Aptamers for direct detection and differentiation of infectious porcine respiratory and reproductive syndrome virus (PPRSV) and porcine epidemic diarrhea virus (PEDV)

Abstract

Aptamers for binding to PRRSV and / or PEDV and assays and methods using the same.

Description

APTAMERS FOR DIRECT DETECTION AND DIFFERENTIATION OF INFECTIOUS PORCINE RESPIRATORY AND REPRODUCTIVE SYNDROME VIRUS (PPRSV) AND PORCINE EPIDEMIC DIARRHEA VIRUS (PEDV)CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to U. S. Provisional Application No.63 / 761,598, filed February 21, 2025, which is incorporated by reference herein in its entirety.BACKGROUND

[0002] Swine-based pathogens pose a severe and growing challenge to the global swine industry, resulting in estimated economic losses of billions of dollars annually.1These financial burdens arise from a combination of reduced herd productivity, increased mortality rates, decreased reproductive efficiency, and the substantial costs of disease management, including medical treatments, culling of infected animals and implementation of biosecurity measures. Additionally, disease outbreaks disrupt trade and supply chains, amplifying economic strain on farmers and stakeholders across the industry. Among the most critical threats are swine-specific viruses such as porcine reproductive and respiratory virus (PRRSV) and porcine epidemic diarrhea virus (PEDV), which are responsible for some of the most devastating outbreaks recorded in swine farming.

[0003] Together, PRRSV and PEDV exert a multifaceted toll on the swine industry. Their ability to spread rapidly within herds and across farms via aerosols, direct contact, and contaminated equipment or personnel amplifies the challenges of containment. Moreover, their economic impact extends beyond direct losses from mortality and reduced productivity, encompassing the costs of medical interventions, increased labor for disease management, trade restrictions, and long-term herd recovery efforts.

[0004] The persis ten t challenge in combating these pathogens lies in the absence of highly efficacious vaccines capable of providing broad and long-lasting protection. Despite ongoing research and development, existing vaccines often fail to prevent infections due to viral genetic diversity and the ability of these viruses to evade immune responses. This leaves the swine industry heavily reliant on biosecurity measures, such as stringent hygiene protocols, quarantine strategies, and effective surveillance systems, to mitigate disease spread. However, these measures are resource -intensive, and their success depends on the early detection of infected animals to prevent further transmission.

[0005] Thus, there exists a need for improved compositions, assays, and methods for detecting PSSRV and PEDV, particularly in swine and other porcine animals. These needs are at least partially satisfied by the present disclosure.SUMMARY

[0006] In an aspect, provided is an aptamer having a nucleic acid sequence including about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71, wherein the aptamer binds to porcine reproductive and respiratory syndrome virus (PRRSV) or a fragment thereof.

[0007] In another aspect, provided is an aptamer having a nucleic acid sequence including about 80% similarity or more to any one of SEQ ID NOS: 84-89, wherein the aptamer binds to porcine epidemic diarrhea virus (PEDV) or a fragment thereof.

[0008] In yet another aspect, provided is an assay for detecting PRRSV, the assay including: a solid support: and a plurality of aptamers coupled to said solid support and having a nucleic acid sequence including about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; wherein the aptamers bind to PRRSV or a fragment thereof.

[0009] In yet still another aspect, provided is an assay for detecting PEDV, the assay including: a solid support; and a plurality of aptamers coupled to said solid support and having a nucleic acid sequence including about 80% similarity or more to any one of SEQ ID NOS: 84-89; wherein the aptamers bind to PEDV or a fragment thereof.

[0010] In yet still another aspect, provided is an assay for detecting PRRSV and / or PEDV, the assay including: a solid support; and a first plurality of aptamers coupled to said solid support and having a nucleic acid sequence including about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; a second plurality of aptamers coupled to said solid support and having a nucleic acid sequence including about 80% similarity or more to any one of SEQ ID NOS: 84-89; wherein the first plurality of aptamers bind to PRRSV or a fragment thereof; and wherein the second plurality of aptamers bind to PEDV or a fragment thereof.

[0011] In yet still another aspect, provided is a lateral flow assay including any of the disclosed assays.

[0012] In yet still another aspect, provided is a nanopore biosensor comprising any of the disclosed assays, wherein the solid support defines one or more nanopores extending between a first surface of the solid support and a second surface of the solid support.

[0013] In yet still another aspect, provided is a method of detecting PRRSV in a subject, the method including contacting a biological sample from the subject with: i) any of the aptamers described above which bind to PRRSV or a fragment thereof; ii) any of the disclosedassays including a plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; iii) any of the disclosed lateral flow assays including a plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; or iv) any of the disclosed nanopore biosensors including a plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71.

[0014] In yet still another aspect, provided is a method of detecting PED V in a subject, the method including contacting a biological sample from the subject with: i) any of the aptamers described above which bind to PEDV or a fragment thereof; ii) any of the disclosed assays including a plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to any one of SEQ ID NOS: 84-89; iii) any of the disclosed lateral flow assays including a plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to any one of SEQ ID NOS: 84-89; or iv) any of the disclosed nanopore biosensors including a plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to any one of SEQ ID NOS: 84-89.

[0015] In yet still another aspect, provided is a method of detecting PRRSV and / or PEDV in a subject, the method including contacting a biological sample from the subject with: i) any of the aptamers described above which bind to PRRSV or a fragment thereof and the any of the aptamers described above which bind to PEDV or a fragment thereof; ii) any of the disclosed assays including: a first plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; and a second plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to any one of SEQ ID NOS: 84-89; iii) any of the disclosed lateral flow assays including: a first plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; and a second plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to any one of SEQ ID NOS: 84-89; or iv) any of the disclosed nanopore biosensors including: a first plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; and a second plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to any one of SEQ ID NOS: 84-89.

[0016] Other systems, methods, features and / or advantages will be or may become apparent to one with skill in the art upon examination of the following drawings and detaileddescription. It is intended that all such additional systems, methods, features and / or advantages be included within this description and be protected by the accompanying claims.BRIEF DESCRIPTION OF DRAWINGS

[0017] FIGURES 1A-1B depict genome structure and mature viral particle of PRRSV. FIG. 1A shows the 5' genome encodes non-structural proteins, translated into polyproteins ppiaand pplab and cleaved into 14 nsps (e.g., nspla, nsplp, nsp7a, nsp7 ). Structural proteins near the 3' end are involved in envelope and RNA packaging. FIG. IB shows the mature PRRSV particle has a lipid envelope with glycoproteins for infection and internalization. Inside, the single-stranded RNA genome is wrapped by nucleocapsid protein.

[0018] FIGURES 2A-2B depict a schematic representation of PEDV genome and virion structure. FIG. 2A shows a diagram of the virion showing the lipid bilayer with S, M, and E proteins surrounding the RNA genome, which is bound to N protein, forming a helical ribonucleoprotein (RNP) complex. FIG. 2B shows PEDV RNA genome structure. The 28 kb genome has a 5' cap, 3' poly-A tail, and UTRs flanking seven open reading frames (ORFla, ORFlb, S, ORF3, E, M, and N). ORFla and ORF1 b overlap, with a programmed -1 ribosomal frameshift (RFS).

[0019] FIGURES 3 depicts a schematic of the in vitro selection process for isolating infectious vims aptamers. The process includes positive and counterselection steps in each round to enhance specificity toward the infectious virus. HAdV refers to human adenovirus. RT indicates room temperature.

[0020] FIGURES 4A-4C depict in vitro selection A of infectious PRRSV -specific aptamers against UV inactivate PRRSV. FIG. 4A shows the negative and positive selection concentrations of PRRSV virus in each round of the PRRSV A selection. FIG. 4B shows monitoring the progress of the SELEX process by quantification of the elution yield, i.e., bound ssDNA over total added ssDNA, using qPCR. FIG. 4C shows melting curves for the different pools during the PRRSV A selection.

[0021] FIGURES 5A-5B depict BEI Inactivated PRRSV and PEDV TCIDso / mL Assay. FIG. 5A, upper left corner is active PRRSV virus 1:10 dilution. FIG. 5A, upper right corner is active PRRSV virus 1:105dilution. FIG. 5A, bottom left corner is inactive PRRSV virus 1:10 dilution. FIG. 5B, upper left corner is active PEDV vims 1:10 dilution. FIG. 5B, upper right corner is active PEDV virus 1: 105dilution. FIG. 5B, bottom left corner is inactive PEDV vims 1:10 dilution.

[0022] FIGURES 6A-6C depict in vitro selection B of infectious PRRSV-specific aptamers against BEI inactivate PRRSV. FIG. 6A shows the negative and positive selection concentrations of PRRSV virus in each round of the PRRSV B selection. FIG. 6B shows monitoring the progress of the SELEX process by quantification of the elution yield, i.e., bound ssDNA over total added ssDNA, using qPCR. FIG. 6C shows melting curves for the different pools during the PRRSV B selection.

[0023] FIGURES 7A-7C depict in vitro selection A of infectious PEDV-specific aptamers against BEI inactivate PEDV. FIG. 7A shows the negative and positive selection concentrations of PEDV virus in each round of the PEDV A selection. FIG. 7B shows monitoring the progress of the SELEX process by quantification of the elution yield, i.e., bound ssDNA over total added ssDNA, using qPCR. FIG. 7C shows melting curves for the different pools during the PEDV A selection.

[0024] FIGURES 8A-8C depict in vitro selection B of infectious PEDV-specific aptamers against BEI inactivate PEDV with higher concentrations of active virus. FIG. 8A shows the negative and positive selection concentrations of PEDV and PRRSV virus in each round of the PEDV B selection. FIG. 8B shows monitoring the progress of the SELEX process by quantification of the elution yield, i.e., bound ssDNA over total added ssDNA, using qPCR. FIG. 8C shows melting curves for the different pools during the PEDV B selection.

[0025] FIGURES 9A-9C depict in vitro selection C of infectious PRRSV-specific aptamers against BEI inactivate PRRSV with filtered active virus. FIG. 9A shows the negative and positive selection concentrations of PRRSV and PEDV virus in each round of the PRRSV C selection. FIG. 9B shows monitoring the progress of the SELEX process by quantification of the elution yield, i.e., bound ssDNA over total added ssDNA, using qPCR. FIG. 9C shows melting curves for the different pools during the PRRSV C selection.

[0026] FIGURES 10A-10C depict in vitro selection C of infectious PEDV-specific aptamers against BEI inactivate PEDV with filtered active virus. FIG. 10A shows the negative and positive selection concentration of PEDV and PRRSV virus in each round of the PEDV C selection. FIG. 10B shows monitoring the progress of the SELEX process by quantification of the elution yield, i.e., bound ssDNA over total added ssDNA, using qPCR. FIG. 10C shows melting curves for the different pools during the PEDV C selection.

[0027] FIGURES 11A-11D depict in vitro selection D of infectious PEDV specific aptamers against BEI inactivate PEDV with filtered active virus performed by collaborator. FIG. I1A shows the negative and positive selection concentrations of PEDV virus in each round of the PEDV D selection. FIG. 11B shows monitoring the progress of the SELEXprocess by quantification of the elution yield, i.e., bound ssDNA over total added ssDNA, using qPCR. FIG, 11C shows melting curves for the different pools before incubating with the virus during the PEDV D selection. FIG. 11D shows melting curves for the different pools after incubating with the virus during the PEDV D selection.

[0028] FIGURES 12A-12D depict in vitro selection D of infectious PRRSV-specific aptamers against BEI inactivate PRRSV with filtered active virus performed by collaborator. FIG. 12A shows the negative and positive selection concentration of PRRSV virus in each round of the PRRSV D selection. FIG. 12B shows monitoring the progress of the SELEX process by quantification of the elution yield, i.e., bound ssDNA over total added ssDNA, using qPCR. FIG. 12C shows melting curves for the different pools before incubating with the virus during the PRRSV D selection. FIG. 12D shows melting curves for the different pools after incubating with the virus during the PRRSV D selection.

[0029] FIGURES 13A-13D depict in vitro selection E of infectious PRRSV-specific aptamers against BEI inactivate PRRSV with filtered active virus performed by collaborator (N). FIG. 13A shows the negative and positive selection concentrations of PRRSV virus in each round of the PRRSV E selection. FIG. 13B shows monitoring the progress of the SELEX process by quantification of the elution yield, i.e., bound ssDNA over total added ssDNA, using qPCR. FIG. 13C shows melting curves for the different pools before incubating with the virus during the PRRSV E selection. FIG. 13D shows melting curves for the different pools after incubating with the virus during the PRRSV E selection.

[0030] FIGURES 14A-14D depict in vitro selection E of infectious PRRSV-specific aptamers against BEI inactivate PRRSV with filtered active virus performed by collaborator (lower concentration branch) (L). FIG. 14A shows the negative and positive selection concentrations of PRRSV virus in each round of the PRRSV E selection. FIG. 14B shows monitoring the progress of the SELEX process by quantification of the elution yield, i.e., bound ssDNA over total added ssDNA, using qPCR. FIG. 14C shows melting curves for the different pools before incubating with the virus during the PRRSV E selection. FIG. 14D shows melting curves for the different pools after incubating with the virus during the PRRSV E selection.

[0031] FIGURES 15A-15D depict the percentage of recurring and newly introduced unique sequences per round for both low (L) and normal (N) selection branches of PRRSV E selection compared to all NGS sequences sequenced, analyzed using the FASTAptamer tool. FIG. 15A shows the percentage of recurring sequences across rounds for the L branch. FIG.15B shows the percentage of recurring sequences across rounds for the N branch. FIG. 15C shows the percentage of newly introduced unique sequences across rounds for the L branch.FIG. 151) shows the percentage of newly introduced unique sequences across rounds for the N branch. These graphs illustrate the trends in sequence retention and diversity throughout the selection process for each branch.

[0032] FIGURES 16A-16B depict the percentage of reads per million (RPM) associated with unique sequences across selection rounds for the low (L) and normal (N) selection branches of PRRSV E selection compared to total RPM for each Round. FIG. 16A shows RPM for unique sequences in the L branch. FIG. 16B shows RPM for unique sequences in the N branch.

[0033] FIGURES 17A-17Q depict a comparison of enrichment fold versus percent abundance per selection round of PRRSV E selection, along with names of sequences showing the highest abundance and enrichment values. FIG. 17A shows a comparison of Round 3 (R3) or Round 4 (R4) against Round 2 (R2). FIG. 17B shows a comparison of Round 4 (R4) or Round 2 (R2) against Round 3 (R3). FIG. 17C shows a comparison of Round 2 (R2) or Round 3 (R3) against Round 4 (R4). FIG. 17D shows a comparison of Round 6 (R6) or Round 7 (R7) against Round 5 (R5). FIG. 17E shows a comparison of Round 7 (R7) or Round 5 (R5) against Round 6 (R6). FIG. 17F shows a comparison of Round 5 (R5) or Round 6 (R6) against Round 7 (R7). FIG. 17G shows a comparison of Round 9 (R9) or Round 10 (R10) against Round 8 (R8). FIG. 17H shows a comparison of Round 10 (R10) or Round 8 (R8) against Round 9 (R9). FIG. 171 shows a comparison of Round 8 (R8) or Round 9 (R9) against Round 10 (R10). FIG. 17J shows a comparison of Round 12N (R12N) or Round 13N (R13N) against Round 11 (Rll). FIG. 17K shows a comparison of Round 13N (R13N) or Round 11 (Rll) against Round 12N (R12N). FIG. 17L shows a comparison of Round 11 (R11) or Round 12N (R12N) against Round 13N (R13N). FIG. 17M shows a comparison of Round 14L (R14L) or Round 15L (R15L) against Round 13L (R13L). FIG. 17N shows a comparison of Round 13L (R13L) or Round 15L (R15L) against Round 14L (R14L). FIG. 170 shows a comparison of Round 14L (R14L) or Round 15L (R15L) against Round 15L (R15L). FIG. 17P shows a comparison of Round 14N (R14N) or Round 15N (R15N) against Round 13N (R13N). FIG. 17Q shows a comparison of Round 13N (R13N) or Round 15N (R15N) against Round 14N (R14N). FIG.17R shows a comparison of Round 14N (R14N) or Round 15N (R15N) against Round 15N (R15N).

[0034] FIGURE 18 depicts predicted secondary structures of PRRSV II aptamer candidates 1-11 (candidate 1 is SEQ ID NO: 72; candidate 2 is SEQ ID NO: 73; candidate 3 is SEQ ID NO: 74; candidate 4 is SEQ ID NO: 75; candidate 5 is SEQ ID NO: 76; candidate 6 is SEQ ID NO: 78; candidate 7 is SEQ ID NO: 148; candidate 8 is SEQ ID NO: 149; candidate9 is SEQ ID NO: 150; candidate 10 is SEQ ID NO: 151; candidate 11 is SEQ ID NO: 152). The mFoid predictions were performed with 1 mM MgCh at 25°C?9

[0035] FIGURE 19 depicts ELONA assays with active PRRSV II with PRRSV II aptamer candidates 1-9.

[0036] FIGURES 20A-20F depict native gel binding assays of active PRRSV II with aptamer candidates 1-6. FIG. 20A is a native gel showing 10 nM aptamer candidates 1 and 2 incubated with varying concentrations of active PRRSV II. FIG. 20B is a Coomassie-stained native gel of 10 nM aptamer candidates 1 and 2 with different concentrations of active PRRSV II. FIG. 20C shows a native gel of 10 nM aptamer candidates 3 and 4 with varying concentrations of active PRRSV II. FIG. 20D shows a Coomassie-stained native gel of 10 nM aptamer candidates 3 and 4 with different concentrations of active PRRSV II. FIG. 20E shows a SYBR Gold-stained native gel of 10 nM aptamer candidates 3 and 4 with varying concentrations of active PRRSV II. FIG. 20F shows a Coomassie-stained native gel of 10 nM aptamer candidates 5 and 6 with different concentrations of active PRRSV II. The red arrow indicates the aptamer, while the orange arrow marks the virus.

[0037] FIGURES 21A-21B depict thermofl uori metric analysis of PRRSV aptamer candidates 1-6 with active PRRSV II. FIG. 21 A shows melting curves of aptamer candidates 1-6 incubated with active PRRSV II, showing fluorescence changes over a temperature range. FIG. 21B shows a normalized derivative of the fluorescence signal (-dE / dT) at 67°C, calculated to assess the effect of active PRRSV II on aptamer stability.

[0038] FIGURE 22 depicts a SYBR green I binding assay of PRRSV aptamer candidates 1-6 with active and inactive PRRSV II. Blue bars represent binding with active PRRSV II, while red bars represent binding with inactive PRRSV II.

[0039] FIGURE 23 depicts fluorescence polarization binding assays of 250 nM F AM- labeled aptamer candidates 1-7 and 9 with active PRRSV II.

[0040] FIGURE 24 depicts MFoid predictions of candidate 5 (candidate 5 (FP, 45 region, RP) is SEQ ID NO: 76; candidate 5 (FP, 45 region) is SEQ, ID NO: 77; candidate 5 (45 region, RP) is SEQ ID NO: 153; candidate 5 (45 region) is SEQ ID NO: I), candidate 6 (candidate 6 (FP, 45 region, RP) is SEQ ID NO: 78; candidate 6 (FP, 45 region) is SEQ ID NO: 154; candidate 6 (45 region, RP) is SEQ ID NO: 79; candidate 6 (45 region) is SEQ ID NO: 28), candidate 7 (candidate 7 (FP, 45 region, RP) is SEQ ID NO: 148; candidate 7 (FP, 45 region) is SEQ ID NO: 80; candidate 7 (45 region, RP) is SEQ ID NO: 81; candidate 7 (45 region) is SEQ ID NO: 15), and candidate 9 (candidate 9 (FP, 45 region, RP) is SEQ ID NO: 150; candidate 9 (FP, 45 region) is SEQ ID NO: 82; candidate 9 (45 region, RP) is SEQ ID NO:83; candidate 9 (45 region) is SEQ ID NO: 49). Structural predictions were generated using mFold with 1 mM MgCh at 25 °C. Here, FP denotes the forward primer, RP denotes the reverse primer, and the 45 region refers to the randomized sequence in the DNA library pool used in SELEX.

[0041] FIGURE 25 depicts ELONA assays with active PRRSV II for truncated aptamer candidates 5, 6, 7, and 9. For Candidate 5, two truncations were tested: one with the forward primer (FP) and 45 region, and one with only the 45 region. Candidate 6 was tested with a single truncation containing the 45 region and reverse primer (RP). For Candidate 7, two truncations were tested: one with FP and the 45 region, and one with the 45 region and RP. Candidate 9 was tested with one truncation containing FP and the 45 region.

[0042] FIGURE 26 depicts selectivity of PRRSV II E-selected aptamer candidates 5, 7, and 9 (Forward Primer (FP) and 45 Region) evaluated by ELONA assays. The selectivity of these aptamer candidates was tested against active PRRSV II, inactive PRRSV II, active PRRSV I, and active PEDV.

[0043] FIGURE 27 depicts selectivity of PRRSV II E-selected 250 nM FAM-labeled aptamer Candidates 5, 7, and 9 (Forward Primer (FP) and 45 Region) evaluated by fluorescence polarization assays. The selectivity of these aptamer candidates was tested against active PRRSV II, inactive PRRSV II, active PRRSV I, and active PEDV.

[0044] FIGURE 28 depicts selectivity of PRRSV II E-selected 250 nM FAM-labeled aptamer candidates 5 and 9 (both containing the Forward Primer (FP) and 45 Region) in the presence of 10% pig oral fluid. The selectivity of these aptamer candidates was assessed using fluorescence polarization assays against active PRRSV II, inactive PRRSV II, active PRRSV I, and active PEDV.

[0045] FIGURE 29 depicts MFold predictions of truncated aptamer candidate 5 (FP, 45 region) (SEQ ID NO: 77), candidate 7 (FP, 45 region) (SEQ ID NO: 80), candidate 9 (FT, 45 region) (SEQ ID NO: 82), and negative control (NC) scrambled (FP, 45 region) (SEQ ID NO: 121) used in the exonuclease digestion assays. Structural predictions were generated using mFold with 1 mM MgCh at 25°C.

[0046] FIGURES 30A-30D depict time-dependent 1'5 exonuclease digestion assays for PRRSV aptamer candidates, in the presence of 2 xlO5active PRRSV II TCIDso / mL. FIG. 30A shows candidate 5 (FP, 45 region). FIG. 30B shows candidate 7 (FP, 45 region). FIG. 30C shows candidate 9 (FP, 45 region). FIG. 30D shows negative control (NC) scrambled (FP, 45 region).

[0047] FIGURES 31A-31D depict selectivity of T5 exonuclease digestion assays for PRRSV aptamer candidates in the presence of 2 xlO5active PRRSV II TCIDso / mL or 2 xlO5inactive PRRSV II TCIDso / mL, 2 xlO5active PRRSV I TCIDso / mL, or 2 xlO5active PEDV TCIDso / mL. FIG. 31A shows candidate 5 (FP, 45 region). FIG. 31B shows candidate 7 (FP, 45 region). FIG. 31C shows candidate 9 (FP, 45 region). FIG. 31D shows negative control (NC) scrambled (FP, 45 region).

[0048] FIGURE 32 depicts MFold predictions of PRRSV aptamer candidate 5 (FP, 45 region) (SEQ ID NO: 77)’s negative controls (NCI is SEQ ID NO: 122; NC2 is SEQ ID NO: 123; NC3 is SEQ ID NO: 124; NC4 is SEQ ID NO: 125; NC5 is SEQ ID NO: 126; NC6 is SEQ ID NO: 127; NC7 is SEQ ID NO: 128; NC8 is SEQ ID NO: 129; NC9 is SEQ ID NO: 130; NC10 is SEQ ID NO: 131; NC11 is SEQ ID NO: 132; NC12 is SEQ ID NO: 133; NC13 is SEQ ID NO: 134; NC14 is SEQ ID NO: 135; NCI is SEQ ID NO: 136; NC16 is SEQ ID NO: 137) used in the exonuclease digestion assays. Structural predictions were generated using niFold with 1 mM MgCh at 25 °C.

[0049] FIGURES 33A-33Q depict selectivity of T5 exonuclease digestion assays for PRRSV aptamer 5 candidate (FP and 45 region) in the presence of 2 xlO5active PRRSV II TCIDso / mL or 2 xlO5inactive PRRSV II TCIDso / mL, 2 xlO5active PRRSV I TCIDso / mL, or 2 xl(P active PEDV TCIDso / mL. FIG. 33A shows Candidate 5 (FP, 45 region). FIG. 33B shows NC 1 for Candidate 5 (FP, 45 region). FIG. 33C shows NC 2 for Candidate 5 (FP, 45 region). FIG. 33D shows NC 3 for Candidate 5 (FP, 45 region). FIG. 33E shows NC 4 for Candidate 5 (FP, 45 region). FIG.33F shows NC 5 for Candidate 5 (FP, 45 region). FIG.33G shows NC 6 for Candidate 5 (FP, 45 region). FIG. 33H shows NC 7 for Candidate 5 (FP, 45 region). FIG. 331 shows NC 8 for Candidate 5 (FP, 45 region). FIG. 33.1 shows NC 9 for Candidate 5 (FP, 45 region). FIG. 33K shows NC 10 for Candidate 5 (FP, 45 region). FIG.33L shows NC 11 for Candidate 5 (FP, 45 region). FIG. 33M shows NC 12 for Candidate 5 (FP, 45 region). FIG.33N shows NC 13 for Candidate 5 (FP, 45 region). FIG.330 shows NC 14 for Candidate 5 (FP, 45 region). FIG. 33P shows NC 15 for Candidate 5 (FP, 45 region).FIG. 33Q shows NC 16 for Candidate 5 (FP, 45 region).

[0050] FIGURE 34 depicts a schematic of the PRRSV nanopore biosensor. The analyte is infectious PRRSV in swine samples, such as saliva or serum. The biocomponent is the aptamer, and the transducer is the nanopore. The signal is generated from the current-voltage curve.

[0051] DETAILED DESCRIPTION

[0052] It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate aspects, can also be provided in combination with a single aspect. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single aspect, can also be provided separately or in any suitable subcombination. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure.DEFINITIONS

[0053] In this specification and in the claims that follow, reference will be made to a number of terms, which shall be defined to have the following meanings:

[0054] As used herein, “comprising” is to be interpreted as specifying the presence of the stated features, integers, steps, or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps, or components, or groups thereof. Moreover, each of the terms “by”, “comprising,” “comprises”, “comprised of,” “including,” “includes,” “included,” “involving,” “involves,” “involved,” and “such as” are used in their open, non-limiting sense and may be used interchangeably. Further, the term “comprising” is intended to include examples and aspects encompassed by the terms “consisting essentially of’ and “consisting of.” Similarly, the term “consisting essentially of’ is intended to include examples encompassed by the term “consisting of.

[0055] As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a compound”, “a composition”, or “a cancer”, includes, but is not limited to, two or more such compounds, compositions, or cancers, and the like.

[0056] It should be noted that ratios, concentrations, amounts, and other numerical data can be expressed herein in a range format. It can be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. Similarly, when values are expressed as approximations, by use of the antecedent“about,” it can be understood that the particular value forms a further aspect. For example, if the value “about 10” is disclosed, then “10” is also disclosed.

[0057] When a range is expressed, a further aspect includes from the one particular value and / or to the other particular value. For example, where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure, e.g. the phrase “x to y” includes the range from ‘x’ to ‘y ’ as well as the range greater than ‘x’ and less than ‘y’. The range can also be expressed as an upper limit, e.g. ‘about x, y, z, or less’ and should be interpreted to include the specific ranges of ‘about x’, ‘about y’, and ‘about z’ as well as the ranges of ‘less than x’, less than y’, and ‘less than z’. Likewise, the phrase ‘about x, y, z, or greater’ should be interpreted to include the specific ranges of ‘about x’, ‘about y’, and ‘about z’ as well as the ranges of ‘greater than x’, greater than y’, and ‘greater than z’. In addition, the phrase “about ‘x’ to ‘y’”, where ‘x’ and ‘y’ are numerical values, includes “about ‘x’ to about ‘y’”.

[0058] It is to be understood that such a range format is used for convenience and brevity, and thus, should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. To illustrate, a numerical range of “about 0.1% to 5%” should be interpreted to include not only the explicitly recited values of about 0.1 % to about 5%, but also include individual values (e.g., about 1%, about 2%, about 3%, and about 4%) and the subranges (e.g., about 0.5% to about 1.1%; about 5% to about 2.4%; about 0.5% to about 3.2%, and about 0.5% to about 4.4%, and other possible sub-ranges) within the indicated range.

[0059] As used herein, the terms “about,” “approximate,” “at or about,” and “substantially” mean that the amount or value in question can be the exact value or a value that provides equivalent results or effects as recited in the claims or taught herein. That is, it is understood that amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but may be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art such that equivalent results or effects are obtained. In some circumstances, the value that provides equivalent results or effects cannot be reasonably determined. In such cases, it is generally understood, as used herein, that “about” and “at or about” mean the nominal value indicated ±10% variation unless otherwise indicated or inferred. In general, an amount, size, formulation, parameter or other quantity or characteristic is “about,” “approximate,” or “at or about” whether or not expressly stated to be such. It isunderstood that where “about,” “approximate,” or “at or about” is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.

[0060] As used herein, the term “effective amount” refers to an amount that is sufficient to achieve the desired modification of a physical property of the composition or material. For example, an “effective amount” of a monomer refers to an amount that is sufficient to achieve the desired improvement in the property modulated by the formulation component, e.g. desired antioxidant release rate or viscoelasticity. The specific level in terms of wt% in a composition required as an effective amount will depend upon a variety of factors including the amount and type of monomer, amount and type of polymer, e.g., acrylamide, amount of antioxidant, and desired release kinetics.

[0061] As used herein, the term “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms but is generally insufficient to cause adverse side effects. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed and like factors within the knowledge and expertise of the health practitioner and which may be well known in the medical arts. In the case of treating a particular disease or condition, in some instances, the desired response can be inhibiting the progression of the disease or condition. This may involve only slowing the progression of the disease temporarily. However, in other instances, it may be desirable to halt the progression of the disease permanently. This can be monitored by routine diagnostic methods known to one of ordinary skill in the art for any particular disease. The desired response to treatment of the disease or condition also can be delaying the onset or even preventing the onset of the disease or condition.

[0062] For example, it is well within the skill of the art to start doses of a compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, single dose compositions can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. It is generally preferred that a maximum dose of the pharmacological agents of the invention (aloneor in combination with other therapeutic agents) be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.

[0063] A response to a therapeutically effective dose of a disclosed drug delivery composition can be measured by determining the physiological effects of the treatment or medication, such as the decrease or lack of disease symptoms following administration of the treatment or pharmacological agent. Other assays will be known to one of ordinary skill in the art and can be employed for measuring the level of the response. The amount of a treatment may be varied for example by increasing or decreasing the amount of a disclosed compound and / or pharmaceutical composition, by changing the disclosed compound and / or pharmaceutical composition administered, by changing the route of administration, by changing the dosage timing and so on. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products.

[0064] As used herein, the term “prophy tactically effective amount” refers to an amount effective for preventing onset or initiation of a disease or condition.

[0065] As used herein, the term “prevent” or “preventing” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed.

[0066] As used herein, the terms “optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

[0067] As used interchangeably herein, “subject,” “individual,” or “patient” can refer to a vertebrate organism, such as a mammal (e.g. porcine). " Subject" can also refer to a cell, a population of cells, a tissue, an organ, or an organism, preferably to porcine and constituents thereof.

[0068] As used herein, the terms "treating" and "treatment" can refer generally to obtaining a desired pharmacological and / or physiological effect. The effect can be, but does not necessarily have to be, prophylactic in terms of preventing or partially preventing a disease, symptom or condition thereof. The effect can be therapeutic in terms of a partial or complete cure of a disease, condition, symptom or adverse effect attributed to the disease, disorder, or condition. The term "treatment" as used herein can include any treatment of a disease disorderin a subject, particularly a human and can include any one or more of the following: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., mitigating or ameliorating the disease and / or its symptoms or conditions. The term "treatment" as used herein can refer to both therapeutic treatment alone, prophylactic treatment alone, or both therapeutic and prophylactic treatment. Those in need of treatment (subjects in need thereof) can include those already with the disorder and / or those in which the disorder is to be prevented. As used herein, the term "treating", can include inhibiting the disease, disorder or condition, e.g., impeding its progress; and relieving the disease, disorder, or condition, e.g., causing regression of the disease, disorder and / or condition. Treating the disease, disorder, or condition can include ameliorating at least one symptom of the particular disease, disorder, or condition, even if the underlying pathophysiology is not affected, e.g., such as treating the pain of a subject by administration of an analgesic agent even though such agent does not treat the cause of the pain.

