Direct in-sample sequencing
Patent Information
- Application Number
- PCT/US2026/015834
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2026-02-04
- Filing Date
- 2026-02-19
- Publication Date
- 2026-08-27
Smart Images

Figure US2026015834_27082026_PF_FP_ABST
Abstract
Description
Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)DIRECT IN-SAMPLE SEQUENCINGCROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to, and benefit of, U. S. Provisional Application Nos.63 / 760,998, filed on February 20, 2025, 63 / 763,017 filed on February 25, 2025, 63 / 802,964 filed on May 9, 2025, 63 / 854,845, filed on July 31, 2025, 63 / 875,656 filed on September 4, 2025, 63 / 880,738, filed on September 12, 2025, 63 / 955,614, filed on January 7, 2026, and 63 / 975,648, filed on February 4, 2026, the contents of each of which are incorporated by reference in their entireties herein.INCORPORATION BY REFERENCE OF SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which has been submitted in XML format via EFS-Web and is hereby incorporated by reference in its entirety. Said XML copy, created on February 17, 2026, is named ELEM-040 001WO SeqList ST26.xml, and is 14,657 bytes in size.BACKGROUND
[0003] Massively parallel sequencing methods have applications in biomedical research and healthcare settings as they allow for analyzing large quantities of nucleic acids with different sequences from biological samples. However, analyzing changes in gene expression and cellular phenotype following disruption of target genes with a single cell resolution remains a challenge. There thus exists a need in the art for improved methods of sequencing target polynucleotides within cells, and visualizing morphology, protein, RNA or lipid expression of cells, with single cell resolution.SUMMARY
[0004] The disclosure provides a method for conducting direct in-sample sequencing comprising: (a) providing a cellular sample on a support, wherein the cellular sample comprises a plurality of target polynucleotide molecules located at one or more spatial positions inside the cellular sample; (b) contacting the cellular sample with a plurality of nucleic acid primers, individual nucleic acid primers comprising (i) a 5’ region comprising at least one universal adaptor sequence and (ii) a 3’ region comprising a sequence that isAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)complementary to at least a portion of an individual target polynucleotide molecule, wherein the contacting is conducted under a condition suitable for moving the plurality of nucleic acid primers into the cellular sample and binding individual nucleic acid primers to at least a portion of an individual target polynucleotide molecule, thereby generating a plurality of target-primer duplexes; (c) conducting a polymerization reaction to synthesize complementary DNA (cDNA) by extending the plurality of nucleic acid primers, thereby generating a plurality of primer-cDNA molecules bound to individual target polynucleotide molecules; (d) contacting the plurality of primer-cDNA molecules with a modifying reagent that appends at least one universal adaptor sequence to 3’ ends of individual primer-cDNA molecules, thereby generating a plurality of linear cDNA library molecules comprising a 5’ universal adaptor sequence, a cDNA sequence complementary to the individual target polynucleotide molecule, and a 3’ universal adaptor sequence; (e) contacting the plurality of linear cDNA library molecules with a plurality of circularization primers under a condition suitable for generating a plurality of open circle cDNA library molecules, individual open circle cDNA library molecules having a gap or nick; (f) generating a plurality of covalently closed circular cDNA library molecules by enzymatically closing the gap or nick; (g) contacting the plurality of covalently closed circular cDNA library molecules with a rolling circle amplification reagent under a condition suitable for generating a plurality of concatemer template molecules inside the cellular sample; and (h) contacting the plurality of concatemer template molecules with a sequencing reagent and conducting at least two sequencing cycles inside the cellular sample.
[0005] In some embodiments, the target polynucleotide molecules comprise RNA and the polymerization reaction comprises a reverse transcription reaction.
[0006] In some embodiments, the method comprises (i) determining the one or more spatial positions of the plurality of target polynucleotide molecules inside the cellular sample from the at least two sequencing cycles.
[0007] In some embodiments, the sequencing reagent comprises a plurality of universal sequencing primers, a plurality of sequencing polymerases, and plurality of nucleotide reagents.
[0008] In some embodiments, conducting the at least two sequencing cycles comprises generating a plurality of sequencing read products. In some embodiments, the plurality of sequencing read products correspond to the plurality of target polynucleotide molecules. In some embodiments, the plurality of sequencing read products are detected by imaging.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0009] In some embodiments, the cellular sample remains positioned on the same support throughout steps (a) - (h).
[0010] In some embodiments, the plurality of target polynucleotides comprise a plurality of target DNA molecules and / or a plurality of target RNA molecules.
[0011] In some embodiments, 5’ regions of the nucleic acid primers comprise at least one universal adaptor or more identification tag sequences.
[0012] In some embodiments, the plurality of target polynucleotide molecules comprises a plurality of polynucleotides comprising a same sequence. In some embodiments, the plurality of target polynucleotide molecules comprises a first plurality of polynucleotides comprising a first sequence and second plurality of polynucleotides comprising a second sequence that is not the same as the first sequence.
[0013] In some embodiments, the plurality of target polynucleotide molecules comprise one or more RNAs encoded by a gene of cells of the cellular sample.
[0014] In some embodiments, the plurality of target polynucleotide molecules comprise a perturbation polynucleotide that perturbs expression of one or more genes of cells in the cellular sample. In some embodiments, the perturbation polynucleotide comprises a CRISPR-Cas guide RNA (gRNA), a small interfering RNA (siRNA), an antisense RNA (asRNA), a short hairpin RNA (shRNA) or a microRNA. In some embodiments, the CRISPR-Cas gRNA comprises a gRNA for a Class 2 Type II or a Class 2 Type V CRISPR-Cas system. In some embodiments, the Class 2 Type II CRISPR system comprises Cas9. In some embodiments, the Class 2 Type V CRISPR system comprises Cpfl (Casl2a), CasX (Cas12e), CasY (Cas12e), Cas, CasLambda or Cas12f.
[0015] In some embodiments, the gRNA comprises a scaffold sequence and a target specific spacer sequence, wherein the target specific spacer sequence is complementary to a sequence of a gene of cells of the cellular sample.
[0016] In some embodiments, individual open circle cDNA library molecules comprise (1) the 5' portion of an individual circularization primer hybridized to a 5’ end portion of a linear cDNA library molecule, (2) a 3’ portion of the circularization primer hybridized to a 3’ end portion of the linear cDNA library molecule, and (3) the gap or nick between the 5’ and 3’ ends of the linear cDNA library molecule.
[0017] The disclosure provides a method for evaluating a cellular sample, comprising: (a) generating a cellular sample comprising a plurality of genetically perturbed cells, wherein individual cells in the plurality comprise a plurality of perturbation polynucleotides comprising a sequencing primer binding sequence and a reverse transcription primer bindingAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)sequence, and wherein the cellular sample is on a support; (b) challenging the cellular sample to induce a morphological change, a physiological change, or a change in gene expression in the plurality of genetically perturbed cells; (c) observing the morphological change, physiological change or change in gene expression; (d) contacting the cellular sample with a fixation reagent and a permeabilization reagent under a condition suitable for generating a plurality of fixed and permeabilized genetically perturbed cells; (e) generating perturbation polynucleotide-primer duplexes by contacting the plurality of perturbation polynucleotides inside the cellular sample with a plurality of nucleic acid primers, wherein individual nucleic acid primers comprise (i) a 5’ region comprising at least one universal adaptor sequence and (ii) a 3’ region comprising a target-specific sequence that is complementary to at least a portion of the reverse transcription primer binding sequence; (f) conducting a polymerization reaction to synthesize complementary DNA (cDNA) by extending the plurality of nucleic acid primers, thereby generating a plurality of primer-cDNA molecules bound to individual perturbation polynucleotides; (g) generating a plurality of linear cDNA library molecules by contacting the plurality of primer-cDNA molecules inside the cellular sample with a modifying reagent that appends at least one universal adaptor sequence to 3’ ends of individual primer-cDNA molecules, thereby generating a plurality of linear cDNA library molecules comprising a 5’ universal adaptor sequence, a cDNA sequence complementary to the perturbation polynucleotide, and a 3’ universal adaptor sequence; (h) contacting the plurality of linear cDNA library molecules with a plurality of circularization primers, thereby generating a plurality of open circle cDNA library' molecules, individual open circle cDNA library molecules having a gap or nick; (i) generating a plurality of covalently closed circular cDNA library molecules by enzymatically closing the gap or nick; (j) generating a plurality of concatemer template molecules by contacting the plurality of covalently closed circular cDNA library molecules with a rolling circle amplification reagent under a condition suitable for conducting a rolling circle amplification reaction comprising initiating synthesis of DNA from the 3’ end of the circularization oligonucleotide and employing one of the covalently closed circular cDNA library molecules as a template molecule; and (k) sequencing the plurality of concatemer template molecules by contacting the plurality of concatemer template molecules with a sequencing reagent under a condition suitable for conducting at least two sequencing cycles inside the cellular sample, thereby generating a plurality of sequencing read products.
[0018] In some embodiments, the perturbation polynucleotide comprises RNA, and the polymerization reaction comprises a reverse transcription reaction.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0019] In some embodiments, the method comprises identifying the perturbation polynucleotide from the at least two sequencing cycles inside the cellular sample.
[0020] In some embodiments, the 5’ region of the individual nucleic acid primer comprising the at least one universal adaptor sequence comprises one or more identification tag sequences.
[0021] In some embodiments, the method comprises, after step (e), contacting the plurality of perturbation polynucleotides with a plurality of blocking oligonucleotides. In some embodiments, individual blocking oligonucleotides comprise a single-stranded oligonucleotide having a sequence that can hybridize to one of the perturbation polynucleotides at a position that is located 5’ relative to the hybridization position of one of the nucleic acid primers, and individual blocking oligonucleotides comprise a terminal 3’ moiety that is non-extendible.
[0022] In some embodiments, individual perturbation polynucleotides comprise a sequence complementary to a target RNA, or a target genomic region comprising a gene encoding the target RNA.
[0023] In some embodiments, individual perturbation polynucleotides comprise a CRISPR-Cas guide RNA (gRNA), a small interfering RNA (siRNA), an antisense RNA (asRNA), a short hairpin RNA (shRNA) or a microRNA. In some embodiments, the CRISPR-Cas gRNA comprises a gRNA for a Class 2 Type II or a Class 2 Type V CRISPR-Cas system. In some embodiments, the Class 2 Type II CRISPR system comprises Cas9. In some embodiments, the Class 2 Type V CRISPR system comprises Cpfl (Casl2a), CasX (Cas12e), CasY (Cas12e), Cas, CasLambda or Cas12f.
[0024] In some embodiments, the genetically perturbed cells express a catalytically active CRISPR-Cas protein that induces a single- stranded or double-stranded break at a target gene.
[0025] In some embodiments, the genetically perturbed cells express a catalytically inactive CRISPR-Cas protein (dCas) fused to a transcriptional repressor domain, that represses expression of a target gene.
[0026] In some embodiments, the genetically perturbed cells express a catalytically inactive CRISPR-Cas protein (dCas) fused to a transcriptional activator domain, that activates expression of a target gene.
[0027] In some embodiments, the CRISPR-Cas gRNA comprises (i) a target-specific spacer sequence, (ii) the sequencing primer binding sequence, (iii) a scaffold sequence, and (iv) the reverse transcription primer binding sequence. In some embodiments, the sequencing primer binding sequence is adjacent to the target-specific spacer sequence.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0028] In some embodiments, individual genetically perturbed ceils in the plurality comprises a CRISPR gRNA inserted into a genomic region of a genome of the individual genetically perturbed cell.
[0029] In some embodiments, the genetically perturbed cells exhibit a morphological change compared to a non-perturbed cell that lacks the perturbation polynucleotide.
[0030] In some embodiments, single genetically perturbed cells are not separated from the plurality of genetically perturbed cells on the support, and wherein single genetically perturbed cells are not partitioned into separate compartments on the support.
[0031] In some embodiments, the challenge condition comprises a temperature change, a pH change, light exposure, a dark condition, a nutrient deprivation, a nutrient addition, a toxin exposure, a chemical compound exposure and / or a drug exposure.
[0032] In some embodiments, the morphological change, physiological change or change in gene expression comprises a change in cell size, a change in cell shape, a change in nuclear size, a change in the cellular location of a protein-of-interest, a change in intracellular protein-protein interaction, a change in gene expression, a change in the presence or absence of a cell surface protein, a change in the structure or arrangement of organelles including mitochondria and / or a change in cell motility.
[0033] In some embodiments, individual open circle cDNA library molecules comprise (1) a 5’ portion of an individual circularization primer hybridized to a 5’ end portion of a linear cDNA library molecule, (2) a 3’ portion of the individual circularization primer hybridized to a 3’ end portion of the linear cDNA library molecule, and (3) the gap or nick between the 5’ and 3’ ends of the linear cDNA library molecule.
[0034] In some embodiments, the perturbation polynucleotide comprises a gRNA, and individual covalently closed circular cDNA library molecules comprise: (i) a sequence for binding a reverse transcription primer; (ii) a scaffold sequence; (iii) a universal sequence for binding a sequencing primer; (iv) a target- specific spacer sequence; and (v) the at least one universal adaptor sequence from the modifying reagent, and wherein the universal sequence for binding a sequencing primer is adjacent to the target-specific spacer sequence.
[0035] In some embodiments, the sequencing comprises sequencing the target-specific spacer region, thereby identifying the genomic target region of the genetically perturbed cells.
[0036] In some embodiments, the cellular sample remains on the same support throughout steps (a) - (k).
[0037] In some embodiments, the sequencing of step (k) identifies individual target genomic regions of individual genetically perturbed cells, and the individual target genomicAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO) with phenotypic exhibited by individual genetically perturbed cells when the plurality of genetically perturbed cells are challenged.
[0038] In some embodiments, the sequencing of step (k) comprises contacting the plurality of concatemer template molecules with a sequencing reagent and conducting at least two sequencing cycles inside the cellular sample. In some embodiments, the sequencing reagent comprises a plurality of sequencing primers, a plurality of sequencing polymerases, a plurality of labeled multivalent molecules and a plurality of non-labeled nucleotides. In some embodiments, individual multivalent molecules comprise a core attached to multiple polymer arms. In some embodiments, individual polymer arms comprise a nucleotide moiety.
[0039] In some embodiments, conducting the at least two sequencing cycles comprises: (a) contacting a first plurality of polymerases to (i) the plurality of concatemer template molecules and (ii) a plurality of sequencing primers, wherein the contacting is conducted under a condition suitable to bind the first plurality of polymerases to the plurality of concatemer template molecules and the plurality of sequencing primers, thereby forming a first plurality of complexed polymerases each comprising a polymerase bound to a nucleic acid duplex, wherein the nucleic acid duplex comprises a concatemer template molecule hybridized to a sequencing primer; (b) contacting the first plurality of complexed polymerases with a plurality of multivalent molecules to form a plurality of multivalent-binding complexes, wherein individual multivalent molecules in the plurality comprise a core attached to multiple nucleotide arms and individual nucleotide amis are attached to a nucleotide moiety, wherein the contacting is conducted under a condition suitable for binding complementary nucleotide moieties of the multivalent molecules to at least two of the first plurality of complexed polymerases thereby forming a plurality of multivalent-binding complexes, and the condition is suitable for inhibiting incorporation of the complementary nucleotide moieties into the nucleic acid primers of the plurality of multivalent-binding complexes; (c) detecting the plurality of multivalent-binding complexes; and (d) identifying the nucleobase of the complementary nucleotide moieties in the plurality of multivalent-binding complexes, thereby determining the sequence of the concatemer template molecules; (e) dissociating the plurality of multivalent-binding complexes by removing the first plurality of polymerases and their bound multivalent molecules, and retaining the plurality of nucleic acid duplexes; (f) contacting the plurality of the nucleic acid duplexes retained at step (e) with a second plurality of a polymerases under a condition suitable for binding the second plurality of polymerases to the plurality of the nucleic acid duplexes, thereby forming aAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO); (g) contacting the second plurality of second polymerases with a plurality of nucleotides, wherein the contacting is conducted under a condition suitable for binding complementary nucleotides from the plurality of nucleotides to at least two of the complexed polymerases, thereby forming a plurality of nucleotide-binding complexes, and the condition is suitable for promoting nucleotide incorporation of the bound complementary nucleotides into the nucleic acid primers of the nucleotide-binding complexes; and (h) repeating steps (a) - (g) at least once. In some embodiments, the method comprises detecting the complementary nucleotides which are incorporated into the nucleic acid primers of the nucleotide-complexed polymerases. In some embodiments, the method comprises detecting the complementary nucleotides which are incorporated into the nucleic acid primers of the nucleotide-complexed polymerases, identifying the nucleobases of the complementary nucleotides which are incorporated into the primers of the nucleotide-complexed polymerases. In some embodiments, the complementary nucleotides which are incorporated into the nucleic acid primers of the nucleotide-complexed polymerases are not detected or identified.
[0040] In some embodiments, the contacting the first plurality of complexed polymerases with the plurality of multivalent molecules of step (b) is conducted in the presence of a non-catalytic divalent cation that inhibits polymerase-catalyzed nucleotide incorporation, optionally wherein the non-catalytic divalent cation comprises strontium or barium.
[0041] In some embodiments, the contacting the second plurality of complexed polymerases with the plurality of nucleotides of step (g) is conducted in the presence of a catalytic divalent cation that promotes polymerase-catalyzed nucleotide incorporation, optionally wherein the catalytic divalent cation comprises magnesium or manganese.
[0042] In some embodiments, individual concatemer template molecules in the plurality comprise a concatemer template molecule having two or more tandem copies of a target sequence.
