Methods and compositions for the ADAR-mediated editing of adenosine monophosphate (AMP)-activated protein kinase (AMPK)

Abstract

The present disclosure relates to methods and compositions for editing an AMPK polynucleotide encoding an AMPK protein. The disclosure also relates to methods and compositions for modulating activity of an AMPK protein, for promoting activation of an AMPK protein, for repairing function of a pathogenic AMPK protein, and methods for regulating energy homeostasis and / or for treating or preventing an AMPK-associated disease or condition in a subject.

Description

Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO METHODS AND COMPOSITIONS FOR THE ADAR-MEDIATED EDITING OF ADENOSINE MONOPHOSPHATE (AMP)-ACTIVATED PROTEIN KINASE (AMPK)CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Application No. 63 / 760,208, filed on February 19, 2025, and to U.S. Application No. 63 / 969,733, filed on January 28, 2026, the entire contents of each of which are fully incorporated herein by reference.INCORPORATION BY REFERENCE OF MATERIALS SUBMITTED ELECTRONICALLY

[0002] This application contains, as a separate part of the disclosure, a Sequence Listing in computer readable form (Filename: 41032P4_SeqListing.xml; Size: 134,822 bytes; Created: January 2, 2026), which is incorporated by reference in its entirety.BACKGROUND

[0003] Adenosine monophosphate (AMP)-activated protein kinase (AMPK) is a highly conserved heterotrimeric serine / threonine kinase which serves as a eukaryotic cellular energy sensor, and plays a vital role in the coordination of cell growth, metabolism, and energy homeostasis (Hardie, et al., Nat Rev Mol Cell Biol, 2012. 13(4): p. 251–262). AMPK is comprised of an alpha (a) catalytic subunit in a molecular complex with a beta (β) scaffolding subunit and a gamma (y) regulatory subunit. Each of the subunits has two or three isoforms (a1 and a2, β1 and β2, γ1, γ2 and γ3) that are encoded by different genes. The composition of AMPK heterotrimeric complexes differs between species, as well as differing across various tissues within a given species.

[0004] Activation of AMPK involves phosphorylation of a conserved threonine residue (Thr172) located within the catalytic core of the AMPK a subunit. Upon binding to the AMPK y subunit, AMP can promote phosphorylation at Thr172, allosterically increase activity of the phosphorylated AMPK, and protect AMPK from dephosphorylation by protein phosphatases. Once activated, AMPK induces a signaling cascade that works to boost ATP levels back to homeostasis levels.

[0005] As a regulator of energy homeostasis, activation of AMPK has been suggested to exert its effect on glucose homeostasis, lipid metabolism, and protein synthesis in the liver, pancreas, skeletal muscle, heart, and brain (Gonon et al., Cardiovasc. Res. 2008, 78, 116-122). For example, activation of the AMPK pathway improves insulin sensitivity by directly stimulating glucose uptake in adipocytes and muscle and by increasing fatty acid oxidation in liver and muscle, resulting in reduced circulating fatty acid levels and reduced intracellular triglyceride contents. Moreover, activation of the AMPK pathway decreases glycogen concentration by reducing the activity of glycogen synthase. Activation of the AMPK pathway also plays a protective role against inflammation and atherosclerosis. It suppresses the expression of adhesion molecules in vascular endothelial cells and cytokine production from macrophages, thus inhibiting the inflammatory processes that occur during the early phases of atherosclerosis.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO Furthermore, accumulating pre-clinical evidence have shown that AMPK activation could also suppress hepatocellular carcinoma.

[0006] As such, pharmacologic AMPK modulation, e.g., activation of AMPK, provides a highly attractive therapeutic option for multiple disorders, such as metabolic disorders, liver diseases, e.g,, non-alcoholic fatty liver disease, nonalcoholic steatohepatitis (NASH); cardiovascular diseases, hypertension, dyslipidemia, diabetes, neurodegenerative diseases, e.g., Alzheimer’s diseases; eye disease, kidney disease, or cancer. Compounds such as 5-amino-1-p-D-ribofuranosyl-imidazole-4-carboxamide (AICAR), thiazolidinediones (TZDs) and metformin are known to activate AMPK, and have been used to treat pre-diabetes, insulin resistance, syndrome X and type 2 diabetes. However, no direct AMPK activators have made it to the clinic due to poor pharmacokinetic profiles or off-target effects.

[0007] Accordingly, there exists an ongoing need for novel compositions and methods that can activate the AMPK pathway, for example, by selectively and efficiently editing the AMPK gene, in order to treat and / or prevent the AMPK-associated diseases or conditions.SUMMARY

[0008] The present disclosure provides methods of editing an AMPK polynucleotide encoding an AMPK protein, methods for modulating activity of an AMPK protein, methods for promoting activation of an AMPK protein, and methods for treating or preventing an AMPK-associated disease or condition, e.g., metabolic diseases, liver diseases, central nervous system (CNS) diseases, and / or cardiovascular diseases, in a subject. In some embodiments, the methods include using a guide oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration in the target AMPK gene.

[0009] The present disclosure provides methods for site specific editing of AMPK in a cell, without the need to transduce or transfect the cell with genetically engineered editing enzymes. The design of the guide oligonucleotides of the present disclosure allows the recruitment of an endogenous ADAR enzyme, to the specific editing sites disclosed herein. The methods of the present disclosure can conveniently be used to make changes in AMPK and / or modulate the activity of AMPK, for example, to introduce mutations that can lead to the activation of the AMPK protein and phosphorylation of the downstream targets, to reverse mutations that are involved in, orcause, an AMPK-associated disease or condition, thereby alleviating the symptoms of and / or treating the disease. This is a great advantage when used in treating an AMPK-associated disease, e.g., liver diseases, metabolic diseases, central nervous system (CNS) diseases, and / or cardiovascular diseases. Further, the guide oligonucleotides used in the methods of the present disclosure allow ease of delivery and avoid any immune response, e.g., associated with viral vectors. Moreover, editing of the existing mutant gene transcripts preserves the endogenous transcriptional control of the gene including cell type specificity, control by exogenous stimuli, and splice variation, that is not preserved by expression of the gene by an exogenously introduced vector.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0010] Accordingly, in one aspect, the disclosure provides a method of editing an AMPK polynucleotide encoding an AMPK protein. The method comprises contacting the AMPK polynucleotide with a guide oligonucleotide which effects an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, wherein the editing promotes activation of the AMPK protein and / or prevents ubiquitination and degradation of the AMPK protein, thereby editing the AMPK polynucleotide

[0011] In another aspect, the present disclosure provides a method of modulating activity of an AMPK protein, the method comprising contacting an AMPK polynucleotide encoding the AMPK protein with a guide oligonucleotide which effects an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, thereby modulating activity of the AMPK protein.

[0012] In one aspect, the present disclosure provides a method of promoting activation of an AMPK protein, the method comprising contacting an AMPK polynucleotide encoding the AMPK protein with a guide oligonucleotide which effects an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, thereby promoting activation of the AMPK protein.

[0013] In yet another aspect, the present disclosure provides a method of preventing ubiquitination and degradation of an AMPK protein, the method comprising contacting an AMPK polynucleotide encoding the AMPK protein with a guide oligonucleotide which effects an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, thereby preventing ubiquitination and degradation of the AMPK protein.

[0014] In some embodiments, the AMPK polynucleotide is contacted with the guide oligonucleotide in a cell. In some embodiments, the ADAR is endogenously expressed in the cell and / or is exogenously introduced into the cell for expression, e.g., via a viral vector, e.g., an AAV vector, or a non-viral delivery system. In some embodiments, the ADAR is a human ADAR. In some embodiments, the ADAR is human ADAR1. In some embodiments, the ADAR is the human ADAR1p110 isoform. In some embodiments, the ADAR is the human ADAR1p150 isoform. In other embodiments, the ADAR is human ADAR2.

[0015] In some embodiments, the cell is selected from a eukaryotic cell, a mammalian cell, and a human cell. In some embodiments, the contacting of the cell occurs in vivo. In other embodiments, the contacting of the cell occurs ex vivo.

[0016] In one aspect, the present disclosure provides a method of treating an AMPK-associated disease or condition in a subject in need thereof, the method comprising contacting an AMPK polynucleotide in a cell of the subject with a guide oligonucleotide which effects an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, thereby treating the AMPK-associated disease or condition.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0017] In some embodiments, the AMPK-associated disease or condition is selected from the group consisting of a metabolic disorder, type 2 diabetes, hyperglycemia, metabolic syndrome, obesity, hypercholesterolemia, nonalcoholic fatty liver disease, nonalcoholic steatohepatitis, hypertension, metabolic syndrome, chronic kidney disease, diabetic kidney disease, acute kidney injury, MASH-associated kidney disease, adrenoleukodystrophy, polycystic kidney disease, cirrhosis, hepatocellular carcinoma, diabetic nephropathy, diabetic retinopathy, diabetic neuropathy, eye disease, coronary artery disease, cancer, a central nervous system disease, a neurodegenerative disorder, Alzheimer's disease, Parkinson's disease, Lewy Body dementia, episodic cluster headache, migraine, pain, a mood disorder, anxiety, depression, affective disorder, schizophrenia, malaise, cognition disorder, addiction, autism, epilepsy autism, hepatic encephalopathy, scleroderma, inflammatory bowel disease, Crohn’s disease, ulcerative colitis, checkpoint inhibitor-induced colitis, psoriasis, celiac disease, enteritis, gastrointestinal injury, allergy, celiac sprue, childhood allergy, graft vs. host disease, irritable bowel syndrome, spontaneous bacterial peritonitis, ischemic colitis, sclerosing cholangitis, or a combination thereof.

[0018] In another aspect, the present disclosure provides a method of regulating energy homeostasis in a subject in need thereof, the method comprising contacting an AMPK polynucleotide in a cell of the subject with a guide oligonucleotide which effects an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, thereby regulating energy homeostasis.

[0019] In yet another aspect, the present disclosure provides a method of inhibiting synthesis of fatty acids and / or cholesterol, promoting fatty acid oxidation, and / or reducing accumulation of lipids in a subject in need thereof, the method comprising contacting an AMPK polynucleotide in a cell of the subject with a guide oligonucleotide which effects an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, thereby inhibiting synthesis of fatty acids and / or cholesterol, promoting fatty acid oxidation, and / or reducing accumulation of lipids.

[0020] In another aspect, the present disclosure provides a method of inhibiting gluconeogenesis and / or glycogen synthesis, promoting glucose uptake and / or glycolysis, improving insulin sensitivity, and / or reducing insulin resistance in a subject in need thereof, the method comprising contacting an AMPK polynucleotide in a cell of the subject with a guide oligonucleotide which effects an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, thereby inhibiting gluconeogenesis and / or glycogen synthesis, promoting glucose uptake and / or glycolysis, improving insulin sensitivity, and / or reducing insulin resistance.

[0021] In another aspect, the present disclosure provides a method of treating an AMPK- associated disease or condition in a subject in need thereof, the method comprising contacting the AMPK polynucleotide in a cell with a guide oligonucleotide which effects an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, and administering the cell to the subject, thereby treating the AMPK-associated disease or condition.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0022] In some embodiments, the AMPK-associated disease or condition is selected from the group consisting of a metabolic disorder, type 2 diabetes, hyperglycemia, metabolic syndrome, obesity, hypercholesterolemia, nonalcoholic fatty liver disease, nonalcoholic steatohepatitis, adrenoleukodystrophy, polycystic kidney disease, cirrhosis, hepatocellular carcinoma, hypertension, metabolic syndrome, chronic kidney disease, diabetic nephropathy, diabetic retinopathy, diabetic neuropathy, eye disease, coronary artery disease, cancer, a central nervous system disease, a neurodegenerative disorder, Alzheimer's disease, Parkinson's disease, Lewy Body dementia, episodic cluster headache, migraine, pain, a mood disorder, anxiety, depression, affective disorder, schizophrenia, malaise, cognition disorder, addiction, autism, epilepsy autism, hepatic encephalopathy, scleroderma, inflammatory bowel disease, Crohn's disease, ulcerative colitis, checkpoint inhibitor-induced colitis, psoriasis, celiac disease, enteritis, gastrointestinal injury, allergy, celiac sprue, childhood allergy, graft vs. host disease, irritable bowel syndrome, spontaneous bacterial peritonitis, ischemic colitis, sclerosing cholangitis, or a combination thereof.

[0023] In one aspect, the present disclosure provides a method of regulating energy homeostasis in a subject in need thereof, the method comprising contacting the AMPK polynucleotide in a cell with a guide oligonucleotide which effects an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, and administering the cell to the subject, thereby regulating energy homeostasis.

[0024] In another aspect, the present disclosure provides a method of inhibiting synthesis of fatty acids and / or cholesterol, promoting fatty acid oxidation, and / or reducing accumulation of lipids in a subject in need thereof, the method comprising contacting the AMPK polynucleotide in a cell with a guide oligonucleotide which effects an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, and administering the cell to the subject, thereby inhibiting synthesis of fatty acids and / or cholesterol, promoting fatty acid oxidation, and / or reducing accumulation of lipids.

[0025] In yet another aspect, the present disclosure provides a method of inhibiting gluconeogenesis and / or glycogen synthesis, promoting glucose uptake and / or glycolysis, improving insulin sensitivity, and / or reducing insulin resistance in a subject in need thereof, the method comprising contacting the AMPK polynucleotide in a cell with a guide oligonucleotide which effects an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, and administering the cell to the subject, thereby inhibiting gluconeogenesis and / or glycogen synthesis, promoting glucose uptake and / or glycolysis, improving insulin sensitivity, and / or reducing insulin resistance.

[0026] In some embodiments, the cell is autologous, allogenic, or xenogenic to the subject. In some embodiments, the subject is a human subject.

[0027] In some embodiments, the guide oligonucleotide comprises a nucleotide sequence complementary to the AMPK polynucleotide selected from the group consisting of SEQ ID Nos: 57-63.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0028] In some embodiments, the adenosine to inosine alteration substitutes a wild type amino acid in the AMPK protein. In some embodiments, the wild type amino acid in the AMPK protein is selected from the group consisting of aspartate 317 in AMPK γ1 subunit, histidine 151 in γ1 subunit, lysine 71 in AMPK α1 subunit, and / or lysine 60 in AMPK α2 subunit.

[0029] In some embodiments, the adenosine to inosine alteration substitutes a wild type aspartate at position 317 of the AMPK γ1 subunit with glycine.

[0030] In some embodiments, the adenosine to inosine alteration substitutes a wild type histidine at position 151 of the AMPK γ1 subunit with an arginine.

[0031] In some embodiments, the adenosine to inosine alteration substitutes a wild type lysine at position 71 of the AMPK α1 subunit with an arginine.

[0032] In some embodiments, the adenosine to inosine alteration substitutes a wild type lysine at position 60 of the AMPK α2 subunit with an arginine.

[0033] In some embodiments, the oligonucleotide further comprises one or more adenosine deaminase acting on RNA (ADAR)-recruiting domains.

[0034] In another aspect, the disclosure provides a method of repairing function of a pathogenic AMPK protein, the method comprising contacting an AMPK polynucleotide encoding the pathogenic AMPK protein with a guide oligonucleotide which effects an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, thereby repairing function of the pathogenic protein.

[0035] In some embodiments, the adenosine to inosine alteration substitutes the pathogenic amino acid with a wild type amino acid or a restored amino acid.

[0036] In some embodiments, the polynucleotide is contacted with the guide oligonucleotide in a cell. In some embodiments, the ADAR is endogenously expressed in the cell and / or is exogenously introduced into the cell for expression, e.g., via a viral vector, e.g., an AAV vector, or a non-viral delivery system. In some embodiments, the ADAR is a human ADAR. In some embodiments, the ADAR is human ADAR1. In some embodiments, the ADAR is the human ADAR1p110 isoform. In some embodiments, the ADAR is the human ADAR1p150 isoform. In other embodiments, the ADAR is human ADAR2.

[0037] In some embodiments, the cell is selected from a eukaryotic cell, a mammalian cell, and a human cell. In some embodiments, the contacting of the cell occurs in vivo. In other embodiments, the contacting of the cell occurs ex vivo.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0038] In one aspect, the present disclosure provides a method for treating an AMPK-associated disease or condition in a subject in need thereof, the method comprising contacting an AMPK polynucleotide encoding a pathogenic AMPK protein in a cell of the subject with a guide oligonucleotide which effects an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, thereby treating the AMPK- associated disease or condition.

[0039] In another aspect, the present disclosure provides a method of treating an AMPK- associated disease or condition in a subject in need thereof, the method comprising contacting the AMPK polynucleotide encoding a pathogenic AMPK protein in a cell with a guide oligonucleotide which effects an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, and administering the cell to the subject, thereby treating the AMPK-associated disease or condition.

[0040] In some embodiments, the guide oligonucleotide comprises a nucleotide sequence complementary to the AMPK polynucleotide encoding the pathogenic AMPK protein.

[0041] In some embodiments, the adenosine to inosine alteration substitutes the pathogenic amino acid with a wild type amino acid or a restored amino acid.

[0042] In some embodiments, wherein the cell is autologous, allogenic, or xenogenic to the subject.

[0043] In some embodiments, the AMPK-associated disease or condition is selected from the group consisting of a metabolic disorder, type 2 diabetes, hyperglycemia, metabolic syndrome, obesity, hypercholesterolemia, nonalcoholic fatty liver disease, nonalcoholic steatohepatitis, adrenoleukodystrophy, polycystic kidney disease, cirrhosis, hepatocellular carcinoma, hypertension, metabolic syndrome, chronic kidney disease, diabetic nephropathy, diabetic retinopathy, diabetic neuropathy, eye disease, coronary artery disease, cancer, a central nervous system disease, a neurodegenerative disorder, Alzheimer's disease, Parkinson's disease, Lewy Body dementia, episodic cluster headache, migraine, pain, a mood disorder, anxiety, depression, affective disorder, schizophrenia, malaise, cognition disorder, addiction, autism, epilepsy autism, hepatic encephalopathy, scleroderma, inflammatory bowel disease, Crohn's disease, ulcerative colitis, checkpoint inhibitor-induced colitis, psoriasis, celiac disease, enteritis, gastrointestinal injury, allergy, celiac sprue, childhood allergy, graft vs. host disease, irritable bowel syndrome, spontaneous bacterial peritonitis, ischemic colitis, sclerosing cholangitis, or a combination thereof.

[0044] In some embodiments, the subject is a human subject.

[0045] In some embodiments, the guide oligonucleotide comprises the structure:[Am]-X1-X2-X3-[Bn]wherein each of A and B is a nucleotide; m and n are each, independently, an integer from 1 to 50, or from 5 to 50, or from 3 to 40; X1, X2, and X3are each, independently, a nucleotide, wherein at least one of X1, X2, or X3is an alternative nucleotide.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0046] In other embodiments, the guide oligonucleotide comprises the structure:[Am]-X1-X2-X3-[Bn]wherein each of A and B is a nucleotide; m and n are each, independently, an integer from 1 to 50, or from 5 to 50, or from 3 to 40; X1, X2, and X3are each, independently, a nucleotide, wherein at least one of X1, X2, or X3has the structure of any one of Formula l-V:Formula I Formula II Formula III Formula IV Formula Vwherein N1is hydrogen or a nucleobase; R1is hydroxy, halogen, or C1-C6 alkoxy; R2is hydrogen, hydroxy, halogen, or C1-C6 alkoxy; R3is hydrogen, hydroxy, halogen, or C1-C6 alkoxy; R4is hydrogen, hydroxy, halogen, or C1-C6 alkoxy; and R5is hydrogen, hydroxy, halogen, or C1-C6 alkoxy. In some embodiments, R4is hydrogen and R5is not hydrogen or hydroxy, R5is hydrogen and R4is not hydrogen, or R6is hydroxy and R4is not hydrogen.

[0047] In some embodiments, at least 80% of the nucleotides of [Am] and / or [Bn] include a nucleobase, a sugar, and an internucleoside linkage. In some embodiments, at least 95% of the nucleotides of [Am] and / or [Bn] include a nucleobase, a sugar, and an internucleoside linkage.

[0048] In some embodiments, R1is hydroxy, halogen, or OCH3. In other embodiments, R2is hydrogen.

[0049] In some embodiments, at least one of X1, X2, or X3has the structure of Formula I, Formula II, or Formula V; and none of X1, X2, or X3has the structure of Formula IV or Formula III. In other embodiments, at least one of X1, X2, orX3has the structure of Formula I or Formula II; and none of X1, X2, or X3has the structure of Formula III, Formula IV, or Formula V.

[0050] In some embodiments, the halogen is fluoro.

[0051] In other embodiments, at least one of X1, X2, and X3has the structure of Formula I, wherein R1is fluoro, and N1is a nucleobase. In some embodiments, X1has the structure of Formula I, wherein R1is fluoro, and N1is a nucleobase. In other embodiments, X2has the structure of Formula I, wherein R1is fluoro and N1is a nucleobase. In some embodiments, X3has the structure of Formula I, wherein R1is fluoro and N1is a nucleobase. In other embodiments, at least one of X1, X2, and X3has the structure of Formula I, wherein R1is hydroxy and N1is a nucleobase. In some embodiments, X1has the structure of Formula I, wherein R1is hydroxy and N1is a nucleobase. In other embodiments, X2has the structure of Formula I, wherein R1is hydroxy and N1is a nucleobase. In some embodiments, X3has the structure of Formula I, wherein R1is hydroxy and N1is a nucleobase. In otherAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO embodiments, at least one of X1, X2, and X3has the structure of Formula I, wherein R1is methoxy and N1is a nucleobase. In some embodiments, X1has the structure of Formula I, wherein R1is methoxy and N1is a nucleobase; and each of X2and X3is a ribonucleotide. In other embodiments, X2has the structure of Formula I, wherein R1is methoxy and N1is a nucleobase. In some embodiments, X3has the structure of Formula I, wherein R1is methoxy and N1is a nucleobase. In other embodiments, at least one of X1, X2, and X3has the structure of Formula I, wherein R1is fluoro, hydroxy, or O-methyl, and N1is a nucleobase.

[0052] In some embodiments, at least one of X1, X2, and X3has the structure of Formula II, wherein R2is hydrogen and N1is a nucleobase. In some embodiments, X2has the structure of Formula II, wherein R2is hydrogen and N1is a nucleobase.

[0053] In some embodiments, when X1has the structure of any one of Formulas I to V, each of X2and X3is, independently, a ribonucleotide, a deoxyribonucleotide, a 2'-O-CI-C6 alkyl- nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2’- F-nucleotide, 2’-O-methoxyethy l-nucleotide, a constrained ethy l-nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X2has the structure of any one of Formulas I to V, each of X1and X3is, independently, a ribonucleotide, a deoxyribonucleotide, a 2'-O-Ci-Ce alkyl-nucleotide, a 2'-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2'-F-nucleotide, 2'-O-methoxyethyl-nucleotide, a constrained ethyl-nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X3has the structure of any one of Formulas I to V, each of X1and X2is, independently, a ribonucleotide, a deoxyribonucleotide, a 2'-O-Ci-Ce alkyl-nucleotide, a 2'- amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2'-F-nucleotide, 2'-O-methoxyethyl-nucleotide, a constrained ethyl-nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X1and X2each have the structure of any one of Formulas I to V, X3is a ribonucleotide, a deoxyribonucleotide, a 2'-O-CI-C6 alkyl-nucleotide, a2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2-F-nucleotide, 2’-O-methoxyethyl- nucleotide, a constrained ethyl-nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X1and X3each have the structure of any one of Formulas I to V, X2is a ribonucleotide, a deoxyribonucleotide, a 2'-O-Ci-Ce alkyl-nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl-nucleotide, a LNA-nucleotide, or a DNA-nucleotide; and when X2and X3each have the structure of any one of Formulas I to V, X1is a ribonucleotide, a deoxyribonucleotide, a 2'-O-Ci-C6 alkyl-nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2’-F-nucleotide, 2'-O-methoxyethyl-nucleotide, a constrained ethyl- nucleotide, a LNA-nucleotide, or a DNA-nucleotide.

[0054] In other embodiments, when X1has the structure of any one of Formulas I to V, each of X2and X3is, independently, a ribonucleotide, a deoxyribonucleotide, a 2’-F-nucleotide, 2’-O- methoxyethyl-nucleotide, or a DNA-nucleotide; when X2has the structure of any one of Formulas I to V, each of X1and X3is, independently, a ribonucleotide, a deoxyribonucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; when X3Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO has the structure of any one of Formulas I to V, each of X1and X2is, independently, a ribonucleotide, a 2’-F-nucleotide, a deoxyribonucleotide, 2'-O-methoxyethyl-nucleotide, or a DNA-nucleotide; when X1and X2each have the structure of any one of Formulas I to V, X3is a ribonucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; when X1and X3each have the structure of any one of Formulas I to V, X2is a ribonucleotide, a deoxyribonucleotide, a 2’-F- nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; and when X2and X3each have the structure of any one of Formulas I to V, X1is a ribonucleotide, a deoxyribonucleotide, a 2'-F-nucleotide, 2'-O-methoxyethyl-nucleotide, or a DNA-nucleotide.

[0055] In some embodiments, when X1has the structure of any one of Formulas I to V, each of X2and X3is a DNA nucleotide or a deoxyribonucleotide; when X2has the structure of any one of Formulas I to V, each of X1and X3is a DNA nucleotide or a deoxyribonucleotide; when X3has the structure of any one of Formulas I to V, each of X1and X2is a DNA nucleotide or a deoxyribonucleotide; when X1and X2each have the structure of any one of Formulas I to V, X3is a DNA nucleotide or a deoxyribonucleotide; when X1and X3each have the structure of any one of Formulas I to V, X2is a DNA nucleotide or a deoxyribonucleotide; and when X2and X3each have the structure of any one of Formulas I to V, X1is a DNA nucleotide or a deoxyribonucleotide.

[0056] In some embodiments, none of X1, X2, and X3has the structure of Formula II, wherein N1is a nucleobase. In other embodiments, none of X1, X2, and X3has the structure of Formula II, wherein N1is a cytosine nucleobase.

[0057] In some embodiments, X1comprises a uracil or thymine nucleobase In other embodiments, X1comprises a uracil nucleobase. In some embodiments, X1comprises a hypoxanthine nucleobase. In other embodiments, X1comprises a cytosine nucleobase.

[0058] In some embodiments, X3comprises a guanine nucleobase. In other embodiments, X3comprises a hypoxanthine nucleobase. In some embodiments, X3comprises an adenine nucleobase.

[0059] In some embodiments, X2comprises a cytosine or 5-methylcytosine nucleobase. In other embodiments, X2comprises a cytosine nucleobase. In some embodiments, X2has the structure of any one of Formula l-V. In other embodiments, X2is not a 2’-O-methyl-nucleotide.

[0060] In some embodiments, X1comprises a uracil or thymine nucleobase, X2comprises a cytosine nucleobase, and X3comprises a hypoxanthine nucleobase.

[0061] In some embodiments, X1, X2, and X3are not 2'-O-methyl-nucleotides.

[0062] In some embodiments, the guide oligonucleotide comprises the structure:[Am]-X1-X2-X3-[Bn]wherein each of A and B is a nucleotide; m and n are each, independently, an integer from 1 to 50 or from 5 to 50, orAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO from 3 to 40; X1, X2, and X3are each, independently, a nucleotide, wherein at least one of X1, X2, and X3has the structure of any one of Formula XII- XV:Formula XII Formula XIII Formula XIV Formula XV wherein N1is hydrogen or a nucleobase; R6is hydrogen, hydroxy, or halogen; R7is hydrogen, hydroxy, halogen, or C1-C6 alkoxy; R8is hydrogen or halogen; R9is hydrogen or hydroxy, halogen, or C1-C6 alkoxy; R10Is hydrogen or halogen; and R11is hydrogen or hydroxy, halogen, orCi-C6 alkoxy.

[0063] In some embodiments, at least 80% of the nucleotides of [Am] and / or [Bn] include a nucleobase, a sugar, and an internucleoside linkage. In some embodiments, at least 95% of the nucleotides of [Am] and / or [Bn] include a nucleobase, a sugar, and an internucleoside linkage.

[0064] In some embodiments, halogen is fluoro.

[0065] In some embodiments, C1-C6 alkoxy is OCH3.

[0066] In some embodiments, at least one ofX1, X2, and X3has the structure of Formula XIII, in which each of R8and R9is hydrogen. In some embodiments, X1has the structure of Formula XIII, in which each of R8and R9is hydrogen. In other embodiments, X2has the structure of Formula XIII, in which each of R8and R9is hydrogen. In some embodiments, X2has the structure of any one of Formula XII-XV.