[0069] As used herein, “dose,” “unit dose,” or “dosage” can refer to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of a disclosed compound and / or a pharmaceutical composition thereof calculated to produce the desired response or responses in association with its administration.

[0070] As used herein, “therapeutic” can refer to treating, healing, and / or ameliorating a disease, disorder, condition, or side effect, or to decreasing in the rate of advancement of a disease, disorder, condition, or side effect.APTAMERS

[0071] In an aspect, provided is an aptamer having a nucleic acid sequence including about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84% similarity or more, about 85% similarity or more, about 86% similarity or more, about 87% similarity or more, about 88% similarity or more, about 89% similarity or more, about 90% similarity or more, about 91% similarity or more, about 92% similarity or more, about 93% similarity or more, about 94% similarity or more, about 95% similarity or more, about 96% similarity or more, about 97% similarity or more, about 98% similarity or more, about 99% similarity or more, about 100% similarity) to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71, wherein the aptamer binds to porcine reproductive and respiratory syndrome virus (PRRSV) or a fragment thereof.

[0072] In some aspects, the nucleic acid sequence can include SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71. In some aspects, the nucleic acid sequence can consist of SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71.

[0073] In some aspects, the nucleic acid sequence can include SEQ ID NO: 2. (AAGGAGCAGCGTGGAGGATA), SEQ ID NO: 3 (ACCACGACGACACACCCTAA), SEQ ID NO: 96, SEQ ID NO: 97, and / or SEQ ID NO: 147 (TTAGGGTGTGTCGTCGTGGT). In some aspects, SEQ ID NO: 2 and / or SEQ ID NO: 96 can be at or adjacent to the 5’ end of the nucleic acid sequence, and SEQ ID NO: 3, SEQ ID NO: 97, and / or SEQ ID NO: 147 can be at or adjacent to the 3’ end of the nucleic acid sequence.TABLE 1, PRRSV aptamers.SEQ IDSequenceNO CCGACACGATGGGACGGGTATTAGGCATAGGGCGCGTCCGCGGAC 1 CGGAGCGATGCGACGAAAGAGATTAGTAGTTGTGCAGAAGATAAT 4 GGACAGGCTGCGACAAATCTCTCAGTTTTGTTCCATCATTTTACT 5 CCGAGACGATGCGAGTTCTAGGGAGAAGTGGATACGTTGGGTCAT 6 GCGCGGCGACGTATTTGCGGGGCGGTTCGTGGGTGGGGTAGCAAA 7 CGATCACGATGCGACGGAGTAGTGTCCAAGGGTATCCGGTAAAAG 8 AAACGGTGGGGTGCTTGGTTGCGGTATGCCGGACAGGTCTATCAT 9 GGAACACGATGCGACGCTGGGTGGGATTGGGCGGGGGTTGCGATT 10 CTCCAACATGATAGTGGACTCCTCCAATCTTCGTITTCTGAAATC 11 CC GAC AC GATGGG ACGGGGCGAGGG A I’C A T I’ AC A T C GGACC TA GA 12 CATGCATGGGGGGGCCCGCTGCGACGTATAGGTGTAACTGTTATА 13 GGTCATTCCGTCCGAATCTTTTCCTGTCAGAAGCGGGGGGAGGCC 14 CGACACGAGGCGACGGGTATAAGTTTCATTAAAAAGTATATTCAA 15 CGGGGACCGAAGCCGTAGCGATGCGACTGGATAGATATTTTTCAA 16 CG ACACG ATGTCC CGTATCTC AGTTATCTTCT ATCTTCTTTA ATC 17 GCGGTTGCCCCCACCTCGTTATTGGCGGTCGAGTTCAGGTTGATA 18 GTAAGTCACTACGCGAGTGTAGGAGCATGCGGTTTAATTAGAAAT 19 AAACTGTAAGTTTTACATGCCGTCTCGTTTGTTCCCGTTGCCGAA 20 ACCACGCAAGGTCAGATGCGGGATGCAGATTAGCTGGTGCGTATG 21 GATTCGTTTGTCTCATTAGTTAATTCAATTCGTAGATTGTAGTGC 22AGTGACACGATGCGAGTGAGGTGGAGCGTAGCGGTTATGAATTCT 23 ACCGTACGATCCGGACGGTCCTTGTCCCCATAGGGCAACATCTTC 24 CGACACGATGGGACAAAAATAATAGTTTTAGGTTTCCAGAATG 25 CGACCGATGCGACTGGTCTTGAGTAGCGGACGGTACGGAAGTGTT 26 ACCGTACGATCCGGACGGTCCTTGCCCCCATAGGGCAACATCTTC 27 CCGAGGCGGGCTAGGCGGGCTGCGACGTGTAGGTACTTGTTATTG 28 GCCACGCAAGGTCAGATGCGGGATGC AGATTAGCTGGTGCGTATG 29 CGCGATGCGACAGGGCGGGATTGCTCATC AGCGGGCGGGGATTTT’ 30 CAGGCGTGTTTCGGGCGTTTAGGACGATGGGTCAGGGGGGGTCAT 31 CGCGATGCGACGAATGGGCGGGTTCTAATTAGGGGGGGTTCTTCG 32 CCGAGGCGGGCTAGGCGGGCTGCGACGTGTAGGTACTTTTTATTG 33 CGACACGAGGATCCGATTGCAAGAGAAGTAGAGTATATAATTCGT 34 GC GC AGC G AC G FA 1 " Fl 'GC GGGGC GG 1 ” I’CG 1 GGGTGGGGT AGC AAA 35 ACAATTACCCAGAGGGTCCCTGCAATATGCAGCATCTTCGCCTTG 36 TACTCCCATAGGGAGTCCAGGCTCTAGCCTTATCTTCCATCGGCC 37 GGGTGGGTGGGGGCTCAGGGATCGCCAATTATTGTGGGGGGTGGG 38 GGAACACGATGCGACGCTGGGTGGGATTGGGCGGGGGTTGCGATC 39 CGACCGATGCGACGAGGGTGGGCAATTGGGCGGGGGTCTCTCTGA 40 CGCGATGCGACGAATGGGCGGGTTCTAATCAGGGGGGGTТCTTCG 41 CCGTAGGGCTGCGACTGAClTGTAATrATGG'FI’FI’FITTCTFFFT 42 GCTCATGCGATCCTAGGGGCAACGGTCCGATTAACTCTGTCTCCG 43 CCCGGGAGACACCAGGATGCGACCCAATAGTGTAGGGTTAATTAG 44 CCGACACGGGGCGACGTCTTCTTAGGGAGAACGTAGTGTTGGTTA 45 CATTAAGGGAGCGAAAGCGGTCAAAATAGAGACAGAGAGATGCGT 46 ACGAGAAAGCGGGTAGGTTATGGCGAATAAAATGTAGCTC ATTGG 47 AAGCGCAGACTATAATACAGATGGGTGCGCCAACGAAGTGTTTC 48 AAACTGTAAGTTTTACATGCCGTCTCGTCTGTTCCCGTTGCCGAA 49 CGAAGTAGCCGGGAGCGATGTGAGGAGGTAGAGTTCAATGGCTAG 50 CGCGATGCGACAGGGCGGGATTGCTCATCAGCGGGCGGGGATTTG 51 GCGCGGCGACGTATTTGCGGGGCGGTTCGTGGGTGGGGTAGCGAA 52 GCC ACGCAGGGTCAGATGCGGGATGC AGATTAGCTGG IGCGTATG 53 CGCGATGCGACAGGGCGGGATTGCTCATTAGCGGGCGGGGATTTT 54TAACGTAGCCCTGCGTATTGATTTCATATCTTGAAATTCCCGAGT 55 CGGAAC A A AGCG ACGTCT A ATAGTCCTATCITI’CTATCA AT1T1 T 56 CCGACAGGGTGCGTATGGTTTTTGTGATTAGTGAGTTTAGGTCTG 57 GCCACGCAAGGTCAGATGCGGGATGCAGATTAGCTGGTGCGTACG 58 GGCGGCACGCATAGCCATTAAATCGGGCACGGTTTCACGGTTGCG 59 ACCACGCAAGATCAGATGCGGGATGCAGATTAGCTGGTGCGTATG 60 GCCACGCAAGGTTAGATGCGGGATGCAGATTAGC TGGTGCGTATG 61 CCGGAAC AGAGCGACCATTAGGGAAAGCGGAATATATTGAGCGTC 62 TGAATCCACGGGTTTGTTTAAGTGCCTTGCCTTCCTGCGTATTCA 63 TTGAGGACACGATGCGACTGAAGGAATAGGTATAATCAATTTTTG 64 CAAAGCGGATCCGTCTGGGGTCTCTTGGGCGGGTGGGAATAATCG 65 GCGCGGCGACGTATTTGCGGGGCGGTCCGTGGGTGGGGTAGCAAA 66 GCGCGGCGACGTATTTGCGGGGTGGTTCGTGGGTGGGGTAGCAAA 67 GCGCGGCGACGTATTTGCGGGGCGGTTTGTGGGTGGGGTAGCAAA 68 CCGTAGGGCTGCGACTGACTTGTAATTATGGTTTTTTTCTTTTT 69 GGAATCCACGGGTTTGCTTAAGTGCCTTGCCTTCCTGCGTATTCA 70 GGAATCCACGGGTTTGTTTAAATGCCTTGCCTTCCTGCGTATTCA 71

[0074] In some aspects, the nucleic acid sequence can include about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84% similarity or more, about 85% similarity or more, about 86% similarity or more, about 87% similarity or more, about 88% similarity or more, about 89% similarity or more, about 90% similarity or more, about 91 % similarity or more, about 92% similarity or more, about 93% similarity or more, about 94% similarity or more, about 95% similarity or more, about 96% similarity or more, about 97% similarity or more, about 98% similarity or more, about 99% similarity or more, about 100% similarity) to any one of SEQ ID NOS: 72-83 or SEQ ID NOS: 148-154. In some aspects, the nucleic acid sequence can include any one of SEQ ID NOS: 72-83 or SEQ ID NOS: 148-154. In some aspects, the nucleic acid sequence can consist of any one of SEQ ID NOS: 72-83 or SEQ ID NOS: 148-154.TABLE 2. Additional PRRSV aptamers.SEQSequenceID NOAAGGAGCAGCGTGGAGGATAACCACGCAAGGTCAGATGCGGGATGCAG72 ATTAGCTGGTGCGTATGTTAGGGTGTGTCGTCGTGGT AAGGAGCAGCGTGGAGGATAAAACTGTAAGTTTTACATGCCGTCTCGTT TGTTCCCGTTGCCGAATTAGGGTGTGTCGTCGTGGT AAGGAGCAGCGTGGAGGATACGATCACGATGCGACGGAGTAGTGTCCA74 AGGGTATCCGGTAAAAGTTAGGGTGTGTCGTCGTGGT AAGGAGCAGCGTGGAGGATACTGACACGGGGCGACGTCTTCTTAGGGA75 GAACGTAGTGTrGGn’ATI’AGGGTGTGTCGTCGTGGT AAGGAGCAGCGTGGAGGATACCGACACGATGGGACGGGTATTAGGCAT76 AGGGCGCGTCCGCGGACTTAGGGTGTGTCGTCGTGGT AAGGAGCAGCGTGGAGGATACCGACACGATGGGACGGGTATTAGGCAT77 AGGGCGCGTCCGCGGAC AAGGAGCAGCGTGGAGGATACCGAGGCGGGCTAGGCGGGCTGCGACGT78 GTAGGTACTTGTTATTGTTAGGGTGTGTCGTCGTGGT CCGAGGCGGGCTAGGCGGGCTGCGACGTGTAGGTACTTGTTATTGTTAG79 GGTGTGTCGTCGTGGT AAGGAGCAGCGTGGAGGATACGACACGAGGCGACGGGTATAAGTTTCA80 TTAAAAAGTATATTCAA CGACACGAGGCGACGGGTATAAGTTTCATTAAAAAGTATATTCAATTAG81 GGTGTGTCGTCGTGGT AAGGAGCAGCGTGGAGGATAAAACTGTAAGTTTTACATGCCGTCTCGTC82 TGTTCCCGTTGCCGAA AAACTGTAAGTTTTACATGCCGTCTCGTCTGTTCCCGTTGCCGAATTAGG83 GTGTGTCGTCGTGGT AAGGAGCAGCGTGGAGGATACGACACGAGGCGACGGGTATAAGTTTCA148 TTAAAAAGTATATTCAATTAGGGTGTGTCGTCGTGGT AAGGAGCAGCGTGGAGGATAGCCACGCAAGGTCAGATGCGGGATGCAG149 ATTAGCTGGTGCGTATGTTAGGGTGTGTCGTCGTGGT AAGGAGCAGCGTGGAGGATAAAACTGTAAGTTTTACATGCCGTCTCGTC150 TGTTCCCGTTGCCGAATTAGGGTGTGTCGTCGTGGT AAGGAGC AGCGTGGAGGATAACCGTACGATCCGGACGGTCCTTGTCCCC151 ATAGGGCAACATCTTCTTAGGGTGTGTCGTCGTGGTAAGGAGCAGCGTGGAGGATAAGTGACACGATGCGAGTGAGGTGGAGCG 152 TAGCGGTTATGAATTCTTTAGGGTGTGTCGTCGTGGT CCGACACGATGGGACGGGTATTAGGCATAGGGCGCGTCCGCGGACTTAG153 GGTGTGTCGTCGTGGT AAGGAGCAGCGTGGAGGATACCGAGGCGGGCTAGGCGGGCTGCGACGT154 GTAGGTACTTGTTATTG

[0075] In some aspects, the aptamer binds only to infectious PRRSV or a fragment thereof. In some aspects, the aptamer does not bind to non-infection PRRSV or a fragment thereof.

[0076] In some aspects, the aptamer can bind to PRRSV-1 or a fragment thereof and / or PRRSV-2 or a fragment thereof.

[0077] In another aspect, provided is an aptamer having a nucleic acid sequence including about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84% similarity or more, about 85% similarity or more, about 86% similarity or more, about 87% similarity or more, about 88% similarity or more, about 89% similarity or more, about 90% similarity or more, about 91% similarity or more, about 92% similarity or more, about 93% similarity or more, about 94% similarity or more, about 95% similarity or more, about 96% similarity or more, about 97% similarity or more, about 98% similarity or more, about 99% similarity or more, about 100% similarity) to any one of SEQ ID NOS: 84-89, wherein the aptamer binds to porcine epidemic diarrhea virus (PEDV) or a fragment thereof.

[0078] In some aspects, the nucleic acid sequence can include any one of SEQ ID NOS: 84-89. In some aspects, the nucleic acid sequence can consist of any one of SEQ ID NOS: 84-89.TABLE 3. PEDV aptamers.SEQ IDSequenceNO TGGATCGTGCACTTGTGATTGTTGACCGCGCTTATTGACCGGTGA 84 GGCAGAGAATGTAAACGGTGTACGACTCCTATGCCTTAATCTCCT 85 CCACCACCCTTAGGAATCGCCTCGTAGGAGTGCGTACGGTACACC 86 CCGTGCATTGTCACATTGAAGTTGCACGCACAGCATCCGATCCCA 87 CTCGAAGGCCAGTGGTTCTGAATGCGAGAGTCTGCCAAGGGGGCC 88AGACAGTGTCGCGTCCTAGCCGCTTTTACCAAAAGGGATCAGCGG 89

[0079] In some aspects, the nucleic acid sequence can include SEQ ID NO: 91 (GTCCATCGTTCGGTAGTG) and / or SEQ ID NO: 92 (AATCGTGGACAGTTAGCC). In some aspects, SEQ ID NO: 91 can be at or adjacent to the 5’ end of the nucleic acid sequence, and SEQ ID NO: 92 can be at or adjacent to the 3’ end of the nucleic acid sequence

[0080] In some aspects, the aptamer binds only to infectious PEDV or a fragment thereof. In some aspects, the aptamer does not bind to non-infection PEDV or a fragment thereof. ASSAYS

[0081] In an aspect, provided is an assay for detecting PRRSV, the assay including: a solid support; and a plurality of aptamers coupled to said solid support and having a nucleic acid sequence including about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84% similarity or more, about 85% similarity or more, about 86% similarity or more, about 87% similarity or more, about 88% similarity or more, about 89% similarity or more, about 90% similarity or more, about 91% similarity or more, about 92% similarity or more, about 93% similarity or more, about 94% similarity or more, about 95%’ similarity or more, about 96% similarity or more, about 97% similarity or more, about 98% similarity or more, about 99% similarity or more, about 100% similarity) to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; wherein the aptamers bind to PRRSV or a fragment thereof. In some aspects, the aptamers can include any of the aptamers described above which bind to PRRSV or a fragment thereof.

[0082] In another aspect, provided is an assay for detecting PEDV, the assay including: a solid support; and a plurality of aptamers coupled to said solid support and having a nucleic acid sequence including about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84% similarity or more, about 85% similarity or more, about 86% similarity or more, about 87% similarity or more, about 88'2 similarity or more, about 89%’ similarity or more, about 90% similarity or more, about 91% similarity or more, about 92% similarity or more, about 93% similarity or more, about 94% similarity or more, about 95% similarity or more, about 96% similarity or more, about 97% similarity or more, about 98% similarity or more, about 99% similarity or more, about 100% similarity) to any one of SEQ ID NOS: 84-89; wherein the aptamers bind to PEDV or a fragment thereof. In some aspects, the aptamers can include any of the aptamers described above which bind to PEDV or a fragment thereof.

[0083] In yet another aspect, provided is an assay for detecting PRRSV and / or PEDV, the assay including: a solid support; and a first plurality of aptamers coupled to said solid support and having a nucleic acid sequence including about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84% similarity or more, about 85% similarity or more, about 86% similarity or more, about 87% similarity or more, about 88% similarity or more, about 89% similarity or more, about 90% similarity or more, about 91% similarity or more, about 92% similarity or more, about 93% similarity or more, about 94% similarity or more, about 95% similarity or more, about 96% similarity or more, about 97% similarity or more, about 98% similarity or more, about 99% similarity or more, about 100% similarity) to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; a second plurality of aptamers coupled to said solid support and having a nucleic acid sequence including about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84% similarity or more, about 85% similarity or more, about 86% similarity or more, about 87% similarity or more, about 88%’ similarity or more, about 89% similarity or more, about 90% similarity or more, about 91% similarity or more, about 92% similarity or more, about 93% similarity or more, about 94% similarity or more, about 95% similarity or more, about 96% similarity or more, about 97% similarity or more, about 98% similarity or more, about 99% similarity or more, about 100% similarity) to any one of SEQ ID NOS: 84-89; wherein the first plurality of aptamers bind to PRRSV or a fragment thereof; and wherein the second plurality of aptamers bind to PEDV or a fragment thereof. In some aspects, the first plurality of aptamers can include any of the aptamers described above which bind to PRRSV or a fragment thereof. In some aspects, the second plurality of aptamers can include any of the aptamers described above which bind to PEDV or a fragment thereof.

[0084] In some aspects, the aptamers can be covalently linked to the solid support.

[0085] In some aspects, the aptamers can be coupled to the solid support via a terminal amino modification. In some aspects, the terminal amino modification can be on the 3’ end or the 5’ end of each aptamer.

[0086] In some aspects, the aptamers can be coupled to the solid support via a spacer. In some aspects, the spacer can include a C0-C12 spacer.

[0087] In yet still another aspect, provided is a lateral flow assay including any of the disclosed assays.

[0088] In yet still another aspect, provided is a nanopore biosensor comprising any of the disclosed assays, wherein the solid support defines one or more nanopores extending between a first surface of the solid support and a second surface of the solid support.

[0089] In some aspects, the aptamers can be coupled to an inner surface of the one or more nanopores.

[0090] In some aspects, the first surface of the solid support can define a first end of each nanopore and the second surface of the solid support can define a second end of each nanopore. Each end of each nanopore can be any suitable shape. For example, in some aspects, the first end of each nanopore and the second end of each nanopore can be circular. In some aspects, the first end of each nanopore and the second end of each nanopore can be the same shape. In other aspects, the first end of each nanopore and the second end of each nanopore can be different shapes.

[0091] In some aspects, the first end of each nanopore can have a characteristic length (e.g., a diameter) of about 800 nm or more (e.g., about 810 nm or more, about 820 nm or more, about 830 nm or more, about 840 nm or more, about 850 nm or more, about 860 nm or more, about 870 nm or more, about 880 nm or more, about 890 nm or more, about 900 nm or more, about 910 nm or more, about 920 nm or more, about 930 nm or more, about 940 nm or more, about 950 nm or more, about 960 nm or more, about 970 nm or more, about 980 nm or more, about 990 nm or more, about 1000 nm or more). In some aspects, the first end of each nanopore can have a characteristic length (e.g., a diameter) of about 1000 nm or less (e.g., about 990 nm or less, about 980 nm or less, about 970 nm or less, about 960 nm or less, about 950 nm or less, about 940 nm or less, about 930 nm or less, about 920 nm or less, about 910 nm or less, about 900 nm or less, about 890 nm or less, about 880 nm or less, about 870 nm or less, about 860 nm or less, about 850 nm or less, about 840 nm or less, about 830 nm or less, about 820 nm or less, about 810 nm or less, about 800 nm or less). The first end of each nanopore can have a characteristic length (e.g., a diameter) ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the first end of each nanopore can have a characteristic length (e.g., a diameter) of from about 800 nm to about 1000 nm (e.g., from about 810 nm to about 990 nm, from about 820 nm to about 980 nm, from about 830 nm to about 970 nm, from about 840 nm to about 960 nm, from about 850 nm to about 950 nm, from about 860 nm to about 940 nm, from about 870 nm to about 930 nm, from about 880 nm to about 920 nm, from about 890 nm to about 910 nm, from about 800 nm to about 900 nm, from about 810 nm to about 890 nm, from about 820 nm to about 880 nm, from about 830 nm to about 870 nm, from about 840 nm to about 860 nm, from about 900nm to about 1000 nm, from about 910 nm to about 990 nm, from about 920 nm to about 980 nm, from about 930 nm to about 970 nm, from about 940 nm to about 960 nm).

[0092] In some aspects, the second end of each nanopore can have a characteristic length (e.g., a diameter) of about 50 nm or more (e.g., about 51 nm or more, about 52 nm or more, about 53 nm or more, about 54 nm or more, about 55 nm or more, about 56 nm or more, about 57 nm or more, about 58 nm or more, about 59 nm or more, about 60 nm or more). In some aspects, the second end of each nanopore can have a characteristic length (e.g., a diameter) of about 60 nm or less (e.g., about 59 nm or less, about 8 nm or less, about 57 nm or less, about 56 nm or less, about 55 nm or less, about 54 nm or less, about 53 nm or less, about 52 nm or less, about 51 nm or less, about 50 nm or less). The second end of each nanopore can have a characteristic length (e.g., a diameter) ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the second end of each nanopore can have a characteristic length of from about 50 nm to about 60 nm (e.g., from about 51 nm to about 59 nm, from about 52 nm to about 58 nm, from about 53 nm to about 57 nm, from about 54 nm to about 56 nm, from about 50 nm to about 55 nm, from about 51 nm to about 54 nm, from about 52 nm to about 53 nm, from about 55 nm to about 60 nm, from about 56 nm to about 59 nm, from about 57 nm to about 58 nm).

[0093] In some aspects, the solid support can include polyethylene terephthalate.

[0094] In some aspects, the nanopore biosensor can include any of the solid state nanopores described in U. S. Patent Application Publication No. 2023 / 0184767, which is incorporated by reference herein in its entirety.METHODS

[0095] In an aspect, provided is a method of detecting PRRSV in a subject, the method including contacting a biological sample from the subject with: i) any of the aptamers described above which bind to PRRSV or a fragment thereof; ii) any of the disclosed assays including a plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; iii) any of the disclosed lateral flow assays including a plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; or iv) any of the disclosed nanopore biosensors including a plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71.

[0096] In some aspects, the method detects only infectious PRRSV. In some aspects, the method does not detect non-infectious PRRSV.

[0097] In some aspects, the method can detect PRRSV-1 and / or PRRSV-2.

[0098] In another aspect, provided is a method of detecting PEDV in a subject, the method including contacting a biological sample from the subject with: i) any of the aptamers described above which bind to PEDV or a fragment thereof; ii) any of the disclosed assays including a plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to any one of SEQ ID NOS: 84-89; iii) any of the disclosed lateral flow assays including a plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to any one of SEQ ID NOS: 84-89; or iv) any of the disclosed nanopore biosensors including a plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to any one of SEQ ID NOS: 84-89.

[0099] In some aspects, the method detects only infectious PEDV. In some aspects, the method does not detect non-infectious PEDV.

[0100] In yet another aspect, provided is a method of detecting PRRSV and / or PEDV in a subject, the method including contacting a biological sample from the subject with: i) any of the aptamers described above which bind to PRRSV or a fragment thereof and the any of the aptamers described above which bind to PEDV or a fragment thereof; ii) any of the disclosed assays including: a first plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; and a second plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to any one of SEQ ID NOS: 84-89; iii) any of the disclosed lateral flow assays including: a first plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; and a second plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to any one of SEQ ID NOS: 84-89; or iv) any of the disclosed nanopore biosensors including: a first plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; and a second plurality of aptamers having a nucleic acid sequence including about 80% similarity or more to any one of SEQ ID NOS: 84-89.

[0101] In some aspects, the method detects only infectious PRRSV and / or PEDV. In some aspects, the method does not detect non-infectious PRRSV and / or PEDV.

[0102] In some aspects, the method can detect PRRSV-1, PRRSV-2, and / or PEDV.

[0103] In some aspects, the method can include: a) providing the nanopore biosensor in a reservoir containing a solution; b) measuring a reference current- voltage curve between a first side of the nanopore biosensor and a second side of the nanopore biosensor; d) introducing the biological sample to the first side of the nanopore biosensor; and e) measuring a test currentvoltage curve between the first side of the nanopore biosensor and the second side of thenanopore biosensor, thereby determining the presence or absence of virus bound to the aptamers in the nanopore biosensor.

[0104] In some aspects, the first side of the nanopore biosensor includes the first side of the solid support and the second side of the nanopore biosensor includes the second side of the solid support.

[0105] In some aspects, the solution can include a chloride salt, for example KC1, NaCl, LiCl, CsCl, MgCh, CaCh, or any combination thereof. In some aspects, the solution can include about 0.1 M or more chloride salt (e.g., about 0.2 M or more, about 0.3 M or more, about 0.4 M or more, about 0.5 M or more, about 1 M or more, about 1.25 M or more, about 1.5 M or more, about 1.75 M or more, about 2 M or more, about 2.5 M or more, about 3 M or more). In some aspects, the solution can include about 3 M or less chloride salt (e.g., about 2.5 M or less, about 2 M or less, about 1.75 M or less, about 1.5 M or less, about 1.25 M or less, about 1 M or less, about 0.5 M or less, about 0.4 M or less, about 0.3 M or less, about 0.2 M or less, about 0.1 M or less).

[0106] The solution can include any amount of chloride salt ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the solution can include from about 0.1 M to about 3 M chloride salt (e.g., from about 0.2 M to about 2.5 M, from about 0.3 M to about 2 M, from about 0.4 M to about 1.75 M, from about 0.5 M to about 1.5 M, from about 1 M to about 1.25 M, from about 0.1 M to about 1.25 M, from about 0.2 M to about 1 M, from about 0.3 M to about 0.5 M, from about 1 M to about 3 M, from about 1.25 M to about 2.5 M, from about 1.5 M to about 2 M).

[0107] In some aspects, the method can include any of the methods of detection using the solid state nanopore described in U. S. Patent Application Publication No. 2023 / 0184767, which is incorporated by reference herein in its entirety.

[0108] In some aspects, the biological sample can be blood, serum, plasma, bronchoalveolar lavage, a nasopharyngeal swab, an oropharyngeal swab, saliva, sputum, urine, or tears.

[0109] In some aspects, the subject can be porcine.EXAMPLESExample 1: Aptamers for Direct Detection and Differentiation of Infectious Porcine Respiratory and Reproductive Syndrome Virus (PPRSV)[OHO] Tills invention involves the development of DNA aptamers capable of specifically detecting and distinguishing between infectious and noninfectious forms of porcine reproductive and respiratory syndrome virus (PRRSV). The primary purpose of this technologyis to enable rapid, on-site testing for viral infections in swine herds, addressing a critical gap in current diagnostic methods. Traditional laboratory-based diagnostic tools often fail to differentiate between infectious and noninfectious virus particles, leading to misdiagnoses, ineffective disease control measures, and significant economic losses. By contrast, the aptamers developed in tills study provide a highly specific and efficient means of detecting only infectious PRRSV, allowing for more accurate and timely decision-making in disease management.

[0111] These DNA aptamers were selected from a diverse DNA library through a process known as systematic evolution of ligands by exponential enrichment (SELEX), which ensures high affinity and selectivity for infectious PRRSV while avoiding noninfectious forms. The aptamers function as molecular recognition elements, binding to structural components unique to infectious virus particles. This detection mechanism can be integrated into various diagnostic platforms, such as lateral flow assays, biosensors, or fluorescence-based detection systems, enabling rapid and portable field testing. Unlike traditional laboratory diagnostics, which require time-consuming sample processing, this aptamer-based approach allows for near- instantaneous identification of infectious PRRSV directly in the field.

[0112] Tills invention introduces several unusual and innovative features that set it apart from existing PRRSV detection technologies. The most distinctive aspect is the use of DNA aptamers to specifically differentiate between infectious and noninfectious forms of PRRSV. Traditional diagnostic methods, such as polymerase chain reaction (PCR) and enzyme-linked immunosorbent assays (ELISA), detect viral genetic material or proteins but cannot distinguish between active, infectious viruses and noninfectious remnants. This limitation often leads to misdiagnoses, where animals that have cleared the infection but still carry viral fragments test positive, resulting in unnecessary interventions or failure to implement appropriate control measures.

[0113] Unlike these conventional methods, the aptamer-based detection system works by selectively binding to structural components unique to only infectious PRRSV, ensuring high specificity and reducing false positives. Another unusual feature is that this approach is field- deployable, unlike PCR, which requires laboratory processing, specialized equipment, and trained personnel. Current diagnostic tests can take hours to days to deliver results, whereas this aptamer-based system can provide real-time, on-site detection, making it highly practical for veterinarians and farmers.

[0114] Additionally, aptamers offer higher stability and reusability compared to antibodies used in ELISA tests. Antibodies are prone to degradation under harsh environmentalconditions, whereas aptamers are more robust and can withstand variations in temperature and storage conditions, making them better suited for on-farm diagnostics. Moreover, this technology can be integrated into multiple detection platforms, such as biosensors and lateral flow assays, providing flexibility in how it can be used in the field.

[0115] Overall, this invention represents a significant departure from existing diagnostic approaches by offering faster, more specific, and portable detection of infectious PRRSV, ultimately improving disease control and reducing economic losses in the swine industry.

[0116] This invention solves several critical problems associated with current PRRSV diagnostic methods, particularly in terms of accuracy, speed, and practicality. Existing tests, such as PCR and ELISA, cannot distinguish between infectious and noninfectious virus particles, often leading to false positives where animals that have cleared an infection are mistakenly identified as contagious. This misdiagnosis can result in unnecessary culling or ineffective disease management, causing significant economic losses. Additionally, current diagnostic methods require laboratory processing, leading to delays of hours or even days before results are available, allowing infections to spread unchecked. In contrast, this aptamerbased detection system enables rapid, on-site identification of only infectious PRRSV, allowing veterinarians and farmers to make immediate and informed decisions to control outbreaks. Unlike antibody- based ELISA tests, which degrade quickly and require specific storage conditions, DNA aptamers are more stable, cost-effective, and reusable, making them ideal for field use. Furthermore, this technology eliminates the need for complex laboratory¬ equipment or specialized training, making disease monitoring more accessible and efficient for swine producers. By improving diagnostic accuracy, reducing testing time, and offering a portable, user-friendly solution, this invention enhances disease control strategies, minimizes economic losses, and supports better overall herd health management.

[0117] The operational advantages of tills technology include rapid detection, high specificity, and ease of use in farm settings. By eliminating false positives caused by residual noninfectious viral particles, the aptamers improve diagnostic accuracy and reduce unnecessary interventions. The ability to conduct reliable on-site testing helps veterinarians and farmers respond quickly to outbreaks, implementing timely biosecurity measures to prevent the spread of disease. This ultimately leads to better disease control, reduced economic losses, and improved swine herd health management. In addition to its practical applications, this technology represents a significant advancement in veterinary diagnostics, offering a powerful tool for mitigating the impact of PRRSV on the swine industry.