[0043] In some embodiments, individual multivalent molecules in the plurality of multivalent molecules comprise: (a) a core; and (b) a plurality of nucleotide arms which comprise (i) a core attachment moiety, (ii) a spacer, (iii) a linker, and (iv) a nucleotide moiety, wherein the core is attached to the plurality of nucleotide arms via their core attachment moiety, wherein the spacer is attached to the linker, and wherein the linker is attached to the nucleotide moiety. In some embodiments, the linker comprises an aliphatic chain having 2-6 subunits or an oligo ethylene glycol chain having 2-6 subunits. In someAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)embodiments, the plurality of nucleotide arms attached to a given core have the same type of nucleotide moi eties, and wherein the types of nucleotide moi eties comprise dATP, dGTP, dCTP, dTTP or dUTP. In some embodiments, the plurality of multivalent molecules comprise one type of a multivalent molecule wherein each multivalent molecule in the plurality has the same type of nucleotide moiety selected from a group consisting of dATP, dGTP, dCTP, dTTP and dUTP. In some embodiments, the plurality of multivalent molecules comprise a mixture of any combination of two or more types of multivalent molecules each type having nucleotide moieties selected from a group consisting of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, at least one multivalent molecule in the plurality of multivalent molecules is labeled with a fluorophore. In some embodiments, at least one multivalent molecule in the plurality of multivalent molecules comprises a core that is labeled with a fluorophore. In some embodiments, at least one multivalent molecule in the plurality of multivalent molecules comprises one or more nucleotide moieties that are labeled with a fluorophore.
[0044] In some embodiments, individual nucleotides in the plurality of nucleotides in step (g) comprise an aromatic base, a five carbon sugar, and 1-10 phosphate groups. In some embodiments, the plurality of nucleotides of step (g) comprise one type of nucleotide selected from a group consisting of dATP, dGTP, dCTP, dTTP and dUTP, or comprise a mixture of any combination of two or more types of nucleotides selected from a group consisting of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, at least one of the nucleotides in the plurality of nucleotides in step (g) is labeled with a fluorophore. In some embodiments, the plurality of nucleotides in step (g) lack a fluorophore label. In some embodiments, at least one of the nucleotides in the plurality of nucleotides of step (g) comprises a removable chain terminating moiety attached to the 3’ carbon position of the sugar group. In some embodiments, the removable chain terminating moiety comprises an alkyl group, alkenyl group, alkynyl group, allyl group, aryl group, benzyl group, azide group, azido group, O-azidomethyl group, amine group, amide group, keto group, isocyanate group, phosphate group, thio group, disulfide group, carbonate group, urea group, or silyl group, and wherein the removable chain terminating moiety is cleavable with a chemical compound to generate an extendible 3 ’OH moiety on the sugar group.
[0045] In some embodiments, the method further comprises forming a plurality of binding complexes, comprising the steps: (a) binding a first sequencing primer, a first polymerase, and a first multivalent molecule to a first portion of a concatemer template molecule, thereby forming a first binding complex, wherein a first nucleotide moiety of the first multivalentAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO); and (b) binding a second sequencing primer, a second polymerase, and the first multivalent molecule to a second portion of the concatemer template molecule, thereby forming a second binding complex, wherein a second nucleotide moiety of the first multivalent molecule binds to the second polymerase, and wherein the first and second binding complexes which include the same multivalent molecule form an avidity complex.
[0046] In some embodiments, the method further comprises (a) contacting the first plurality of polymerases and the plurality of sequencing primers with different portions of a concatemer template molecule to form at least first and second complexed polymerases on the immobilized concatemer template molecule; (b) contacting a plurality of multivalent molecules to the at least first and second complexed polymerases, under conditions suitable to bind a single multivalent molecule from the plurality to the first and second complexed polymerases, wherein at least a first nucleotide moiety of the single multivalent molecule is bound to the first complexed polymerase which includes a first sequencing primer hybridized to a first portion of the concatemer template molecule, thereby forming a first binding complex, and wherein at least a second nucleotide moiety of the single multivalent molecule is bound to the second complexed polymerase which includes a second sequencing primer hybridized to a second portion of the concatemer template molecule, thereby forming a second binding complex, and wherein the contacting is conducted under a condition suitable to inhibit polymerase-catalyzed incorporation of the bound first and second nucleotide moieties in the first and second binding complexes, and wherein the first and second binding complexes which are bound to the same multivalent molecule form an avidity complex; (c) detecting the first and second binding complexes on the concatemer template molecule; and (d) identifying the first nucleotide moiety in the first binding complex thereby determining the sequence of the first portion of the concatemer template molecule, and identifying the second nucleotide moiety in the second binding complex thereby determining the sequence of the second portion of the concatemer template molecule.
[0047] In some embodiments, the cellular sample comprises (i) a first plurality of concatemer template molecules that correspond to a plurality of target polynucleotides and (ii) a plurality of target analytes located at spatial positions inside the cellular sample. In some embodiments, the plurality of target analytes comprises target polypeptides, target lipids or target polysaccharides.
[0048] In some embodiments, the method further comprises (a) contacting the cellular sample with a plurality of analyte detection complexes, wherein individual analyte detectionAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)complexes comprise (i) an antibody that binds a target analyte, (ii) a bridge oligonucleotide comprising a 5’ end and a 3’ end, wherein the 5’ end is attached to the antibody and the 3’ end comprises an extendible end, and (iii) a circularized barcoded oligonucleotide hybridized to a portion of the bridge oligonucleotide, wherein the circularized barcoded oligonucleotide comprises a universal sequencing primer binding site sequence, a target barcode sequence that corresponds to the target analyte, and a universal circularized region that hybridizes to the bridge oligonucleotide, and wherein the contacting is conducted under a condition suitable for moving the plurality of analyte detection complexes into the cellular sample and binding individual analyte detection complexes to one of the target analytes; (b) contacting the plurality of analyte detection complexes with a rolling circle amplification reagent under a condition suitable for generating a second plurality of concatemer template molecules using the 3’ end of the bridge oligonucleotides to initiate DNA synthesis and employing the circularized barcoded oligonucleotides as template molecules, wherein individual concatemer template molecules in the second plurality comprise tandem repeat polynucleotide units, wherein individual polynucleotide units comprise a sequence that is complementary to the circularized barcoded oligonucleotide, and wherein the second plurality of concatemer template molecules correspond to the plurality of target analytes; (c) conducting at least two sequencing cycles of the first plurality of concatemer template molecules thereby generating a plurality of sequencing read products that correspond to the plurality of target polynucleotides; and (d) conducting at least two sequencing cycles of the second plurality of concatemer template molecules, thereby generating a plurality of sequencing read products that correspond to the plurality of target analytes.
[0049] In some embodiments, the method further comprises (a) contacting the cellular sample with a plurality of analyte detection complexes, wherein individual analyte detection complexes comprise (i) a first antibody that binds the target analyte, (ii) a second antibody that is attached to the first antibody, wherein the second antibody exhibits little or no binding to the target analyte, (iii) a bridge oligonucleotide comprising a 5’ end and a 3’ end, wherein the 5’ end is attached to the second antibody and the 3’ end comprises an extendible end, and (iv) a circularized barcoded oligonucleotide which is hybridized to a portion of the bridge oligonucleotide, wherein the circularized barcoded oligonucleotide comprises a universal sequencing primer binding site sequence, a target barcode sequence that corresponds to the target analyte, and a universal circularized region that hybridizes to the bridge oligonucleotide, wherein the contacting is conducted under a condition suitable for moving the plurality of analyte detection complexes into the cellular sample and binding individualI IAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)analyte detection complexes to one of the target analytes; (b) contacting the plurality of analyte detection complexes with a rolling circle amplification reagent under a condition suitable for generating a second plurality of concatemer template molecules using the 3’ end of the bridge oligonucleotide to initiate DNA synthesis and employing the circularized barcoded oligonucleotides as template molecules, wherein individual concatemer template molecules in the second plurality comprise tandem repeat polynucleotide units, wherein individual polynucleotide units comprise a sequence that is complementary to the circularized barcoded oligonucleotide, and wherein the second plurality of concatemer template molecules correspond to the plurality of target analytes; (c) conducting at least two sequencing cycles of the first plurality of concatemer template molecules thereby generating a plurality of sequencing read products that correspond to the plurality of target polynucleotides; and (d) conducting at least two sequencing cycles of the second plurality of concatemer template molecules thereby generating a plurality of sequencing read products that correspond to the plurality of target analytes.
[0050] In some embodiments, the sequencing comprises sequencing essentially simultaneously the first plurality of concatemer template molecules and the second plurality of concatemer template molecules, wherein the sequencing generates a first plurality of sequencing read products that correspond to the plurality of target polynucleotides and a second plurality of sequencing read products that correspond to the plurality of target analytes. In some embodiments, the sequencing comprises (a) contacting the cellular sample with a sequencing reagent comprising a plurality of universal sequencing primers, a plurality of sequencing polymerases, and plurality of nucleotide reagents, wherein the plurality of universal sequencing primers binds the first plurality of concatemer template molecules and the second plurality of concatemer template molecules; and (b) and conducting at least two sequencing cycles, thereby generating the plurality of sequencing read products and the second plurality of sequencing read products.
[0051] In some embodiments, the sequencing comprises detecting by imaging essentially simultaneously the first plurality of sequencing read products and the second plurality of sequencing read products, thereby determining the spatial positions of the plurality of target polynucleotide molecules inside the cellular sample and determining the spatial positions of the plurality of the target analytes inside the cellular sample.
[0052] In some embodiments, the sequencing comprises sequencing in separate batches the first plurality of concatemer template molecules and the second plurality of concatemer template molecules, wherein the sequencing generates a first plurality of sequencing readAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)products that correspond to the plurality of target polynucleotides and a second plurality of sequencing read products that correspond to the plurality of target analytes. In some embodiments, the sequencing comprises: (a) contacting the cellular sample with a first sequencing reagent comprising a first plurality of batch-specific sequencing primers, a first plurality of sequencing polymerases, and a first plurality of nucleotide reagents, wherein the first plurality of batch-specific sequencing primers binds the first plurality of concatemer template molecules, and conducting at least two sequencing cycles, thereby generating the plurality of sequencing read products; and (b) contacting the cellular sample with a second sequencing reagent comprising a second plurality of batch-specific sequencing primers, a second plurality of sequencing polymerases, and a second plurality of nucleotide reagents, wherein the second plurality of batch-specific sequencing primers binds the second plurality of concatemer template, and conducting at least two sequencing cycles, thereby generating the second plurality of sequencing read products. In some embodiments, step b) is conducted prior to step a), or step a) is conducted prior to step b).
[0053] In some embodiments, the sequencing comprises: (a) detecting by imaging the first plurality of sequencing read products, thereby determining the spatial positions of the plurality of target polynucleotide molecules inside the cellular sample; and (b) detecting by imaging the second plurality of sequencing read products, thereby determining the spatial positions of the plurality of the target analytes inside the cellular sample. In some embodiments, step b) is conducted prior to step a), or step a) is conducted prior to step b).BRIEF DESCRIPTION OF THE DRAWINGS
[0054] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:
[0055] FIG. 1 is a schematic of various exemplary configurations of multivalent molecules. Left (Class I): schematics of multivalent molecules having a “starburst” or “helter-skelter” configuration. Center (Class II): a schematic of a multivalent molecule having a dendrimer configuration. Right (Class III): a schematic of multiple multivalent molecules formed by reacting streptavidin with 4-arm or 8-arm PEG-NHS with biotin and dNTPs. Nucleotide moieties are designated ‘N’, biotin is designated ‘B’, and streptavidin is designated ‘SA’.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0056] FIG. 2 is a schematic of an exemplary multivalent molecule comprising a generic core atached to a plurality of nucleotide-arms.
[0057] FIG. 3 is a schematic of an exemplary multivalent molecule comprising a dendrimer core attached to a plurality of nucleotide-arms.
[0058] FIG. 4 shows a schematic of an exemplary multivalent molecule comprising a core attached to a plurality of nucleotide-arms, where the nucleotide arms comprise biotin as the core atachment moiety, a spacer, a linker and a nucleotide moiety.
[0059] FIG. 5 is a schematic of an exemplary nucleotide-arm comprising a core attachment moiety, spacer, linker and nucleotide moiety.
[0060] FIG. 6 shows the chemical structure of an exemplary' spacer (top), and the chemical structures of various exemplary linkers, including an 11-atom Linker, 16-atom Linker, 23-atom Linker and an N3 Linker (bottom).
[0061] FIG. 7 shows the chemical structures of various exemplary linkers, including Linkers 1-9.
[0062] FIG. 8 shows the chemical structures of various exemplary' linkers joined / attached to nucleotide moieties.
[0063] FIG. 9 shows the chemical structures of various exemplary linkers joined / attached to nucleotide moieties.
[0064] FIG. 10 shows the chemical structures of various exemplary linkers joined / attached to nucleotide moieties.
[0065] FIG. 11 shows the chemical structures of various exemplary' linkers joined / attached to nucleotide moieties.
[0066] FIG. 12 shows the chemical structure of an exemplary' biotinylated nucleotide-arm. In this example, the nucleotide moiety is connected to the linker via a propargyl amine attachment at the 5 position of a pyrimidine base or the 7 position of a purine base.
[0067] FIG. 13 is a schematic of an embodiment of an in-sample sequencing workflow,
[0068] FIG. 14 is a graph showing the median sequencing quality score (Q-score) achieved for 100 cycles of in-sample sequencing in HeLa cells. The quality score (Q-score) is shown in the y-axis, and the cycle number on the x-axis.
[0069] FIG. 15 is a schematic showing an embodiment of a bridge circle complex (1600) comprising a circularized barcoded oligonucleotide (1400) hybridized to a bridge oligonucleotide (1500). In some embodiments, the circularized barcoded oligonucleotide (1400) comprises: (i) a sequencing primer binding site sequence (1100) (or a complementary sequence thereof); (ii) a target barcode sequence (1200) that corresponds to a target analyte orAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)a cell paint barcode sequence that can identify a target organelle; and (iii) a universal circularized region (1300) that binds a universal sequence region of the bridge oligonucleotide (1500). In some embodiments, the bridge oligonucleotide comprises an oligonucleotide having a universal sequence region (1500) that binds the universal circularized region (1300) of a circularized barcoded oligonucleotide (1400). In some embodiments, the bridge circle complex (1600) can be part of an analyte detection complex used for detecting and identifying a target analyte. In some embodiments, the bridge circle complex (1600) can be part of an analyte detection complex used for sequencing-based cell painting for detecting and identifying an organelle.
[0070] FIG. 16 is a table showing several embodiments of target barcode sequences that can be employed for simultaneously detecting and identifying two or more cellul r target analytes (e.g., cellular structures or organelles) by conducting a single sequencing cycle and employing multi-color imaging (e.g., fluorescent imaging). In some embodiments, the target barcode sequences listed in the table in FIG. 16 can be used for sequencing-based cell painting.
[0071] FIG. 17A is a schematic showing an exemplary in-sample rolling circle amplification reaction using a covalently closed circular library molecule a strand displacing polymerase and a mixture of nucleotides including nucleotides having a scissile moiety that can be cleaved to generate an abasic site (e.g., dUTP). The rolling circle amplification reaction generates a single stranded concatemer template molecule having at least one nucleotide with a scissile moiety which can be cleaved to generate an abasic site in the concatemer template molecule. The arrangement of the various primer binding sequences is for illustration purposes. The skilled artisan will appreciate that many other arrangements are possible. FIGS. 17B-17H show the workflow of painvise sequencing the concatemer template molecule depicted in FIG. 17 A.
[0072] FIG. 17B is a schematic showing an exemplary single stranded concatemer template molecule inside a cellular sample. The cell membrane and internal cellular structures are omitted for clarity. The concatemer template molecule comprises at least one nucleotide having a scissile moiety that can be cleaved to generate an abasic site in the concatemer template molecule. In some embodiments, the concatemer template molecule can be generated by conducting an in-sample rolling circle amplification reaction. The arrangement of the various primer binding sequences is for illustration purposes. The skilled artisan will appreciate that many other arrangements are possible.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0073] FIG. 17C is a schematic showing an exemplary forward sequencing reaction conducted on the concatemer template molecule shown in FIG. 17B. The forward sequencing reaction can be conducted inside the cellular sample with a plurality of soluble forward sequencing primers, and generates a plurality of extended forward sequencing primer strands. The concatemer template molecule can have two or more extended forward sequencing primer strands hybridized thereon.
[0074] FIG. 17D is a schematic showing an exemplary method for replacing the extended forward sequencing primer strands by conducting a primer extension reaction with a strand displacing polymerase in the absence of a soluble primer, thereby generating a forward extension strand.
[0075] FIG. 17E is a schematic showing an exemplary method for replacing the extended forward sequencing primer strands by conducting a primer extension reaction with a soluble forward sequencing primer, thereby generating a forward extension strand.
[0076] FIG. 17F is a schematic showing an exemplary method for generating abasic sites in the single stranded concatemer template molecules at the nucleotides having the scissile moiety and generating gaps at the abasic sites to generate a plurality of gap-containing concatemer template molecules while retaining the plurality of forward extension strands in the cellular sample.
[0077] FIG. 17G is a schematic showing an exemplary retained forward extension strand after removal of the gap-containing concatemer template molecule as shown in FIG. 17F.