[0067] In some embodiments, when X1has the structure of any one of Formulas XII-XV, each of X2and X3is, independently, a ribonucleotide, a deoxyribonucleotide, a 2'-O-Ci-Ce alkyl- nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2'- F-nucleotide, 2'-O-methoxyethyl-nucleotide, a constrained ethyl-nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X2has the structure of any one of Formulas XII-XV, each of X1and X3is, independently, a ribonucleotide, a deoxyribonucleotide, a 2'-O-CI-C6 alkyl-nucleotide, a 2'-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2'-F-nucleotide, 2'-O-methoxyethyl-nucleotide, a constrained ethyl-nucleotide, a LNA-nucleotide, or a DNA- nucleotide; when X3has the structure of any one of Formulas XII-XV, each of X1and X2is, independently, a ribonucleotide, a deoxyribonucleotide, a2'-O-Ci-Ce alkyl-nucleotide, a 2’- amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl-nucleotide, a LNA-nucleotide, or a DNA- nucleotide; when X1and X2each have the structure of any one of Formulas XII-XV, X3is a ribonucleotide, a deoxyribonucleotide, a 2'-O-Ci-Ce alkyl-nucleotide, a2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2’-F-nucleotide, 2'-Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO O-methoxyethyl-nucleotide, a constrained ethyl-nucleotide, a LNA-nucleotide, or a DNA-nucleotide; when X1and X3each have the structure of any one of Formulas XII-XV, X2is a ribonucleotide, a deoxyribonucleotide, a 2'-O-Ci-Ce alkyl-nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl-nucleotide, a LNA-nucleotide, or a DNA-nucleotide; and when X2and X3each have the structure of any one of Formulas XII-XV, X1is a ribonucleotide, a deoxyribonucleotide, a 2'-O-Ci-Ce alkyl-nucleotide, a 2’-amino-nucleotide, an arabinonucleic acid-nucleotide, a bicyclic-nucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, a constrained ethyl- nucleotide, a LNA-nucleotide, or a DNA-nucleotide.

[0068] In other embodiments, when X1has the structure of any one of Formulas XII-XV, each of X2and X3is, independently, a ribonucleotide, a deoxyribonucleotide, a 2’-F-nucleotide, 2’-O- methoxyethyl-nucleotide, or a DNA-nucleotide; when X2has the structure of any one of Formulas XII-XV, each of X1and X3is, independently, a ribonucleotide, a deoxyribonucleotide, a 2’-F-nucleotide, 2'-O-methoxyethyl-nucleotide, or a DNA-nucleotide; when X3has the structure of any one of Formulas XII-XV, each of X1and X2is, independently, a ribonucleotide, a deoxyribonucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; when X1and X2each have the structure of any one of Formulas XII-XV, X3is a ribonucleotide, a deoxyribonucleotide, a 2’-F-nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; when X1and X3each have the structure of any one of Formulas XII-XV, X2is a ribonucleotide, a 2'-F-nucleotide, 2’-O-methoxyethyl-nucleotide, or a DNA-nucleotide; and when X2and X3each have the structure of any one of Formulas XII-XV, X1is a ribonucleotide, a deoxyribonucleotide, a 2'-F-nucleotide, 2'-O-methoxyethyl-nucleotide, or a DNA-nucleotide.

[0069] In some embodiments, when X1has the structure of any one of Formulas XII-XV, each of X2and X3is a ribonucleotide; when X2has the structure of any one of Formulas XII-XV, each of X1and X3is a ribonucleotide; when X3has the structure of any one of Formulas XII-XV, each of X1and X2is a ribonucleotide; when X1and X2each have the structure of any one of Formulas XII-XV, X3is a ribonucleotide; when X1and X3each have the structure of any one of Formulas XII-XV, X2is a ribonucleotide; and when X2and X3each have the structure of any one of Formulas XII-XV, X1is a ribonucleotide.

[0070] In some embodiments, when X1has the structure of any one of Formulas XII-XV, each of X2and X3is a DNA nucleotide or a deoxyribonucleotide; when X2has the structure of any one of Formulas XII-XV, each of X1and X3is a DNA nucleotide or a deoxyribonucleotide; when X3has the structure of any one of Formulas XII-XV, each of X1and X2is a DNA nucleotide or a deoxyribonucleotide; when X1and X2each have the structure of any one of Formulas XII-XV, X3is a DNA nucleotide or a deoxyribonucleotide; when X1and X3each have the structure of any one of Formulas XII-XV, X2is a DNA nucleotide or a deoxyribonucleotide; and when X2and X3each have the structure of any one of Formulas XII-XV, X1is a DNA nucleotide or a deoxyribonucleotide.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0071] In some embodiments, X1includes a hypoxanthine nucleobase. In other embodiments, X1includes a uracil nucleobase. In some embodiments, X1includes a cytosine nucleobase. In other embodiments, X3includes a hypoxanthine nucleobase. In some embodiments, X3includes an adenine nucleobase. In other embodiments, X2includes a cytosine nucleobase. In some embodiments, X2includes a uracil nucleobase. In other embodiments, X2does not include a nucleobase. In some embodiments, X2is not a 2'-O-methyl-nucleotide. In other embodiments, X1, X2, and X3are not 2’-O-methyl-nucleotides.

[0072] In some embodiments, [Am] comprises at least one nuclease resistant nucleotide. In other embodiments, [Am] comprises at least one 2'-O-Ci-Ce al ky l-nucleotide, at least one 2'-amino- nucleotide, at least one arabino nucleic acid-nucleotide, at least one bicycl ic-nucleotide, at least one 2'-F-nucleotide, at least one 2'-O-methoxyethyl-nucleotide, at least one constrained ethyl (cEt)-nucleotide, at least one LNA-nucleotide, and / or at least one DNA-nucleotide. In some embodiments, [Am] comprises at least one 2’-O-methyl-nucleotide, at least one 2'-F-nucleotide, at least one 2’-O-methoxyethyl-nucleotide, at least one cEt-nucleotide, at least one LNA-nucleotide, and / or at least one DNA-nucleotide. In other embodiments, [Am] comprises at least five terminal 2'-O-methyl-nucleotides. In some embodiments, [Am] comprises at least one phosphorothioate linkage. In other embodiments, [Am] comprises at least four terminal phosphorothioate linkages. In some embodiments, at least one phosphorothioate linkage is stereopure.

[0073] In some embodiments, [Bn] comprises at least one nuclease resistant nucleotide. In other embodiments, [Bn] comprises at least one at least one 2'-O-CI-C6 alkyl-nucleotide, at least one 2’-amino-nucleotide, at least one arabino nucleic acid-nucleotide, at least one bicyclic-nucleotide, at least one 2’-F-nucleotide, at least one 2’-O-methoxyethyl-nucleotide, at least one cEt-nucleotide, at least one LNA-nucleotide, and / or at least one DNA-nucleotide. In some embodiments, [Bn] comprises at least one 2'-O-methyl-nucleotide, at least one 2'-F-nucleotide, at least one 2'-O-methoxyethyl-nucleotide, at least one cEt-nucleotide, at least one LNA-nucleotide, and / or at least one DNA-nucleotide. In other embodiments, [Bn] comprises at least three terminal 2'-O-methyl-nucleotides. In some embodiments, [Bn] comprises at least one phosphorothioate linkage. In other embodiments, [Bn] comprises at least four terminal phosphorothioate linkages. In some embodiments, at least one phosphorothioate linkage is stereopure.

[0074] In some embodiments, [Am] and [Bn] each comprises at least one phosphorothioate linkage. In some embodiments, [Am] and [Bn] each comprises at least one 2’-O-methyl-nucleotide, at least one 2'-F-nucleotide, at least one 2'-O-methoxyethyl-nucleotide, at least one cEt-nucleotide, at least one LNA-nucleotide, and / or at least one DNA-nucleotide.

[0075] In some embodiments, at least 20% of the nucleotides of [Am] and [Bn] combined are 2'- O-methyl-nucleotides.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0076] In some embodiments, the oligonucleotide further comprises a 5’-cap structure. In other embodiments, the oligonucleotide comprises at least one alternative nucleobase. In some embodiments, the 5'-terminal nucleotide is a 2’-amino-nucleotide.

[0077] In other embodiments, A and B combined consist of 18 to 200, 18 to 150, or 18 to 100 nucleotides. In some embodiments, A and B combined consist of 22 to 82 nucleotides.

[0078] In some embodiments, m is 3 to 100, 3 to 90, 3to 80, 3 to 70, 3 to 60, 3 to 50, 3 to 40, 3 to 30, 3 to 25, or 3 to 20. In other embodiments, n is 3 to 100, 3 to 90, 3 to 80, 3 to 70, 3 to 60, 3 to 50, 3 to 40, 3 to 30, 3 to 25, or 3 to 20. In some embodiments, m is an integer from 3-50 or from 5-40. In some embodiments, n is an integer from 3-50 or from 5-40. In some embodiments, m and n are each, independently, an integer from 3-50, or from 5-40.

[0079] In some embodiments, m and n are each, independently, an integer from 3 to 100, from 3 to 40, or from 3 to 25; at least one of X1, X2, and X3has the structure of Formula I, wherein R1is fluoro, hydroxy, or methoxy and N1is a nucleobase, or the structure of Formula V, wherein R4is hydrogen and R6is hydrogen; each of X1, X2, and X3that does not have the structure of Formula I or Formula V is a ribonucleotide; [Am] and [Bn] each comprise at least five terminal 2’-O- methyl-nucleotides and at least four terminal phosphorothioate linkages; and at least 20% of the nucleotides of [Am] and [Bn] combined are 2’-O-methyl-nucleotides.

[0080] In some embodiments, m and n are each, independently, an integer from 3 to 100, from 3 to 40, or from 3 to 25; at least one of X1, X2, and X3has the structure of Formula I, wherein R1is fluoro, hydroxy, or O-methyl and N1is a nucleobase, each of X1, X2, and X3that does not have the structure of Formula I is a DNA nucleotide or a deoxyribonucleotide; [Am] and [Bn] each include at least five terminal 2’-O-methyl-nucleotides; at least four terminal phosphorothioate linkages, and at least 20% of the nucleotides of [Am] and [Bn] combined are 2’-O-methyl-nucleotides.

[0081] In some embodiments, m and n are each, independently, an integer from 3 to 100, from 3 to 40, or from 3 to 25; at least one of X1, X2, and X3has the structure of Formula II, wherein R2is hydroxy, fluoro, or methoxy and N1is a nucleobase; each of X1, X2, and X3that does not have the structure of Formula II is a DNA nucleotide or a deoxyribonucleotide; [Am] and [Bn] each include at least five terminal 2'-O-methyl-nucleotides; at least four terminal phosphorothioate linkages, and at least 20% of the nucleotides of [Am] and [Bn] combined are 2'-O-methyl-nucleotides.

[0082] In some embodiments, m and n are each, independently, an integer from 3 to 100, from 3 to 40, or from 3 to 25; at least of X1, X2, and X3has the structure of Formula XIII, wherein R8and R9are each hydrogen, and each of X1, X2and X3that does not have the structure of Formula XIII is a DNA nucleotide or a deoxyribonucleotide; [Am] and [Bn] each include at least five terminal 2’-O-methyl-nucleotides and at least four terminal phosphorothioate linkages; and at least 20% of the nucleotides of [Am] and [Bn] combined are 2'-O-methyl-nucleotides.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0083] In another aspect, the present disclosure provides a guide oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration of an AMPK polynucleotide encoding an AMPK protein.

[0084] In some embodiments, the adenosine to inosine alteration promotes activation of the AMPK protein and / or phosphorylation of a downstream target of AMPK.

[0085] In some embodiments, the adenosine to inosine alteration prevents ubiquitination and / or degradation of the activated AMPK.

[0086] In some embodiments, the guide oligonucleotide comprises a nucleotide sequence complementary to the AMPK polynucleotide selected from the group consisting of SEQ ID Nos: 57-63.

[0087] In some embodiments, the adenosine to inosine alteration substitutes a wild type amino acid in the AMPK protein. In some embodiments, the wild type amino acid in the AMPK protein is selected from the group consisting of aspartate 317 in AMPK y1 subunit, histidine 151 in y1 subunit, lysine 71 in AMPK a1 subunit, and / or lysine 60 in AMPK oc2 subunit.

[0088] In some embodiments, the adenosine to inosine alteration substitutes a wild type aspartate at position 317 of the AMPK y1 subunit with a glycine.

[0089] In some embodiments, the adenosine to inosine alteration substitutes a wild type histidine at position 151 of the AMPK yl subunit with an arginine.

[0090] In some embodiments, the adenosine to inosine alteration substitutes a wild type lysine at position 71 of the AMPK a1 subunit with an arginine.

[0091] In some embodiments, the adenosine to inosine alteration substitutes a wild type lysine at position 60 of the AMPK a2 subunit with an arginine.

[0092] In some embodiments, the adenosine to inosine alteration substitutes a pathogenic amino acid with a wild type amino acid or with a restored amino acid.

[0093] In some embodiments, the guide oligonucleotide is suitable for administration to a subject, and / or for delivery into a cell In some embodiments, the oligonucleotide is administered to the subject by intrathecal administration, by intravitreal administration, by intravenous administration, or by subcutaneous administration.

[0094] In some embodiments, administration of the guide oligonucleotides to the subject regulates energy homeostatis, inhibits synthesis of fatty acids and / or cholesterol, promotes fatty acid oxidation, reduces accumulation of lipids, inhibits gluconeogenesis and / or glycogen synthesis, promotes glucose uptake and / or glycolysis, improves insulin sensitivity, reduces insulin resistance, and / or treat an AMPK-associated disease or condition in the subject.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0095] In some embodiments, the guide oligonucleotide comprises any one of the chemical structures as described above and herein.

[0096] In another aspect, the disclosure provides a kit comprising the guide oligonucleotide of the disclosure, and instructions for use.

[0097] In one aspect, the present disclosure provides a nucleic acid molecule, e.g., a DNA molecule, or an RNA molecule, encoding an AMPK protein comprising a glycine at position 317 of the AMPK yl subunit, wherein the AMPK protein optionally further comprises an arginine at position 151 in AMPK yl subunit, an arginine at position 71 in AMPK a1 subunit, and / or an arginine at position 60 in AMPK a2 subunit.

[0098] In another aspect, the present disclosure provides a vector comprising a nucleic acid molecule encoding an AMPK protein, wherein the AMPK protein comprises a glycine at position 317 of the AMPK y1 subunit, wherein the AMPK protein optionally further comprises an arginine at position 151 in AMPK yl subunit, an arginine at position 71 in AMPK a1 subunit, and / or an arginine at position 60 in AMPK o2 subunit.

[0099] In some embodiments, the vector is a viral vector. In other embodiments, the vector is a non-viral vector. In some embodiments, the viral vector is selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a lentiviral vector, a herpes simplex viral vector, a parvoviral vector, a papillomavirus vector, a vaccinia viral vector, or a hybrid or chimeric vector thereof.

[0100] In another aspect, the present disclosure provides an isolated cell comprising a nucleic acid molecule encoding an AMPK protein comprising a glycine at position 317 of the AMPK y1 subunit wherein the AMPK protein optionally further comprises an arginine at position 151 in AMPK yl subunit, an arginine at position 71 in AMPK a1 subunit, and / or an arginine at position 60 in AMPK a2 subunit.

[0101] In another aspect, the disclosure provides an AMPK protein comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 64-67, or 69-81. In some embodiments, the AMPK protein comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the amino acid sequence of SEQ ID NO: 64- 67, or 69-81, or a portion thereof.

[0102] In another aspect, the disclosure provides a composition comprising an AMPK protein, wherein the AMPK protein comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 64-67, or 69-81.

[0103] In another aspect, the disclosure provides a composition or a pharmaceutical composition comprising the isolated nucleic acid molecule of the disclosure, the vector of the disclosure, or the isolated cell of the disclosure. In some embodiments, the cells further comprise a nucleic acid molecule encoding an ADAR, or a vector comprising a nucleic acid molecule encoding an ADAR.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0104] In another aspect, the disclosure provides a kit comprising the isolated nucleic acid molecule of the disclosure, the vector of the disclosure, or the isolated cell of the disclosure, and instructions for use. In some embodiments, the kits further comprise a nucleic acid molecule encoding an ADAR, or a vector comprising a nucleic acid molecule encoding an ADAR.BRIEF DESCRIPTION OF THE DRAWINGS

[0105] FIG. 1 shows a bar graph depicting the phosphorylation levels of AMPK in Hep3B cells transfected with wild type AMPKγ1 and variant (D317G) constructs.

[0106] FIG. 2 shows a bar graph depicting the phosphorylation levels of an AMPK downstream target (acetyl-CoA carboxylase, ACC) in Hep3B cells transfected with wild type AMPKγ1 and variant (D317G) constructs.DETAILED DESCRIPTION

[0107] The present disclosure provides mutant AMPK proteins comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 64-67 or 69-81.

[0108] The present disclosure also provides methods of editing an AMPK polynucleotide encoding an AMPK protein, methods for modulating activity of an AMPK protein, methods for promoting activation of an AMPK protein, methods for regulating energy homeostasis, and methods for treating or preventing an AMPK-associated disease or condition, e.g., metabolic diseases, liver diseases, central nervous system (CNS) diseases, and / or cardiovascular diseases, in a subject using a guide oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration in the target AMPK gene.

[0109] The present disclosure also provides methods for site specific editing of AMPK in a cell, without the need to transduce or transfect the cell with genetically engineered editing enzymes. The design of the guide oligonucleotides of the present disclosure allows the recruitment of the ADAR enzyme, to the specific editing sites disclosed herein. The methods of the present disclosure can conveniently be used to make changes in AMPK and / or modulate the activity of AMPK, for example to introduce mutations that can lead to the activation of the AMPK protein and phosphorylation of the downstream targets, to reverse mutations that are involved in, or cause, an AMPK-associated disease or condition, thereby alleviating the symptoms of and / or treating the disease. This is a great advantage when used in treating an AMPK-associated disease, e.g., liver diseases, metabolic diseases, central nervous system (CNS) diseases, and / or cardiovascular diseases. Further, the guide oligonucleotides used in the methods of the present disclosure allow ease of delivery and avoid any immune response. Moreover, editing of the existing mutant gene preserves the endogenous transcriptional control of the gene including cell type specificity, control by exogenous stimuli, and splice variation, that is not preserved by expression of the gene by an exogenously introduced vector.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0110] The following detailed description discloses methods for editing an AMPK polynucleotide using a guide oligonucleotide capable of effecting an ADAR-mediated adenosine to inosine alteration in an AMPK gene, how to make and use compositions containing the guide oligonucleotides capable of effecting an ADAR-mediated adenosine to inosine alteration in an AMPK gene, as well as AMPK guide oligonucleotide compositions, uses, and methods for treating subjects having an AMPK-associated disease or condition that would benefit from editing the sequence of an AMPK gene.

[0111] Definitions:

[0112] In order that the present disclosure may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this disclosure.

[0113] The articles "a” and “an” are used herein to refer to one or to more than one ( / .e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements.

[0114] The term “including” is used herein to mean, and is used interchangeably with, the phrase “including, but not limited to”.

[0115] The term “or” is used herein to mean, and is used interchangeably with, the term “and / or,” unless context clearly indicates otherwise.

[0116] The term “about” is used herein to mean within the typical ranges of tolerances in the art, e.g., acceptable variation in time between doses, acceptable variation in dosage unit amount. For example, “about” can be understood as within about 2 standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range.

[0117] The term “at least" prior to a number or series of numbers is understood to include the number adjacent to the term "at least", and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a 21 -nucleotide nucleic acid molecule" means that 18, 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that "at least" can modify each of the numbers in the series or range.

[0118] As used herein, “central triplet" or the “triplet” is understood as the three nucleotides opposite the target adenosine in the target RNA, wherein the middle nucleotide in the central triplet is directly opposite the target adenosine. The central triplet does not have to be in the middle (in the center) of the guide oligonucleotide, it may beAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO located more to the 3' as well as to the 5' end of the guide oligonucleotide, whatever is preferred for a certain target. Central in this aspect has therefore more the meaning of the triplet that is in the center of catalytic activity when it comes to chemical modifications and targeting the target adenosine. It should also be noted that the guide oligonucleotides are sometimes depicted from 3' to 5', especially when the target sequence is shown from 5' to 3'. However, whenever herein the order of nucleotides within the guide oligonucleotide is discussed it is always from 5' to 3' of the guide oligonucleotide. The position can also be expressed in terms of a particular nucleotide within the guide oligonucleotide while still adhering to the 5' to 3' directionality, in which case other nucleotides 5' of the said nucleotide are marked as negative positions and those 3' of it as positive positions. For example, the C in the Central triplet is the nucleotide (at the 0 position) opposite the targeted adenosine and the U would in this case be the -1 nucleotide and the G would then be the +1 nucleotide, etc. In one embodiment, the central triplet comprises the nucleotide sequence UCG, wherein C is at the 0 position.

[0119] As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, an oligonucleotide with “no more than 5 unmodified nucleotides” has 5, 4, 3, 2, 1, or 0 unmodified nucleotides. When “no more than” is present before a series of numbers or a range, it is understood that “no more than” can modify each of the numbers in the series or range.

[0120] As used herein, “adenosine monophosphate (AMP)-activated protein kinase (AMPK)” refers to the well-known genes and proteins or protein subunits. AMPK is also known as acetyl- coA carboxylase kinase and hydroxymethylgl utary l-coA reductase kinase. AMPK is a highly conserved heterotrimeric serine / threonine kinase which serves as a eukaryotic cellular energy sensor, and plays a vital role in the coordination of cell growth, metabolism, and energy homeostasis (Hardie, etal., Nat Rev Mol Cell Biol, 2012. 13(4): p. 251–262). AMPK is comprised of an alpha (a) catalytic subunit in a molecular complex with a beta (p) scaffolding subunit and a gamma (y) regulatory subunit. Each of the subunits has two or three isoforms (a1 and a2, p1 and p2, y1, y2 and y3) that are encoded by different genes. As used herein, the terms “an AMPK polypeptide”, or “an AMPK protein” refer to either the AMPK heterotrimer, or the individual subunits of the AMPK heterotrimer, i.e., the AMPK a subunit, the AMPK p subunit, and the AMPK y subunit, and their corresponding isoforms, i.e., the a1 and a2 isoforms, the pi and 2 isoforms, and the y1, y2 and y3 subunits. The terms “an AMPK polynucleotide”, “an AMPK mRNA sequence”, or “an AMPK gene” refer to the genes that encode the individual subunits and their isoforms of the AMPK heterotrimer, i.e., the PRKAA1 gene, the PRKAA2 gene, the PRKAB1 gene, the PRKAB2 gene, the PRKAG1 gene, the PRKAG2 gene, and / or the PRKAG3 gene.

[0121] Activation of AMPK involves phosphorylation of a conserved threonine residue (Thr172) located within the catalytic core of the AMPK a subunit. Upon binding to the AMPK y subunit, AMP can promote phosphorylation at Thr172, allosterically increase activity of the phosphorylated AMPK, and protect AMPK from dephosphorylation byAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO protein phosphatases. Once activated, AMPK induces a signaling cascade that works to boost ATP levels back to homeostasis levels.

[0122] AMPK, as a significant metabolic regulatory component, can reflect the stress state of cells when the body is under oxidative stress and energy deficiency, and subsequently control the target proteins via phosphorylation. Maintenance of energy homeostasis and the execution of adaptive responses during periods of low nutrients are critical functions of all cells. In general, AMPK is activated in response to energy stress and restores energy balance by inhibiting anabolic processes that consume ATP, while promoting catabolic processes that generate ATP Moreover, the activity of AMPK is extensively regulated by multiple upstream signals, thus making AMPK a central node exploited by cells to coordinate their metabolism with specific energy demands. Previous studies have confirmed that after AMPK was activated, it could regulate cell lipid metabolism by phosphorylating a series of metabolic proteins that affect fatty acid, cholesterol synthesis and fatty acid oxidation. For instance, AMPK inhibited the activity of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) through phosphorylation, which plays a key role in regulating cholesterol synthesis. At the same time, AMPK can also phosphorylate hormone-sensitive lipase (HSL) to increase its activity, thereby promoting the hydrolysis of fatty acylglycerol and cholesterol lipids. In addition, it was discovered that activated AMPK can phosphorylate acetyl-CoA carboxylase (ACC) and inactivate it, preventing ACC dimerization and, as a result, reducing fatty acid synthesis and increasing fatty acid oxidation. AMPK can phosphorylate the expression of downstream key target proteins, reduce lipid accumulation, promote fatty acid oxidation, and inhibit the synthesis of cholesterol and fatty acids. AMPK also has functions as a regulator of proliferative signals such as mammalian target of rapamycin (mTOR), tuberous sclerosis complex (TSC), ribosomal protein S6 kinase (p70S6) and elongation factor-2, indicating that cancer cell proliferation can be modified via modulating the signaling network through AMPK (Lee etal., Oncol. Rep. 2010, 24, 1471-1477). In addition, researchers have shown that liver-specific activation of AMPK is sufficient to protect against hepatic triglyceride accumulation, a hallmark of non-alcoholic fatty liver disease (Woods, et al., Cell Reports, 2017, 18, 3043-3051). Furthermore, the AMPK activators AICAR (the prodrug of ZMP) and A-769662 have been shown to decrease blood sugar levels in mouse models of diabetes (Carling, et al., Biochem J. 2012, 445, 11-27; Cool, et al., Cell Metab.2006, 3: 403-416). As such, pharmacologic AMPK modulation, e.g., activation of AMPK, provides a highly attractive and wildly studied therapeutic option for multiple disorders.

[0123] The a1 subunit of AMPK is encoded by the PRKAA1 gene. The sequence of a human PRKAA1 mRNA transcript can be found at National Center for Biotechnology Information (NCBI) RefSeq accession number NM_006251.6 (SEQ ID NO.: 57).

[0124] The a2 subuit of AMPK is encoded by the PRKAA2 gene. The sequence of a human PRKAA2 mRNA transcript can be found at National Center for Biotechnology Information (NCBI) RefSeq accession number NM_006252.4 (SEQ ID NO.: 58).Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0125] The β1 subuit of AMPK is encoded by the PRKAB1 gene. The sequence of a human PRKAB1 mRNA transcript can be found at National Center for Biotechnology Information (NCBI) RefSeq accession number NM_006253.5 (SEQ ID NO.: 59).

[0126] The β2 subuit of AMPK is encoded by the PRKAB2 gene. The sequence of a human PRKAB2 mRNA transcript can be found at National Center for Biotechnology Information (NCBI) RefSeq accession number NM_005399.5 (SEQ ID NO.: 60).

[0127] The γ1 subuit of AMPK is encoded by the PRKAG1 gene. The sequence of a human PRKAG1 mRNA transcript can be found at National Center for Biotechnology Information (NCBI) RefSeq accession number NM_002733.5 (SEQ ID NO.: 61).

[0128] The γ2 subuit of AMPK is encoded by the PRKAG2 gene. The sequence of a human PRKAG2 mRNA transcript can be found at National Center for Biotechnology Information (NCBI) RefSeq accession number NM_016203.4 (SEQ ID NO.: 62).

[0129] The γ3 subuit of AMPK is encoded by the PRKAG3 gene. The sequence of a human PRKAG3 mRNA transcript can be found at National Center for Biotechnology Information (NCBI) RefSeq accession number NM_017431.4 (SEQ ID NO.: 63).

[0130] Additional examples of AMPK mRNA sequences are readily available using publicly available databases, e.g., GenBank, UniProt, and OMIM.

[0131] As used herein, the term "energy homeostasis" refers to a biological process by which the cells balance energy intake / production (e.g., energy absorbed and maintained by the body) and expenditure (e.g., energy used in cellular metabolism or lost from excretory routes).

[0132] As used herein, the term “AMPK-associated disease or condition”, or “AMPK-associated disorder” is intended to include any disease, disorder, or condition associated with the AMPK genes or proteins or protein subunits, and / or its activities as described herein. Such a disease may be caused, for example, by AMPK gene mutations, by inactivation of the AMPK protein, by abnormal phosphorylation, acetylation, and / or ubiquitination of the AMPK protein, by a lack of production or activity of the AMPK protein, by abnormal cleavage of the AMPK protein, by instability of AMPK, by abnormal interactions between AMPK and other proteins or other endogenous or exogenous substances.

[0133] Exemplary AMPK-associated diseases include, but are not limited to, a metabolic disorder, type 2 diabetes, hyperglycemia, metabolic syndrome, obesity, hypercholesterolemia, liver disease, non-alcoholic fatty liver disease, nonalcoholic steatohepatitis, adrenoleukodystrophy, polycystic kidney disease, cirrhosis, hepatocellular carcinoma, hypertension, metabolic syndrome, chronic kidney disease, diabetic nephropathy, diabetic retinopathy, diabeticAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO neuropathy, eye disease, coronary artery disease, cancer, a central nervous system disease, a neurodegenative disorder, Alzheimer's disease, Parkinson's disease, Lewy Body dementia, episodic cluster headache, migraine, pain, a mood disorder, anxiety, depression, affective disorder, schizophrenia, malaise, cognition disorder, addiction, autism, epilepsy autism, hepatic encephalopathy, scleroderma, inflammatory bowel disease, Crohn's disease, ulcerative colitis, checkpoint inhibitor-induced colitis, psoriasis, celiac disease, enteritis, gastrointestinal injury, allergy, celiac sprue, childhood allergy, graft vs. host disease, irritable bowel syndrome, spontaneous bacterial peritonitis, ischemic colitis, sclerosing cholangitis, or a combination thereof.