[0118] Aptamer-based diagnostics may require integration with a suitable detection platform such as a biosensor, lateral flow assay, or fluorescence-based system. The effectiveness of the technology depends on the sensitivity and reliability of the chosen platform. Advances in nanotechnology and microfluidics can help improve signal amplification and detection limits, making the system more sensitive and field-friendly.

[0119] The ability to perform rapid and accurate on-site testing for viral infections is critical for managing and mitigating the spread of disease in swine populations. One of the most economically devastating swine diseases is Porcine Reproductive and Respiratory Syndrome (PRRS), which is caused by the PRRS virus (PRRSV). This virus leads to severe reproductive failure in sows and respiratory distress in piglets, resulting in significant economic losses for the global pork industry. Effective disease control relies on early detection and isolation of infected animals to prevent widespread outbreaks.

[0120] However, existing diagnostic methods for PRRSV present several limitations. Current techniques, such as polymerase chain reaction (PCR) and enzyme-linked immunosorbent assays (ELISA), can detect viral genetic material or antibodies, but they cannot differentiate between infectious and noninfectious virus particles. This inability leads to potential misdiagnoses, as animals that have cleared the infection or received vaccinations may still test positive despite not posing an active transmission risk. Furthermore, many of these laboratory-based methods require specialized equipment, trained personnel, and extended processing times, making them impractical for rapid field testing.

[0121] To address the limitations of current diagnostic methods, a study was conducted which developed a detection system using DNA aptamers specifically designed to identify and differentiate infectious PRRSV from its noninfectious counterparts. Aptamers are short, singlestranded DNA molecules that can bind with high specificity and affinity to target molecules, making them a powerful alternative to traditional antibody-based diagnostics. By leveraging a systematic evolution of ligands by exponential enrichment (SELEX) process, the study screened and selected aptamers from a diverse DNA library that exhibit strong and selective binding to infectious PRRSV while minimizing interaction with noninfectious viral particles.

[0122] The invention features a set of DNA aptamers that have been carefully selected to bind selectively to infectious PRRSV, distinguishing it from noninfectious viral particles. These aptamers were developed using a systematic evolution of ligands by exponential enrichment (SELEX) process, ensuring high specificity and affinity for their target. Unlike traditional antibody-based detection methods, aptamers offer increased stability, lower production costs, and the ability to function effectively in diverse environmental conditions.The aptamer-based detection system can be integrated into portable diagnostic platforms, allowing for rapid, on-site identification of infectious PRRSV without requiring complex laboratory equipment. Additionally, this system minimizes false positives by targeting structural or conformational markers unique to infectious virus particles rather than simply detecting viral genetic material or proteins. This high specificity and practical usability make the invention an essential tool for efficient disease management in swine populations.

[0123] The benefits of this invention are significant for both the efficiency and cost¬ effectiveness of PRRSV diagnostics. By using DNA aptamers that specifically bind to infectious PRRSV, the detection process becomes more accurate, eliminating false positives caused by noninfectious viral particles. This specificity leads to faster and more reliable results, enabling swine producers and veterinarians to make informed decisions about disease management in real time. The aptamer-based system operates significantly faster than traditional laboratory methods, reducing the time required for diagnosis and improving the speed at which infected animals can be identified and isolated. Additionally, this diagnostic tool is cost-effective, as aptamers are cheaper to produce than antibodies, and the system is field-deployable, eliminating the need for expensive equipment and specialized personnel. By providing a rapid, low-cost, and highly accurate diagnostic solution, this invention helps minimize the spread of PRRSV, reduce economic losses in the swine industry, and streamline disease control efforts.

[0124] The primary market for this invention includes the global swine farming industry, which is a significant part of the agricultural economy. According to the Food and Agriculture Organization (FAO), the global pork industry is valued at over $200 billion annually, with over 1 billion pigs raised worldwide. The United States alone has more than 60 million pigs in production, and PRRSV is one of the most prevalent and costly diseases affecting swine herds globally, with estimates suggesting that the disease causes losses of up to $1 billion annually in the U. S. alone. Therefore, swine producers, veterinarians, and disease management organizations would be key stakeholders in adopting this diagnostic tool.

[0125] Additionally, governments and regulatory bodies involved in animal health and biosecurity could be interested in this technology to improve surveillance and containment of infectious diseases within swine populations. The development of cost-effective, rapid, and field-deployable diagnostic tools also presents opportunities in emerging markets, where large- scale swine farming is growing rapidly, particularly in Asia and Latin America.

[0126] Veterinary diagnostic companies and biotech firms involved in developing point-of-care diagnostic solutions for animal health would also find this technology valuable. Thesecompanies can incorporate this invention into their product portfolios, improving their diagnostic offerings and expanding their reach in the animal health market.

[0127] Furthermore, researchers and academic institutions focused on viral epidemiology, swine health, and disease control would be interested in using this technology as a tool for more accurate and timely detection of PRRSV in their studies.Example 2: Development of DNA Aptamer Sensors for Direct Detection of Infectious Swine Viruses

[0128] Swine-based pathogens pose a severe and growing challenge to the global swine industry, resulting in estimated economic losses of billions of dollars annually.1These financial burdens arise from a combination of reduced herd productivity, increased mortality rates, decreased reproductive efficiency, and the substantial costs of disease management, including medical treatments, culling of infected animals and implementation of biosecurity measures. Additionally, disease outbreaks disrupt hade and supply chains, amplifying economic strain on farmers and stakeholders across the industry. Among the most critical threats are swine- specific viruses such as porcine reproductive and respiratory virus (PRRSV) and porcine epidemic diarrhea virus (PEDV), which are responsible for some of the most devastating outbreaks recorded in swine farming.

[0129] PRRSV was first isolated in the early 1990s in Europe and North America. PRRSV is a 15 kb enveloped, positive-sense single-stranded RNA virus belonging to the family Arteriviridae (FIGS. 1A-1B). It is highly mutable, with two major genotypes — European (PRRSV-1) and North American (PRRSV-2)--each exhibiting significant genetic variability, complicating vaccine development and disease control. The proteins of PRRSV-1 and PRRSV-2 strains share similarities but also exhibit key differences in structure and function, contributing to their pathogenicity. Both genotypes possess structural proteins, including glycoproteins (GP2, GP3, GP4, and GPS), the matrix protein (M), and the nucleocapsid protein (N). Among these, the surface glycoproteins, particularly GP2, GP3, GP4, and GP5, play crucial roles in viral entry and infection. GP5 is the most abundant surface glycoprotein and is implicated in receptor binding and immune evasion through its ability to inhibit host immune responses. GP2 and GP4 form a complex that interacts with cellular receptors including CD 163, facilitating viral attachment and entry into macrophages, the primary target cells of PRRSV. The significant genetic variability of these surface proteins between PRRSV-1 and PRRSV-2 contributes to differences in virulence, immune evasion, and the challenges of vaccine development, as these proteins are critical targets for both host immunity and therapeutic interventions. PRRSV is known for its dual impact: reproductive issues in breedingsows, including stillbirths, abortions, and mummified fetuses, and respiratory disease in piglets and growing pigs. The respiratory syndrome caused by PRRSV is often compounded by secondary bacterial infections, further exacerbating the disease burden and mortality rates. This virus targets macrophages, especially those in the lungs, impairing immune responses and enabling its persistence within infected herds, sometimes for years.

[0130] PEDV was first reported in the United Kingdom and Belgium in 1977 and 1978. PEDV is a member of the family Coronaviridae and is approximately 28 kb single-stranded RNA virus closely related to other coronaviruses that infect animals (FIGS. 2A-2B). PEDV possesses four structural proteins: spike (S), envelope (E), membrane (M), and nucleocapsid (N). Among these, the S protein, prominently displayed on the virus surface, plays a pivotal role in infection. The S protein facilitates viral attachment to host cells by binding to cellular receptors, primarily aminopeptidase N (APN), and mediates membrane fusion for viral entry. It is also the primary target of neutralizing antibodies, making it central to immune recognition and vaccine development. The envelope (E) and membrane (M) proteins contribute to viral assembly and budding, while the nucleocapsid (N) protein is involved in genome packaging and replication. The surface-exposed S protein’s high mutation rate enables PEDV to evade immune responses, complicating control efforts and emphasizing the importance of targeting this protein in diagnostic and therapeutic strategies. PEDV primarily affects the gastrointestinal tract, causing severe enteritis, dehydration, and diarrhea, particularly in neonatal piglets, where the underdeveloped immune system and inability to retain fluids lead to mortality rates nearing 100% in outbreak settings. In adult pigs, while clinical signs are less severe, PEDV infections still result in production losses, including weight loss and reduced feed efficiency. The virus spreads rapidly through direct contact with infected feces or contaminated materials, emphasizing the importance of rigorous hygiene and containment measures.

[0131] Together, PRRSV and PEDV exert a multifaceted toll on the swine industry. Their ability to spread rapidly within herds and across farms via aerosols, direct contact, and contaminated equipment or personnel amplifies the challenges of containment. Moreover, their economic impact extends beyond direct losses from mortality and reduced productivity, encompassing the costs of medical interventions, increased labor for disease management, trade restrictions, and long-term herd recovery efforts.

[0132] The persistent challenge in combating these pathogens lies in the absence of highly efficacious vaccines capable of providing broad and long-lasting protection. Despite ongoing research and development, existing vaccines often fail to prevent infections due to viral genetic diversity and the ability of these viruses to evade immune responses. This leaves the swineindustry heavily reliant on biosecurity measures, such as stringent hygiene protocols, quarantine strategies, and effective surveillance systems, to mitigate disease spread. However, these measures are resource-intensive, and their success depends on the early detection of infected animals to prevent further transmission.

[0133] Biosecurity measures, including effective surveillance and rapid detection, are vital to mitigate the devastating impact of swine-based pathogens on the global swine industry. These strategies serve as the first line of defense against outbreaks, helping to prevent the rapid transmission of viruses like PRRSV and PEDV within and between farms. Quick and accurate diagnosis is a cornerstone of biosecurity, enabling timely treatment of infected animals and the implementation of containment measures to protect healthy herds. Without reliable and efficient diagnostic tools, delays in detection can result in widespread infection, increased mortality, and significant economic losses.

[0134] Several diagnostic methods have been developed to detect swine viruses, with reverse transcription-quantitative polymerase chain reaction (RT-qPCR) being the gold standard. Tills technique offers high sensitivity and specificity by amplifying viral RNA, but it has critical limitations that hinder its practicality in field settings. RT-qPCR requires sample pretreatment to extract viral RNA, a process susceptible to incomplete extraction or degradation, leading to false-negative results. Furthermore, contamination during sample handling can cause false positives, undermining the reliability of the results. Additionally, RT-qPCR demands highly skilled personnel, expensive laboratory equipment, and a controlled environment, making it inaccessible and impractical for many farmers, especially in resource¬ limited regions.

[0135] Alternative molecular techniques such as loop-mediated isothermal amplification (LAMP) and next-generation sequencing (NGS) offer promising avenues for virus detection. However, these methods also require sample pretreatment and sophisticated infrastructure, limiting their utility for on-site diagnostics. Serological approaches, including enzyme-linked immunosorbent assay (ELISA) and viais neutralization assays, detect antibodies specific to swine viruses, but their utility is hampered by the delayed immune response; antibodies take days to weeks to develop after infection, delaying early intervention. These methods also fail to differentiate between active infections and past exposure, reducing their diagnostic value during acute outbreaks.

[0136] Traditional virological techniques, such as virus isolation, remain the definitive method for distinguishing infectious from noninfectious viruses. However, these approaches require growing the virus in host cells, a process that can take several days to weeks. Theprolonged timeframe for obtaining results delays the initiation of treatment and control measures, allowing the disease to spread further. Such delays exacerbate the economic and logistical challenges faced by the swine industry in managing viral outbreaks.

[0137] To overcome the limitations of current diagnostic methods, the Lu lab recently developed an innovative approach for the direct detection of intact viruses, eliminating the need for labor-intensive sample pretreatment. This method not only simplifies diagnostics but also provides the critical ability to differentiate between infectious and noninfectious viruses — essential for effective disease management. Previously demonstrated for detecting human adenovirus and SARS-CoV-2, this aptamer-nanopore sensor technology has the potential to revolutionize viral diagnostics by addressing key shortcomings of traditional techniques like RT-qPCR, which are prone to false positives and negatives due to RNA degradation or sample contamination. By directly targeting intact infectious viruses, the sensors enable rapid, on-site diagnostics crucial for containing outbreaks before they spread. Moreover, unlike antibodybased methods or time-intensive virological techniques, tliis platform delivers real-time insights into the infectious status of viruses, guiding targeted interventions such as quarantine, treatment, and vaccination strategies. These advancements promise to minimize economic losses and enhance biosecurity across a range of applications.

[0138] Tills study expands upon a detection method to tackle the critical challenges posed by PRRSV and PEDV, two of the most economically and biologically significant viruses in the swine industry. The study developed DNA aptamers that specifically bind to the intact, infectious forms of these viruses while showing negligible affinity for their noninfectious counterparts. The aptamers will be integrated into a solid-state nanopore platform, creating a robust sensor for real-time virus detection. This technology will be validated using diverse porcine samples, such as saliva and serum, to demonstrate its versatility and applicability in various diagnostic scenarios. By offering apractical, farmer-friendly solution that delivers high accuracy, rapid results, and ease of use, this aptamer-nanopore platform addresses critical gaps in current diagnostic tools. Tliis approach represents a transformative advancement in swine viral diagnostics, enabling early detection and informed decision-making to mitigate the devastating impacts of PRRSV and PEDV. Ultimately, it aims to safeguard animal health and promote economic sustainability in the swine sector.Materials and Methods

[0139] DNA Library: DNA sequences, including the random single-stranded DNA (ssDNA) libraries, primers, and oligonucleotides, were synthesized and desalted by Integrated DNA Technologies (IDT). The random ssDNA libraries, along with the forward and reverseprimers, were further purified by polyacrylamide gel electrophoresis to ensure high-quality preparation.

[0140] The ssDNA library featured a 45-nucleotide randomized central region flanked by constant sequences at the 3' and 5' ends, which served as primer-binding sites for amplification (TABLE 4). For the in vitro selection process, the reverse primer was modified with biotin to facilitate the separation of ssDNA from amplified double-stranded PCR products using streptavidin-coated magnetic beads. In contrast, unmodified forward and reverse primers were employed during PCR amplification for the final selection round, high-throughput sequencing (HTS) library preparation, and quantitative PCR (qPCR) quan ification.

[0141] To ensure proper folding, the ssDNA library and pools were denatured at 95°C for 15 minutes, followed by immediate cooling on ice for 15 minutes prior to use in each round of the selection process.TABLE 4. DNA sequences used in this work. Modification codes are from ID T.SEQName DNA Sequence (5' to 3')ID NO GTCCATCGTTCGGTAGTG-45N- DNA library PEDV 90GGCTAACTGTCCACGA1TForward primerGTCCATCGTTCGGTAGTG 91 (FwdP) PEDVReverse primerAATCGTGG AC AGTTAGCC 92 (RevP) PEDVReverse primer Biotin / 5BiosG / AATCGTGGACAGTTAGCC 93 (BRevP) PEDVT20 TTTTTTTTTTTTTTTTTTTT 94ACCGTCAGTTACAATGCT-45N- DNA library PRRSV 95GGCTGGACTATCTGTGTAForward primerACCGTCAGTTACAATGCT 96 (FwdP) PRRSVReverse primerTACACAGATAGTCCAGCC 97 (RevP) PRRSVReverse primer Biotin / 5BiosG / TACACAGATAGTCCAGCC 98 (BRevP) PRRSVAAGGAGCAGCGTGGAGGATA-N45- DNA library Beta 99TTAGGGTGTGTCGTCGTGGTForward primerAAGGAGCAGCGTGGAGGATA 2 (FwdP) BetaReverse primerACCACGACGACACACCCTAA 3 (RevP) BetaReverse primer Biotin / 5BiosG / ACCACGACGACACACCCTAA 100 (BRevP) Beta / 5BiosG / TGGATCGTGCACTrGTGATTGTTGACCG PEDV CR8X-1 101CGCITATl GACCGGTGA / 5BiosG / GGCAGAGAATGTAAACGGTGTACGACT PEDV CR8X-7 102CCTATGCCTTAATCTCCT / 5BiosG / CCACCACCCTTAGGAATCGCCTCGTAGG PEDV CR8X-11 103AGTGCGTACGGTACACC / 5BiosG / CCGTGCATTGTCACATTGAAGTTGCACG PEDV CR8X-13 104CACAGCATCCGATCCCA / 5BiosG / CTCGAAGGCCAGTGGTTCTGAATGCGA PEDV CR8X-18 105GAGTCTGCC AAGGGGGCC / 5BiosG / AGACAGTGTCGCGTCCTAGCCGCTTTTA PEDV CR8X-20 106CCAAAAGGGATCAGCGG / 5BiosG / CCCGACCAGCCACCATCAGCAACTCTTC SARS2-AR10 107C GC GTCC ATCCCTGCTG / 5BiosG / AAGGAGCAGCGTGGAGGATAACCACGC PRRSV Candidate 1AAGGTCAGATGCGGGATGCAGATTAGCTGGTG 108 BiotinCGTATGTTAGGGTGTGTCGTCGTGGT / 5BiosG / AAGGAGCAGCGTGGAGGATAAAACTGT PRRSV Candidate 2AAGTTTTACiATGCCGTCTCGTTTGTTCCCGTTGC 109 BiotinCGAATTAGGGTGTGTCG TCGTGG T / 5BiosG / AAGGAGCAGCGTGGAGGATACGATCAC PRRSV Candidate 3GATGCGACGGAGTAGTGTCCAAGGGTATCCGGT 110 BiotinAAAAGTTAGGGTGTGTCGTCGTGGT / 5BiosG / AAGGAGCAGCGTGGAGGATAC TGACAC PRRSV Candidate 4GGGGCGACGTCTTCTTAGGGAGAACGTAGTGTT 111 BiotinGGTTATTAGGGTGTGTCGTCGTGGT / 5BiosG / AAGGAGCAGCGTGGAGGATACCGACAC PRRSV Candidate 5GATGGGACGGGTATTAGGCATAGGGCGCGTCC 112 BiotinGCGGACTIAGGGTGTGTCGTCGTGGT PRRSV Candidate 5 / 5BiosG / CCGACACGATGGGACGGGTATTAGGCA 113 (45 region) Biotin TAGGGCGCGTCCGCGGACPRRSV Candidate 5 / 5BiosG / AAGGAGCAGCGTGGAGGATACCGACAC (FP and 45 region) GATGGGACGGGTATTAGGCATAGGGCGCGTCC 114 Biotin GCGGAC AAGGAGCAGCGTGGAGGATACCGACACGATGG PRRSV Candidate 5G AC GGGT A I T AGGC AT AGGGCGC GTCC GC GGA 77 (FP and 45 region)C / 5BiosG / AAGGAGCAGCGTGGAGGATACCGAGGC PRRSV Candidate 6GGGCTAGGCGGGCTGCGACGTGTAGGTACTTGT 115 BiotinTATTGTTAGGGTGTGTCGTCGTGGT PRRSV Candidate 6 / 5BiosG / CCGAGGCGGGCTAGGCGGGCTGCGACG (45 region and RP) TGT AGGT ACTTGTT ATTG' TTAGGGTGTGTC GTCG 116 Biotin TGGTPRRSV Candidate 7 / 5BiosG / AAGGAGCAGCGTGGAGGATACGACACG (FP and 45 region) AGGCGACGGGTATAAGTTTCATTAAAAAGTATA 117 Biotin TTCAAPRRSV Candidate 7 AAGGAGCAGCGTGGAGGATACGACACGAGGCG80 (FP and 45 region) ACGGGTATAAGTTTCATTAAAAAGTATATTCAA PRRSV Candidate 7 / 5BiosG / CGACACGAGGCGACGGGTATAAGTITC (45 region and RP) ATTAAAAAGTATATTCAATTAGGGTGTGTCGTC 118 Biotin GTGGTPRRSV Candidate 9 / 5BiosG / AAGGAGCAGCGTGGAGGA TAAAACTGT (FP and 45 region) AAGTTTTACATGCCGTCTCGTCTGTTCCCGTTGC 119 Biotin CGAAPRRSV Candidate 9 AAGGAGCAGCGTGGAGGATAAAACTGTAAGTT82 (FP and 45 region) TTACATGCCGTCTCGTCTGITCCCG1TGCCGAA PRRSV Candidate 9 Z5BiosG / AAACTGTAAGTTTTACATGCCGTCTCGT (45 region and RP) CTGTTCCCGTTGCCGAATTAGGGTGTGTCGTCG 120 Biotin TGGTPRRSV Scrambled AAGGAGCAGCG 1GGAGGATAACC ACGCAAGGT 121 NC CAGATGCGGGATGCAGATTAGCTGGTGCGTATG PRRSV NCI for AAGGAGCAGCG 1GGAGGAT ACCG AC ACGATGG Candidate 5 (FP and GACGGGTCGTGAATGATAGGCGCGTCCGCGGA 122 45 region) CPRRSV NC2 for AAGGAGCAGCGTGGAGGATACCGACACGATGG Candidate 5 (FP and G AC GGGTGG T ACT A AT AGGGCGC GTCC GC GGA 123 45 region) CPRRSV NC3 for AAGGAGCAGCGTGGAGGATACCGACACGGTAG Candidate 5 (FP and GACGGGTATTAGGCATAGGGCGCGTCCGCGGA 124 45 region) CPRRSV NC4 for AAGGAGCAGCGTGGAGGATACCGACACGATGG Candidate 5 (FP and GACGGGTATTAGGCATAGGGGGCGTCCGCGGA 125 45 region)PRRSV NC5 for AAGGAGCAGCGTGGAGGATACCTCCACGATGG Candidate 5 (FP and GACGGGTATTAGGCATAGGGCGCGTCCGCGGA 126 45 region) CPRRSV NC6 for AAGGAGCA TCGTGGAGGATACCGAC ACGATGG Candidate 5 (FP and GACGGGT ATT AGGC ATAGGGCGCGTCCGCGGA 127 45 region) CPRRSV NC7 for AAGGAGCAGCGTGATCAGGGACGACACGATGG Candidate 5 (FP and GACGGGT A I T AGGC ATAGGGCGCGTCCGCGGA 128 45 region) CPRRSV NC8 for CGAAGGAGACGTGGAGGATACCGACACGATGG Candidate 5 (FP and GACGGGT ATT AGGC ATAGGGCGCGTCCGCGGA 129 45 region) CPRRSV NC9 for AAGGAGCAGCGTGGAGGATACCACGACGATGG Candidate 5 (FP and GACGGGTATTAGGCATAGGGCGCGTCCGCGGA 130 45 region) CPRRSV NC10 for AAGGAGCAGCGTGGAGGATACCGAC ACGATGG Candidate 5 (FP and G AC G 1 'Fl AGG AGGC A'l A GGGCGC G 1 CC GC GGA 131 45 region) CPRRSV NC11 for AAGGAGCAGCGTGGAGGATACCGAC ACGATGG Candidate 5 (FP and GACGGGTAGTAGGCATAGGGCGCGTCCGCGGA 132 45 region) CPRRSV NCI 2 for AAGGAGCAGCGTGGAGGATACCGACACGGATG Candidate 5 (FP and G AC GGGT A I T AGGC AT AGGGCGC GTCC GC GGA 133 45 region)PRRSV NCI 3 for GGAAAGGCACG1 GGAGGAI’ACCGAC ACGATGG Candidate 5 (FP and GACGGGT ATT AGGC ATAGGGCGCGTCCGCGGA 134 45 region) CPRRSV NC14 forAAG GAGC AGCGTG GAGGAT ACCG AC ACG ATG ACandidate 5 (FP and 135AGTAGGTATTAGGCATAGGGCGTACTTGCGGAC45 region)PRRSV NCI 5 for AAGGAGCAGTACAGAGGATACCGATGTAATGG Candidate 5 (FP and GACGGGTATTAGGCATAGGGCGCGTCCGCGGA 136 45 region)PRRSV NCI 6 for AAGGAGCAGCGTGCAGGATACCGACACGATGG Candidate 5 (FP and GACGGGTATTAGGCATAGGGCGCGTCCGCGGA 137 45 region) C / 56- PRRSV Candidate 1 FAM / AAGGAGCAGCGTGGAGGATAACCACGCA 138 FAM AGGTCAGATGCGGGATGCAGATTAGCTGGTGC GTATG1TAGGGTGTGTCGTCGTGGT756- PRRSV Candidate 2 FAM / AAGGAGCAGCGTGGAGGATAAAAC TGTA 139 FAM AGTTTTACATGCCGTCTCGTTTGTTCCCGTTGCC GAAn’AGGGTGTGTCGTCGTGGT756- PRRSV Candidate 3 FAM / A AGG AGC AGC GTGG AGG AT AC G ATC AC G 140 FAM AT GCGACGGAGTAG TGTCCAAGGGT ATCCGGT A AAAGTTAGGGTGTGTCGTCGTGGT756- PRRSV Candidate 4 FAM / AAGGAGCAGCGTGGAGGATACTGACACG 141 FAM GGGCGACGTCTTCTTAGGGAGAACGTAGTGTTG GITATI’AGGGTGTGTCGTCGTGGT756- PRRSV Candidate 5 FAM / AAGGAGCAGCGTGGAGGATACCGACACG 142 FAM ATGGGACGGGTATTAGGCATAGGGCGCGTCCG CGGACT I AGGGTGTGTCGTCG TGGT / 56~PRRSV Candidate 5FAM / AAGGAGCAGCGTGGAGGATACCGAC ACG (FP and 45 region) 143ATGGGACGGGTATTAGGCATAGGGCGCGTCCG FAM CGGAC PRRSV Candidate 6 756- 144 FAM F AM / AAGG AGC AGC GTGG AGG AT ACC G AGGCGGGCTAGGCGGGCTGCGACGTGTAGGTACTTGTT ATTGTTAGGGTGTGTCGTCGTGGT / 56- PRRSV Candidate 7FAM / AAGGAGCAGCGTGGAGGATACGACACGA(FP and 45 region) 145 GGCGACGGGTATAAGTITCATTAAAAAGTATAT FAM TCAA / 56- PRRSV Candidate 9FAM / AAGGAGCAGCGTGGAGGATAAAACTGTA(FP and 45 region) 146 AGTTrrACATGCCGTCrCGTCTGTTCCCG'rTGCCFAM GAA

[0142] PRRSV and PEDV propagation: MARC-145 cells were cultured in Minimum Essential Medium (MEM; Gibco / Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 8% fetal bovine serum (FBS; Sigma, Burlington, MA, USA) and antibiotics (100 pg / mL streptomycin, 100 U / mL penicillin) at 37°C in a humidified atmosphere with 5% CO2.

[0143] For virus propagation, MARC- 145 cells were seeded at varying densities and inoculated with porcine reproductive and respiratory syndrome virus (PRRSV) or porcine epidemic diarrhea virus (PEDV) stocks at a multiplicity of infection (MOI) of 0.08. The inoculation was carried out for 2 hours, after which the cells were washed with serum -free Dulbecco’s Modified Eagle Medium (DMEM) to remove unbound virus. The cells were then maintained in DMEM containing 2% horse serum (Hyclone) to support virus replication.

[0144] At designated time points post-infection, the culture supernatants containing replicated virus particles were harvested for downstream analysis.

[0145] 50% Cell Culture Infectious Dose (TCID 50) Assay: MARC-145 cells were seeded into clear 96- well plates at a density of 104cells per well in 100 pl of Minimum Essential Medium (MEM) supplemented with 10%’ fetal bovine serum (FBS). Cells were seeded into all wells except column 10, which was left empty to spatially separate infected wells from uninfected wells. After a 12-hour incubation at 37°C with 5% CO2, serial 10-fold dilutions of virus (from 10-1to 10“9) were prepared, each containing 5% trypsin.

[0146] The cell supernatants were discarded, andlOO pl of each virus dilution was added to columns 1 through 9, corresponding to dilutions 10-1to IO-9, respectively. Pipette tips were changed between columns to avoid cross-contamination. Columns 11 and 12 were filled withmedium only and served as negative controls. The plates were then incubated at 37°C with 5% CO? for 6 days. On the 6th day, the supernatants were removed, and cells were fixed at room temperature for 15 minutes. Cytopathic effects (CPE) in the wells were assessed using immunofluorescence assay (IF’ A) methods, and the number of wells exhibiting CPE was recorded. A Reed and Muench calculation was then performed to determine the 50% tissue culture infective dose (TCID50), which was then presented as TCIDso / ml.

[0147] Inactivation of PRRSV by Low-Pressure UV Light: UV inactivation experiments were conducted using porcine reproductive and respiratory syndrome virus (PRRSV) at a concentration of 1 x 106TClDso / ml PRRSV. Virus samples were aliquoted into wells of a 6-well cell culture plate and exposed to UV light under specific conditions. Plates were placed without lids in a UV crosslinker and exposed to 1000 mJ of UV light.88Additionally samples were exposed to 1000 mJ of UV light combined with 15 minutes of irradiation at each of three wavelengths: 365 nm, 302 nm, and 254 nm, using a UV lamp. The remained infectivity of treated virus samples was assessed using the 50% Cell Culture Infectious Dose (TCID 50) Assay.

[0148] Inactivation of PRRSV and PEDV — BEI Treatment: PRRSV was inactivated using the binary ethyleneimine (BEI) method. Virus stock was prepared by harvesting the cell culture supernatant from virus-infected MARC- 145 cells. The harvested supernatant was concentrated using Macrosep Advance Centrifugal Devices (Pall, Westborough, MA, USA) and Minimum Essential Medium (MEM) to achieve a titer of 10sTCIDso / ml.

[0149] A 0.1 M BEI stock was prepared by dissolving 2 -bromoethylamine (Sigma, Burlington, MA, USA) in 0.175 M sodium hydroxide (NaOH; Thermo Fisher Scientific, Waltham, MA, USA) at 37°C for 1 hour. The stock solution was stored at 4°C until use. For virus inactivation, 10 mL of the virus suspension with 1 mM BEI at 37°C for 24 hours with gently stirring. Residual BEI was neutralized by incubation by adding 0.1 mM sodium thiosulphate (Sigma, Burlington, MA, USA) and incubating at 37 °C for 2 hours. To confirm complete inactivation, the treated virus was inoculated onto MARC- 145 cells, and the absence of infectivity was verified.

[0150] Removal of BEI from PRRSV and PEDV’s BEI Treatment Samples: To concentrate the inactivated virus, 300 pL of the virus stock was applied to an Amicon Ultra-0.5 100-kDa centrifugal filter. The filter was centrifuged at 14,000 x g for 10 minutes. The virus was then washed twice with 300 pL of SELEX buffer by centrifuging the filter after each wash. After washing, the Amicon filter was inverted into a clean collection tube and centrifuged for an additional 5 minutes to recover the concentrated virus.

[0151] Filtration of PRRSV and PEDV’s from Cellular Proteins and other Components: To concentrate the inactivated virus, 300 pL of the virus stock was applied to an Amicon Ultra-0.5 100-kDa centrifugal filter. The filter was centrifuged at 14,000 x g for 10 minutes. The virus was then washed twice with 300 pL of SELEX buffer by centrifuging the filter after each wash. After washing, the Amicon filter was inverted into a clean collection tube and centrifuged for an additional 5 minutes to recover the concentrated virus.

[0152] In vitro Selection of the Virus-specific Aptamers: A schematic diagram of the in vitro selection process is shown in FIG. 3.

[0153] First Round of In vitro Selection: The in vitro selection followed methods described in Peinetti, A. S. et al. (Direct Detection of Human Adenovirus or SARS-CoV-2 with Ability to Inform Infectivity Using DNA Aptamer-Nanopore Sensors. Sci. Adv. 202.1, 7 (39), eabh2848). The heat-denatured ssDNA library (1 nmol) was mixed with 50 pl of infectious PRRSV virus (1 x 106TCIDso / ml) in a total volume of 250 pl of SELEX buffer [lx PBS, with 2.5 mM MgCk and 0.5 mM CaCh (pH 7.4)] and incubated with gentle agitation for 2 hours at room temperature. Then, the unbound sequences were removed using an Amicon Ultra-0.5 100-kDa filter, followed by washing three times with 300 pl of SELEX buffer to ensure removal of all unbound sequences. To elute the bound sequences, the filter containing the virus and bound sequences was heated for 15 minutes at 95°C in the presence of 8 M urea and then centrifuged, collecting the fraction that flowed through the filter in a new tube. Then, to concentrate and desalt the DNA, an Amicon Ultra-0.5 10-kDa filter was used and washed two times with SELEX buffer (300 pi each time). 1 pi of the eluted single stranded DNA (ssDNA) was used to quantify the amount of DNA by qPCR, and the remaining pool was used as a template for amplification of bound sequences by PCR (30 cycles of 1 minutes at 95°C, 30 seconds at 52°C, 1 minutes at 72°C, followed by 10 minutes at 72°C) to obtain the dsDNA pool. The PCR was carried out in a total volume of 50 pl with the reverse primer labeled with a biotin, using a GoTaq Flexi DNA polymerase (Promega). Last, ssDNA was recovered by streptavidin-coated magnetic beads. 1 pl of the recovered ssDNA to quantify the amount of DNA by qPCR, and the remaining DNA was used for the following round.