[0078] FIG. 17H is a schematic showing an exemplary reverse sequencing reaction conducted inside the cellular sample on the retained forward extension strand shown in FIG.17G. The reverse sequencing reaction can be conducted with a plurality of soluble reverse sequencing primers. The retained forward extension strand can have two or more extended reverse sequencing primer strands hybridized thereon. For the sake of simplicity, FIGS. 17A-17F show an exemplary concatemer template molecule with two copies of a sequence of interest and various universal primer binding sites. The skilled artisan will appreciate that the retained forward extension strand can include three or more tandem copies containing the sequence of interest and various universal primer binding sites.
[0079] FIG. 18 is a schematic of an embodiment of an amplification-free probe complex. Open triangles indicate abasic sites, and solid arrows indicate canonical nucleotides. The ‘XXX’ designates one or more modified nucleotides or modified nucleotide linkages.
[0080] FIG. 19A is a schematic of an embodiment of a portion of a modified oligonucleotide comprising at least one sequencing primer binding site, a canonical nucleo-Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)base and an abasic site. The open triangle indicates an abasic site, while the solid arrow indicates a canonical nucleotide. The ‘XXX’ designates one or more modified nucleotides or modified nucleotide linkages.
[0081] FIG. 19B is a schematic of the same modified oligonucleotide and sequencing primer as shown in FIG. 19 A, with a sequencing polymerase and a detectably labeled multivalent molecule. The open triangle indicates an abasic site, while the solid arrow indicates a canonical nucleotide. The ‘XXX’ designates one or more modified nucleotides or modified nucleotide linkages.
[0082] FIG. 20 a schematic of an embodiment of a portion of a modified oligonucleotide comprising at least one sequencing primer binding site and a target barcode sequence. The ‘XXX’ designates one or more modified nucleotides or modified nucleotide linkages.
[0083] FIG. 21A shows a graph presenting data from a multiplex in-sample sequencing workflow conducted inside HeLa cells which employed a panel of nucleic acid primers that selectively hybridized to non-overlapping portions of RNA transcripts encoding actin beta (ACTB). The workflow includes targeted reverse transcription, generation of linear cDNA library molecules, generation of circularized cDNA library molecules, rolling circle amplification to generate concatemer template molecules, and sequencing the concatemer template molecules. The X-axis shows the total concentration of nucleic acid primers in individual panels used to conduct targeted reverse transcription. The number of non¬ overlapping nucleic acid primers that selectively hybridized to RNA transcripts encoding ACTB is indicated on the right of the graph. The Y-axis shows the on-target counts per cell.
[0084] FIG. 21B shows a graph presenting a summary of the data presented in FIG, 21 A. The X-axis shows the number of non-overlapping nucleic acid primers in each panel (1, 3, 6 or 12) employed in the multiplex in-sample sequencing workflow. The Y-axis shows the on-target counts per cell.
[0085] FIG. 22A shows a graph presenting data from a multiplex in-sample sequencing workflow conducted inside HeLa cells which employed a panel of nucleic acid primers that selectively hybridized to non-overlapping portions of RNA transcripts encoding glyceraldehyde-3 -phosphate dehydrogenase (GAPDH). The workflow includes targeted reverse transcription, generation of linear cDNA library molecules, generation of circularized cDNA library molecules, rolling circle amplification to generate concatemer template molecules, and sequencing the concatemer template molecules. The X-axis shows the total concentration of nucleic acid primers in individual panels used to conduct targeted reverse transcription. The number of non-overlapping nucleic acid primers that selectively hybridizedAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)to RNA transcripts encoding GAPDH is indicated on the right of the graph. The Y-axis shows the on-target counts per cell.
[0086] FIG. 22B shows a graph presenting a summary of the data presented in FIG. 22A.The X-axis shows the number of non-overlapping nucleic acid primers in each panel (1, 3, 6 or 12) employed in the multiplex in-sample sequencing workflow. The Y-axis shows the on- target counts per cell.
[0087] FIG. 23A shows a graph presenting data from a multiplex in-sample sequencing workflow conducted inside HeLa cells which employed a panel of nucleic acid primers that selectively hybridized to non-overlapping portions of RNA transcripts encoding tumor protein 53 (TP53). The workflow includes targeted reverse transcription, generation of linear cDNA library molecules, generation of circularized cDNA library molecules, rolling circle amplification to generate concatemer template molecules, and sequencing the concatemer template molecules. The X-axis shows the total concentration of nucleic acid primers in individual panels used to conduct targeted reverse transcription. The number of non¬ overlapping nucleic acid primers that selectively hybridized to RNA transcripts encoding TP53 is indicated on the right of the graph. The Y-axis shows the on-target counts per cell.
[0088] FIG. 23B shows a graph presenting a summary of the data presented in FIG. 23 A. The X-axis shows the number of non-overlapping nucleic acid primers in each panel (1, 3, 6 or 12) employed in the multiplex in-sample sequencing w'orkflow. The Y-axis shows the on- target counts per cell.
[0089] FIG. 24A shows a graph presenting data from a multiplex in-sample sequencing workflow conducted inside HeLa cells which employed a panel of nucleic acid primers that selectively hybridized to non-overlapping portions of RNA transcripts encoding erb-b2 receptor tyrosine kinase 2 (ERBB2). The workflow includes targeted reverse transcription, generation of linear cDNA library molecules, generation of circularized cDNA library molecules, rolling circle amplification to generate concatemer template molecules, and sequencing the concatemer template molecules. The X-axis shows the total concentration of nucleic acid primers in individual panels used to conduct targeted reverse transcription. The number of non-overlapping nucleic acid primers that selectively hybridized to RNA transcripts encoding ERBB2 is indicated on the right of the graph. The Y-axis shows the on-target counts per cell.
[0090] FIG. 24B shows a graph presenting a summary of the data presented in FIG. 24A.The X-axis shows the number of non-overlapping nucleic acid primers in each panel (1, 3, 6Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)or 12) employed in the multiplex in-sample sequencing workflow. The Y-axis shows the on- target counts per cell.
[0091] FIG. 25A shows a graph presenting data from a multiplex in-sample sequencing workflow conducted inside HeLa cells which employed a panel of nucleic acid primers that selectively hybridized to non-overlapping portions of RNA transcripts encoding BRC / X2 DNA repair associated (BRCA2). The workflow includes targeted reverse transcription, generation of linear cDNA library molecules, generation of circularized cDNA library molecules, rolling circle amplification to generate concatemer template molecules, and sequencing the concatemer template molecules. The X-axis shows the total concentration of nucleic acid primers in individual panels used to conduct targeted reverse transcription. The number of non-overlapping nucleic acid primers that selectively hybridized to RNA transcripts encoding BRCA2 is indicated on the right of the graph. The Y-axis shows the on-target counts per cell.
[0092] FIG. 25B shows a graph presenting a summary of the data presented in FIG. 25 A.The X-axis shows the number of non-overlapping nucleic acid primers in each panel (1, 3, 6 or 12) employed in the multiplex in-sample sequencing workflow. The Y-axis shows the on- target counts per cell.
[0093] FIG. 26 shows an image of untreated wild type A549 cells that do not contain knockout genes compared to an image of knockout A549 cells treated with TGF-beta for 48 hours. The change in morphology of the A549 cells was visualized by conducting sequencing-based cell painting using amplification-free probe complexes that were designed to bind cell membranes.
[0094] FIG. 27 shows four bar graphs showing the change in RNA expression in knockout cells determined by conducting in-sample sequencing inside different A549 knockout cells. CTNNB1: catenin beta 1; GSK3B: glycogen synthase kinase 3 beta; IL1R1: interleukin 1 receptor type 1; TGFBR2: transforming growlh factor beta receptor 2; OR111: olfactory receptor family 6 subfamily Y member 1; SMAD2: SMAD family member 2; NT: non-target control cells.
[0095] FIG. 28 is a graph showing decreased expression of phosphorylated Smad2 protein (Ser 467)in TGFBR2 knockout (KO) cells after treatment with TGF-beta compared to expression of phosphorylated Smad2 protein in non-target control cells (NT), OR111 knockout cells, and median measurement of all cells (dashed line). The protein expression data was generated by conducting in-sample sequencing using bipartite complexes thatAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)selectively bind to phosphorylated Smad2 protein. The x-axis indicates the treatment times in minutes. The y-axis indicates the mean counts per cell.
[0096] FIG. 29A is a graph showing increased allocated target barcodes used and increased mean counts per cell of phospho-HSP27 (heat shock protein family B (small) member 2) protein of an assay using HeLa cells stimulated with TNF-alpha (tumor necrosis factor alpha).
[0097] FIG. 29B is a graph showing target barcode allocation curves in which an increase in cell sample size results in increased Power. The graph on the left shows the results of HeLa cells stimulated with TNF-alpha for 0 or 5 minutes. The graph on the right shows the results of HeLa cells stimulated with TNF-alpha for 0 or 30 minutes.DETAILED DESCRIPTIONDefinitions
[0098] The headings provided herein are not limitations of the various aspects of the disclosure, which aspects can be understood by reference to the specification as a whole.
[0099] Unless defined otherwise, technical and scientific terms used herein have meanings that are commonly understood by those of ordinary' skill in the art unless defined otherwise. Generally, terminologies pertaining to techniques of molecular biology, nucleic acid chemistry', protein chemistry, genetics, microbiology, transgenic cell production, and hybridization described herein are those well-known and commonly used in the art.Techniques and procedures described herein are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the instant specification. For example, see Sambrook et al., Molecular Cloning: A Laboratory Manual (Third ed.. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. 2000). See also Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992). The nomenclatures utilized in connection with, and the laboratory procedures and techniques described herein are those well-known and commonly used in the art.
[0100] Unless otherwise required by context herein, singular terms shall include pluralities and plural terms shall include the singular. Singular forms “a”, “an” and “the”, and singular use of any word, include plural referents unless expressly and unequivocally limited on one referent.
[0101] It is understood the use of the alternative term (e.g., “or”) is taken to mean either one or both or any combination thereof of the alternatives.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0102] The term “and / or” used herein is to be taken mean specific disclosure of each of the specified features or components with or without the other. For example, the term “and / or” as used in a phrase such as “A and / or B” herein is intended to include: “A and B”; “A or B”; “A” (A alone); and “B” (B alone). In a similar manner, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following aspects: “A, B, and C”; “A, B, or C”; “A or C”; “A or B”; “B or C”; “A and B”; “B and C”; “A and C”; “A” (A alone); “B” (B alone); and “C” (C alone).
[0103] As used herein and in the appended claims, terms “comprising”, “including”, “having” and “containing”, and their grammatical variants, as used herein are intended to be non-limiting so that one item or multiple items in a list do not exclude other items that can be substituted or added to the listed items. It is understood that wherever aspects are described herein with the language “comprising,” otherwise analogous aspects described in terms of “consisting of” and / or “consisting essentially of’ are also provided.
[0104] As used herein, the terms “about” and “approximately” refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined, i.e., the limitations of the measurement system. For example, “about” or “approximately” can mean within one or more than one standard deviation per the practice in the art. Alternatively, “about” or “approximately” can mean a range of up to 10% (i.e., ±10%) or more depending on the limitations of the measurement system. For example, about 5 mg can include any number between 4.5 mg and 5.5 mg.Furthermore, particularly with respect to biological systems or processes, the terms can mean up to an order of magnitude or up to 5-fold of a value. When particular values or compositions are provided in the instant disclosure, unless otherwise stated, the meaning of “about” or “approximately” should be assumed to be within an acceptable error range for that particular value or composition. Also, where ranges and / or subranges of values are provided, the ranges and / or subranges can include the endpoints of the ranges and / or subranges.
[0105] As used herein, “corresponding to” or “corresponds to” refers to two or more entities whose identities are sufficiently related such that the identity of one entity can be used to determine the identity, position and / or other properties of the other entity. As a non¬ limiting example, a target barcode sequence can be said to correspond to a particular target analyte or fluorophore color if the fluorophore color can be used to determine the identity of the barcode sequence, and similarly, the barcode sequence can be used to determine the identity of the target analyte.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0106] A “bridge circle complex (1600)” refers to a complex comprising two oligonucleotide molecules including a circularized barcoded oligonucleotide (1400) and a linear bridge oligonucleotide (1500) (e.g., see FIG. 15). The circularized barcoded oligonucleotide (1400) can comprise a target barcode sequence (1200), also referred to herein as a cell paint barcode sequence, when used for the cell paint methods described herein. In some embodiments, the target barcode sequence (1200) or the cell paint barcode sequence comprises a short random sequence comprising 3-20 nucleotides in length (e.g., NNN). The bridge circle complex (1600) can be generated by hybridizing a circularized barcoded oligonucleotide (1400) with the bridge oligonucleotide (1500). One end of the bridge oligonucleotide (1500) can be attached to a primary antibody to form a primary antibody bridge circle complex. Alternatively, one end of the bridge oligonucleotide (1500) can be attached to a secondary' antibody, and the secondary antibody can be attached to a primary antibody, to form a bipartite complex. In the primary' antibody bridge complex and the bipartite complex, the primary' antibody can selectively bind to a target analyte. The bridge circle complex (1600) can be attached to an antibody which pairs together the target analyte binding capability of the antibody and the target barcode sequence (1200). With respect to the target barcode sequence (1200) and the polypeptide binding capability of the antibody, the term “corresponds to” as used herein refers to the pairing of the target barcode sequence (1200) and the polypeptide binding capability in the same primary antibody bridge complex or the bipartite complex.
[0107] The term “polymerase” and its variants, as used herein, refer to an enzyme comprising a domain that binds a nucleotide (or nucleoside) where the polymerase can form a complex having a template nucleic acid and a complementary nucleotide. The polymerase can have one or more activities including, but not limited to, base analog detection activities, DNA polymerization activity, reverse transcriptase activity', DNA binding, strand displacement activity, and nucleotide binding and recognition. A polymerase can be any enzyme that can catalyze polymerization of nucleotides (including analogs thereof) into a nucleic acid strand. Typically, but not necessarily such nucleotide polymerization can occur in a template-dependent fashion. Typically, a polymerase comprises one or more active sites at which nucleotide binding and / or catalysis of nucleotide polymerization can occur. In some embodiments, a polymerase includes other enzymatic activities, such as for example, 3' to 5' exonuclease activity or 5' to 3' exonuclease activity. In some embodiments, a polymerase has strand displacing activity. A polymerase can include, without limitation, naturally occurring polymerases and any subunits and truncations thereof, mutant polymerases, variantAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)polymerases, recombinant, fusion or otherwise engineered polymerases, chemically modified polymerases, synthetic molecules or assemblies, and any analogs, derivatives or fragments thereof that retain the ability to catalyze nucleotide polymerization (e.g., catalytically active fragment). Polymerases can include catalytically inactive polymerases, catalytically active polymerases, reverse transcriptases, and other enzymes comprising a nucleotide binding domain. In some embodiments, a polymerase can be isolated from a cell, or generated using recombinant DNA technology or chemical synthesis methods. In some embodiments, a polymerase can be expressed in prokaryote, eukaryote, viral, or phage organisms. In some embodiments, a polymerase can be post-translationally modified proteins or fragments thereof. A polymerase can be derived from a prokaryote, eukaryote, virus or phage. A polymerase comprises DNA-directed DNA polymerase and RNA-directed DNA polymerase. A DNA polymerase comprises a polymerase from A, B, C, D, X, Y or RT family of polymerases. A DNA polymerase comprises a pol I, pol II or pol III polymerase. A DNA polymerase comprises a DNA polymerase I large (Klenow) fragment, Bst DNA polymerase, T7 DNA polymerase or Phi29 polymerase. A DNA polymerase comprises a template¬ dependent or template-independent polymerase. In some embodiments, a template independent DNA polymerase comprises a terminal deoxynucleotidyl transferase.
[0108] As used herein, the term “recombinase” refers to an enzyme that catalyzes site¬ specific recombination events within DNA. A recombinase can break and rejoin DNA strands at specific locations. The recombinase can rejoin the DNA in different combinations.Catalysis of a recombinase enzyme can generate excisions, insertions, inversions and / or translocations.
[0109] As used herein, the term “strand displacing” refers to the ability of a polymerase to locally separate strands of double-stranded nucleic acids and synthesize a new strand in a template-based manner. Strand displacing polymerases displace a complementary strand from a template strand and catalyze new strand synthesis. Strand displacing polymerases include mesophilic and thermophilic polymerases. Strand displacing polymerases include wild type enzymes, and variants including exonuclease minus mutants, mutant versions, chimeric enzymes and truncated enzymes. Examples of strand displacing polymerases include phi29 DNA polymerase, large fragment of Bst DNA polymerase, large fragment of Bsu DNA polymerase (exo-), Bea DNA polymerase (exo-), Klenow fragment of E. coli DNA polymerase, T5 polymerase, M-MuLV reverse transcriptase, HIV viral reverse transcriptase, Deep Vent DNA polymerase and KOD DNA polymerase. The phi29 DNA polymerase can be wild type phi29 DNA polymerase (e.g., MagniPhi from Expedeon), or variant EquiPhi29Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)DNA polymerase (e.g., from Thermo Fisher Scientific), or chimeric QualiPhi DNA polymerase (e.g., from 4basebio).