[0134] In some embodiments, the AMPK-associated disease is type 2 diabetes mellitus. Type 2diabetes mellitus is a metabolic disorder characterized by pancreatic β cell dysfunction, hyperglycemia, and insulin resistance, resulting in glucose and lipid metabolism deregulation. The therapeutic potential of activating AMPK to treat type 2 diabetes mellitus was suggested when it was discovered that physical exercise activated AMPK in skeletal muscle, which led to increase glucose uptake. Activation of AMPK stimulates glucose transporter type 4 (GLUT4) translocation to the plasma membrane to actively promote increased glucose uptake in skeletal muscle, enabling ATP production through glycolysis (Hunter et al., Diabetes, 201, 60, 766-775).

[0135] In some embodiments, the AMPK-associated disease is a liver disease. Liver plays a key role in the maintenance of glucose homeostasis by modulating hepatic glucose during periods of fasting and feeding.Researchers have shown that AMPK signal axes are involved in the prevention and reduction of liver injury.Upregulation of AMK can alleviate fatty liver disease in mice induced by alcohol or insulin resistance, type 2 diabetes, and obesity, and most natural AMPK agonists can regulate lipid metabolism, inflammation, and oxidative stress in hepatocytes, consequently regulating fatty liver disease in mice. Non-alcoholic steatohepatitis (NASH) is the most severe form of non-alcoholic fatty liver disease (NAFLD), which is tightly linked to overnutrition and obesity. Hepatic cell death, including apoptosis, is an important driver of NASH pathology. NASH-associated hepatocyte apoptosis was shown to be inhibited by AMPK. AMPK downregulation was also associated with NAFLD. Mice on NASH-inducing diets had reduced AMPK activity. Furthermore, generation of liver-specific AMPK knock-out mice demonstrated that loss of AMPK exaggerates diet-induced NASH pathology, including increased liver damage, fibrosis and cell death (Zhao, P. et al. Science 367, 652-660 (2020); Herzig, S. & Shaw, R. J. Nat. Rev. Mol. Cell Biol.19, 121-135 (2018)).

[0136] In some embodiments, the AMPK-associated disease is a central nervous system disorder e.g., a neurodegeneative disorder. Neurodegenerative diseases are characterized by progressive degeneration of nerve cells that eventually leads to dementia, such as, Alzheimer's (AD), Parkinson's (PD), Huntington's (HD) and amyotrophic lateral sclerosis (ALS) can be found. Although they affect different neural populations, they share several characteristics in common. For example, they are characterized by the presence of proteins aggregates in degenerating neurons. In the brain, AMPK acts as a multifunctional metabolic sensor and, depending on the type ofAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO stress, cell type and duration of exposure, has a dual role in regulating cell death and survival: its activation incites cell death, while its inhibition produces a protective effect in different models exposed to different stressors (Lee, et al. Oncol. Rep. 2010, 24, 1471-1477). AMPK is highly expressed in neurons, and is vital for neuronal survival and genetic ablation of AMPK subunits demonstrating that its genetic ablation induces progressive neurodegeneration (Tschäpe, etal. EMBO J.. 2002, 21, 6367–6376; Spasic, M.R.; etal. J. Neurosci. 2008, 28, 6419–6429).

[0137] In some embodiments, the AMPK-associated disease is a cardiovascular disease. Cardiovascular disease, including heart disease and stroke, represent the principal cause of death in western countries. The AMPK pathway was shown to be involved in protecting cardiovascular function (Bonnefont-Rousselot, D. Nutrients 2016, 8, E250). AMPK activation is also required to attenuate the expression of the intracellular adhesion molecule 1, which is involved in atherogenesis (Nizamutdinova et al., Atherosclerosis 2009, 207, 405-411). AMPK plays a crucial role in cardiac function, since its inactivation could lead to heart failure. Cardiac dysfunction can be prevented by resveratrol through AMPK modulation, since it has been shown that resveratrol treatment on cardiac function is closely related to its capacity to improve AMPK activity via Sirtuin-1 activation (Gu etal., Genet. Mol. Res. 2014, 13, 323-335), as shown in vitro on treated cardiomyocytes. A great beneficial effect after treatment with resveratrol was also found in an in vivo model of heart failure of myocardia infarction, enhancing AMPK expression. AMPK activation is also necessary for vascular relaxation (Soylemez, S. etal. Cardiovasc. Drugs Ther. 2009, 23, 449-45). AMPK activation has also shown an effect on hypertrophy, inhibiting hypertrophic growth (Dolinsky, etal., Biochim. Biophys. Acta. 2011, 1812, 1477–1489).

[0138] In some embodiments, the AMPK-associated disease is cancer. Accumulating pre- clinical evidence have shown that AMPK activation could suppress hepatocellular carcinoma (Jiang etal., Cancers, 2019, 11, 647). In addition, myc has been shown to activate the AMPK pathway, which induces mitochondrial accumulation of p53, which in turn induces apoptosis (Nieminen etal., PNAS, 110(20): E1839-48 (2013). Accordingly, direct activation of AMPK will also induce mitochondrial accumulation of p53, and thus apoptosis. Because induction of apoptosis can arrest undesirable cell proliferation such as tumor growth, AMPK activation can be effective in treating cancer and other cell proliferation disorders.

[0139] The term “pathogenic amino acid" refers to any amino acid that is not a wild-type amino acid in a protein and which leads to a pathogenesis.

[0140] The term “pathogenic protein” refers to any protein that comprises one or more pathogenic amino acids.

[0141] The terms “pathogenic mutation”, “pathogenic variant”, “disease causing mutation”, “disease causing variant", or “deleterious mutation,” refer to a genetic alteration or mutation that increases an individual’s susceptibility or predisposition to a certain disease or disorder. In some embodiments, the pathogenic mutation comprises at least one wild-type amino acid substituted by at least one pathogenic amino acid in a protein encoded by a gene. In someAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO embodiments, the pathogenic mutation comprises a missense mutation. In some embodiments, the pathogenic mutation comprises a splice site mutation, e.g., a splice donor variant, or a splice acceptor variant. In some embodiments, the pathogenic mutation comprises a nonsense mutation. In some embodiments, the pathogenic mutation comprises at least one wild-type allele substituted by at least one pathogenic allele in the target gene.

[0142] The term "restored amino acid," as used herein, refers to an amino acid that is not a wild type amino acid at a specific position in a protein, but is an amino acid that constitutes a conservative amino acid substitution of the wild type amino acid at the specific position in the protein. In some embodiments, the restored amino acid restores the function of a pathogenic AMPK protein. In some embodiments, the restored amino acid restores at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% of the function of a pathogenic AMPK protein. In some embodiments, the restored amino acid substitutes a pathogenic amino acid in the pathogenic AMPK protein. In some embodiments, the restored amino acid substitutes a wild type amino acid in the pathogenic AMPK protein at a different site from the pathogenic amino acid, for example, generating a compensatory function. In some embodiments, the restored amino acid is selected from the restored amino acids described in Table 2.

[0143] The term "conservative amino acid substitution,” as used herein, refers to a substitution in which an amino acid is replaced by another amino acid having a side chain group R with similar chemical properties (for example, charge, size, and / or hydrophobicity), in a protein. In some embodiments, the conservative amino acid substitution affects the functional properties of the protein. In some embodiments, the conservative amino acid substitution does not substantially affect the functional properties of the protein. In some embodiments, the conservative amino acid substitution is selected from the conservative amino acid substitutions described in Table 2.

[0144] As used herein, a "premature stop codon" refers to the appearance of a stop codon where there should be a codon corresponding to an amino acid.

[0145] The term "adenosine deaminase", as used herein, refers to a polypeptide or fragment thereof capable of catalyzing the hydrolytic deamination of adenine or adenosine. In some embodiments, the deaminase or deaminase domain is an adenosine deaminase catalyzing the hydrolytic deamination of adenosine to inosine or deoxy adenosine to deoxyinosine. In some embodiments, the adenosine deaminase catalyzes the hydrolytic deamination of adenine or adenosine in deoxyribonucleic acid (DNA). In some embodiments, the adenosine deaminase catalyzes the hydrolytic deamination of adenine or adenosine in ribonucleic acid (RNA). The adenosine deaminases may be from any organism, such as a human, chimpanzee, gorilla, monkey, cow, dog, rat, or mouse. In some embodiments, the adenosine deaminase is from a bacterium, such as E. coli, S. aureus, S. typhi, S. putrefaciens, H. influenzae, or C. crescentus. In some embodiments, the deaminase or deaminase domain is a variant of a naturally occurring deaminase from an organism, such as a human, chimpanzee, gorilla, monkey, cow, dog, rat, or mouse. In some embodiments, the deaminase or deaminase domain does not occur in nature. For example, in some embodiments,Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO the deaminase or deaminase domain is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75% at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1 %, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to a naturally occurring deaminase. For example, deaminase domains are described in International PCT Application Nos. PCT / 2017 / 045381 (WO 2018 / 027078) and PCT / US2016 / 058344 (WO 2017 / 070632), each of which is incorporated herein by reference for its entirety. Also see Komor, A. C., etal., Nature 533, 420-424 (2016); Gaudelli, N. M., eta / ., Nature 551, 464-471 (2017); Komor, A. C., eta / ., Science Advances 3:eaao4774 (2017), and Rees, H. A., eta / ., Nat Rev Genet.2018; 19(12):770-788, the entire contents of which are hereby incorporated by reference.

[0146] As used herein, the term “Adenosine deaminases acting on RNA (ADAR)” refers to editing enzymes which can recognize certain structural motifs of double-stranded RNA (dsRNA), bind to dsRNA and convert adenosine to inosine through deamination, resulting in recoding of amino acid codons that may lead to changes to the encoded protein and its function. The nucleobases surrounding the editing site, especially the one immediately 5’ of the editing site and one immediately 3' to the editing site, which together with the editing site are termed the triplet, play an important role in the deamination of adenosine. A preference for U at the 5' position and G at the 3' position relative to the editing site, was revealed from the analysis of yeast RNAs efficiently edited by overexpressed human ADAR2 and ADAR1. (See Wang etal., (2018) Biochemistry, 57: 1640-1651; Eifler etal., (2013) Biochemistry, 52: 7857-7869, and Eggington etal., (2011) Nat. Commun., 319: 1-9.) There are three known ADAR proteins expressed in humans, ADAR1, ADAR2, and ADAR3. ADAR1 and ADAR2 are expressed throughout the body, although the level of expression varies across tissues. ADAR3 is expressed only in the brain. For tissues where ADAR1 is expressed, both the p110 and p150 isoforms are expressed. However, the p150 isoform of ADAR1 is only expressed in certain conditions, for example, in response to interferon stimulation. In contrast, expression of ADAR2 is more restricted. ADAR2 is predominantly expressed in the central nervous system, however, its expression is also observed in other tissues, such as the liver. ADAR1 and ADAR2 are catalytically active, while ADAR3 is thought to be inactive.Recruiting ADAR to specific sites of selected transcripts and deamination of adenosine regardless of neighboring bases holds great promise for the treatment of disease.

[0147] As used herein, the term “ADAR-recruiting domain” refers to nucleotide sequences that may be part of the oligonucleotides of the instant disclosure and which are able to recruit an ADAR enzyme. In some embodiments, the ADAR-recruiting domains may form stem-loop structures that act as recruitment and binding regions for the ADAR enzyme. Oligonucleotides including such ADAR-recruiting domains may be referred to as “axiomer AONs” or “selflooping AONs.” In other embodiments, the ADAR-recruiting domain does not comprise a stem- loop structure. The ADAR-recruiting domain portion may act to recruit an endogenous ADAR enzyme present in the cell and / or exogenous ADAR enzyme introduced into the cell for expression. Such ADAR-recruiting domains do not requireAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO conjugated entities or presence of modified recombinant ADAR enzymes. Alternatively, the ADAR-recruiting portion may act to recruit a recombinant ADAR fusion protein that has been delivered to a cell or to a subject via an expression vector construct including a polynucleotide encoding an ADAR fusion protein. Such ADAR-fusion proteins may include the deaminase domain of ADAR1 orADAR2 enzymes fused to another protein, e.g, to the MS2 bacteriophage coat protein. An ADAR-recruiting domain may be a nucleotide sequence based on a natural substrate (e.g., the GluR2 receptor pre-mRNA; such as a GluR2 ADAR-recruiting domain), a Z-DNA structure, or a domain known to recruit another protein which is part of an ADAR fusion protein, e.g., an MS2 ADAR-recruiting domain known to be recognized by the dsRNA binding regions of ADAR. A stem-loop structure of an ADAR-recruiting domain can be an intermolecular stem-loop structure, formed by two separate nucleic acid strands, or an intramolecular stem loop structure, formed within a single nucleic acid strand

[0148] As used herein, the term " Z-DNA" refers to a left-handed conformation of the DNA double helix or RNA stem loop structures. Such DNA or dsRNA helices wind to the left in a zigzag pattern (as opposed to the right, like the more commonly found B-DNAform). Z-DNA is a known high-affinity ADAR binding substrate and has been shown to bind to human ADAR1 enzyme.

[0149] “G,” “C,” “A,” “T,” and “U” each generally stand for a naturally-occurring nucleotide that contains guanine, cytosine, adenine, thymidine, and uracil as a base, respectively. However, it will be understood that the term "nucleotide" can also refer to an alternative nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide including a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide including hypoxanthine as its base can base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of oligonucleotides featured in the disclosure by a nucleotide containing, for example, hypoxanthine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the disclosure.

[0150] The terms “nucleobase” and "base” include the purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization. In the context of the present disclosure, the term nucleobase also encompasses alternative nucleobases which may differ from naturally-occuring nucleobases but are functional during nucleic acid hybridization. In this context “nucleobase” refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as alternative nucleobases. Such variants are, for example, described in Hirao et al (2012) Accounts of Chemical Research vol 45, page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 Chapter 1, unit 4.1.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0151] In some embodiments the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as an “alternative nucleobase” selected from isocytosine, pseudoisocytosine, 5- methylcytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, pseudouracil, 1-methylpseudouracil, 5-methoxyuracil, 2'-thio- thymine, hypoxanthine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0152] The nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C, or U, wherein each letter may optionally include alternative nucleobases of equivalent function.

[0153] A “sugar” or “sugar moiety,” includes naturally occurring sugars having a furanose ring A sugar also includes an “alternative sugar,” defined as a structure that is capable of replacing the furanose ring of a nucleoside. In certain embodiments, alternative sugars are non-furanose (or 4'-substituted furanose) rings or ring systems or open systems. Such structures include simple changes relative to the natural furanose ring, such as a six-membered ring, or may be more complicated as is the case with the non-ring system used in peptide nucleic acid.

[0154] Alternative sugars may also include sugar surrogates wherein the furanose ring has been replaced with another ring system such as, for example, a morpholino or hexitol ring system. Sugar moieties useful in the preparation of oligonucleotides having motifs include, without limitation, β-D-ribose, β-D-2'-deoxyribose, substituted sugars (such as 2', 5' and bis substituted sugars), 4'-S-sugars (such as 4'-S-ribose, 4'-S-2'-deoxyribose and 4'-S-2'-substituted ribose), bicyclic alternative sugars (such as the 2'-O— CH2-4' or 2'-O— (CH2)2-4‘ bridged ribose derived bicyclic sugars) and sugar surrogates (such as when the ribose ring has been replaced with a morpholino or a hexitol ring system). The type of heterocyclic base and internucleoside linkage used at each position is variable and is not a factor in determining the motif. In most nucleosides having an alternative sugar moiety, the heterocyclic nucleobase is generally maintained to permit hybridization.

[0155] A “nucleotide,” as used herein refers to a monomeric unit of an oligonucleotide or polynucleotide that includes a nucleoside and an internucleoside linkage. The internucleoside linkage may or may not include a phosphate linkage. Similarly, “linked nucleosides” may or may not be linked by phosphate linkages. Many “alternative internucleoside linkages” are known in the art, including, but not limited to, phosphorothioate and boronophosphate linkages. Alternative nucleosides include bicyclic nucleosides (BNAs) (e.g., locked nucleosides (LNAs) and constrained ethyl (cEt) nucleosides), peptide nucleosides (PNAs), phosphotriesters, phosphorothionates, phosphoramidates, and other variants of the phosphate backbone of native nucleoside, including those described herein.

[0156] An “alternative nucleotide” as used herein, refers to a nucleotide having an alternative nucleobase or an alternative sugar, and an internucleoside linkage, which may include alternative nucleoside linkages.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0157] The term "nucleoside” refers to a monomeric unit of an oligonucleotide or a polynucleotide having a nucleobase and a sugar moiety. A nucleoside may include those that are naturally-occurring as well as alternative nucleosides, such as those described herein. The nucleobase of a nucleoside may be a naturally-occurring nucleobase or an alternative nucleobase. Similarly, the sugar moiety of a nucleoside may be a naturally-occurring sugar or an alternative sugar.

[0158] The term “alternative nucleoside” refers to a nucleoside having an alternative sugar or an alternative nucleobase, such as those described herein

[0159] The term “nuclease resistant nucleotide” as used herein refers to nucleotides which limit nuclease degradation of oligonucleotides. Nuclease resistant nucleotides generally increase stability of oligonucleotides by being poor substrates for the nucleases. Nuclease resistant nucleotides are known in the art, e.g., 2’-O-methyl-nucleotides and 2’-fluoro-nucleotides.

[0160] The terms “oligonucleotide” and “polynucleotide” as used herein, are defined as it is generally understood by the skilled person as a molecule including two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The oligonucleotide of the disclosure may be man-made, and is chemically synthesized, and is typically purified or isolated. Oligonucleotide is also intended to include (i) compounds that have one or more furanose moieties that are replaced by furanose derivatives or by any structure, cyclic or acyclic, that may be used as a point of covalent attachment for the base moiety, (ii) compounds that have one or more phosphodiester linkages that are either modified, as in the case of phosphoramidate or phosphorothioate linkages, or completely replaced by a suitable linking moiety as in the case of formacetal or riboacetal linkages, and / or (iii) compounds that have one or more linked furanose-phosphodiester linkage moieties replaced by any structure, cyclic or acyclic, that may be used as a point of covalent attachment for the base moiety. The oligonucleotide of the disclosure may include one or more alternative nucleosides or nucleotides {e.g., including those described herein). It is also understood that oligonucleotide includes compositions lacking a sugar moiety or nucleobase but is still capable of forming a pairing with or hybridizing to a target sequence.

[0161] “Oligonucleotide” refers to a short polynucleotide {e.g., of 100 or fewer linked nucleosides).

[0162] The phrases “an oligonucleotide that is capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration” or “a guide oligonucleotide that is capable of effecting an ADAR-mediated adenosine to inosine alteration” refer to an oligonucleotide that is specific for a target sequence, e.g., an AMPK mRNA sequence, and is capable to be utilized for the deamination reaction of a specific adenosine in a targetAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO sequence through an ADAR-mediated pathway. The oligonucleotide may comprise a nucleic acid sequence complementary to a target sequence, e.g., an AMPK mRNA sequence, e.g., a nucleotide sequence selected from the group consisting of SEQ ID NOs:57-63. In some embodiments, the oligonucleotides may comprise a nucleic acid sequence complementary to target mRNA with the exception of at least one mismatch (e.g., at least 1, 2, 3, 4, or 5 mismatches). In some embodiments, the oligonucleotides may comprise a nucleic acid sequence complementary to target mRNA with about 5%, about 10%, about 15%, about 20% or about 25% mismatches. The oligonucleotide includes a mismatch opposite the target adenosine. In some embodiments, the oligonucleotides for use in the methods of the present disclosure do not include those used by any non-ADAR mediated gene editing technologies known in the art., e.g., CRISPR or siRNA.

[0163] The oligonucleotide may be of any length, and may range from about 10-200 bases in length, e.g., about 15-100 bases in length or about 18-100 bases in length, for example, about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 bases in length, such as about 15-50, 15-49, 15-48, 15-47, 15-46, 15-45, 15-44, 15-43, 15-42, 15-41, 15-40, 15-39, 15-38, 15-37, 15-36, 15-35, 15-34, 15-33, 15-32, 15-31, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 16-22, 18-55, 18-50, 18-49, 18-48, 18-47, 18-46, 18-45, 18-44, 18-43, 18-42, 18-41, 18-40, 18-39, 18-38, 18-37, 18-36, 18-35, 18-34, 18-33, 18-32, 18-31, 18-31, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 19-50, 19-49, 19-48, 19-47, 19-46, 19-45, 19-44, 19-43, 19-42, 19-41, 19-40, 19-39, 19-38, 19-37, 19-36, 19-35, 19-34, 19-33, 19-32, 19-31, 19-31, 19-30, 20-50, 20-49, 20-48, 20-47, 20-46, 20-45, 20-44,20-43, 20-42, 20-41, 20-40, 20-39, 20-38, 20-37, 20-36, 20-35, 20-34, 20-33, 20-32, 20-31, 20-31, 20-30, 21-50, 21-49, 21-48, 21-47, 21-46, 21-45, 21-44, 21-43, 21-42, 21-41, 21-40, 21-39, 21-38, 21-37, 21-36, 21-35, 21-34, 21-33, 21-32, 21-31, 21-31, or 21-30 bases in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.

[0164] The term "linker" or "linking group" is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. Conjugate moieties can be attached to the oligonucleotide directly or through a linking moiety (e.g. linker or tether). Linkers serve to covalently connect a third region, e.g. a conjugate moiety to an oligonucleotide (e.g. the termini of region A or C). In some embodiments of the disclosure the conjugate or oligonucleotide conjugate of the disclosure may optionally, include a linker region which is positioned between the oligonucleotide and the conjugate moiety. In some embodiments, the linker between the conjugate and oligonucleotide is biocleavable. Phosphodiester containing biocleavable linkers are described in more detail in WO 2014 / 076195 (herein incorporated by reference).

[0165] “Complementary" polynucleotides are those that are capable of base pairing according to the standard Watson-Crick complementarity rules. Specifically, purines will base pair with pyrimidines to form a combination ofAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO guanine paired with cytosine (G: C) and adenine paired with either thymine (A: T) in the case of DNA, or adenine paired with uracil (A: U) in the case of RNA. It is understood that two polynucleotides may hybridize to each other even if they are not completely complementary to each other, provided that each has at least one region that is substantially complementary to the other. Complementary sequences between an oligonucleotide and a target sequence as described herein, include base-pairing of the oligonucleotide or polynucleotide including a first nucleotide sequence to an oligonucleotide or polynucleotide including a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as "fully complementary" with respect to each other herein. In some embodiments, the term “complementary” as used herein also encompasses the term “substantially complementary.” For example, where a first sequence is referred to as "substantially complementary" with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally no more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., deamination of an adenosine. “Substantially complementary” can also refer to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA having a target adenosine). For example, a polynucleotide is complementary to at least a part of the mRNA of interest if the sequence is substantially complementary to a non-interrupted portion of the mRNA of interest. In some embodiments, the oligonucleotide, as described herein, is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75% at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1 %, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% complementary to the target sequence.

[0166] As used herein, and unless otherwise indicated, the term "complementary," when used to describe a first nucleotide or nucleoside sequence in relation to a second nucleotide or nucleoside sequence, refers to the ability of an oligonucleotide or polynucleotide including the first nucleotide or nucleoside sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide including the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCI, 40 mM PIPES pH 6.4, 1 mM EDTA, 50 °C, or 70 °C, for 12-16 hours followed by washing (see, e.g., " Molecular Cloning: A Laboratory Manual, Sambrook, etal. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides or nucleosides.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0167] As used herein, the terms “variant” and “derivative" are used interchangeably and refer to naturally-occurring, synthetic, and semi-synthetic analogues of a compound, peptide, protein, or other substance described herein. A variant or derivative of a compound, peptide, protein, or other substance described herein may retain or improve upon the biological activity of the original material.

[0168] The term “mutation," as used herein, refers to a substitution of a residue within a sequence, e.g., a nucleic acid or amino acid sequence, with another residue, or a deletion or insertion of one or more residues within a sequence. Mutations are typically described herein by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue. Various methods for making the amino acid substitutions (mutations) provided herein are well known in the art, and are provided by, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. (2012)). In some embodiments, the presently disclosed compositions can efficiently generate an “intended mutation”, such as a point mutation, in a nucleic acid (e.g., a nucleic acid within a genome of a subject) without generating a significant number of unintended mutations, such as unintended point mutations. In some embodiments, an intended mutation is a mutation that is generated by a specific guide oligonucleotide, specifically designed to generate the intended mutation. In general, mutations made or identified in a sequence (e.g., an amino acid sequence as described herein) are numbered in relation to a reference (or wild type) sequence, i.e., a sequence that does not contain the mutations. The skilled practitioner in the art would readily understand how to determine the position of mutations in amino acid and nucleic acid sequences relative to a reference sequence.

[0169] As used herein, the term “single nucleotide polymorphisms (SNP),” refers to a variation at a single position in a DNA sequence among individuals. If more than 1% of a population does not carry the same nucleotide at a specific position in the DNA sequence, then this variation can be classified as a SNP. If a SNP occurs within a gene, then the gene is described as having more than one allele. In these cases, SNPs may lead to variations in the amino acid sequence. For example, at a specific base position in the human genome, the C nucleotide can appear in most individuals, but in a minority of individuals, the position is occupied by an A. This means that there is a SNP at this specific position, and the two possible nucleotide variations, C or A, are the two alleles for this position.

[0170] SNPs can fall within coding regions of genes, non-coding regions of genes, or in the intergenic regions (regions between genes). In some embodiments, SNPs within a coding sequence do not necessarily change the amino acid sequence of the protein that is produced, due to degeneracy of the genetic code. SNPs in the coding region are of two types: synonymous and nonsynonymous SNPs. Synonymous SNPs do not affect the protein sequence, while nonsynonymous SNPs change the amino acid sequence of protein. The nonsynonymous SNPs are of two types: missense and nonsense. SNPs that are not in protein-coding regions can still affect gene splicing, transcription factor binding, messenger RNA degradation, or the sequence of noncoding RNA. Gene expression affected by this type of SNP is referred to as an eSNP (expression SNP) and can be upstream or downstream fromAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO the gene. A single nucleotide variant is a variation in a single nucleotide without any limitations of frequency and can arise in somatic cells. A somatic single nucleotide variation can also be called a si ngle-nucleotide alteration.

[0171] Although a particular SNP may not cause a disorder, some SNPs are associated with certain diseases. These associations allow for the use of specific SNPs to evaluate an individual's genetic predisposition to develop a disease. In addition, if certain SNPs are known to be associated with a trait, then examination of certain stretches of DNA near these SNPs will help identify the gene or genes responsible for the trait.

[0172] The term ''contacting,’’ as used herein, includes contacting a target gene, e.g., AMPK by any means. In some embodiments, a target gene is contacted with a guide oligonucleotide in a cell. Contacting an AMPK polynucleotide in a cell with a guide oligonucleotide includes contacting the AMPK polynucleotide in a cell in vitro with the guide oligonucleotide or contacting the AMPK polynucleotide in a cell in vivo with the guide oligonucleotide.

[0173] Contacting a cell in vitro may be done, for example, by incubating the cell with the guide oligonucleotide. Contacting a cell in vivo may be done, for example, by injecting the guide oligonucleotide into or near the tissue where the cell is located, or by injecting the guide oligonucleotide agent into another area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the guide oligonucleotide may contain and / or be coupled to a ligand that directs the oligonucleotide to a site of interest. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with a guide oligonucleotide and subsequently transplanted into a subject.

[0174] In one embodiment, contacting a cell with a guide oligonucleotide includes "introducing" or "delivering the oligonucleotide into the cell" by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of a guide oligonucleotide can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. Introducing a guide oligonucleotide into a cell may be in vitro and / or in vivo. For example, for in vivo introduction, oligonucleotides can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below and / or are known in the art.

[0175] By "determining the level of a protein” is meant the detection of a protein, or an mRNA encoding the protein, by methods known in the art either directly or indirectly. " Directly determining” means performing a process (e.g., performing an assay or test on a sample or “analyzing a sample" as that term is defined herein) to obtain the physical entity or value. “Indirectly determining" refers to receiving the physical entity or value from another party or source (e.g., a third-party laboratory that directly acquired the physical entity or value). Methods to measure protein level generally include, but are not limited to, western blotting, immunoblotting, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoprecipitation, immunofluorescence, surface plasmon resonance,Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO chemiluminescence, fluorescent polarization, phosphorescence, immunohistochemical analysis, matrix-assisted laser desorption / ionization time-of-flight (MALDI-TOF) mass spectrometry, liquid chromatography (LC)-mass spectrometry, microcytometry, microscopy, fluorescence activated cell sorting (FACS), and flow cytometry, as well as assays based on a property of a protein including, but not limited to, enzymatic activity or interaction with other protein partners. Methods to measure mRNA levels are known in the art.

[0176] “Percent (%) sequence identity” with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, percent sequence identity values may be generated using the sequence comparison computer program BLAST. As an illustration, the percent sequence identity of a given nucleic acid or amino acid sequence, A, to, with, or against a given nucleic acid or amino acid sequence, B, (which can alternatively be phrased as a given nucleic acid or amino acid sequence, A that has a certain percent sequence identity to, with, or against a given nucleic acid or amino acid sequence, B) is calculated as follows:100 multiplied by (the fraction X / Y)where X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in that program's alignment of A and B, and where Y is the total number of nucleic acids in B. It will be appreciated that where the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, the percent sequence identity of A to B will not equal the percent sequence identity of B to A.