[0154] Second to Last Round of In Vitro Selection: Enriched pools (200 pmol) were heat-denatured as described before and mixed with 50 pl of noninfectious PRRSV virus (1 x 105TCIDso / ml) in a total volume of 100 pl of SELEX buffer as the counterselection step. After incubation for 1 hour at room temperature, the unbound sequences were recovered using an Amicon Ultra-0.5 100-kDa cutoff and washed two times with 100 pl of SELEX buffer. The unbound sequences that flowed through the filter were collected and incubated with 50 pl ofinfectious virus (1 x 106TCIDso / ml) in a total volume of 350 pl as the positive selection step. From here, the protocol is the same as for round 1 for sequence elution, desalting, and PCR amplification. PCR amplification was optimized for each round.

[0155] All Amicon Ultra-0.5 filters were treated with 1 mM T20 for 30 minutes to avoid nonspecific adsorption of the library and pool sequences on the filter, followed by washing for three times with SELEX buffer. A new PCR using unlabeled primers was performed to prepare the pools for HTS.

[0156] The in vitro selection process to obtain an aptamer specific for infectious PEDV was performed using the same procedure as for PRRSV, with the following changes listed in the results and discussion section.

[0157] In vitro Selection Monitoring: qPCR was employed to monitor the SELEX process in two ways: (i) to assess the enrichment of the pools (elution yield) using absolute quantification and (ii) to evaluate the sequence diversity of the pools (convergence of aptamer species) by analyzing the melting curve. Real-time PCR was conducted using the CFX96 Real- Time PCR System (Bio-Rad) following the manufacturer’s instructions.

[0158] Each reaction was carried out in a 10 pL volume in 96-well PCR plates. The standard qPCR mixture included 5 pL of SsoFast EvaGreen Supemiix (Bio-Rad), 0.5 pL of each 10 pM unlabeled primer, and 4 pL of DNA template dilution. The thermal cycling conditions included an initial denaturation at 98°C for 2 minutes, followed by 40 cycles of denaturation at 98°C for 5 seconds and annealing / extension at 52°C for 10 seconds. After amplification, melting curve analysis was performed from 40°C to 90°C. Threshold cycle (Ct) values were determined using automated threshold analysis.

[0159] TOPO TA Cloning and Sanger Sequencing of PEDV CR8X rounds: The PEDV CR8X DNA was PCR-amplified from its single-stranded DNA (ssDNA) templates using Taq DNA polymerase (New England Biolabs, NEB). The amplified DNA was then inserted into the pCRII vector (Invitrogen) using TA cloning, following the procedures outlined in the Invitrogen TA Cloning Kit protocol.

[0160] Competent E. coli cells (NEB -alpha Subcloning Efficiency, NEB) were transformed with the ligated plasmids. A total of 24 individual colonies were selected and the corresponding plasmids were purified using the QIAprep Miniprep Kit (QIAGEN). The purified plasmids were sent for Sanger sequencing at Eton Bioscience to confirm the successful insertion of the PEDV CR8X DNA.

[0161] HTS of Selection Rounds: High-throughput sequencing (HTS) was performed on selected rounds from the PRRSV B selection and PEDV A selection. For PRRSV B selection,rounds 2.2 100K wash, 3.1 100K wash, 4.1 100K wash, 5.1 1OOK wash, 6.1 1OOK wash, 7.4 1OOK wash, 8.4 1OOK wash, 9.4 1OOK wash, 10.4 100K wash, and their corresponding amplification rounds (2.2a, 3.1a, 4.1a, 5.1a, 6.1a, 7.4a, 8.4a, 9.4a, and 10.4a) were selected, while for PEDV A selection, rounds 2.1 100K wash, 3.1 100K wash, 4.1 100K wash, 5.1 100K wash, 6.1 100K wash, 7. Id 100K wash, 8.12d 100K wash, 9. Id 100K wash, and their corresponding amplification rounds (2.1a, 3.1a, 4.1a, 5.1a, 6.1a, 7. Ida, 8.12da, and 9. Ida) were prepared for sequencing. HTS was conducted on an Illumina HiSeq 4000 platform, with library preparation using the Celero DNA-Seq Kit (Nugen / Tecan), which incorporates unique dual indexes for the simultaneous analysis of multiple rounds in a single lane.

[0162] The library preparation involved end-repairing fragmented DNA, followed by adaptor ligation and PCR amplification to generate the final libraries. After purification with Agencourt AMPure XP Beads (Beckman Coulter), DNA quantification was performed using a fluorescence-based method (Qubit dsDNA Broad Range kit). Equal amounts of libraries, containing unique indexes, were combined for sequencing. A quality control step, including qPCR quantification and fragment analysis of the DNA (conducted by the Genomic Sequencing and Analysis Facility at UT), was performed before 150-base pair single-end sequencing.

[0163] For the infectious PRRSV-specific aptamers against BEI-inactivated PRRSV (E), rounds R2, R3, R4, R5, R6, R7, R8, R9, R10, Rll, R12N, R13N, R14N, R15N, R13L, R14L, and R15E were selected for NGS. These samples were processed similarly to the previous rounds. Paired end 150 sequencing was performed with 100 million reads.

[0164] After sequencing, the data were demultiplexed, and the HTS results were analyzed using FASTAptamer software?7FASTAptamer-Count was employed to quantify the number of occurrences of each sequence within the population, ranking the sequences by abundance. FASTAptamer-Enrich was used to calculate fold enrichment for sequences present across multiple selection rounds by comparing the reads per million (RPM) of each sequence across rounds.

[0165] Binding Affinity Tests - Enzyme-Linked Oligonucleotide Assay: To evaluate the binding affinity of PEDV CR8X aptamers toward infectious PEDV and PRRSV aptamers toward infectious PRRSV, an Enzyme-Linked Oligonucleotide Assay (ELONA) was conducted.47,63For this, either infectious PEDV (1 x IO7TCIDso / ml), noninfectious PEDV (1 x 105TCIDso / ml), infectious PRRSV (1 x 106TCIDso / ml), noninfectious PRRSV (1 x 106TCIDso / ml), or SARS-CoV-2 spike protein SI (Invitrogen, aal 1-682) was coated onto individual wells of microplate. The virus or protein was incubated at room temperature for 2hours to ensure adequate binding to the well surface. Then, the plate was washed with phosphate-buffered saline (PBS) with 0.05% Tween-203 times.

[0166] Following virus or protein coating, the wells were blocked with 100 pl of 5% bovine serum albumin (BSA) in PBS for 1 hour at room temperature to prevent non-specific binding. After blocking, biotin-labeled aptamers were added to the wells at range of concentrations (0.1 to 1000 nM) in the SELEX binding buffer, and the plate was incubated for 1 hour at room temperature. Then, the plate was washed with phosphate-buffered saline (PBS) with 0.05% Tween-2.03 times.

[0167] To detect aptamer binding, horseradish peroxidase (HRP)-conjugated streptavidin (diluted 1:500) was added to the wells and incubated for 45 minutes. The plate was washed with phosphate-buffered saline (PBS) with 0.05% Tween-20 3 times. The color development step involved adding tetramethylbenzidine (TMB) chromogen substrate, which reacts with the HRP enzyme. The reaction was stopped by adding 2 M II2SO4, and the optical density (OD) at 450 nm was measured using a microplate reader. The resulting absorbance values were used to assess the binding affinity of the aptamers to their respective target viruses or proteins. This method provided a quantitative measure of the interaction between the aptamers and infectious or noninfectious forms of the virus, enabling comparison of the aptamer’s binding specificity and affinity.

[0168] Thermofluorimetric Analysis Assays: Thermal fluorescence assay (TFA) was employed to assess the binding affinity of PRRSV aptamer candidates (1-6) to infectious PRRSV. TFA measures fluorescence changes in a mixture of DNA and intercalating dye as a function of temperature. The intercalating dye, SYBR Gold, is only highly fluorescent when bound to double-stranded DNA (dsDNA). As the temperature increases and the DNA denatures (dsDNA separates into single strands), the fluorescence intensity decreases. This change in fluorescence can be used to monitor aptamer melting behavior and to measure the thermodynamic stability changes induced by target binding.

[0169] For the TFA experiment, 20 nM of each PRRSV aptamer candidate was first annealed by heating the solution to 95°C for 10 minutes, followed by a slow cooling step to room temperature to ensure proper formation of the aptamer structure. In each well of a 96-well plate, a mixture was prepared including 2 l of the annealed aptamer solution, 2 pl of SYBR Gold (1:100 dilution), and 15 ul of PRRSV solution at varying concentrations. The samples were then placed in a qPCR instrument and melting curve data were collected in triplicate. The temperature was ramped from 20°C and 9 °C at a rate of 0.5 °C per minute, with fluorescence data captured every 30 seconds on a CFX96 Real-Time PCR System (Bio-Rad).

[0170] To evaluate the background fluorescence signal, a control experiment was performed under the same conditions, but without the PRRSV aptamer, allowing for the determination of any fluorescence contribution from the PRRSV virus alone. Additionally, a negative control was conducted in which the PRRSV aptamer was replaced with a nonspecific DNA sequence of the same length but with a random nucleotide composition. This control helped confirm that the observed fluorescence changes were specifically due to the interaction between the PRRSV aptamer candidates and infectious PRRSV.

[0171] Finally, a selectivity test was carried out to further validate the specificity of the aptamers by repeating the assay with both infectious and noninfectious PRRSV samples. This test allowed for the determination of the aptamers' ability to selectively bind to infectious PRRSV and differentiate it from noninfectious PRRSV, ensuring that any observed changes in fluorescence were indeed due to specific interactions with the target vims.

[0172] SYBR Green Binding Assays: To assess the binding interactions between aptamers and viruses, a SYBR Green binding assay was performed. Various concentrations of active or inactive PRRSV 11 were incubated with 300 nM of each aptamer candidate (1 through 6), 80% polyethylene glycol 2000 (PEG 2000), and 0.5 nM single-stranded DNA binding protein (SSB) in lx SELEX buffer. The purpose of PEG 2000 was to promote aptamer-vims binding by increasing the viscosity of the solution, while SSB was included to prevent non¬ specific binding of single-stranded DNA in the mixture.

[0173] The aptamer-virus mixtures were incubated at room temperature for 1 hour to allow for sufficient interaction between the aptamers and the viruses. Following the incubation, 40 |iL of each sample were transferred into 100 L of lx SYBR Green solution. SYBR Green, a DNA intercalating dye, was used to detect the binding of aptamers to DNA or virus structures, as it fluoresces when bound to double-stranded or stable aptamer-vims complexes.

[0174] The resulting aptamer-vims-SYBR Green mixtures were incubated for an additional 30 minutes at room temperature to allow the dye to fully intercalate into the complex. Fluorescence spectra of each sample were measured using the ISS ChronosDFD fluorometer (ISS Inc., Champaign, IL, USA) with excitation at 497 nm and emission detected between 10 nm and 600 nm. The fluorescence intensity was directly related to the binding interaction between the aptamers and the vimses.

[0175] Gel Binding Assays: To assess the binding interactions between aptamer candidates and active or inactive PRRSV II, various concentrations of each vims were incubated with 10 nM of FAM-labeled aptamer candidates (1 through 6) at room temperature for 1 hour. Following the incubation, the samples were analyzed using either an agarose gelelectrophoresis or Native PAGE gel electrophoresis, depending on the nature of the binding interaction being investigated.

[0176] For the agarose gel electrophoresis method, the samples were prepared by adding purple loading dye and loaded onto a 1% agarose gel prepared in lx TAE buffer with Mg“+ions to stabilize the aptamer- virus interactions. The gel was run at a constant voltage of 120 V for 2 hours to allow for separation based on the molecular size and binding affinity of the complexes. After electrophoresis, the gel was first imaged using the Bio-Rad Gel Doc system without staining to visualize the F AM-labeled aptamers. The gel was then stained with SYBR Gold, a DNA intercalating dye, and imaged again to confirm the presence of aptamer-virus complexes.

[0177] In addition, Native PAGE gel electrophoresis was used for a more detailed examination of aptamer-virus binding. In this method, the samples were prepared similarly by adding purple loading dye and then loaded onto a 12% native polyacrylamide gel in lx TAE buffer with Mg2+. This gel was run under native conditions (non-denaturing) at 120 V for 2 hours, allowing the aptamer- virus complexes to maintain their native structure. The gel was first imaged using the Bio-Rad Gel Doc system without staining to capture the mobility of the F AM-labeled complexes. Subsequently, the gel was stained with SYBR Gold to detect DNA complexes, and a final image was obtained after Coomassie Blue staining, which provided a visual confirmation of the protein content and integrity of the gel.

[0178] This gel electrophoresis approach allowed for the assessment of the binding efficiency and complex formation between F AM-labeled aptamers and the PRRSV II virus under both denaturing and non-denaturing conditions. The presence of distinct bands in the SYBR Gold-stained gel indicated successful binding between the aptamers and the viral targets, while the Coomassie Blue-stained gel provided confirmation of the gel’s protein content and overall integrity.

[0179] Fluorescence Polarization Binding Assays: Fluorescence polarization was employed to assess the binding affinity of PRRSV aptamer candidates selected from the PRRSV II E selection to active PRRSV. The assays were conducted at a concentration of 250 nM FAM-labeled aptamer. For the initial binding interaction assessments, 263.16 nM of each PRRSV aptamer candidate in the SEEEX buffer was prepared by annealing the aptamer solution. The annealing process involved heating the aptamer solution to 95°C for 10 minutes, followed by a slow cooling step at room temperature to facilitate proper folding of the aptamer structure.

[0180] For the FP assay, 190 pL of the 263.16 nM annealed aptamer candidate solution was mixed with 10 pL of various concentrations of PRRSV. The vims concentrations were prepared to cover a range of potential binding interactions. The aptamer-virus mixture was incubated at room temperature for 1 hour to allow sufficient rime for the aptamer and vims to interact.

[0181] After incubation, fluorescence polarization measurements were performed using the ISS ChronosDFD fluorometer ( ISS Inc., Champaign, IL, USA) with excitation at 550 nm and emission at 570 nm. For each sample, 10 individual fluorescence polarization measurements were recorded to ensure data reliability. Three biological replicates were conducted for each aptamer-vims interaction to ensure reproducibility and statistical significance.

[0182] Exonuclease Digestion Assays: Exonuclease digestion assay protocol was modified from this paper to suit the experimental conditions for viruses.74For all digestion assays, 1 pl of 50 pM annealed aptamer was mixed with 44 pl of reaction buffer containing the appropriate concentration of 2 x 105TCIDso / ml for each virus in the SELEX buffer. After incubation for one hour at room temperature, 5 pl of 2 U / pl T5 Exonuclease (T5 Exo) was added to the solution. At various time points, 5 pl aliquots of the reaction mixture were collected and immediately mixed with 5 pl of 2x clear loading buffer (9.2 M Urea, 0.001 M H2EDTA, 180 mM Tris, 180 mM boric acid) to quench the reaction. The solutions were frozen at -20°C until preheated to -90°C before loading into the PAGE gel.

[0183] The digestion products were analyzed using 15% denaturing polyacrylamide gel electrophoresis. Separation was performed at 36 for 1.5 hours in lx TBE buffer. Following electrophoresis, the gel was stained with lx SYBR Gold for 10 minutes and imaged.Results and Discussion

[0184] Design of the SELEX Process: There is a need to develop biosensors that can differentiate infectious porcine viruses from noninfectious viruses in a specific and simple manner. To address this need, the study developed DNA aptamers as the recognition element to selectively bind to only intact infectious porcine vims. DNA aptamers are single stranded DNA molecules that recognize a target with high affinity and specificity. They often rival antibodies biorecognition ability; however, aptamers are more stable, cost effective, and reliable to produce and transform into sensors. Aptamers are obtained through a test tube combinatorial selection technique called systematic evolution of ligands by exponential enrichment (SELEX) or in vitro selection. This process uses a DNA library of 1015random sequences and produces enriched sequences with high affinity towards its analyte. Thoughmany rounds of SELEX and PCR amplification, gradual enrichment of the DNA pool occurs. Counterselection measures can be incorporated into the SELEX process to help remove sequences that can bind to biochemically similar molecules. There have been aptamers selected for PRRSV virus and the N-protein in PEDV. These aptamers were not selected based on infectivity of the whole virus and do not have low limits of detection. Therefore, these aptamers have limited application towards stopping the spread of these diseases. Here, the study used whole virus SELEX with positive selection measures of either live infectious PRRSV or PEDV virus and counter selection measure of BEI inactivated PRRSV or PEDV virus (FIG. 3).

[0185] PRRSV A Selection: The first attempt at PRRSV II selection is referred to as PRRSV A Selection. Selection was performed with PRRSV 45 DNA pool on PRRSV II virus (1 x 106TCIDso / ml) and in the second round UV inactivated PRRSV II virus (1 x 10° TCIDso / ml) was incorporated into the SELEX process (FIG. 4A). Various branches of selection with different concentrations of virus and incubation time with DNA pool and virus were tested; however, only the main branch with promising results were shown in tliis report. To monitor the selection progress, qPCR was used to measure both the elution yield, defined as the amount of single-stranded DNA (ssDNA) bound to infectious PRRSV divided by the total amount of added ssDNA into each round of selection (FIG. 4B), and the sliift in melting curves after qPCR to assess sequence diversity of the DNA pools (FIG. 4C). The elution yields increased until round 5. There was no observed shift in the melting curves. TCIDso infectivity assays were performed on the UV inactivated PRRSV and demonstrated that the virus was not completely inactive (data not shown). BEI inactivation methods were performed on the PRRSV and PEDV viruses. As demonstrated in FIGS. 5A-5B, the TCID50 infectivity assays demonstrated a lack of green signal in the MARC-145 cells incubated with the BEI inactivated viruses, confirming the lack of virus infectivity for these PRRSV and PEDV samples. Therefore, the BEI inactivated virus stocks were filtered and used in future selection attempts.

[0186] PRRSV B Selection: The second attempt at PRRSV II selection is referred to as PRRSV II B Selection. Various branches of selection with different concentrations of virus and incubation time with DNA pool and virus were tested; however, only the main branch with promising results were shown in this report. Selection was performed with PRRSV 45 DNA pool on PRRSV II virus (1 x 106TCIDso / ml) and in the third round BEI inactivated PRRSV II virus (1 x 105TCIDso / ml) was incorporated into the SELEX process (FIG. 6A). In round the amount of counter selection increased from 50 pL 1 x 10' to 50 pL 2 x 105for the BEI inactivated PRRSV II. The 2ndround of selection demonstrated interesting results including the elution yield being -36% (FIG. 6B). This yield seemed quite high, so qPCR results wererepeated, and similar results occurred. There was an increase in elution yield at round 6 and a drop of the plateau at round 9. The melting peak at ~60°C increased and the peak at ~79°C decreased as the rounds of selection increased. The shift should occur in the other direction. The peak at ~70°C in rounds 9 and 10 are due to side product formation. The side product formation was noticeable in the cycle titration gels for these rounds of selection (FIG. 6C).

[0187] PEDV A Selection: The first attempt at PEDV selection is referred to as PEDV A Selection. Various branches of selection with different concentrations of virus and incubation time with DNA pool and virus were tested; however, only the main branch with promising results were shown in this report. Selection was performed with PEDV 45 DNA pool on PED V virus (1 x 105TCIDso / ml) and in the second round BEI inactivated PEDV virus (1 x 104TClDso / ml) was incorporated into the SELEX process (FIG. 7A). The 4thround of selection demonstrated interesting results including an increase of elution yield to around 30% (FIG. 7B). The elution plateaued until round 8 where the elution yield decreased to around 12%. The melting peak at ~60°C had no shift and the peak at ~79°C had no shift as the rounds of selection increased (FIG. 7C).

[0188] NGS Analysis of PRRSV B and PEDV A Selections: PRRSV B selection attempt and PEDV A selection attempt were chosen for next generation sequencing (NGS) due to the increase in elution yields throughout the progression of SELEX rounds. The analysis of the NGS sequencing results demonstrated that the library was highly diverse and did not show' any enrichment for the PRRSV B selection (TABLE 5). The top 10 sequences in each round are listed from round 2 (R2) to round 10 (R10). The most enriched sequences in the library only reached around 0.8 count per million sequences. The analysis of the NGS sequencing results demonstrated that the library was highly diverse and did not show any enrichment for the PEDV A selection (TABLE 6). The top 10 sequences in each round are listed from round 2 (R2) to round 9 (R9). The most enriched sequences in the library only reached around 0.8 count per million sequences. From the experience of other lab members, this is the first time with such a diverse pool of DNA after selection. Therefore, there was no identified shared abundant sequences between libraries using the analyzing pipeline described in the materials and methods section. There were attempts at searching for the enriched sequences from the last round of selection and attempts to trace back to see if there is any sequence that can be manually picked out. However, none of the top 10 sequences from the last round of selection can be found in other libraries under the same selection. Therefore, another attempt at PEDV selection was conducted at a higher concentration of active PEDV to see if the melting curve could shift towards higher temperatures which would demonstrate less diversity of the DNA pool.TABLE 5. NGS analysis of PRRSV B selection. The top 10 sequences in each round are listed from round 2 (R2) to round 10 (RIO).TABLE 6. NGS analysis of PEDV A selection. The top 10 sequences in each round are listed from round 2 (R2) to round 9 (R9).R2

[0189] PEDV B Selection: The second attempt at PEDV selection will be referred to as PEDV B Selection. Various branches of selection with different concentrations of virus andincubation time with DNA pool and virus were tested; however, only the main branch with promising results were shown in this report. Selection was performed with PEDV 45 DNA pool on PEDV virus (1 x 107TCIDso / ml) and in the third round BEI inactivated PEDV virus (1 x IO3TCIDso / ml) and BEI inactivated PRRSV virus (l x 105TCIDso / ml) was incorporated into the SELEX process (FIG. 8A). At round 6 and 7, there was an increase in elution yield to - 10% and 16%, respectively (FIG. 8B). The melting peak at ~60°C had no shift and the peak at ~79°C had no shift as the rounds of selection increased (FIG. 8C). Therefore, the study- stopped this selection to analyze the NGS that was mentioned in the prior section and dig into literature to see if there was a way to resolve the lack of a shift in melting temperature of the DNA pools as the rounds of selection increased.

[0190] To resolve this issue, a literature search was conducted and concluded that selection of whole viruses is often tricky. The other components (e.g., proteins and lipids) from cell culture which is how viruses are propagated may be also in the spiked analyte solution. Thus, the purity of the sample is not only virus. Therefore, I filtered the active PRRSV and active PEDV viruses following the BEI virus filtration process to see if this would help with improving the shift in melting temperature.

[0191] PRRSV C Selection: The third attempt at PRRSV selection will be referred to as PRRSV C Selection. Various branches of selection with different concentrations of virus and incubation time with DNA pool and virus were tested; however, only the main branch with promising results were shown in this report. Selection was performed with PRRSV 45 DNA pool on PRRSV virus (1 x 107TCIDso / ml) and in the fifth round BEI inactivated PRRSV virus (1 x 10?TCIDso / ml) and BEI inactivated PRRSV virus (1 x 10' TCIDso / ml) was incorporated into the SELEX process (FIG.9A). At round 5, there was a significant decrease in elution yield from -30% to 0.01%’ (FIG. 9B). The decrease in elution yield is due to the incorporation of negative selection of inactivated PRRSV and PEDV viruses. The melting peak at ~60°C shifted toward ~75°C during rounds 8 and 9 and the peak at ~79°C shifted towards ~80°C (FIG. 9C).The filtered viruses were sent to the collaborator to verify infectivity after filtration treatment. However, the results indicated that the infectious virus was no longer infectious after the filtration. Therefore, the collaborator decided to filter the virus themselves and ship it to us to use in future selections.

[0192] PEDV C Selection: The study continued onto the filtered PEDV virus SELEX since it was not known at the time that the filtered PEDV active virus was not infectious. Various branches of selection with different concentrations of virus and incubation time with DNA pool and virus were tested; however, only the main branch with promising results wereshown in this report. The third attempt at PEDV selection will be referred to as PEDV C Selection. Selection was performed with PEDV 45 DNA pool on PEDV virus (1 x 107TCIDso / ml) and in the fourth round BEI inactivated PEDV virus (1 x 106TCIDso / ml) and active PRRSV virus (1 x 106TCIDso / ml) was incorporated into the SELEX process (FIG. 10A). At round 4, there was a significant decrease in elution yield from -18% to 1% (FIG. 10B). The decrease in elution yield is due to the incorporation of negative selection of inactivated PRRSV and PEDV viruses. There was an increase in elution yield at rounds 8 and 9 to -12% and -13%, respectively. The elution yield dropped to -3% in round 10. The melting peak at ~60°C did not shift and the peak at ~79°C did not shift (FIG. 10C). The filtered viruses were sent to the collaborator to verify infectivity after filtration treatment. However, the results indicated that the infectious virus was no longer infectious after the filtration. Therefore, the collaborator decided to filter the virus themselves and ship it to us to use in future selections.

[0193] Sanger Sequencing Results of PEDV C Selection: Due to other aptamers for whole virus selections having performed Sanger Sequencing on different rounds and testing various candidates, the study decided to perform TOPO TA cloning and Sanger Sequencing on round R8X pools due to the dramatic increase in elution yield at round 8 that remained there in round 9. 23 of 24 plasmid samples contained an DNA insert from the R8X pool. Six of these sequences were chosen as candidates for ELONA binding assay testing. These sequences had the primer regions removed and a biotin modification added to the 5’ end of the single stranded DNA. ELONAs were performed with these aptamer candidates and infectious filtered PEDV. Positive controls were done with the SARS2-AR10 aptamer and SARS-CoV-2 spike protein. There was no specific binding interactions detected between the aptamer candidates and the virus (data not shown). Therefore, selection needed to be redone. Also, the virus was dead so the newly filtered virus from the collaborator was needed to move forward.

[0194] PEDV D Selection: The fourth attempt at PEDV selection is referred to as PEDV D Selection. This selection used collaborator filtered PEDV virus. Selection was performed with PEDV 45 DNA pool on collaborator filtered PEDV virus (1 x IO6TCIDso / ml) and in the third round BEI inactivated PEDV virus (1 x 105TCIDso / ml) was incorporated into the SELEX process (FIG. 11A). There was a slight decrease in elution yield from -10% to 07% when incorporating negative selection in round 3, but the DNA elution yield % starting to quickly increase overtime (FIG. 11B). There is no shift in melting temperature (FIGS. 11C-11D). This selection was paused due to no significant shift in melting temperature and too high elution yields.

[0195] PRRSV II I) Selection: The fourth attempt at PRRSV selection is referred to as PRRSV II D Selection. 'This selection used collaborator filtered PRRSV virus. Selection was performed with PRRSV 45 DNA pool on collaborator filtered PRRSV II virus (1 x 106TCIDso / ml) and in the third round BEI inactivated PRRSV II virus (l x 105TCIDso / ml) was incorporated into the SELEX process (FIG. 12A). There was a slight decrease in elution yield from -0.3% to 0.25% when incorporating negative selection in round 3 (FIG. 12B). There is shift in melting temperature starting at round 7; however, there are side products forming in the PCR reactions which are causing this new peak to show up around 72°C (FIGS. 12C-12D). Due to the massive side product formation that was noticed through PAGE gel electrophoresis, this selection was paused. This attempt was performed simultaneously as PRRSV E Selection.

[0196] PRRSV II E Selection: 'The fifth attempt at PRRSV II selection is referred to as PRRSV II E Selection. This selection used collaborator filtered PRRSV II virus. Selection was performed with Beta 45 DNA pool on collaborator filtered PRRSV II virus (l x 106TCIDso / ml) and in the third round BEI inactivated PRRSV II virus (l x 105TCID.so / nil) was incorporated into the SELEX process (FIG. 13A). There was a slight decrease in elution yield from -0.25% to -0.1% when incorporating negative selection in round 3 (FIG. 13B). However, there is an increase in elution yield until round 10 (yellow) where there is a plateau in elution yield. Tills sign is indicative of an enrichment of DNA sequences. There is shift in melting temperature from 68°C to 82°C for the initial input DNA for each round which is indicative by the change of intensities of each peak at each round (FIG. 13C). There is shift in melting temperature from 68°C to 72°C to 72°C for the DNA that binds to the virus for each round (FIG. 13D). This selection also had several branches with different conditions tested to optimize the DNA library’s ability to bind to the vims. FIGS. 14A-14B show that the active virus concentration decreased to (1 x 105TCIDso / ml) in round 12 and the DNA continue to bind to the virus. Also, the melting curves (FIGS. 14C-14D) demonstrate similar curves. These results are promising, because they show for the first time shifting of the melting temperatures and thus convergence of DNA sequences to more structured DNA aptamers. The DNA pools were collected and carried out NGS analysis.

[0197] NGS Analysis of PRRSV II E Selection for Total Number of Sequences Sequenced: The NGS data was analyzed using the FASTAptamer bioinformatics tool, which is specifically designed for analyzing large datasets of sequences, such as those generated during aptamer selection experiments. FASTAptamer works by identifying and quantifying unique sequences, while allowing tracking of changes in sequence prevalence across differentrounds of selection. This bioinformatics tool filters out sequences that do not contain key features, such as primer regions or random binding regions, ensuring only relevant sequences are analyzed for enrichment and diversity patterns. In this study, sequences lacking the forward primer, reverse primer, and the random 45 -nucleotide region were removed, leaving only those suitable for analysis.

[0198] TABLE 7 shows the total number of sequences retained after each selection round of PRRSV E selection, analyzed using the FASTAptamer bioinformatics tool. Across all rounds, a total of 12,826 unique sequences met the primer recognition criteria. Early rounds, such as round 2, retained fewer sequences (1,359), while later rounds, from round 9 through 15, had approximately 2,500 sequences each. By round 8, the number of sequences leveled off, indicating that the selection process had stabilized.

[0199] Diversity trends showed that earlier rounds had more new and unique sequences. For instance, round 5 introduced 1,543 new sequences, reflecting high variation at that stage of PRRSV E selection. In contrast, by round 9, only 90 new sequences were identified, suggesting a significant drop in diversity.

[0200] Similarly, FIGS. 15A-15D compare the percentage of recurring sequences and new unique sequences per round in both the low (L) and normal (N) selection branches of PRRSV E selection compared to all NGS sequences sequenced. The graphs demonstrate a plateau around round 9, where the introduction of new' sequences slowed significantly. This indicates that branching the selection process at earlier rounds might have been more effective. The decrease in new sequences suggests that the selection reached a point of convergence, where the sequence pool became highly enriched with high-affinity binders. The results from T BLE 7 and FIGS. 15A-15D collectively indicate that while sequence retention increased and stabilized by round 8, diversity decreased significantly in later rounds. This convergence in both the total number of sequences and the introduction of new unique sequences, particularly in both low' (I.,) and normal (N) branches of PRRSV E selection, suggests that selection pressure 'as effective, but earlier brandling may have allowed for greater diversity and higher-affinity binders to emerge earlier in the process.TABLE 7. Total number of sequences retained after each selection round and the number of new unique sequences added in each round of PRRSV E selection, based on analysis of NGS results using FAST Aptamer.Round Number Total Sequences Per Round New Unique Sequences 2 1359 13223 1688 16544 1837 18025 1584 15436 1328 12167 2064 4948 2407 3099 2473 9010 2477 3711 2486 1112N 2498 3213L 2493 2413N 2494 114L 2484 1415L 2496 12914N 2489 6415N 2477 232

[0201] NGS Analysis of PRRSV II E Selection based on Reads Per Million for Each Sequence: Understanding how the findings relate to the NGS process is crucial for interpreting the results. NGS involves several key steps: first, DNA is fragmented, and adapter sequences are attached to each piece. These fragments are then amplified to create a sequencing library, which is loaded onto a sequencing platform. Each DNA fragment is read base by base, producing millions of short sequences known as "reads." These reads are subsequently aligned to a reference genome or assembled into a sequence map for further analysis. To ensure meaningful comparisons across samples, data is normalized using a metric called reads per million (RPM). RPM standardizes the number of reads mapped to specific features, such as genes or sequences, in relation to the total number of reads in a sample. This normalization isessential, as it accounts for variations in the total number of reads generated in different samples, allowing for accurate assessments of sequence abundance and diversity.