[0110] The terms “nucleic acid”, "polynucleotide" and "oligonucleotide" and other related terms used herein are used interchangeably and refer to polymers of nucleotides and are not limited to any particular length. Nucleic acids include recombinant and chemically- synthesized forms. Nucleic acids can be isolated. Nucleic acids include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), analogs of the DNA or RNA generated using nucleotide analogs (e.g., peptide nucleic acids (PNA) and non-naturally occurring nucleotide analogs), and chimeric forms containing DNA and RNA. Nucleic acids can be single-stranded or double-stranded. Nucleic acids comprise polymers of nucleotides, where the nucleotides include natural or non-natural bases and / or sugars. Nucleic acids comprise naturally-occurring internucleosidic linkages, for example phosphodiester linkages. Nucleic acids can lack a phosphate group. Nucleic acids comprise non-natural internucleoside linkages, including phosphorothioate, phosphorothiolate, or peptide nucleic acid (PNA) linkages. In some embodiments, nucleic acids comprise one type of polynucleotide or a mixture of two or more different types of polynucleotides.
[0111] The term “operably linked” and “operably joined” or related terms as used herein refer to a juxtaposition of components. The juxtaposed components can be linked together covalently. For example, two nucleic acid components can be enzymatically ligated together where the linkage that joins together the two components comprises a phosphodiester linkage. A first and second nucleic acid component can be linked together, where the first nucleic acid component can confer a function on a second nucleic acid component. For example, linkage between a primer binding sequence and a sequence of interest forms a nucleic acid library molecule having a portion that can bind to a primer. In another example, a transgene (e.g., a nucleic acid encoding a polypeptide or a nucleic acid sequence of interest) can be ligated to a vector where the linkage permits expression or functioning of the transgene sequence contained in the vector. In some embodiments, a transgene is operably linked to a host cell regulatory sequence (e.g., a promoter sequence) that affects expression of the transgene. In some embodiments, the vector comprises at least one host cell regulatory sequence, including a promoter sequence, enhancer, transcription and / or translation initiation sequence, transcription and / or translation termination sequence, polypeptide secretion signal sequences, and the like. In some embodiments, the host cell regulatory sequence controls expression of the level, timing and / or location of the transgene.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0112] The terms “linked”, “joined”, “attached”, “appended” and variants thereof comprise any type of fusion, bond, adherence or association between any combination of compounds or molecules that is of sufficient stability to withstand use in the particular procedure. The procedure can include but are not limited to. nucleotide binding; nucleotide incorporation; de-blocking (e g., removal of chain-terminating moiety); washing; removing; flowing; detecting; imaging and / or identifying. Such linkage can comprise, for example, covalent, ionic, hydrogen, dipole-dipole, hydrophilic, hydrophobic, or affinity bonding, bonds or associations involving van der Waals forces, mechanical bonding, and the like. In some embodiments, such linkage occurs intramolecularly, for example linking together the ends of a single-stranded or double-stranded linear nucleic acid molecule to form a circular molecule. In some embodiments,, such linkage can occur between a combination of different molecules, or between a molecule and a non-molecule, including but not limited to: linkage between a nucleic acid molecule and a solid surface; linkage between a protein and a detectable reporter moiety; linkage between a nucleotide and detectable reporter moiety; and the like. Some examples of linkages can be found, for example, in Hermanson, G., “Bioconjugate Techniques”, Second Edition (2008); Aslam, M., Dent, A., “Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences”, London: Macmillan (1998); Aslam, M., Dent, A., “Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences”, London: Macmillan (1998).
[0113] The term “primer” and related terms used herein refers to an oligonucleotide that is capable of hybridizing with a DNA and / or RNA polynucleotide template to form a duplex molecule. Primers comprise natural nucleotides and / or nucleotide analogs. Primers can be recombinant nucleic acid molecules. Primers may have any length, but typically range from 4-50 nucleotides. A typical primer comprises a 5’ end and 3’ end. The 3’ end of the primer can include a 3’ OH moiety which serves as a nucleotide polymerization initiation site in a polymerase-catalyzed primer extension reaction. Alternatively, the 3’ end of the primer can lack a 3’ OH moiety, or can include a terminal 3’ blocking group that inhibits nucleotide polymerization in a polymerase-catalyzed reaction. Any one nucleotide, or more than one nucleotide, along the length of the primer can be labeled with a detectable reporter moiety. A primer can be in solution (e.g., a soluble primer) or can be immobilized to a support (e.g., a capture primer).
[0114] The term “template nucleic acid”, “template polynucleotide”, “target nucleic acid” “target polynucleotide”, “template strand” and other variations refer to a nucleic acid strand that serves as the basis nucleic acid molecule for any replication reaction (e.g., amplification)Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)and for any of the sequencing methods describe herein. The template nucleic acid can be single- stranded or double-stranded, or the template nucleic acid can have single- stranded or double-stranded portions. The template nucleic acid can be obtained from a naturally- occurring source, recombinant form, or chemically synthesized to include any type of nucleic acid analog. The template nucleic acid can be linear, circular, or other forms. The template nucleic acids can include an insert portion having an insert sequence. The template nucleic acids can also include at least one universal adaptor sequence. The insert portion can be isolated in any form, including chromosomal, genomic, organellar (e.g., mitochondrial, chloroplast or ribosomal), recombinant molecules, cloned, amplified, cDNA, RNA such as precursor mRNA or mRNA, oligonucleotides, whole genomic DNA, obtained from fresh frozen paraffin embedded tissue, needle biopsies, circulating tumor cells, cell free circulating DNA, or any type of nucleic acid library. The insert portion can be isolated from any source including from organisms such as prokaryotes, eukaryotes (e.g., humans, plants and animals), fungus, viruses cells, tissues, normal or diseased cells or tissues, body fluids including blood, urine, serum, lymph, tumor, saliva, anal and vaginal secretions, amniotic samples, perspiration, semen, environmental samples, culture samples, or synthesized nucleic acid molecules prepared using recombinant molecular biology or chemical synthesis methods. The insert portion can be isolated from any organ, including head, neck, brain, breast, ovary, cervix, colon, rectum, endometrium, gallbladder, intestines, bladder, prostate, testicles, liver, lung, kidney, esophagus, pancreas, thyroid, pituitary, thymus, skin, heart, larynx, or other organs. The insert portion can be isolated from a cellular sample as described herein. The template nucleic acid can be subjected to nucleic acid analysis, including sequencing and composition analysis.
[0115] The term “adaptor” and related terms refer to oligonucleotides that can be operably linked to a target polynucleotide, where the adaptor confers a function to the co¬ joined adaptor-target molecule. Adaptors can comprise DNA, RNA, chimeric DNA / RNA, or analogs thereof. Adaptors can include at least one ribonucleoside residue. Adaptors can be single-stranded, double-stranded, or have single-stranded and / or double-stranded portions. Adaptors can be configured to be linear, stem-looped, hairpin, or Y-shaped forms. Adaptors can be any length, including 4-100 nucleotides or longer. Adaptors can have blunt ends, overhang ends, or a combination of both. Overhang ends include 5’ overhang and 3’ overhang ends. The 5’ end of a single-stranded adaptor, or one strand of a double-stranded adaptor, can have a 5’ phosphate group or lack a 5’ phosphate group. Adaptors can include a 5’ tail that does not hybridize to a target polynucleotide (e.g., tailed adaptor), or adaptors canAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)be non-tailed. An adaptor can include a sequence that is complementary to at least a portion of a primer, such as an amplification primer, a sequencing primer, or a capture primer (e.g., soluble or immobilized capture primers). Adaptors can include a random sequence or degenerate sequence. Adaptors can include at least one inosine residue. Adaptors can include at least one phosphorothioate, phosphorothiolate and / or phosphoramidate linkage. Adaptors can include at least one barcode sequence which can be used to distinguish polynucleotides (e.g., insert sequences) from different sample sources in a multiplex assay. In some embodiments, a barcode sequence uniquely identifies a target RNA. Adaptors can include a unique identification sequence (e.g., unique molecular index, UMI; or a unique molecular tag) that can be used to uniquely identify a nucleic acid molecule to which the adaptor is appended. In some embodiments, a unique identification sequence can be used to increase error correction and accuracy, reduce the rate of false-positive variant calls and / or increase sensitivity of variant detection. Adaptors can include at least one restriction enzyme recognition sequence, including any one or any combination of two or more selected from a group consisting of type I, type II, type III, type IV, type Hs or type IIB. In some embodiments, any of the adaptor sequences, including but not limited to amplification primer sequences, sequencing primer sequences, sample index sequences, target barcode sequences, identification tag sequences, can be about 3-50 nucleotides in length, or about 5-40 nucleotides in length, or about 5-25 nucleotides in length.
[0116] The term “universal sequence” and related terms refer to a sequence in a nucleic acid molecule that is common among two or more polynucleotide molecules. For example, an adaptor having a universal sequence can be operably joined to a plurality of polynucleotides so that the population of co-joined molecules carry the same universal adaptor sequence. Examples of universal adaptor sequences include but are not limited to an amplification primer sequence and a sequencing primer sequence.
[0117] As used herein, the term “sequencing read product” refers to a primer extension product generated by conducting a sequencing reaction using a sequencing primer hybridized to a template molecule to be sequenced (e.g., a concatemer template molecule), a sequencing polymerase and a plurality of nucleotides. In some embodiments, the sequencing polymerase catalyzes nucleotide incorporation using the 3’ end of the sequencing primer as an initiation site and generates an extension product comprising a sequence that is complementary to the template molecule. In some embodiments, a nucleotide incorporation reaction extends the sequencing primer by one nucleotide. In some embodiments, the number of nucleotide incorporation reactions that are conducted will dictate the length of the sequencing readAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)product. For example, conducting eleven nucleotide incorporation reactions will generate a sequencing primer that is extended by eleven nucleotides.
[0118] A “sequencing cycle” refers to one complete round of the chemical and imaging steps that determine a single base (nucleotide) in a sequencing reaction. In some embodiments, one cycle of a sequencing reaction comprises: conducting one nucleotide incorporation reaction using a sequencing polymerase and a nucleotide thereby extending the sequencing primer by one nucleotide. In some embodiments, one cycle of a sequencing reaction comprises: (i) binding a multivalent molecule to the 3’ end of a first sequencing primer and a sequencing polymerase, thereby forming a binding complex, under a condition that inhibits polymerase-catalyzed nucleotide incorporation where the multivalent molecule comprises a plurality of nucleotide arms attached to a core; (ii) removing the multivalent molecule and the sequencing polymerase while retaining the template molecule hybridized to the sequencing primer; and (iii) conducting one nucleotide incorporation reaction using a second sequencing polymerase and a nucleotide thereby extending the sequencing primer by one nucleotide. In some embodiments, individual sequencing read products include a binding complex.
[0119] As used herein the term “batch sequencing” refers to a method which comprises separately sequencing two or more sub-populations (e.g., batches) of template molecules from a larger population of template molecules. In a non-limiting example, a cellular sample harbors a plurality of concatemer template molecules comprising at least a first and second sub-population of concatemer template molecules. The first sub-population of concatemer template molecules can undergo a first batch sequencing workflow using a plurality of first batch sequencing primers which selectively hybridize to the first sub-population of concatemer template molecules, wherein the first batch sequencing workflow comprises conducting a first plurality of sequencing cycles thereby generating a first plurality of sequencing read products, and the second sub-population of concatemer template molecules can undergo a second batch sequencing workflow using a plurality of second batch sequencing primers which selectively hybridize to the second sub-population of concatemer template molecules wherein the second batch sequencing workflow comprises conducting a second plurality of sequencing cycles thereby generating a second plurality of sequencing read products, wherein the first and second sequencing primers have different sequences.
[0120] When used in reference to nucleic acid molecules, the terms “hybridize” or “hybridizing” or “hybridization” or other related terms refers to hydrogen bonding between two different nucleic acids to form a duplex nucleic acid. Hybridization also includesAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)hydrogen bonding between two different regions of a single nucleic acid molecule to form a self-hybridizing molecule having a duplex region. Hybridization can comprise Watson-Crick or Hoogstein binding to form a duplex double-stranded nucleic acid, or a double-stranded region within a nucleic acid molecule. The double-stranded nucleic acid, or the two different regions of a single nucleic acid, may be wholly complementary, or partially complementary. Complementary nucleic acid strands need not hybridize with each other across their entire length. The complementary base pairing can be the standard A-T or C-G base pairing, or can be other forms of base-pairing interactions. Duplex nucleic acids can include mismatched base-paired nucleotides.
[0121] When used in reference to nucleic acids, the terms “extend”, “extending”, “extension” and other variants, refers to incorporation of one or more nucleotides into a nucleic acid molecule. Nucleotide incorporation comprises polymerization of one or more nucleotides into the terminal 3’ OH end of a nucleic acid strand, resulting in extension of the nucleic acid strand. Nucleotide incorporation can be conducted with natural nucleotides and / or nucleotide analogs. Typically, but not necessarily, nucleotide incorporation occurs in a template-dependent fashion. Any suitable method of extending a nucleic acid molecule may be used, including primer extension catalyzed by a DNA polymerase or RNA polymerase.
[0122] The term “nucleotides” and related terms refer to a molecule comprising an aromatic base, a five-carbon sugar (e.g., ribose or deoxyribose), and at least one phosphate group. Canonical or non-canonical nucleotides are consistent with use of the term. The phosphate in some embodiments comprises a monophosphate, diphosphate, or triphosphate, or corresponding phosphate analog. The term “nucleoside” refers to a molecule comprising an aromatic base and a sugar. Nucleotides and nucleosides can be non-labeled or labeled with a detectable reporter moiety.
[0123] Nucleotides (and nucleosides) typically comprise a hetero cyclic base including substituted or unsubstituted nitrogen-containing parent heteroaromatic ring which are commonly found in nucleic acids, including naturally-occurring, substituted, modified, or engineered variants, or analogs of the same. The base of a nucleotide (or nucleoside) is capable of forming Watson-Crick and / or Hoogstein hydrogen bonds with an appropriate complementary base. Exemplary' bases include, but are not limited to, purines and pyrimidines such as: 2-ami nopurine, 2,6-diaminopurine, adenine (A), ethenoadenine, N6-A2-isopentenyladenine (6iA), Nb-A2-isopentenyl-2-methylthioadenine (2ms6iA), N°- m ethyl adenine, guanine (G), isoguanine, N2-dimethylguanine (dmG), 7-methylguanine (7mG), 2 -thiopyrimidine, 6-thioguanine (6sG), hypoxanthine and CE-methylguanine; 7-Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)deaza-purines such as 7-deazaadenine (7-deaza-A) and 7-deazaguanine (7-deaza-G); pyrimidines such as cytosine (C), 5-propynylcytosine, isocytosine, thymine (T), 4-thiothymine (4sT), 5,6-dihydrothymine, O4-methylthymine, uracil (U), 4-thiouracil (4sU) and 5,6-dihydrouracil (dihydrouracil; D); indoles such as nitroindole and 4-methylindole; pyrroles such as nitropyrrole; nebularine; inosines; hydroxymethyl cytosines; 5-methycytosines; base (Y); as well as methylated, glycosylated, and acylated base moieties; and the like. Additional exemplary bases can be found in Fasman, 1989, in “Practical Handbook of Biochemistry and Molecular Biology”, pp. 385-394, CRC Press, Boca Raton, Fla.
[0124] Nucleotides (and nucleosides) typically comprise a sugar moiety, such as carbocyclic moiety (Ferraro and Gotor 2000 Chem. Rev. 100: 4319-48), acyclic moieties (Martinez, et al., 1999 Nucleic Acids Research 27: 1271-1274; Martinez, et al., 1997 Bioorganic & Medicinal Chemistry Letters vol. 7: 3013-3016), and other sugar moieties (Joeng, et al,, 1993 J. Med. Chem. 36: 2627-2638; Kim, et al., 1993 J. Med. Chem. 36: 30-7; Eschenmosser 1999 Science 284:2118-2124; and U. S. Pat. No. 5,558,991). The sugar moiety comprises: ribosyl; 2'-deoxyribosyl; 3 '-deoxyribosyl; 2', 3 '-dideoxyribosyl; 2',3'-didehydrodideoxyribosyl; 2'-alkoxyribosyl; 2'-azidoribosyl; 2'-aminoribosyl; 2 '-fluororibosyl; 2'-mercaptoriboxyl; 2'-alkylthioribosyl; 3 '-alkoxyribosyl; 3 '-azidoribosyl; 3 '-aminoribosyl; 3 '-fluororibosyl; 3'-mercaptoriboxyl; 3 '-alkylthioribosyl carbocyclic; acyclic or other modified sugars.
[0125] In some embodiments, nucleotides comprise a chain of one, two or three phosphorus atoms where the chain is typically attached to the 5’ carbon of the sugar moiety via an ester or phosphoramide linkage. In some embodiments, the nucleotide is an analog having a phosphorus chain in which the phosphorus atoms are linked together with intervening O, S, NH, methylene or ethylene. In some embodiments, the phosphorus atoms in the chain include substituted side groups including O, S or BHv In some embodiments, the chain includes phosphate groups substituted with analogs including phosphorami date, phosphorothioate, phosphorodithioate, and O-methylphosphoroamidite groups.
[0126] The term “reporter moiety”, “reporter moieties” or related terms refers to a compound that generates, or causes to generate, a detectable signal. A reporter moiety is sometimes called a “label”. Any suitable reporter moiety may be used, including luminescent, photoluminescent, electroluminescent, bioluminescent, chemiluminescent, fluorescent, phosphorescent, chromophore, radioisotope, electrochemical, mass spectrometry', Raman, hapten, affinity tag, atom, or an enzyme. A reporter moiety generates a detectable signal resulting from a chemical or physical change (e.g., heat, light, electrical, pH, saltAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)concentration, enzymatic activity, or proximity events). A proximity event includes two reporter moieties approaching each other, or associating with each other, or binding each other. It is well known to one skilled in the art to select reporter moieties so that each absorbs excitation radiation and / or emits fluorescence at a wavelength distinguishable from the other reporter moieties to permit monitoring the presence of different reporter moieties in the same reaction or in different reactions. Two or more different reporter moieties can be selected having spectrally distinct emission profiles, or having minimal overlapping spectral emission profiles. Reporter moieties can be linked (e.g., operably linked) to nucleotides, nucleosides, nucleic acids, enzymes (e.g., polymerases or reverse transcriptases), or support (e.g., surfaces).
