Specific aptamer of heterogeneous nuclear ribonucleoprotein hnRNPA2B1 and application thereof
The nucleic acid aptamers screened and modified using SELEX technology have solved the problem of insufficient binding to hnRNPA2B1, enabling efficient detection and functional regulation of hnRNPA2B1, and have significant application potential.
Patent Information
- Application Number
- CN202610257253.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-04
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies lack nucleic acid aptamers capable of specifically binding to and regulating heterogeneous ribonucleoprotein hnRNPA2B1, resulting in limited applications, particularly in the fields of oncology, neurodegenerative diseases, and anti-infection.
Specific nucleic acid aptamers Apt-hnRNPA2B1-1, Apt-hnRNPA2B1-2, and Apt-hnRNPA2B1-3 were screened and chemically modified using SELEX technology. Their binding affinity was verified by combining magnetic bead SELEX technology and biomembrane interference (BLI) technology. Targeted binding ability was analyzed using biotinylated probes.
A nucleic acid aptamer capable of significantly binding to the hnRNPA2B1 protein was obtained, enabling ultrasensitive detection and functional regulation of hnRNPA2B1, with potential applications in targeted cancer therapy, control of neurodegenerative diseases, and anti-infective immune modulation.
Smart Images

Figure CN122104715A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, specifically to a specific nucleic acid aptamer for a heterogeneous nucleoribonucleoprotein hnRNPA2B1 and its applications. Background Technology
[0002] Heterogeneous nuclear ribonucleoproteins A2 / B1 (hnRNPA2 / B1) are abundant in higher eukaryotes and play a wide range of RNA regulatory functions, including splicing, nucleoplasmic transport, transcriptional stability, and translational regulation. They also act as "readers" for N6-methyladenosine (m6A), playing a crucial role in the epitranscriptome regulatory network. In recent years, hnRNPA2 / B1 has also been discovered as a novel pattern recognition receptor in the cytoplasm that recognizes viral double-stranded DNA. During viral infection, it directly binds to viral dsDNA and translocates from the nucleus to the cytoplasm, inducing activation of the type I interferon pathway and exerting antiviral activity.
[0003] Due to its complex functions in multiple key biological processes and its increasingly revealed close associations with human diseases, hnRNPA2 / B1 has become a highly anticipated frontier research topic in the biomedical field. In oncology, hnRNPA2 / B1 is frequently overexpressed in various malignant tumors (such as lung cancer, breast cancer, glioblastoma, and liver cancer), driving malignant tumor progression through multiple mechanisms, including regulating oncogene splicing, enhancing tumor cell invasion and metastasis, promoting tumor angiogenesis, and assisting immune escape. In the field of neurodegenerative diseases, mutations in hnRNPA2 / B1 can enhance pathological phase separation, promoting the transformation of dynamic droplet structures into irreversible protein aggregates. This is directly related to the pathogenesis of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), revealing its important role in the development and progression of these diseases. In the field of anti-infection, hnRNPA2B1 has been identified as a nuclear innate immune recognition receptor that can recognize viral DNA. It then promotes the secretion of type I interferon by polymerizing out of the nucleus and activating the expression of proteins such as cGAS and STING, playing a key role in antiviral immunity. hnRNPA2B1 also participates in the expression regulation of the Il1b gene, thereby enhancing the body's innate antibacterial immunity.
[0004] Given the functional diversity of hnRNPA2B1 in various physiological and pathological processes, precise regulation and detection of its activity are crucial. Currently, nucleic acid aptamers exhibit significant advantages in targeting specific proteins due to their high affinity, high specificity, and ease of engineering modification. Therefore, utilizing the unique structure and function of aptamers to screen for aptamers that can specifically bind to hnRNPA2B1 and effectively detect or intervene in its function has become a highly promising new research strategy. However, current research on aptamer screening for hnRNPA2B1 is very limited, especially lacking reports of aptamers with clear intervention effects on its function. To address this gap, this invention discloses three novel aptamers capable of specifically targeting hnRNPA2B1. Summary of the Invention
[0005] To address the shortcomings of the existing technologies, this invention provides a specific nucleic acid aptamer for hnRNPA2B1, solving the problem of insufficient molecules for direct binding of hnRNPA2B1 and providing the prerequisites for the detection and functional regulation of hnRNPA2B1.