[0202] To gain insights into the dynamics of sequence diversity throughout the selection process, it was important to analyze the relationship between unique sequences and overall sequence abundance. Therefore, the RPM for unique sequences was compared to the total RPM for each round in both the low (L) and normal (N) selection branches of PRRSV E selection, as illustrated in FIGS. 16A-16B. The analysis revealed that most of the RPM in the early rounds of selection (specifically rounds 3, 5, and 6) was associated with the introduction of unique sequences. In contrast, later rounds primarily exhibited RPM linked to sequences that had already been identified in prior rounds. Interestingly, the N selection branch showed an increase in RPM for unique sequences during the later rounds (14N and 15N). This uptick suggests the possibility of contamination or the emergence of new diversity within this selection process. Conversely, this trend was not observed in the later rounds of the L selection branch. These findings highlight the dynamic nature of sequence diversity in the NGS process and suggest that the selection strategy may influence the introduction and retention of unique sequences over time. This insight is valuable for optimizing future selection strategies to enhance the identification of high-affinity binders.

[0203] NGS Analysis of PRRSV II E Selection based on Fold -Enrichment and Percent Abundance for Sequences: The FAST Aptamer toolkit is essential for calculating both foldenrichment and percent abundance of sequences throughout the selection process. Foldenrichment quantifies how much more abundant a specific sequence or group of sequences is in a sample compared to a control sample. This is calculated by dividing the count of the target sequence in the selected sample by its count in the control sample. A fold-enrichment value greater than 1 indicates that the sequence is enriched in the selected sample, while a value less than 1 suggests it is less abundant. In the context of aptamer selections and similar assays, fold¬ enrichment is critical for evaluating the success of the selection process. High fold-enrichment values indicate that specific sequences have been effectively enriched for their affinity to the target of interest. In contrast, percent abundance measures the proportion of specific sequences relative to the total number of sequences observed in each sequencing round. This is calculated by dividing the number of reads for a specific sequence by the total reads in that round and multiplying by 100. Percent abundance is particularly useful for tracking how the representation of sequences changes over multiple selection rounds.

[0204] Comparing fold-enrichment and percent abundance provides complementary insights into the sample dynamics. While fold-enrichment highlights which sequences arefavored during selection, percent abundance reveals whether those sequences remain dominant within the overall pool. Thus, this bioinformatics approach was applied to the NGS sequencing results for selection analysis, with each unique sequence assigned an identifier starting with " A." FIGS. 13A-13D illustrate the comparison of enrichment fold versus percent abundance across PRRSV E selection rounds, along with the identifiers of sequences showing the highest abundance and enrichment values. Notably, early rounds (2 through 4) showed fewer sequences with high percent abundance or enrichment. In round 7, sequences A 1667 and A807 exhibited fold-enrichment values exceeding 100 and more than 2% abundance, highlighting their significance in that pool. In round 10, sequences A 1245 and Al 122 showed foldenrichment values greater than 18 and over 1.9% abundance, indicating continued selection success. Similarly, in round 13N compared to round 11, sequences A1245, A1779, and A1122 had fold-enrichment values greater than 4 and more than 3% abundance, signifying their enrichment in this later round. Moreover, in the comparison between round 15L and round 13L, sequence A 34 displayed the highest fold-enrichment and percent abundance in the round 15L pool, while sequence A1726 held this distinction in the round 15N pool. Interestingly, the comparison between rounds 6 and 7 yielded the most significant enrichment, with some sequences, such as A5355, A53, and A1024, displaying fold-enrichment values greater than 40. TABLE 8 shows the 69 sequences correlated to these identifiers. The N45 region without the primer regions were shown.

[0205] These findings indicate that certain sequences not only enriched significantly during specific rounds but also maintained considerable representation within the overall sequence pool, highlighting their potential as high-affinity binders. The consistent observation of high fold-enrichment and percent abundance values in later rounds emphasizes the effectiveness of the selection process and suggests that these sequences are particularly promising candidates for further study and application.TABLE 8. Sequences with highest enrichment fold and or percent abundance per round of selection of PRRSV E selection. The N45 region without the primer regions were shown. Identifier Name N45 Region Sequence Identifier Name N45 Region Sequence A53 SEQ ID NO: 4 A5884 SEQ ID NO: 38 A 163 SEQ ID NO: 5 A5963 SEQ ID NO: 39 A 194 SEQ ID NO: 6 A6262 SEQ ID NO: 40 A534 SEQ ID NO: 7 A6590 SEQ ID NO: 41A565 SEQ ID NO: 8 A9627 SEQ ID NO: 42 A574 SEQ ID NO: 9 A9995 SEQ ID NO: 43 A615 SEQ ID NO: 10 A 10047 SEQ ID NO: 44 A691 SEQ ID NO: 11 A10167 SEQ ID NO: 45 A710 SEQ ID NO: 12 A10171 SEQ ID NO: 46 A728 SEQ ID NO: 13 A10214 SEQ ID NO: 47 A 806 SEQ ID NO: 14 A10365 SEQ ID NO: 48 A 807 SEQ ID NO: 15 A10481 SEQ ID NO: 49 A864 SEQ ID NO: 16 A10855 SEQ ID NO: 50 A 1024 SEQ ID NO: 17 Al 1125 SEQ ID NO: 51 A 1033 SEQ ID NO: 18 Al 1224 SEQ ID NO: 52 A 1047 SEQ ID NO: 19 Al 1302 SEQ ID NO: 53 Al 122 SEQ ID NO: 20 Al 1307 SEQ ID NO: 54 A 1245 SEQ ID NO: 21 Al 1341 SEQ ID NO: 55 A1386 SEQ ID NO: 1 A11381 SEQ ID NO: 56 A1387 SEQ ID NO: 22 A11458 SEQ ID NO: 57 Al 457 SEQ ID NO: 23 A11460 SEQ ID NO: 58 Al 667 SEQ ID NO: 24 A11511 SEQ ID NO: 59 A1671 SEQ ID NO: 25 Al 1512 SEQ ID NO: 60 A 1709 SEQ ID NO: 26 Al 1521 SEQ ID NO: 61 A 1726 SEQ ID NO: 27 Al 1576 SEQ ID NO: 62 A1756 SEQ ID NO: 28 Al 1647 SEQ ID NO: 63 A 1779 SEQ ID NO: 29 Al 1702 SEQ ID NO: 64 A3077 SEQ ID NO: 30 Al 1721 SEQ ID NO: 65 A4241 SEQ ID NO: 31 A12109 SEQ ID NO: 66 A4864 SEQ ID NO: 32 A12172 SEQ ID NO: 67 A5268 SEQ ID NO: 33 A12184 SEQ ID NO: 68 A5355 SEQ ID NO: 34 A12355 SEQ ID NO: 69 A5437 SEQ ID NO: 35 A12619 SEQ ID NO: 70 A5584 SEQ ID NO: 36 A12678 SEQ ID NO: 71A5655 SEQ ID NO: 37

[0206] Choosing Aptamer Candidates from PRRSV II E Selection NGS Results: During the selection process, 69 distinct sequences were identified by analyzing the enrichment fold in relation to the percent abundance of sequences across multiple selection rounds. To refine these candidates, the study focused on sequences that exhibited either high abundance, high enrichment fold, or both, across the rounds. These sequences were then cross-referenced with qPCR results from the selection pools (FIGS. 13A-13D and FIGS. 14A-14D) to confirm their relevance. Based on this analysis, several promising aptamer candidates were selected and are presented in TABLE 9.

[0207] TABLE 9 provides an overview of the final aptamer candidates, including their identifier names, the rounds in which they demonstrated high abundance, and the rounds where they exhibited a high enrichment fold. The aptamer candidates were prioritized based on their consistent performance across multiple rounds, as well as their correlation with the qPCR data of the selection pools (FIGS. 13A-13D and FIGS. 14A-14D). Sequences that repeatedly- showed strong abundance and / or enrichment were considered to have greater potential for successful binding to the target. For example, Aptamer Candidate 1 (identifier A1245) displayed high abundance in numerous rounds, including rounds 2, 3,4, 5, 9, 10, 11, 12N, 13N, 14N, and 15N. This candidate also demonstrated a consistently high enrichment fold from rounds 8 to 13N, marking it as a strong contender for further analysis. In contrast, Aptamer Candidate 4 (identifier A29) showed no significant abundance or enrichment fold in any round and was thus selected as a negative control for comparison purposes.TABLE 9. Summary of selected aptamer candidates, showing their identifier names, rounds with high sequence abundance, and rounds with high enrichment fold.Aptamer Identifier Rounds with High Rounds with High Abundance %Candidate # Name Enrichment-Fold 2, 3, 4, 5, 9, 10, 11, 12N, 13N,1 A 1245 8, 9, 10, 11, 12N, 13N 14N, 15N, 13L, 14L, 15L2, 3, 5, 9, 10, 11, 12N, 13N, 14N, 9, 10, 11, 12N, 13N, 2 Al 12215N, 13L, 14L, 15L 13L, 14L 2, 4, 5, 6, 11, 12N, 13N, 14N, 13L,3 A565 4, 5, 614L, 15L4 A29 None None9, 10, 11, 12N, 13N, 13L, 14L,5 A1386 7, 815L6 A 1756 11, 12N, 13L, 14L, E5L 2, 37 A807 5, 6, 7, 8, 9, 10, 11, 13L 5, 6, 73, 4, 8, 11, 12N, 13N, 14N, 15N, 4, 8, 9, 10, 11, 12N, 8 A177913L 13N9 Al 0481 None 8, 9, 1010 A 1667 5, 6, 7 5, 6, 711 A 1457 4 2, 3, 4

[0208] Cluster Analysis of Aptamer Candidates from the PRRSV II E Selection: Evaluating the cluster and intra-cluster ranks of candidates is a key step in identifying selection patterns and determining which candidates demonstrate the most potential for further development. The cluster rankings of Candidates 1 through 11 from the PRRSV II E selection process over multiple rounds were assessed and summarized in TABLES 10A-10B. Specifically, clustering data were analyzed from Round 5 to Round 7, Round 8 to Round 10, Round 11 to Round 13N, and from Round 13N to Round 15N. In addition to rank of cluster, analysis of sequences in each candidate’s cluster in round 15N was conducted (TABLE 11, TABLE 12, TABLE 13, TABLE 14, TABLE 15, TABLE 16, TABLE 17). This analysis provided insights into the rank dynamics within and across clusters as the selection process progressed, allowing us to track changes in candidate performance and behavior over time.

[0209] For instance, Candidates 1 and 8 were both part of the same cluster which had 38 sequences in R15N. Candidate 1 consistently ranked first, followed by Candidate 8 in second place. Their cluster ranked second from Round 8 to Round 10, which correlated with an increase in elution yield and a notable shift in the melting curve, as shown in FIGS. 13A-13D. Similarly, Candidates 2 and 9, also from the same cluster which had 29 sequences in R15N, were ranked first and second respectively, with their cluster ranking fourth during the same rounds, again corresponding with a rise in elution yield and changes in the melting curve.

[0210] Candidate 3’s cluster ranked fifth between Round 8 and Round 10, a period that also saw improvements in elution yield and melting curve shifts. In addition, by R15N, there were 11 sequences within this cluster. Candidate 4 demonstrated a steady increase in cluster ranking as the selection rounds advanced and had 13 sequences in its cluster in R15N. Meanwhile, Candidate 5’s cluster achieved the top ranking from Round 8 to Round 10,coinciding with enhanced elution yield and melting curve shifts. Furthermore, by Round 15N, this cluster contained a total of 11 sequences.

[0211] The clusters for Candidates 6 and 7 were ranked seventh and third, respectively, during Rounds 8 through 10, again reflecting increases in elution yield and shifts in the melting curve. By Round 15N, Candidate 6’s cluster contained 11 sequences, while Candidate 7’s cluster included 6 sequences. Interestingly, Candidate 10’s cluster held the top rank between Round 5 and Round 7, a period characterized by an increase in elution yield and changes in the melting curve. Furthermore, Candidate 10 achieved a ranking of 2 out of 26 sequences in Round 15N. In contrast, Candidate H’s cluster showed a drop in ranking during the later selection rounds, particularly in Round 15N, where it contained 7 unique sequences. This decline may be linked to a decrease in elution yield. These results suggest that by Round 8, each of the aptamer candidates had formed distinct clusters, and their rankings provided valuable insights into the efficiency of selection.TABLE 10A. Summary of cluster rank and intra-cluster rank for candidates 1 to 11 from PRRSV II E selection across clusters in Round 5 (R5) to Round 7 (R7), Round 8 (R8) to Round 10 (RIO), Round 11 (Rll) to Round 13N (R13N), and R13N to Round 15N (R15N).Aptamer Rank of Cluster Rank in Cluster Rank of Cluster Rank in Cluster Candidate # (R5-R7) (R7) (R8-R10) (R10)1 47 1 / 2 2 1 / 4 2 Not in a cluster Not in a cluster 4 1 / 14 3 Not in a cluster Not in a cluster 5 1 / 7 4 18 1 / 2 17 1 / 6 5 4 1 / 3 1 1 / 14 6 35 1 / 2 7 1 / 5 7 2 1 / 5 3 1 / 20 8 47 2 / 2 2 2 / 4 9 Not in a cluster Not in a cluster 4 2 / 14 10 1 1 / 9 25 1 / 8 11 Not in a cluster Not in a cluster 8 1 / 8TABLE 10B. Summary of cluster rank and intra-cluster rank for candidates 1 to 11 from PRRSV II E selection across clusters in Round 5 (R5) to Round 7 (R7), Round 8 (R8) to Round 10 (RIO), Round 11 (Rll) to Round 13N (R13N), and R13N to Round 15N (R15N).Aptamer Rank of Cluster Rank in Cluster Rank of Cluster Rank in Cluster Candidate # (R11-R13N) (R13N) (R13N-R15N) (R15N) 1 1 1 / 54 1 1 / 38 2 2 1 / 35 2 1 / 29 3 3 1 / 17 5 1 / 11 4 8 1 / 15 7 1 / 13 5 4 1 / 19 8 1 / 11 6 6 1 / 14 10 1 / 11 7 16 1 / 17 36 1 / 6 8 1 2 / 54 1 2 / 38 9 2 2 / 35 2 2 / 29 10 13 1 / 15 4 2 / 26 11 19 1 / 10 29 1 / 7TABLE 11. Cluster analysis of candidate 1 (A1245) and candidate 8 (A1779) from Round R15N. Red letters indicate the primer regions. Blue highlights nucleotide changes introduced by Al 779 compared to A1245, while green indicates nucleotide changes relative to both A 1779 and A 1245. Underlined text denotes newly added nucleotides.TABLE 12. Cluster analysis of candidate 2 (A 1122) and candidate 9 (A 10481) from Round R15N. Red letters indicate the primer regions. Blue highlights nucleotide changes introduced by A 10481 compared to Al 122, while green indicates nucleotide changes relative to both Al 0481 and Al 122. Underlined text denotes newly added nucleotides.TABLE 13. Cluster analysis of candidate 3 (A565) from Round R15N. Red letters indicate the primer regions. Green indicates nucleotide changes relative to A565.TABLE 14. Cluster analysis of candidate 4 (A29) from Round R15N. Red letters indicate the primer regions. Green indicates nucleotide changes relative to A29.TABLE 15. Cluster analysis of candidate 5 (A1386) from Round R15N. Red letters indicate the primer regions. Green indicates nucleotide changes relative to A1386.TABLE 16. Cluster analysis of candidate 6 (A1756) from Round R15N. Red letters indicate the primer regions. Green indicates nucleotide changes relative to A 1756.TABLE 17. Cluster analysis of candidate 7 (A807) from Round R15N. Red letters indicate the primer regions. Green indicates nucleotide changes relative to 807.TABLE 18. Cluster analysis of candidate 10 (A1667) from Round R15N. Red letters indicate the primer regions. Green indicates nucleotide changes relative to Al 726 which is the top rank sequence in the cluster.TABLE 19. Cluster analysis of candidate 11 (A1457) from Round R15N. Red letters indicate the primer regions. Green indicates nucleotide changes relative to A1457.

[0212] Secondary Predictions of Aptamer Candidates from the PRRSV II E Selection: The secondary structure predictions for the 11 aptamer candidates from the PRRSV II E selection process were generated using mFold under the same conditions as the initial selection process (25°C and 1 mM MgCh), ensuring that the structures are relevant to the conditions in which they were developed (FIG. 18). The analysis revealed that candidates 1 and 8, which are derived from the same cluster, share a similar secondary structure, suggesting they may have a common structural motif or function. This resemblance could indicate they bind the target similarly, or that their binding regions are structurally conserved.

[0213] Candidates 2 and 9, although possessing unique overall secondary structures, displayed two shared motifs, one at each terminal end of the sequences (5’ and 3’ ends). This characteristic suggests these motifs may play a role in binding or folding interactions while allowing for variability in other regions of the aptamer. The presence of these consistent motifswithin otherwise distinct structures indicates that, while diverse in structure, they may share common functional elements crucial for binding. Candidates 3 and 11 similarly contain a shared motif at their 5' ends, highlighting another potential structural feature that may contribute to target binding or structural stability.

[0214] Overall, this diversity in secondary structure among the candidates points to a varied pool of aptamers, each potentially interacting with the target in unique ways. This structural diversity, while containing some recurring motifs, indicates a promising selection of candidates, each bringing a unique configuration that could enhance the chances of identifying a high-affinity, specific aptamer for the intended target. These insights into structural uniqueness and conserved motifs guided the selection of these aptamers for further validation and testing.

[0215] ELONA Binding Assays of Aptamer Candidates from the PRRSV II E Selection to Active PRRSV IL To evaluate the binding capability of these aptamer candidates to the viral target, the study used an oligonucleotide-linked oligonucleotide assay (ELONA), a variant of the enzyme-linked immunosorbent assay (ELISA). ELONA is specifically designed to detect binding interactions between nucleic acids, such as aptamers, and their targets. In this method, the vi s is immobilized on a surface, and a biotin-labeled aptamer is incubated with the virus, with unbound aptamer subsequently washed away. After binding, a streptavidin-enzyme-linked detection molecule is added, producing a colorimetric signal proportional to the binding interaction. This allows for the quantification of binding affinities, making ELONA a common choice for determining the binding constants of aptamers with viral targets due to its sensitivity and adaptability to nucleic acid interactions.

[0216] To assess the binding affinity of PRRSV II Aptamer Candidates 1-9 to active PRRSV II, ELONAs were conducted, as shown in FIG. 19. The ELONA results indicate that Candidates 1, 2, 3, 4, 6, and 8 did not produce sigmoidal binding curves, suggesting a lack of specific binding to the target. In contrast, Candidates 5, 7, and 9 displayed varying degrees of sigmoidal binding curves, with Candidate 9 showing the most pronounced sigmoidal profile, suggesting a stronger binding interaction with PRRSV II. Candidates 10 and 11 were selected at a later stage in the binding assay analysis, which is why they were not included in the initial ELONA testing.

[0217] To further quantify binding affinity, dissociation constants (KA values) were calculated for Candidates 5, 7, and 9 using a one-site specific binding model. Candidate 5 exhibited a KA of 18.61 nM, suggesting a moderate binding affinity. Candidate 7 displayed a KA of 67.11 nM, indicating a somewhat weaker binding compared to Candidate 5. Candidate9, although showing the best sigmoidal curve in the ELONA assay, had a higher K,t of 110.7 nM, indicating a comparatively lower affinity among the three. For context, previously reported aptamers show significantly lower KA values, such as 0.9 nM for the HAdV-Seq4 aptamer specific for infectious human adenovirus and 79 nM for the SARS2-AR10 aptamer binding to infectious pseudotyped SARS-CoV-2.

[0218] These results suggest that, while PRRSV II Candidates 5, 7, and 9 demonstrate some binding affinity to active PRRSV II, their dissociation constants indicate that further optimization may be needed to enhance binding specificity and strength, especially in comparison with aptamers targeting other infectious agents.

[0219] To validate these preliminary findings and assess the selectivity of the PRRSV II aptamer candidates, additional binding assays, such as mobility shift gel binding assays, thermofl uorimetric analysis, and fluorescence polarization assays, could be used. These complementary techniques could confirm binding interactions and provide more reliable Ad values, ultimately supporting the identification of the most specific and high-affinity aptamers for PRRSV II.

[0220] Mobility Shift Gel Binding Assays of Aptamer Candidates from the PRRSV II E Selection to Active PRRSV II: To evaluate whether the PRRSV II aptamer candidates bind to active PRRSV II, mobility shift gel assays were conducted. Mobility shift gel assays, also known as electrophoretic mobility shift assays (EMS As), are widely used to detect interactions between nucleic acids, such as aptamers, and target molecules, including viruses. In these assays, aptamers are mixed with the viral particles and then run on a gel to observe any changes in the mobility of the nucleic acids. If binding occurs, the aptamer-virus complex typically moves more slowly through the gel due to increased size and altered charge, providing evidence of an interaction. To ensure a comprehensive analysis, both agarose and native polyacrylamide (PAGE) gels were used, as they offer distinct advantages. Agarose gels generally support larger molecular complexes, while native PAGE gels, with their higher resolution, are ideal for detecting smaller shifts and subtle differences in mobility. By employing both gel types, this study aimed to optimize conditions for detecting specific interactions between the aptamer candidates and active PRRSV II.

[0221] Following 1 hour incubation of various concentrations of active PRRSV II with 10 nM of F AM-labeled aptamer candidates 1-6, 1% agarose gels were run to assess any potential mobility shifts. However, no significant shift in mobility was observed for the FAM-labeled aptamers in the presence of the virus, suggesting that under the agarose gel assay conditions, the aptamer candidates might not be binding effectively to PRRSV II. Tills outcome could10indicate that the aptamers’ affinity for PRRSV II is too weak to form a detectable complex or that the assay conditions, such as ionic strength or incubation lime, may not be optimal. Additionally, structural constraints within the agarose gel matrix could potentially hinder the interaction, underscoring the need to test alternative conditions or methods.

[0222] To further explore binding interactions, native PAGE gels were also used, as shown in FIGS. 20A-20F. In FIG. 20A, lane 4 shows a decrease in the aptamer signal when active PRRSV II was incubated with Candidate 1, which could indicate an interaction between the aptamer and the virus. Similarly, lane 8 in FIG. 20A reveals a reduction in the aptamer signal, accompanied by a band smear when active PRRSV II was incubated with Candidate 2, possibly suggesting a weaker or non-specific interaction.

[0223] In FIG. 20B, FIG. 20D, and FIG. 20F, Coomassie-stained bands are visible in lanes 2, 4, 5, 6, 8, 9, and 10, with band intensities correlating with the concentration of virus incubated with the aptamers. For example, lane 4 in FIG. 20B, which contains a higher virus concentration (8.33 x IO4TCIDso / mL), shows a stronger band than lane 6, which has a low'er virus concentration (5.2.1 x IO3TCIDso / mL). This observation supports the notion of a concentration-dependent interaction, as the intensity of the Coomassie-stained bands increases with higher viral loads.

[0224] In FIG. 20C, lane 4 exhibits a band with lower mobility than the unbound aptamer signal when active PRRSV II was incubated with Candidate 4, implying a possible binding interaction. Lane 8 in FIG. 20C shows a similar pattern when active PRRSV II was incubated with Candidate 3, indicating that these candidates may form complexes with the virus under the PAGE conditions.

[0225] Further analysis in FIG. 20E shows a decrease in the aptamer signal in lane 4 when active PRRSV II was incubated with Candidate 5, suggesting a potential interaction. However, no significant decrease in the aptamer signal was observed when active PRRSV II was incubated with Candidate 6 in lane 8, which may imply that Candidate 6 does not effectively bind to the virus.

[0226] In conclusion, the mobility shift gel assays, conducted with both agarose and native PAGE gels, provide initial insights into the binding behavior of PRRSV II aptamer candidates. While some candidates, such as 1, 2, 3, 4, and 5, demonstrated potential interactions with active PRRSV II, others showed limited or no binding. The results indicate concentration-dependent interactions in some cases, but the observed band smearing and lack of mobility shifts for certain candidates suggest that further optimization and validation are required. To strengthen these findings, additional assays under varied conditions and complementary binding studieswill be essential to confirm specific aptamer- virus interactions and refine the selection of high- affinity, selective aptamers for PRRSV II.

[0227] Thermofl uorimetric analysis of Aptamer Candidates from the PRRSV II E Selection to Active PRRSV II: Thermofluorimetric analysis (TFA) is a technique used to assess the thermal stability of biomolecules, including proteins and nucleic acids, by tracking changes in fluorescence as the temperature increases. In this method, intercalating dyes are utilized that emit strong fluorescence only when they bind to double- stranded DNA (dsDNA). As the temperature rises, the double-stranded regions of the DNA separate (or dehybridize), resulting in a decrease in fluorescence. TFA can be applied to monitor the melting of aptamers, utilizing the changes in thermal stability that occur when these molecules bind to their target. This method evaluates how the binding of a target affects the stability of the aptamer, providing insights into the interactions between aptamers and their respective targets.

[0228] To investigate potential binding interactions between PRRSV II and aptamer candidates, 15 nM of each aptamer candidate (1 through 6) was incubated with various concentrations of active PRRSV II for 30 minutes. SYBR Gold dye was added, and TFA data were collected over a temperature range of 20°C to 95°C, with increments of 0.5°C per minute and data acquisition at 30-second intervals, as shown in FIG. 21A. The normalized derivative of the fluorescence signal (-dF / dT) in the presence of virus was calculated at 67°C and is displayed in FIG. 21B. Results show that as the concentration of active PRRSV II increased, the signal at 67°C generally rose for most candidates (1, 2, 3, 4, and 6), while for candidate 5, the signal unexpectedly decreased with higher concentrations of PRRSV II.

[0229] These results, however, did not produce typical binding curves that would indicate strong and specific interactions between the aptamer candidates and the virus. The lack of clear binding behavior suggests that TFA may not be a reliable method for detecting aptamer binding to active PRRSV II in this case. Possible reasons could include low binding affinity under the experimental conditions or non-specific interactions that do not stabilize the aptamers in a way- detectable by TFA. In conclusion, this study found that TFA was insufficient for confirming binding interactions between the aptamer candidates and PRRSV II, highlighting the need for alternative assays to belter evaluate aptamer-target binding in future analyses.

[0230] SYBR Green I Assay of Aptamer Candidates from the PRRSV II E Selection to Active PRRSV II and Inactive PRRSV II: A SYBR Green I binding assay is an analytical technique used to assess interactions between a virus and an aptamer by measuring fluorescence changes that signal binding events. SYBR Green I, a fluorescent dye, binds strongly to double-stranded DNA (dsDNA) and fluoresces more intensely when bound thanwhen free in solution. In a virus-aptamer assay, the aptamer -typically a single-stranded DNA or RNA molecule — is incubated with viral particles. If the aptamer binds to specific regions on the virus, it may form double-stranded regions or stable secondary structures that can bind SYBR Green I, resulting in increased fluorescence. This rise in fluorescence serves as an indication that the aptamer has potentially bound to the virus.

[0231] As shown in FIG. 22, active and inactive PRRSV II were incubated with 300 nM of each aptamer candidate (1 through 6) in the presence of SYBR Green I. After a 30-minute incubation, fluorescence was measured to determine the dissociation constant (Kd) for each aptamer’s binding affinity to active and inactive PRRSV II. Candidates 1 and 2 showed no detectable binding to either active or inactive PRRSV II, indicating these candidates may lack the necessary affinity for the viral target. Candidate 3 did not bind to active PRRSV II but demonstrated a <j of 0.530 TCIDso / mL with inactive PRRSV II, suggesting a possible structural preference or binding affinity for the inactive form of the virus. Candidate 4 showed a Ka of 35.32 TCIDso / mL with active PRRSV II and a significantly lower Ad of 2.53 TCIDso / mL with inactive PRRSV II, indicating stronger binding to the inactive form. Similarly, Candidate 5 had a Kd of 34.66 TCIDso / mL for active PRRSV II and a lower Ad of 12.62 TCIDso / mL for the inactive virus, further suggesting a preference for the inactive form. Candidate 6 showed the weakest affinity among the binding candidates, with a d of 159.4 TCIDso / mL for active PRRSV II and a Kd of 17.84 TCIDso / mL for inactive PRRSV II. These results indicate that aptamer candidates 3, 4, 5, and 6 have a stronger binding affinity for inactive PRRSV II than for the active form. The differences in binding affinity suggest that these candidates may recognize structural elements or epitopes that are more accessible in the inactive vims. Overall, the SYBR Green I assay reveals that while certain candidates may bind PRRSV II, they may exhibit greater affinity for the inactive form. However, a secondary method needs to validate these binding assays.

[0232] Fluorescence Polarization Binding Assays of 250 nM FAM Aptamer Candidates from the PRRSV II E Selection to Active PRRSV II: Fluorescence polarization (FP) is a valuable technique for studying molecular interactions, such as the binding of aptamers to viruses. In FP, a molecule labeled with a fluorophore is excited by polarized light, and the degree of fluorescence polarization in the emitted light is measured. The principle behind FP is that smaller, unbound molecules rotate rapidly in solution, leading to depolarized emitted light, while larger complexes, like an aptamer bound to a vims, rotate more slowly, resulting in higher fluorescence polarization. This property allows FP to differentiate between free and bound aptamers, providing a sensitive and quantitative way to assess bindinginteractions. Using a fluorophore -labeled aptamer in FP offers several advantages: it enables real-time, non-invasive measurement of binding events, supports precise quantification of binding affinity, and simplifies the detection process by eliminating the need to separate bound from unbound molecules. As such, FP is an efficient method for evaluating aptamer-virus interactions and is especially useful in identifying aptamers with high affinity and specificity-- key attributes for developing effective diagnostic or therapeutic tools.

[0233] For the initial assessments of binding interactions using fluorescence polarization (FP), aptamer candidates from the PRRSV II E selection were evaluated for binding affinity with active PRRSV II using FP assays at 250 nM FAM-labeled concentration, as shown in FIG. 23. Among the tested candidates, candidates 1-4 and 9 did not exhibit binding, showing no significant polarization change and suggesting a lack of strong interaction with active PRRSV II. In contrast, candidates 5, 6, and 7 produced clear binding signals, each displaying a sigmoidal curve typical of specific binding interactions. For candidate 5, a dissociation constant (Ad) of 187.3 TCIDso / mL was observed, indicating moderate affinity toward active PRRSV II. Candidate 6 demonstrated a significantly stronger interaction, with a lower Ah of 13.42 TCIDso / mL, suggesting high affinity for the virus. Candidate 7 also showed a substantial binding affinity with a Ad of 42.67 TCIDso / mL. The sigmoidal binding curves for candidates 5, 6, and 7 reinforce their potential as aptamers capable of specifically binding to active PRRSV II.

[0234] These results suggest that candidates 5, 6, and 7 have promising binding affinities, with candidate 6 exhibiting the highest specificity among the three. The observed Ah values also imply varying levels of aptamer selectivity, which will be explored further to confirm their binding characteristics and potential use in diagnostic applications for detecting active PRRSV II. Further testing will be essential to validate these findings and to evaluate each aptamer’s performance in different assay conditions and against viral targets, which will ultimately clarify their suitability as PRRSV Il-specific binding agents.

[0235] Truncated Aptamer Candidates 5, 6, 7, and 9 from PRRSV II E Selection: Based on the results from ELONA and fluorescence polarization binding assays, aptamer candidates 5, 6, 7, and 9 demonstrate the highest binding affinity for PRRSV II. Prior studies have shown that truncating aptamers can enhance their binding efficiency by isolating the essential binding region, thereby improving their specificity and affinity for the target.70-72Additionally, truncated aptamers offer practical benefits, as they can be synthesized with higher yields and reduced costs, making them more feasible for large-scale applications.

[0236] To optimize these candidates for PRRSV II, a systematic analysis of truncated variants was conducted. The secondary structures of each truncated aptamer version were predicted using mFold, as illustrated in FIG. 24. For candidate 5, two conserved motifs were identified. The yellow-highlighted motif appeared across several truncated regions, including the full FP-45-RP sequence, FP and 45 regions, 45 and RP regions, and the 45 region alone. This recurring motif suggests a potentially essential structure for target interaction, as it remains present even in truncated forms. Another motif, highlighted in pink, was conserved between the FP, 45 region, and RP, and the FP and 45 region. This motif’s recurrence suggests it may also contribute to maintaining structural elements important for candidate 5’s binding affinity.

[0237] Candidate 6 displayed a conserved motif, marked in orange, across two truncated regions: FP-45-RP and 45-RP. This motif’s presence in multiple configurations suggests it may play a role in binding, particularly in maintaining structural flexibility while supporting aptamer functionality in truncated forms.

