas9 sequence set forth in SEQ ID NO: 1, wherein the Cas9 variant has a reduced immunogenicity compared to the wild-type Cas9, wherein the Cas9 variant comprises at least one immunoreceptor tyrosinebased inhibitory motif (ITIM) located between position 971 and position 1019 of SEQ ID NO: 1, the ITIM having an amino acid sequence of X1X2YX3X4X5, wherein X₁ is selected from the group consisting of V, L, I and S, wherein each of X₂, X₃ and X₄ are independently selected from any amino acid, and wherein X₅ is selected from the group consisting of L, V and I.
[0042] In one embodiment, the Cas9 variant as described herein comprises one or more amino acid substitutions at one or more positions of SEQ ID NO: 1 selected from the group consisting of K999, K1014, R1019, Q971 and R976, wherein the amino acid substitution at position K999 is selected from the group consisting of K999S, K999I, K999L and K999V, wherein the amino acid substitution at position K1014 is selected from the group consisting of K1014T, K1014S, K1014L, K1014I and K1014V, wherein the amino acid substitution at position R1019 is selected from the group consisting of R1019I, R1019L and R1019V, wherein the amino acid substitution at position Q971 is selected from the group consisting of Q971 V, Q971S, Q971L and Q971I, and wherein the amino acid substitution at position R976 is selected from the group consisting of R976V, R976S, R976L and R976I.
[0043] In one embodiment, the amino acid substitution is K999S. Such a Cas9 variant may include at least one ITIM motif.
[0044] K999 has not previously been implicated in the art as a functionally important residue. The implication of this residue and the specific mutation K999S has not previously been associated with an impact on immunogenicity.
[0045] In various embodiments, “at least 95% sequence identity” includes at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the wildtype Cas9 sequence set forth in SEQ ID NO: 1.
[0046] As used herein, the term “Cas9” (also called “Cas9 nuclease” or “Cas9 endonuclease”) refers to the “clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9”. The terms “Cas9”, “CRISPR-Cas9” and “CRISPR / Cas9” are used interchangeably. The wild-type Cas9 protein is the Streptococcus pyogenes Cas9 and has the sequence shown in SEQ ID NO: 1.
[0047] As used herein, the terms “Cas9 variant”, “CRISPR / Cas9 variant” and “engineered Cas9” are used interchangeably. The term “Cas9 variant” may refer to a Streptococcus pyogenes Cas9 variant.
[0048] As used herein, the term “variant” in the context of a protein refers to a protein comprising a mutation of one or more amino acids as compared to a reference protein. An example of a reference protein is the wild type (WT) protein, i.e. a protein that is found in nature and deemed normal for said protein. In the context of a protein, the term “mutation” refers to a modification to the amino acid sequence resulting in a change in the amino acid sequence of the protein compared to a reference amino acid sequence. The mutation may involve one or more amino acid residues and may be selected from the group consisting of substitution, insertion, deletion, truncation and combinations thereof. Preferably, the mutation is an amino acid substitution.
[0049] As used herein, the term “reduced immunogenicity” is meant to include a decreased undesired immune response provoked by the Cas9 variant. In particular, it may refer to a decrease in undesired adaptive immune responses that inhibit the therapeutic function or safety profile of the Cas9 variant. Examples of these undesired adaptive immune responses include antibody binding to Cas9 and the T-cell / NK-cell response towards Cas9. The present disclosure includes data on reduction of IFN-y-secreting immune cells (Fig. 2B), which include antigen-activated CD4+ helper T cells, CD8+ cytotoxic T-cells, and NK cells. These are all expected to diminish the safety and efficacy profile of Cas9. In contrast, the T-reg cells (Fig2C) are immune-inhibitory, i.e. they reduce the activation of the above IFN-y-secreting cells. Therefore, increase of T-reg cells acts to increase the safety and efficacy profile of engineered Cas9. The term “reduced immunogenicity” may refer to a decrease in cytotoxic T cell response and / or an increase in the frequency of T-reg cells. In this study, the inventors quantitatively assessed the cytotoxic T-cell activity by measuring the production of interferon-gamma through an ELISpot assay. The results showed a decrease in interferon-gamma secretion by 36% in the CRISPR / Cas9_variant#1 group and by 40% in the CRISPR / Cas9_variant#2 group, when compared to the wild-type (WT) CRISPR / Cas9 group. Additionally, quantitative analysis of T-reg cell frequency using flow cytometry demonstrated a 2.5-fold increase in theCRISPR / Cas9_variant#1 group and a 1.95-fold increase in the CRISPR / Cas9_variant#2 group, in comparison to the WT CRISPR / Cas9 group.
[0050] In one embodiment, the amino acid substitution are K999S, K1014T and R1019I. Such a Cas9 variant may include an ITIM motif and a ITSM motif.
[0051] In one embodiment, the amino acid substitutions are K999S, K1014L and R1019V. Such a Cas9 variant may include two ITIM motifs.
[0052] In one embodiment, the amino acid substitutions are K999S, K1014I and R1019L. Such a Cas9 variant may include two ITIM motifs.
[0053] In one embodiment, the Cas9 variant as described herein further comprises an immunoreceptor tyrosine-based switch motif (ITSM) located between position 999 and position 1019 of SEQ ID NO: 1, the ITSM having the sequence of TX₁YX₂X₃X₄, wherein each of X₁, X₂ and X₃ are independently selected from any amino acid, and wherein X₄ is selected from the group consisting of V and I.
[0054] In one embodiment, the Cas9 variant as described herein comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 2 to 80.
[0055] In one aspect, there is provided a nucleic acid construct comprising a polynucleotide sequence encoding the Cas9 variant as described herein.
[0056] In one embodiment, the polynucleotide sequence comprises a sequence selected from the group consisting of SEQ ID NOs 82 to 160.
[0057] In one aspect, there is provided a Cas9 variant as described herein or a nucleic acid construct as described herein for use in treating a genetic disorder. It will be generally understood by the skilled person that the Cas9 variant or nucleic acid construct as described herein can be used to treat a broad range of genetic disorders, which may include but is not limited to cancers, blood disorders, cystic fibrosis, muscular dystrophy, Huntington’s disease, cardiovascular diseases, neurodegenerative diseases, infectious diseases and anything with DNA as the underpinning reason for the disease such as inherited genetic diseases, somatic genetic diseases and DNA viral infections.
[0058] In another aspect, there is provided a use of a Cas9 variant as described herein or a nucleic acid construct as described herein in the manufacture of a medicament for treating a genetic disorder.
[0059] In another aspect, there is provided a method of treating a genetic disorder comprising administering to a subject a composition comprising a Cas9 variant as described herein or a nucleic acid construct as described herein. In various embodiments, the Cas9 variant can be administered as DNA encoding the Cas9 variant, mRNA encoding the Cas9variant or a ribonucleoprotein (RNP) comprising Cas9 variant protein and the necessary gRNA. The vectors used may include viruses or non-viral delivery vectors.
[0060] In one aspect, there is provided a pharmaceutical composition comprising (a) a therapeutically effective amount of a Cas9 variant as described herein or a nucleic acid construct as described herein and (b) one or more pharmaceutically acceptable carriers and / or diluents.