[0127] A reporter moiety (or label) comprises a fluorescent label or a fluorophore.Exemplary' fluorescent moieties which may serve as fluorescent labels or fluorophores include, but are not limited to fluorescein and fluorescein derivatives such as carboxyfluorescein, tetrachlorofluorescein, hexachlorofluorescein, carboxynapthofluorescein, fluorescein isothiocyanate, NHS-fluorescein, iodoacetamidofluorescein, fluorescein maleimide, SAMSA-fluorescein, fluorescein thiosemicarbazide, carbohydrazinomethylthioacetyl-amino fluorescein, rhodamine and rhodamine derivatives such as TRITC, TMR, lissamine rhodamine, Texas Red, rhodamine B, rhodamine 6G, rhodamine 10, NHS-rhodamine, TMR-iodoacetamide, lissamine rhodamine B sulfonyl chloride, lissamine rhodamine B sulfonyl hydrazine, Texas Red sulfonyl chloride, Texas Red hydrazide, coumarin and coumarin derivatives such as AMCA, AMCA-NHS, AMCA-sulfo-NHS, AMCA-HPDP, DCIA, AMCE-hydrazide, BODIPY® and derivatives such as BODIPY FL C3-SE, BODIPY 530 / 550 C3, BODIPY 530 / 550 C3-SE, BODIPY 530 / 550 C3 hydrazide, BODIPY 493 / 503 C3 hydrazide, BODIPY FL. C3 hydrazide, BODIPY FL IA, BODIPY 530 / 551 IA, Br-BODIPY 493 / 503, Cascade Blue and derivatives such as Cascade Blue acetyl azide, Cascade Blue cadaverine, Cascade Blue ethylenediamine, Cascade Blue hydrazide, Lucifer Yellow and derivatives such as Lucifer Yellow iodoacetamide, Lucifer Yellow CH, cyanine and derivatives such as indolium based cyanine dyes, benzo-indolium based cyanine dyes, pyridium based cyanine dyes, thiozolium based cyanine dyes, quinolinium based cyanine dyes, imidazolium based cyanine dyes, Cy 3, Cy5, lanthanide chelates and derivatives such as BCPDA, TBP, TMT, BHHCT, BCOT, Europium chelates, Terbium chelates, Alexa® Fluor dyes, DyLight® dyes, Atto™ dyes, LightCycler® Red dyes, CAL Flour dyes, JOE and derivatives thereof, Oregon Green™ dyes, WellRED dyes, I RD dyes, phycoerythrin and phycobilin dyes, Malachite green, stilbene, DEG dyes, NR dyes, near¬Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)infrared dyes and others known in the art such as those described in Haugland, Molecular Probes Handbook, (Eugene, Oreg.) 6th Edition; Lakowicz, Principles of Fluorescence Spectroscopy, 2nd Ed., Plenum Press New York (1999), or Hermanson, Bioconjugate Techniques, 2nd Edition, or derivatives thereof, or any combination thereof. Cyanine dyes may exist in either sulfonated or non-sulfonated forms, and consist of two indolenin, benzo-indolium, pyridiuni, thiozoliuni, and / or quinolinium groups separated by a polymethine bridge between two nitrogen atoms. Commercially available cyanine fluorophores include, for example, Cy3, (which may comprise l-[6-(2,5-dioxopyrrolidin-l-yloxy)-6-oxohexyl]-2-(3-{l-[6-(2,5-dioxopyrrolidin-l-yloxy)-6-oxohexyl]-3,3-dimethyl-l,3-dihydro-2H-indol-2-ylidene}prop- 1 -en- 1 -y l)-3,3 -dimethyl-3H-indolium or 1 - [6-(2, 5-dioxopyrrolidin- 1 -yloxy)-6-oxohexyl]-2-(3-{l-[6-(2,5-dioxopyrrolidin-l-yloxy)-6-oxohexyl]-3,3-dimethyl-5-sulfo-l,3-dihydro-2H-indol-2-ylidene}prop-l-en-l-yl)-3,3-dimethyl-3H-indolium-5-sulfonate), Cy5 (which may comprise l-(6-((2,5-dioxopyrrolidin-l-yl)oxy)-6-oxohexyl)-2-((lE,3E)-5-((E)-l-(6-((2,5-dioxopyrrolidin-l-yl)oxy)-6-oxohexyl)-3,3-dimethyl-5-indolin-2-ylidene)penta-l,3-dien-l-yl)-3,3-dimethyl-3H-indol-l-ium or l-(6-((2,5-dioxopyrrolidin-l-yl)oxy)-6-oxohexyl)-2-((lE,3E)-5-((E)-l-(6-((2,5-dioxopyrrolidin-l-yl)oxy)-6-oxohexyl)-3,3-dimethyl-5-sulfoindolin-2-ylidene)penta-l,3-dien-l-yl)-3,3-dimethyl-3H-indol-l-ium-5-sulfonate), and Cy7 (which may comprise l-(5-carboxypentyl)-2-[(lE,3E,5E,7Z)-7-(l-ethyl-l,3-dihydro-2H-indol-2-ylidene)hepta-l,3,5-trien-l-yl]-3H-indolium or l-(5-carboxypentyl)-2-[(lE,3E,5E,7Z)-7-(T-ethyl-5-sulfo-l,3-dihydro-2H-indol-2-ylidene)hepta-l,3,5-trien-l-yl]-3H-indolium-5-sulfonate), where “Cy” stands for 'cyanine', and the first digit identifies the number of carbon atoms between two indolenine groups. Cy2 which is an oxazole derivative rather than indolenin, and the benzo-derivatized Cy3.5, Cy5.5 and Cy7.5 are exceptions to this rule.
[0128] In some embodiments, the reporter moiety can be a FRET pair, such that multiple classifications can be performed under a single excitation and imaging step. As used herein, FRET may comprise excitation exchange (Forster) transfers, or electron-exchange (Dexter) transfers.
[0129] When used in reference to nucleic acids, the terms “amplify”, “amplifying”, “amplification”, and other related terms include producing multiple copies of an original polynucleotide template molecule, where the copies comprise a sequence that is complementary’ to the template sequence, or the copies comprise a sequence that is the same as the template sequence. In some embodiments, the copies comprise a sequence that isAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)substantially identical to a template sequence, or is substantially identical to a sequence that is complementary to the template sequence,
[0130] As used herein, the term “selectively binds” in the context of any binding agent, for example, a primary antibody bridge circle complex or bipartite complex of the disclosure, refers to a binding agent that binds specifically to a target analyte, such as with a high affinity, and does not significantly bind other unrelated target analytes. The person of ordinary skill in the art will appreciate that a binding agent that binds specifically to a target analyte with high affinity, but binds to non-targets (off-targets) with suitably low affinity can still be said to selectively bind to the target analyte.
[0131] As used herein, the term “target analyte” refers to any analyte that can be bound by an affinity moiety of any of the analyte detection complexes or amplification-free probes disclosed herein. Exemplary target analytes can be on the surface of or inside a cell.Exemplary target analytes include, but are not limited to polynucleotides, proteins, lipids, polysaccharides and the like. In some embodiments, the protein target analytes comprise phosphorylated or non-phosphorylated proteins. When used with respect to an antibody of a primary antibody bridge circle complex or bipartite complex, the term “target analyte” refers to any analyte that can be bound by the antibody of an antibody of a primary antibody bridge circle complex or bipartite complex disclosed herein. Exemplary target analytes include, but are not limited to polypeptides, lipids, nucleic acids, polysaccharides or a combination thereof
[0132] The term “target polynucleotide” refers to a polynucleotide, such as a cellular mRNA or a perturbation polynucleotide, whose presence and / or sequence is detected by the methods described herein. When target polynucleotides are RNAs expressed by a cell (e.g., mRNAs, transgenes or non-coding RNAs), the target polynucleotide can be encoded by a target gene. Target polynucleotides can be RNA, DNA or a combination thereof.
[0133] The term “support” as used herein refers to a substrate that is designed for deposition of cellular samples for assays and / or analyses. Examples of cellular sample to be deposited onto a support include a single cell, cell suspension, multiple cells, tissue, organ or organoid.
[0134] In some embodiments, the support is solid, semi-solid, or a combination of both. In some embodiments, the support is porous, semi -porous, non-porous, or any combination of porosity. In some embodiments, the support can be substantially planar, concave, convex, or any combination thereof. In some embodiments, the support can be cylindrical, for example comprising a capillary or interior surface of a capillary.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0135] In some embodiments, the surface of the support can be substantially smooth. In some embodiments, the support can be regularly or irregularly textured, including bumps, etched, pores, three-dimensional scaffolds, or any combination thereof.
[0136] In some embodiments, the support comprises a bead having any shape, including spherical, hemi-spherical, cylindrical, barrel-shaped, toroidal, disc-shaped, rod-like, conical, triangular, cubical, polygonal, tubular or wire-like.
[0137] The support can be fabricated from any material, including but not limited to glass, fused-silica, silicon, a polymer (e.g., polystyrene (PS), macroporous polystyrene (M PS), polymethylmethacrylate (PMMA), polycarbonate (PC), polypropylene (PP), polyethylene (PE), high density polyethylene (HDPE), cyclic olefin polymers (COP), cyclic olefin copolymers (COC), polyethylene terephthalate (PET)), or any combination thereof. Various compositions of both glass and plastic substrates are contemplated.
[0138] The term “persistence time'’ and related terms refer to the length of time that a binding complex, which is formed between the target nucleic acid, a polymerase, a conjugated or unconjugated nucleotide, remains stable without any binding component dissociates from the binding complex. The persistence time is indicative of the stability of the binding complex and strength of the binding interactions. Persistence time can be measured by observing the onset and / or duration of a binding complex, such as by observing a signal from a labeled component of the binding complex. For example, a labeled nucleotide or a labeled reagent comprising one or more nucleotides may be present in a binding complex, thus allowing the signal from the label to be detected during the persistence time of the binding complex. One exemplary label is a fluorescent label.
[0139] The term “target-primer duplex” and related terms refer to a target polynucleotide hybridized to a nucleic acid primer. In some embodiments, the target polynucleotide comprises DNA, RNA, cDNA or chimeric DNA and RNA. In some embodiments, the nucleic acid primer comprises (i) a 5’ region comprising at least one universal adaptor sequence, and optionally one or more identification tag sequences, and (ii) a 3’ region comprising a sequence that is complementary to at least a portion of the target polynucleotide. In some embodiments, the 5’ region of the nucleic acid primer is designed to exhibit little or no hybridization to the target polynucleotide. In some embodiments, the nucleic acid primer comprises a 5’ tailed primer.
[0140] The term “blocked target-primer duplex” and related terms refer to a target-primer duplex and a blocking oligonucleotide which is hybridized to the target polynucleotide. The blocking oligonucleotide comprises a single-stranded oligonucleotide that can hybridize to aAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)predetermined location on the target polynucleotide. The 5’ end of the blocking oligonucleotide can hybridize to the target polynucleotide at a known distance from the 3’ end of the nucleic acid primer which is also hybridized to the target polynucleotide.Hybridization of the blocking oligonucleotide to the target polynucleotide can block progression of a primer extension reaction (e.g., reverse transcription) that initiates from the nucleic acid primer. Hybridization of the blocking oligonucleotide to the target polynucleotide can be used to generate a primer extension product having a predicted length.
[0141] The term “primer-cDNA molecule” and related terms refer to an target polynucleotide hybridized to a 5’ tailed nucleic acid primer, wherein the 5’ tailed nucleic acid primer is used to initiate a polymerization reaction (when the target polynucleotide is an RNA, a reverse transcription reaction) to generate a complementary DNA (cDNA) molecule that is covalently joined to the 3’ end of the 5’ tailed nucleic acid primer. In some embodiments, the 5’ tailed nucleic acid primer comprises (i) a 5’ region comprising at least one universal adaptor sequence and optionally one or more identification tag sequences and (ii) a 3’ region comprising a sequence that is complementary to at least a portion of the target polynucleotide. In some embodiments, the cDNA molecule is partially or wholly complementary to at least a portion of the RNA target polynucleotide. The primer-cDNA molecule comprises a nucleic acid duplex comprising the target polynucleotide hybridized to the nucleic acid primer which is covalently joined to the cDNA molecule. In some embodiments, the target polynucleotide comprises RNA.
[0142] The term “linear cDNA library molecule” and related terms refer to a nucleic acid molecule that can be generated by hybridizing a target polynucleotide with a 5’ tailed nucleic acid primer, thereby generating a target-primer duplex, and conducting polymerization reaction (when the target polynucleotide is an RNA, a reverse transcription) to generate a primer-cDNA molecule, and using a modifying reagent to append at least one universal adaptor sequence to the 3’ end of the primer-cDNA molecule. In some embodiments, the linear cDNA library molecule comprise: (i) a 5’ universal adaptor sequence (e.g., from the 5’ tailed nucleic acid primer); (ii) a cDNA sequence that is complementary to the RNA target polynucleotide, and (iii) a 3’ universal adaptor sequence (e.g., generated by the modifying reagent). In some embodiments, the cDNA portion of the linear cDNA library molecule comprises the insert sequence.
[0143] The term “open circle cDNA library' molecule” and related terms refer to a linear cDNA library molecule hybridized to a circularization primer. In some embodiments, the circularization primer comprises a single-stranded oligonucleotide comprising a 5’ endAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)portion that can hybridize to the 5’ end portion of the linear cDNA library molecule, and a 3’ end portion that can hybridize to the 3’ end portion of the same linear cDNA library molecule. In some embodiments, the terminal 3’ end of the circularization primer is extendible or non-extendible. In some embodiments, the open circle cDNA library' molecule comprises (i) the 5’ portion of the circularization primer hybridized to the 5’ end portion of the linear cDNA library molecule, (ii) the 3’ portion of the same circularization primer hybridized to the 3’ end portion of the same linear cDNA library molecule, and (iii) a gap or nick between the 5’ and 3’ ends of the linear cDNA library molecule wherein the gap and nick can be closed with an enzymatic reaction.
[0144] The term “open circle-target complex” and related terms refer to an open circle cDNA library molecule hybridized to the RN target polynucleotide.
[0145] The term “covalently closed circular cDNA library molecule” and related terms refer to the open circle cDNA library molecule which is subjected to enzymatic closure of the gap or nick to generate a covalently closed circular cDNA library molecule that is hybridized to a circularization primer. In some embodiments, the terminal 3’ end of the circularization primer is extendible or non-extendible.
[0146] The term “closed circle-target complex” and related terms refer to the covalently closed circular cDNA library molecule which is hybridized to an RNA target polynucleotide.
[0147] The term “closed circle-target-fastener complex” and related terms refer to the closed circle-target complex which is hybridized to a fastening oligonucleotide. The fastening oligonucleotide comprises a single-stranded oligonucleotide comprising a 5’ portion that can hybridize to at least a portion of the target polynucleotide and a 3’ portion that can hybridize to at least a portion of the covalently closed circular cDNA library molecule, thereby binding together the target polynucleotide and the covalently closed circular cDNA library molecule and generating the closed circle-target-fastener complex. In some embodiments, the terminal 3’ end of the fastener complex is extendible or non-extendible.
[0148] Throughout this application various publications, patents, and / or patent applications are referenced. The disclosures of the publications, patents and / or patent applications are hereby incorporated by reference in their entireties into this application in order to more fully describe the state of the art to which this disclosure pertains.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)IntroductionDirect In-Sample Sequencing Methods
[0149] The present disclosure provides methods for conducting direct in-sample sequencing. The disclosed methods comprise generating library molecules inside a cellular sample. The resulting library molecules can be further manipulated, while still residing inside the cellular sample, including amplifying the library molecules to generate amplicons inside the cellular sample, and sequencing the amplicons inside the cellular sample. In addition, the cellular sample can also be labeled to identify protein expression or changes in cellular morphology, which can be correlated with the sequencing data with single cell level resolution. The sequencing steps can be employed for polynucleotide detection and identification of DNA and / or RNA which leverages massively parallel sequencing technologies. All of the steps disclosed herein are conducted inside intact cellular samples. The DNA and RNA is not fragmented inside the cellular sample. The cellular samples are not lysed. The polynucleotides are not eluted from the cellular sample and manipulated in vitro. The polynucleotides remain inside the cellular sample and the disclosed method occurs inside the cellular sample (e.g., FIG. 13).
[0150] Accordingly, the present disclosure provides compositions, apparatus and methods for conducting direct in-sample sequencing inside a cellular sample for simultaneous detection of multiple biomolecules including polynucleotides, polypeptides, lipids and polysaccharides.
[0151] The initial steps of the disclosed methods comprise depositing the cellular sample on a support, optionally culturing the cellular sample, and preparing the cellular sample for generating library molecules inside the cellular sample. The library molecules can be amplified to generate concatemer template molecules that are sequenced while inside the cellular sample. After deposition of the cellular sample on the support, the cellular sample remains on the same support, and all of the steps of the method are conducted on the support. The cellular sample is not transferred to a different support, which differentiates the disclosed methods from other in-sample sequencing methods.