[0238] For candidate 7, two unique motifs were identified. The green-highlighted motif was present between the FP-45-RP and FP-45 regions, while the purple-highlighted motif was conserved between the FP-45-RP and 45-RP regions. These motifs’ recurrence across different truncated segments implies they could be integral for binding activity and stability, even when the aptamer length is reduced.

[0239] In candidate 9, the blue-highlighted motif appeared in both the FP-4 -RP and FP-45 regions, suggesting this structure may also support effective binding. The motif’s presence in shorter segments further supports the possibility of maintaining binding specificity with truncated forms.

[0240] Based on structural predictions, specific truncations were designed and created for each aptamer candidate to focus on the regions most likely to contribute to target binding. For candidate 5, two truncations were generated: one containing the forward primer and 45 region and another with only the 45 region. For candidate 6, a truncation containing the 45 region and reverse primer was selected. Candidate 7 was also truncated into two versions, one with the forward primer and 45 region, and another with the 45 region and reverse primer. Lastly, for candidate 9, a truncation was created with the forward primer and 45 region. These truncated versions were chosen to isolate regions identified as potentially essential for binding, while minimizing the overall aptamer length. Reducing aptamer length can lead to more cost- effective synthesis, making these versions advantageous for practical applications. Eachtruncation focuses on segments previously shown to contain conserved motifs, ensuring that critical structural elements are retained for effective target interaction.

[0241] ELONA Binding Assays of Truncated Aptamer Candidates 5, 6, 7, and 9 from PRRSV II E Selection: To assess the binding capability of truncated aptamer candidates 5, 6, 7, and 9 to active PRRSV II, ELONAs were conducted, as shown in FIG. 25. Two truncated forms of candidate 5 were tested: one containing the forward primer (FP) and 45 region, and another with only the 45 region. The FP and 45 region truncation showed a dissociation constant (Kd) of 16.44 nM, while the 45 region alone demonstrated a Kd of 100.1 nM, indicating lower affinity. Given its superior binding affinity, the FP and 45 region truncation of candidate 5 was selected for further study. For candidate 6, a single truncation containing the 45 region and reverse primer (RP) was tested, but it did not display significant binding to active PRRSV II. Consequently, candidate 6 was not investigated further. Candidate 7 was tested with two truncations: one combining FP and the 45 region, and another with the 45 region and RP. The FP and 45 region truncation showed the highest binding affinity, with a Kd of 0.59 nM, while the 45 region and RP had a 'dof 1.29 nM. The stronger binding affinity of the FP and 45 region truncation led to its selection for continued analysis. Finally, candidate 9 was assessed with a single truncation that included the FP and 45 region, which showed a Kd of 74.88 nM. Tills truncation demonstrated sufficient binding affinity to warrant further testing. These results indicate that specific truncations, particularly those involving the FP and 45 region, enhance binding affinity for candidates 5, 7, and 9, making them promising options for further investigation in binding studies with active PRRSV II.

[0242] Selectivity of PRRSV II E-Selected Aptamer Candidates 5, 7, and 9 (Forward Primer and 45 Region) via ELONA Assays: To evaluate the selectivity of truncated aptamer candidates 5, 7, and 9 (each containing the forward primer and 45 region), ELONAs were conducted using active PRRSV II, inactive PRRSV II, active PRRSV 1, and active PEDV, as illustrated in FIG. 26. Candidate 5 demonstrated binding to active PRRSV II with a dissociation constant (Kd) of 2417 nM and to inactive PRRSV II with a Kd of 33.56 nM, indicating a significant degree of cross-reactivity. However, there was no binding observed between this aptamer and either active PEDV or active PRRSV I.

[0243] Candidate 7 exhibited a K of 83.33 nM for active PRRSV II, showing a stronger affinity than candidate 5; however, it did not bind to inactive PRRSV II, active PEDV, or active PRRSV I. In the case of candidate 9, binding was observed for both active PRRSV II, with a K of 604.5 nM, and active PRRSV I, with a K of 555.6 nM, indicating cross-reactivitybetween these two viral strains. No binding was detected with inactive PRRSV II or active PEDV for this candidate.

[0244] These results suggest that while candidates 5, 7, and 9 exhibit selective binding to active PRRSV II, they also show varying degrees of cross-reactivity, particularly candidate 9, which binds to both PRRSV II and PRRSV I. The presence of cross-reactivity and differences in binding affinities among the candidates highlights the need for further validation. Therefore, a second binding assay method should be performed to confirm these findings and establish the reliability of these aptamer candidates for specific targeting of PRRSV II.

[0245] Selectivity of PRRSV II E-Selected Aptamer Candidates 5, 7, and 9 (Forward Primer and 45 Region) via Fluorescence Polarization Assays: To evaluate the selectivity of truncated aptamer candidates 5, 7, and 9 (all containing the forward primer and 45 region), fluorescence polarization assays were performed using active PRRSV II, inactive PRRSV II, active PRRSV I, and active PEDV, as shown in FIG. 27. Candidate 5 showed binding to active PRRSV II with a dissociation constant (Ad) of 17,841 TCIDso / mL and to inactive PRRSV II with a Ad of 55.69 TCIDso / mL, indicating significant cross-reactivity; however, no binding was observed with active PEDV or active PRRSV I.

[0246] Candidate 7 exhibited a Ad of 374.4 TCIDso / mL for active PRRSV II, indicating a stronger binding affinity compared to candidate 5, but it did not bind to inactive PRRSV II, active PEDV, or active PRRSV I. For candidate 9, binding was detected for both active PRRSV II (Ad of 84.49 TCIDso / mL) and active PRRSV I (Ad of 8.319 TCIDso / mL), suggesting crossreactivity between these viral strains, while no binding was seen with inactive PRRSV II or active PEDV.

[0247] These results suggest that while all three aptamer candidates show selectivity for active PRRSV II, they differ in their levels of cross-reactivity, with candidate 9 displaying the widest range of interactions. Moreover, the selectivity trends from the fluorescence polarization assays align with those observed in the ELONA assays. Although these findings indicate potential for using these aptamer candidates in detecting PRRSV, issues with reproducibility and consistency need to be addressed. To effectively utilize these aptamers for detecting the virus in porcine samples, such as oral fluids and blood, further refinement and consistency in results are essential.

[0248] Selectivity of PRRSV II E-Selected Aptamer Candidates 5 and 7 (Forward Primer and 45 Region) in 10% Pig Oral Fluid via Fluorescence Polarization Assays: To evaluate the selectivity of truncated aptamer candidates 5 and 7 (all containing the forward primer and 45 region) in 10% pig oral fluid, fluorescence polarization assays were performedusing active PRRSV IL inactive PRRSV II, active PRRSV I, and active PEDV, as shown in FIG. 28. Candidate 5 (containing the forward primer and 45 region) showed no binding to active PRRSV II, inactive PRRSV II, active PEDV, or active PRRSV I. Candidate 7 (containing the forward primer and 45 region) showed no binding to active PRRSV II, inactive PRRSV II, active PEDV, or active PRRSV I. These results suggest that these aptamer candidates cannot distinguish between active PRRSV II, inactive PRRSV II, active PEDV, or active PRRSV I with 10% pig oral fluid while using fluorescence polarization. Additional methods need to be explored to find a way to differentiate the viruses using these aptamers.

[0249] Structures of PRRSV Aptamer Candidates for Exonuclease Digestion Assays: Exonuclease digestion assays are widely used to evaluate the stability and functionality of nucleic acids, such as DNA and RNA, in the presence of exonucleases, which are enzymes that sequentially degrade nucleotides from the ends of nucleic acid strands. These assays are particularly useful in studying aptamer-target interactions, as they exploit the protective effect of target binding against enzymatic degradation. T5 exonuclease, a thermostable enzyme, specifically degrades DNA in a 5' to 3' direction, cleaving single-stranded DNA or double¬ stranded DNA with exposed 5' ends, while leaving protected regions, such as those bound to a target or paired in duplex structures, intact. This selective degradation property makes T5 exonuclease particularly effective for studying aptamer binding. When an aptamer binds its target with high affinity, the complex resists 1'5 exonuclease digestion, whereas unbound aptamers or unprotected regions are readily degraded. This property has been harnessed in aptamer selection and screening processes. Therefore, the PRRSV aptamer candidate 5 (FP, 45 region), candidate 7 (FP, 45 region), candidate 9 (FP, 45 region), and negative control (NC) scrambled (FP, 45 region), were used in the exonuclease digestion assay. Their predicted mFold structures are shown in FIG. 29.

[0250] Time-Dependent Analysis of Exonuclease Digestion Assays of PRRSV Aptamer Candidates: The '1'5 exonuclease digestion assay was performed to evaluate the stability and binding characteristics of PRRSV aptamer candidate 5 (FP, 45 region), candidate 7 (FP, 45 region), candidate 9 (FP, 45 region), and negative control (NC) scrambled (FP, 45 region), in the presence of 2 xlO5active PRRSV II TCIDso / mL. The assay was designed to be time-dependent, with aliquots collected at various intervals to monitor progression digestion. This approach allowed for the observation of time-dependent changes in the aptamer bands, providing insights into the aptamers’ protection against exonuclease digestion in the presence of the virus.

[0251] FIG. 30A shows that as the incubation time increases, the band corresponding to candidate 7 (FP, 45 region) in the presence of active PRRSV II and T5 exonuclease decreases in intensity. The band begins to fragment into shorter products, with significant degradation observed at 16 hours. This suggests that candidate 7 is susceptible to exonuclease digestion over time, but the presence of PRRSV II may influence its stability. FIG. 30B demonstrates that the band for candidate 5 (FP, 45 region) disappears within the first hour of digestion, followed by the appearance of shorter fragments, indicating rapid degradation by T5 exonuclease. A similar trend is seen for candidate 9 (FIG.30C), where the band also disappears within one hour and is replaced by shorter degradation products. Given that the 5' end of the aptamers likely contains double-stranded regions, which are more prone to exonuclease activity, this rapid degradation is likely. The same pattern is observed for the NC scrambled aptamer (FIG. 30D), where the band decreases in intensity over time, and by 16 hours, the entire aptamer is degraded.

[0252] Based on these observations, the 16-hour incubation period with T5 exonuclease was selected for subsequent exonuclease experiments. At this time point, there was a substantial reduction in band intensity, making it the most suitable for assessing the stability and binding interactions of the aptamers under the conditions tested. This time frame provided a clear window for analyzing aptamer protection against exonuclease digestion, offering valuable insight into the strength of aptamer-target interactions in the presence of active PRRSV II.

[0253] Selectivity of Exonuclease Digestion Assays for PRRSV Aptamer Candidates:To determine the selectivity of the PRRSV aptamer candidates, a T5 exonuclease digestion assay was performed using PRRSV aptamer candidate 5 (FP, 45 region), candidate 7 (FP, 45 region), candidate 9 (FP, 45 region), and negative control (NC) scrambled (FP, 45 region), in the presence of 2 xlO5active PRRSV II TCIDso / mL, or 2 xlO5inactive PRRSV II TCIDso / mL, 2 xlO5active PRRSV I TCIDso / mL,, or 2 xlO5active PEDV TCIDso / mL. Various time points (8 hours and 16 hours) were used to assess the rate of exonuclease digestion. The rationale for employing multiple time points was to capture the dynamics of the aptamer’s interaction with the viruses and observe the extent of protection offered by binding, which would manifest as resistance to exonuclease digestion.

[0254] FIG. 31A shows the results for candidate 5 (FP, 45 region), where at 16 hours of T5 exonuclease digestion, the aptamer band partially digests into three new bands in lane 8 but forms one lower-migrating band in lane 9, which corresponds to the sample containing active PRRSV II. This suggests that Candidate 5 binds to active PRRSV II, offering partial protectionfrom exonuclease digestion. In contrast, lane 10, which contains inactive PRRSV II, exhibits a similar patern to lane 8 but with more intense lower-migrating bands, indicating less protection. Lanes 11 (active PRRSV I) and 12 (active PEDV) show similar degradation patterns to lane 8, further confirming that Candidate 5 is more selective for active PRRSV II than for inactive PRRSV II, active PRRSV I, or active PEDV. These results suggest that the aptamer recognizes and selectively binds to active PRRSV II, making it a potential candidate for further development.

[0255] FIG. 31B presents the selectivity of candidate 7 (FP, 45 region) in the exonuclease digestion assay. In the absence of the target, candidate 7 remained intact at both 8 hours (lane 2) and 16 hours (lane 7) of T5 exonuclease digestion. In the presence of inactive PRRSV II, active PRRSV I, and active PEDV, no significant degradation occurred at either 8 hours or 16 hours (lanes 3-8). However, in the presence of active PRRSV II, the aptamer was digested into two lower-mobility bands at both time points, with the bands becoming more intense at 16 hours (lanes 3 and 8). This indicates that while candidate 7 binds to active PRRSV II, it is less prone to exonuclease digestion than candidate 5. The stable structure of candidate 7 in the presence of other virus strains, however, suggests high stability to exonuclease digestion.

[0256] FIG. 31C presents the exonuclease digestion results for candidate 9 (FP, 45 region), where in the absence and presence of active PRRSV II, inactive PRRSV II, active PRRSV I, and active PEDV, the aptamer was exonucleolytically digested at both 8 hours and 16 hours.

[0257] FIG.31D shows the exonuclease digestion assay for the scrambled negative control (NC) (FP, 45 region). In the presence of active PRRSV II, the aptamer was partially digested at 8 hours and completely digested at 16 hours (lanes 4 and 9). In contrast, the negative control remained undigested at both time points in the absence of target (lanes 3 and 8), as well as in the presence of active PRRSV I (lanes 6 and 11) and active PEDV (lanes 7 and 12). The NC was partially digested and formed a lower-migrating band in the presence of inactive PRRSV II (lanes 5 and 10). The fact that the NC was not completely resistant to exonuclease digestion in the presence of active PRRSV II indicates that it is not an ideal negative control. A proper negative control should not interact with the viruses and should show similar exonuclease digestion activity as the aptamer without the target virus present. Therefore, this scrambled NC does not adequately serve as a negative control in future experiments, as it suggests some nonspecific interactions with PRRSV II.

[0258] Overall, the results highlight the selectivity of candidate 5 for active PRRSV II. Furthermore, the need for a more suitable negative control is emphasized to ensure the specificity of the observed aptamer- virus interactions.

[0259] Structures of PRRSV Aptamer Candidate 5 (FP and 45 Region) Negative Controls (NC) for Exonuclease Digestion Assays: To validate the selectivity of Candidate 5 (FP and 45 region) in binding to PRRSV, it is essential to include negative controls that are structurally like the original aptamer but do not bind to the vims. These controls help differentiate between nonspecific interactions and genuine aptamer-virus binding, which is especially important in T5 exonuclease digestion assays. T5 exonuclease selectively degrades single-stranded DNA from the 5' end, and when an aptamer binds to its target, it typically resists exonuclease digestion, while unbound or nonspecifically bound sequences are degraded. By designing sequences where the 3' end of Candidate 5 was altered in NC 1-4, the 5' end was altered in NC 5-8, and the conserved region was altered in NC 9-16, the study aimed to retain the overall structural conformation of the aptamer while disrupting its ability to bind to the virus. 'This ensures that any observed resistance to T5 exonuclease digestion in the original aptamer sequence is due to specific binding to the virus, rather than structural features that could confer protection from exonuclease activity. TABLE 20 demonstrates the alignment of the negative control (NC) candidate sequences to candidate 5 (FP, 45 region). The mFold predictions for the structures of these negative controls (NCI through NCI 6) are shown in FIG. 32.TABLE 20. Sequence alignment of Candidate 5 (FP, 45 region) with NC1-NC16. Green letters indicate the forward primer sequence, blue letters highlight the conserved region for Candidate 5 (FP, 45 region) based on cluster alignment, and red letters denote changes in the negative control aptamers.Name Sequence (5* to 3')Candidate 5 (FP, 45 region) CC A A G TA; i AG CATA TC NCI Candidate 5 (FP, 45 region) AAGGAGCAGCGTGGAGGATACCGACACGATGGGACGGGKGTGAAffiATAGGCGCGTCCGCGGAC NC2 Candidate 5 (FP, 45 region) AAGGAGCAGCGTGGAGGATACCGACACGATGGGACGGGTGGTACTAATAGGGCGCGTCCGCGGAC NC3 Candidate 5 (FP, 45 region) AAGGAGCAGCGTGGAGGATACCGACACGSTAGGACGGGTATTAGGCATAGGGCGCGTCCGCGGAC NC4 Candidate 5 (FP, 45 region) AAGGAGCAGCGTGGAGGATACCGACACGATGGGACGGGTATTAGGCATAGGGGGCGTCCGCGGAC NC5 Candidate 5 (FP, 45 region) AAGGAGCAGCGTGGAGGATACCiCCACGATGGGACGGGTATTAGGCATAGGGCGCGTCCGCGGAC NC6 Candidate 5 (FP, 45 region) AAGGAGCATCGTGGAGGATACCGACACGATGGGACGGGTATTAGGCATAGGGCGCGTCCGCGGAC NC7 Candidate 5 (FP, 45 region) AAGGAGCAGCGTG / VtCAGSSACGACACGATGGGACGGGTATTAGGCATAGGGCGCGTCCGCGGAC NC8 Candidate 5 (FP, 45 region) CGAAGGAG4CGTGGAGGATACCGACACGATGGGACGGGTATTAGGCATAGGGCGCGTCCGCGGAC NC9 Candidate 5 (FP, 45 region) AAGGAGCAGCGTGGAGGATACCACGACGATGGGACGGGTATTAGGCATAGGGCGCGTCCGCGGAC NC10 Candidate 5 (FP, 45 region) AAGGAGCAGCGTGGAGGATACCGACACGATGGGACGT7TAGSAGGCATAGGGCGCGTCCGCGGAC NCI 1 Candidate 5 (FP, 45 region) AAGGAGCAGCGTGGAGGATACCGACACGATGGGACGGGTAGTAGGCATAGGGCGCGTCCGCGGAC NCI 2 Candidates (FP, 45 region) AAGGAGCAGCGTGGAGGATACCGACACGGATGGACGGGTATTAGGCATAGGGCGCGTCCGCGGAC NCI 3 Candidate 5 (FP, 45 region) GGsoAAGGi'ACGTGGAGGATACCGACACGATGGGACGGGTATTAGGCATAGGGCGCGTCCGCGGAC NCI 4 Candidate 5 (FP, 45 region) AAGGAGCAGCGTGGAGGATACCGACACGATGAAG7AGGTATTAGGCATAGGGCGTACTTGCGGAC NCI 5 Candidate 5 (FP, 45 region) AAGGAGCAG-ACAGAGGATACCGAmiAATGGGACGGGTATTAGGCATAGGGCGCGTCCGCGGACNCI 6 Candidate 5 (FP, 45 region) AAGGAGCAGCGTGCAGGATACCGACACGATGGGACGGGTATTAGGCATAGGGCGCGTCCGCGGAC

[0260] Selectivity of Exonuclease Digestion Assays for PRRSV Aptamer Candidate 5 (FP and 45 Region) Negative Controls (NC): To evaluate whether the negative controls for PRRSV Aptamer Candidate 5 (FP and 45 region) are suitable for comparing the binding of the aptamer to active PRRSV II, their selectivity was assessed using the exonuclease digestion assay.

[0261] FIG. 33 shows the selectivity results for Candidate 5 (FP and 45 region) at 16 hours of T5 exonuclease digestion. In the absence of the target, the aptamer partially digests into three new bands in lane 3. In lane 4, when active PRRSV II is present, the aptamer digests into lower-migrating bands, which differ in size compared to those in lane 3, indicating a selective interaction with active PRRSV II. In contrast, when the aptamer is incubated with inactive PRRSV II (lane 5), active PRRSV I (lane 6), or active PEDV (lane 7), it digests into three bands that are similar in intensity and size to those observed in the absence of the target (lane 2). These results demonstrate that Candidate 5 (FP and 45 region) is more selective for active PRRSV II than for inactive PRRSV II, active PRRSV I, or active PEDV.

[0262] FIG. 33B displays the selectivity results for NCI Candidate 5 (FP and 45 region) after 16 hours of T5 exonuclease digestion. In the absence of the target, the aptamer partially digests into four new bands (lane 3). In the presence of active PRRSV II, active PRRSV I, or inactive PRRSV II (lanes 4, 5, and 6), the aptamer partially digests into numerous lower- migrating bands compared to lane 3. However, when the aptamer is incubated with active PEDV (lane 7), it digests into four bands that are similar in intensity and size to those observed in the absence of the target (lane 2). These results suggest that NCI Candidate 5 (FP and 45 region) is not an appropriate negative control for Candidate 5 in the exonuclease digestion assay, as it still interacts with the viruses, leading to non-specific digestion.

[0263] FIG. 33C shows the selectivity results for NC2 Candidate 5 (FP and 45 region) after 16 hours of T5 exonuclease digestion. In the absence of the target, the aptamer partially digests into three new bands (lane 3). In lane 4, when active PRRSV II is present, the aptamer digests into lower-migrating bands, which are distinct from those in lane 3, indicating a selective interaction with active PRRSV II. In contrast, when the aptamer is incubated with active PRRSV I (lane 5), inactive PRRSV II (lane 6), or active PEDV (lane 7), it digests into three bands that are similar in intensity and size to those observed in the absence of the target (lane 2). These results demonstrate that NC2 Candidate 5 (FP and 45 region) exhibits the same selectivity as Candidate 5 (FP and 45 region), indicating that the mutation in NC2 does not affect the aptamer’s binding ability or selectivity towards active PRRSV II.

[0264] FIG. 33D displays the selectivity results for NC3 Candidate 5 (FP and 45 region) after 16 hours of T5 exonuclease digestion. In the absence of the target, the aptamer partially digests into two new bands (lane 3). In lane 4, when active PRRSV II is present, the aptamer digests into small lower-migrating bands, which are distinct from those in lane 3, indicating a selective interaction with active PRRSV II. However, when the aptamer is incubated with active PRRSV I (lane 5) or active PEDV (lane 7), it digests into two bands that are similar in intensity and size to those observed in the absence of the target (lane 2). Interestingly, when the aptamer is incubated with inactive PRRSV II (lane 6), it exhibits a digestion pattern like that observed in lane 4, indicating that the mutations in NC3 cause a loss of selectivity between active and inactive PRRSV II. This suggests that the modification in NC3 disrupts the ability of the aptamer to differentiate between active and inactive PRRSV II.

[0265] FIG. 33E presents the selectivity results for NC4 Candidate 5 (FP and 45 region) following 16 hours of T5 exonuclease digestion. In the absence of the target, the aptamer partially digests into three new bands (lane 3). In lane 4, when active PRRSV II is present, the aptamer exhibits distinct lower-migrating bands, indicating a selective interaction with active PRRSV II. However, when incubated with active PRRSV I (lane 5), inactive PRRSV II (lane 6), or active PEDV (lane 7), the aptamer digests into three bands that are similar in intensity and size to those observed in the absence of the target (lane 2). These results suggest that NC4 Candidate 5 (FP and 45 region) displays the same selectivity as Candidate 5 (FP and 45 region), indicating that the mutation in NC4 does not interfere with the aptamer’s binding ability or selectivity for active PRRSV II.

[0266] FIG.33F shows the selectivity results for NC5 Candidate 5 (FP and 45 region) after 16 hours of T5 exonuclease digestion. In the absence of the target, the aptamer partially digests into two new bands (lane 3). In lane 4, when active PRRSV II is present, the aptamer undergoes selective digestion into smaller lower-migrating bands, which are distinct from those in lane 3. However, when the aptamer is incubated with active PRRSV I (lane 6) or active PEDV (lane 7), it digests into two bands similar in intensity and size to those in the absence of the target (lane 2). Notably, incubation with inactive PRRSV II (lane 5) produces a digestion pattern like lane 4, indicating that the mutation in NC5 causes a loss of selectivity between active and inactive PRRSV II. This suggests that the modification in NC5 impairs the aptamer’s ability to differentiate between active and inactive PRRSV II.

[0267] FIG. 33G shows the selectivity results for NC6 Candidate 5 (FP and 45 region) after 16 hours of T5 exonuclease digestion. In the absence of the target, the aptamer partially digests into four new bands (lane 3). In lane 4, the presence of active PRRSV II results incomplete digestion into lower-migrating bands, distinct from those in lane 3, indicating a selective interaction with active PRRSV II. However, when the aptamer is incubated with active PRRSV I (lane 5), inactive PRRSV II (lane 6), or active PEDV (lane 7), it exhibits a similar digestion pattern to that seen in the absence of the target (lane 2). These results show that NC6 Candidate 5 (FP and 45 region) maintains the same selectivity as Candidate 5 (FP and 45 region), indicating that the mutation in NC6 does not affect the aptamer’s ability to selectively bind to active PRRSV II.

[0268] FIG. 33H displays the selectivity results for NC7 Candidate 5 (FP and 45 region) following 16 hours of 1'5 exonuclease digestion. In the absence of the target, the aptamer partially digests into two new bands (lane 3). In lane 4, when active PRRSV II is present, the aptamer digests into smaller lower-migrating bands, indicating a selective interaction with active PRRSV II. However, incubation with active PRRSV I (lane 6) or active PEDV (lane 7) results in two bands similar in size and intensity to those observed in the absence of the target (lane 2). Interestingly, when incubated with inactive PRRSV II (lane 5), the digestion pattern mirrors lane 4, suggesting that the mutations in NC7 lead to a loss of selectivity between active and inactive PRRSV II. This indicates that the modification in NC7 impedes the aptamer’s ability to distinguish between active and inactive PRRSV II.

[0269] FIG. 331 shows the selectivity results for NC8 Candidate 5 (FP and 45 region) after 16 hours of 1'5 exonuclease digestion. In the absence of the target, the aptamer partially digests into two new bands (lane 3). In lane 4, with active PRRSV II, the aptamer digests into smaller lower-migrating bands, indicating a selective interaction with active PRRSV II. However, incubation with active PEDV (lane 7) results in digestion into two bands like those observed in the absence of the target (lane 2). Lane 6 (active PRRSV I) shows a decrease in signal with a pattern like lane 3, which may indicate an interaction with this aptamer mutation. When incubated with inactive PRRSV II (lane 5), the digestion pattern resembles lane 4, suggesting that the mutations in NC8 disrupt the aptamer’s ability to differentiate between active and inactive PRRSV II, as well as between active PRRSV I and PRRSV II.

[0270] FIG.33J shows the selectivity results for NC9 Candidate 5 (FP and 45 region) after 16 hours of T5 exonuclease digestion. In the absence of the target, the aptamer partially digests into two new bands (lane 3). In lane 4, with active PRRSV II, the aptamer digests into smaller lower-migrating bands, indicating a selective interaction with active PRRSV II. However, incubation with active PEDV (lane 7) results in digestion into two bands like those observed in the absence of the target (lane 2). Lane 6 (active PRRSV I) shows a decrease in signal with a pattern like lane 3, which may indicate an interaction with this aptamer mutation. Whenincubated with inactive PRRSV II (lane 5), the digestion pattern resembles lane 4, suggesting that the mutations in NC8 disrupt the aptamer’s ability to differentiate between active and inactive PRRSV II, as well as between active PRRSV I and PRRSV II.

[0271] In conclusion, the results for all NC Candidate 5 (FP and 45 region) mutants suggest that these mutations do not effectively disrupt binding or interactions with PRRSV. Therefore, these aptamer variants are not suitable negative controls for the exonuclease digestion assay, as they fail to prevent interactions with the virus.

[0272] Summary of Project: This research aimed to develop innovative solutions for pork producers by isolating specific DNA sequences capable of distinguishing between infectious and non-infectious forms of Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) and Porcine Epidemic Diarrhea Virus (PEDV). These viruses present significant challenges to the pork industry, highlighting the need for accurate detection methods essential for effective disease management and prevention.

[0273] Throughout this challenging project, the study employed the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) process, which is designed to identify aptamers — short, single-stranded DNA or RNA molecules that bind selectively to target viruses. The study undertook a total of ten selection attempts, including six for PRRSV, each including 8 to 25 rounds, and five for PEDV, similarly structured. To monitor the progress of these selections, the study utilized quantitative PCR (qPCR) to measure the melting temperatures of the DNA pools at each selection round.

[0274] Initially, during the early rounds of selection, the study did not observe any significant shifts in the melting temperatures. This was likely due to the high diversity of the initial DNA sequences. As the study selected and enriched the DNA aptamers, it was anticipated that the diversity would decrease, resulting in more structured DNA aptamers, which inherently have higher melting temperatures. In previous successful SELEX projects targeting other viruses, such as human adenovirus and SARS-CoV-2, the study observed similar trends.

[0275] To understand the lack of melting temperature shifts in the current selections, the study conducted Next-Generation Sequencing (NGS) analysis on one of the selection pools. The analysis confirmed a diverse array of DNA sequences, indicating that while the study had selected numerous DNA aptamers, many might bind to unintended targets within the virus samples. This diversity presented challenges in identifying aptamers with specificity for these targets.

[0276] In response, the study optimized its selection conditions by varying factors such as virus concentration, purity, and reaction limes. 'These findings indicated that virus purity was a critical factor affecting the success of the selections. Therefore, the study focused on conducting SELEX experiments using uitra-centrifugally purified viruses, litis approach yielded promising results, as illustrated in FIGS. 13A-13D and FIGS. 14A-14D, where the study observed shifts in melting temperatures that mirrored previous successes with other viral targets.

[0277] After performing NGS on these more refined samples, the study analyzed the data and obtained several promising DNA sequences. These biochemical studies aimed to identify aptamers with the highest selectivity for either infectious PRRSV or PEDV. The study identified three different aptamer candidates for PRRSV. Candidate 5 demonstrated binding to active PRRSV II and inactive PRRSV II, with no binding to active PEDV or active PRRSV I. Candidate 7 exhibited binding to active PRRSV II but no binding to inactive PRRSV II, active PEDV, or active PRRSV I. Candidate 9 showed binding to both active PRRSV II and active PRRSV I, while no binding was observed with inactive PRRSV II or active PEDV.Conclusions

[0278] Tills study focused on developing a whole virus SELEX strategy to differentiate infectious from noninfectious porcine viruses, specifically PRRSV and PEDV. Although no aptamers were identified for PEDV, several aptamer candidates for PRRSV were successfully selected and validated through various binding assays, including ELONA, gels, and fluorescence polarization. One key challenge that was overcome in this process was the realization that the purity of the vims sample is crucial for the SELEX process to work effectively. By ensuring that the virus samples were highly purified, the study was able to improve the accuracy of aptamer selection and ultimately identify specific candidates. These aptamers represent promising tools for the rapid, specific detection of infectious PRRSV, an essential step in controlling viral outbreaks in swine herds.

[0279] Aptamer Integration into Nanopore System: The study can next translate these aptamers into functional biosensors (FIG.29), starting with integration into a nanopore system, based on the approach described in Peinetti, A. S. etal. (Direct Detection of Human Adenovirus or SARS-CoV-2 with Ability to Inform Infectivity Using DNA Aptamer-Nanopore Sensors. Sci. Adv. 2021, 7 (39), eabli2848). The fabrication of single-nanochannel membranes can be achieved by irradiating polyethylene terephthalate (PET) films with single swift heavy ions, followed by chemical etching to create bullet-shaped nanopores with a tip size of less than 55 nm. The small tip size is critical for enhancing the sensitivity of the nanopore system, enablingthe detection of small variations in current signals when the virus binds to the pore. The PRRS V aptamer can be immobilized onto the inner wall of the nanopore using EDC / Sulfo-NHS coupling. To ensure efficient binding, a spacer of adenosine nucleotides can be introduced to prevent interference from the nanopore surface. The success of the aptamer attachment can be verified using I- V measurements, where a decrease in current is likely due to the blockage of the nanochannel by the DNA.

[0280] Aptamer-Based Lateral Flow Assay (LFA) for Virus Detection: In addition to the nanopore system, lateral flow assays (LFAs) can be explored as an alternative platform for the detection of PRRSV and PEDV (FIGS, 30A-30D). LFAs offer several advantages, including cost-effectiveness, ease of use, rapid on-site testing, and the ability to perform multiplex detection. These advantages make LFAs particularly suitable for use in porcine farms, allowing frequent, immediate testing without the need for lab equipment. The PRRSV and PEDV aptamers can be added to specific areas of lateral flow strips to allow simultaneous detection of both viruses from a single sample, following the success of using aptamers in LFAs.Example 3: DNA Aptamers for Distinguishing Infectious and Noninfectious Porcine Reproductive and Respiratory Syndrome Virus

[0281] Swine pathogens pose a significant threat to the global swine industry, causing billions in annual losses due to reduced productivity, increased mortality, reproductive inefficiencies, and costly disease management. Beyond direct financial burdens, outbreaks disrupt trade and supply chains, compounding economic strain. Among the most critical threats is porcine reproductive and respiratory syndrome virus (PRRSV), responsible for devastating swine farm outbreaks.