[0177] The term “modulating” or “modulate”, as used herein, refers to either up-regulating (e.g., activating or stimulating), down-regulating (e.g., inhibiting or suppressing) or otherwise changing a functional property or biological activity of an AMPK protein. The activity of AMPK may be modulated either directly or indirectly.

[0178] By “level” is meant a level or activity of a protein, or mRNA encoding the protein, as compared to a reference. The reference can be any useful reference, as defined herein. By a “decreased level” or an “increased level” of a protein is meant a decrease or increase in protein level, as compared to a reference (e.g., a decrease or an increase by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 150%, about 200%, about 300%, about 400%, about 500%, or more; a decrease orAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO an increase of more than about 10%, about 15%, about 20%, about 50%, about 75%, about 100%, or about 200%, as compared to a reference; a decrease or an increase by less than about 0.01-fold, about 0.02-fold, about 0.1-fold, about 0.3-fold, about 0.5-fold, about 0.8-fold, or less; or an increase by more than about 1.2-fold, about 1.4-fold, about 1.5-fold, about 1.8-fold, about 2-fold, about 3-fold, about 3.5-fold, about 4.5-fold, about 5-fold, about 10-fold, about 15- fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 100-fold, about 1000-fold, or more). A level of a protein may be expressed in mass / vol (e.g., g / dL, mg / mL, pg / mL, ng / mL) or percentage relative to total protein or mRNA in a sample.

[0179] The term "pharmaceutical composition,” as used herein, represents a composition containing a compound described herein formulated with a pharmaceutically acceptable excipient, and preferably manufactured or sold with the approval of a governmental regulatory agency as part of a therapeutic regimen for the treatment of disease in a mammal. Pharmaceutical compositions can be formulated, for example, for oral administration in unit dosage form (e.g., a tablet, capsule, caplet, gelcap, or syrup); for topical administration (e.g., as a cream, gel, lotion, or ointment); for intravenous administration (e.g., as a sterile solution free of particulate emboli and in a solvent system suitable for intravenous use); for intrathecal injection; for intracerebroventricular injections; for intraparenchymal injection; or in any other pharmaceutically acceptable formulation.

[0180] A “pharmaceutically acceptable excipient," as used herein, refers any ingredient other than the compounds described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non- inflammatory in a patient. Excipients may include, for example: antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspensing or dispersing agents, sweeteners, and waters of hydration. Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.

[0181] As used herein, the term “pharmaceutically acceptable salt” means any pharmaceutically acceptable salt of the compound of any of the compounds described herein. For example, pharmaceutically acceptable salts of any of the compounds described herein include those that are within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and animals without undue toxicity, irritation, allergic response and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. ForAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO example, pharmaceutically acceptable salts are described in: Berge etal., J. Pharmaceutical Sciences 66:1-19, 1977 and in Pharmaceutical Salts: Properties, Selection, and Use, (Eds. P. H. Stahl and C. G. Wermuth), Wiley-VCH, 2008. The salts can be prepared in situ during the final isolation and purification of the compounds described herein or separately by reacting a free base group with a suitable organic acid.

[0182] The compounds described herein may have ionizable groups so as to be capable of preparation as pharmaceutically acceptable salts. These salts may be acid addition salts involving inorganic or organic acids or the salts may, in the case of acidic forms of the compounds described herein, be prepared from inorganic or organic bases. Frequently, the compounds are prepared or used as pharmaceutically acceptable salts prepared as addition products of pharmaceutically acceptable acids or bases. Suitable pharmaceutically acceptable acids and bases and methods for preparation of the appropriate salts are well-known in the art. Salts may be prepared from pharmaceutically acceptable non-toxic acids and bases including inorganic and organic acids and bases.Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, and valerate salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, and magnesium, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, and ethylamine.

[0183] By a "reference” is meant any useful reference used to compare protein or mRNA levels or activity. The reference can be any sample, standard, standard curve, or level that is used for comparison purposes. The reference can be a normal reference sample or a reference standard or level. A “reference sample” can be, for example, a control, e.g., a predetermined negative control value such as a “normal control” or a prior sample taken from the same subject; a sample from a normal healthy subject, such as a normal cell or normal tissue; a sample (e.g., a cell or tissue) from a subject not having a disease; a sample from a subject that is diagnosed with a disease, but not yet treated with a compound described herein; a sample from a subject that has been treated by a compound described herein; or a sample of a purified protein (e.g., any described herein) at a known normal concentration. By “reference standard or level” is meant a value or number derived from a reference sample. A “normal control value" is a pre-determined value indicative of non-disease state, e.g., a value expected in a healthy control subject. Typically, a normal control value is expressed as a range (“between X and Y”), a high threshold (“no higher than X”), or a low threshold (“no lower than X”). A subject having a measured value within the normal control value for a particularAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO biomarker is typically referred to as “within normal limits” for that biomarker. A normal reference standard or level can be a value or number derived from a normal subject not having a disease or disorder; a subject that has been treated with a compound described herein. In preferred embodiments, the reference sample, standard, or level is matched to the sample subject sample by at least one of the following criteria: age, weight, sex, disease stage, and overall health. A standard curve of levels of a purified protein, e.g., any described herein, within the normal reference range can also be used as a reference.

[0184] As used herein, the term “subject” refers to any organism to which a composition in accordance with the disclosure may be administered, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include any animal (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans). A subject may seek or be in need of treatment, require treatment, be receiving treatment, be receiving treatment in the future, or be a human or animal who is under care by a trained professional for a particular disease or condition.

[0185] As used herein, the term “administration” refers to the administration of a composition (e.g., a compound or a preparation that includes a compound as described herein) to a subject or system. Administration to an animal subject (e.g., to a human) may be by any appropriate route, such as the one described herein.

[0186] As used herein, a “combination therapy" or “administered in combination" means that two (or more) different agents or treatments are administered to a subject as part of a defined treatment regimen for a particular disease or condition The treatment regimen defines the doses and periodicity of administration of each agent such that the effects of the separate agents on the subject overlap. In some embodiments, the delivery of the two or more agents is simultaneous or concurrent and the agents may be co-formulated. In some embodiments, the two or more agents are not co-formulated and are administered in a sequential manner as part of a prescribed regimen. In some embodiments, administration of two or more agents or treatments in combination is such that the reduction in a symptom, or other parameter related to the disorder is greater than what would be observed with one agent or treatment delivered alone or in the absence of the other. The effect of the two treatments can be partially additive, wholly additive, or greater than additive (e.g., synergistic). Sequential or substantially simultaneous administration of each therapeutic agent can be effected by any appropriate route including, but not limited to, oral routes, intravenous routes, intramuscular routes, and direct absorption through mucous membrane tissues. The therapeutic agents can be administered by the same route or by different routes. For example, a first therapeutic agent of the combination may be administered by intravenous injection while a second therapeutic agent of the combination may be administered orally.

[0187] As used herein, the terms "treat," "treated," or "treating" mean both therapeutic treatment and prophylactic or preventative measures wherein the object is to prevent or slow down (lessen) an undesired physiological condition, disorder, or disease, or obtain beneficial or desired clinical results. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of a condition, disorder, or disease; stabilizedAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO (i.e., not worsening) state of condition, disorder, or disease; delay in onset or slowing of condition, disorder, or disease progression; amelioration of the condition, disorder, or disease state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient; or enhancement or improvement of condition, disorder, or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.

[0188] As used herein, the terms “effective amount,” “therapeutically effective amount,” and “a “sufficient amount” of an agent that results in a therapeutic effect (e.g., in a cell or a subject) described herein refer to a quantity sufficient to, when administered to the subject, including a human, effect beneficial or desired results, including clinical results, and, as such, an “effective amount” or synonym thereto depends on the context in which it is being applied. For example, in the context of treating a disorder, it is an amount of the agent that is sufficient to achieve a treatment response as compared to the response obtained without administration. The amount of a given agent will vary depending upon various factors, such as the given agent, the pharmaceutical formulation, the route of administration, the type of disease or disorder, the identity of the subject (e.g., age, sex, and / or weight) or host being treated, and the like, but can nevertheless be routinely determined by one of skill in the art. Also, as used herein, a “therapeutically effective amount” of an agent is an amount which results in a beneficial or desired result in a subject as compared to a control. As defined herein, a therapeutically effective amount of an agent may be readily determined by one of ordinary skill by routine methods known in the art. Dosage regimen may be adjusted to provide the optimum therapeutic response.

[0189] “Prophylactically effective amount,” as used herein, is intended to include the amount of an oligonucleotide that, when administered to a subject having or predisposed to have a disorder, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The “prophylactically effective amount" may vary depending on the oligonucleotide, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

[0190] A “therapeutically-effective amount” or “prophylactically effective amount" also includes an amount (either administered in a single or in multiple doses) of an oligonucleotide that produces some desired local or systemic effect at a reasonable benefi t / risk ratio applicable to any treatment. Oligonucleotides employed in the methods of the present disclosure may be administered in a sufficient amount to produce a reasonable benefi t / risk ratio applicable to such treatment.

[0191] A prophylactically effective amount may also refer to, for example, an amount sufficient to, when administered to the subject, including a human, to delay the onset of one or more of the disorders described hereinAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO by at least 120 days, for example, at least 6 months, at least 12 months, at least 2 years, at least 3 years, at least 4 years, at least 5 years, at least 10 years or more, when compared with the predicted onset.

[0192] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Methods and materials are described herein for use in the present disclosure; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control

[0193] The details of one or more embodiments of the disclosure are set forth in the description below. Other features, objects, and advantages of the disclosure will be apparent from the description and from the claims.

[0194] Methods of Making a Mutant AMPK protein

[0195] The mutant AMPK proteins described herein can be produced, for example, by gene-editing or mRNA technologies known in the art. For example, mRNA or DNA for AMPK can be edited by ADAR-editing technology (discussed in detail below), clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9), transcription activator-like effector nucleases (TALENs), zinc-finger nucleases (ZFNs), additional nucleic acid editing enzymes, e.g., cytidine deaminases (e.g., APOBEC1 family deaminases), and / or homing endonucleases or meganucleases.

[0196] In some embodiments, the AMPK mRNA is edited by ADAR-editing technology. In mammalian cells, there are three types of ADAR proteins, Adarl (two isoforms, p110 and p150), Adar2 and Adar3 (catalytically inactive). The catalytic substrate of ADAR protein is double-stranded RNA, and ADAR can remove the -NH2 group from an adenosine (A) nucleobase, changing A to inosine (I). (I) is recognized as guanosine (G) and paired with cytidine (C) during subsequent cellular transcription and translation processes. To achieve targeted RNA editing, the ADAR protein or its catalytic domain can be fused with a AN peptide, a SNAP-tag or a Cas protein (dCas13b), and a guide RNA can be designed to recruit the chimeric ADAR protein to the target site. Alternatively, overexpressing ADAR1 or ADAR2 proteins together with an R / G motif-bearing guide RNA has also been reported to enable targeted RNA editing. ADAR-editing technology is described in more detail in PCT Publication Nos. WO 2020 / 154342, WO 2020 / 154344, and WO 2020 / 154343, the disclosures of which are incorporated herein by reference in their entireties.

[0197] Other gene-editing technologies known in the art can also be used in the methods of the present disclosure. For example, the AMPK genes encoding the different subunits can be edited by clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR- associated protein 9 (Cas9), deaminase base editors, e.g., adenosine base editors, cytidine deaminases (e.g., APOBEC1 family deaminases), transcription activator-like effector nucleases (TALENs), zinc- finger nucleases (ZFNs), and / or homing endonucleases or meganucleases, e.g., to generateAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO functional AMPK variants that can promote activation of the protein, or to substitute a pathogenic amino acid of the AMPK protein with either a wild type amino acid, or a restored amino acid. In some embodiments, an exogenous or engineered protein, such as a programmable DNA base editor, e.g., a deaminase coupled with CRISPR-Cas9, can be used as a gene-editing approach (Xie et al., BMC Biol. 2020; 18: 131).

[0198] In some embodiments, the AMPK gene is edited by CRISPR technology. CRISPR technology is included in the disclosure as an approach for generating RNA-guided nuclease with customizable specificities for targeted genome editing. Genome editing mediated by these nucleases has been used to rapidly, easily and efficiently modify endogenous genes in a wide variety of biomedically important cell types and in organisms that have traditionally been challenging to manipulate genetically.

[0199] In some embodiments, the AMPK gene is edited by the transcription activator like effector nucleases (TALENs). The term TALEN, as used herein, is broad and includes a monomeric TALEN that can cleave double stranded DNA without assistance from another TALEN. The term TALEN is also used to refer to one or both members of a pair of TALENs that are engineered to work together to cleave DNA at the same site.

[0200] In some embodiments, the AMPK gene is edited by a nucleic acid editing enzyme, e.g., a deaminase, e.g., a cytidine deaminase. The term "cytidine deaminase" or "cytidine deaminase protein" as used herein refers to a protein, a polypeptide, or one or more functional domain(s) of a protein or a polypeptide that is capable of catalyzing a hydrolytic deamination reaction that converts an cytosine (or an cytosine moiety of a molecule) to an uracil (or a uracil moiety of a molecule). In some embodiments, the cytosine-containing molecule is a cytidine (C), and the uracil-containing molecule is an uridine (U). The cytosine-containing molecule can be deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).

[0201] In some embodiments, the cytidine deaminase is an apolipoprotein B mRNA-editing complex (APOBEC) family deaminase, an activation-induced deaminase (AIU), or a cytidine deaminase 1 (CDA1). In some embodiments, the APOBEC family deaminase is selected from the group consisting of APOBEC1 deaminase, APOBEC2 deaminase, APOBEC3A deaminase, APOBEC3B deaminase, APOBEC3C deaminase, APOBEC3D deaminase, APOBEC3F deaminase, APOBEC3G deaminase, APOBEC3H deaminase, or any functional variants or fusion proteins thereof.

[0202] In some embodiments, the cytidine deaminase protein recognizes and converts one or more target cytosine residue(s) in a target RNA or DNA molecule. The changes may be in 5' or 3' untranslated regions of a target RNA, in splice sites, in exons (changing amino acids in protein translated from the target RNA, changing codon usage or splicing behavior by changing exonic splicing silencers or enhancers, and / or introducing or removing start or stop codons), in introns (changing splicing by altering intronic splicing silencers or intronic splicing enhancers, branchAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO points) and in general in any region affecting RNA stability, structure or functioning. The target RNA sequence may comprise a mutation that one may wish to correct or alter, such as a transition or a transversion.

[0203] In certain embodiments, the cytidine deaminase can be introduced into a cell for expression via a viral vector or a non-viral delivery system as described herein or any known viral vectors or non-viral delivery systems in the art.

[0204] Nucleic Acids

[0205] In another aspect, the disclosure provides a nucleic acid molecule encoding a mutant AMPK protein as disclosed herein. The term "nucleic acid molecule" is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA) and analogs of the DNA or RNA generated using nucleotide analogs. The nucleic acid molecule can be single-stranded or double-stranded.

[0206] In some embodiments, the disclosure provides a nucleic acid molecule (e.g., nucleotide sequence) (e.g., DNA or mRNA) encoding a mutant AMPK protein comprising a glycine, alanine, valine, proline, methionine, leucine, isoleucine, serine, phenylalanine, cysteine, asparagine, threonine, tryptophan, glutamine, or histidine at position 317 in AMPK y1 subunit, an arginine at position 151 in AMPK y1 subunit, an arginine at position 71 in AMPK a1 subunit, or an arginine at position 60 in AMPK a2 subunit. In some embodiments, the mutant AMPK protein comprises the amino acid sequence set forth in SEQ ID NO: 64. In some embodiments, the mutant AMPK protein comprises the amino acid sequence set forth in SEQ ID NO: 65. In some embodiments, the mutant AMPK protein comprises the amino acid sequence set forth in SEQ ID NO: 66. In some embodiments, the mutant AMPK protein comprises the amino acid sequence set forth in SEQ ID NO: 67. In some embodiments, the mutant AMPK protein comprises the amino acid sequence set forth in SEQ ID NO: 69. In some embodiments, the mutant AMPK protein comprises the amino acid sequence set forth in SEQ ID NO: 70. In some embodiments, the mutant AMPK protein comprises the amino acid sequence set forth in SEQ ID NO: 71. In some embodiments, the mutant AMPK protein comprises the amino acid sequence set forth in SEQ ID NO: 72. In some embodiments, the mutant AMPK protein comprises the amino acid sequence set forth in SEQ ID NO: 73. In some embodiments, the mutant AMPK protein comprises the amino acid sequence set forth in SEQ ID NO: 74. In some embodiments, the mutant AMPK protein comprises the amino acid sequence set forth in SEQ ID NO: 75. In some embodiments, the mutant AMPK protein comprises the amino acid sequence set forth in SEQ ID NO: 76. In some embodiments, the mutant AMPK protein comprises the amino acid sequence set forth in SEQ ID NO: 77. In some embodiments, the mutant AMPK protein comprises the amino acid sequence set forth in SEQ ID NO: 78. In some embodiments, the mutant AMPK protein comprises the amino acid sequence set forth in SEQ ID NO: 79. In some embodiments, the mutant AMPK protein comprises the amino acid sequence set forth in SEQ ID NO: 80. In some embodiments, the mutant AMPK protein comprises the amino acid sequence set forth in SEQ ID NO: 81.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0207] A nucleic acid molecule used in the methods of the present disclosure can be isolated using standard molecular biology techniques. Using all or portion of a nucleic acid sequence of interest as a hybridization probe, nucleic acid molecules can be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning. A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y, 1989).

[0208] A nucleic acid molecule can also be isolated by the polymerase chain reaction (PCR) using synthetic oligonucleotide primers designed based upon the sequence of a nucleic acid molecule of interest A nucleic acid molecule of the disclosure can be amplified using cDNA, mRNA or, alternatively, genomic DNA as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. Furthermore, oligonucleotides corresponding to nucleotide sequences of interest can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer. In some embodiments, the nucleic acids of the disclosure are prepared by standard recombinant DNA techniques. A nucleic acid of the disclosure can also be chemically synthesized using standard techniques. Various methods of chemically synthesizing polydeoxynucleotides are known, including solid-phase synthesis which has been automated in commercially available DNA synthesizers (See e.g., Itakura et al. U. S. Patent No. 4,598,049; Caruthers et al. U. S. Patent No. 4,458,066; and Itakura U. S. Patent Nos. 4,401,796 and 4,373,071, incorporated by reference herein).

[0209] In one embodiment, the nucleic acid molecule can be present in an inducible construct. In another embodiment, the nucleic acid molecules can be present in a construct which leads to constitutive expression.

[0210] In one embodiment, the nucleic acid molecules of the disclosure may be delivered to a mammalian cell, or to subjects, in a vector, e.g., a recombinant expression vector. In another embodiment, the nucleic acid molecules of the disclosure may be delivered to cells or to subjects, in the absence of a vector.

[0211] As used herein, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a “plasmid," which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as “expression vectors.” In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0212] The recombinant expression vectors of the disclosure comprise a nucleic acid of the disclosure in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operatively linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell). The term “regulatory sequence” is intended to include promoters, enhancers and other expression control elements (e.g., poly adenylation signals). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cells, those which are constitutively active, those which are inducible, and those which direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and the like. The expression vectors of the disclosure can be introduced into host cells to thereby produce proteins or portions thereof, including fusion proteins or portions thereof, encoded by nucleic acids as described herein.

[0213] In one embodiment, a nucleic acid molecule encoding a mutant AMPK protein described herein is expressed in mammalian cells using a mammalian expression vector. When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements

[0214] In some embodiments, the nucleic acid molecule encoding a mutant AMPK protein is contained within a viral vector and may be delivered to cells or to subjects. Exemplary viral vectors include, but are not limited to, an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a lentiviral vector, a herpes simplex viral vector, a parvoviral vector, a papillomavirus vector, a vaccinia viral vector, or a hybrid or chimeric vector thereof.

[0215] The vector will include one or more promoters or enhancers, the selection of which will be known to those skilled in the art. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus and simian virus 40 (SV40). Suitable promoters include, but are not limited to, the retroviral long terminal repeat (LTR), the SV40 promoter, the human cytomegalovirus (CMV) promoter, and other viral and eukaryotic cellular promoters known to the skilled artisan. For other suitable expression systems for both prokaryotic and eukaryotic cells see chapters 16 and 17 of Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989.

[0216] In another embodiment, the viral vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid). Tissue-specificAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO regulatory elements are known in the art. In one embodiment, a tissue-specific promoter for use in the vectors and methods of the disclosure is a liver cell-specific promoter.

[0217] Any mammalian cell or cell type susceptible to cell culture, and to expression of polypeptides, may be utilized in accordance with the present disclosure, such as, for example, human embryonic kidney (HEK) 293, Chinese hamster ovary (CHO), monkey kidney (COS), HT1080, C10, HeLa, baby hamster kidney (BHK), 3T3, C127, CV-1, HaK, NS / 0, and L-929 cells. Non-limiting examples of mammalian cells that may be used in accordance with the present invention include, but are not limited to, BALB / c mouse myeloma line (NS0 / 1, ECACC No: 85110503); human retinoblasts (PER. C6 (CruCell, Leiden, The Netherlands)); monkey kidney CV1 line transformed by 5V40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol., 36:59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells + / -DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77:4216 (1980)); mouse sertoli cells (TM4, Mather, Biol. Reprod., 23:243-251 (1980)); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1 587); human cervical carcinoma cells (HeLa, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (M[VIT 060562, ATCC CCL51); TRI cells (Mather et al., Annals N. Y. Acad. Sci., 383:44-68 (1982)); MRC 5 cells; F54 cells; and a human hepatoma line (Hep G2).

[0218] In another aspect, the present disclosure provides an isolated cell comprising a nucleic acid molecule encoding a mutant GLUL protein comprising an amino acid sequence set forth in any one of SEQ ID NOs: 64-67, 69-81.

[0219] In another aspect, the present disclosure provides a cell modified to express a mutant AMPK protein described herein. In some embodiments, the mutant AMPK protein comprises an amino acid sequence set forth in any one of SEQ ID NOs: 64-67, 69-81.

[0220] ADAR editing

[0221] The present disclosure provides methods of editing an AMPK polynucleotide encoding an AMPK protein, methods for modulating activity of an AMPK protein, methods for promoting activation of an AMPK protein, methods for regulating energy homeostasis, and methods for treating or preventing an AMPK-associated disease or condition, e.g., metabolic diseases, liver diseases, central nervous system (CNS) diseases, and / or cardiovascular diseases, in a subject. The methods include contacting the AMPK polynucleotide with a guide oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration in the target AMPK polynucleotide.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0222] The disclosure is used to make desired changes in a target sequence, e.g., an AMPK polynucleotide, in a cell or a subject by site-directed editing of nucleotides through the use of an oligonucleotide that is capable of effecting an adenosine deaminase acting on RNA (ADAR)- mediated adenosine to inosine alteration on the AMPK polynucleotide. As a result, the target sequence is edited through an adenosine deamination reaction mediated by ADAR, converting adenosines into inosine

[0223] The changes may be in 5' or 3' untranslated regions of a target RNA, in splice sites, in exons (changing amino acids in protein translated from the target RNA, changing codon usage or splicing behavior by changing exonic splicing silencers or enhancers, and / or introducing or removing start or stop codons), in introns (changing splicing by altering intronic splicing silencers or intronic splicing enhancers, branch points) and in general in any region affecting RNA stability, structure or functioning. The target RNA sequence may comprise a mutation that one may wish to correct or alter, such as a transition or a transversion.

[0224] RNA editing enzymes are known in the art. In some embodiments, the RNA editing enzyme is the adenosine deaminase acting on RNA (ADARs), such as hADARI and hADAR2 in humans or human cells.

[0225] Adenosine deaminases acting on RNA (ADARs) catalyze adenosine (A) to inosine (I) editing of RNA that possesses double-stranded (ds) structure. A-to-l RNA editing results in nucleotide substitution, because I is recognized as G instead of A both by ribosomes and by RNA polymerases. A-to-l substitution can also cause dsRNA destabilization, as 1:11 mismatch base pairs are less stable than A: U base pairs. A-to-l editing occurs with both viral and cellular RNAs, and affects a broad range of biological processes. These include virus growth and persistence, apoptosis and embryogenesis, neurotransmitter receptor and ion channel function, pancreatic cell function, and post-transcriptional gene regulation by microRNAs. Biochemical processes that provide a framework for understanding the physiologic changes following ADAR- catalyzed A-to-l ( = G) editing events include mRNA translation by changing codons and hence the amino acid sequence of proteins; pre-mRNA splicing by altering splice site recognition sequences; RNA stability by changing sequences involved in nuclease recognition; genetic stability in the case of RNA virus genomes by changing sequences during viral RNA replication; and RNA-structure-dependent activities such as microRNA production or targeting or protein- RNA interactions.

[0226] Three human ADAR genes are known, of which two encode active deaminases (ADAR1 and ADAR2). Human ADAR3 (hADAR3) has been described in the prior art, but reportedly has no deaminase activity. Alternative promoters together with alternative splicing give rise to two protein size forms of ADAR1: an interferon-inducible ADAR1-p150 deaminase that binds dsRNA and Z-DNA, and a constitutively expressed ADAR1-p110 deaminase. ADAR2, like ADAR1-p110, is constitutively expressed and binds dsRNA. It is known that only the longer isoform of ADAR1 is capable of binding to the Z-DNA structure that can be comprised in the recruiting portion of the oligonucleotide construct according to the disclosure. Consequently, the level of the 150 kDa isoform present in the cell may be influenced by interferon, particularly interferon-gamma (IFN-gamma). hADARI is also inducible by TNF-Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO alpha. This provides an opportunity to develop combination therapy, whereby interferon-gamma or TNF-alpha and oligonucleotide constructs comprising Z-DNA as recruiting portion according to the disclosure are administered to a patient either as a combination product, or as separate products, either simultaneously or subsequently, in any order. Certain disease conditions may already coincide with increased IFN-gamma or TNF-alpha levels in certain tissues of a patient, creating further opportunities to make editing more specific for diseased tissues.

[0227] Recruiting ADAR to specific sites of selected transcripts and deamination of adenosine regardless of neighboring bases holds great promise for the treatment of disease. In some embodiments, the oligonucleotide that is capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, e.g, a guide oligonucleotide as described herein, further comprises an ADAR-recruiting domain. In some embodiments, the ADAR-recruiting domain comprises nucleotide sequences that may be covalently linked to the oligonucleotides for use in the methods of the instant disclosure and may form stem-loop structures that act as recruitment and binding regions for the ADAR enzyme. Oligonucleotides including such ADAR-recruiting domains may be referred to as “axiomer AONs” or “self-looping AONs.” In some embodiments, the ADAR-recruiting domain does not comprise a stem-loop structure. The ADAR-recruiting domain portion may act to recruit an endogenous ADAR enzyme present in the cell and / or an exogenous ADAR enzyme introduced into the cell for expression. Such ADAR-recruiting domains do not require conjugated entities or presence of modified recombinant ADAR enzymes. Alternatively, the ADAR-recruiting portion may act to recruit a recombinant ADAR fusion protein that has been delivered to a cell or to a subject via an expression vector construct including a polynucleotide encoding an ADAR fusion protein. Such ADAR-fusion proteins may include the deaminase domain of ADAR1 or ADAR2 enzymes fused to another protein, e.g., to the MS2 bacteriophage coat protein. An ADAR-recruiting domain may be a nucleotide sequence based on a natural substrate {e.g., the GluR2 receptor pre-mRNA; such as a GluR2 ADAR-recruiting domain), a Z-DNA structure, or a domain known to recruit another protein which is part of an ADAR fusion protein, e.g., an MS2 ADAR-recruiting domain known to be recognized by the dsRNA binding regions of ADAR. A stem-loop structure of an ADAR-recruiting domain can be an i ntermolecular stem-loop structure, formed by two separate nucleic acid strands, or an intramolecular stem loop structure, formed within a single nucleic acid strand.

[0228] In some embodiments, the ADAR is endogenously expressed in a cell. In some embodiments, the ADAR is exogenous and is introduced into a cell for expression, e.g, via a viral vector, e.g., an AAV vector, or a non-viral delivery system. The cell is selected from the group consisting of a bacterial cell, a eukaryotic cell, a mammalian cell, and a human cell. In principle the disclosure can be used with cells from any mammalian species, but it is preferably used with a human cell.

[0229] The oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, e.g, a guide oligonucleotide as described herein, comprises a nucleic acid sequence complementary to the AMPK mRNA, e.g, a nucleotide sequence selected fromAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO the group consisting of SEQ ID NOs:57-63. In some embodiments, the guide oligonucleotides are complementary to target mRNA with the exception of at least one mismatch (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches). In some embodiments, the oligonucleotides may comprise a nucleic acid sequence complementary to target mRNA with about 5%, about 10%, about 15%, about 20% or about 25% mismatches. The oligonucleotide includes a mismatch opposite the target adenosine.