[0061] The term “therapeutically effective amount” refers to the amount of the Cas9 variant or nucleic acid construct as described herein that is required to confer the intended therapeutic effect in the subject, which amount will vary depending on the route of administration, status of disease, and possible inclusion of other therapeutics or excipients. A “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired therapeutic result. A therapeutically effective amount may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the therapeutic agent to elicit a desired response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects of the protein or protein portion are outweighed by the therapeutically beneficial effects.
[0062] A “therapeutically effective amount” for therapy may also be measured by its ability to stabilize the progression of disease. A therapeutically effective amount of a therapeutic agent may reduce or ameliorate symptoms in a subject. One of ordinary skill in the art would be able to determine such amounts based on such factors as the subject’s size, the severity of the subject’s symptoms, and the particular composition or route of administration selected.
[0063] In the methods of the invention, therapy is used to provide a positive therapeutic response with respect to a disease or condition. By “positive therapeutic response” is intended an improvement in the disease or condition, and / or an improvement in the symptoms associated with the disease or condition, and / or prevent the worsening of symptoms associated with the disease or condition. An example of a positive therapeutic response in the context of retinal degenerative diseases is the halting or delaying of progression to blindness. Positive therapeutic responses in any given disease or condition can be determined by standardized response criteria specific to that disease or condition. In addition to these positive therapeutic responses, the subject undergoing therapy may experience the beneficial effect of an improvement in the symptoms associated with the disease.
[0064] As used herein, the term “pharmaceutical composition” is meant to include any pharmaceutical preparation or formulation which is suitable for administration to a subject in need thereof. The pharmaceutical composition comprising the Cas9 variant or the nucleic acid construct as described herein may be delivered via viral vectors, non-viral vectors or RNAconjugates. In some embodiments, the gRNA and the Cas9 variant are provided in the same type of delivery vehicle, wherein the delivery vehicle is a viral vector or a non-viral vector. In other embodiments, the gRNA is provided in a viral vector, and the Cas9 variant is provided in a non-viral vector. In still other embodiments, the gRNA is provided in a non-viral vector and the Cas9 variant is provided in a viral vector. In some embodiments, the gRNA is provided in an RNA conjugate.
[0065] In some embodiments, the viral vector is selected from an adeno-associated virus (AAV), adenovirus, retrovirus, and lentivirus vector. While the viral vector may deliver any component of the system described herein so long as it provides the desired profile for tissue presence or expression, in some embodiments the viral vector provides for expression of the gRNA and optionally delivers a repair template. In some embodiments, the viral delivery system is adeno-associated virus (AAV) 2 / 8. However, in various embodiments other AAV serotypes are used, such as AAV1, AAV2, AAV4, AAV5, AAV6, and AAV8. In some embodiments, AAV6 is used when targeting airway epithelial cells, AAV7 is used when targeting skeletal muscle cells (similarly for AAV1 and AAV5), and AAV8 is used for hepatocytes. In some embodiments, AAV1 and 5 can be used for delivery to vascular endothelial cells. Further, most AAV serotypes show neuronal tropism, while AAV5 also transduces astrocytes. In some embodiments, hybrid AAV vectors are employed. In some embodiments, each serotype is administered only once to avoid immunogenicity. Thus, subsequent administrations employ different AAV serotypes. Additional viral vectors that can be employed are as described in U. S. Pat. No. 8,697,359, which is hereby incorporated by reference in its entirety.
[0066] In some embodiments, the delivery system comprises a non-viral delivery vehicle. In some embodiments, the non-viral delivery vehicle is lipid-based. In other embodiments, the non-viral delivery vehicle is a polymer. In some embodiments, the non-viral delivery vehicle is biodegradable. In embodiments, the non-viral delivery vehicle is a lipid encapsulation system and / or polymeric particle.
[0067] In certain embodiments, the delivery system comprises lipid particles as described in Kanasty R, Delivery materials for siRNA therapeutics Nat Mater. 12(11):967-77 (2013), which is hereby incorporated by reference. In some embodiments, the lipid-based vector is a lipid nanoparticle, which is a lipid particle between about 1 and about 100 nanometers in size. In some embodiments, the lipid-based vector is a lipid or liposome. Liposomes are artificial spherical vesicles comprising a lipid bilayer. In some embodiments, the lipid-based vector is a small nucleic acid-lipid particle (SNALP). SNALPs comprise small (less than 200 nm in diameter) lipid-based nanoparticles that encapsulate a nucleic acid. In some embodiments,the SNALP is useful for delivery of an RNA molecule such as siRNA. In some embodiments, SNALP formulations deliver nucleic acids to a particular tissue in a subject, such as the liver.
[0068] In some embodiments, the gRNA and / or Cas9 variant (or the RNA encoding the same) is delivered via polymeric vectors. In some embodiments, the polymeric vector is a polymer or polymerosome. Polymers encompass any long repeating chain of monomers and include, for example, linear polymers, branched polymers, dendrimers, and polysaccharides. Linear polymers comprise a single line of monomers, whereas branched polymers include side chains of monomers. Dendrimers are also branched molecules, which are arranged symmetrically around the core of the molecule. Polysaccharides are polymeric carbohydrate molecules, and are made up of long monosaccharide units linked together. Polymersomes are artificial vesicles made up of synthetic amphiphilic copolymers that form a vesicle membrane, and may have a hollow or aqueous core within the vesicle membrane.
[0069] Various polymer-based systems can be adapted as a vehicle for administering RNA encoding the Cas9 variant. Exemplary polymeric materials include poly(D, L-lactic acid-co-glycolic acid) (PLGA), poly(caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly(lactic acid) (PLA), poly(L-lactic acid) (PLLA), poly(glycolic acid) (PGA), poly(L-lactic acid-co-glycolic acid) (PLLGA), poly(D, L-lactide) (PDLA), poly(L-lactide) (PLLA), PLGA-b-poly(ethylene glycol)-PLGA (PLGA-bPEG-PLGA), PLLA-bPEG-PLLA, PLGA-PEG-maleimide (PLGA-PEG-mal), poly(D, L-lactide-co-caprolactone), poly(D, L-lactide-co-caprolactone-co-glycolide), poly(D, L-lactide-co-PEO-co-D, L-lactide), poly(D, L-lactide-co-PPO-co-D, L-lactide), polyalkyl cyanoacralate, polyurethane, poly-L-lysine (PLL), hydroxypropyl methacrylate (HPMA), polyethyleneglycol, poly-L-glutamic acid, poly(hydroxy acids), polyanhydrides, polyorthoesters, poly(ester amides), polyamides, poly(ester ethers), polycarbonates, polyalkylenes such as polyethylene and polypropylene, polyalkylene glycols such as polyethylene glycol) (PEG), polyalkylene oxides (PEG), polyalkylene terephthalates such as poly(ethylene terephthalate), polyvinyl alcohols (PVA), polyvinyl ethers, polyvinyl esters such as poly(vinyl acetate), polyvinyl halides such as poly(vinyl chloride) (PVC), polyvinylpyrrolidone, polysiloxanes, polystyrene (PS), polyurethanes, derivatized celluloses such as alkyl celluloses, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, nitro celluloses, hydroxypropylcellulose, carboxymethylcellulose, polymers of acrylic acids, such as poly(methyl(meth)acrylate) (PMMA), poly(ethyl(meth)acrylate), poly(butyl(meth)acrylate), poly(isobutyl(meth)acrylate), poly(hexyl(meth)acrylate), poly(isodecyl(meth)acrylate), poly(lauryl(meth)acrylate), poly(phenyl(meth)acrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate) (polyacrylic acids), and copolymers and mixtures thereof, polydioxanone and its copolymers, polyhydroxyalkanoates,polypropylene fumarate), polyoxymethylene, poloxamers, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), trimethylene carbonate, polyvinylpyrrolidone, polyorthoesters, polyphosphazenes, Poly([beta]-amino esters (PBAE), and polyphosphoesters, and blends and / or block copolymers of two or more such polymers. Polymer-based systems may also include Cyclodextrin polymer (CDP)-based nanoparticles such as, for example, CDP-admantane (AD)-PEG conjugates and CDP-AD-PEG-transferrin conjugates. Exemplary polymeric particle systems for delivery of drugs, including nucleic acids, include those described in U. S. Pat. Nos. 5,543,158, 6,007,845, 6,254,890, 6,998,115, 7,727,969, 7,427,394, 8,323,698, 8,071,082, 8,105,652, US 2008 / 0268063, US 2009 / 0298710, US 2010 / 0303723, US 2011 / 0027172, US 2011 / 0065807, US 2012 / 0156135, US 2014 / 0093575, WO 2013 / 090861, each of which are hereby incorporated by reference in its entirety.