[0282] First identified in the 1990s in Europe and North America, PRRSV is a highly mutable, enveloped RNA virus from the Arteriviridae family. It has two major genotypes-- European (PRRSV- 1) and North American (PRRSV-2) — with significant genetic variability that complicates vaccine development and disease control. PRRSV causes severe reproductive issues in sows, including stillbirths and abortions, while triggering respiratory disease in piglets, often worsened by secondary bacterial infections. The virus primarily targets macrophages in the lungs, weakening immune responses and enabling persistent infections. PRRSV spreads rapidly via aerosols, direct contact, and contaminated equipment or personnel, making containment challenging. Its economic impact extends beyond mortality and productivity losses to include medical costs, increased labor, trade restrictions, and prolonged herd recovery efforts.

[0283] Effective biosecurity, including surveillance and rapid detection, is essential to controlling swine pathogens like PRRSV. Quick and accurate diagnostics enable timely treatment and containment, preventing widespread infection and economic losses. Several diagnostic methods have been developed to detect swine viruses, with reverse transcription- quantitative polymerase chain reaction (RT-qPCR) being the gold standard. This technique provides high sensitivity and specificity but is impractical for field use due to its complex sample preparation, risk of false results from degradation or contamination, and reliance on skilled personnel and expensive equipment, making it inaccessible for many farmers. Alternative methods such as loop-mediated isothermal amplification (LAMP) and nextgeneration sequencing (NGS) offer promising avenues for virus detection, but require sample pretreatment and sophisticated infrastructure. Serological tests, including enzyme-linked immunosorbent assay (ELISA) and virus neutralization assays, detect antibodies specific to swine viruses, but their utility is hampered by the delayed immune response; antibodies take days to weeks to develop after infection, delaying early intervention. Traditional virological techniques, such as virus isolation, remain the definitive method for distinguishing infectious from noninfectious viruses. However, these approaches require growing the virus in host cells, a process that can take several days to weeks. These challenges underscore the need for rapid, accurate, and field-deployable diagnostic tools.

[0284] To overcome the limitations of current diagnostic methods, the Lu lab recently developed an approach for the direct detection of intact viruses, eliminating the need for labor-intensive sample pretreatment. Previously demonstrated for detecting human adenovirus and S ARS-CoV-2, this aptamer-n anopore sensor technology has the potential to revolutionize viral diagnostics by addressing key shortcomings of traditional techniques like RT-qPCR, which are prone to false positives and negatives due to RNA degradation or sample contamination. By directly targeting intact infectious viruses, the sensors enable rapid, on-site diagnostics crucial for containing outbreaks before they spread. Unlike antibody-based or virological methods, it provides real-time infectious status, guiding timely interventions and strengthening biosecurity to reduce economic losses.

[0285] Therefore, this study aims to address the critical challenges of PRRSV detection by developing DNA aptamers that selectively bind to intact, infectious viruses while minimizing affinity for noninfectious counterparts. This approach enhances diagnostic accuracy, enabling early and reliable detection crucial for effective disease management. By distinguishing infectious from noninfectious PRRSV, this technology supports timely intervention strategies, strengthening biosecurity measures and reducing the economic burden on the swine industry.Materials and Methods

[0286] DNA Library: DNA sequences, including the random single-stranded DNA (ssDNA) libraries, primers, and oligonucleotides, were synthesized and desalted by Integrated DNA Technologies (IDT). The random ssDNA libraries, along with the forward and reverse primers, were further purified by polyacrylamide gel electrophoresis to ensure high-quality preparation.

[0287] The ssDNA library featured a 45 -nucleotide randomized central region flanked by constant sequences at the 3' and 5' ends, which served as primer-binding sites for amplification (TABLE 4). For the in vitro selection process, the reverse primer was modified with biotin to facilitate the separation of ssDNA from amplified double-stranded PCR products using streptavidin-coated magnetic beads. In contrast, unmodified forward and reverse primers were employed during PCR amplification for the final selection round, high-throughput sequencing (UTS) library preparation, and quantitative PCR (qPCR) quantification.

[0288] To ensure proper folding, the ssDNA library and pools were denatured at 95°C for 15 minutes, followed by immediate cooling on ice for 15 minutes prior to use in each round of the selection process.

[0289] PRRSV and PEDV propagation: MARC- 145 cells were cultured in Minimum Essential Medium (MEM; Gibco / Thernio Fisher Scientific, Waltham, MA, USA) supplemented with 8% fetal bovine serum (FBS; Sigma, Burlington, MA, USA) and antibiotics (lOO pg / mL streptomycin, lOO U / mL penicillin) at 37°C in a humidified atmosphere with 5% CO2.

[0290] For virus propagation, MARC-145 cells were seeded at varying densities and inoculated with porcine reproductive and respiratory syndrome virus (PRRSV) or porcine epidemic diarrhea virus (PEDV) stocks at a multiplicity of infection (MOI) of 0.08. The inoculation was carried out for 2 hours, after which the cells were washed with serum-free Dulbecco’s Modified Eagle Medium (DMEM) to remove unbound virus. The cells were then maintained in DMEM containing 2% horse serum (Hyclone) to support virus replication.

[0291] At designated time points post-infection, the culture supernatants containing replicated virus particles were harvested for downstream analysis.

[0292] 50% Cell Culture Infectious Dose (TCID 50) Assay: MARC-145 cells were seeded into clear 96-well plates at a density of 104cells per well in 100 pl of Minimum Essential Medium (MEM) supplemented with 10% fetal bovine serum (FBS). Cells were seeded into all wells except column 10, which was left empty to spatially separate infected wells fromuninfected wells. After a 12-hour incubation at 37°C with 5% CO2, serial 10-fold dilutions of virus (from 10-1to IO-9) were prepared, each containing 5% trypsin.

[0293] The cell supernatants were discarded, andlOO pl of each virus dilution was added to columns 1 through 9, corresponding to dilutions 10”1to 10”9, respectively. Pipette tips were changed between columns to avoid cross-contamination. Columns 11 and 12 were filled with medium only and served as negative controls. The plates were then incubated at 37°C with 5% CO2 for 6 days. On the 6th day, the supernatants were removed, and cells were fixed at room temperature for 15 minutes. Cytopathic effects (CPE) in the wells were assessed using immunofluorescence assay (IFA) methods, and the number of wells exhibiting CPE was recorded. A Reed and Muench calculation was then performed to determine the 50% tissue culture infective dose (TCID50), which was then presented as TCIDso / ml.1

[0294] Inactivation of PRRSV and PEDV — BEI Treatment: PRRSV was inactivated using the binary ethyleneimine (BET) method.2Virus stock was prepared by harvesting the cell culture supernatant from virus-infected MARC- 145 cells. The harvested supernatant was concentrated using Macrosep Advance Centrifugal Devices (Pall, Westborough, MA, USA) and Minimum Essential Medium (MEM) to achieve a titer of 108TCIDso / ml.

[0295] A 0.1 M BEI stock was prepared by dissolving 2 -bromoethylamine (Sigma, Burlington, MA, USA) in 0.175 M sodium hydroxide (NaOH; Thermo Fisher Scientific, Waltham, MA, USA) at 37°C for 1 hour. The stock solution was stored at 4°C until use. For virus inactivation, 10 mL of the virus suspension with 1 mM BEI at 37°C for 24 hours with gently stirring. Residual BEI was neutralized by incubation by adding 0.1 mM sodium thiosulphate (Sigma, Burlington, MA, USA) and incubating at 37 °C for 2 hours. To confirm complete inactivation, the treated virus was inoculated onto MARC-145 cells, and the absence of infectivity was verified.

[0296] Removal of BEI from PRRSV and PEDV’s BEI Treatment Samples: To concentrate the inactivated virus, 300 pL of the vims stock was applied to an Amicon Ultra-0.5 100-kDa centrifugal filter. The filter was centrifuged at 14,000 x g for 10 minutes. The vims was then washed twice with 300 uL of SELEX buffer by centrifuging the filter after each wash. After washing, the Amicon filter was inverted into a clean collection tube and centrifuged for an additional 5 minutes to recover the concentrated virus.

[0297] Filtration of PRRSV and PEDV’s from Cellular Proteins and other Components: To concentrate the inactivated virus, 300 pL of the vims stock was applied to an Amicon Ultra-0.5 100-kDa centrifugal filter. The filter was centrifuged at 14,000 x g for 10 minutes. The vims was then washed twice with 300 pL of SELEX buffer by centrifuging thefilter after each wash. After washing, the Amicon filter was inverted into a clean collection tube and centrifuged for an additional 5 minutes to recover the concentrated virus.

[0298] In vitro Selection of the Virus-specific Aptamers:

[0299] First Round of In vitro Selection: The in vitro selection followed methods described in Peinetti, A. S. et al. (Direct Detection of Human Adenovirus or SARS-CoV-2 with Ability to Inform Infectivity Using DNA Aptamer-Nanopore Sensors. Sci. Adv. 2021, 7 (39), eabh2848). The heat-denatured ssDNA library (1 nmol) was mixed with 50 pl of infectious PRRSV virus (1 x 106TCIDso / ml) in a total volume of 250 pl of SELEX buffer [lx PBS, with 2.5 mM MgCh and 0.5 mM CaCh (pH 7.4)] and incubated with gentle agitation for 2 hours at room temperature. Then, the unbound sequences were removed using an Amicon Ultra-0.5 100-kDa filter, followed by washing three times with 300 pl of SELEX buffer to ensure removal of all unbound sequences. To elute the bound sequences, the filter containing the virus and bound sequences was heated for 1 minutes at 95°C in the presence of 8 M urea and then centrifuged, collecting the fraction that flowed through the filter in a new tube. Then, to concentrate and desalt the DNA, an Amicon Ultra-0.5 10-kDa filter was used and washed two times with SELEX buffer (300 pl each time). 1 pl of the eluted single stranded DNA (ssDNA) was used to quantify the amount of DNA by qPCR, and the remaining pool was used as a template for amplification of bound sequences by PCR (30 cycles of 1 minutes at 95 °C, 30 seconds at 52°C, 1 minutes at 72°C, followed by 10 minutes at 72°C) to obtain the dsDNA pool. The PCR was carried out in a total volume of 50 pl with the reverse primer labeled with a biotin, using a GoTaq Flexi DNA polymerase (Promega). Last, ssDNA was recovered by streptavidin -coated magnetic beads. 1 pl of the recovered ssDNA to quantify the amount of DNA by qPCR, and the remaining DNA was used for the following round.

[0300] Second to Last Round of In vitro Selection: Enriched pools (200 pmol) were heat- denatured as described before and mixed with 50 pl of noninfectious PRRSV virus (l x 105TClDso / ml) in a total volume of 100 pl of SELEX buffer as the counterselection step. After incubation for 1 hour at room temperature, the unbound sequences were recovered using an Amicon Ultra-0.5 100-kDa cutoff and washed two times with 100 pl of SELEX buffer. The study collected the unbound sequences that flowed through the filter and incubated them with 50 pl of infectious virus (1 x 106TCIDso / ml) in a total volume of 350 pl as the positive selection step. From here, the protocol is the same as for round 1 for sequence elution, desalting, and PCR amplification. PCR amplification was optimized for each round.

[0301] All Amicon Ultra-0.5 filters were treated with 1 mM T20 for 30 minutes to avoid nonspecific adsorption of the library and pool sequences on the filter, followed by washing forthree times with SELEX buffer. A new PCR using unlabeled primers was performed to prepare the pools for HTS.

[0302] In vitro Selection Monitoring: qPCR was employed to monitor the SELEX process in two ways: (i) to assess the enrichment of the pools (elution yield) using absolute quantification and (ii) to evaluate the sequence diversity of the pools (convergence of aptamer species) by analyzing the melting curve.4Real-time PCR was conducted using the CFX96 Real-Time PCR System (Bio-Rad) following the manufacturer’s instructions.

[0303] Each reaction was carried out in a 10 pL volume in 96-well PCR plates. The standard qPCR mixture included 5 gL of SsoFast EvaGreen Supermix (Bio-Rad), 0.5 iiL of each 10 pM unlabeled primer, and 4 pL of DNA template dilution. The thermal cycling conditions included an initial denaturation at 98°C for 2. minutes, followed by 40 cycles of denaturation at 98°C for 5 seconds and annealing / extension at 52°C for 10 seconds. After amplification, melting curve analysis was performed from 40°C to 90°C. Threshold cycle (Ct) values were determined using automated threshold analysis.

[0304] HTS of Selection Rounds: High-throughput sequencing (HTS) was conducted on an Illumina HiSeq 4000 platform, with library preparation using the Celero DNA-Seq Kit (Nugen / Tecan), which incorporates unique dual indexes for the simultaneous analysis of multiple rounds in a single lane. For the infectious PRRSV-specific aptamers against BEI-inactivated PRRSV, rounds R2, R3, R4, R5, R6, R7, R8, R9, R10, Rll, R12, R13, R14, and R15 were selected for NGS. The library preparation involved end-repairing fragmented DNA, followed by adaptor ligation and PCR amplification to generate the final libraries. After purification with Agencourt AMPure XP Beads (Beckman Coulter), DNA quantification was performed using a fluorescence-based method (Qubit dsDNA Broad Range kit). Equal amounts of libraries, containing unique indexes, were combined for sequencing. A quality control step, including qPCR quantification and fragment analysis of the DNA (conducted by the Genomic Sequencing and Analysis Facility at UT), was performed before 150-base pair single-end sequencing with 100 million reads.

[0305] After sequencing, the data were demultiplexed, and the HTS results were analyzed using FASTAptamer software.5FA ST' Aptamer-Count was employed to quantify the number of occurrences of each sequence within the population, ranking the sequences by abundance. FASTAptamer-Enrich was used to calculate fold enrichment for sequences present across multiple selection rounds by comparing the reads per million (RPM) of each sequence across rounds.

[0306] Binding Affinity Tests - Enzyme-Linked Oligonucleotide Assay: To evaluate the binding affinity of PRRSV II aptamers toward infectious PRRSV, an Enzyme-Linked Oligonucleotide Assay (ELONA) was conducted. For this, either infectious PEDV (1 x ICF TCIDso / ml), noninfectious PEDV (1 x 105TCIDso / ml), infectious PRRSV (1 x 10° TCIDso / ml), noninfectious PRRSV (1 x 106TCIDso / ml), or SARS-CoV-2 spike protein SI (Invitrogen, aal 1-682) was coated onto individual wells of microplate. The virus or protein was incubated at room temperature for 2 hours to ensure adequate binding to the well surface. Then, the plate was washed with phosphate-buffered saline (PBS) with 0.05% Tween- 203 times.

[0307] Following virus or protein coating, the wells were blocked with 100 pl of 5%’ bovine serum albumin (BSA) in PBS for 1 hour at room temperature to prevent non-specific binding. After blocking, biotin-labeled aptamers were added to the wells at range of concentrations (0.1 to 1000 nM) in the SELEX binding buffer, and the plate was incubated for 1 hour at room temperature. Then, the plate was washed with phosphate-buffered saline (PBS) with 0.05% Tween-203 times.

[0308] To detect aptamer binding, horseradish peroxidase (HRP)-conjugated streptavidin (diluted 1:500) was added to the wells and incubated for 45 minutes. The plate was washed with phosphate-buffered saline (PBS) with 0.05% Tween-20 3 times. The color development step involved adding tetramethylbenzidine (TMB) chromogen substrate, which reacts with the HRP enzyme. The reaction was stopped by adding 2 M II2SO4, and the optical density (OD) at 450 nm was measured using a microplate reader. The resulting absorbance values were used to assess the binding affinity of the aptamers to their respective target viruses or proteins. This method provided a quantitative measure of the interaction between the aptamers and infectious or noninfectious forms of the virus, enabling comparison of the aptamer’s binding specificity and affinity.

[0309] Fluorescence Polarization Binding Assays: Fluorescence polarization was employed to assess the binding affinity of PRRSV aptamer candidates selected from the PRRSV II selection to active PRRSV. The assays were conducted at a concentration of 250 nM FAM-labeled aptamer. For the initial binding interaction assessments, 263.16 nM of each PRRSV aptamer candidate in the SELEX buffer was prepared by annealing the aptamer solution. The annealing process involved heating the aptamer solution to 95°C for 10 minutes, followed by a slow cooling step at room temperature to facilitate proper folding of the aptamer structure.

[0310] For the FP assay, 190 pL of the 263.16 nM annealed aptamer candidate solution was mixed with 10 pL of various concentrations of PRRSV. The vims concentrations were prepared to cover a range of potential binding interactions. The aptamer-virus mixture was incubated at room temperature for 1 hour to allow sufficient rime for the aptamer and vims to interact.

[0311] After incubation, fluorescence polarization measurements were performed using the ISS ChronosDFD fluorometer ( ISS Inc., Champaign, IL, USA) with excitation at 550 nm and emission at 570 nm. For each sample, 10 individual fluorescence polarization measurements were recorded to ensure data reliability. Three biological replicates were conducted for each aptamer-vims interaction to ensure reproducibility and statistical significance.

[0312] Exonuclease Digestion Assays: Exonuclease digestion assay protocol was modified from this paper to suit the experimental conditions for viruses.7For all digestion assays, 1 pl of 50 pM annealed aptamer was mixed with 44 pl of reaction buffer containing the appropriate concentration of 2 x 105TCIDso / ml for each virus in the SELEX buffer. After incubation for one hour at room temperature, 5 pl of 2 U / pl T5 Exonuclease (T5 Exo) was added to the solution. At various time points, 5 pl aliquots of the reaction mixture were collected and immediately mixed with 5 pl of 2x clear loading buffer (9.2 M Urea, 0.001 M H2EDTA, 180 mM Tris, 180 mM boric acid) to quench the reaction. The solutions were frozen at -20°C until preheated to -90°C before loading into the PAGE gel.

[0313] The digestion products were analyzed using 15% denaturing polyacrylamide gel electrophoresis. Separation was performed at 36 for 1.5 hours in lx TBE buffer. Following electrophoresis, the gel was stained with lx SYBR Gold for 10 minutes and imaged.Results and Discussion

[0314] SELEX of Aptamer for Infectious PRRSV II: To identify aptamers that can distinguish between infectious PRRSV and noninfectious PRRSV, SELEX was employed with Beta 45 DNA pool on filtered PRRSV II vims (1 x 106TCIDso / ml) and in the third-round binary ethyleneimine (BEI) inactivated PRRSV II vims (l x 105TCIDso / ml) was incorporated into the SELEX process (FIG. 13A and FIG. 5A). There was a slight decrease in elution yield from -0.25 % to -0.1% when incorporating negative selection in round 3 (FIG.13B). However, there is an increase in elution yield until round 10 (yellow) where there is a plateau in elution yield. This sign is indicative of an enrichment of DNA sequences. There is shift in melting temperature from 68°C to 82°C for the initial input DNA for each round which is indicative by the change of intensities of each peak at each round (FIG. 13C). There is shift in meltingtemperature from 68°C to 72°C to 72°C for the DNA that binds to the virus for each round (FIG. 13D). Due to the plateau of DNA elution and shift in melting temperatures, the SELEX pools were sequenced via Next Generation Sequencing (NGS).

[0315] NGS Analysis of SELEX: The NGS data was analyzed using the FASTAptamer bioinformatics tool, which is specifically designed for analyzing large datasets of sequences, such as those generated during aptamer selection experiments. FASTAptamer works by¬ identifying and quantifying unique sequences, while allowing tracking of changes in sequence prevalence across different rounds of selection. In this study, sequences lacking the forward primer, reverse primer, and the random 45-nucleotide region were removed, leaving only those suitable for analysis. TABLE 7 shows the total number of sequences retained after each selection round of PRRSV selection. Across all rounds, a total of 12,826 unique sequences met the primer recognition criteria. Early rounds, such as round 2, retained fewer sequences (1,359), while later rounds, from round 9 through 15, had approximately 2,500 sequences each. Byround 8, the number of sequences leveled off, indicating that the selection process had stabilized. Diversity trends showed that earlier rounds had more new and unique sequences. For instance, round 5 introduced 1,543 new sequences, reflecting high variation at that stage of PRRSV selection. In contrast, by round 9, only 90 new sequences were identified, suggesting a significant drop in diversity.

[0316] Similarly, FIGS. I5A-15D compares the percentage of recurring sequences and new unique sequences per round in PRRSV selection compared to all NGS sequences sequenced. The graphs demonstrate a plateau around round 9, where the introduction of new sequences slowed significantly. This indicates that branching the selection process at earlier rounds might have been more effective. The decrease in new sequences suggests that the selection reached a point of convergence, where the sequence pool became highly enriched with high-affinity binders. This convergence in both the total number of sequences and the introduction of new unique sequences suggests that selection pressure was effective, but earlier brandling may have allowed for greater diversity and higher-affinity binders to emerge earlier in the process.

[0317] To gain insights into the dynamics of sequence diversity throughout the selection process, it was important to analyze the relationship between unique sequences and overall sequence abundance. Therefore, the Reads Per Million (RPM) for unique sequences was compared to the total RPM for each round of PRRSV selection, as illustrated in FIGS. 16A-16B. The analysis revealed that most of the RPM in the early rounds of selection (specifically rounds 3, 5, and 6) was associated with the introduction of unique sequences. In contrast, laterrounds primarily exhibited RPM linked to sequences that had already been identified in prior rounds. Interestingly, there was an increase in RPM for unique sequences during the later rounds (14 and 15). This uptick suggests the possibility of contamination or the emergence of new diversity within this selection process. These findings highlight the dynamic nature of sequence diversity in the NGS process and suggest that the selection strategy may influence the introduction and retention of unique sequences over time.

[0318] Comparing fold-enrichment and percent abundance provides complementary insights into the sample dynamics. While fold-enrichment highlights which sequences are favored during selection, percent abundance reveals whether those sequences remain dominant within the overall pool. Thus, this bioinformatics approach was applied to the NGS sequencing results for selection analysis, with each unique sequence assigned an identifier starting with " A." FIGS. 17A-17R illustrates the comparison of enrichment fold versus percent abundance across PRRSV selection rounds, along with the identifiers of sequences showing the highest abundance and enrichment values. Notably, early rounds (2 through 4) showed fewer sequences with high percent abundance or enrichment. In round 7, sequences A1667 and A807 exhibited fold-enrichment values exceeding 100 and more than 2% abundance, highlighting their significance in that pool. In round 10, sequences A1245 and Al 122 showed fold¬ enrichment values greater than 18 and over 1.9% abundance, indicating continued selection success. Interestingly, the comparison between rounds 6 and 7 yielded the most significant enrichment, with some sequences, such as A5355, A53, and A1024, displaying foldenrichment values greater than 40. TABLE 8 shows the 69 sequences correlated to these identifiers. TABLE 9 provides an overview of the final aptamer candidates, including their identifier names, the rounds in which they demonstrated high abundance, and the rounds where they exhibited a high enrichment fold. In addition, analysis of sequences in each candidate’s cluster in round 15 was conducted (TABLE 11, TABLE 12, TABLE 13, TABLE 14, TABLE 15, TABLE 16, TABLE 17, TABLE 18, TABLE 19).

[0319] The secondary structure predictions for the 11 aptamer candidates from the PRRSV II selection process were generated using mFold under the same conditions as the initial selection process (25 °C and 1 mM MgCh), ensuring that the structures are relevant to the conditions in which they were developed (FIG. 18). The analysis revealed that candidates 1 and 8, which are derived from the same cluster, share a similar' secondary structure, suggesting they may have a common structural motif or function. This resemblance could indicate they bind the large; similarly, or that their binding regions are structurally conserved. Candidates 2 and 9, although possessing unique overall secondary structures, displayed two shared motifs,Attorney Docket No. 10046-674W01one at each terminal end of the sequences (5’ and 3’ ends). Tills characteristic suggests these motifs may play a role in binding or folding interactions while allowing for variability in other regions of the aptamer. The presence of these consistent motifs within otherwise distinct structures indicates that, while diverse in structure, they may share common functional elements crucial for binding. Candidates 3 and 11 similarly contain a shared motif at their 5' ends, highlighting another potential structural feature that may contribute to target binding or structural stability. Overall, tliis diversity in secondary structure among the candidates points to a varied pool of aptamers, each potentially interacting with the target in unique ways.

[0320] Screening of Aptamer Candidates: To assess the binding affinity of PRRSV II Aptamer Candidates 1-9 to active PRRSV II, ELONAs were conducted, as shown in FIG. 19. The ELONA results indicate that Candidates 1, 2, 3, 4, 6, and 8 did not produce sigmoidal binding curves, suggesting a lack of specific binding to the target. In contrast, Candidates 5, 7, and 9 displayed varying degrees of sigmoidal binding curves, with Candidate 9 showing the most pronounced sigmoidal profile, suggesting a stronger binding interaction with PRRSV II (FIG. 19). To further quantify binding affinity, dissociation constants K values) were calculated for Candidates 5, 7, and 9 using a one-site specific binding model. Candidate 5 exhibited a Kd of 18.61 nM, suggesting a moderate binding affinity. Candidate 7 displayed a K of 67.11 nM, indicating a somewhat weaker binding compared to Candidate 5. Candidate 9, although showing the best sigmoidal curve in the ELONA assay, had a higher Afj of 110.7 nM. For context, previously reported aptamers show significantly lower Kd values, such as 0.9 nM for the HAdV-Seq4 aptamer specific for infectious human adenovirus and 79 nM for the S ARS2-AR10 aptamer binding to infectious pseudotyped SARS-CoV-2.

[0321] For the initial assessments of binding interactions using fluorescence polarization (FP), aptamer candidates from the PRRSV II selection were evaluated for binding affinity with active PRRSV II using FP assays at 250 nM F AM-labeled concentration, as shown in FIG. 23. Among the tested candidates, candidates 1-4 and 9 did not exhibit binding, showing no significant polarization change and suggesting a lack of strong interaction with active PRRSV II. In contrast, candidates 5, 6, and 7 produced clear binding signals, each displaying a sigmoidal curve typical of specific binding interactions. For candidate 5, a dissociation constant (K ) of 187.3 TCIDso / mL was observed, indicating moderate affinity toward active PRRSV II (FIG. 23). Candidate 7 also showed a substantial binding affinity with a K of 42.67 TCIDso / mL (FIG. 23). The sigmoidal binding curves for candidates 5 and 7 reinforce their potential as aptamers capable of specifically binding to active PRRSV II.Attorney Docket No. 10046-674W01

[0322] Truncation of PRRSV II Aptamer Candidates 5, 6, 7, and 9: Prior studies have shown that truncating aptamers can enhance their binding efficiency by isolating the essential binding region, thereby improving their specificity and affinity for the target. Additionally, truncated aptamers offer practical benefits, as they can be synthesized with higher yields and reduced costs, making them more feasible for large-scale applications.

[0323] To optimize these candidates for PRRSV II, a systematic analysis of truncated variants was conducted. The secondary structures of each truncated aptamer version were predicted using mFold, as illustrated in FIG. 24. For candidate 5, two conserved motifs were identified. The yellow-highlighted motif appeared across several truncated regions, including the full FP-45-RP sequence, FP and 45 regions, 45 and RP regions, and the 45 region alone. This recurring motif suggests a potentially essential structure for target interaction, as it remains present even in truncated forms. Another motif, highlighted in pink, was conserved between the FP, 45 region, and RP, and the FP and 45 region. This motif’s recurrence suggests it may also contribute to maintaining structural elements important for candidate 5’s binding affinity. Candidate 6 displayed a conserved motif, marked in orange, across two truncated regions: FP-45-RP and 45-RP. This motif’s presence in multiple configurations suggests it may play a role in binding, particularly in maintaining structural flexibility while supporting aptamer functionality in truncated forms. For candidate 7, two unique motifs were identified. The green-highlighted motif was present between the FP-45-RP and FP-45 regions, while the purple -highlighted motif was conserved between the FP-45-RP and 45-RP regions. These motifs’ recurrence across different truncated segments implies they could be integral for binding activity and stability, even when the aptamer length is reduced. In candidate 9, the blue -highlighted motif appeared in both the FP-45-RP and FP-45 regions, suggesting this structure may also support effective binding. The motif’s presence in shorter segments further supports the possibility of maintaining binding specificity with truncated forms.

[0324] To assess the binding capability of truncated aptamer candidates 5, 6, 7, and 9 to active PRRSV II, ELONAs were conducted, as shown in FIG. 25. Two truncated forms of candidate 5 were tested: one containing the forward primer (FP) and 45 region, and another with only the 45 region. The FP and 45 region truncation showed a dissociation constant ( a) of 16.44 nM, while the 45 region alone demonstrated a K-< of 100.1 nM, indicating lower affinity. Given its superior binding affinity, the FP and 45 region truncation of candidate 5 was selected for further study. For candidate 6, a single truncation containing the 45 region and reverse primer (RP) was tested, but it did not display significant binding to active PRRSV II. Consequently, candidate 6 was not investigated further. Candidate 7 was tested with twoAttorney Docket No. 10046-674W01truncations: one combining FP and the 45 region, and another with the 45 region and RP. The FP and 45 region truncation showed the highest binding affinity, with a K of 0.59 nM, while the 45 region and RP had a K of 1.29 nM. The stronger binding affinity of the FP and 45 region truncation led to its selection for continued analysis. Finally, candidate 9 was assessed with a single truncation that included the FP and 45 region, which showed a K of 74.88 nM. These results indicate that specific truncations, particularly those involving the FP and 45 region, enhance binding affinity for candidates 5, 7, and 9, making them promising options for further investigation in binding studies with active PRRSV II.

[0325] Selectivity of Candidates 5, 7, and 9: To evaluate the selectivity of truncated aptamer candidates 5, 7, and 9 (all containing the forward primer and 45 region), fluorescence polarization assays were performed using active PRRSV II, inactive PRRSV II, active PRRSV I, and active PEDV, as shown in FIG. 26. Candidate 5 showed binding to active PRRSV II with a d of 17,841 TCIDso / mL and to inactive PRRSV II with a of 55.69 TCIDso / mL, indicating cross-reactivity; however, no binding was observed with active PEDV or active PRRSV I. Candidate 7 exhibited a KA of 374.4 TCIDso / mL for active PRRSV 11, as shown in FIG. 26, indicating a stronger binding affinity compared to candidate 5, but it did not bind to inactive PRRSV II, active PEDV, or active PRRSV I. For candidate 9, binding was detected for both active PRRSV II (K of 84.49 TCIDso / mL) and active PRRSV I KA of 8.319 TCIDso / mL.), suggesting cross-reactivity between these viral strains, while no binding was seen with inactive PRRSV II or active PEDV.

[0326] To determine the selectivity of the PRRSV aptamer candidates, a T5 exonuclease digestion assay was performed using PRRSV aptamer candidate 5 (FP, 45 region), candidate 7 (FP, 45 region), candidate 9 (FP, 45 region), and negative control (NC) scrambled (FP, 45 region), in the presence of 2 xl()5active PRRSV II TCIDso / mL, or 2 xl()5inactive PRRSV II TCIDso / mL, 2 xlO5active PRRSV I TCIDso / mL, or 2 xlO5active PEDV TCIDso / mL. Various time points (8 hours and 16 hours) were used to assess the rate of exonuclease digestion. The rationale for employing multiple time points was to capture the dynamics of the aptamer’s interaction with the viruses and observe the extent of protection offered by binding, which would manifest as resistance to exonuclease digestion.

[0327] FIG. 30A shows the results for candidate 5 (FP, 45 region), where at 16 hours of T5 exonuclease digestion, the aptamer band partially digests into three new bands in lane 8 but forms one lower-migrating band in lane 9, which corresponds to the sample containing active PRRSV II. This suggests that Candidate 5 binds to active PRRSV II, offering partial protection from exonuclease digestion. In contrast, lane 10, which contains inactive PRRSV II, exhibits aAttorney Docket No. 10046-674W01similar pattern to lane 8 but with more intense lower-migrating bands, indicating less protection. Lanes 11 (active PRRS V I) and 12 (active PEDV) show similar degradation paterns to lane 8, further confirming that Candidate 5 is more selective for active PRRSV II than for inactive PRRSV II, active PRRSV I, or active PEDV. These results suggest that the aptamer recognizes and selectively binds to active PRRSV II, making it a potential candidate for further development.