[0006] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides a specific nucleic acid aptamer for heterogeneous nucleoribonucleoprotein hnRNPA2B1, wherein the nucleic acid aptamer is at least one of Apt-hnRNPA2B1-1, Apt-hnRNPA2B1-2, and Apt-hnRNPA2B1-3.
[0007] The sequence of Apt-hnRNPA2B1-1 is as follows: AGCGTCGAATAACCACTACAGTGGGTTGCGGCGAGATTTAAAGTTCGAAGGACCGTATCCGGACTGGTGCTCGAGGTAATC (SEQ ID NO. 4).
[0008] The sequence of Apt-hnRNPA2B1-2 is as follows: AGCGTCGAATACCACTACAGTCGCTTGTCGAGTACTGTGCGAGAGTTTTGCATTTCCCGAGACTGGTGCTCGAGGTAATC (SEQ ID NO. 5).
[0009] The sequence of Apt-hnRNPA2B1-3 is as follows: AGCGTCGAATAACCACTACAGGACACTGGAGCGAGGTACCAACGGTGGGTTTGCGCTGCTCGACTGGTGCTCGAGGTAATC (SEQ ID NO. 6).
[0010] Furthermore, the specific nucleic acid aptamer is chemically modified at the 5' or 3' end with a fluorescent group, thiol group, amino group, biotin, digoxigenin, or polyethylene glycol.
[0011] Furthermore, a specific position on the nucleotide sequence of the described specific nucleic acid aptamer is phosphorylated, oxymethylated, methylated, aminoized, thiolated, or isotopized.
[0012] Furthermore, the specific nucleic acid aptamers were obtained by screening using magnetic bead SELEX technology.
[0013] Secondly, the present invention provides a method for screening the above-mentioned hnRNPA2B1 aptamer, the steps of which include: (1) Design and synthesize an aptamer screening library containing 40 nt random sequences, and synthesize the corresponding forward and reverse primers.
[0014] (2) Perform 12 rounds of screening to obtain the nucleic acid aptamers: Rounds 1-3 only involve positive screening, which involves incubating the initial library with the target protein and then enriching the protein-aptamer complex using magnetic beads. For rounds 4 and above, incubation was first performed using reverse screening magnetic beads, and then the unbound supernatant was collected for positive screening. The incubation time between the protein and the library was shortened to 1 hour. In addition, fetal bovine serum matrix is added during the sixth and subsequent screening processes to intervene in order to exclude low-affinity, low-specificity and unstable sequences and improve the actual binding performance of aptamers.
[0015] (3) After completing 12 rounds of screening, the enriched products were subjected to second-generation sequencing to obtain the sequence information of the enriched aptamers.
[0016] Thirdly, the present invention provides a biotinylated probe of the aptamer and an analysis of the targeting binding ability based on the probe, which can be used in methods for detecting hnRNPA2B1 protein or corresponding detection products, and can also be used in the development of targeted agents. Specifically, it can be made into a molecular probe, used as a detection reagent, or used as a targeted agent for the diagnosis and treatment of hnRNPA2B1 protein-related diseases.
[0017] The binding affinity of any of the specific nucleic acid aptamers for the hnRNPA2B1 protein described herein was determined using biomembrane interferometry (BLI).
[0018] Fourthly, the present invention provides the application of the above-mentioned specific nucleic acid aptamer in the preparation of hnRNPA2B1 protein as a targeting reagent, molecular probe, detection kit, or sensor.
[0019] The binding of any of the specific nucleic acid aptamers for the hnRNPA2B1 protein described in the study was verified using a pull-down assay.
[0020] The beneficial effects of this invention are as follows: Through high-throughput screening based on SELEX technology, and by progressively introducing a serum environment to simulate complex physiological conditions in vivo during the screening process, a nucleic acid aptamer capable of specifically targeting the hnRNPA2B1 protein was successfully obtained. BLI experiments verified that the aptamer has a significant binding affinity to the target protein; pull-down experiments confirmed that the aptamer can effectively bind to and enrich native hnRNPA2B1 protein in cells. These aptamers hold promise for achieving ultrasensitive detection of the hnRNPA2B1 protein through specific binding, or for precisely intervening in or enhancing the biological functions of hnRNPA2B1, showing significant application potential in areas such as targeted cancer therapy, control of neurodegenerative diseases, and anti-infective immune modulation. Attached Figure Description
[0021] Figure 1 This is a flowchart illustrating the nucleic acid aptamer screening method of the present invention; Figure 2 The following are simulation diagrams of the secondary structures of Apt-hnRNPA2B1-1, Apt-hnRNPA2B1-2, and Apt-hnRNPA2B1-3 provided by the present invention; wherein, Figure a is a simulation diagram of the secondary structure of Apt-hnRNPA2B1-1, Figure b is a simulation diagram of the secondary structure of Apt-hnRNPA2B1-2, and Figure c is a simulation diagram of the secondary structure of Apt-hnRNPA2B1-3.