[0070] In some embodiments, the lipid-based delivery system comprises a lipid encapsulation system. The lipid encapsulation system can be designed to drive the desired tissue distribution and cellular entry properties, as well as to provide the requisite circulation time and biodegrading character. The lipid encapsulation may involve reverse micelles and / or further comprise polymeric matrices, for example as described in U. S. Pat. No. 8,193,334, which is hereby incorporated by reference. In some embodiments, the particle includes a lipophilic delivery compound to enhance delivery of the particle to tissues, including in a preferential manner. Such compounds are disclosed in US 2013 / 0158021, which is hereby incorporated by reference in its entirety. Such compounds may generally include lipophilic groups and conjugated amino acids or peptides, including linear or cyclic peptides, and including isomers thereof. An exemplary compound is referred to as CKK-E12, which can affect delivery to liver and kidney cells, for example. The present disclosure can employ compounds of formulas (I), (II), (III), IV), (V), and (VI) of US 2013 / 0158021. Compounds can be engineered for targeting to various tissues, including pancreas, spleen, liver, fat, kidneys, uterus / ovaries, muscle, heart, lungs, endothelial tissue, and thymus.
[0071] A pharmaceutically acceptable carrier refers, generally, to materials that are suitable for administration to a subject wherein the carrier is not biologically harmful, or otherwise, causes undesirable effects. Such carriers are typically inert ingredients of a medicament. Typically a carrier is administered to a subject along with an active ingredient without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of a pharmaceutical composition in which it is contained.
[0072] The pharmaceutical compositions or formulations of the disclosure, which may conveniently be presented in unit dosage form, may be prepared according to conventionaltechniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
[0073] Combination therapy with an additional therapeutic agent may also contemplated by the disclosure. The term "combination" or "combination therapy" as used throughout the specification, is meant to encompass the administration of the referred therapeutic agents to a subject suffering from a disease, disorder or pathological condition, in the same or separate pharmaceutical formulations, and at the same time or at different times. If the therapeutic agents are administered at different times they should be administered sufficiently close in time to provide for the potentiating or synergistic response to occur.
[0074] In another aspect, the present invention provides a method for reducing the immunogenicity of a Cas9 protein, the method comprising introducing one or more amino acid substitutions with reference to a wild-type Cas9 sequence set forth in SEQ ID NO: 1 to form a Cas9 variant, wherein the Cas9 variant comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 1, wherein the introduction of the one or more amino acid substitutions results in the Cas9 variant comprising at least one immunoreceptor tyrosinebased inhibitory motif (ITIM) located between position 971 and position 1019 of SEQ ID NO: 1, the ITIM having an amino acid sequence of X1X2YX3X4X5, wherein Xi is selected from the group consisting of V, L, I and S, wherein each of X2, X3 and X4 are independently selected from any amino acid, and wherein X₅ is selected from the group consisting of L, V and I.
[0075] In one embodiment, the one or more amino acid substitutions are introduced at one or more positions of SEQ ID NO: 1 selected from the group consisting of K999, K1014, R1019, Q971 and R976, wherein the amino acid substitution at position K999 is selected from the group consisting of K999S, K999I, K999L and K999V, wherein the amino acid substitution at position K1014 is selected from the group consisting of K1014T, K1014S, K1014L, K1014I and K1014V, wherein the amino acid substitution at position R1019 is selected from the group consisting of R1019I, R1019L and R1019V, wherein the amino acid substitution at position Q971 is selected from the group consisting of Q971V, Q971S, Q971L and Q971I, wherein the amino acid substitution at position R976 is selected from the group consisting of R976V, R976S, R976L and R976I.
[0076] In various embodiments, the amino acid substitution is K999S.
[0077] In one embodiment, the amino acid substitutions are K999S, K1014T and R1019I.
[0078] In another embodiment, the amino acid substitutions are K999S, K1014L and R1019V.
[0079] In one embodiment, the amino acid substitutions are K999S, K1014I and R1019L.
[0080] In one embodiment, the introduction of the one or more amino acid substitutions results in the Cas9 variant further comprising an immunoreceptor tyrosine-based switch motif (ITSM) located between position 999 and position 1019 of SEQ ID NO: 1, the ITSM having the sequence of TX₁YX₂X₃X₄, wherein each of X₁, X₂ and X₃ are independently selected from any amino acid, and wherein X₄ is selected from the group consisting of V and I.
[0081] In one embodiment, the Cas9 variant comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 2 to 80.
[0082] It would be generally appreciated by the skilled person that different positions within a protein have different tolerance for amino acid identities. For example, not all K can be substituted to S, I, L, orV, while still retaining protein function. Advantageously, the amino acid substitutions at the specific positions described in the present invention not only retain protein function, but also have reduced immunogenicity.
[0083] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
[0084] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
[0085] Other embodiments are within the following claims and non- limiting examples. In addition, where features or aspects of the invention are described in terms of Markush groups,those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.
[0086] MATERIAL AND METHODS
[0087] Transfection of HEK293T cells and analysis of VEGFA-1 indel frequency for evaluating in vitro on-target efficiency
[0088] HEK293T cells (293AAV cells, Cell Biolabs) were cultured and maintained in Dulbecco’s modified Eagle's medium plus GlutaMax (DMEM) (Thermo Fisher Scientific) supplemented with 10% (v / v) fetal bovine serum (FBS, Thermo Fisher Scientific). One day before transfection, cells were seeded at a density of 3x104cells / well per well in a 48 well plate. The next day, for each well, 750 ng of Cas9 variant plasmid and 250ng of VEGFA-1-targeting gRNA (GATGTCTGCAGGCCAGATGA) (SEQ ID NO: 161) plasmid were transfected into cells using lipofectamine 3000. 72h after transfection, media was removed, cells were washed with PBS and genomic DNA was extracted using 50pL of Quick Extract DNA Extract Solution. Then, cell suspension is heated in PCR thermocycler for 65C (10 min) and 95C (5 min). Then, 1 pL of cell lysate was used for amplification of VEGFA-1 genomic target site by PCR. 1 pL of the first PCR reaction mixture was used for a second PCR to introduce Illumina adaptors. Amplicons from the PCR2 were then pooled and gel extracted (Promega) to make the final library, which was quantified via Qubit fluorometer (Thermo Fisher) and sequenced on an Illumina iSeq 100 according to the manufacturer’s protocol. The resultant FASTQ files were analyzed using using CRISPResso2.