[0328] FIG.30B presents the selectivity of candidate 7 (FP, 45 region) in the exonuclease digestion assay. In the absence of the target, candidate 7 remained intact at both 8 hours (lane 2) and 16 hours (lane 7) of T5 exonuclease digestion. In the presence of inactive PRRSV II, active PRRSV I, and active PEDV, no significant degradation occurred at either 8 hours or 16 hours (lanes 3-8). However, in the presence of active PRRSV II, the aptamer was digested into two lower-mobility bands at both time points, with the bands becoming more intense at 16 hours (lanes 3 and 8). This indicates that while candidate 7 binds to active PRRSV II, it is less prone to exonuclease digestion than candidate 5. The stable structure of candidate 7 in the presence of other virus strains, however, suggests that high stability to exonuclease digestion.

[0329] FIG.30C presents the exonuclease digestion results for candidate 9 (FP, 45 region), where in the absence and presence of active PRRSV II, inactive PRRSV II, active PRRSV I, and active PEDV, the aptamer was exonucleolyticaliy digested at both 8 hours and 16 hours.

[0330] FIG.30D shows the exonuclease digestion assay for the scrambled negative control (NC) (FP, 45 region). In the presence of active PRRSV II, the aptamer was partially digested at 8 hours and completely digested at 16 hours (lanes 4 and 9). In contrast, the negative control remained undigested at both time points in the absence of target (lanes 3 and 8), as well as in the presence of active PRRSV I (lanes 6 and 11) and active PEDV (lanes 7 and 12). The NC was partially digested and formed a lower-migrating band in the presence of inactive PRRSV II (lanes 5 and 10). The fact that the NC was not completely resistant to exonuclease digestion in the presence of active PRRSV II indicates that it is not an ideal negative control. A proper negative control should not interact with the viruses and should show similar exonuclease digestion activity as the aptamer without the target virus present. Overall, the results highlight the selectivity of candidate 5 for active PRRSV II.Conclusions

[0331] In conclusion, the development of DNA aptamers capable of distinguishing between infectious and noninfectious PRRSV represents a significant advancement in swine viral diagnostics. By enabling rapid and accurate on-site detection, this approach addresses the limitations of current methods, reducing the risk of misdiagnosis and uncontrolled outbreaks.Attorney Docket No. 10046-674W01The ability to directly target infectious viruses enhances biosecurity measures, allowing for timely interventions that can mitigate economic losses and improve disease management in the swine industry.EXAMPLE ASPECTS

[0332] Example 1: An aptamer having a nucleic acid sequence comprising about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71, wherein the aptamer binds to porcine reproductive and respiratory syndrome virus (PRRSV) or a fragment thereof.

[0333] Example 2: The aptamer any examples herein, particularly Example 1, wherein the nucleic acid sequence further comprises SEQ ID NO: 2 and / or SEQ ID NO: 3.

[0334] Example 3: The aptamer of any examples herein, particularly Examples 1-2, wherein the nucleic acid sequence comprises SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71 or any one of SEQ ID NOS: 72-83 or SEQ ID NOS: 148-154.

[0335] Example 4: The aptamer of any examples herein, particularly Examples 1-3, wherein the aptamer binds only to infectious PRRSV or a fragment thereof.

[0336] Example 5: The aptamer of any examples herein, particularly Examples 1-4, wherein the aptamer does not bind to non-infection PRRSV or a fragment thereof.

[0337] Example 6: The aptamer of any examples herein, particularly Examples 1-5, wherein the aptamer binds to PRRSV- 1 or a fragment thereof and / or PRRSV-2 or a fragment thereof.

[0338] Example 7: An aptamer having a nucleic acid sequence comprising about 80% similarity or more to any one of SEQ ID NOS: 84-89, wherein the aptamer binds to porcine epidemic diarrhea virus (PEDV) or a fragment thereof.

[0339] Example 8: The aptamer of any examples herein, particularly Example 7, wherein the nucleic acid sequence further comprises SEQ ID NO: 91 and / or SEQ ID NO: 92.

[0340] Example 9: The aptamer any examples herein, particularly Examples 7-8, wherein the aptamer binds only to infectious PEDV or a fragment thereof.

[0341] Example 10: The aptamer of any examples herein, particularly Examples 7-9, wherein the aptamer does not bind to non-infection PEDV or a fragment thereof.

[0342] Example 11: An assay for detecting PRRSV, the assay comprising: a solid support; and a plurality of aptamers coupled to said solid support and having a nucleic acid sequence comprising about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; wherein the aptamers bind to PRRSV or a fragment thereof.

[0343] Example 12: The assay of any examples herein, particularly Example 11, wherein the aptamers comprise the aptamers of any examples herein, particularly Examples 1-6.Attorney Docket No. 10046-674W01

[0344] Example 13: An assay for detecting PEDV, the assay comprising: a solid support; and a plurality of aptamers coupled to said solid support and having a nucleic acid sequence comprising about 80% similarity or more to any one of SEQ ID NOS: 84-89; wherein the aptamers bind to PEDV or a fragment thereof.

[0345] Example 14: The assay any examples herein, particularly Example 13, wherein the aptamers comprise the aptamers of any examples herein, particularly Examples 7-10.

[0346] Example 15: An assay for detecting PRRSV and / or PEDV, the assay comprising: a solid support; and a first plurality of aptamers coupled to said solid support and having a nucleic acid sequence comprising about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; a second plurality of aptamers coupled to said solid support and having a nucleic acid sequence comprising about 80% similarity or more to any one of SEQ ID NOS: 84-89; wherein the first plurality of aptamers bind to PRRSV or a fragment thereof; and wherein the second plurality of aptamers bind to PEDV or a fragment thereof.

[0347] Example 16: The assay any examples herein, particularly Example 15, wherein the first plurality of aptamers comprise the aptamers of any examples herein, particularly Examples 1-6; and wherein the second plurality of aptamers comprise the aptamers of any examples herein, particularly Examples 7-10.

[0348] Example 17: The assay of any examples herein, particularly Examples 11-16, wherein the aptamers are covalently linked to the solid support.

[0349] Example 18: The assay of any examples herein, particularly Examples 11-17, wherein the aptamers are coupled to the solid support via a terminal amino modification.

[0350] Example 19: 'The assay any examples herein, particularly Example 18, wherein the terminal amino modification is on the 3’ end or the 5’ end of each aptamer.

[0351] Example 20: The assay of any examples herein, particularly Examples 11-19, wherein the aptamers are coupled to the solid support via a spacer.

[0352] Example 21: The assay any examples herein, particularly Example 20, wherein the spacer comprises a Ce-Ci2 spacer.

[0353] Example 22: A lateral flow assay comprising the assay of any examples herein, particularly Examples 11-21.

[0354] Example 23: A nanopore biosensor comprising the assay of any examples herein, particularly Examples 11-21, wherein the solid support defines one or more nanopores extending between a first surface of the solid support and a second surface of the solid support.

[0355] Example 24: The nanopore biosensor any examples herein, particularly Example 23, wherein the aptamers are coupled to an inner surface of the one or more nanopores.Attorney Docket No. 10046-674W01

[0356] Example 25: The nanopore biosensor of any examples herein, particularly Examples 23-24, wherein the first surface of the solid support defines a first end of each nanopore and the second surface of the solid support defines a second end of each nanopore.

[0357] Example 26: The nanopore biosensor any examples herein, particularly Example 25, wherein the first end of each nanopore and the second end of each nanopore are circular.

[0358] Example 27: The nanopore biosensor any examples herein, particularly Example 26, wherein the first end of each nanopore has a diameter of from about 800 nm to about 1000 nm; and wherein the second end of each nanopore has a diameter of from about 50 nm to about 60 nm.

[0359] Example 28: The nanopore biosensor of any examples herein, particularly Examples 23-27, wherein the solid support comprises polyethylene terephthalate.

[0360] Example 29: A method of detecting PRRSV in a subject, the method comprising contacting a biological sample from the subject with: i) the aptamer of any examples herein, particularly Examples 1-6; ii) the assay of any examples herein, particularly Examples 11-12 or 17-21 comprising a plurality of aptamers having a nucleic acid sequence comprising about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; iii) the lateral flow assay any examples herein, particularly Example 22 comprising a plurality of aptamers having a nucleic acid sequence comprising about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; or iv) the nanopore biosensor of any examples herein, particularly Examples 23-28 comprising a plurality of aptamers having a nucleic acid sequence comprising about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71.

[0361] Example 30: The method any examples herein, particularly Example 29, wherein the method detects only infectious PRRSV.

[0362] Example 31: The method of any examples herein, particularly Examples 29-30, wherein the method does not detect non-infectious PRRSV.

[0363] Example 32: 'The method of any examples herein, particularly Examples 29-31, wherein the method detects PRRSV-1 and / or PRRSV-2.

[0364] Example 33: A method of detecting PEDV in a subject, the method comprising contacting a biological sample from the subject with: i) the aptamer of any examples herein, particularly Examples 7-10; ii) the assay of any examples herein, particularly Examples 13-14 or 17-21 comprising a plurality of aptamers having a nucleic acid sequence comprising about 80% similarity or more to any one of SEQ ID NOS: 84-89; iii) the lateral flow assay any examples herein, particularly Example 22 comprising a plurality of aptamers having a nucleic acid sequence comprising about 80%’ similarity or more to any one of SEQ ID NOS: 84-89; orAttorney Docket No. 10046-674W01iv) the nanopore biosensor of any examples herein, particularly Examples 23-28 comprising a plurality of aptamers having a nucleic acid sequence comprising about 80% similarity or more to any one of SEQ ID NOS: 84-89.

[0365] Example 34: The method any examples herein, particularly Example 33, wherein the method detects only infectious PEDV.

[0366] Example 35: The method of any examples herein, particularly Examples 34-35, wherein the method does not detect non-infectious PEDV.

[0367] Example 36: A method of detecting PRRSV and / or PEDV in a subject, the method comprising contacting a biological sample from the subject with: i) the aptamer of any examples herein, particularly Examples 1-6 and the aptamer of any examples herein, particularly Examples 7-10; ii) the assay of any examples herein, particularly Examples 15-16 or 17-21 comprising: a first plurality of aptamers having a nucleic acid sequence comprising about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; and a second plurality of aptamers having a nucleic acid sequence comprising about 80% similarity or more to any one of SEQ ID NOS: 84-89; iii) the lateral flow assay any examples herein, particularly Example 22 comprising: a first plurality of aptamers having a nucleic acid sequence comprising about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; and a second plurality of aptamers having a nucleic acid sequence comprising about 80% similarity or more to any one of SEQ ID NOS: 84-89; or iv) the nanopore biosensor of any examples herein, particularly Examples 23-28 comprising: a first plurality of aptamers having a nucleic acid sequence comprising about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71; and a second plurality of aptamers having a nucleic acid sequence comprising about 80% similarity or more to any one of SEQ ID NOS: 84-89.

[0368] Example 37: The method any examples herein, particularly Example 36, wherein the method detects only infectious PRRSV and / or PEDV.

[0369] Example 38: 'The method of any examples herein, particularly Examples 36-37, wherein the method does not detect non-infectious PRRSV and / or PEDV.

[0370] Example 39: The method of any examples herein, particularly Examples 36-38, wherein the method detects PRRSV-1, PRRSV-2, and / or PEDV.

[0371] Example 40: The method of any examples herein, particularly Examples 29-39, wherein the method comprises: a) providing the nanopore biosensor in a reservoir containing a solution; b) measuring a reference current-voltage curve between a first side of the nanopore biosensor and a second side of the nanopore biosensor; c) introducing the biological sample to the first side of the nanopore biosensor; and d) measuring a test current-voltage curve betweenAttorney Docket No. 10046-674W01the first side of the nanopore biosensor and the second side of the nanopore biosensor, thereby determining the presence or absence of virus bound to the aptamers in the nanopore biosensor.

[0372] Example 41: The method any examples herein, particularly Example 40, wherein the first side of the nanopore biosensor comprises the first side of the solid support and the second side of the nanopore biosensor comprises the second side of the solid support.

[0373] Example 42: The method of any examples herein, particularly Examples 40-41, wherein the solution comprises 0.1 M KC1.

[0374] Example 43: The method of any examples herein, particularly Examples 29-42, wherein the biological sample is blood, serum, plasma, bronchoalveolar lavage, a nasopharyngeal swab, an oropharyngeal swab, saliva, sputum, urine, or tears.

[0375] Example 44: The method of any examples herein, particularly Examples 29-43, wherein the subject is porcine.

[0376] The following patents, applications and publications as listed below and throughout this document are hereby incorporated by reference in their entirety herein.Reference ListAdams, M. J. et al. Ratification Vote on Taxonomic Proposals to the International Committee on Taxonomy of Viruses (2016). Arch. Virol. 2016, 161 (10), 2921-2949.Alam, K. K. et al. FASTAptamer: A Bioinfomiatic Toolkit for High-Throughput Sequence Analysis of Combinatorial Selections. Mol. Ther. — Nucleic Acids 2015, 4 (3), e230.Alkhamis, O. et al. Label -Free Profiling of DNA Aptamer-Small Molecule Binding Using T5 Exonuclease. Nucleic Acids Res. 2020, 48 (20), e!20.Alkhamis, O. et al. Using Exonucleases for Aptamer Characterization, Engineering, and Sensing. Acc. Cheni. Res. 2023, 56 (13), 1731-1743.An ias. M.; Wozniakowski, G. Current Status of Porcine Epidemic Diarrhoea (PED) in European Pigs. J. Vet. Res. 2019, 63 (4), 465-470.Apel, P. Y. et al. Fabrication of Nanopores in Polymer Foils with Surfactant-Controlled Longitudinal Profiles. Nanotechnology 2007, 18 (30), 305302.Arevalo-Rodriguez, I. et al. False-Negative Results of Initial RT-PCR Assays for COVID-19: A Systematic Review. PLOS ONE 2020, 1 (12), e0242958.Attorney Docket No. 10046-674WGIBai, C. et al. Aptamer Selection and Application in Multivalent Binding-Based Electrical Impedance Detection of Inactivated H1N1 Virus. Biosens. Bioelectron. 2018, 110 (March), 162-167.Benson, J. E. et al. A Comparison of Virus Isolation, Immunohistochemistry, Fetal Serology, and Reverse-Transcription Polymerase Chain Reaction Assay for the Identification of Porcine Reproductive and Respiratory Syndrome Vi s Transplacental Infection in the Fetus. J. Vet. Diagn. Invest. 2002, 14 (1), 8-14.Boeters, M. et al. The Economic Impact of Endemic Respiratory Disease in Pigs and Related Interventions - a Systematic Review. Pore. Health Manag. 2023, 9 (1), 45.Canoura, J. et al. Accelerating Post-SELEX Aptamer Engineering Using Exonuclease Digestion. J. Am. Chem. Soc. 2021, 143 (2), 805-816.Canoura, J. et al. Determining the Precision of High-Throughput Sequencing and Its Influence on Aptamer Selection. Anal. Chem. 2024, 96 (44), 17720-17729.Canoura, J. et al. No Structure-Switching Required: A Generalizable Exonuclease-Mediated Aptamer-Based Assay for Small-Molecule Detection. J. Am. Chem. Soc. 2018, 140 (31), 9961-9971.Chae, H. et al. Development of a One-Step Reverse Transcription-Quantitative Polymerase Chain Reaction Assay for the Detection of Porcine Reproductive and Respiratory Syndrome Virus. PEGS ONE 2023, 18 (10), e0293042.Chen, C. et al. Development and Validation of Reverse Transcription Loop-Mediated Isothermal Amplification for Detection of PRRSV. Vims Genes 2010, 40 (1), 76-83.Cho, H. J. et al. An ELISA for Porcine Reproductive and Respiratory Syndrome: Production of Antigen of High Quality. Can. J. Vet. Res. 1996, 60 (2), 89-93.Collins, J. E. et al. Isolation of Swine Infertility and Respiratory Syndrome Vims (Isolate ATCC VR-2332) in North America and Experimental Reproduction of the Disease in Gnotobiotic Pigs. J. Vet. Diagn. Investig. Off. Publ. Am. Assoc. Vet. Lab. Diagn. Inc 1992, 4 (2), 117-126.Cornelison, A. S. et al. Impact of Health Challenges on Pig Growth Performance, Carcass Characteristics, and Net Returns under Commercial Conditions. Transl. Anim. Sei. 2018, 2 (1), 50-61.Attorney Docket No. 10046-674W01Cui, X.-Y. et al. Recombinant Characteristics, Pathogenicity, and Viral Shedding of a Novel PRRSV Variant Derived from Twice Inter-Lineage Recombination. Vet. Microbiol. 2022, 271, 109476.Damase, T. R. et al. Application of the Open qPCR Instrument for the in vitro Selection of DNA Aptamers against Epidermal Growth Factor Receptor and Drosophila C Virus. ACS Comb. Sci. 2018, 20 (2), 45-54.Deng, F. et al. Identification and Comparison of Receptor Binding Characteristics of the Spike Protein of Two Porcine Epidemic Diarrhea Virus Strains. Viruses 2016, 8 (3), 55. Dewey, T. M. et al. New Uridine Derivatives for Systematic Evolution of RNA Ligands by Exponential Enrichment. J. Am. Chem. Soc. 1995, 117 (32), 8474-8475.Dhiman, A. et al. Rational Truncation of Aptamer for Cross-Species Application to Detect Krait Envenomation. Sci. Rep. 2018, 8 (1), 17795.Dj, II. et al. Assessment of the Economic Impact of Porcine Reproductive and Respiratory Syndrome Virus on United States Pork Producers. J. Swine Health Prod. 2013, 21 (2), 13. Dokland, T. The Structural Biology of PRRSV. Virus Res. 2010, 154 (1), 86-97.Escudero- Abarca, B. I. et al. Selection, Characterization and Application of Nucleic Acid Aptamers for the Capture and Detection of Human Norovirus Strains. PloS One 2014, 9 (9), 6106805.Feng, R.-M. et al. Advances in Nucleic Acid Aptamer-Based Detection of Respiratory Virus and Bacteria: A Mini Review. Virol. J. 2024, 21 (1), 237.Gerdts, V.; Zakhartchouk, A. Vaccines for Porcine Epidemic Diarrhea Virus and Other Swine Coronaviruses. Vet. Microbiol. 2017, 206, 45- 1.Hafner, M. et al. Displacement of Protein-Bound Aptamers with Small Molecules Screened by Fluorescence Polarization. Nat. Protoc. 2008, 3 (4), 579-587.Hou, X. et al. A Biomimetic Potassium Responsive Nanochannel: G-Quadruplex DNA Conformational Switching in a Synthetic Nanopore. J. Am. Chem. Soc. 2009, 1 1, 7800-7805.Hu, J. et al. Quantifying Aptamer-Protein Binding via Thermo fl uorimetric Analysis. Anal. Methods 2015, 7 (17), 7358-7362.Attorney Docket No. 10046-674W01Ince, B.; Sezginttirk, M. K. Lateral Flow Assays for Viruses Diagnosis: Up-to-Date Technology and Future Prospects. Trends Anal. Chem. 2022, 157, 116725.Ishikawa, K. et al. Direct and Rapid Detection of Porcine Epidemic Diarrhea Virus by RT-PCR. J. Virol. Methods 1997, 69 (1), 191-195.Jameson, D. M.; Ross, J. A. Fluorescence Polarization / Anisotropy in Diagnostics and Imaging. Chem. Rev. 2010, 110 (5), 2685-2708.Jung, K. et al. Porcine Epidemic Diarrhea Virus (PEDV): An LTpdate on Etiology, Transmission, Pathogenesis, and Prevention and Control. Virus Res. 2020, 286, 198045. Kim, S.-H. et al. Development of ssDNA Aptamers for Diagnosis and Inhibition of the Highly Pathogenic Avian Influenza Virus Subtype H5N1. Biomolecules 2020, 10 (8), 1116. Kocherhans, R. et al. Completion of the Porcine Epidemic Diarrhoea Coronavirus (PEDV) Genome Sequence. Virus Genes 2001, 23 (2), 137-144.Kucirka, L. M. et al. Variation in False-Negative Rate of Reverse Transcriptase Polymerase Chain Reaction-Based SARS-CoV-2 Tests by Time Since Exposure, Ann. Intern. Med. 2020, 173 (4), 262-267.Kuitio, C. et al. Development of a Biosensor from Aptamers for Detection of the Porcine Reproductive and Respiratory Syndrome Virus. J. Vet, Sci. 2020, 21 (5), e79.Kuitio, C.; et al. Aptamer-Based QCM-Sensor for Rapid Detection of PRRS Virus.Proceedings 2018, 2 (13), 1038.Lei, C. et al. On the Calculation of TCID50 for Quantitation of Virus Infectivity. Virol. Sin.2021, 36 (1), 141-144.Li, J. et al. Current Status of Vaccines for Porcine Reproductive and Respiratory Syndrome: Interferon Response, Immunological Overview, and Future Prospects. Vaccines 2024, 12 (6), 606.Li, R. et al. Point-of-Care Tests for Rapid Detection of Porcine Epidemic Diarrhea Virus: A Systematic Review and Meta- Analysis. Viruses 2022, 14 (7), 1355.1,1, W. et al. Mass Spectrometry-Based Proteomic Analysis of Potential Host Proteins Interacting with GP5 in PRRSV-Infected PAMs. Int, J. Mol. Sci. 2024, 25 (5), 2778.Attorney Docket No. 10046-674W01Lin, F. et al. PEDV: Insights and Advances into Types, Function, Structure, and Receptor Recognition. Viruses 2022, 14 (8), 1744.Liu, J. et al. A Simple and Sensitive '‘Dipstick” Test in Serum Based on Lateral Flow Separation of Aptamer-Linked Nanostructures. Angew. Chem. Ink Ed. 2006, 45 (47), 7955-7959.Liu, J. et al. Functional Nucleic Acid Sensors. Chem. Rev. 2009, 109 (5), 1948-1998. (51) Loving, C. L. et al. Innate and Adaptive Immunity against Porcine Reproductive and Respiratory Syndrome Virus. Vet. Immunol. Immunopathol. 2015, 167 (1), 1-14.Lu, T. et al. Selection of an Aptamer against Muscovy Duck Parvovirus for Highly Sensitive Rapid Visual Detection by Label-Free Aptasensor. Taianta 2018, 176, 214-220.Lunney, J. K. et al. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV):Pathogenesis and Interaction with the Immune System. Annu. Rev. Anim. Biosci. 2016, 4, 129-154.Luo, H. et al. Research Progress of Porcine Epidemic Diarrhea Virus S Protein. Front.Microbiol. 2024, 15, 1396894.Ma, P. et al. Aptamer Truncation Strategy Assisted by Molecular Docking and Sensitive Detection of T-2 Toxin Using SYBR Green I as a Signal Amplifier. Food Chem. 2022, 381, 132171.Majdinasab, M. et al. Aptamer-Based Lateral Flow Assays: Current Trends in Clinical Diagnostic Rapid Tests. Pharmaceuticals 2022, 15 (1), 90.Montaner-Tarbes, S. et al. Key Gaps in the Knowledge of the Porcine Respiratory Reproductive Syndrome Virus (PRRSV). Front. Vet. Sei. 2019, 6.Morris, G. et al. Review of Livestock Biosecurity Resources and Trainings: Local, State, Federal, and International Organizations. J. Biosaf. Biosecurity 2023, 5 (4), 162-169.Olanratmanee, E. et al. Prevalence of Porcine Reproductive and Respiratory Syndrome Virus Detection in Aborted Fetuses, Mummified Fetuses and Stillborn Piglets Using Quantitative Polymerase Chain Reaction. J. Vet. Med. Sei. 2015, 77 (9), 1071-1077.Opriessnig, T. et al. Future Perspectives on Swine Viral Vaccines: Where Are We Headed? Pore. Health Manag. 2021, 7 (1), 1.Attorney Docket No. 10046-674W01Panyasing, Y. et al. Effective Surveillance for Early Classical Swine Fever Virus Detection Will Utilize Both Virus and Antibody Detection Capabilities. Vet. Microbiol. 2018, 216, 72-78.Pawel, G. T. et al. Binding Affinity Measurements Between DNA Aptamers and Their Virus Targets Using ELONA and MST. Bio-Protoc. 2022, 12 (21), e4548.Peinetti, A. S. et al. Direct Detection of Human Adenovirus or SARS-CoV-2 with Ability to Inform Infectivity Using DNA Aptamer-Nanopore Sensors. Sei. Adv. 2021, 7 (39), eabh2848.Pensaert, M. B.; de Bouck, P. A New Coronavirus-like Particle Associated with Diarrhea in Swine. Arch. Virol. 1978, 58 (3), 243-247.Perez-Mitta, G. et al. Highly Sensitive Biosensing with Solid-State Nanopores Displaying Enzymatically Reconfigurable Rectification Properties. Nano Lett. 2018, 18 (5), 3303-3310. Pittman Ratterree, D. C. et al. The Reproduction Number of Swine Viral Respiratory Diseases: A Systematic Review. Vet. Sei. 2024, 11 (7), 300.Rowland, R. R. R.; Brandariz-Nunez, A. Role of CD 163 in PRRSV Infection. Virology 2024, 600, 110262.Ruan, S. et al. Development and Implementation of a Quadruple RT-qPCR Method for the Identification of Porcine Reproductive and Respiratory Syndrome Virus Strains. Viruses 2023, 15 (9), 1946.Sanchez-Bascones, E. et al. Aptamers against Viruses: Selection Strategies and Bioanalytical Applications. 1’rAC Trends Anal. Chem. 2021, 143, 116349.Schulz, L. L.; Tonsor, G. T. Assessment of the Economic Impacts of Porcine Epidemic Diarrhea Virus in the United States. J. Anim. Sei. 2015, 93 (11), 5111-5118.Sefali, K. et al. Development of DNA Aptamers Using Cell-SELEX. Nat. Protoc. 2010, 5 (6), 1169-1185.Song, D.; Park, B. Porcine Epidemic Diarrhoea Virus: A Comprehensive Review of Molecular Epidemiology, Diagnosis, and Vaccines. Virus Genes 2012, 44 (2), 167-175.Attorney Docket No. 10046-674W01Song, W. et al. Development of a Multiplex Reverse Transcription-Quantitative PCR (qPCR) Method for Detecting Common Causative Agents of Swine Viral Diarrhea in China. Porc. Health Manag. 2024, 10 (1), 12. .Tan, S. et al. Characterization of Emerging Swine Viral Diseases through Oxford Nanopore Sequencing Using Senecavirus A as a Model. Viruses 2020, 12 (10), 1136.Tan, S. et al. Rapid, Unbiased PRRS V Strain Detection Using MinION Direct RNA Sequencing and Bioinformatics Tools. Viruses 2019, 11 (12), 1132.Turlewicz-Podbielska, H.; Pomorska-Mól, M. Porcine Coronaviruses: Overview of the State of the Art. Virol. Sin. 2021, 36 (5), 833-851.VanderWaal, K.; Deen, J. Global Trends in Infectious Diseases of Swine. Proc. Natl. Acad. Sci. 2018, 115 (45), 11495-11500.Vanhee, M. et al. Development of an Experimental Inactivated PRRSV Vaccine That Induces Virus-Neutralizing Antibodies. Vet. Res. 2009, 40 (6), 1-15.Victorious, A. et al. A DNA Barcode-Based Aptasensor Enables Rapid Testing of Porcine Epidemic Diarrhea Viruses in Swine Saliva Using Electrochemical Readout. Angew. Chem. Int. Ed. n / a (n / a).Wang, K. et al. Development of an Indirect ELISA to Detect PEDV Specific IgA Antibody Based on a PEDV Epidemic Strain. BMC Vet. Res. 2022, 18 (1), 319.Wang, R. et al. Identification of Host Cell Proteins That Interact with the M Protein of Porcine Epidemic Diarrhea Virus. Vet. Microbiol. 2020, 246, 108729.Wang, T. et al. Three Decades of Nucleic Acid Aptamer Technologies: Lessons Learned, Progress and Opportunities on Aptamer Development. Biotechnol. Adv. 2019, 37 (1), 28-50. Wang, X. et al. Systematic Truncating of Aptamers to Create High-Performance Graphene Oxide (GO)-Based Aptasensors for the Multiplex Detection of Mycotoxins. Analyst 2019, 144 (12), 3826-3835.Wensvoort, G. et al. Mystery Swine Disease in The Netherlands: The Isolation of Lelystad Virus. Vet. Q. 1991, 13 (3), 121-130.Wood, E. N. An Apparently New Syndrome of Porcine Epidemic Diarrhoea. Vet. Rec. 1977, 100 (12), 243-244.Attorney Docket No. 10046-674W01Xiao, Y. et al. Establishing Broad Generality of DNA Catalysts for Site-Specific Hydrolysis of Single-Stranded DNA. Nucleic Acids Res. 2012, 40 (4), 1778-1786.Yoon, J. et al. A Modified Serum Neutralization Test for the Detection of Antibody to Porcine Reproductive and Respiratory Syndrome Virus in Swine Sera. J. Vet. Diagn. Invest.1994, 6 (3), 289-292.Zhang, J. et al. Integration of Solution-Based Assays onto Lateral Flow Device for One-Step Quantitative Point-of-Care Diagnostics Using Personal Glucose Meter. ACS Sens. 2016, 1 (9), 1091-1096.Zhao, Q. et al. Aptamer Binding Assays and Molecular Interaction Studies Using Fluorescence Anisotropy - A Review. Anal. Chim. Acta 2020, 1125, 267–278.Zhao, Q. et al. Nucleic Acid Aptamers Improving Fluorescence Anisotropy and Fluorescence Polarization Assays for Small Molecules. TrAC Trends Anal. Chem. 2019, 110, 401-409. Zhu, W. et al. Lateral Flow Assay for the Detection of African Swine Fever Virus Antibodies Using Gold Nanoparticle-Labeled Acid-Treated P72. Front. Chem. 2022, 9.Zuker, M. Mfold Web Server for Nucleic Acid Folding and Hybridization Prediction. Nucleic Acids Res. 2003, 31 (13), 3406–3415.

Claims

Attorney Docket No. 10046-674W01CLAIMS1. An aptamer having a nucleic acid sequence comprising about 80% similarity or more to SEQ ID NO: 1 or any one of SEQ ID NOS: 4-71, wherein the aptamer binds to porcine reproductive and respiratory syndrome virus (PRRSV) or a fragment thereof.

2. The aptamer of claim 1, wherein the nucleic acid sequence further comprises SEQ ID NO: 2 and / or SEQ ID NO: 3.

3. The aptamer of claim 1, wherein the aptamer binds only to infectious PRRSV or a fragment thereof.

4. The aptamer of claim 1, wherein the aptamer does not bind to non-infection PRRSV or a fragment thereof.

5. The aptamer of claim 1, wherein the aptamer binds to PRRSV-1 or a fragment thereof and / or PRRSV-2 or a fragment thereof.

6. An assay for detecting PRRSV, the assay comprising:a solid support; anda plurality of aptamers of claim 1 coupled to said solid support;wherein the aptamers bind to PRRSV or a fragment thereof.

7. The assay of claim 6, wherein the aptamers are covalently linked to the solid support.

8. The assay of claim 6, wherein the aptamers are coupled to the solid support via a terminal amino modification.

9. The assay of claim 6, wherein the aptamers are coupled to the solid support via a spacer.

10. The assay of claim 9, wherein the spacer comprises a Ce-Cn spacer.

11. A lateral flow assay comprising the assay of claim 6.Attorney Docket No. 10046-674W0112. A nanopore biosensor comprising the assay of claim 6, wherein the solid support defines one or more nanopores extending between a first surface of the solid support and a second surface of the solid support.

13. The nanopore biosensor of claim 12, wherein the aptamers are coupled to an inner surface of the one or more nanopores.

14. The nanopore biosensor of claim 12, wherein the first surface of the solid support defines a first end of each nanopore and the second surface of the solid support defines a second end of each nanopore.

15. The nanopore biosensor of claim 14, wherein the first end of each nanopore and the second end of each nanopore are circular.

16. The nanopore biosensor of claim 15, wherein the first end of each nanopore has a diameter of from about 800 nm to about 1000 nm; andwherein the second end of each nanopore has a diameter of from about 50 nm to about 60 nm.

17. A method of detecting PRRSV in a subject, the method comprising contacting a biological sample from the subject with the aptamer of claim 1.

18. A method of detecting PRRSV in a subject, the method comprising:a) providing the nanopore biosensor of claim 12 in a reservoir containing a solution; b) measuring a reference current-voltage curve between a first side of the nanopore biosensor and a second side of the nanopore biosensor;c) introducing a biological sample from the subject to the first side of the nanopore biosensor; andd) measuring a test current-voltage curve between the first side of the nanopore biosensor and the second side of the nanopore biosensor, thereby determining the presence or absence of virus bound to the aptamers in the nanopore biosensor.

19. The method of claim 18, wherein the solution comprises 0.1 M KC1.Attorney Docket No. 10046-674W0120. The method of claim 18, wherein the subject is porcine.

Images