[0022] Figure 3 The secondary structure prediction of Apt-hnRNPA2B1-1 and its affinity analysis for hnRNPA2B1 protein provided for this invention; Figure 4 The secondary structure prediction of Apt-hnRNPA2B1-2 and its affinity analysis for hnRNPA2B1 protein provided for this invention; Figure 5 The secondary structure prediction of Apt-hnRNPA2B1-3 and its affinity analysis for hnRNPA2B1 protein provided for this invention; Figure 6 The pull-down experimental target protein enrichment map of Apt-hnRNPA2B1-1, Apt-hnRNPA2B1-2 and Apt-hnRNPA2B1-3 provided by the present invention. Detailed Implementation
[0023] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. However, the scope of protection of the present invention is not limited to the description, and it should be understood that the present invention can be implemented in various forms and should not be limited to the described embodiments. Rather, these embodiments are provided to provide a more thorough understanding of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without inventive effort are within the scope of protection of the present invention.
[0024] Example 1. Screening of nucleic acid aptamers that specifically bind to hnRNPA2B1 protein The screening process for hnRNPA2B1 protein-specific nucleic acid aptamers is as follows: Figure 1 As shown, it is specifically as follows: (1) Constructing a screening library of random oligonucleotides The design for screening random oligonucleotide libraries is as follows (directions 5'-3'): AGCGTCGAATACCACTACAG-N40-GACTGGTGCTCGAGGTAATC (SEQ ID NO.1) Wherein, “N” represents any base (A, T, C, or G), and N40 represents 40 arbitrary consecutive bases.
[0025] The nucleotide sequence of the forward primer is shown below (direction 5'-3'): AGCGTCGAATACCACTACAG (SEQ ID NO.2).
[0026] The nucleotide sequence of the reverse primer is shown below (direction 5'-3'): P-GATTACCTCGAGCACCAGTC (SEQ ID NO.3).
[0027] (2) Forward screening of hnRNPA2B1 protein-aptamer The initial oligonucleotide library (120 μL, 10 μM) was added to PBS (380 μL) to a total volume of 500 μL, incubated at 95°C for 10 min, on ice for 10 min, and then at room temperature for 10 min. Biotinylated hnRNPA2B1 protein (protein biotinylation reagent: Sulfo-NHS-LC-Biotin sodium, CAS number: 191671-46-2) was added to the library and incubated at room temperature for 2 h. Then, streptavidin-modified magnetic beads (SA-MBs) (50 μg) were added, and the mixture was incubated at room temperature for 1 h. After washing three times with PBS, the mixture was resuspended in 100 μL of PBS. Proteinase K (1.8 μL, 20 mg / mL) was added, and the mixture was incubated at 52°C for 2 h, then at 95°C for 20 min. Magnetic separation was performed, and the supernatant was used as a PCR template.
[0028] (3) Preparation of secondary libraries (3.1) Using the supernatant obtained from magnetic separation in (2) above as a template, prepare a PCR reaction system (50 μL): DNA template (5 μL), forward and reverse primers (5 μL each, 10 μM), 2 × Taq Mix (25 μL), and ddH2O (10 μL). Perform the PCR reaction: pre-denaturation at 95℃ for 10 min, 20 extension cycles (denaturation at 94℃ for 30 s, annealing at 61℃ for 30 s, extension at 72℃ for 30 s), and 72℃ for 5 min; verify the correctness of the bands and the success of the amplification by 3% agarose gel electrophoresis, and then purify the PCR product using the TaKaRaMiniBest DNA fragment purification kit. Measure the concentration of the recovered product.
[0029] (3.2) Preparation and purification of single-stranded DNA: The purified PCR product was treated with λ exonuclease to obtain single-stranded DNA. The operation method is as follows: 10 × reaction buffer and λ exonuclease were added respectively, incubated at 37℃ for 30 min, EDTA was added to a final concentration of 10 mM to terminate the reaction, and the enzyme was inactivated at 95℃ for 5 min to obtain single-stranded DNA.