[0089] AAV vector production
[0090] The expression cassettes of wild-type (WT) CRISPR / Cas9, CRISPR / Cas9__variant#1 and CRISPR / Cas9_variant#2 were delivered via a dual-AAV-DJ vector system. The first AAV-DJ cassette contained the N-terminal portion of CRiSPR / Cas9 fused with an N-intein, while the second AAV-DJ cassette contained the C-terminal portion of CRISPR / Cas9 with the specific amino acid substitutions, fused with a C-intein,
[0091] AAV-DJ vectors were produced by triple transfection of 293AAV cells (AAV-100, Cell Biolabs). Cells were plated in growth media consisting of DMEM + glutaMax + pyruvate + 10% HI FBS (Thermo Fisher), supplemented with 1X MEM non-essential amino acids (Gibco). Confluency at transfection was between 70% and 90%. Celis were plated in HYPERflask M, and the DNA mixtures for AAV vectors consisted of 200 pg of helper plasmid (Cell Biolabs), 100 pg of Rep / Cap plasmid and 100 pg of Cas9 ITR cargo plasmid (Cas9 ITR cargo plasmids were a gift from George Church (Addgene #80938 and Addgene #80931). 24 hours later, the medium was changed to a fresh culture medium containing 2% FBS. Threedays after transfection, cells were collected and resuspended in lysis buffer (Tris HCl pH 7.5 + 2 mM MgCl + 150 mM NaCl) and lysed by three cycles of freezing / thawing. The supernatant was collected and treated with 50 U / ml of Benzonase (Sigma-Aldrich) and 1 U / mL of RNase cocktail (invitrogen) for 30 min at 37 °C to remove unpackaged nucleic acids. After incubation, the lysate was loaded on top of a discontinuous iodixanol gradient (15%, 25%, 40 %, 60%) and ultracentrifuged at 54000 rpm at 18°C for 1.5h, on a type 70 Ti rotor. The 40% fraction was collected, and dialyzed with 1X PBS with 0.001% pluronic acid, using an Amicon Ultra- 15 (100 kDa MWCO). The DNase-resistant AAV vectors were quantified by real-time qPCR with ITR-sequence-specific primers and probe and referenced against the ATCC reference standard material 2 (ATCC).
[0092] Animal studies
[0093] C57BL / 6 mice were handled according with the National Advisory Committee for Laboratory Animal Research (NACLAR) Guidelines and all experimental procedures were approved by A*STAR IACUC (Institutional Animal Care & Use Committee, IACUC #211646). Mice were injected intravenously with 1 x 1010GCs of dual AAV-DJ vectors encoding WT CRISPR / Cas9 (n=3) or CRISPR / Cas9„variant#1 (n=5) or CRISPR / Cas9„variant#2 (n=5). 3 months later, animals were euthanized, and spleens were collected, and single-cell suspension were then prepared. 2 x 105cells were stimulated with 10 pg / ml of WT CRISPR / Cas9, medium only was used as negative control and 5 x 104cells were stimulated with PMA / ionomycin as positive control (ELISpot assay). Cells were stimulated for 48 h at 37C 5%CO2. Detection IFN-y secreting cells following Cas9 stimulation was performed using enzyme-linked immune-sorbent spot (ELISpot) assay following manufacturer’s instructions (Mabtech). Following stimulation, cells were also stained for the surface markers: anti-CD3 (1:100, Biolegend) anti-CD4, (dilution 1:200, Biolegend), intracellular staining of FoxP3 (dilution 1:50, Thermo Fisher Scientific) was performed after fixation and permeabilization using murine FoxP3 buffer kit (Thermo Fisher Scientific) according to manufacturer's instructions. Data analysis was performed using FlowJo software (Tree Star, Ashland, OR).
[0094] EXAMPLES
[0095] Non-limiting examples of the invention and comparative examples will be further described in greater detail by reference to specific Examples, which should not be construed as in any way limiting the scope of the invention.
[0096] Example 1: Functional evaluation of engineered CRISPR-Cas9
[0097] The following 79 variants were designed and 10 variants were tested, among others.CRISPR / Cas9 variants SubstitutionsCRISPR / Cas9 Variant#! K999SCRISPR / Cas9 Variant#2 K999l / K10!4T / R10!9L CRISPR / Cas9 Variant#3 K999S_K10!4S_R10!9l CRISPR / Cas9 Variant#4 Q97! V. R976V. K999S CRISPR / Cas9 Variant#5 K999S, KI OUT, R!019l, Q97! V R976V CRISPR / Cas9 Variant#6 K999S, Q971S R976S CRISPR / Cas9 Variant#? K999S, K10!4T, R!019l, Q97! S R976S CRISPR / Cas9 Variant#8 K999VCRISPR / Cas9 Variant#9 K999LCRISPR / Cas9 _Variant#10 K999ICRISPR / Cas9 Variant#! 1 K999L / K1O!4T / R1O19L CRISPR / Cas9. Variant#! 2 K999L / K10!4T / R!019V CRISPR / Cas9 Variant#! 3 K999L / K1O!4T / R1O19I CRISPR / Cas9. Variant#! 4 K999S / K!0!4T / R10!9L CRISPR / Cas9 Variant#! 5 K999S / K!014T / R!0!9V CRISPR / Cas9 Variant#! 6 K999S / K!0!4T / R10!9l CRISPR / Cas9 Variant#! 7 K999I / K1014T / R1019V CRISPR / Cas9 Variant#! 8 K999l / K10!4T / R10!9l CRISPR / Cas9 Variant#! 