[0230] Once the oligonucleotide hybridizes to the target mRNA sequence, it forms a double-stranded RNA structure, which can be recognized by ADAR, and facilitates the recruitment of ADAR to the target sequence As a result, ADAR can catalyze the deamination reaction of the specific adenosine on the AMPK polynucleotide into an inosine.

[0231] In some embodiments, the adenosine to inosine alteration substitutes a wild type amino acid in the AMPK protein, e.g., aspartate 317 in the AMPK yl subunit, histidine 151 in the y1 subunit, lysine 71 in the oc1 subunit, and / or lysine 60 in the AMPK a2 subunit.

[0232] In some embodiments, the adenosine to inosine alteration substitutes a wild type aspartate at position 317 of the AMPK y1 subunit with a glycine. In some embodiments, the adenosine to inosine alteration substitutes a wild type histidine at position 151 of the AMPK γ1 subunit with an arginine. In some embodiments, the adenosine to inosine alteration substitutes a wild type lysine at position 71 of the AMPK a1 subunit with an arginine. In some embodiments, the adenosine to inosine alteration substitutes a wild type lysine at position 60 of the AMPK o2 subunit with an arginine. As demonstrated in the Examples, AMPK variants with these mutations remain functional and have an elevated activity level when compared to the wild type AMPK.

[0233] Alternatively, in some embodiments, the adenosine to inosine alteration substitutes a pathogenic amino acid, including any known pathogenic amino acid known in the art for AMPK, with a wild type amino acid, thereby removing the pathogenic or disease causing mutation in AMPK protein.

[0234] In other embodiments, the ADAR-mediated adenosine to inosine alteration substitutes a pathogenic amino acid of the AMPK protein with a restored amino acid, i.e., an amino acid that is not a wild type amino acid at a specific position in a protein, but is an amino acid that constitutes a conservative amino acid substitution of the wild type amino acid at the specific position in the protein, thereby removing the pathogenic or disease causing mutation in AMPK protein. Without wishing to be bound by theory, it is believed that since the pathogenic amino acid is substituted by a restored amino acid, the ADAR-mediated adenosine to inosine alteration allows restoration of the AMPK protein function

[0235] The methods of the present disclosure can be used with any organ, or cells from any organ, e.g. brain, skin, lung, heart, kidney, liver, pancreas, gut, muscle, gland, eye, blood and the like. The disclosure is particularly suitable for modifying sequences in cells, tissues or organs implicated in a diseased state of a (human) subject. Such organsAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO include but are not limited to liver, brain, or heart. Such cells include but are not limited to the cells in brain, e..g, neuron cells, or glial cells.

[0236] The methods of the disclosure can also be used with mammalian cells which are not naturally present in an organism e.g. with a cell line or with an embryonic stem (ES) cell. The methods of the disclosure can be used with various types of stem cells, including pluripotent stem cells, totipotent stem cells, embryonic stem cells, induced pluripotent stem cells, etc.

[0237] The cells can be located in vitro or in vivo. One advantage of the disclosure is that it can be used with cells in situ in a living organism, but it can also be used with cells in culture. In some embodiments cells are treated ex vivo and are then introduced into a living organism (e.g. re-introduced into an organism from whom they were originally derived). In some embodiments, the cell is contacted in vivo. In other embodiments, the cell is ex vivo.

[0238] The methods of disclosure can also be used to edit target RNA sequences in cells within a so-called organoid. Organoids are self-organized three-dimensional tissue structures derived from stem cells. Such cultures can be crafted to replicate much of the complexity of an organ, or to express selected aspects of it like producing only certain types of cells (Lancaster & Knoblich, Sc / ence2014, vol. 345 no. 6194 1247125). In a therapeutic setting they are useful because they can be derived in vitro om a patient's cells, and the organoids can then be re-introduced to the patient as autologous material which is less likely to be rejected than a normal transplant. Thus, according to another preferred embodiment, the disclosure may be practiced on organoids grown from tissue samples taken from a patient (e.g. from their gastrointestinal tract; see Sala etai. J Surg Res. 2009; 156(2):205-12, and Sato etal. Gastroenterology 201 1;141: 1762-72). Upon RNA editing in accordance with the disclosure, the organoids, or stem cells residing within the organoids, may be used to transplant back into the patient to ameliorate organ function.

[0239] In some embodiments, the cells to be treated have a genetic mutation. The mutation may be heterozygous or homozygous. The disclosure can be used to modify point mutations, for example, to correct a G to A mutation. In other embodiments, the cells to be treated do not have a genetic mutation. The disclosure can be used to create point mutations, for example, to generate a A to G mutation.

[0240] Accordingly, the disclosure is not limited to correcting mutations, as it may instead be useful to change a wild-type sequence into a mutated sequence by applying oligonucleotides according to the disclosure. One example where it may be advantageous to modify a wild-type adenosine is to bring about skipping of an exon, for example by modifying an adenosine that happens to be a branch site required for splicing of said exon. Another example is where the adenosine defines or is part of a recognition sequence for protein binding, or is involved in secondary structure defining the stability of the mRNA. In some embodiments, however, the disclosure is used in the opposite way by introducing a disease-associated mutation into a cell line or an animal, in order to provide a useful research tool for the disease in question. As an example of creating a disease model for research purposes, an oligonucleotideAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO sequence described herein provides for the recruitment of editing activity in a human cell to create a mutation in AMPK, e.g., a y1 D317G, yl H151R, a1 K71R, or a2 K60R mutation. As a result, the disclosure can be used to provide research tools for diseases, to introduce new mutations which are less deleterious and even more beneficial than a wild type amino acid or an existing mutation, e.g., promoting activiaton of the AMPK protein.

[0241] A mutation to be reverted through RNA editing may have arisen on the level of the chromosome or some other form of DNA, such as mitochondrial DNA, or RNA, including pre-mRNA, ribosomal RNA or mitochondrial RNA. A change to be made may be in a target RNA of a pathogen, including fungi, yeasts, parasites, kinetoplastids, bacteria, phages, viruses etc, with which the cell or subject has been infected. Subsequently, the editing may take place on the RNA level on a target sequence inside such cell, subject or pathogen. Certain pathogens, such as viruses, release their nucleic acid, DNA or RNA into the cell of the infected host (cell). Other pathogens reside or circulate in the infected host. The oligonucleotide constructs of the disclosure may be used to edit target RNA sequences residing in a cell of the infected eukaryotic host, or to edit a RNA sequence inside the cell of a pathogen residing or circulating in the eukaryotic host, as long as the cells where the editing is to take place contain an editing entity compatible with the oligonucleotide construct administered thereto.

[0242] Without wishing to be bound be theory, the RNA editing through ADAR1 and ADAR2 is thought to take place on pre-mRNAs in the nucleus, during transcription or splicing. Editing of mitochondrial RNA codons or non-coding sequences in mature mRNAs is not excluded.

[0243] Deamination of an adenosine using the oligonucleotides disclosed herein includes any level of adenosine deamination, e.g., at least 1 deaminated adenosine within a target sequence (e.g, at least, 1, 2, 3, or more deaminated adenosines in a target sequence). Adenosine deamination may be assessed by a decrease in an absolute or relative level of adenosines within a target sequence compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g, buffer only control or inactive agent control).

[0244] Because the enzymatic activity of ADAR converts adenosines to inosines, adenosine deamination can alternatively be assessed by an increase in an absolute or relative level of inosines within a target sequence compared with a control level. Similarly, the control level may be any type of control level that is utilized in the art, e.g, pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g, buffer only control or inactive agent control).

[0245] The levels of adenosines and / or inosines within a target sequence can be assessed using any of the methods known in the art for determining the nucleotide composition of a polynucleotide sequence. For example, the relative or absolute levels of adenosines or inosines within a target sequence can be assessed using nucleic acidAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO sequencing technologies including but not limited to Sanger sequencing methods, Next Generation Sequencing (NGS; e.g., pyrosequencing, sequencing by reversible terminator chemistry, sequencing by ligation, and real-time sequencing) such as those offered on commercially available platforms {e.g., Illumina, Qiagen, Pacific Biosciences, Thermo Fisher, Roche, and Oxford Nanopore Technologies). Clonal amplification of target sequences for NGS may be performed using real-time polymerase chain reaction (also known as qPCR) on commercially available platforms from Applied Biosystems, Roche, Stratagene, Cepheid, Eppendorf, or Bio-Rad Laboratories. Additionally or alternatively, emulsion PCR methods can be used for amplification of target sequences using commercially available platforms such as Droplet Digital PCR by Bio-Rad Laboratories.

[0246] In certain embodiments, surrogate markers can be used to detect adenosine deamination within a target sequence. For example, effective treatment of a subject having a genetic disorder involving G-to-A mutations with an oligonucleotide of the present disclosure, as demonstrated by an acceptable diagnostic and monitoring criteria can be understood to demonstrate a clinically relevant adenosine deamination. In certain embodiments, the methods include a clinically relevant adenosine deamination, e.g., as demonstrated by a clinically relevant outcome after treatment of a subject with an oligonucleotide of the present disclosure.

[0247] Adenosine deamination in a gene of interest may be manifested by an increase or decrease in the levels of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a gene of interest is transcribed and which has or have been treated {e.g., by contacting the cell or cells with an oligonucleotide of the present disclosure, or by administering an oligonucleotide of the disclosure to a subject in which the cells are or were present) such that the expression of the gene of interest is increased or decreased, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s) not treated with an oligonucleotide or not treated with an oligonucleotide targeted to the gene of interest). The degree of increase or decrease in the levels of mRNA of a gene of interest may be expressed in terms of:{ RNA is control ce s) •■■■ ( RNA in treated calls)- - ~; — 7T-. - ~ x IGCm( ass A is controt ceils)

[0248] In other embodiments, change in the levels of a gene may be assessed in terms of a reduction of a parameter that is functionally linked to the expression of a gene of interest, e.g., protein expression of the gene of interest or signaling downstream of the protein. A change in the levels of the gene of interest may be determined in any cell expressing the gene of interest, either endogenous or heterologous from an expression construct, and by any assay known in the art.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0249] A change in the level of expression of a gene of interest may be manifested by an increase or decrease in the level of the protein produced by the gene of interest that is expressed by a cell or group of cells (e.g., the level of protein expressed in a sample derived from a subject). As explained above, for the assessment of mRNA suppression, the change in the level of protein expression in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells.

[0250] A control cell or group of cells that may be used to assess the change in the expression of a gene of interest includes a cell or group of cells that has not yet been contacted with an oligonucleotide of the present disclosure. For example, the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an oligonucleotide.

[0251] The level of mRNA of a gene of interest that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of a gene of interest in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the gene of interest. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol / guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNEASY™ RNA preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern blotting, in situ hybridization, and microarray analysis. In some embodiments, the level of expression of the gene of interest is determined using a nucleic acid probe. The term "probe," as used herein, refers to any molecule that is capable of selectively binding to a specific sequence, e.g. to an mRNA or polypeptide. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

[0252] Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PCR) analyses, and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to the mRNA of a gene of interest. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an AFFYMETRIX gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of mRNA of a gene of interest.

[0253] An alternative method for determining the level of expression of a gene of interest in a sample involves the process of nucleic acid amplification and / or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR, ligase chain reaction, self- sustained sequence replication, transcriptional amplificationAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO system, Q-Beta Replicase, rolling circle replication or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.

[0254] The expression levels of mRNA of a gene of interest may be monitored using a membrane blot (such as used in hybridization analysis such as northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support including bound nucleic acids). The determination of gene expression level may also include using nucleic acid probes in solution.

[0255] In some embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). Such methods can also be used for the detection of nucleic acids of the gene of interest.

[0256] The level of protein produced by the expression of a gene of interest may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescentassays, electrochemiluminescence assays, and the like. Such assays can also be used for the detection of proteins indicative of the presence or replication of proteins produced by the gene of interest. Additionally, the above assays may be used to report a change in the mRNA sequence of interest that results in the recovery or change in protein function thereby providing a therapeutic effect and benefit to the subject, treating a disorder in a subject, and / or reducing of symptoms of a disorder in the subject.

[0257] Method of T reatment

[0258] The present disclosure also includes methods for regulating energy homeostasis, methods for inhibiting synthesis of fatty acids and / or cholesterol, methods for promoting fatty acid oxidation, methods for reducing accumulation of lipids, methods for inhibiting gluconeogenesis and / or glycogen synthesis, methods for promoting glucose uptake and / or glycolysis, methods for improving insulin sensitivity, and / or methods for reducing insulin resistance in a subject in need thereof. The present disclosure further provide methods for treating or preventing an AMPK-associated disease or disorder, e.g., metabolic diseases, liver diseases, central nervous system (CNS) diseases, and / or cardiovascular diseases. For example, the methods of the disclosure may be used to treat or prevent any AMPK-associated disorders which may be caused by a guanosine to adenosine mutation, the introduction of a premature stop codon, an abnormal activity level of a target protein, or expression of an undesired protein. In some embodiments, the oligonucleotides for use in the methods of the disclosure, when introduced to aAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO cell or a subject, can result in correction of a guanosine to adenosine mutation. In some embodiments, the oligonucleotides for use in the methods of the disclosure can result in turning off of a premature stop codon so that a desired protein is expressed. In some embodiments, the oligonucleotides for use in the methods of the disclosure can result in an elevated level of activity for a target protein.

[0259] In some embodiments, the oligonucleotides for use in the methods of the disclosure can result in inhibition of expression of an undesired protein.

[0260] In one aspect, the present disclosure is directed to a method of regulating energy homeostasis in a subject in need thereof. The method comprises contacting an AMPK polynucleotide in a cell of the subject with a guide oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, thereby regulating energy homeostasis.

[0261] In another aspect, the present disclosure is directed to a method of inhibiting synthesis of fatty acids and / or cholesterol, promoting fatty acid oxidation, and / or reducing accumulation of lipids in a subject in need thereof. The method comprises contacting an AMPK polynucleotide in a cell of the subject with a guide oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucletide, thereby inhibiting synthesis of fatty acids and / or cholesterol, promoting fatty acid oxidation, and / or reducing accumulation of lipids.

[0262] In yet another aspect, the present disclosure provides a method of inhibiting gluconeogenesis and / or glycogen synthesis, promoting glucose uptake and / or glycolysis, improving insulin sensitivity, and / or reducing insulin resistance in a subject in need thereof. The method comprises contacting an AMPK polynucleotide in a cell of the subject with a guide oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, thereby inhibiting gluconeogenesis and / or glycogen synthesis, promoting glucose uptake and / or glycolysis, improving insulin sensitivity, and / or reducing insulin resistance.

[0263] In another aspect, the present disclosure provides a method of inhibiting gluconeogenesis and / or glycogen synthesis, promoting glucose uptake and / or glycolysis, improving insulin sensitivity, and / or reducing insulin resistance in a cell, the method comprising contacting the cell with the nucleic acid molecule encoding a mutant AMPK protein described herein, or a mutant AMPK protein described herein,. thereby inhibiting gluconeogenesis and / or glycogen synthesis, promoting glucose uptake and / or glycolysis, improving insulin sensitivity, and / or reducing insulin resistance.

[0264] In one aspect, the present disclosure is directed to a method of regulating energy homeostasis in a subject in need thereof. The method comprises contacting the AMPK polynucleotide in a cell with a guide oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, and administering the cell to the subject, thereby regulating energy homeostasis.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0265] In another aspect, the present disclosure is directed to a method of inhibiting synthesis of fatty acids and / or cholesterol, promoting fatty acid oxidation, and / or reducing accumulation of lipids in a subject in need thereof. The method comprises contacting the AMPK polynucleotide in a cell with a guide oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, and administering the cell to the subject, thereby inhibiting synthesis of fatty acids and / or cholesterol, promoting fatty acid oxidation, and / or reducing accumulation of lipids. In yet another aspect, the present disclosure provides a method of inhibiting gluconeogenesis and / or glycogen synthesis, promoting glucose uptake and / or glycolysis, improving insulin sensitivity, and / or reducing insulin resistance in a subject in need thereof.

[0266] In another aspect, the disclosure provides a method of inhibiting synthesis of fatty acids and / or cholesterol, promoting fatty acid oxidation, and / or reducing accumulation of lipids in a cell, the method comprising contacting the cell with the nucleic acid molecule encoding a mutant AMPK protein described herein, or a mutant AMPK protein described herein,. thereby inhibiting synthesis of fatty acids and / or cholesterol, promoting fatty acid oxidation, and / or reducing accumulation of lipids

[0267] In some embodiments, the methods comprise contacting the AMPK polynucleotide in a cell with a guide oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, and administering the cell to the subject, thereby inhibiting gluconeogenesis and / or glycogen synthesis, promoting glucose uptake and / or glycolysis, improving insulin sensitivity, and / or reducing insulin resistance.

[0268] In some embodiments, the levels of lipid / fatty acids / cholesterols, the levels of glucose and insulin sensitivity can be measured and monitored using standard clinical lab tests known in the art. For example, methods of diagnostic measurement include, but are not limited to, blood test, urine test, liver biopsy, ultrasound scan, computed tomography (CT) scan, magnetic resonance imaging (MRI), electropyography (EMG) and nerve conduction study; spinal tap / lumbar puncture, X-rays, positron emission tomography (PET), myelogram of cervical spine, muscle and / or nerve biopsy, or neurological examination.

[0269] In one aspect, the present disclosure is directed to a method of treating an AMPK- associated disease or condition in a subject in need thereof. The method comprises contacting an AMPK polynucleotide in a cell of the subject with a guide oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, thereby treating the subject.

[0270] In another aspect, the present disclosure is directed to a method of treating an AMPK- associated disease or condition in a subject in need thereof. The method comprises contacting an AMPK polynucleotide in a cell with a guide oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, and administering the cell to the subject, thereby treating the subject.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0271] In another aspect, the disclosure provides a method of treating an AMPK-associated disease or condition in a subject in need thereof, the method comprising contacting exposing the subject to a nucleic acid molecule encoding a mutant AMPK [protein described herein or a mutant AMPK protein described herein in a cell of the subject thereby treating the AMPK-associated disease or condition.

[0272] In some embodiments, the subject is a human subject.

[0273] The methods of the disclosure may also include a step of identifying a subject with an AMPK-associated disease in a subject in need thereof. In some embodiments, the subject may have a single nucleotide polymorphism (SNP) associated with the AMPK-associated disease in an AMPK polynucleotide. Specifically, the methods of the disclosure include a step of identifying the presence of the desired nucleotide change or SNPs in the target RNA sequence, thereby verifying that the target RNA sequence has the disease causing mutations to be corrected or edited. This step will typically involve sequencing of the relevant part of the target RNA sequence, or a cDNA copy thereof (or a cDNA copy of a splicing product thereof, in case the target RNA is a pre-mRNA), and the sequence change can thus be easily verified. The presence of a desired nucleotide change of SNPs can also be detected by sequencing the genomic DNA isolated from cells or DNA fragments present in a sample, e.g, a blood sample. Alternatively the modifications may be assessed on the level of the protein (length, glycosylation, function or the like), or by some functional read-out.

[0274] In some embodiments, the methods disclosed herein also include contacting the AMPK polynucleotides in a cell or a subject (including a subject identified as being in need of such treatment, or a subject suspected of being at risk of disease and in need of such treatment) with a guide oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration on the AMPK polynucleotide, as described herein.

[0275] In some embodiments, the guide oligonucleotides for use in the methods of the disclosure are designed to specifically target the AMPK gene of a subject (e.g., a human patient) in need thereof, and effect an ADAR-mediated adenosine to inosine alteration in the AMPK gene. In some embodiments, the guide oligonucleotides are capable of recruiting the ADAR to the target mRNA, which then catalyze deamination of target adenosines in the target mRNA. Such treatment will be suitably introduced to a subject, particularly a human subject, suffering from, having, susceptible to, or at risk for developing an AMPK-associated disease. The compositions disclosed herein may be also used in the treatment of any other disorders in which AMPK-associated disease may be implicated.

[0276] In one embodiment, the disclosure provides a method of monitoring treatment progress. The method includes the step of determining a level of diagnostic marker (e.g, SNP associated with an AMPK-associated disease) or diagnostic measurement (e.g, screen, assay) in a subject suffering from or susceptible to developing the AMPK-associated disease, or symptoms associated with the AMPK-associated disease in which the subject hasAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO been administered a therapeutic amount of a composition disclosed herein sufficient to treat the disease or symptoms thereof. The level of marker (e.g., the blood glucose, insulin, triglyceride, or cholesterol level) determined in the method can be compared to known levels of marker in either healthy normal controls or in other afflicted patients to establish the subject’s disease status. In preferred embodiments, a second level of marker in the subject is determined at a time point later than the determination of the first level, and the two levels are compared to monitor the course of disease or the efficacy of the therapy. In certain preferred embodiments, a pre-treatment level of marker in the subject is determined prior to beginning treatment according to this disclosure; this pre-treatment level of marker can then be compared to the level of marker in the subject after the treatment commences, to determine the efficacy of the treatment. Other methods of diagnostic measurement include, but are not limited to, blood test, urine test, liver biopsy, ultrasound scan, computed tomography (CT) scan, magnetic resonance imaging (MRI), electropyography (EMG) and nerve conduction study; spinal tap / lumbar puncture, X-rays, positron emission tomography (PET), myelogram of cervical spine, muscle and / or nerve biopsy, or neurological examination.

[0277] In some embodiments, cells are obtained from the subject and contacted with an oligonucleotide composition of the disclosure as provided herein. In some embodiments, the cell is autologous, allogenic, or xenogenic to the subject. In some embodiments, cells removed from a subject and contacted ex vivo with an oligonucleotide composition of the disclosure are re- introduced into the subject, optionally after the desired genomic modification has been effected or detected in the cells.

[0278] In some embodiments, the oligonucleotide for use in the methods of the present disclosure is introduced to a subject such that the oligonucleotide is delivered to a specific site within the subject. The change in the expression of the gene of interest may be assessed using measurements of the level or change in the level of mRNA or protein produced by the gene of interest in a sample derived from a specific site within the subject.

[0279] In other embodiments, the oligonucleotide is introduced into the cell or the subject in an amount and for a time effective to result in one of (or more, e.g., two or more, three or more, four or more of: (a) decrease the number of adenosines within a target sequence of the gene of interest, (b) decrease the number of pathogenic mutations in the target protein, e.g., AMPK, or the proportion of target protein comprising the pathogenic mutations, (c) delayed onset of an AMPK-associated disease, (d) increased survival of subject,, (e) recovery or change in protein function, and (f) reduction in one or more of symptoms related to an AMPK-associated disease, such as increased blood pressure, high blood sugar, excess body fat around the waist, and abnormal cholesterol or triglyceride, abdominal swelling,.

[0280] Treating disorders associated with G-to-A mutations can also result in a decrease in the mortality rate of a population of treated subjects in comparison to an untreated population. For example, the mortality rate is decreased by more than 2% (e.g., more than 5%, 10%, or 25%). A decrease in the mortality rate of a population of treated subjects may be measured by any reproducible means, for example, by calculating for a population the averageAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO number of disease-related deaths per unit time following initiation of treatment with a compound or pharmaceutically acceptable salt of a compound described herein. A decrease in the mortality rate of a population may also be measured, for example, by calculating for a population the average number of disease-related deaths per unit time following completion of a first round of treatment with a compound or pharmaceutically acceptable salt of a compound described herein.

[0281] Methods of Administration

[0282] The delivery of an oligonucleotide for use in the methods of the disclosure to a cell, e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having an AMPK-associated disease) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an oligonucleotide of the disclosure either in vitro or in vivo. Contacting a cell in vitro may be done, for example, by incubating the cell with the oligonucleotide. In vivo delivery may be performed directly by administering a composition including an oligonucleotide to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the oligonucleotide. Contacting a cell in vivo may be done, for example, by injecting the oligonucleotide into or near the tissue where the cell is located, or by injecting the oligonucleotide into another area, e.g., the liver or the central nervous system (CNS), optionally via intrathecal, intravitreal or other injection, or to the bloodstream or the subcutaneous space, such that the oligonucleotide will subsequently reach the tissue where the cell to be contacted is located. Combinations of in vitro and in vivo methods of contacting a cell are also possible.

[0283] The delivery of an oligonucleotide to a cell may be direct or indirect. Furthermore, the oligonucleotides may be conjugated to a targeting ligand or a targeting moiety, including any ligand described herein or known in the art. In some embodiments, the targeting ligand is a carbohydrate moiety, e.g., GalNAc3 ligand, or any other ligand that directs the oligonucleotide to a site of interest, for example, the liver. In other embodiments, the targeting ligand is a lipophilic moiety or any other ligand that directs the delivery of the oligonucleotide to the CNS or the brain (e.g., neurons).

[0284] Contacting of a cell with an oligonucleotide may be done in vitro or in vivo. Known methods can be adapted for use with an oligonucleotide of the disclosure (see e.g., Akhtar S. and Julian R L, (1992) Trends Cell. Biol.2(5): 139-144 and WO94 / 02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider in order to deliver an oligonucleotide molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue. The non-specific effects of an oligonucleotide can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that canAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the oligonucleotide molecule to be administered.

[0285] For administering an oligonucleotide systemically for the treatment of a disease, the oligonucleotide can include alternative nucleobases, alternative sugar moieties, and / or alternative internucleoside linkages, or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the oligonucleotide by endo- and exo-nucleases in vivo.

[0286] Modification of the oligonucleotide or the pharmaceutical carrier can also permit targeting of the oligonucleotide composition to the target tissue and avoid undesirable off-target effects. Oligonucleotide molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. In an alternative embodiment, the oligonucleotide can be delivered using drug delivery systems such as a nanoparticle, a lipid nanoparticle, a polyplex nanoparticle, a lipoplex nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an oligonucleotide molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an oligonucleotide by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an oligonucleotide, or induced to form a vesicle or micelle that encases an oligonucleotide. The formation of vesicles or micelles further prevents degradation of the oligonucleotide when administered systemically. In general, any methods of delivery of nucleic acids known in the art may be adaptable to the delivery of the oligonucleotides of the disclosure. Methods for making and administering cationic oligonucleotide complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, D R., et al. (2003) J. Mol. Biol 327:761-766, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of oligonucleotides include DOTAP, Oligofectamine, "solid nucleic acid lipid particles", cardiolipin, polyethyleneimine, Arg-Gly-Asp (RGD) peptides, and polyamidoamines. In some embodiments, an oligonucleotide forms a complex with cyclodextrin for systemic administration. In some embodiments the oligonucleotides of the disclosure are delivered by polyplex or lipoplex nanoparticles.

[0287] The guide oligonucleotides can be delivered in a manner to target a particular tissue, such as the liver, the kidney, the eye, the central nervous system (CNS) (e.g., neuronal, glial or vascular tissue of the brain). In some embodiments, the guide oligonucleotides are administered via intrathecal injection, i.e., injection into the spinal fluid which bathes the brain and spinal cord tissue.

[0288] Intrathecal injection of guide oligonucleotides into the spinal fluid can be performed as a bolus injection or via minipumps which can be implanted beneath the skin, providing a regular and constant delivery of oligonucleotides into the spinal fluid. The circulation of the spinal fluid from the choroid plexus, where it is produced, down around the spinal chord and dorsal root ganglia and subsequently up past the cerebellum and over the cortex to the arachnoidAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO granulations, where the fluid can exit the CNS, that, depending upon size, stability, and solubility of the compounds injected, molecules delivered intrathecally could hit targets throughout the entire CNS.

[0289] In some embodiments, the intrathecal administration is via a pump. The pump may be a surgically implanted osmotic pump. In one embodiment, the osmotic pump is implanted into the subarachnoid space of the spinal canal to facilitate intrathecal administration. In some embodiments, the oligonucleotides are administered intrathecally during a lumbar puncture procedure.

[0290] In some embodiments, the intrathecal administration is via an intrathecal delivery system for a pharmaceutical including a reservoir containing a volume of the pharmaceutical agent, and a pump configured to deliver a portion of the pharmaceutical agent contained in the reservoir. More details about this intrathecal delivery system may be found in WO 2015 / 116658, which is incorporated by reference in its entirety.

[0291] Membranous Molecular Assembly Delivery Methods

[0292] Oligonucleotides for use in the methods of the disclosure can also be delivered using a variety of membranous molecular assembly delivery methods including polymeric, biodegradable microparticle, or microcapsule delivery devices known in the art. For example, a colloidal dispersion system may be used for targeted delivery an oligonucleotide agent described herein. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

[0293] The oligonucleotide for use in the methods of the disclosure can also be provided as micellar formulations. Micelles are a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.

[0294] Lipid Nanoparticle-Based Delivery Methods

[0295] Oligonucleotides for use in the methods of in the disclosure may be fully encapsulated in a lipid formulation, e.g., a lipid nanoparticle (LNP), or other nucleic acid-lipid particles. LNPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites {e.g., sites physically separated from the administration site). LNPs include "pSPLP," which include an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00 / 03683. The particles of the present disclosure typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid-lipid particles of the present disclosure are resistant in aqueous solution to degradation with a nuclease. Nucleic acid-lipidAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO particles and their method of preparation are disclosed in, e.g., U. S. Pat. Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; U. S. Publication No. 2010 / 0324120 and PCT Publication No. WO 96 / 40964.