[0152] The support can be fabricated into any shape and size. The support can comprise glass or plastic. The support can comprise a planar surface having walls to contain the cellular sample and liquids, such as for example, liquid cell culture medium and reagents for library preparation and sequencing. The support can be configured to include at least two wells. Individual wells can be loaded with different types of cellular samples. Assembly of aAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)hybridization chamber on the support is not needed. Preparation of chemically-washed glass beads for cell adherence is not needed.
[0153] In some embodiments, the support is a flow cell. In some embodiments, the support is a flow cell compatible with a high throughput sequencing system. Exemplary flow cells and high throughput sequencing systems are described, for example, in WO2025 / 062341, WO2025 / 024672, WO2025 / 196650, WO2025 / 235016, W02020 / 118255, WO2021 / 252671, WO2024 / 118641, WO2024 / 151556, WO2024 / 158927, WO2024 / 173403, WO2024 / 243548 and WO2025 / 235781, the contents of which are incorporated by reference in their entireties herein.
[0154] The support can be passivated with a coating that promotes cell adhesion to the support. The coating does not need to be formulated to include tethered capture primers. The support, having a cell sample adhered thereon, can be easily adapted to fit into an existing flowcell holder / cradle which is fluidi cally connected to an automated fluid dispensing system and configured on an imaging system.
[0155] The disclosed methods can be performed in an automated mode using a fluid dispensing system, including cell seeding, cell fixation, cell permeabilization, primer hybridization, library' preparation, library circularization, rolling circle amplification, and sequencing.
[0156] In some embodiments the methods can be conducted within a cellular sample including a single cell, cell suspension, multiple cells, a tissue, organ, organoid, purified cells from a blood sample, tumor cells from a patient sample, subcultures or cells adhered to a support.
[0157] The disclosed methods have many uses including unbiased digital detection of RNA or DNA targets in a sample. Those targets can be any of the following but not limited to specific RNAs of interest, mutant RNA sequences, splice variants, and their abundance levels thereof. Further targets include RNAs used to perturb gene expression in cells of the sample, including, but not limited to CRISPR-Cas guide RNAs (gRNAs), small interfering RNAs (siRNAs), antisense RNAs (asRNAs), short hairpin RNAs (shRNAs) and microRNAs.
[0158] In some embodiments, the disclosed methods comprise conducting batch sequencing of different sub-populations of concatemer template molecules, wherein each sub-population of concatemer template molecules carries a batch-specific sequencing primer binding site.
[0159] One of the purposes of the disclosed methods is to detect and image the spatial localization of polynucleotides within a cellular sample using massively parallel sequencing.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0160] In some embodiments, the cellular sample can be exposed to at least one challenge condition that can cause a change in cell morphology or physiology, a change in RNA expression and / or a change in protein expression. The at least one challenge condition includes, without limitation, a temperature change, a pH change, a change in light exposure, a change in a dark condition, nutrient deprivation, nutrient addition, toxin exposure, chemical compound exposure and / or drug exposure. The at least one challenge condition includes exposing the cellular sample to different concentrations of at least one nutrient, at least one toxin, at least one chemical compound and / or at least one drug. The at least one challenge condition includes exposing the cellular sample to at least one challenge condition for different lengths of time. The challenged cellular sample can then be subjected to the disclosed methods to reveal changes in transcriptomics, proteomics and cellular morphology in response to the at least one challenge condition. The in situ sequencing methods described herein, in combination with the at least one challenge condition, permit visualization of changes in the spatial location of the compact concatemer template molecules (e.g., DNA nanoballs), which correspond to the spatial location of target organelles, target RNA and target proteins inside the cellular sample.
[0161] The disclosed methods comprise the following general steps. The cellular sample is placed on a support and optionally cultured under a condition suitable for promoting cell proliferation, migration, differentiation and / or adhesion. The support can be positioned on an imaging system which includes, but is not limited, to a fluorescence imaging system and / or a chemiluminescence imaging system. The cellular sample can be treated with a chemical fixation reagent to retain the polynucleotides inside the sample. The cellular sample can also be treated with a permeabilization reagent to permit manipulation of the polynucleotides inside the cells. In some embodiments, the cellular sample is not treated with a chemical fixation reagent. In some embodiments, the cellular sample is not treated with a permeabilization reagent. The polynucleotides inside the cellular sample, including target RNA, can be selectively hybridized to nucleic acid primers for generating cDNA that corresponds to the target RNA molecules. The nucleic acid primers can hybridize to at least a portion of a target RNA molecule or can hybridize to a poly-A region of an RNA molecule. The nucleic acid primers can carry' at least a universal adaptor for a sequencing primer binding site. The nucleic acid primers can optionally carry an identification tag sequence that can be used to identify characteristics of the target RNA molecules and / or the cellular sample. The cDNA can form part of a linear library molecule that can be circularized to form covalently closed circular cDNA library molecules which are amplified inside the cellularAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)sample via rolling circle amplification to generate concatemer template molecules. The concatemer template molecules collapse to form compact DNA nanoballs inside the cellular sample. The concatemer template molecules are sequenced inside the cellular sample. The cellular sample remains on the same support throughout this method.
[0162] The methods disclosed herein offer several advantages over other library preparation methods used in combination with sequencing. There are no separate purification or cleanup steps required to generate the library molecules. For example, clean-up steps involving bead or column purification are not needed. In the disclosed methods, nucleic acid barcode or index sequences are not needed to identify the cellular samples. Instead, sequencing-based cell painting can be employed to identify the cellular sample and / or different cellular samples can be loaded into different wells of the support. It is also possible to create a droplet technique to deposit samples on a flow cell at high sample numbers and the imaging system resolution is the only limitation to the total sample number.
[0163] After conducting the direct in-sample library preparation steps, amplification can be performed to generate amplicons, and the amplicons can be sequenced using any sequencing modality to identify the sequences of the target polynucleotides. The in-sample sequencing method can include, but is not limited to, sequencing-by-synthesis, sequencing- by-binding, pyrosequencing, or sequencing using multivalent molecules. Sequencing using multivalent molecules provides low phasing and pre-phasing signals in a cellular sample which are advantages not shared with other sequencing methods. Exemplary sequencing methods are described, for example, in WO2022 / 266470, WO2024 / 159166, W02024 / 040058, W02024 / 124008, WO2025 / 196727, WO2025 / 196731, WO2025 / 120579, WO2025 / 024465, WO2025 / 147667, WO2025 / 212654, WO2025 / 212655, WO2025 / 163526, WO2025 / 165512, WO2025 / 239936, W02020 / 102766, WO2022 / 094332, W02023 / 205707 and W02020 / 243017, the contents of which are incorporated by reference in their entireties herein.
[0164] Another advantage of the methods disclosed herein is the formation of concatemer template molecules inside the cellular sample. The concatemers collapse into compact DNA nanoballs, where each nanoball carries numerous tandem copies of a polynucleotide unit along their lengths, where the polynucleotide unit includes an RNA sequence-of-interest (or a complementary sequence thereof) and at least a universal sequencing primer binding site. Individual polynucleotide units can bind a sequencing primer, a sequencing polymerase and a detectably-labeled nucleotide reagent (e.g., detectably labeled multivalent molecules), to form a detectable sequencing complex (e.g., a detectable ternary complex). Each nanoballAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)carries numerous detectable sequencing complexes. Thus, the compact nature of the nanoballs increases the local concentration of detectably-labeled nucleotide reagents that are used during the sequencing workflow which increases the signal intensity emitted from a nanoball to give a discrete detectable signal which can be imaged as a fluorescent spot inside the cellular sample. Each spot corresponds to a concatemer and each concatemer corresponds to a target RNA molecule in the cellular sample. Multiple spots can be detected and imaged simultaneously in the cellular sample. Alternatively, multiple spots can be detected and imaged in separate batches in the cellular sample.
[0165] A concatemer template molecule includes multiple sequencing primer binding sites along the same concatemer template molecule which can be used to generate multiple usable sequencing reads for increased sequencing depth. Sequencing multiple regions on one strand of the concatemer template increases sequencing base coverage and sequencing depth compared to sequencing a one-copy template molecule.
[0166] The methods disclosed herein can be conducted in uni-plex or multi-plex modes. Two or more different target RNAs can be detected and imaged simultaneously inside a cellular sample using different target-specific primers, and universal sequencing primers. For example, the presence of a housekeeping RNA and at least one target RNA in a cellular sample can be simultaneously detected and imaged using any of the sequencing methods disclosed herein. In some embodiments, at least 10, at least 20, at least 50, at least 100, at least 200, or at least 500, at least 750, or at least 1000 different target RNAs can be detected and imaged simultaneously inside a cellular sample. In some embodiments, between 1 and about 1,000, between 10 and about 750, between 10 and about 500, between about 30 and about 200, between 5 and about 50, between 25 and about 100, between about 100 and about 400, or between about 200 and about 500 different target RNAs can be detected and imaged simultaneously inside a cellular sample.
[0167] In the methods disclosed herein, the RNA is not extracted from the cellular sample and sequencing information does not need to be tracked and mapped back to an image of the cellular sample. Rather, RNA is retained inside the cellular sample to permit direct imaging of the spatial location of target RNAs within the cells. Additionally, RNA within the cellular sample is not fragmented and enrichment of target RNA is not necessary. Use of target¬ specific and / or random-sequence primers enables detection of both poly-A and non-poly-A RNAs in either uni-plex or multi-plex modes.
[0168] The methods disclosed herein offer several advantages over other in-sample transcriptomics workflows, including a simpler workflow, fewer reagents, lower cost, lessAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)time, gentler conditions on the cellular sample, and no requirement for specialized equipment.Methods for Conducting Direct In-Sample Sequencing
[0169] The present disclosure provides methods for conducting direct in-sample sequencing comprising: step (a): depositing a cellular sample onto a support, or providing a cellular sample on a support. The cellular sample can comprise a plurality of target polynucleotide molecules (also referred to herein as “target polynucleotides” and similar) including a plurality of target DNA molecules and / or a plurality of target RNA molecules. In some embodiments, the target polynucleotides are located at one or more spatial positions inside the cellular sample. In some embodiments, the cellular sample is fixed and permeabilized. In some embodiments, the cellular sample is fixed but is not permeabilized. In some embodiments, the cellular sample is not fixed or permeabilized. In some embodiments, the cellular sample can be contacted with a reagent that catalyzes de-crosslinking of molecular crosslinks inside the cellular sample. In some embodiments, the de-crosslinking step can be omitted.
[0170] In some embodiments, in step (a), the cellular sample comprises, without limitation a single cell, multiple cells, a cell suspension, a subculture, adherent cells, one or more tissues, cells from a blood sample, tumor cells from a patient sample, or portions thereof. Cells purified from a blood sample can comprise white blood cells including lymphocytes, monocytes, granulocytes, stem cells, or any combination thereof. In some embodiments, the cellular sample comprises cells from any organism, any combination of organisms (such as a biofilm or infected tissue) or cells from any organ. In some embodiments, the cellular sample comprises cells from any cell line. In some embodiments, the cellular sample comprises healthy cells, diseased cells or a mixture of both. In some embodiments, the diseased cells comprise cancer cells. In some embodiments, the diseased cells comprise cells infected with a virus or bacteria. In some embodiments, the cellular sample comprises cells from an organoid or tumor organoid. In some embodiments, the cellular sample comprises transgenic cells, including, without limitation, chimeric antigen receptor T cells (CAR T-cells).
[0171] In some embodiments, in step (a), the cellular sample comprises a plurality of target DNA molecules including at least a first sub-population of target DNA molecules and a second sub-population of target DNA molecules.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0172] In some embodiments, in step (a), the cellular sample harbors a plurality of target RNA molecules including at least a first sub-population of target RNA molecules and a second sub-population of target RNA molecules.
[0173] In some embodiments, the cellular sample of step (a) harbors 2-25 different target polynucleotide molecules, or harbors 25-50 different target polynucleotide molecules, or harbors 50-75 different target polynucleotide molecules, or harbors 75-100 different target polynucleotide molecules, or harbors 2-200 different target polynucleotide molecules. In some embodiments, the cellular sample comprises more than 100 different target polynucleotide molecules, or more than 250 different target polynucleotide molecules, or more than 500 different target polynucleotide molecules, or more than 1000 different target polynucleotide molecules, or more. In some embodiments, the cellular sample harbors more than 10,000 different target polynucleotide molecules. Target polynucleotide molecules are considered to be “different” if they include one or more differences in sequence. The skilled artisan will appreciate that even single sequence differences, such as single nucleotide polymorphisms, can produce target polynucleotide molecules that are different from other target polynucleotide molecules.
[0174] In some embodiments, in step (a), the cellular sample can be deposited (e.g.. seeded) onto a support comprising a planar or non-planar support. In some embodiments, the support comprises a solid or semi-solid support. In some embodiments, the support comprises a porous, semi-porous or non-porous support. The support can be made of any material such as glass, plastic or a polymer material. In some embodiments, the support can be optically transparent. In some embodiments, the surface of the support can be coated with one or more compounds to produce a passivated layer on the support. In some embodiments, the passivated layer forms a porous or semi -porous layer.
[0175] In some embodiments, in step (a), the cellular sample can be deposited (e.g., seeded) onto a support comprising a planar surface and having walls to contain the cellular sample and liquids, such as for example, liquid cell culture medium and reagents for library preparation and sequencing. The support can be configured to include walls that form at least two wells. In some embodiments, individual wells can be loaded with different types of cellular samples.
[0176] Exemplary supports include, without limitation, flowcells. For example, the flowcell can have two or more channels or regions that can be seeded with two or more cellular samples.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0177] In some embodiments, step (a) comprises depositing one or more cellular samples onto one or more supports. The one or more cellular samples can include at least a first and second cellular sample. In some embodiments, the first and second cellular samples comprise the same type or different types of cellular samples. In some embodiments, the first and second cellular samples can be deposited onto the same support or different supports (e.g., the same or different flowcells). In some embodiments, the first cellular sample harbors a plurality of target polynucleotides including a plurality of target DNA molecules and / or a plurality of target RNA molecules. In some embodiments, the second cellular sample harbors a plurality of target polynucleotides including a plurality of target DNA molecules and / or a plurality of target RNA molecules. In some embodiments, at least one of the cellular samples deposited onto the support can be exposed to a challenge condition that causes a morphological change, a change in RNA expression and / or a change in protein expression. Alternatively, in some embodiments, none of the cellular samples deposited onto the support are exposed to a challenge condition. In some embodiments, exposing the cellular samples to a challenge condition can be omitted.
[0178] In some embodiments, step (a) comprises challenging the cellular sample to induce a morphological change, a physiological change, or a change in gene expression in the cells of the cellular sample.
[0179] In some embodiments, the cellular sample is challenged prior to fixation and / or permeabilization.
[0180] In some embodiments, step (a) comprises exposing the first cellular sample to at least one challenge condition and exposing the second cellular sample to no challenge condition (e.g., a control cellular sample). In some embodiments, the first cellular sample exhibits a morphological or phenotypic change in response to exposure to the at least one challenge condition. In some embodiments, the second cellular sample exhibits little or no morphological or phenotypic change. In some embodiments, the first cellular sample exhibits a change in RNA expression in response to exposure to the at least one challenge condition. In some embodiments, the second cellular sample exhibits little or no change in RNA expression.
[0181] In some embodiments, step (a) comprises exposing the first cellular sample to the at least one challenge condition before or after depositing the cellular sample onto the support.
[0182] In some embodiments, step (a) comprises exposing the first cellular sample to the at least one challenge condition prior to cell fixation and permeabilization.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0183] In some embodiments, the at least one challenge condition at step (a) comprises a temperature change, a pH change, light exposure, a dark condition, a nutrient deprivation, a nutrient addition, a toxin exposure, a chemical compound exposure and / or a drug exposure.
[0184] In some embodiments, step (a) comprises exposing the first cellular sample to one or any combination of two or more challenge conditions including a temperature change, a pH change, a change in light exposure, a change in a dark condition, nutrient deprivation, nutrient addition, toxin exposure, chemical compound exposure and / or drug exposure.
[0185] In some embodiments, step (a) comprises exposing the first cellular sample to at least one challenge condition for different lengths of time.
[0186] In some embodiments, step (a)comprises exposing the first cellular sample to different concentrations of at least one nutrient, at least one toxin, at least one chemical compound and / or at least one drug.
[0187] In some embodiments, step (a) comprises observing the morphological change, physiological change or change in gene expression.
[0188] In some embodiments, step (a) comprises observing a morphological change, physiological change, or a change in gene expression of the first cellular sample in response to the at least one challenge condition. In some embodiments, step (a) comprises comparing the morphological change of the first cellular sample with the little or no morphology change of the second cellular sample. In some embodiment, observing a morphological change of the first cellular sample is omitted.
[0189] In some embodiments, step (a) comprises observing morphological changes, physiological changes, or changes in gene expression exhibited by the first cellular sample after exposure to the at least one challenge condition. Morphological, physiological and gene expression changes include, without limitation, a change in cell size (e.g., change in cell diameter and / or cell area), a change in cell shape, a change in cell division, a change in growth pattern, a change in the level of confluency, a change in cell motility, a change in nuclear size, a change in the cellular location of a protein-of-interest, a change in intracellular protein-protein interaction, a change in the presence or absence of a cell surface protein, and / or a change in the structure or arrangement of organelles including mitochondria. In some embodiments, the morphological change includes a change in cell resistance or a change in cell sensitivity to a challenge condition. In some embodiments, the morphological change includes apoptosis. The skilled artisan will appreciate that the cellular sample can exhibit other morphological changes in response to the at least one challenge condition. In some embodiments, the changes in gene expression include changes in the expression level ofAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)one or more cellular RNAs, or a change in the subcellular localization of one or more cellular RNAs.