9 K999V / K!014T / R!0!9L CRISPR / Cas9 Variant#20 K999V / K!0!4T / R10!9V CRISPR / Cas9 Variant#2! K999V / K!014T / R!0!9l CRISPR / Cas9 Variant#22 K999S_K10!4V_R10!9L CRISPR / Cas9 Variant#23 K999S_K10!4V_R10!9V CRISPR / Cas9 Variant#24 K999S_K10!4V_R10!9l CRISPR / Cas9 Variant#25 K999S_K1O!4L_R1O19L CRISPR / Cas9 Variant#26 K999S_K10!4L_R!019V CRISPR / Cas9 Variant#27 K999S_K1O!4L_R1O19I CRISPR / Cas9 Variant#28 K999S_K10!4l_R10!9L CRISPR / Cas9 Variant#29 K999S_K10!4l_R10!9V CRISPR / Cas9 Variant#30 K999S_K10!4l_R10!9l CRISPR / Cas9 Variant#3! K999S_K10!4S_R10!9L CRISPR / Cas9 Variant#32 K999S_K10!4S_R10!9V CRISPR / Cas9 Variant#33 Q971S. R976L. K999S CRISPR / Cas9 Variant#34 Q97! S_R976L_K999L CRISPR / Cas9 Variant#35 Q971S. R976L. K999V CRISPR / Cas9 Variant#36 Q97! S_R976L_K999I CRISPR / Cas9 Variant#37 Q971S. R976V. K999S CRISPR / Cas9 Variant#38 Q97! S_R976V_K999L CRISPR / Cas9 _Variant#39 Q971S. R976V. K999V CRISPR / Cas9 Variant#40 Q97! S_R976V_K999I CRISPR / Cas9 _Variant#4! Q971S. R976I. K999SCRISPR / Cas9 Variant#42 Q97! S_R976I_K999LCRISPR / Cas9 _Variant#43 Q971S. R976I. K999VCRISPR / Cas9 Variant#44 Q971S_R976I_K999ICRISPR / Cas9 _Variant#45 Q971 L_R976L_K999SCRISPR / Cas9 Variant#46 Q971 L_R976L_K999LCRISPR / Cas9 Variant#47 Q971 L_R976L_K999VCRISPR / Cas9 Variant#48 Q971 L_R976L_K999ICRISPR / Cas9 _Variant#49 Q971 L_R976V_K999SCRISPR / Cas9 Variant#50 Q971 L_R976V_K999LCRISPR / Cas9 _Variant#51 Q971 L_R976V_K999VCRISPR / Cas9 Variant#52 Q971 L_R976V_K999ICRISPR / Cas9 Variant#53 Q971 L_R976I_K999SCRISPR / Cas9 Variant#54 Q971 L_R976I_K999LCRISPR / Cas9 Variant#55 Q971 L_R976I_K999VCRISPR / Cas9 Variant#56 Q971 L_R976I_K999ICRISPR / Cas9 Variant#57 Q971 l_R976L_K999SCRISPR / Cas9 Variant#58 Q971 l_R976L_K999LCRISPR / Cas9 _Variant#59 Q971 l_R976L_K999VCRISPR / Cas9 Variant#60 Q971 l_R976L_K999lCRISPR / Cas9 _Variant#61 Q971 l_R976V_K999SCRISPR / Cas9 Variant#62 Q971 l_R976V_K999LCRISPR / Cas9 _Variant#63 Q971 l_R976V_K999VCRISPR / Cas9 Variant#64 Q971 l_R976V_K999lCRISPR / Cas9 Variant#65 Q971 l_R976l_K999SCRISPR / Cas9 Variant#66 Q971 l_R976l_K999LCRISPR / Cas9 Variant#67 Q971 l_R976l_K999VCRISPR / Cas9 Variant#68 Q971 l_R976l_K999lCRISPR / Cas9 _Variant#69 Q971 V_R976L_K999SCRISPR / Cas9 Variant#70 Q971 V_R976L_K999LCRISPR / Cas9 Variant#71 Q971 V_R976L_K999VCRISPR / Cas9 Variant#72 Q971 V_R976L_K999ICRISPR / Cas9 Variant#73 Q971 V_R976V_K999LCRISPR / Cas9 Variant#74 Q971 V_R976V_K999VCRISPR / Cas9 Variant#75 Q971 V_R976V_K999ICRISPR / Cas9 Variant#76 Q971 V_R976I_K999SCRISPR / Cas9 _Variant#77 Q971 V_R976I_K999LCRISPR / Cas9 Variant#78 Q971 V_R976I_K999VCRISPR / Cas9 _Variant#79 Q971 V_R976I_K999ITable 1.
[0098] The in vitro cleavage activity of each CRISPR / Cas9 variants in HEK293AAV cells was assessed, along with gRNA designed to target genomic site VEGFA-1. As a control, cells were treated with wild-type (WT) CRISPR / Cas9 with the same gRNA. High-throughput sequencing results showed that the variants #1, #2 and #3 exhibit similar editing efficiency when compared to WT CRISPR / Cas9 (Figurel). These results indicates that thesesubstitutions do not affect the enzymatic function of CRISPR / Cas9. However, variants #4, #5, #6 and #7 displayed a significant decrease in on-target efficiency in vitro compared to WT CRISPR / Cas9 (Figure 1).
[0099] Therefore, variants #1, #2 and #3 are fully active engineered Cas9 (similar than WT CRISPR / Cas9), and variants #4, #5, #6 and #7 for are modestly impacted in their endonucleolytic activity, but can potentially retain target binding function useful for base editors, prime editors, or other Cas9-based epigenetic modifiers.
[0100] Example 2: Modulation of the immune responses by CRISPR / Cas9 variants
[0101] To investigate the efficacy of the engineered variants in reducing the immune responses directed towards CRISPR / Cas9 in vivo, a proof-of-concept study was conducted (Figure 2A). The expression cassettes of wild-type (WT) CRISPR / Cas9, CRISPR / Cas9_variant#1 and CRISPR / Cas9_variant#2 were delivered via a dual- AAV-DJ vector system. The first AAV-DJ cassette contained the N-terminal portion of CRISPR / Cas9 fused with an N-intein, while the second AAV-DJ cassette contained the C-terminal portion of CRISPR / Cas9 with the specific amino acid substitutions, fused with a C-intein. The viruses were intravenously injected at a dose of 1 x 1010vector genomic copies (GCs) per animal into adult mice. 3 months following the initial AAVs injection, animals were euthanized, and the organs were collected. To detect T-cell response to CRISPR / Cas9 in mouse splenocytes, we used a CRISPR / Cas9-specific interferon (IFN)-y enzyme-linked immune-sorbent spot (ELISpot) assay. Cells were stimulated with either 10 pg / ml of WT CRISPR / Cas9, PMA-ionomycin as a positive control, or medium only as a negative control, and then incubated in a 37 °C, 5% CO2 incubator for 48 h.
[0102] The T-cell ELISpot results showed a significant decrease in T-cell response in CRISPR / Cas9_variant#1 group compared to animal injected with WT CRISPR / Cas9 (Figure 2B). However, in the case of CRISPR / Cas9_variant#2, although there was a noticeable trend towards reduced T-cell response, the difference did not currently reach statistical significance (Figure 2B), presumably resolved via increasing the animal sample size (n=5).
[0103] Additionally, the frequency of Tregs in the spleen was assessed following 48 hours of stimulation with WT CRISPR / Cas9. Interestingly, there was a significant increase in Tregs in both CRISPR / Cas9_variant#1 and CRISPR / Cas9_variant#2 groups compared to the WT CRISPR / Cas9 group (Figure 2C). These findings highlight the potential of CRISPR / Cas9_variant#1 and CRISPR / Cas9_variant#2 to induce immune tolerance by attenuating cytotoxic immune responses and enhancing Tregs.
[0104] Example 3: Editing efficiency (EMX1 indel%) of Cas9 variants
[0105] Figure 3 demonstrates the editing efficiency (EMX1 indel%) of variants at the target locus. Variants #26 and #28 were specifically selected for further characterization based on multiple design criteria beyond editing efficiency alone. These variants were engineered to incorporate two ITIM motifs predicted to confer enhanced immune evasion properties similar to or exceeding those of variant #1.