[0296] In one embodiment, the lipid to drug ratio (mass / mass ratio) (e.g, lipid to oligonucleotide ratio) will be in the range of from about 1:1 to about 50: 1, from about 1: 1 to about 25: 1, from about 3: 1 to about 15: 1, from about 4: 1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the above recited ranges are also contemplated to be part of the disclosure.

[0297] Non-limiting examples of cationic lipid include N, N-dioleyl-N, N-dimethylammonium chloride (DODAC), N, N-distearyl-N, N-dimethylammonium bromide (DDAB), N- (l-(2,3- dioleoyloxy)propyl)-N, N, N-trimethylammonium chloride (DOTAP), N- (l-(2,3- dioleyloxy)propyl)-N, N, N-trimethylammonium chloride (DOTMA), N, N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-DiLinoleyloxy-N, N-dimethylaminopropane (DLinDMA), 1,2-Dilinolenyloxy-N, N-dimethylaminopropane (DLenDMA), 1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleyoxy-3- (dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyoxy-3-morpholinopropane (DLin- MA), 1,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-Dilinoleylthio-3- dimethylaminopropane (DLin-S-DMA), 1-Li noleoy I-2-I i noleyloxy-3-d i methyl ami nopropane (DLin-2-DMAP), 1, 2-Di I i noleyloxy-3-tri methylami nopropane chloride salt (DLin-TMA. CI), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP. CI), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N, N-Dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N, N-Dioleylamino)-1,2-propanedio (DOAP), 1,2-Dilinoleyloxo-3-(2-N, N- dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-Dilinolenyloxy-N, N- dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N, N-dimethyl-2,2-di((9Z, 12Z)-octadeca-9,12- dienyetetrahydro— 3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)- heptatriaconta-6,9,28,31-tetraen-19-yl4-(dimethylamino)bu- tanoate (MC3), 1, 1 '-(2-(4-(2-((2- (bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)ami-no)ethyl)piperazin-1- yeethylazanediyedidodecan-2-ol (Tech G1), or a mixture thereof. The cationic lipid can include, for example, from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the particle.

[0298] The ionizable / non-cationic lipid can be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE- mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1- trans PE, 1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, or a mixture thereof.

[0299] The non-cationic lipid can be, for example, from about 5 mol % to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol is included, of the total lipid present in the particle.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0300] The conjugated lipid that inhibits aggregation of particles can be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof. The PEG-DAA conjugate can be, for example, a PEG-dil auryloxy propyl (Ci2), a PEG- dimyristyloxypropyl (Ci4), a PEG-dipalmityloxy propyl (Ci6), or a PEG-distearyloxy propyl (C]8). The conjugated lipid that prevents aggregation of particles can be, for example, from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle.

[0301] In some embodiments, the nucleic acid-lipid particle further includes cholesterol at, e.g, about 10 mol % to about 60 mol % or about 50 mol % of the total lipid present in the particle.

[0302] Combination Therapies

[0303] A method of the disclosure can be used alone or in combination with an additional therapeutic agent, e.g., other agents that treat the same disorder, e.g., AMPK-associated disease, or symptoms associated therewith, or in combination with other types of therapies to the disorder. In combination treatments, the dosages of one or more of the therapeutic compounds may be reduced from standard dosages when administered alone. For example, doses may be determined empirically from drug combinations and permutations or may be deduced by isobolographic analysis. Dosages of the compounds when combined should provide a therapeutic effect.

[0304] In some embodiment, the second therapeutic agent is an AMPK activator. In some embodiments, the AMPK activator is selected from the group consisting of Metformin, Thiazolidinediones, Adiponectin, Leptin, Ciliary Neurotrophic Factor (CNTF), Ghrelin / cCannabinoids, lnterleukin-6, al pha-Lipoic Acid alkaloids, bitter melon extracts, resveratrol, epigallocathechin gallate, berberine, quercetin, ginsenoside, curcumin, caffeic acid, henethyl ester, theaflavin, A-769662, PT1, Thienopyridone derivatives, imidazole derivatives, and thiazole derivatives.

[0305] In some embodiments, the second therapeutic agent is an antidepressant, an antipsychotic, or a cholinesterase inhibitor. In some embodiments, the second therapeutic agent is Riluzole, Edaravone, or Sodium phenylbutyrate and taurursodiol.

[0306] The second agent may also be a therapeutic agent which is a non-drug treatment. For example, the second agent may be a therapy, e.g., a physical therapy, an occupational therapy, or a speech therapy.

[0307] In any of the combination embodiments described herein, the first and second therapeutic agents are administered simultaneously or sequentially, in either order. The first therapeutic agent may be administered immediately, up to 1 hour, up to 2 hours, up to 3 hours, up to 4 hours, up to 5 hours, up to 6 hours, up to 7 hours, up to, 8 hours, up to 9 hours, up to 10 hours, up to 11 hours, up to 12 hours, up to 13 hours, 14 hours, up to hours 16, up to 17 hours, up 18 hours, up to 19 hours up to 20 hours, up to 21 hours, up to 22 hours, up to 23 hours up to 24 hours or up to 1-7, 1-14, 1-21 or 1-30 days before or after the second therapeutic agent.Attorney Docket No.: 33791 / 41032 Korro Ref.: KB-032-WO

[0308] Compositions of the Disclosure

[0309] The compositions of the present disclosure include a guide oligonucleotide capable of effecting anadenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration in the AMPK gene.

[0310] The oligonucleotides, or guide oligonucleotides of the disclosure may be utilized to deaminate target adenosines on a specific mRNA, e.g., an adenosine which may be deaminated to produce a therapeutic result, e.g., in a subject in need thereof.

[0311] Examples of modifications resulting from deamination of target adenosines within target codon are provided in Table 1 below.

[0312] Table 1.Amino Acid Encoded by Target Amino Acid Encoded by Target Codon Modified CodonCodon Modified Codon Lys GluAAA IAAArgAIAGlyIIAArgAllGluIAIGlyIIIAsn AspAAC IACSerAICGlyIICLys GluAAG IAGArgAIGGlyIIGArg AspAAUIAUSerAIUAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO GlyIIUThr AlaACA ICAAlaICIThr AlaACC ICCThr AlaACG ICGThr AlaACU ICUArg GlyAGA IGAGlyIGISer GlyAGC IGCArg GlyAGG IGGSer GlyAGU IGUlie AspAUA IUAMetAUIVaiIUIIle ValAUC IUCMet ValAUG IUGIle ValAUU IUUGin ArgCAA CIAArgCllHis ArgCAC CICGin ArgCAG CIGHis ArgCAU CIUAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO Glu GlyGAA GIAGlyGilAsp GlyGAC GICGlu GlyGAG GIGAsp GlyGAU GIUStop TrpUAA UIIStop TrpUGA UGITyr CysUAC UICStop TrpUAG UIGTyr CysUAU UIU

[0313] Because the deamination of the adenosine to an inosine may result in a protein that no longer bears the mutated A at the target position, the identification of the deamination into inosine may be a functional read-out, for instance an assessment on whether a functional protein is present, or even the assessment that a disease that is caused by the presence of the adenosine is (partly) reversed. The functional assessment for each of the diseases mentioned herein will generally be according to methods known to the skilled person. When the presence of a target adenosine causes aberrant splicing, the read-out may be the assessment of whether the aberrant splicing is still taking place, or not, or less. On the other hand, when the deamination of a target adenosine is wanted to introduce a splice site, then similar approaches can be used to check whether the required type of splicing is indeed taking place. A very suitable manner to identify the presence of an inosine after deamination of the target adenosine is of course RT-PCR and sequencing, using methods that are well-known to the person skilled in the art.

[0314] In general, mutations in any target RNA that can be reversed using oligonucleotide constructs according to the disclosure are G-to-A mutations, and oligonucleotide constructs can be designed accordingly. Mutations that may be targeted using oligonucleotide constructs according to the disclosure also include C to A, U to A (T to A on the DNA level) in the case of recruiting adenosine deaminases. Although RNA editing in the latter circumstances may not necessarily revert the mutation to wild-type, the edited nucleotide may give rise to an improvement over the original mutation. For example, a mutation that causes an in frame stop codon - giving rise to a truncated protein, upon translation - may be changed into a codon coding for an amino acid that may not be the original amino acid inAttorney Docket No.: 33791 / 41032 Korro Ref.: KB-032-WO that position, but that gives rise to a (full length) protein with at least some functionality, at least more functionality than the truncated protein.

[0315] The oligonucleotides, or guide oligonucleotides of the disclosure may be utilized to deaminate target adenosines on a specific mRNA to generate a restored amino acid. Exemplary restored amino acids of the disclosure are described in Table 2 below.

[0316] Table 2.Wild type amino Conservative amino acid Restored amino acid acid substitutionAianine (Ala, A) Ser, Thr, Pro, Gly Ser, Gly Arginine (Arg, R) His, Lys - Asparagine (Asn, N) Asp, Glu, Gin Asp, Glu Aspartic Acid (Asp, D) Asn, Glu, Gin Glu Cysteine (Cys, C) Met, Leu, lie, Vai Met Glutamine (Gin, Q) Asp, Asn, Glu Asp, Glu Glutamic Acid (Glu, E) Asp, Asn, Glu Asp, Glu Glycine (Gly, G) Ala, Ser, Thr, Pro Ala, Ser Histidine (His, H) Arg, Lys Arg Isoleucine (lie, I) Met, Leu, Vai, Cys Met, Vai, Cys Leucine (Leu, L) Met, lie, Vai, Cys Met, Vai, Cys Lysine (Lys, K) His, Arg Arg Methionine (Met, M) Leu, lie, Vai, Cys Vai, Cys Phenylalanine (Phe, Tyr, Trp Trp F)Proline (Pro, P) Ala, Ser, Thr, Gly Ala, Ser, Gly Serine (Ser, S) Ala, Thr, Pro, Gly Ala, Gly Threonine (Thr, T) Ala, Ser, Pro, Gly Ala, Ser, Gly Tryptophan (Trp, W) Phe, Tyr - Tyrosine (Tyr, Y) Phe, Trp Trp Valine (Vai, V) Met, Leu, lie, Cys Met, CysAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0317] In some embodiments, the restored amino acid is selected from the group consisting of serine, glycine, aspartic acid, glutamic acid, methionine, alanine, arginine, valine, cysteine, and tryptophan. In some embodiments, the restored amino acid is serine. In some embodiments, the restored amino acid is glycine. In some embodiments, the restored amino acid is aspartic acid. In some embodiments, the restored amino acid is glutamic acid. In some embodiments, the restored amino acid is methionine. In some embodiments, the restored amino acid is alanine. In some embodiments, the restored amino acid is arginine. In some embodiments, the restored amino acid is valine. In some embodiments, the restored amino acid is cysteine. In some embodiments, the restored amino acid is tryptophan.

[0318] In some embodiments, the restored amino acid restores the function of a pathogenic AMPK protein. In some embodiments, the restored amino acid restores at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% of the function of a pathogenic AMPK protein. In some embodiments, the restored amino acid restores at least 5% of the function of a pathogenic AMPK protein In some embodiments, the restored amino acid restores at least 10% of the function of a pathogenic AMPK protein. In some embodiments, the restored amino acid restores at least 20% of the function of a pathogenic AMPK protein. In some embodiments, the restored amino acid restores at least 30% of the function of a pathogenic AMPK protein. In some embodiments, the restored amino acid restores at least 40% of the function of a pathogenic AMPK protein. In some embodiments, the restored amino acid restores at least 50% of the function of a pathogenic AMPK protein. In some embodiments, the restored amino acid restores at least 60% of the function of a pathogenic AMPK protein In some embodiments, the restored amino acid restores at least 70% of the function of a pathogenic AMPK protein. In some embodiments, the restored amino acid restores at least 80% of the function of a pathogenic AMPK protein. In some embodiments, the restored amino acid restores at least 90% of the function of a pathogenic AMPK protein. In some embodiments, the restored amino acid restores 100% of the function of a pathogenic AMPK protein.

[0319] In some embodiments, the restored amino acid modulates the function of a wild type AMPK protein. In some embodiments, the restored amino acid modulates at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% of the function of a wild type AMPK protein. In some embodiments, the restored amino acid modulates at least 5% of the function of a wild type AMPK protein In some embodiments, the restored amino acid modulates at least 10% of the function of a wild type AMPK protein. In some embodiments, the restored amino acid modulates at least 20% of the function of a wild type AMPK protein. In some embodiments, the restored amino acid modulates at least 30% of the function of a wild type AMPK protein. In some embodiments, the restored amino acid modulates at least 40% of the function of a wild type AMPK protein. In some embodiments, the restored amino acid modulates at least 50% of the function of a wild type AMPK protein. In some embodiments, the restored amino acid modulates at least 60% of the function of a wild type AMPK protein In some embodiments, the restored amino acid modulates at least 70% of the function of a wild type AMPKAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO protein. In some embodiments, the restored amino acid modulates at least 80% of the function of a wild type AMPK protein. In some embodiments, the restored amino acid modulates at least 90% of the function of a wild type AMPK protein. In some embodiments, the restored amino acid modulates 100% of the function of a wild type AMPK protein

[0320] Oligonucleotide Agents

[0321] The oligonucleotides of the present disclosure are complementary to target mRNA sequence, e.g., AMPK. In some embodiments, the guide oligonucleotides are complementary to target mRNA with the exception of at least one mismatch. The oligonucleotide includes a mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise 2 mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise 3 mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise 4 mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise 5 mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise 6 mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise 7 mismatches to the target sequence, with 1 mismatch opposite the target adenosine In some embodiments, the guide oligonucleotides comprise 8 mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise 9 mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise 10 mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise about 5% mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise about 10% mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise about 15% mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise about 20% mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise about 25% mismatches to the target sequence, with 1 mismatch opposite the target adenosine.

[0322] The guide oligonucleotides are also capable of recruiting adenosine deaminase acting on RNA (ADAR) enzymes to deaminate selected adenosines on the target mRNA. In some embodiments, the oligonucleotide further comprises one or more ADAR-recruiting domains. In some embodiments, only one adenosine is deaminated. In some embodiments, 1, 2, or 3 adenosines are deaminated.

[0323] The guide oligonucleotides are capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration of an AMPK polynucleotide, wherein the adenosine to inosine alteration promotes activation of the AMPK protein.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0324] In some embodiments, the adenosine to inosine alteration substitutes a wild type amino acid in the AMPK protein, e.g, aspartate 317 in the AMPK y1 subunit, histidine 151 in the y1 subunit, lysine 71 in the α1 subunit, and / or lysine 60 in the AMPK a2 subunit.

[0325] In some embodiments, the adenosine to inosine alteration substitutes a wild type aspartate at position 317 of the AMPK y1 subunit with a glycine

[0326] In some embodiments, the adenosine to inosine alteration substitutes a wild type histidine at position 151 of the AMPK γ1 subunit with an arginine.

[0327] In some embodiments, the adenosine to inosine alteration substitutes a wild type lysine at position 71 of the AMPK a1 subunit with an arginine.

[0328] In some embodiments, the adenosine to inosine alteration substitutes a wild type lysine at position 60 of the AMPK a2 subunit with an arginine.

[0329] The guide oligonucleotides are also capable of recruiting adenosine deaminase acting on RNA (ADAR) enzymes to deaminate selected adenosines on the target mRNA, wherein the adenosine to inosine alteration substitutes a pathogenic amino acid with a wild type amino acid or a restored amino acid.

[0330] The oligonucleotides for use in the methods of the disclosure may further include modifications (e.g., alternative nucleotides) to increase stability and / or increase deamination efficiency.

[0331] Whenever reference is made to nucleotides in the guide oligonucleotide, such as cytosine, 5-methylcytosine, 5-hydroxymethylcytosine, Pyrrolocytidine, and -D-Glucosyl-5-hydroxy- methylcytosine are included; when reference is made to adenine, 2-aminopurine, 2,6-diaminopurine, 3-deazaadenosine, 7-deazaadenosine, 8-azidoadenosine, 8-methyladenosine, 7- aminomethyl-7-deazaguanosine, 7-deazaguanosine, N6-Methyladenine and 7-methyladenine are included; when reference is made to uracil, 5-methoxyuracil, 5-methyluracil, dihydrouracil, pseudouracil, and thienouracil, dihydrouracil, 4-thiouracil and 5-hydroxymethyluracil are included; when reference is made to guanosine, 7-methylguanosine, 8-aza-7-deazaguanosine, thienoguanosine and 1 -methylguanosine are included.

[0332] Whenever reference is made to nucleosides or nucleotides, ribofuranose derivatives, such as 2'- deoxy, 2'-hydroxy, 2-fl uororibose and 2'-0-su bsti tuted variants, such as 2-0-methy I, are included, as well as other modifications, including 2-4' bridged variants.

[0333] Whenever reference is made to oligonucleotides, linkages between two mono-nucleotides may be phosphodiester linkages as well as modifications thereof, including, phosphodiester, phosphotriester, phosphoro(di)thioate, methylphosphonate, phosphor-amidate linkers, and the like.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0334] Modifications

[0335] A guide oligonucleotide according to the present disclosure may be chemically modified in its entirety, for example by modifying all nucleotides with a 2'-O-methylated sugar moiety (2'-OMe). Various chemistries and modifications are known in the field of oligonucleotides that can be readily used in accordance with the disclosure. The regular internucleosidic linkages between the nucleotides may be altered by mono- or di-thioation of the phosphodiester bonds to yield phosphorothioate esters or phosphorodithioate esters, respectively. Other modifications of the internucleosidic linkages are possible, including amidation and peptide linkers. In some embodiments, the guide oligonucleotides of the present disclosure have one, two, three, four or more phosphorothioate linkages. It will be understood by the skilled person that the number of such linkages may vary on each end, depending on the target sequence, or based on other aspects, such as toxicity.

[0336] The ribose sugar may be modified by substitution of the 2'-0 moiety with a lower alkyl (C1-4, such as 2'-0-methyl), alkenyl (C2-4), alkynyl (C2-4), methoxyethyl (2-O-MOE), -H (as in DNA) or other substituent. Preferred substituents of the 2'-OH group are a methyl, methoxyethyl or 3,3'- dimethylallyl group. The latter is known for its property to inhibit nuclease sensitivity due to its bulkiness, while improving efficiency of hybridization (Angus & Sproat. 1993. FEES Vol. 325, no. 1, 2, 123-7). Alternatively, locked nucleic acid sequences (LNAs), comprising a 2'-4' intramolecular bridge (usually a methylene bridge between the 2' oxygen and 4' carbon) linkage inside the ribose ring, or2’-fluoroarabinonucleosides (FANA), may be applied. Purine nucleobases and / or pyrimidine nucleobases may be modified to alter their properties, for example, by amination or deamination of the heterocyclic rings. The exact chemistries and formats may vary from oligonucleotide construct to oligonucleotide construct and from application to application. It is believed that 4 or more consecutive DNA nucleotides (4 consecutive deoxyriboses) in an oligonucleotide create so-called gapmers that - when annealed to their RNA cognate sequences - induce cleavage of the target RNA by RNaseH. According to the present disclosure, RNaseH cleavage of the target RNA is generally to be avoided as much as possible.

[0337] Examples of chemical modifications in the guide oligonucleotides of the present disclosure are modifications of the sugar moiety, including by cross-linking substituents within the sugar (ribose) moiety (e.g, as in locked nucleic acids: LNA), by substitution of the 2'-0 atom with alkyl (e.g. 2'-O-methyl), alkynyl (2'-O-alkynyl), alkenyl (2'-O-alkenyl), alkoxyalkyl (e.g. methoxyethyl: 2-O-MOE) groups, having a length as specified above, and the like. Additional modifications may include 2'-fluoro modifications (2’F), for example, 2'F modification at the +3 position (the center nucleotide in the triplet being position 0).

[0338] In addition, the phosphodiester group of the backbone may be modified by thioation, dithioation, amidation and the like to yield phosphorothioate, phosphorodithioate, phosphoramidate, etc., internucleosidic linkages. The internucleotidic linkages may be replaced in full or in part by peptidic linkages to yield in peptidonucleic acid sequences and the like. Alternatively, or in addition, the nucleobases may be modified by (de)amination, to yieldAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO inosine or 2'6'-diami nopurines and the like. A further modification may be methylation of the C5 in the cytidine moiety of the nucleotide, to reduce potential immunogenic properties known to be associated with CpG sequences. Yet, a further modification of beta-D-homoDNA-cytidine may also be included in the guide oligonucleotides of the present disclosure.

[0339] Mismatches

[0340] Mismatches, wobbles and / or out- looping bulges (caused by nucleotides in the guide oligonucleotide that do not form perfect base pairs with the target RNA according to the Watson- Crick base pairing rules) are generally tolerated and may improve editing activity of the target RNA sequence. The number of mismatches, wobbles or bulges in the guide oligonucleotide of the present disclosure (when it hybridizes to its RNA target sequence) may be one (which may be the one mismatch formed at the target adenosine position, when a cytosine is the opposite nucleoside, or some other position in the guide oligonucleotide) or more (either including or not including the mismatch at the target adenosine), depending on the length of the guide oligonucleotide. Additional mismatches, wobbles or bulges may be upstream as well as downstream of the target adenosine. In some embodiments, the guide oligonucleotides comprise 2 mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise 3 mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise 4 mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise 5 mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise 6 mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise 7 mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise 8 mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise 9 mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise 10 mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise about 5% mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise about 10% mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise about 15% mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise about 20% mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, the guide oligonucleotides comprise about 25% mismatches to the target sequence, with 1 mismatch opposite the target adenosine. In some embodiments, a mismatch or wobble is present at position 12 nucleotides upstream (towards the 5' end) from the targeted adenosine. In some embodiments, aAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO mismatch or wobble is present at position 16 nucleotides upstream (towards the 5' end) from the targeted adenosine. In some embodiments, a mismatch or wobble is present at position 17 nucleotides upstream (towards the 5' end) from the targeted adenosine. In some embodiments, a mismatch or wobble is present at position 21 nucleotides upstream (towards the 5' end) from the targeted adenosine. The bulges or mismatches may be at a single position (caused by one mismatching, wobble or bulge base pair) or a series of nucleotides that are not fully complementary (caused by more than one consecutive mismatching or wobble base pair or bulge, preferably two or three consecutive mismatching and / or wobble base pairs and / or bulges).

[0341] Alternative Oligonucleotides

[0342] In one embodiment, one or more of the nucleotides of the oligonucleotide of the disclosure, is naturally-occurring, and does not include, e.g., chemical modifications and / or conjugations known in the art and described herein. In another embodiment, one or more of the nucleotides of an oligonucleotide of the disclosure, is chemically modified to enhance stability or other beneficial characteristics (e.g., alternative nucleotides). Without being bound by theory, it is believed that certain modification can increase nuclease resistance and / or serum stability, or decrease immunogenicity. For example, polynucleotides of the disclosure may contain nucleotides found to occur naturally in DNA or RNA (e.g., adenine, thymidine, guanosine, cytidine, uridine, or inosine) or may contain nucleotides which have one or more chemical modifications to one or more components of the nucleotide (e.g., the nucleobase, sugar, or phospho-linker moiety). Oligonucleotides of the disclosure may be linked to one another through naturally-occurring phosphodiester bonds, or may be modified to be covalently linked through phosphorothiorate, 3’-methylenephosphonate, 5’-methylenephosphonate, 3’-phosphoamidate, 2’- 5’ phosphodiester, guanidinium, S-methylthiourea, or peptide bonds.

[0343] In some embodiments, one or more of the nucleotides of the oligonucleotide of the disclosure has the structure of any one of Formula l-V:N1Formula I

[0344] In some embodiments, one or more of the nucleotides of the oligonucleotide of the disclosure has the structure of any one of Formula I, e.g., has the structure:Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0345] In some embodiments, one or more of the nucleotides of the oligonucleotide of the disclosure has the structure of any one of Formula II, e.g, has the structure:

[0346] In some embodiments, one or more of the nucleotides of the oligonucleotide of the disclosure has the structure of any one of Formula III.

[0347] In some embodiments, one or more of the nucleotides of the oligonucleotide of the disclosure has the structure of any one of Formula IV, e.g., has the structure:

[0348] In some embodiments, one or more of the nucleotides of the oligonucleotide of the disclosure has the structure of any one of Formula V, e.g, has the structure:

[0349] In certain embodiments of the disclosure, substantially all of the nucleotides of an oligonucleotide of the disclosure are alternative nucleotides. In other embodiments of the disclosure, all of the nucleotides of an oligonucleotide of the disclosure are alternative nucleotides. Oligonucleotides of the disclosure in whichAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO "substantially all of the nucleotides are alternative nucleotides" are largely but not wholly modified and can include no more than 5, 4, 3, 2, or 1 naturally-occurring nucleotides. In still other embodiments of the disclosure, oligonucleotides of the disclosure can include no more than 5, 4, 3, 2, or 1 alternative nucleotides.

[0350] In some embodiments, the oligonucleotides of the instant disclosure include the structure:[Am]-X1-X2-X3-[Bn]wherein each of A and B is a nucleotide; m and n are each, independently, an integer from 3 to 40; at least one of X1, X2, and X3has the structure of Formula I, wherein R1is fluoro, hydroxy, or methoxy and N1is a nucleobase, or the structure of Formula V, wherein R4is hydrogen and R5is hydrogen; each of X1, X2, and X3that does not have the structure of Formula I is a ribonucleotide; [Am] and [Bn] each include at least five terminal 2’-O-methyl-nucleotides; at least four terminal phosphorothioate linkages, and at least 20% of the nucleotides of [Am] and [Bn] combined are 2'-O-methyl-nucleotides.

[0351] In some embodiments, the oligonucleotides of the instant disclosure include the structure:[Am]-X1-X2-X3-[Bn]wherein each of A and B is a nucleotide; m and n are each, independently, an integer from 3 to 40; at least one of X1, X2, and X3has the structure of Formula I, wherein R1is hydroxy, fluoro, or O-methyl and N1is a nucleobase, each of X1, X2, and X3that does not have the structure of Formula I is a DNA nucleotide or a deoxyribonucleotide; [Am] and [Bn] each include at least five terminal 2’-O-methyl-nucleotides; at least four terminal phosphorothioate linkages, and at least 20% of the nucleotides of [Am] and [Bn] combined are 2’-O-methyl-nucleotides.

[0352] In some embodiments, the oligonucleotides of the instant disclosure include the structure:[Am]-X1-X2-X3-[Bn]wherein each of A and B is a nucleotide; m and n are each, independently, an integer from 3 to 40; at least one of X1, X2, and X3has the structure of Formula II, wherein R2is hydroxy, fluoro, or methoxy and N1is a nucleobase; each of X1, X2, and X3that does not have the structure of Formula II is a DNA nucleotide or a deoxyribonucleotide; [Am] and [Bn] each include at least five terminal 2’-O-methyl-nucleotides; at least four terminal phosphorothioate linkages, and at least 20% of the nucleotides of [Am] and [Bn] combined are 2’-O-methyl-nucleotides.

[0353] In some embodiments, X1includes an adenine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes an adenine nucleobase; X1includes an adenine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a guanine or hypoxanthine nucleobase; X1includes an adenine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a uracil or thymine nucleobase; X1includes an adenine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a cytosine or 5-methylcytosine nucleobase;Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO X1includes a guanine or hypoxanthine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes an adenine nucleobase; X1includes a guanine or hypoxanthine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a guanine or hypoxanthine nucleobase; X1includes a guanine or hypoxanthine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a uracil or thymine nucleobase; X1includes a guanine or hypoxanthine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a cytosine or 5-methylcytosine nucleobase; X1includes a uracil or thymine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes an adenine nucleobase; X1includes a uracil or thymine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a guanine or hypoxanthine nucleobase; X1includes a uracil or thymine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a uracil or thymine nucleobase; X1includes a uracil or thymine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a cytosine or 5-methylcytosine nucleobase; X1includes a cytosine or 5-methylcytosine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes an adenine nucleobase; X1includes a cytosine or 5-methylcytosine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a guanine or hypoxanthine nucleobase; X1includes a cytosine or 5-methylcytosine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a uracil or thymine nucleobase; or X1includes a cytosine or 5-methylcytosine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a cytosine or 5-methylcytosine nucleobase.

[0354] In some embodiments, one or more of the nucleotides of the oligonucleotide of the disclosure has the structure of any one of Formula XII-XV:Formula XII Formula XIII Formula XIV Formula XV

[0355] In some embodiments, one or more of the nucleotides of the oligonucleotide of the disclosure has the structure of any one of Formula XII, e.g., has the structure:Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0356] In some embodiments, one or more of the nucleotides of the oligonucleotide of the disclosure has the structure of any one of Formula XIII, e.g, has the structure:

[0357] In some embodiments, one or more of the nucleotides of the oligonucleotide of the disclosure has the structure of any one of Formula XIV, e.g., has the structure:

[0358] In some embodiments, one or more of the nucleotides of the oligonucleotide of the disclosure has the structure of any one of Formula XV.