[0030] (3.3) Ethanol precipitation: Add 1 / 10 volume of 3M sodium acetate (pH 5.2) according to the volume of the DNA solution. Add 2.5 volumes of cold ethanol (-20°C) to the DNA solution. Gently mix the solution and incubate at -20°C for at least 30 min, or overnight. Remove the centrifuge tube from the refrigerator and centrifuge at maximum speed (usually 12,000-16,000 rpm) for 15 min. Carefully remove the supernatant. Add 1 mL of cold 70% ethanol to the centrifuge tube. Gently mix and centrifuge again at maximum speed for 15 min to remove residual salts and impurities. Carefully remove the 70% ethanol, avoiding aspirating the DNA precipitate as much as possible. Invert the centrifuge tube on a clean paper towel and air dry at room temperature for 5-10 min to remove residual ethanol. Be careful not to over-dry. Then add 50-100 μL of sterile water or PBS buffer to dissolve the DNA as a secondary library for the next round of screening.
[0031] (4) Multiple rounds of screening The operations described in (2) and (3) were repeated using the secondary library as the next round of screening, for a total of 12 rounds of screening. To ensure the specificity of the candidate aptamers, starting from the 4th round, the incubation time between the protein and the library was shortened to 1 h to eliminate aptamers with weak affinity, and SA-MBs (50 μg) were added for negative screening to exclude non-specific binding sequences; starting from the 6th round, fetal bovine serum (FBS) was added to the secondary library obtained in (3) to a final concentration of 20% (v / v) to simulate the intracellular environment.
[0032] (5) Analysis of high-throughput sequencing results Based on homology, base number, frequency of occurrence, and free energy, three candidate nucleic acid aptamers for the hnRNPA2B1 protein were screened from the library. The names and nucleotide sequences of these three candidate nucleic acid aptamers are shown below.
[0033] The nucleotide sequence of Apt-hnRNPA2B1-1 is shown below (direction 5'-3'): AGCGTCGAATAACCACTACAGTGGGTTGCGGCGAGATTTAAAGTTCGAAGGACCGTATCCGGACTGGTGCTCGAGGTAATC (SEQ ID NO. 4).
[0034] The nucleotide sequence of Apt-hnRNPA2B1-2 is shown below (direction 5'-3'): AGCGTCGAATACCACTACAGTCGCTTGTCGAGTACTGTGCGAGAGTTTTGCATTTCCCGAGACTGGTGCTCGAGGTAATC (SEQ ID NO. 5).
[0035] The nucleotide sequence of Apt-hnRNPA2B1-3 is shown below (direction 5'-3'): AGCGTCGAATAACCACTACAGGACACTGGAGCGAGGTACCAACGGTGGGTTTGCGCTGCTCGACTGGTGCTCGAGGTAATC (SEQ ID NO. 6).
[0036] The secondary structure of the aptamer was simulated using UNAFold, and the simulation results are as follows: Figure 2 As shown.
[0037] Example 2. Determination of hnRNPA2B1 aptamer affinity based on BLI This invention provides a method for determining the affinity of the hnRNPA2B1 specific aptamer using BLI technology, specifically including the following steps: (1) Protein purification: The heterogeneous ribonucleoprotein hnRNPA2B1 carrying the His tag was purified by nickel column and quantitatively diluted to 200 μM.
[0038] (2) Buffer preparation: PBS buffer (0.01 M pH 7.4): Take one packet of purchased PBS powder, dissolve it in 1 L ddH2O, filter through a 0.45 µm aqueous filter membrane, and degas by sonication before use. PBST buffer (0.01 M pH 7.4): Add 200 μL Tween 20 to 1 L PBS and mix well before use.
[0039] (3) Aptamer pretreatment: 20 μL of biotinylated aptamers (all biotinylated at the 5' end, all sequences were synthesized from Sangon Biotech (Shanghai) Co., Ltd., first prepared as 10 μM, then diluted with PBS to 1 μM) were incubated at 95℃ for 10 min, placed on ice for 10 min, and placed at room temperature for 10 min, and then dissolved in 180 μL PBST (final concentration 100 nM).