[0190] In some embodiments, in step (a), the first and / or second cellular samples can be subjected to cell staining, and the morphology of the first and second cellular samples can be observed and compared. In some embodiments, the first and / or second cellular samples can be subjected to staining to visualize the morphology of the organelles, cytoplasm and / or cellular membrane. Exemplary nuclear stains comprise: Hoechst® 33342, DAPI and RedDot® Far-Red. Exemplary mitochondrial stains comprise: JC-1, MitoTracker® Orange, MitoTracker Red, MitoTracker Deep Red, TMRE (Tetramethylrhodamine ethyl ester) and TMRM (Tetramethylrhodamine ethyl ester). Exemplary endoplasmic reticulum stains comprise: cresyl violet, (DIOC6) 3,3 '-Dihexyloxacarbocyanine Iodide, CellLight® ER-GFP, ER-RFP, and glibenclamide-based probes including ER-Tracker® Red, ER-Tracker Green, and LumiTrackerTM. Exemplary stains for Golgi apparatus comprise: NBD-C6-ceramide, BODIPY FL C5-ceramide, BODIPY® TR ceramide, and fluorescently labeled wheat germ agglutinin or concanavalin A. Exemplary cytoplasm stains comprise: eosin, calcein-AM and fluorescently labeled phalloidin. In some embodiments, the cell staining of the first and / or second cellular samples can be omitted. In some embodiments, observing the morphological changes in the first and / or second cellular sample can be omitted.
[0191] In some embodiments, in step (a), the first and / or second cellular samples can be subjected to sequencing-based cell painting as described herein, and the morphology of the first and second cellular samples can be observed and compared. In some embodiments, the sequencing-based cell painting can visualize the morphology of organelles. The sequencing-based cell painting can employ any of the primary antibody bridge circle complexes, bipartite complexes and target-specific cell paint primers described herein. In some embodiments, the sequencing-based cell painting of the first and / or second cellular sample can be omitted.
[0192] In some embodiments, the methods comprise step (b): generating a plurality of target-primer duplexes by contacting the plurality of target polynucleotides inside the cellular sample with a plurality of nucleic acid primers. In some embodiments, individual nucleic acid primers comprise (i ) a 5’ region comprising at least one universal adaptor sequence, and optionally one or more identification tag sequences, and (ii) a 3’ region comprising a sequence that is complementary to at least a portion of one of the target polynucleotides. In some embodiments, the 5’ regions of the nucleic acid primers are designed to exhibit little or no hybridization to the target polynucleotides.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0193] In some embodiments, in step (b), the plurality of nucleic acid primers comprises a plurality of a first nucleic acid primer that can bind at least a portion of one of the target polynucleotides, thereby generating a target-primer duplex.
[0194] In some embodiments, in step (b), the plurality of nucleic acid primers comprises a mixture of different nucleic acid primers, wherein individual nucleic acid primers in the mixture can bind to different target polynucleotides, thereby generating a plurality of target¬ primer duplexes. In some embodiments, individual nucleic acid primers in the mixture comprise different sequences in their 3’ regions that can bind to different target polynucleotides. In some embodiments, individual nucleic acid primers in the mixture comprise the same universal adaptor sequence in their 5’ regions. For example, the plurality of target polynucleotide molecules comprises a first plurality of polynucleotides compri sing a first sequence and second plurality of polynucleotides comprising a second sequence that is not the same as (i.e. different from) the first sequence. The plurality of nucleic acid primers can comprise a first nucleic acid primer comprising a first 3’ region comprising a sequence that is compl ementary to at least a portion of the first sequence, and optionally a first identification tag sequence identifying the first plurality of polynucleotides, and the plurality of plurality of nucleic acid primers can comprise a second nucleic acid primer comprising a second 3’ region comprising a sequence that is complementary to at least a portion of the second sequence and optionally a second identification tag sequence identifying the second plurality of polynucleotides, and the first and second identification tag sequences are not the same sequence.
[0195] In some embodiments, in step (b), the plurality of nucleic acid primers comprises a first and second nucleic acid primer that can bind to different non-overlapping regions of the same target polynucleotide, thereby generating two target-primer duplexes on the same target polynucleotide (e.g., tiled primers). In some embodiments, the plurality of nucleic acid primers comprise 2-100 (e.g., 2-10, 5-25, 10-50, 10-80, 50-100 or any range therebetween) different nucleic acid primers, wherein individual nucleic acid primers can bind to different non-overlapping regions of the same target polynucleotide thereby generating 2-100 (e.g., a plurality) target-primer duplexes on the same target polynucleotide. In some embodiments, the different target-primer duplexes on the same target polynucleotide can be spaced apart about 1-100 nucleotides, or about 100-250 nucleotides, or about 250-500 nucleotides, or about 500-750 nucleotides, or about 750-1000 nucleotides, or any range therebetween.
[0196] In some embodiments, step (b) can be conducted under a condition suitable for moving the plurality of nucleic acid primers into the cellular sample and binding individualAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)nucleic acid primers to at least a portion of their target polynucleotide molecules inside the cellular sample, thereby generating a plurality of target-primer duplexes.
[0197] In some embodiments, in step (b), the 3’ region of at least one of the nucleic acid primers in the plurality comprises a target-specific sequence that can hybridize to a region of a target RNA molecule.
[0198] In some embodiments, in step (b), the 3’ region of at least one of the nucleic acid primers in the plurality comprises a target-specific sequence that can hybridize to a target sequence in a target RNA molecule.
[0199] In some embodiments, in step (b), the 3’ region of at least one of the nucleic acid primers in the plurality comprises a poly-T sequence that can hybridize to a poly-A sequence in a target RNA molecule. In some embodiments, the poly-T sequence comprises 5-50 consecutive thymine bases.
[0200] In some embodiments, in step (b), the 3’ region of at least one of the nucleic acid primers in the plurality comprises a random sequence that can hybridize to at least one RNA molecule. In some embodiments, the random sequence comprises any combination of two or more of A, G, C and / or T. In some embodiments, the random sequence can be 4-50 (e.g., 4-8, 4-10, 5-20, 10-50, 15-25 or any range therebetween) bases in length.
[0201] In some embodiments, in step (b), the 3’ region of at least one of the nucleic acid primers in the plurality comprises a poly-T sequence and a random sequence. In some embodiments, the poly-T sequence in the 3’ region of the nucleic acid primer can hybridize to a poly-A sequence in a target RNA molecule. In some embodiments, the poly-T sequence comprises 5-50 consecutive thymine bases. In some embodiments, the random sequence in the 3’ region of the nucleic acid primer can hybridize to a region that is upstream of the poly-A sequence in the target RNA molecule. In some embodiments, the random sequence comprises any combination of two or more of adenine, guanine, cytosine and / or thymine bases. In some embodiments, the random sequence can be 4-50 (e.g., 4-8, 4-10, 5-20, 10-50, 15-25 or any range therebetween) bases in length.
[0202] In some embodiments, in step (b), the plurality of nucleic acid primers comprises a mixture of (1) nucleic acid primers having a 3’ region comprising a target-specific sequence that can hybridize to a target RNA molecule, and (2) nucleic acid primers having a 3’ region comprising a poly-T sequence that can hybridize to a poly-A sequence in a target RNA molecule.
[0203] In some embodiments, in step (b), the 5’ region of individual nucleic acid primers in the plurality comprises any one or any combination of two or more of a universal bindingAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)site for a forward sequencing primer, a universal binding site for a reverse sequencing primer and / or a universal binding site for an amplification primer. In some embodiments, the 5’ region of individual nucleic acid primers comprises a universal binding site for a compaction oligonucleotide.
[0204] In some embodiments, in step (b), the 5’ region of individual nucleic acid primers comprises at least one identification tag sequence. In some embodiments, the at least one identification tag sequence comprises a sample index sequence that can be used in a multiplex workflow to distinguish different target polynucleotide molecules that originate from different sources. In some embodiments, the at least one identification tag sequence comprises a unique molecular index (UMI) that can be used to uniquely identify individual target polynucleotide molecules (or cDNA molecules) to which the unique molecular index sequence is appended in a population of other target polynucleotide molecules (e.g., molecular tagging). In some embodiments, the at least one identification tag sequence can identify a cell type or tissue type. In some embodiments, the at least one identification tag sequence comprises a target barcode sequence that can be used to identify a target polynucleotide molecules (e.g., a target RNA molecule).
[0205] In some embodiments, in step (b), the at least one identification tag sequence can be used to identify a growth medium used to grow the cellular sample, or a stress condition used to challenge the cellular sample including, but not limited to, temperature changes, pH, light, nutrient deprivation, nutrient addition, toxin exposure, chemical compound exposure and / or drug exposure.
[0206] In some embodiments, in step (b), the 5’ region of the nucleic acid primers comprises a short random sequence comprising 3-20 nucleotides in length (e.g, NNN), or any range therebetween. The short random sequence can be designed, for example, to provide nucleotide diversity and color balance generated by the detectable signals during a sequencing workflow. In some embodiments, the nucleic acid primers lack a short random sequence.
[0207] In some embodiments, nucleotide diversity and color balance of the plurality of nucleic acid primers employed at step (b) can be improved by the addition of a plurality of spike-in primers. The plurality of spike-in primers can be added to the plurality of nucleic acid primers, where the spike-in primers provide nucleotide diversity and color balance during a subsequent sequencing workflow.
[0208] In some embodiments, step (b) comprises generating a plurality of target-primer duplexes by contacting the plurality of target polynucleotide molecules inside the cellularAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)sample with a plurality of nucleic acid primers and a plurality of spike-in primers. In some embodiments, the plurality of target polynucleotides can be contacted with the plurality of nucleic acid primers and the plurality of spike-in primers essentially simultaneously or in separate batches. In some embodiments, the spike-in primers can be used to hybridize to RNA and synthesize cDNA in a reverse transcription reaction, and the cDNA can be amplified to generate amplification products that are sequenced. In some embodiments, sequencing at least a portion of the amplification products that are generated from spike-in primers can provide nucleotide diversity and color balance generated by the detectable signals during a sequencing workflow. In some embodiments, the amplification products that are generated from spike-in primers and the amplification products that are generated from the nucleic acid primers can be sequenced essentially simultaneously or in separate batches. In some embodiments, individual spike-in primers comprise a 5’ region having a universal binding site for a forward sequencing primer and an optional diversity barcode sequence comprising 3-50 nucleotides in length, or any range therebetween. In some embodiments, individual spike-in primers comprise-a 3’ region having a target-specific sequence, a homopolymer sequence, or a random sequence. Exemplary homopolymer sequences include poly-A, poly-T, poly-C, poly-G or poly-U sequences. In some embodiments, the 5’ region of the spike-in primers are designed to exhibit little or no hybridization to the target polynucleotides. In some embodiments, the 3’ region of the spike-in primers are designed to hybridize to the target polynucleotides. In some embodiments, contacting the plurality of target polynucleotides inside the cellular sample with a plurality of spike-in primers can be omitted.
[0209] In some embodiments, in step (b), individual spike-in primers comprise a 5’ region comprising (i) a universal binding site for a forward sequencing primer and (ii) a diversity barcode sequence comprising 3-50 nucleotides in length, and a 3’ region comprising a poly-T sequence that can hybridize to a poly-A region of an RNA molecule. In some embodiments, the diversity barcode sequence comprises a pre-determined non-random sequence or a random sequence (e.g., NNN). In some embodiments, the spike-in primers can be used to hybridize to poly-A RNA, thereby generating a plurality of target-primer duplexes and synthesize cDNA in a reverse transcription reaction, and the cDNA can be amplified to generate amplification products that are sequenced. In some embodiments, sequencing at least a portion of the amplification products that are generated from spike-in primers can provide nucleotide diversity and color balance generated by the detectable signals during a sequencing workflow. In some embodiments, sequencing at least a portion of the cDNAAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)region of the amplification products that are generated from spike-in primers can provide nucleotide diversity and color balance generated by the detectable signals during a sequencing workflow. In some embodiments, sequencing the diversity barcode region of the amplification products that are generated from spike-in primers can provide nucleotide diversity and color balance generated by the detectable signals during a sequencing workflow. In some embodiments, in the diversity random barcode sequence each base “N” at a given position can be independently selected from A, G, C, T or U In some embodiments, the diversity random barcode sequence lacks consecutive repeat sequences having 2 or 3 of the same nucleo-base, for example, AA, TT, CC, GG, UU, AAA, TTT, CCC, GGG or UUU. In some embodiments, in a population of spike-in primers, the diversity random barcode sequence comprises a high diversity sequence which includes approximately equal proportions of all four nucleotides (e.g., A, G, C, T and / or U) that will be represented in each cycle of a sequencing run. In some embodiments, the diversity random barcode sequence includes, but is not limited to, AGC, AGT, GAC, GAT, CAT, CAG, TAG, TAC. The skilled artisan will recognize that many more diversity random barcode sequences can be prepared (e.g., 64 possible combinations) where each base “ T at a given position in the short random sequence is independently selected from A, G, C, T or U.
[0210] In some embodiments, in step (b), individual spike-in primers comprise a 5’ region comprising a universal binding site for a forward sequencing primer and a 3’ region comprising a random sequence having 15-50 nucleotides in length. In some embodiments, the random sequence of the 3’ region can hybridize to a portion of an RNA molecule. In some embodiments, the spike-in primers can be used to hybridize to a portion of RNA thereby generating a plurality of target-primer duplexes and synthesize cDNA in a reverse transcription reaction, and the cDNA can be amplified to generate amplification products that are sequenced. In some embodiments, sequencing at least a portion of the amplification products that are generated from spike-in primers can provide nucleotide diversity and color balance generated by the detectable signals during a sequencing workflow. In some embodiments, sequencing the cDNA region of the amplification products that are generated from spike-in primers can provide nucleotide diversity and color balance generated by the detectable signals during a sequencing workflow.
[0211] In some embodiments, in step (b), individual spike-in primers comprise a 5’ region comprising a universal binding site for a forward sequencing primer and a 3’ region comprising a poly-T sequence comprising 15-50 deoxythymidines. In some embodiments, the spike-in primers can be used to hybridize to poly-A RNA thereby generating a plurality ofAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)target-primer duplexes and synthesize cDNA in a reverse transcription reaction, and the cDNA can be amplified to generate amplification products that are sequenced. In some embodiments, sequencing at least a portion of the amplification products that are generated from spike-in primers can provide nucleotide diversity and color balance generated by the detectable signals during a sequencing workflow. In some embodiments, sequencing the cDNA region of the amplification products that are generated from spike-in primers can provide nucleotide diversity and color balance generated by the detectable signals during a sequencing workflow.
[0212] In some embodiments, step (b) comprises contacting the cellular sample with a mixture of primers including a plurality of any of the nucleic acid primers described herein and a plurality of any of the spike-in primers described here. In some embodiments, the mixture of primers comprises a small amount of spike-in primers compared to the amount of nucleic acid primers. In some embodiments, the mixture of primers comprises 1 part spike-in primers and 1-10 parts nucleic acid primers, 1 part spike-in primers and 10-50 parts nucleic acid primers, 1 part spike-in primers and 50-100 parts nucleic acid primers, 1 part spike-in primers and 100-250 parts nucleic acid primers, 1 part spike-in primers and 250-500 parts nucleic acid primers, 1 part spike-in primers and 500-750 parts nucleic acid primers, or 1 part spike-in primers and 750-1000 parts nucleic acid primers.
[0213] In some embodiments, the plurality of nucleic acid primers of step (b) comprise at least a first and second sub-population of nucleic acid primers. In some embodiments, the nucleic acid primers in the first and second sub-population can bind to different target RNA sequences. In some embodiments, the 3’ region of the nucleic acid primers of the first subpopulation differs from the 3’ region of the nucleic acid primers of the second sub¬ population.
[0214] In some embodiments, in step (b), the nucleic acid primers of the first sub¬ population can bind target RNA molecules of a first sub-population, thereby generating a first sub-population of target-primer duplexes. In some embodiments, the nucleic acid primers of the second sub-population can bind RNA molecules of a second sub-population thereby generating a second sub-population of target-primer duplexes. In some embodiments, the sequence of the target RNA molecules of the first sub-population differs from the sequence of the target RNA molecules of the second sub-population.
[0215] In some embodiments, step (b) optionally comprises: contacting the plurality of target polynucleotides inside cellular sample with a plurality of blocking oligonucleotides, wherein individual blocking oligonucleotides comprise a single-stranded oligonucleotideAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)having a sequence that can hybridize to one of the target RNA molecules at a position that is located 5’ to the hybridization position of one of the nucleic acid primers. In some embodiments, individual blocking oligonucleotides can hybridize to a position on the target RNA molecule that is downstream relative to the hybridization position of one of the nucleic acid primers. In some embodiments, the blocking oligonucleotide can hybridize to a position on a target RNA molecule so that the blocking oligonucleotide can inhibit progression of a primer extension reaction by a polymerase or reverse transcription enzyme. In some embodiments, individual blocking oligonucleotides comprise a terminal 3’ moiety that is nonextendible. In some embodiments, step (b) can be conducted under a condition suitable for moving the plurality of blocking oligonucleotides into the cellular sample and binding individual blocking oligonucleotides to at least a portion of their target RNA molecules inside the cellular sample thereby generating a plurality of blocked target-primer duplexes. In some embodiments, the cellular sample is not contacted with a plurality of blocking oligonucleotides.