[0359] In certain embodiments of the disclosure, substantially all of the nucleotides of an oligonucleotide of the disclosure are alternative nucleotides. In other embodiments of the disclosure, all of the nucleotides of an oligonucleotide of the disclosure are alternative nucleotides. Oligonucleotides of the disclosure in which "substantially all of the nucleotides are alternative nucleotides" are largely but not wholly modified and can include no more than 5, 4, 3, 2, or 1 naturally-occurring nucleotides. In still other embodiments of the disclosure, oligonucleotides of the disclosure can include no more than 5, 4, 3, 2, or 1 alternative nucleotides.

[0360] In some embodiments, the oligonucleotides of the instant disclosure include the structure:[Am]-X1-X2-X3-[Bn]wherein each of A and B is a nucleotide; m and n are each, independently, an integer from 5 to 40; at least of X1, X2, and X3has the structure of Formula XIII, wherein R8and R9are each hydrogen, and each of X1, X2and X3that does not have the structure of Formula XIII is a ribonucleotide; [Am] and [Bn] each include at least five terminal 2’-O-methyl-Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO nucleotides and at least four terminal phosphorothioate linkages; and at least 20% of the nucleotides of [Am] and [Bn] combined are 2’-O-methyl-nucleotides.

[0361] In some embodiments, X1includes an adenine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes an adenine nucleobase; X1includes an adenine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a guanine or hypoxanthine nucleobase; X1includes an adenine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a uracil or thymine nucleobase; X1includes an adenine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a cytosine or 5-methylcytosine nucleobase; X1includes a guanine or hypoxanthine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes an adenine nucleobase; X1includes a guanine or hypoxanthine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a guanine or hypoxanthine nucleobase; X1includes a guanine or hypoxanthine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a uracil or thymine nucleobase; X1includes a guanine or hypoxanthine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a cytosine or 5-methylcytosine nucleobase; X1includes a uracil or thymine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes an adenine nucleobase; X1includes a uracil or thymine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a guanine or hypoxanthine nucleobase; X1includes a uracil or thymine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a uracil or thymine nucleobase; X1includes a uracil or thymine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a cytosine or 5-methylcytosine nucleobase; X1includes a cytosine or 5-methylcytosine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes an adenine nucleobase; X1includes a cytosine or 5-methylcytosine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a guanine or hypoxanthine nucleobase; X1includes a cytosine or 5-methylcytosine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a uracil or thymine nucleobase; or X1includes a cytosine or 5-methylcytosine nucleobase, X2includes a cytosine, 5-methylcytosine, uracil, or thymine nucleobase or does not include a nucleobase, and X3includes a cytosine or 5-methylcytosine nucleobase.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0362] In some embodiments, the oligonucleotides for use in the methods of the instant disclosure include a recruitment domain for the ADAR enzyme (e.g., an ADAR-recruiting domain). In some embodiments, the ADAR-recruiting domain is a stem-loop structure. Such oligonucleotides may be referred to as “axiomer AONs” or “selflooping AONs.” The recruitment portion acts in recruiting a natural ADAR enzyme present in the cell to the dsRNA formed by hybridization of the target sequence with the targeting portion. The recruitment portion may be a stemloop structure mimicking either a natural substrate (e.g. the glutamate ionotropic receptor AMPA type subunit 2 (GluR2) receptor; such as a GluR2 ADAR-recruiting domain) or a Z-DNA structure known to be recognized by the dsRNA binding regions of ADAR enzymes (e.g, a Z-DNA ADAR-recruiting domain). As GluR2 and Z-DNA ADAR-recruiting domains are high affinity binding partners to ADAR, there is no need for conjugated entities or presence of modified recombinant ADAR enzymes. A stem-loop structure can be an i ntermolecular stem-loop structure, formed by two separate nucleic acid strands, or an intramolecular stem loop structure, formed within a single nucleic acid strand. The stem-loop structure of the recruitment portion may be a step loop structure described in WO 2016 / 097212, US 2018 / 0208924, Merkle etal. Nature Biotechnology, 37: 133-8 (2019), Katrekar etal. Nature Methods, 16(3): 239-42 (2019), Fukuda etal. Scientific Reports, 7: 41478 (2017), the stem-loop structures of the ADAR recruitment portion of which are herein incorporated by reference. In some embodiments, the oligonucleotides include one or more ADAR-recruiting domains (e.g, 1 or 2 ADAR-recruiting domains). In some embodiments, the ADAR-recruiting domain is at the 5’ end of the oligonucleotide In other embodiments, the ADAR-recruiting domain is at the 3' end of said oligonucleotide. In some embodiments, the oligonucleotide includes a first ADAR-recruiting domain and a second ADAR-recruiting domain, the first ADAR-recruiting domain is at the 5' end of said oligonucleotide, and the second ADAR-recruiting domain is at the 3' end of said oligonucleotide.

[0363] In some embodiments, the oligonucleotide includes the structure of Formula XVI:C-L1-D-L2-[Am]-X1-X2-X3-[Bn]Formula XVI,wherein [Am]-X1-X2-X3-[Bn] is the oligonucleotide of any one of formulas l-XV; C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length; Li is a loop region; and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length; l_2 is an optional linker; wherein the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length, wherein the duplex structure includes at least one mismatch between nucleotides of C and nucleotides of D, and wherein C or D includes at least one alternative nucleobase.

[0364] In some embodiments, C and D include at least one alternative nucleobase. In other embodiments, Li includes linked nucleosides. In yet another embodiment, Li consists of linked nucleosides. In some embodiments, Li includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety. In some embodiments, C or D includes at least one alternative internucleoside linkageAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO and / or at least one alternative sugar moiety. In some embodiments, C and D each independently includes at least one alternative internucleoside linkage and / or at least one alternative sugar moiety.

[0365] In some embodiments, the oligonucleotide includes the structure of Formula XVII:C-Li-D-L2-[Am]-X1-X2-X3-[Bn]Formula XVII,wherein [Am]-X1-X2-X3-[Bn] is the oligonucleotide of any one of Formulas l-XV; C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length; Li is a loop region that does not consist of linked nucleosides; and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length; L2is an optional linker, wherein the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length, and wherein the duplex structure includes at least one mismatch between nucleotides of C and nucleotides of D.

[0366] In some embodiments, Li has the structure of Formula XVIIIF1-(G1)j-(H1)k-(G2)m-(l)-(G3)n-(H2)p-(G4)q-F2Formula XVIII,wherein F1is a bond between the loop region and C; F2is a bond between D and [Am] or between D and, optionally, the linker; G1, G2, G3, and G4each, independently, is selected from optionally substituted Ci-C2alkyl, optionally substituted C1-C3 heteroalkyl, O, S, and NRN; RNis hydrogen, optionally substituted C1-4 alkyl, optionally substituted C2-4 alkenyl, optionally substituted C2-4 alkynyl, optionally substituted C2-e heterocyclyl, optionally substituted C6-12 aryl, or optionally substituted C1-7 heteroalkyl; C1and C2are each, independently, selected from carbonyl, thiocarbonyl, sulphonyl, or phosphoryl; j, k, m, n, p, and q are each, independently, 0 or 1; and I is optionally substituted C1-10 alkyl, optionally substituted C2-10 alkenyl, optionally substituted C2-10 alkynyl, optionally substituted C2-6 heterocyclyl, optionally substituted C6-12 aryl, optionally substituted C2-C10 polyethylene glycol, or optionally substituted C1-10 heteroalkyl, or a chemical bond linking F1-(G1)j-(H1)k-(G2)m-(l)-(G3)n-(H2)p-(G4)q— F2.

[0367] In some embodiments, Li includes a carbohydrate-containing linking moiety.

[0368] In some embodiments, C or D each includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety. In some embodiments, C and D each includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety.

[0369] In some embodiments, the oligonucleotide includes the structure of Formula XIX:C-Li-D-L2-[Am]-X1-X2-X3-[Bn]Formula XIX,wherein [Am]-X1-X2-X3-[Bn] is the oligonucleotide of any one of formulas I to XV; C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length; Li is a loop region including at least one alternative nucleobase or at least oneAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO alternative internucleoside linkage; and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length; l_2 is an optional linker, wherein the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length, and wherein the duplex structure includes at least one mismatch between nucleotides of C and nucleotides of D.

[0370] In some embodiments, Li includes at least one alternative nucleobase and at least one alternative internucleoside linkage.

[0371] In some embodiments, the oligonucleotide includes the structure of Formula XX:C-Li-D-L2-[Am]-X1-X2-X3-[Bn]Formula XX,wherein [Am]-X1-X2-X3-[Bn] is the oligonucleotide of any one of formulas I to XV; C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length; Li is a loop region including at least one alternative sugar moiety, wherein the alternative sugar moiety is selected from the group consisting of a 2'-O-C1-C6alkyl-sugar moiety, a 2-amino-sugar moiety, a 2'-fluoro-sugar moiety, a 2’-O-MOE sugar moiety, an arabino nucleic acid (ANA) sugar moiety, a deoxyribose sugar moiety, and a bicyclic nucleic acid; D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length; and l_2is an optional linker, wherein the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length, and wherein the duplex structure includes at least one mismatch between nucleotides of C and nucleotides of D.

[0372] In some embodiments, the bicyclic sugar moiety is selected from an oxy-LNA sugar moiety (also referred to as an “LNA sugar moiety”), a thio-LNA sugar moiety, an amino-LNA sugar moiety, a cEt sugar moiety, and an ethylene-bridged (ENA) sugar moiety. In some embodiments, the ANA sugar moiety is a 2’-fluoro-ANA sugar moiety.

[0373] In some embodiments, C or D includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety. In some embodiments, C and D each includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety. In some embodiments, C is complementary to at least 5 contiguous nucleobases of D. In some embodiments, at least 80% (e.g., at least 85%, at least 90%, at least 95%) of the nucleobases of C are complementary to the nucleobases of D.

[0374] In some embodiments, C includes a nucleobase sequence having at least 80% sequence identity to a nucleobase sequence set forth in any one of SEQ ID NOs. 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, and 34.

[0375] In some embodiments, D includes a nucleobase sequence having at least 80% sequence identity to a nucleobase sequence set forth in any one of SEQ ID NOs. 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, and 35.

[0376] In some embodiments, C-Li-D includes a nucleobase sequence having at least 80% sequence identity to a nucleobase sequence set forth in any one of SEQ ID NOs. 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, and 36.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0377] In some embodiments, the at least one alternative nucleobase is selected from the group consisting of 5-methylcytosine, 5-hydroxycytosine, 5-methoxycytosine, N4-methylcytosine, N3-Methylcytosine, N4-ethylcytosine, pseudoisocytosine, 5-fluorocytosine, 5-bromocytosine, 5-iodocytosine, 5-ami nocytosine, 5-ethynylcytosine, 5-propynylcytosine, pyrrolocytosine, 5-aminomethylcytosine, 5-hydroxymethylcytosine, naphthyridine, 5-methoxyuracil, pseudouracil, dihydrouracil, 2-thiouracil, 4-thiouracil, 2-thiothymine, 4-thiothymine, 5,6-dihydrothymine, 5-halouracil, 5-propynyluracil, 5-aminomethyluracil, 5-hydroxymethyluracil, hypoxanthine, 7-deazaguanine, 8-aza-7-deazaguanine, 7-aza-2,6-diaminopurine, thienoguanine, N1-methylguanine, N2-methylguanine, 6-thioguanine, 8-methoxyguanine, 8-allyloxyguanine, 7-aminomethyl-7-deazaguanine, 7-methylguanine, imidazopyridopyrimidine, 7-deazaadenine, 3-deazaadenine, 8-aza-7-deazaadenine, 8-aza-7-deazaadenine, N1 -methyladenine, 2-methyladenine, N6-methyladenine, 7-methyladenine, 8-methyladenine, or 8-azidoadenine.

[0378] In some embodiments, the at least one alternative nucleobase is selected from the group consisting of 2-amino-purine, 2,6-diamino-purine, 3-deaza-adenine, 7-deaza-adenine, 7-methyl-adenine, 8-azido-adenine, 8-methyl-adenine, 5-hydroxymethyl-cytosine, 5-methyl-cytosine, pyrrolo-cytosine, 7-aminomethyl-7-deaza-guanine, 7-deaza-guanine, 7-methyl-guanine, 8-aza-7-deaza-guanine, thieno-guanine, hypoxanthine, 4-thio-uracil, 5-methoxy-uracil, dihydro-uracil, or pseudouracil.

[0379] In some embodiments, the at least one alternative internucleoside linkage is selected from the group consisting of a phosphorothioate internucleoside linkage, a 2'-alkoxy internucleoside linkage, and an alkyl phosphate internucleoside linkage. In some embodiments, the at least one alternative internucleoside linkage is at least one phosphorothioate internucleoside linkage.

[0380] In some embodiments, the at least one alternative sugar moiety is selected from the group consisting of a 2'-O-alkyl-sugar moiety, a 2'-O-methyl-sugar moiety, a 2'-amino-sugar moiety, a 2'-fluoro-sugar moiety, a 2’-O-MOE sugar moiety, an ANA sugar moiety deoxyribose sugar moiety, and a bicyclic nucleic acid. In some embodiments, the bicyclic sugar moiety is selected from an oxy-LNA sugar moiety, a thio-LNA sugar moiety, an amino-LNA sugar moiety, a cEt sugar moiety, and an ethylene-bridged (ENA) sugar moiety. In some embodiments, the ANA sugar moiety is a 2'-fluoro-ANA sugar moiety. In some embodiments, the at least one alternative sugar moiety is a 2'-O-methyl-sugar moiety, a 2'-fluoro-sugar moiety, or a 2’-O-MOE sugar moiety.

[0381] In some embodiments, the at least one mismatch is a paired A to C mismatch, a paired G to G mismatch, or a paired C to A mismatch. In some embodiments, the oligonucleotide includes at least two mismatches between nucleotides of C and nucleotides of D.

[0382] In some embodiments, the at least two mismatches are separated by at least three linked nucleosides. In some embodiments, the at least two mismatches are separated by three linked nucleosides.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0383] In some embodiments, the at least one mismatch includes a nucleoside having an alternative nucleobase. In some embodiments, the alternative nucleobase has the structure:wherein R1is hydrogen, trifluoromethyl, optionally substituted amino, hydroxyl, or optionally substituted C1-C6alkoxy; R2is hydrogen, optionally substituted amino, or optionally substituted C1-C6alkyl; and R3and R4are, independently, hydrogen, halogen, or optionally substituted C1-C6alkyl, or a salt thereof.

[0384] In one embodiment, the oligonucleotides of the disclosure include those including an ADAR-recruiting domain having a structure of Formula XXXIV:C-Li-D,Formula XXXIV,wherein C is a single-stranded oligonucleotide of about 10-50 linked nucleosides in length e.g., about 10, 15, 20, 25, 30, 35, 40, 45, 46, 47, 48, 49, or 50 linked nucleosides in length), Li is a loop region, and D is a single-stranded oligonucleotide of about 10-50 linked nucleosides in length (e.g, about 10, 15, 20, 25, 30, 35, 40, 45, 46, 47, 48, 49, or 50 linked nucleosides in length).

[0385] In some embodiments, C includes a region that is complementary to D such that the two strands hybridize and form a duplex under suitable conditions. Generally, the duplex structure is between 5 and 50 linked nucleosides in length, e.g, between, 5-49, 5-45, 5-40, 5-35, 5-30, 5-25, 5-20, 5-15, 5-10, 5-6, 8-50, 8-45, 8-40, 8-35, 8-30, 8-25, 8-20, 8-15, 8-10, 15-50, 15-45, 15-40, 15-35, 15-30, 15-25, 15-20, 15-16, 20-50, 20-45, 20-40, 20-35, 20-30, 20-25, 25-50, 25-45, 25-40, 25-35, or 25-30 linked nucleosides in length. Ranges and lengths intermediate to the aboverecited ranges and lengths are also contemplated to be part of the disclosure. In some embodiments, C is complementary to at least 5 contiguous nucleobases (e.g, 5, 10, 15, 20, 25, 30, or more contiguous nucleobases) of D, and the oligonucleotide forms a duplex structure of between 10-50 linked nucleosides in length (e.g, at least 10, 15, 20, 25, 30, 35, 40, 45, 46, 47, 48, 49, or 50 linked nucleosides in length).

[0386] In some embodiments, the duplex structure includes at least one mismatch between nucleotides of C and nucleotides of D (e.g, at least 1, 2, 3, 4, or 5 mismatches). In some embodiments, the mismatch is a paired A to C mismatch. In some embodiments, the A nucleoside of the A to C mismatch is on the C strand and the C nucleoside of the A to C mismatch is on the D strand. In some embodiments, the A nucleoside of the A to C mismatch is on the D strand and the C nucleoside of the A to C mismatch is on the C strand. In other embodiments, the mismatch is a paired G-to-G mismatch. In still yet other embodiments, the mismatch is a paired C to A mismatch. In some embodiments, the C nucleoside of the C to A mismatch is on the C strand and the A nucleoside of the C to AAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO mismatch is on the D strand. In some embodiments, the C nucleoside of the C to A mismatch is on the D strand and the A nucleoside of the C to A mismatch is on the C strand. In some embodiments, the mismatch is a paired I to I mismatch. In some embodiments, the mismatch is a paired I to G mismatch. In some embodiments, the I nucleoside of the I to G mismatch is on the C strand and the G nucleoside of the I to G mismatch is on the D strand. In some embodiments, the I nucleoside of the I to G mismatch is on the D strand and the G nucleoside of the I to G mismatch is on the C strand. In some embodiments, the mismatch is a paired G to I mismatch. In some embodiments, the G nucleoside of the G to I mismatch is on the C strand and the I nucleoside of the G to I mismatch is on the D strand. In some embodiments, the G nucleoside of the G to I mismatch is on the D strand and the I nucleoside of the G to I mismatch is on the C strand. In some embodiments, the mismatch includes a nucleoside having an alternative nucleobase. In some embodiments, the alternative nucleobase has the structure:wherein R1is hydrogen, trifluoromethyl, optionally substituted amino, hydroxyl, or optionally substituted C1-C6alkoxy; R2is hydrogen, optionally substituted amino, or optionally substituted C1-C6alkyl; and R3and R4are, independently, hydrogen, halogen, or optionally substituted C1-C6alkyl, or a salt thereof. In some embodiments, R1is a hydrogen bond donor group (e.g, a hydroxyl group, an amino group). In some embodiments, R1is a hydrogen bond accepting group (e.g, an alkoxy group).

[0387] In some embodiments, the duplex structure includes two mismatches. In some embodiments, the mismatches are at least three linked nucleosides apart. For example, when mismatches are “separated by 3 nucleotides,” the oligonucleotide includes the structure M1-N1-N2-N3-M2, where Mi is the first mismatch, N1, N2, and N3 are paired nucleobases, and M2 is the second mismatch. In some embodiments Mi is a paired A to C mismatch and M2 is a paired G-to-G mismatch.

[0388] In some embodiments, the loop region, Li, includes linked nucleosides. In some embodiments, Li includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety.

[0389] In other embodiments, the loop region has the structure of Formula XVIII:F1-(G1)j-(H1)k-(G2)m-(I)-(G3)n-(H2)p-(G4)q-F2Formula XVIII,wherein F1is a bond between the loop region and C; F2is a bond between D and a nucleotide or between D and, optionally, a linker; G1, G2, G3, and G4each, independently, is selected from optionally substituted C1-C2 alkyl, optionally substituted C1-C3 heteroalkyl, 0, S, and NRN; RNis hydrogen, optionally substituted C1-4 alkyl, optionallyAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO substituted C2-4 alkenyl, optionally substituted C2-4 alky nyl, optionally substituted C2-6 heterocyclyl, optionally substituted C6-12 aryl, or optionally substituted C1-7 heteroalkyl; C1and C2are each, independently, selected from carbonyl, thiocarbonyl, sulphonyl, or phosphoryl; j, k, m, n, p, and q are each, independently, 0 or 1; and I is optionally substituted C1-10 alkyl, optionally substituted C2-10 alkenyl, optionally substituted C2-10 alkynyl, optionally substituted C2-6 heterocyclyl, optionally substituted C6-12 aryl, optionally substituted C2-C10 polyethylene glycol, or optionally substituted C1-10 heteroalkyl, or a chemical bond linking F1-(G1)j-(H1)k-(G2)m-(I)-(G3)n-(H2)p-(G4)q–F2. In some embodiments, the linker is optional.

[0390] In some embodiments, the loop region, Li includes a carbohydrate-containing linking moiety.

[0391] In one embodiment, one or more of the nucleotides of the oligonucleotides of the disclosure, is naturally-occurring, and does not include, e.g., chemical modifications and / or conjugations known in the art and described herein. In another embodiment, one or more of the nucleotides of an oligonucleotide of the disclosure is chemically modified to enhance stability or other beneficial characteristics (e.g., alternative nucleotides). Without being bound by theory, it is believed that certain modification can increase nuclease resistance and / or serum stability, or decrease immunogenicity. For example, polynucleotides of the disclosure may contain nucleotides found to occur naturally in DNA or RNA (e.g., adenine, thymidine, guanosine, cytidine, uridine, or inosine) or may contain nucleotides which have one or more chemical modifications to one or more components of the nucleotide (e.g., the nucleobase, sugar, or phospho-linker moiety). Oligonucleotides of the disclosure may be linked to one another through naturally-occurring phosphodiester bonds, or may be modified to be covalently linked through phosphorothiorate, 3’-methylenephosphonate, 5’-methylenephosphonate, 3’-phosphoamidate, 2’ -5’ phosphodiester, guanidinium, S-methylthiourea, or peptide bonds.

[0392] In some embodiments, C includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety. In other embodiments, D includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety. In some embodiments, both C and D each include at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety.

[0393] In certain embodiments of the disclosure, substantially all of the nucleotides of an oligonucleotide of the disclosure are alternative nucleotides. In other embodiments of the disclosure, all of the nucleotides of an oligonucleotide of the disclosure are alternative nucleotides. Oligonucleotides of the disclosure in which "substantially all of the nucleotides are alternative nucleotides" are largely but not wholly modified and can include no more than 5, 4, 3, 2, or 1 naturally-occurring nucleotides. In still other embodiments of the disclosure, an oligonucleotide of the disclosure can include no more than 5, 4, 3, 2, or 1 alternative nucleotides.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0394] In one embodiment, the oligonucleotides of the disclosure include an ADAR-recruiting domain having the structure of Formula XXXIV, wherein C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length, Li is a loop region, and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length. In some embodiments, C is complementary to at least 5 contiguous nucleobases of D, and the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length. In some embodiments, the duplex structure includes at least one mismatch. In some embodiments, C or D includes at least one alternative nucleobase. In some embodiments, C and D each include at least one alternative nucleobase. In some embodiments, C and / or D, independently, further include at least one alternative internucleoside linkage and / or at least one alternative sugar moiety. In some embodiments, Li includes linked nucleotides. In other embodiments, Li consists of linked nucleosides. In some embodiments, Li includes at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety.

[0395] In another embodiment, the oligonucleotides of the disclosure include an ADAR-recruiting domain having the structure of Formula XXXIV, wherein C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length, Li is a loop region that does not consist of linked nucleosides, and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length. In some embodiments, C is complementary to at least 5 contiguous nucleobases of D, and the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length. In some embodiments, the duplex structure includes at least one mismatch. In some embodiments, Li has the structure of Formula VIII, as described herein. In some embodiments, Li includes a carbohydrate-containing linking moiety. In some embodiments, C and / or D, independently, include at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety.

[0396] In another embodiment, the oligonucleotides of the disclosure include an ADAR-recruiting domain having the structure of Formula XXXIV, wherein C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length, Li is a loop region including at least one alternative nucleobase or at least one alternative internucleoside linkage, and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length. In some embodiments, C is complementary to at least 5 contiguous nucleobases of D, and the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length. In some embodiments, the duplex structure includes at least one mismatch. In some embodiments, Li includes at least one alternative nucleobase and at least one alternative internucleoside linkage.

[0397] In another embodiment, the oligonucleotides of the disclosure include an ADAR-recruiting domain having the structure of Formula XXXIV, wherein C is a single-stranded oligonucleotide of 10-50 linked nucleosides in length, Li is a loop region including, at least one alternative sugar moiety that is not a 2’-O-methyl sugar moiety (e.g, the alternative sugar moiety is selected from the group consisting of a 2'-O-C1-C6alkyl-sugar moiety, a 2-amino-sugar moiety, a 2'-fluoro-sugar moiety, a 2’-O-MOE sugar moiety, an LNA sugar moiety, an arabino nucleic acid (ANA)Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO sugar moiety, a 2'-fluoro-ANA sugar moiety, a deoxyribose sugar moiety, and a bicyclic nucleic acid), and D is a single-stranded oligonucleotide of 10-50 linked nucleosides in length. In some embodiments, C is complementary to at least 5 contiguous nucleobases of D, and the oligonucleotide includes a duplex structure formed by C and D of between 10-50 linked nucleosides in length. In some embodiments, the duplex structure includes at least one mismatch. In some embodiments, C and / or D, independently, include at least one alternative nucleobase, at least one alternative internucleoside linkage, and / or at least one alternative sugar moiety.

[0398] In some embodiments, C includes a nucleobase sequence having at least 50% sequence identity (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to a nucleobase sequence set forth in of any one of SEQ ID NOs. 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, and 34, and D includes a nucleobase sequence complementary to the nucleobase sequence of C, wherein the sequence includes at least one mismatch as described herein. In other embodiments, D includes a nucleobase sequence having at least 50% sequence identity (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to a nucleobase sequence set forth in of any one of SEQ ID NOs. 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, and 35, and C includes a nucleobase sequence complementary to the nucleobase sequence of C, wherein the sequence includes at least one mismatch as described herein. In some embodiments, C-Li-D includes a nucleobase sequence having at least 50% sequence identity (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to a nucleobase sequence set forth in of any one of SEQ ID NOs. 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, and 36, wherein the sequence includes at least one mismatch as described herein.

[0399] Nucleobase sequences of SEQ ID NOs:. 1-36 are provided below:

[0400] Table 3.GGUGAAUAGUAUAACAAUAU SEQ ID NO. 1 AUGUUGUUAUAGUAUCCACC SEQ ID NO. 2 GGUGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCACC SEQ ID NO. 3 GGUGAAGAGGAGAACAAUAU SEQ ID NO. 4 AUGUUGUUCUCGUCUCCACC SEQ ID NO. 5 GGUGAAGAGGAGAACAAUAUGCUAAAUGUUGUUCUCGUCUCCACC SEQ ID NO. 6 GGUGUCGAGAAGAGGAGAACAAUAU SEQ ID NO. 7 AUGUUGUUCUCGUCUCCUCGACACC SEQ ID NO. 8 GGUGUCGAGAAGAGGAGAACAAUAUGCUAAAUGUUGUUCUCGUCUCCUCGACACC SEQ ID NO. 9 GGGUGGAAUAGUAUAACAAUAU SEQ ID NO. 10 AUGUUGUUAUAGUAUCCCACCU SEQ ID NO. 11 GGGUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCACCU SEQ ID NO. 12 GUGGAAUAGUAUAACAAUAU SEQ ID NO. 13 AUGUUGUUAUAGUAUCCCAC SEQ ID NO. 14GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC SEQ ID NO. 15Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO GGUGUCGAGAAUAGUAUAACAAUAU SEQ ID NO. 16 AUGUUGUUAUAGUAUCCUCGACACC SEQ ID NO. 17 GGUGUCGAGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCUCGACACC SEQ ID NO. 18 GGGUGGAAUAGUAUAACAAUAU SEQ ID NO. 19 AUGUUGUUAUAGUAUCCCACCU SEQ ID NO. 20 GGGUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCACCU SEQ ID NO. 21 GGGUGGAAUAGUAUACCA SEQ ID NO. 22 UGGUAUAGUAUCCCACCU SEQ ID NO. 23 GGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCU SEQ ID NO. 24 GUGGGUGGAAUAGUAUACCA SEQ ID NO. 25 UGGUAUAGUAUCCCACCUAC SEQ ID NO. 26 GUGGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCUAC SEQ ID NO. 27 UGGGUGGAAUAGUAUACCA SEQ ID NO. 28 UGGUAUAGUAUCCCACCUA SEQ ID NO. 29 UGGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCUA SEQ ID NO. 30 GGUGGAAUAGUAUACCA SEQ ID NO. 31 UGGUAUAGUAUCCCACC SEQ ID NO. 32 GGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACC SEQ ID NO. 33 GUGGAAUAGUAUACCA SEQ ID NO. 34 UGGUAUAGUAUCCCAC SEQ ID NO. 35GUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCAC SEQ ID NO. 36

[0401] It will be understood that, although the sequences in SEQ ID NOs. 1-36 are described as unmodified and / or un-conjugated sequences, the RNA of the oligonucleotides of the disclosure may include any one of the sequences set forth in SEQ ID NOs. 1-36 that is an alternative nucleoside and / or conjugated as described in detail below.

[0402] In some embodiments, the oligonucleotide of the disclosure may further include a 5’ cap structure. In some embodiments, the 5’ cap structure is a 2,2,7-trimethylguanosine cap.

[0403] An oligonucleotide of the disclosure can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc.

[0404] The oligonucleotide compound can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide including unnatural or alternative nucleotides can be easily prepared. Single-stranded oligonucleotides of the disclosure can be prepared using solution-phase or solid-phase organic synthesis or both.