[0106] Example 4: Sequences
[0107] Table 2 shows the SEQ ID NOs of the wild-type (WT) and variant CRISPR / Cas9 sequences of the present disclosure.SEQ DescriptionID NOAmino acid sequence of WT CRISPR / Cas912 Amino acid sequence of CRISPR / Cas9_variant#1 (K999S)3 Amino acid sequence of CRISPR / Cas9_variant#2 (K999S, K1014T, R1019I)4 Amino acid sequence of CRISPR / Cas9_variant#3 (K999S, K1014S, R1019I)5 Amino acid sequence of CRISPR / Cas9_variant#4 (K999S, Q971V, R976V)6 Amino acid sequence of CRISPR / Cas9_variant#5 (K999S, K1014T, R1019I, Q971V, R976V)7 Amino acid sequence of CRISPR / Cas9_variant#6 (K999S, Q971S, R976S)8 Amino acid sequence of CRISPR / Cas9_variant#7 (K999S, K1014T, R1019I, Q971S, R976S)9 Amino acid sequence of CRISPR / Cas9 _Variant#8 (K999V)10 Amino acid sequence of CRISPR / Cas9 _Variant#9 (K999L)11 Amino acid sequence of CRISPR / Cas9 _Variant#10 (K999I)12 Amino acid sequence of CRISPR / Cas9 _Variant#11 (K999L, K1014T, R1019L)13 Amino acid sequence of CRISPR / Cas9 _Variant#12 (K999L, K1014T, R1019V)14 Amino acid sequence of CRISPR / Cas9 _Variant#13 (K999L, K1014T, R1019I)15 Amino acid sequence of CRISPR / Cas9 _Variant#14 (K999S, K1014T, R1019L)16 Amino acid sequence of CRISPR / Cas9 _Variant#15 (K999S, K1014T, R1019V)17 Amino acid sequence of CRISPR / Cas9 _Variant#16 (K999S, K1014T, R1019I)18 Amino acid sequence of CRISPR / Cas9 _Variant#17 (K999I, K1014T, R1019V)19 Amino acid sequence of CRISPR / Cas9 _Variant#18 (K999I, K1014T, R1019I)20 Amino acid sequence of CRISPR / Cas9 _Variant#19 (K999V, K1014T, R1019L)21 Amino acid sequence of CRISPR / Cas9 _Variant#20 (K999V, K1014T, R1019V)22 Amino acid sequence of CRISPR / Cas9 _Variant#21 (K999V, K1014T, R1019I)23 Amino acid sequence of CRISPR / Cas9 _Variant#22 (K999S, K1014V, R1019L)24 Amino acid sequence of CRISPR / Cas9 _Variant#23 (K999S, K1014V, R1019V)25 Amino acid sequence of CRISPR / Cas9 _Variant#24 (K999S, K1014V, R1019I)26 Amino acid sequence of CRISPR / Cas9 _Variant#25 (K999S, K1014L, R1019L)27 Amino acid sequence of CRISPR / Cas9 _Variant#26 (K999S, K1014L, R1019V)28 Amino acid sequence of CRISPR / Cas9 _Variant#27 (K999S, K1014L, R1019I)29 Amino acid sequence of CRISPR / Cas9 _Variant#28 (K999S, K1014I, R1019L)Amino acid sequence of CRISPR / Cas9 _Variant#29 (K999S, K1014I, R1019V) Amino acid sequence of CRISPR / Cas9 _Variant#30 (K999S, K1014I, R1019I) Amino acid sequence of CRISPR / Cas9 _Variant#31 (K999S, K1014S, R1019L) Amino acid sequence of CRISPR / Cas9 _Variant#32 (K999S, K1014S, R1019V) Amino acid sequence of CRISPR / Cas9 _Variant#33 (Q971S, R976L, K999S) Amino acid sequence of CRISPR / Cas9 _Variant#34 (Q971S, R976L, K999L) Amino acid sequence of CRISPR / Cas9 _Variant#35 (Q971S, R976L, K999V) Amino acid sequence of CRISPR / Cas9 _Variant#36 (Q971S, R976L, K999I) Amino acid sequence of CRISPR / Cas9 _Variant#37 (Q971S, R976V, K999S) Amino acid sequence of CRISPR / Cas9 _Variant#38 (Q971S, R976V, K999L) Amino acid sequence of CRISPR / Cas9 _Variant#39 (Q971S, R976V, K999V) Amino acid sequence of CRISPR / Cas9 _Variant#40 (Q971S, R976V, K999I) Amino acid sequence of CRISPR / Cas9 _Variant#41 (Q971S, R976I, K999S) Amino acid sequence of CRISPR / Cas9 _Variant#42 (Q971S, R976I, K999L) Amino acid sequence of CRISPR / Cas9 _Variant#43 (Q971S, R976I, K999V) Amino acid sequence of CRISPR / Cas9 _Variant#44 (Q971S, R976I, K999I) Amino acid sequence of CRISPR / Cas9 _Variant#45 (Q971L, R976L, K999S) Amino acid sequence of CRISPR / Cas9 _Variant#46 (Q971L, R976L, K999L) Amino acid sequence of CRISPR / Cas9 _Variant#47 (Q971L, R976L, K999V) Amino acid sequence of CRISPR / Cas9 _Variant#48 (Q971L, R976L, K999I) Amino acid sequence of CRISPR / Cas9 _Variant#49 (Q971L, R976V, K999S) Amino acid sequence of CRISPR / Cas9 _Variant#50 (Q971L, R976V, K999L) Amino acid sequence of CRISPR / Cas9 _Variant#51 (Q971L, R976V, K999V) Amino acid sequence of CRISPR / Cas9 _Variant#52 (Q971L, R976V, K999I) Amino acid sequence of CRISPR / Cas9 _Variant#53 (Q971L, R976I, K999S) Amino acid sequence of CRISPR / Cas9 _Variant#54 (Q971L, R976I, K999L) Amino acid sequence of CRISPR / Cas9 _Variant#55 (Q971L, R976I, K999V) Amino acid sequence of CRISPR / Cas9 _Variant#56 (Q971L, R976I, K999I) Amino acid sequence of CRISPR / Cas9 _Variant#57 (Q971I, R976L, K999S) Amino acid sequence of CRISPR / Cas9 _Variant#58 (Q971I, R976L, K999L) Amino acid sequence of CRISPR / Cas9 _Variant#59 (Q971I, R976L, K999V) Amino acid sequence of CRISPR / Cas9 _Variant#60 (Q971I, R976L, K999I) Amino acid sequence of CRISPR / Cas9 _Variant#61 (Q971I, R976V, K999S) Amino acid sequence of CRISPR / Cas9 _Variant#62 (Q971I, R976V, K999L) Amino acid sequence of CRISPR / Cas9 _Variant#63 (Q971I, R976V, K999V) Amino acid sequence of CRISPR / Cas9 _Variant#64 (Q971I, R976V, K999I) Amino acid sequence of CRISPR / Cas9 _Variant#65 (Q971I, R976I, K999S) Amino acid sequence of CRISPR / Cas9 _Variant#66 (Q971I, R976I, K999L) Amino acid sequence of CRISPR / Cas9 _Variant#67 (Q971I, R976I, K999V) Amino acid sequence of CRISPR / Cas9 _Variant#68 (Q971I, R976I, K999I) Amino acid sequence of CRISPR / Cas9 _Variant#69 (Q971V, R976L, K999S) Amino acid sequence of CRISPR / Cas9 _Variant#70 (Q971V, R976L, K999L) Amino acid sequence of CRISPR / Cas9 _Variant#71 (Q971V, R976L, K999V)Amino acid sequence of CRISPR / Cas9 _Variant#72 (Q971V, R976L, K999I)Amino acid sequence of CRISPR / Cas9 _Variant#73 (Q971V, R976V, K999L) Amino acid sequence of CRISPR / Cas9 _Variant#74 (Q971V, R976V, K999V) Amino acid sequence of CRISPR / Cas9 _Variant#75 (Q971V, R976V, K999I) Amino acid sequence of CRISPR / Cas9 _Variant#76 (Q971V, R976I, K999S) Amino acid sequence of CRISPR / Cas9 _Variant#77 (Q971V, R976I, K999L) Amino acid sequence of CRISPR / Cas9 _Variant#78 (Q971V, R976I, K999V) Amino acid sequence of CRISPR / Cas9 _Variant#79 (Q971V, R976I, K999I) DNA sequence ofWT CRISPR / Cas9DNA sequence of CRISPR / Cas9 _Variant#1 (K999S)DNA sequence of CRISPR / Cas9 _Variant#2 (K999I, K1014T, R1019L) DNA sequence of CRISPR / Cas9 _Variant#3 (K999S, K1014S, R1019I) DNA sequence of CRISPR / Cas9 _Variant#4 (Q971V, R976V, K999S) DNA sequence of CRISPR / Cas9 _Variant#5 (K999S, K1014T, R1019I, Q971V, R976V)DNA sequence of CRISPR / Cas9 _Variant#6 (K999S, Q971S, R976S) DNA sequence of CRISPR / Cas9 _Variant#7 (K999S, K1014T, R1019I, Q971S, R976S)DNA sequence of CRISPR / Cas9 _Variant#8 (K999V)DNA sequence of CRISPR / Cas9 _Variant#9 (K999L)DNA sequence of CRISPR / Cas9 _Variant#10 (K999I)DNA sequence of CRISPR / Cas9 _Variant#11 (K999L, K1014T, R1019L) DNA sequence of CRISPR / Cas9 _Variant#12 (K999L, K1014T, R1019V) DNA sequence of CRISPR / Cas9 _Variant#13 (K999L, K1014T, R1019I) DNA sequence of CRISPR / Cas9 _Variant#14 (K999S, K1014T, R1019L) DNA sequence of CRISPR / Cas9 _Variant#15 (K999S, K1014T, R1019V) DNA sequence of CRISPR / Cas9 _Variant#16 (K999S, K1014T, R1019I) DNA sequence of CRISPR / Cas9 _Variant#17 (K999I, K1014T, R1019V) DNA sequence of CRISPR / Cas9 _Variant#18 (K999I, K1014T, R1019I) DNA sequence of CRISPR / Cas9 _Variant#19 (K999V, K1014T, R1019L) DNA sequence of CRISPR / Cas9 _Variant#20 (K999V, K1014T, R1019V) DNA sequence of CRISPR / Cas9 _Variant#21 (K999V, K1014T, R1019I) DNA sequence of CRISPR / Cas9 _Variant#22 (K999S, K1014V, R1019L) DNA sequence of CRISPR / Cas9 _Variant#23 (K999S, K1014V, R1019V) DNA sequence of CRISPR / Cas9 _Variant#24 (K999S, K1014V, R1019I) DNA sequence of CRISPR / Cas9 _Variant#25 (K999S, K1014L, R1019L) DNA sequence of CRISPR / Cas9 _Variant#26 (K999S, K1014L, R1019V) DNA sequence of CRISPR / Cas9 _Variant#27 (K999S, K1014L, R1019I) DNA sequence of CRISPR / Cas9 _Variant#28 (K999S, K1014I, R1019L) DNA sequence of CRISPR / Cas9 _Variant#29 (K999S, K1014I, R1019V) DNA sequence of CRISPR / Cas9 _Variant#30 (K999S, K1014I, R1019I) DNA sequence of CRISPR / Cas9 _Variant#31 (K999S, K1014S, R1019L) DNA sequence of CRISPR / Cas9 _Variant#32 (K999S, K1014S, R1019V) DNA sequence of CRISPR / Cas9 _Variant#33 (Q971S, R976L, K999S) DNA sequence of CRISPR / Cas9 _Variant#34 (Q971S, R976L, K999L)DNA sequence of CRISPR / Cas9 _Variant#35 (Q971S, R976L, K999V)DNA sequence of CRISPR / Cas9 _Variant#36 (Q971S, R976L, K999I) DNA sequence of CRISPR / Cas9 _Variant#37 (Q971S, R976V, K999S) DNA sequence of CRISPR / Cas9 _Variant#38 (Q971S, R976V, K999L) DNA sequence of CRISPR / Cas9 _Variant#39 (Q971S, R976V, K999V) DNA sequence of CRISPR / Cas9 _Variant#40 (Q971S, R976V, K999I) DNA sequence of CRISPR / Cas9 _Variant#41 (Q971S, R976I, K999S) DNA sequence of CRISPR / Cas9 _Variant#42 (Q971S, R976I, K999L) DNA sequence of CRISPR / Cas9 _Variant#43 (Q971S, R976I, K999V) DNA sequence of CRISPR / Cas9 _Variant#44 (Q971S, R976I, K999I) DNA sequence of CRISPR / Cas9 _Variant#45 (Q971L, R976L, K999S) DNA sequence of CRISPR / Cas9 _Variant#46 (Q971L, R976L, K999L) DNA sequence of CRISPR / Cas9 _Variant#47 (Q971L, R976L, K999V) DNA sequence of CRISPR / Cas9 _Variant#48 (Q971L, R976L, K999I) DNA sequence of CRISPR / Cas9 _Variant#49 (Q971L, R976V, K999S) DNA sequence of CRISPR / Cas9 _Variant#50 (Q971L, R976V, K999L) DNA sequence of CRISPR / Cas9 _Variant#51 (Q971L, R976V, K999V) DNA sequence of CRISPR / Cas9 _Variant#52 (Q971L, R976V, K999I) DNA sequence of CRISPR / Cas9 _Variant#53 (Q971L, R976I, K999S) DNA sequence of CRISPR / Cas9 _Variant#54 (Q971L, R976I, K999L) DNA sequence of CRISPR / Cas9 _Variant#55 (Q971L, R976I, K999V) DNA sequence of CRISPR / Cas9 _Variant#56 (Q971L, R976I, K999I) DNA sequence of CRISPR / Cas9 _Variant#57 (Q971I, R976L, K999S) DNA sequence of CRISPR / Cas9 _Variant#58 (Q971I, R976L, K999L) DNA sequence of CRISPR / Cas9 _Variant#59 (Q971I, R976L, K999V) DNA sequence of CRISPR / Cas9 _Variant#60 (Q971I, R976L, K999I) DNA sequence of CRISPR / Cas9 _Variant#61 (Q971I, R976V, K999S) DNA sequence of CRISPR / Cas9 _Variant#62 (Q971I, R976V, K999L) DNA sequence of CRISPR / Cas9 _Variant#63 (Q971I, R976V, K999V) DNA sequence of CRISPR / Cas9 _Variant#64 (Q971I, R976V, K999I) DNA sequence of CRISPR / Cas9 _Variant#65 (Q971I, R976I, K999S) DNA sequence of CRISPR / Cas9 _Variant#66 (Q971I, R976I, K999L) DNA sequence of CRISPR / Cas9 _Variant#67 (Q971I, R976I, K999V) DNA sequence of CRISPR / Cas9 _Variant#68 (Q971I, R976I, K999I) DNA sequence of CRISPR / Cas9 _Variant#69 (Q971V, R976L, K999S) DNA sequence of CRISPR / Cas9 _Variant#70 (Q971V, R976L, K999L) DNA sequence of CRISPR / Cas9 _Variant#71 (Q971V, R976L, K999V) DNA sequence of CRISPR / Cas9 _Variant#72 (Q971V, R976L, K999I) DNA sequence of CRISPR / Cas9 _Variant#73 (Q971V, R976V, K999L) DNA sequence of CRISPR / Cas9 _Variant#74 (Q971V, R976V, K999V) DNA sequence of CRISPR / Cas9 _Variant#75 (Q971V, R976V, K999I) DNA sequence of CRISPR / Cas9 _Variant#76 (Q971V, R976I, K999S) DNA sequence of CRISPR / Cas9 _Variant#77 (Q971V, R976I, K999L) DNA sequence of CRISPR / Cas9 _Variant#78 (Q971V, R976I, K999V)DNA sequence of CRISPR / Cas9 _Variant#79 (Q971V, R976I, K999I)Table 2. SEQ ID NOs of CRISPR / Cas9 sequences of the present embodiments
[0108] In various embodiments of the present invention, there are provided CRISPR / Cas9 compositions of matter that reduce cytotoxic T-cell immunogenicity and increases immune-reducing regulatory T-cell formation. Advantageously, the mutations are present within the Cas9 protein, and in not a separate domain fusion that would increase the size of the protein. Furthermore, it would be generally appreciated by a person skilled in the art that the majority of amino acid mutations tend to be deleterious. Advantageously, despite these mutations, the Cas9 variants of the present invention retain the function of the Cas9 enzyme. A further advantage is that these Cas9 variants exhibit a reduced immunogenicity in terms of reducing the activation of IFN-y-secreting immune cells and increasing the formation of immune-modulatory Tregs.