[0040] (4) BLI determination of aptamer affinity: First, the streptavidin (SA) sensor was transferred to buffer for baseline equilibration (Baseline 180 s). Then, the biotinylated aptamer was immobilized on the SA sensor surface (Loading 300 s). Next, the sensor was transferred to buffer for baseline equilibration again (Baseline 180 s). After the signal stabilized, the sensor was transferred to a solution containing 200 nM hnRNPA2B1 protein for binding (Association 180 s). Finally, the sensor was transferred to buffer for dissociation (Disassociation 300 s). Real-time binding-dissociation curves were acquired using the instrument, and the affinity K between the aptamer and the protein was calculated based on the kinetic model. D .
[0041] The results are as follows Figure 3-5 As shown, Apt-hnRNPA2B1-1, Apt-hnRNPA2B1-2, and Apt-hnRNPA2B1-3 all exhibit strong affinity for the hnRNPA2B1 protein. D They are 1.329 × 10 -7 M, 1.664 × 10 -7 M and 1.429 × 10 -7 M.
[0042] Example 3. Pull-down assay to determine the targeting enrichment ability of aptamers for native hnRNPA2B1 protein in cells. This invention provides a method for verifying the binding ability of the hnRNPA2B1 aptamer to the native hnRNPA2B1 protein in cells using a pull-down assay, specifically including the following steps: (1) Pretreatment of hnRNPA2B1 specific aptamer: Biotinylated nucleic acid aptamers (all biotinylated at the 5' end, and the sequences were all synthesized from Sangon Biotech (Shanghai) Co., Ltd.) were placed in a 95℃ water bath for 10 min to denature, immediately transferred to an ice bath and allowed to stand for 10 min, and then placed at room temperature for equilibration for 10 min. The working concentration of the aptamer was 10 µM.
[0043] (2) Extraction of total cell protein: HepG2 cells were cultured, lysed and extracted to obtain total cell protein. 600 µg of cell lysate protein was used for each reaction.
[0044] (3) Synthesis of aptamer-modified agarose beads: Take 25 µL of streptavidin agarose beads, add 500 µL of PBS, vortex, centrifuge at 1000 rpm for 1 min, and carefully discard the supernatant. Repeat the washing once and resuspend in 20 µL of PBS; add 25 µL of aptamer and 55 µL of PBS, and incubate at room temperature for 30 min; after incubation, wash the beads 3 times with PBS to remove unbound free aptamers, and resuspend in PBS to 200 μL.
[0045] (4) Specific capture: Add a total of 600 μg of cell lysis protein to aptamer-modified agarose beads and incubate at 37°C for 2 h; after the incubation, centrifuge at 8000 rpm for 1 min, discard the supernatant, and wash 3 times with PBS.
[0046] (5) High-temperature denaturation elution: Add 40 µL of cell lysis buffer and 10 µL of 5 × protein loading buffer, mix well, heat in a boiling water bath for 10 min, and centrifuge to collect the supernatant.
[0047] (6) Western Blot verification of the enrichment of native hnRNPA2B1 in cells: The enriched products were electrophoresed with 10% SDS-PAGE gel, and then the enrichment of hnRNPA2B1 was verified by Western Blot incubation of hnRNPA2B1 antibody.
[0048] The results are as follows Figure 6 As shown, Apt-hnRNPA2B1-1, Apt-hnRNPA2B1-2, and Apt-hnRNPA2B1-3 can all effectively pull down the hnRNPA2B1 protein in cells, indicating that the three aptamers obtained through in vitro screening of recombinant proteins have the ability to bind the native hnRNPA2B1 protein, which is of great value in the application of disease diagnosis targeting this target.
Claims
1. A specific nucleic acid aptamer for a heterogeneous nucleoribonucleoprotein hnRNPA2B1, characterized in that, The nucleotide sequence of the specific nucleic acid aptamer is at least one of SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.
6.
2. The specific nucleic acid aptamer according to claim 1, characterized in that, The specific nucleic acid aptamer is chemically modified at its 5' or 3' end with a fluorescent group, thiol group, amino group, biotin, digoxigenin, or polyethylene glycol.
3. The specific nucleic acid aptamer according to claim 1, characterized in that, The specific nucleic acid aptamer has a nucleotide sequence that is phosphorylated, oxygen-methylated, methylated, aminoized, thiolated, or isotopized at a certain position.
4. The specific nucleic acid aptamer according to claim 1, characterized in that, The specific nucleic acid aptamers were obtained by screening using magnetic bead SELEX technology.
5. The use of the specific nucleic acid aptamer according to any one of claims 1-4 in the preparation of hnRNPA2B1 protein as a targeting reagent, molecular probe, detection kit, or sensor.