[0405] Further, it is contemplated that for any sequence identified herein, further optimization could be achieved by systematically either adding or removing linked nucleosides to generate longer or shorter sequences. Further still, such optimized sequences can be adjusted by, e.g., the introduction of alternative nucleosides, alternative sugar moieties, and / or alternative internucleosidic linkages as described herein or as known in the art, including alternative nucleosides, alternative sugar moieties, and / or alternative internucleosidic linkages as known in the art and / or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasingAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, and / or increasing interaction with RNA editing enzymes (e.g, ADAR)).

[0406] In some embodiments, the one or more ADAR-recruiting domains are GluR2 ADAR-recruiting domains. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 37, as shown below in the 5’ to 3’ direction:GGUGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCACC(SEQ ID NO. 37)

[0407] In some embodiments, the oligonucleotide includes the structure of Formula XXI (SEQ ID NO: 37), as shown below:A® G^? G „S' GGUG AUA UAUAACAAUAU 0H U H I! H J H H u3' USQMXAC GAU AUAUUGUUGUAACS5. f«: AFormula XXI,

[0408] wherein [ASO] includes any of the oligonucleotides of the instant disclosure, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 38, as shown below in the 5' to 3’ direction:GGUGAAGAGGAGAACAAUAUGCUAAAUGUUGUUCUCGUCUCCACC(SEQ ID NO. 38)

[0409] In some embodiments, the oligonucleotide includes the structure of Formula XXII (SEQ ID NO: 38), as shown below:5' GGUG AGA " GAGAACAAUAU CU H m H H H H m u3‘ (ABO> CCAC UCU CUCGUGUUGUAArss S.-. Gs AFormula XXII,

[0410] wherein [ASO] includes any of the oligonucleotides of the instant disclosure, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 39, as shown below in the 5’ to 3’ direction:GGUGUCGAGAAGAGGAGAACAAUAUGCUAAAUGUUGUUCUCGUCUCCUCGACACC(SEQ ID NO. 39)Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0411] In some embodiments, the oligonucleotide includes the structure of Formula XXIII (SEQ ID NO: 39), as shown below:Am Gm GS’ GGU UCGAG AGA GAGAACAAUAU CH; H h H i i i I i H H I H U.5 [AGOj-GQ C A CUO UCD _ C OLGiUGUUGUA.Cm Gm AFormula XXIII,

[0412] wherein [ASO] includes any of the oligonucleotides of the instant disclosure, wherein m designates a mismatched nucleotide.

[0413] In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 40, as shown below in the 5’ to 3’ direction:*s*s*G**GAGAAGAGGAGAA*AA*A*G**AAA*G**G*****G*******GA*A** (SEQ ID NO. 40) wherein * is a 2'-O-methyl nucleotide and s is a phosphorothioate internucleoside linkage between two linked nucleotides. In some embodiments, the oligonucleotide includes the structure of Formula XXIV (SEQ ID NO: 40), as shown below:* * * G *XGAGA:AGAX!GAGAASAA* A *G*rn H H H H l H l l H I H H: ASO]- s >: A * AG * ’ ’ * * * ** * G * *G* A A.« Gm AFormula XXIV,

[0414] wherein [ASO] includes any one of the oligonucleotides presented herein, wherein * is a 2’-O-methyl nucleotide, wherein s is a phosphorothioate internucleoside linkage, wherein m designates a mismatched nucleotide. In some embodiments, the ADAR-recruiting domains further include at least one nuclease-resistant nucleotide (e.g., 2’-O-methyl nucleotide). In some embodiments, the ADAR-recruiting domains include at least one alternative internucleoside linkage (e.g., a phosphorothioate internucleoside linkage). In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 41, as shown below in the 5’ to 3’ direction:GGGUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCACCU(SEQ ID NO. 41)

[0415] In some embodiments, the oligonucleotide includes the structure of Formula XXV (SEQ ID NO: 41), as shown below:Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO5' GGGUGG AUA OAUAACAAUAU u n; H H M n NM n u3 At> C*$;'U3X„-A3'C* G A:L< AUAUGGOIA< J*GA, AQ® AFormula XXV,

[0416] wherein [ASO] includes any of the oligonucleotides of the instant disclosure, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 42, as shown below in the 5' to 3' direction:GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC(SEQ ID NO. 42)

[0417] In some embodiments, the oligonucleotide includes the structure of Formula XXVI (SEQ ID NO: 42), as shown below:Am G5' GUGG AGA UAUAACAAUAU VH U H l H H H I H H U3’ [ASG]-€ACC, UAU AUAUUGUUGUAACFormula XXVI,

[0418] wherein [ASO] includes any of the oligonucleotides of the instant disclosure, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 43, as shown below in the 5’ to 3’ direction:GGUGUCGAGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCUCGACACC(SEQ ID NO. 43)

[0419] In some embodiments, the oligonucleotide includes the structure of Formula XXVII (SEQ ID NO: 43), as shown below:3 GGUGUQGAG AUA UAUAACAAUAU CH l H M 1 H H H U3' [ASOl-CCAaAGCUC. UAV AUAUUGUUGUA AAFormula XVII,

[0420] wherein [ASO] includes any of the oligonucleotides of the instant disclosure, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 44, as shown below in the 5’ to 3’ direction:Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO GGGUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCACCU(SEQ ID NO. 44)

[0421] In some embodiments, the oligonucleotide includes the structure of Formula XXVIII (SEQ ID NO: 44), as shown below:A- Gs GGGUGC AUA IMVAAC AGm m H H l H H ) I Hu3sM MCG CC MU AUAUUGUGGUA A. AFormula XXVIII,

[0422] wherein [ASO] includes any of the oligonucleotides of the instant disclosure, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 45, as shown below in the 5' to 3' direction:GGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCU (SEQ ID NO. 45)

[0423] In some embodiments, the oligonucleotide includes the structure of Formula XXIX (SEQ ID NO: 45), as shown below:A.«.t UGUuGG AIM IMUACCA "t.O H i i i I 4 i i "3" (ASO} UGC ACC%QAU~ AUADGGU^ CFormula XXIX,

[0424] wherein [ASO] includes any of the oligonucleotides of the instant disclosure, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 46, as shown below in the 5’ to 3’ direction:GUGGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCUAC(SEQ ID NO. 46)

[0425] In some embodiments, the oligonucleotide includes the structure of Formula XXX (SEQ ID NO: 46), as shown below:Am >5’GGGGGWG AUA UAUAC 33^sA^3]--CAUCCACC „ UAU,, AUAC L- 3Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO Formula XXX,

[0426] wherein [ASO] includes any of the oligonucleotides of the instant disclosure, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 47, as shown below in the 5' to 3' direction:UGGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCUA(SEQ ID NO. 47)

[0427] In some embodiments, the oligonucleotide includes the structure of Formula XXXI (SEQ ID NO: 47), as shown below:■. >£ AUA.M lUUA. U AGA >00 J CFormula XXXI,

[0428] wherein [ASO] includes any of the oligonucleotides of the instant disclosure, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 48, as shown below in the 5’ to 3’ direction:GGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACC(SEQ ID NO. 48)

[0429] In some embodiments, the oligonucleotide includes the structure of Formula XXXII (SEQ ID NO: 48), as shown below:A® SjT: < <S'GGOSG -AJA MALACCA,H i! H I H m HuA® Gss GFormula XXXII,

[0430] wherein [ASO] includes any of the oligonucleotides of the instant disclosure, wherein m designates a mismatched nucleotide. In some embodiments, the GluR2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 49, as shown below in the 5’ to 3’ direction:GUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCAC (SEQ ID NO. 49)Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO

[0431] In some embodiments, the oligonucleotide includes the structure of Formula XXXIII (SEQ ID NO: 49), as shown below:''A3' [ASOKACC t A > AUAUGGU CFormula XXXIII,

[0432] wherein [ASO] includes any of the oligonucleotides of the instant disclosure, wherein m designates a mismatched nucleotide.

[0433] In some embodiments, the ADAR-recruiting domains are Z-DNA ADAR-recruiting domains. In some embodiments, the ADAR-recruiting domains are MS2 ADAR-recruiting domains. In some embodiments, an MS2 bacteriophage stem-loop structure may be used as an ADAR-recruiting domain e.g, and MS2 ADAR-recruiting domain). MS2 stem-loops are known to bind the MS2 bacteriophage coat protein, which when fused to the deaminase domain of ADAR (e.g. an ADAR fusion protein) can be used for target-specific deamination. In some embodiments, the MS2 ADAR-recruiting domain has the nucleotide sequence of SEQ ID NO. 50, as shown below in the 5’ to 3’ direction:ACATGAGGATCACCCATGT (SEQ ID NO. 50)

[0434] In some embodiments, an ADAR fusion protein is administered to the cell or to the subject using an expression vector construct including a polynucleotide encoding an ADAR fusion protein. In some embodiments, the ADAR fusion protein includes a deaminase domain of ADAR fused to an MS2 bacteriophage coat protein. In some embodiments, the deaminase domain of ADAR is a deaminase domain of ADAR1. In some embodiments, the deaminase domain of ADAR is a deaminase domain of ADAR2. The ADAR fusion protein may be a fusion protein described in Katrekar eta / . Nature Methods, 16(3): 239-42 (2019), the ADAR fusion protein of which is herein incorporated by reference

[0435] The nucleic acids featured in the disclosure can be synthesized and / or modified by methods well established in the art, such as those described in " Current protocols in nucleic acid chemistry," Beaucage, S. L. eta / . (Edrs.), John Wiley & Sons, Inc., New York, N. Y., USA, which is hereby incorporated herein by reference. Alternative nucleotides and nucleosides include those with modifications including, for example, end modifications, e.g, 5-end modifications (phosphorylation, conjugation, inverted linkages) or 3'-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g, replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2'-posi tion or 4'-position) or replacement of the sugar; and / or backbone modifications, including modification or replacement of the phosphodiester linkages. The nucleobase may also be anAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO isonucleoside in which the nucleobase is moved from the C1 position of the sugar moiety to a different position (e.g. C2, C3, C4, or C5). Specific examples of oligonucleotide compounds useful in the embodiments described herein include, but are not limited to alternative nucleosides containing modified backbones or no natural internucleoside linkages. Nucleotides and nucleosides having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, alternative RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, an oligonucleotide will have a phosphorus atom in its internucleoside backbone.

[0436] Alternative internucleoside linkages include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, ami noalkyl phosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boronophosphates having normal 3'-5' linkages, 2'-5'-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included.

[0437] Representative U. S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U. S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U. S. Pat. RE39464, the entire contents of each of which are hereby incorporated herein by reference.

[0438] Alternative internucleoside linkages that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S, and CH2 component parts.

[0439] Representative U. S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U. S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046;Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.

[0440] In other embodiments, suitable oligonucleotides include those in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, a mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar of a nucleoside is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U. S. patents that teach the preparation of PNA compounds include, but are not limited to, U. S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the oligonucleotides of the disclosure are described in, for example, in Nielsen eta / ., Science, 1991, 254, 1497-1500.

[0441] Some embodiments featured in the disclosure include oligonucleotides with phosphorothioate backbones and oligonucleotides with heteroatom backbones, and in particular -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2-[known as a methylene (methylimino) or MMI backbone], -CH2-O-N(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2- and -N(CH3)-CH2-CH2-[wherein the native phosphodiester backbone is represented as -O-P-O-CH2-] of the above-referenced U. S. Pat. No.5,489,677, and the amide backbones of the above-referenced U. S. Pat. No. 5,602,240. In some embodiments, the oligonucleotides featured herein have morpholino backbone structures of the above-referenced U. S. Pat. No.5,034,506. In other embodiments, the oligonucleotides described herein include phosphorodiamidate morpholino oligomers (PMO), in which the deoxyribose moiety is replaced by a morpholine ring, and the charged phosphodiester inter-subunit linkage is replaced by an uncharged phophorodiamidate linkage, as described in Summerton, et al., Antisense Nucleic Acid Drug Dev. 1997, 7:63-70.

[0442] Alternative nucleosides and nucleotides can also contain one or more substituted sugar moieties. The oligonucleotides, e.g., oligonucleotides, featured herein can include one of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted Ci to C10 alkyl or C2 to C10 alkenyl and alkynyl. Exemplary suitable modifications include -O[(CH2)nO]mCH3, -O(CH2)nOCH3, -O(CH2)n-NH2, -O(CH2)nCH3, -O(CH2)n-ONH2, and -O(CH2)n-ON[(CH2)nCH3]2, where n and m are from 1 to about 10. In other embodiments, oligonucleotides include one of the following at the 2' position: Ci to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. In some embodiments, theAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO modification includes a 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2-O-MOE) (Martin et al., Helv. Chin. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. 2’-O-MOE nucleosides confer several beneficial properties to oligonucleotides including, but not limited to, increased nuclease resistance, improved pharmacokinetics properties, reduced non-specific protein binding, reduced toxicity, reduced immunostimulatory properties, and enhanced target affinity as compared to unmodified oligonucleotides.

[0443] Another exemplary alternative contains 2'-dimethylaminooxyethoxy, i.e., a -O(CH2)2ON(CH3)2 group, also known as 2-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2-DMAEOE), i.e., 2'-O-(CH2)2-O-(CH2)2-N(CH3)2. Further exemplary alternatives include: 5'-Me-2'-F nucleotides, 5'-Me-2'-OMe nucleotides, 5'-Me-2'-deoxynucleotides, (both R and S isomers in these three families); 2'-alkoxyalkyl; and 2-NMA (N-methylacetamide).

[0444] Other alternatives include 2'-methoxy (2-OCH3), 2'-aminopropoxy (2-OCH2CH2CH2NH2) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the nucleosides and nucleotides of an oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U. S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U. S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920. The entire contents of each of the foregoing are hereby incorporated herein by reference.

[0445] An oligonucleotide for use in the methods of the present disclosure can also include nucleobase (often referred to in the art simply as "base") alternatives e.g., modifications or substitutions). Unmodified or natural nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Alternative nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine, 5-hydroxymethylcytosine, 5-formylcytosine, 5-carboxycytosine, pyrrolocytosine, dideoxycytosine, uracil, 5-methoxyuracil, 5-hydroxydeoxyuracil, dihydrouracil, 4-thiouracil, pseudouracil, 1-methyl-pseudouracil, deoxyuracil, 5-hydroxybutynl-2’ -deoxyuracil, xanthine, hypoxanthine, 7-deaza-xanthine, thienoguanine, 8-aza-7-deazaguanine, 7-methylguanine, 7-deazaguanine, 6-aminomethyl-7-deazaguanine, 8-aminoguanine, 2,2,7-trimethylguanine, 8-methyladenine, 8-azidoadenine, 7-methyladenine, 7-deazaadenine, 3-deazaadenine, 2,6-diaminopurine, 2-aminopurine, 7-deaza-8-aza-adenine, 8-amino-adenine, thymine, dideoxythymine, 5-nitroindole, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils andAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO cytosines, 8-azaguanine and 8-azaadenine, and 3-deazaguanine. Further nucleobases include those disclosed in U. S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the disclosure. These include 5-substi tuted pyrimidines, 6-azapyrimidines, and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

[0446] Representative U. S. patents that teach the preparation of certain of the above noted alternative nucleobases as well as other alternative nucleobases include, but are not limited to, the above noted U. S. Pat. Nos.3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.

[0447] In other embodiments, the sugar moiety in the nucleotide may be a ribose molecule, optionally having a 2’-O-methyl, 2’-O-MOE, 2’-F, 2’-amino, 2’-O-propyl, 2’-aminopropyl, or 2’-OH modification.

[0448] An oligonucleotide for use in the methods of the present disclosure can include one or more bicyclic sugar moieties. A "bicyclic sugar" is a furanosyl ring modified by the bridging of two atoms. A "bicyclic nucleoside" (" BNA") is a nucleoside having a sugar moiety including a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring. Thus, in some embodiments an agent of the disclosure may include one or more locked nucleosides. A locked nucleoside is a nucleoside having a modified ribose moiety in which the ribose moiety includes an extra bridge connecting the 2' and 4' carbons. In other words, a locked nucleoside is a nucleoside including a bicyclic sugar moiety including a 4-CH2-O-2' bridge. This structure effectively "locks" the ribose in the 3'-endo structural conformation. The addition of locked nucleosides to oligonucleotides has been shown to increase oligonucleotide stability in serum, and to reduce off-target effects (Grunweller, A. et al., (2003) Nucleic Acids Research 31 (12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the disclosure include without limitation nucleosides including a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, the polynucleotide agents of the disclosure include one or more bicyclic nucleosides including a 4' to 2' bridge.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO Examples of such 4' to 2' bridged bicyclic nucleosides, include but are not limited to 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2' (ENA); 4'-CH(CH3)-O-2' (also referred to as "constrained ethyl" or "cEt") and 4'-CH(CH2OCH3)-O-2' (and analogs thereof; see, e.g., U. S. Pat. No. 7,399,845); 4'-C(CH3)(CH3)-O-2' (and analogs thereof; see e.g, U. S. Pat. No. 8,278,283); 4'-CH2-N(OCH3)-2' (and analogs thereof; see e.g., U. S. Pat. No. 8,278,425); 4'-CH2-O-N(CH3)2-2' (see, e.g., U. S. Patent Publication No 2004 / 0171570); 4'-CH2-N(R)-O-2', wherein R is H, C1-C12 alkyl, or a protecting group (see, e.g., U. S. Pat. No. 7,427,672); 4'-CH2-C(H)(CH3)-2' (see, e.g., Chattopadhyaya etal., J. Org. Chem., 2009, 74, 118-134); and 4'-CH2-C(=CH2)-2' (and analogs thereof; see, e.g, U. S. Pat. No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference.

[0449] Additional representative U. S. Patents and US Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U. S. Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008 / 0039618; and US 2009 / 0012281, the entire contents of each of which are hereby incorporated herein by reference.

[0450] Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and p-D-ribofuranose (see WO 99 / 14226).

[0451] An oligonucleotide for use in the methods of the disclosure can also be modified to include one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid including a bicyclic sugar moiety including a 4'-CH(CH3)-O-2' bridge. In one embodiment, a constrained ethyl nucleotide is in the S conformation referred to herein as " S-cEt."

[0452] An oligonucleotide for use in the methods of the disclosure may also include one or more "conformationally restricted nucleotides" (" CRN"). CRN are nucleotide analogs with a linker connecting the C2' and C4' carbons of ribose or the C3 and -C51carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA. The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.

[0453] Representative publications that teach the preparation of certain of the above noted CRN include, but are not limited to, US Patent Publication No. 2013 / 0190383; and PCT publication WO 2013 / 036868, the entire contents of each of which are hereby incorporated herein by reference.

[0454] In some embodiments, an oligonucleotide for use in the methods of the disclosure includes one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar" residue. In one example, UNA also encompasses monomer with bonds between CT-C4' have been removed (i.e. the covalent carbon-oxygen-carbon bond between the CT and C4' carbons). In another example, the C2'-C3' bond (i.e. the covalent carbon-carbon bondAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO between the C2' and C3' carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by reference).

[0455] Representative U. S. publications that teach the preparation of UNA include, but are not limited to, U. S. Pat. No. 8,314,227; and US Patent Publication Nos. 2013 / 0096289; 2013 / 0011922; and 2011 / 0313020, the entire contents of each of which are hereby incorporated herein by reference.

[0456] The ribose molecule may also be modified with a cyclopropane ring to produce a tricyclodeoxynucleic acid (tricyclo DNA). The ribose moiety may be substituted for another sugar such as 1,5,-anhydrohexitol, threose to produce a threose nucleoside (TNA), or arabinose to produce an arabino nucleoside. The ribose molecule can also be replaced with non-sugars such as cyclohexene to produce cyclohexene nucleoside or glycol to produce glycol nucleosides.

[0457] The ribose molecule can also be replaced with non-sugars such as cyclohexene to produce cyclohexene nucleic acid (CeNA) or glycol to produce glycol nucleic acids (GNA). Potentially stabilizing modifications to the ends of nucleotide molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"-phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011 / 005861.

[0458] Other alternatives chemistries of an oligonucleotide of the disclosure include a 5' phosphate or 5' phosphate mimic, e.g., a 5'-terminal phosphate or phosphate mimic of an oligonucleotide. Suitable phosphate mimics are disclosed in, for example US Patent Publication No. 2012 / 0157511, the entire contents of which are incorporated herein by reference.

[0459] Exemplary oligonucleotides for use in the methods of the disclosure include sugar-modified nucleosides and may also include DNA or RNA nucleosides. In some embodiments, the oligonucleotide includes sugar-modified nucleosides and DNA nucleosides. Incorporation of alternative nucleosides into the oligonucleotide of the disclosure may enhance the affinity of the oligonucleotide for the target nucleic acid. In that case, the alternative nucleosides can be referred to as affinity enhancing alternative nucleotides.

[0460] In some embodiments, the oligonucleotide includes at least 1 alternative nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 alternative nucleosides. In other embodiments, the oligonucleotides include from 1 to 10 alternative nucleosides, such as from 2 to 9 alternative nucleosides, such as from 3 to 8 alternative nucleosides, such as from 4 to 7 alternative nucleosides, such as 6 or 7 alternative nucleosides. In an embodiment, the oligonucleotide of the disclosure may include alternatives, which are independently selected from these three types of alternative (alternative sugar moiety, alternative nucleobase, and alternative internucleoside linkage), or aAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO combination thereof. Preferably the oligonucleotide includes one or more nucleosides including alternative sugar moieties, e.g., 2' sugar alternative nucleosides. In some embodiments, the oligonucleotide of the disclosure include the one or more 2' sugar alternative nucleoside independently selected from the group consisting of 2'-O-alky l-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, ANA, 2'-fluoro-ANA, and BNA (e.g., LNA) nucleosides In some embodiments, the one or more alternative nucleoside is a BNA.

[0461] In some embodiments, at least 1 of the alternative nucleosides is a BNA (e.g., an LNA), such as at least 2, such as at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 of the alternative nucleosides are BNAs. In a still further embodiment, all the alternative nucleosides are BNAs.

[0462] In a further embodiment the oligonucleotide includes at least one alternative internucleoside linkage. In some embodiments, the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate or boronophosphate internucleoside linkages. In some embodiments, all the internucleotide linkages in the contiguous sequence of the oligonucleotide are phosphorothioate linkages. In some embodiments the phosphorothioate linkages are stereochemically pure phosphorothioate linkages. In some embodiments, the phosphorothioate linkages are Sp phosphorothioate linkages. In other embodiments, the phosphorothioate linkages are Rp phosphorothioate linkages.

[0463] In some embodiments, the oligonucleotide for use in the methods of the disclosure includes at least one alternat...

Claims

1. Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO What is claimed is:

1. A mutant AMPK protein comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 64-67 or 69-81.

2. The mutant AMPK protein of claim 1, comprising the amino acid sequence set forth in SEQ ID NO:

64.

3. The mutant AMPK protein of claim 1, comprising the amino acid sequence set forth in SEQ ID NO:

65.

4. The mutant AMPK protein of claim 1, comprising the amino acid sequence set forth in SEQ ID NO:

66.

5. The mutant AMPK protein of claim 1, comprising the amino acid sequence set forth in SEQ ID NO:

67.

6. The mutant AMPK protein of claim 1, comprising the amino acid sequence set forth in SEQ ID NO:

69.

7. The mutant AMPK protein of claim 1, comprising the amino acid sequence set forth in SEQ ID NO:

70.

8. The mutant AMPK protein of claim 1, comprising the amino acid sequence set forth in SEQ ID NO:

71.

9. The mutant AMPK protein of claim 1, comprising the amino acid sequence set forth in SEQ ID NO:

72.

10. The mutant AMPK protein of claim 1, comprising the amino acid sequence set forth in SEQ ID NO:

73.

11. The mutant AMPK protein of claim 1, comprising the amino acid sequence set forth in SEQ ID NO:

74.

12. The mutant AMPK protein of claim 1, comprising the amino acid sequence set forth in SEQ ID NO:

75.

13. The mutant AMPK protein of claim 1, comprising the amino acid sequence set forth in SEQ ID NO:

76.

14. The mutant AMPK protein of claim 1, comprising the amino acid sequence set forth in SEQ ID NO:

77. 15 The mutant AMPK protein of claim 1, comprising the amino acid sequence set forth in SEQ ID NO:

78.

16. The mutant AMPK protein of claim 1, comprising the amino acid sequence set forth in SEQ ID NO:

79.

17. The mutant AMPK protein of claim 1, comprising the amino acid sequence set forth in SEQ ID NO:

80.

18. The mutant AMPK protein of claim 1, comprising the amino acid sequence set forth in SEQ ID NO:

81.

19. A composition comprising a mutant AMPK protein set forth in any one of claims 1-18.

20. A nucleic acid molecule encoding a mutant AMPK protein comprising a glycine, alanine, valine, proline, methionine, leucine, isoleucine, serine, phenylalanine, cysteine, asparagine, threonine, tryptophan, glutamine, or histidine at position 317 in AMPK y1 subunit, an arginine at position 151 in AMPK y1 subunit, an arginine at position 71 in AMPK a1 subunit, or an arginine at position 60 in AMPK a2 subunit.

21. A nucleic acid molecule encoding the mutant AMPK protein of any one of claims 1-18.

22. A vector comprising the nucleic acid molecule of claim 20 or claim 21.Attorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO 23. The vector of claim 22, wherein the vector is a viral vector, or a non-viral vector.

24. The vector of claim 23 wherein the vector is a viral vector, or a non-viral vector.25 The vector of claim 24, wherein the viral vector is selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a lentiviral vector, a herpes simplex viral vector, a parvoviral vector, a papillomavirus vector, a vaccinia viral vector, or a hybrid or chimeric vector thereof.

26. An isolated cell comprising the nucleic acid molecule of claim 20 or 21, or the vector of claim 22 or 23. 27 An isolated cell modified to express the mutant AMPK protein of any one of claims 1-18.

28. A method of modulating the activity of a wild type AMPK protein in a cell, the method comprising contacting in need thereof, the method comprising contacting the cell with the nucleic acid molecule of claim 20 or 21, of the mutant AMPK protein of any one of claims 1-18.

29. The method of claim 28, wherein the modulation comprises an increase in activity of the AMPK protein of at least 20% as compared to the wild type AMPK protein.

30. A method of regulating energy homeostasis in a cell in need thereof, the method comprising contacting the cell with the nucleic acid molecule of claim 20 or 21, of the mutant AMPK protein of any one of claims 1-18.

31. A method of inhibiting synthesis of fatty acids and / or cholesterol, promoting fatty acid oxidation, and / or reducing accumulation of lipids in a cell, the method comprising contacting the cell with the nucleic acid molecule of claim 20 or 21, or the mutant AMPK protein of any one of claims 1-18,. thereby inhibiting synthesis of fatty acids and / or cholesterol, promoting fatty acid oxidation, and / or reducing accumulation of lipids.

32. A method of inhibiting gluconeogenesis and / or glycogen synthesis, promoting glucose uptake and / or glycolysis, improving insulin sensitivity, and / or reducing insulin resistance in a cell, the method comprising contacting the cell with the nucleic acid molecule of claim 20 or 21, or the mutant AMPK protein of any one of claims 1- 18,.thereby inhibiting gluconeogenesis and / or glycogen synthesis, promoting glucose uptake and / or glycolysis, improving insulin sensitivity, and / or reducing insulin resistance.33 A method of treating an AMPK-associated disease or condition in a subject in need thereof, the method comprising contacting exposing the subject to a nucleic acid molecule of claim 20 or 21, or the mutant AMPK protein of any one of claims 1-18. in a cell of the subject thereby treating the AMPK-associated disease or condition.

34. The method of claim 33, wherein the AMPK-associated disease or condition is selected from the group consisting of a metabolic disorder, type 2 diabetes, hyperglycemia, metabolic syndrome, obesity, hypercholesterolemia, non-alcoholic fatty liver disease, nonalcoholic steatohepatitis, adrenoleukodystrophy, polycystic kidney disease, cirrhosis, hepatocellular carcinoma, hypertension, metabolic syndrome, chronic kidneyAttorney Docket No.: 33791 / 41032Korro Ref.: KB-032-WO disease, diabetic kidney disease, acute kidney injury, MASH-associated kidney disease, adrenoleukodystrophy, polycystic kidney disease, cirrhosis, hepatocellular carcinoma, diabetic nephropathy, diabetic retinopathy, diabetic neuropathy, eye disease, coronary artery disease, cancer, a central nervous system disease, a neurodegenerative disorder, Alzheimer's disease, Parkinson's disease, Lewy Body dementia, episodic cluster headache, migraine, pain, a mood disorder, anxiety, depression, affective disorder, schizophrenia, malaise, cognition disorder, addiction, autism, epilepsy autism, hepatic encephalopathy, scleroderma, inflammatory bowel disease, Crohn's disease, ulcerative colitis, checkpoint inhibitor-induced colitis, psoriasis, celiac disease, enteritis, gastrointestinal injury, allergy, celiac sprue, childhood allergy, graft vs. host disease, irritable bowel syndrome, spontaneous bacterial peritonitis, ischemic colitis, sclerosing cholangitis, or a combination thereof.

35. The method of claim 33 or claim 34, wherein the subject is human.

Images