[0109] While embodiments of the invention have been particularly shown and described with reference to specific embodiments, it should be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the scope of the invention as defined by the appended claims. The scope of the invention is thus indicated by the appended claims and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced.
Claims
CLAIMS1. A Cas9 variant comprising an amino acid sequence having at least 95% sequence identity to a wild-type Cas9 sequence set forth in SEQ ID NO: 1, wherein the Cas9 variant has a reduced immunogenicity compared to the wild-type Cas9, wherein the Cas9 variant comprises at least one immunoreceptor tyrosine-based inhibitory motif (ITIM) located between position 971 and position 1019 of SEQ ID NO: 1, the ITIM having an amino acid sequence of X1X2YX3X4X5, wherein X₁ is selected from the group consisting of V, L, I and S, wherein each of X₂, X₃ and X₄ are independently selected from any amino acid, and wherein X₅ is selected from the group consisting of L, V and I.
2. The Cas9 variant of claim 1, comprising one or more amino acid substitutions at one or more positions of SEQ ID NO: 1 selected from the group consisting of K999, K1014, R1019, Q971 and R976,wherein the amino acid substitution at position K999 is selected from the group consisting of K999S, K999I, K999L and K999V,wherein the amino acid substitution at position K1014 is selected from the group consisting of K1014T, K1014S, K1014L, K1014I and K1014V,wherein the amino acid substitution at position R1019 is selected from the group consisting of R1019I, R1019L and R1019V,wherein the amino acid substitution at position Q971 is selected from the group consisting of Q971V, Q971S, Q971L and Q971I, andwherein the amino acid substitution at position R976 is selected from the group consisting of R976V, R976S, R976L and R976I.
3. The Cas9 variant of claim 2, wherein the amino acid substitution is K999S.
4. The Cas9 variant of claim 2, wherein the amino acid substitutions are K999S, K1014T and R1019I.
5. The Cas9 variant of claim 2, wherein the amino acid substitutions are K999S, K1014L and R1019V.
6. The Cas9 variant of claim 2, wherein the amino acid substitutions are K999S, K1014I and R1019L.
7. The Cas9 variant of claim 1, further comprising an immunoreceptor tyrosine- based switch motif (ITSM) located between position 999 and position 1019 of SEQ ID NO: 1, the ITSM having the sequence of TX₁YX₂X₃X₄, wherein each of X₁, X₂ and X₃ are independently selected from any amino acid, and wherein X₄ is selected from the group consisting of V and I.
8. The Cas9 variant of claim 1 or 2, comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 2 to 80.
9. A nucleic acid construct comprising a polynucleotide sequence encoding the Cas9 variant of any one of claims 1 to 8.
10. The nucleic acid construct of claim 9, wherein the polynucleotide sequence comprises a sequence selected from the group consisting of SEQ ID NOs 82 to 160.
11. A Cas9 variant of any one of claims 1 to 8 or a nucleic acid construct of claim 9 or 10 for use in treating a genetic disorder.
12. Use of a Cas9 variant of any one of claims 1 to 8 or a nucleic acid construct of claim 9 or 10 in the manufacture of a medicament for treating a genetic disorder.
13. A method of treating a genetic disorder comprising administering to a subject a composition comprising a Cas9 variant of any one of claims 1 to 8 or a nucleic acid construct of claim 9 or 10.
14. A pharmaceutical composition comprising (a) a therapeutically effective amount of a Cas9 variant of any one of claims 1 to 8 or a nucleic acid construct of claim 9 or 10 and (b) one or more pharmaceutically acceptable carriers and / or diluents.
15. A method for reducing the immunogenicity of a Cas9 protein, the method comprising introducing one or more amino acid substitutions with reference to a wild-type Cas9 sequence set forth in SEQ ID NO: 1 to form a Cas9 variant, wherein the Cas9 variant comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 1, wherein the introduction of the one or more amino acid substitutions results in the Cas9 variant comprising at least one immunoreceptor tyrosine-based inhibitory motif (ITIM) located between position 971 and position 1019 of SEQ ID NO: 1, the ITIMhaving an amino acid sequence of X1X2YX3X4X5, wherein X₁ is selected from the group consisting of V, L, I and S, wherein each of X₂, X₃ and X₄ are independently selected from any amino acid, and wherein X₅ is selected from the group consisting of L, V and I.
16. The method of claim 15, wherein the one or more amino acid substitutions are introduced at one or more positions of SEQ ID NO: 1 selected from the group consisting of K999, K1014, R1019, Q971 and R976,wherein the amino acid substitution at position K999 is selected from the group consisting of K999S, K999I, K999L and K999V,wherein the amino acid substitution at position K1014 is selected from the group consisting of K1014T, K1014S, K1014L, K1014I and K1014V,wherein the amino acid substitution at position R1019 is selected from the group consisting of R1019I, R1019L and R1019V,wherein the amino acid substitution at position Q971 is selected from the group consisting of Q971V, Q971S, Q971L and Q971I, andwherein the amino acid substitution at position R976 is selected from the group consisting of R976V, R976S, R976L and R976I.
17. The method of claim 16, wherein the amino acid substitution is K999S.
18. The method of claim 16, wherein the amino acid substitutions are K999S, K1014T and R1019I.
19. The method of claim 16, wherein the amino acid substitutions are K999S, K1014L and R1019V.
20. The method of claim 16, wherein the amino acid substitutions are K999S, K1014I and R1019L.
21. The method of claim 15 or 16, wherein the introduction of the one or more amino acid substitutions results in the Cas9 variant further comprising an immunoreceptor tyrosine-based switch motif (ITSM) located between position 999 and position 1019 of SEQ ID NO: 1, the ITSM having the sequence of TX1YX2X3X4, wherein each of Xi, X2 and X3 are independently selected from any amino acid, and wherein X4 is selected from the group consisting of V and I.
22. The method of claim 15 or 16, wherein the Cas9 variant comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 2 to 80.