[0216] In some embodiments, step (b) comprises generating a plurality of target-primer duplexes by contacting the plurality of target polynucleotides inside the first and second cellular samples with a plurality of nucleic acid primers. The nucleic acid primers can be target-specific. In some embodiments, individual nucleic acid primers comprise (i) a 5’ region comprising at least one universal adaptor sequence and optionally one or more identification tag sequences and (ii) a 3’ region comprising a sequence that is complementary to at least a portion of one of the target polynucleotides. In some embodiments, the 5’ regions of the nucl eic acid primers are designed to exhibit little or no hybridization to the target polynucleotides. In some embodiments, the plurality of nucleic acid primers comprise a plurality of 5’ tailed primers. In some embodiments, a 5’ tailed primer comprises (i) a 3’ region that can hybridize to at least a portion of a target polynucleotide thereby forming a nucleic acid duplex region, and (ii) a 5 ’ region that does not hybridize to the target nucleotide thereby generating a 5 ’ unpaired tail.
[0217] In some embodiments, step (b) comprises contacting the plurality of target polynucleotides inside the cellular sample with a hybridization reagent and any combination of the plurality of nucl eic acid primers, the plurality of spike-in primers, and / or the plurality of blocking primers. In some embodiments, the hybridization reagent comprise at least one compound that can reduce non-specific hybridization between the target polynucleotides and the nucleic acid primers, the spike-in primers and / or the blocking primers. In some embodiments, the hybridization reagent comprises any one or any combination of shearedAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)salmon sperm DNA, sheared herring sperm DNA, human Cot-1 DNA, BSA (bovine serum albumin), ficoll, PVP (polyvinylpyrrolidone), formamide, detergent (e.g., Tween-20, (SDS) sodium dodecyl sulfate), PEG 400 (Polyethylene Glycol 400), NHS-PEG (N-hydroxysuccinidie PEG) and / or heparin.
[0218] In some embodiments, the methods comprise step (c): conducting a polymerization reaction by contacting the plurality of target-primer duplexes inside cellular sample with a polymerization reagent under a condition suitable for initiating synthesis of cDNA from the plurality of target-primer duplexes thereby generating a plurality of primer-cDNA molecules each bound to their target molecule. In some embodiments, step (c) comprises conducting a polymerization reaction to synthesize complementary DNA (cDNA) by extending the plurality of nucleic acid primers. In some embodiments, for example those embodiments where the target polynucleotide molecules comprise DNA, the polymerization reagent comprises a polymerase and a plurality of nucleotides (dATP, dGTP, dCTP and / or dTTP). In some embodiments, for example those embodiments where the target polynucleotide molecules are RNA, the polymerization reaction comprises a reverse transcription reaction, and the polymerization reagent comprises a reverse transcription reagent. In some embodiments, the reverse transcription reagent comprises a plurality of reverse transcriptase enzymes and a plurality of nucleotides. In some embodiments, the plurality of nucleotides comprises any combination of dATP, dGTP, dCTP and / or dTTP. In some embodiments, step (c) can be conducted under a condition suitable for moving the polymerization reagent, for example reverse transcription reagent, into the cellular sample and binding the plurality of target-primer duplexes with the reverse transcription reagent. In some embodiments, the length of the synthesized cDNA can be about 10-30 nucleotides, or about 30-50 nucleotides, or about 50-80 nucleotides, or about 80-110 nucleotides, or about 110-150 nucleotides. In some embodiments, the length of the synthesized cDNA can be about 150-200 nucleotides. In some embodiments, the length of the synthesized cDNA can be about 200-2000 nucleotides, or about 2000-5000 nucleotides. In some embodiments, after the reverse transcription reaction, the target RNA molecules can be enzymatically degraded using an RNase enzyme. In some embodiments, after the reverse transcription reaction, the target RNA molecules are not enzymatically degraded using an RNase enzyme.
[0219] In some embodiments, the length of the cDNA can be predetermined when the plurality of target polynucleotide molecules is contacted with the plurality of target-specific nucleic acid primers and blocking oligonucleotides at step (b) thereby generating a plurality of blocked target-primer duplexes. In some embodiments, individual blockingAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)oligonucleotides comprise single-stranded oligonucleotides that can hybridize to a predetermined location on a given target polynucleotide molecule. In some embodiments, the 5’ end of the blocking oligonucleotide is a known distance from the 3’ end of a given target¬ specific nucleic acid primer. In some embodiments, the reverse transcription reaction of step (c) can generate a cDNA molecule having a 3’ end portion comprising a known sequence (e.g., pre-determined sequence). In some embodiments, the reverse transcription reaction of step (c) can generate a cDNA molecule having a length that is approximately the length as the predetermined length. In some embodiments, the approximate length of the cDNA molecule can be up to 10 nucleotides longer or up to 10 nucleotides shorter than the predetermined length.
[0220] In some embodiments, the target-primer duplexes comprise RNA target-primer duplexes, and the contacting of step (c) comprises contacting the target-primer duplexes of the first sub-population with a reverse transcription reagent. In some embodiments, the reverse transcription reagent comprises a plurality of reverse transcriptase enzymes and a plurality of nucleotides. In some embodiments, the reverse transcription reaction can be conducted under a condition suitable for conducting a primer extension reaction and initiating synthesis of cDNA from the plurality of nucleic acid primers, thereby generating a first subpopulation of primer-cDNA molecules comprising a sequence that is complementary to at least a portion of the target RNA molecules of the first sub-population, wherein individual primer-cDNA molecules are bound to their target RNA molecule.
[0221] In some embodiments, the target-primer duplexes comprise RNA target-primer duplexes, and the contacting of step (c) comprises contacting the target-primer duplexes of the second sub-population with a reverse transcription reagent. In some embodiments, the reverse transcription reagent comprises a plurality of reverse transcriptase enzymes and a plurality of nucleotides. In some embodiments, the reverse transcription reaction can be conducted under a condition suitable for conducting a primer extension reaction and initiating synthesis of cDNA from the plurality of nucleic acid primers, thereby generating a second sub-population of primer-cDNA molecules comprising a sequence that is complementary to at least a portion of the target RNA molecules of the second sub-population, wherein individual primer-cDNA molecules are bound to their target RNA molecule.
[0222] In some embodiments, the target-primer duplexes comprise RNA target-primer duplexes, and step (c) comprises conducting a reverse transcription reaction by contacting the plurality of target-primer duplexes inside the first and second cellular samples with a reverse transcription reagent under a condition suitable for initiating synthesis of cDNA from theAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)plurality of target-primer duplexes thereby generating a plurality of primer-cDNA molecules each bound to their target RNA molecule. In some embodiments, the reverse transcription reagent comprises a plurality of reverse transcriptase enzymes and a plurality of nucleotides. In some embodiments, the plurality of nucleotides comprises any combination of dATP, dGTP, dCTP and / or dTTP. In some embodiments, step (c) can be conducted under a condition suitable for moving the reverse transcription reagent into the first and second cellular sample and binding the plurality of target-primer duplexes with the reverse transcription reagent.
[0223] In some embodiments, the target-primer duplexes comprise RNA target-primer duplexes, and step (c) comprises conducting the reverse transcription reaction and adding an exonuclease reagent that can degrade single-stranded DNA and retain double-stranded DNA. In some embodiments, the exonuclease reagent can degrade the primers that are not hybridized to the target polynucleotides. In some embodiments, the exonuclease reagent can degrade the non-hybridized nucleic acid primers, spike-in primers, and / or blocking primers. In some embodiments, the exonuclease reagent comprises any one or any combination of E. coli exonuclease I, E. coli Reel exonuclease, exonuclease VII, exonuclease III and / or T5 exonuclease. In some embodiments, in step (c), the cellular sample can be contacted with the exonuclease reagent after conducting the reverse transcription reaction. In some embodiments, the exonuclease reaction is omitted.
[0224] In some embodiments, the methods comprise step (d): generating a plurality of linear cDNA library molecules. In some embodiments, step (d) comprises contacting the plurality of primer-cDNA molecules with a modifying reagent that appends at least one universal adaptor sequence to the 3’ ends of individual primer-cDNA molecules. In some embodiments, individual linear cDNA library molecules comprise a 5’ universal adaptor sequence (e.g., from the nucleic acid primer), a cDNA sequence that is complementary to the target polynucleotide molecule (e.g., target RNA molecule), and a 3’ universal adaptor sequence (e.g., appended by the modifying reagent). In some embodiments, the cDNA portion of the linear cDNA library molecule comprises the insert sequence. The modifying reagent can comprise any combination of at least one modifying enzyme (described further below), a plurality of nucleotides and / or oligonucleotides that mediate appending at least one universal adaptor sequence to the 3’ end of the primer-cDNA molecules. In some embodiments, step (d) can be conducted under a condition suitable for moving the modifying reagent into the cellular sample and binding the primer-cDNA molecules inside the cellular sample with the modifying reagent. Exemplary embodiments of step (d) are described below.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0225] In some embodiments, step (d) comprises generating a plurality of linear cDNA library molecules by contacting the plurality of primer-cDNA molecules inside the first and second cellular samples with a modifying reagent that appends at least one universal adaptor sequence to the 3’ ends of individual primer-cDNA molecules. In some embodiments, individual linear cDNA library molecules comprise a 5’ universal adaptor sequence (e g., from the nucleic acid primer), a cDNA sequence that is complementary to the target RNA, and a 3’ universal adaptor sequence (e g., appended by the modifying reagent). In some embodiments, the cDNA sequence of individual linear cDNA library molecules comprises an insert sequence, for example a target polynucleotide molecule sequence as described herein. The modifying reagent can comprise any combination of at least one modifying enzyme, a plurality of nucleotides and / or oligonucleotides that mediate appending at least one universal adaptor sequence to the 3’ end of the primer-cDNA molecules. In some embodiments, step (d) can be conducted under a condition suitable for moving the modifying reagent into the first and second cellular samples and binding the primer-cDNA molecules inside the first and second cellular samples with the modifying reagent. Exemplary embodiments of step (d) are described below.
[0226] In some embodiments, step (d) comprises generating a plurality of linear cDNA library molecules by contacting the plurality of primer-cDNA molecules inside the first and second cellular samples with a modifying reagent that can append at least one universal adaptor sequence to the 3’ end of individual primer-cDNA molecules. In some embodiments, individual linear cDNA library molecules comprise a 5’ universal adaptor sequence (e.g., from the nucleic acid primer), a cDNA sequence that is complementary to the target RNA, and a 3’ universal adaptor sequence (e.g., generated by the modifying reagent). The modifying reagent can comprise any combination of at least one modifying enzyme, a plurality of nucleotides and / or oligonucleotides that mediate appending at least one universal adaptor sequence to the 3’ end of the primer-cDNA molecules. In some embodiments, step (d) can be conducted under a condition suitable for moving the modifying reagent into the first and second cellular samples and binding the primer-cDNA molecules inside the first and second cellular samples with the modifying reagent. Exemplary embodiments of step (d) are described below. The skilled artisan will appreciate that these are for illustrative purposes, and not intended to be limiting. Methods that disclose first and second cellular samples can also be employed with a single cellular sample, or more than two cellular samples.
[0227] In some embodiments, in step (d), the modifying reagent comprises doublestranded adaptors (e.g., double-stranded oligonucleotides) and a ligase enzyme. In someAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)embodiments, individual double-stranded adaptors comprise a first and second strand, wherein the first strand comprises a universal adaptor sequence, and the second strand comprises a 3’ portion that can hybridize to the 3’ end portion of the primer-cDNA molecule. In some embodiments, the first strand comprises a Cre loxP site that mediates Cre recombinase circularization. In some embodiments, the second strand of the double-stranded adaptor can form a 3’ overhang end. In some embodiments, step (d) comprises contacting the primer-cDNA molecules with the double-stranded adaptor and a ligase enzyme under a condition suitable for hybridizing the ’3 overhang end of the double-stranded adaptor to the 3’ end portion of the primer-cDNA molecule, and ligating the first strand to the 3’ end of the primer-cDNA molecule thereby generating a linear cDNA library molecule comprising a 5’ universal adaptor sequence from the primer, a cDNA sequence that is complementary to the RNA, and a 3’ universal adaptor sequence from the first strand of the double-stranded adaptor.
[0228] In some embodiments, in step (d), the modifying reagent comprises template switching oligonucleotides, a template-independent DNA polymerase, a reverse transcriptase enzyme, and a plurality of nucleotides. In some embodiments, the template-independent DNA polymerase comprises a DNA polymerase comprising a family A, family B or family X DNA polymerase. In some embodiments, the template-independent DNA polymerase can append a template-independent polynucleotide to the 3’ end of DNA. In some embodiments, the template-independent DNA polymerase can be encoded by a recombinant cloned terminal transferase gene from calf thymu s. In some embodiments, the plurality of nucleotides comprises a mixture of nucleotides (e.g., dATP, dGTP, dCTP and / or dTTP). In some embodiments, the plurality of nucleotides comprises one type of a nucleotide (e.g., dATP, dGTP, dCTP or dTTP). In some embodiments, the template switching oligonucleotide comprises a single-stranded DNA / RNA oligonucleotide having at least one universal adaptor sequence at its 5’ portion and a homo-polymer sequence at its 3’ portion. In some embodiments, the 5’ portion of the template switching oligonucleotide comprises a Cre loxP site that mediates Cre recombinase circularization. In some embodiments, the 5’ portion of the template switching oligonucleotide comprises two or more deoxyribonucleotides. In some embodiments, the 3’ portion of the template switching oligonucleotide comprises two or more ribonucleotides. In some embodiments, step (d) comprises contacting the primer-cDNA molecules with the template switching oligonucleotide, a template-independent DNA polymerase, a reverse transcriptase enzyme, and a plurality of nucleotides, under a condition suitable for extending the 3’ end of the primer-cDNA molecules and generating a template-Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)independent 3’ homopolymer tail, hybridizing the template switching oligonucleotide to the template-independent 3’ homopolymer tail, and extending the 3’ end of the templateindependent 3’ homopolymer tail to generate a cDNA sequence that is complementary to the at least one universal adaptor sequence at the 5’ portion of the template switching oligonucleotide, thereby generating a linear cDNA library molecule comprising a 5’ universal adaptor sequence from the primer, a cDNA sequence that is complementary to the RNA and a 3’ universal adaptor sequence that is complementary to the 5’ portion of the template switching oligonucleotide.
[0229] In some embodiments, in step (d), the modifying reagent comprises a template¬ independent DNA polymerase and a plurality of nucleotides. In some embodiments, the template-independent DNA polymerase comprises a DNA polymerase comprising a family A, family B or family X DNA polymerase. In some embodiments, the template-independent DNA polymerase can append a template-independent polynucleotide to the 3’ end of DNA. In some embodiments, the template-independent DNA polymerase can be encoded by a recombinant cl oned terminal transferase gene from calf thymus. In some embodiments, the modifying reagent comprises a template-independent DNA polymerase, a reverse transcriptase enzyme and a plurality of nucleotides. In some embodiments, the reverse transcriptase enzyme comprises MAXIMA H-MINUS®. In some embodiments, the plurality of nucleotides comprises one type of a nucleotide (e.g., dATP, dGTP, dCTP or dTTP). In some embodiments, step (d) comprises contacting the primer-cDNA molecules with the template-independent DNA polymerase and the plurality of nucleotides under a condition suitable for extending the 3’ end of the primer-cDNA molecules thereby generating a template-independent homopolymer tail, thereby generating a linear cDNA library molecule comprising a 5’ universal adaptor sequence from the primer, a cDNA sequence that is complementary to the RNA and a 3’ universal adaptor sequence comprising the templateindependent homopolymer tail.
[0230] In some embodiments, in step (d), the modifying reagent comprises a plurality of hairpin adaptors and a ligase. In some embodiments, individual hairpin adaptors comprise a single-stranded oligonucleotide comprising (i) a sequence near the 3’ portion that can hybridize with a 3’ portion of the primer-cDNA molecules, (ii) optionally a sequence near the 5’ portion that can hybridize with an internal portion of the hairpin adaptor to form a stable hairpin structure, and (iii) a loop between the 5’ and 3’ ends wherein the loop comprises at least one universal adaptor sequence and optionally at least one identification tag sequence. In some embodiments, step (d) comprises contacting the primer-cDNA molecules with theAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)plurality of hairpin adaptors and the ligase under a condition suitable for the hairpin adaptors to form hairpin structures, wherein individual hairpin adaptors comprise a 5’ portion that is hybridized to an internal portion of the hairpin adaptor, a loop, a 3’ end of the hairpin adaptor that is hybridized to at least a portion of one of the primer-cDNA molecules, and a nick formed between the 3’ end of the primer-cDNA molecule and the 5’ end of the hairpin adaptor, wherein the nick is enzymatically ligatable, and wherein the nick is closed using the ligase, thereby generating a linear cDNA library molecule comprising a 5’ universal adaptor sequence from the primer, a cDNA sequence that is complementary to the RNA and a 3’ universal adaptor sequence comprising the sequences of the hairpin adaptor.
[0231] In some embodiments, in step (d), the modifying reagent comprises a plurality of single- stranded adaptors, a plurality of single-stranded splint oligonucleotides and a ligase enzyme. In some embodiments, individual single-stranded adaptors comprise a universal adaptor sequence. In some embodiments, individual single-stranded adaptors comprise a Cre loxP site that mediates Cre recombinase circularization. In some embodiments, individual single-stranded splint oligonucleotides comprise (i) a 5’ portion that can hybridize with at least a portion of individual single-stranded adaptors, and (ii) a 3’ portion that can hybridize with the 3’ portion of a primer-cDNA molecule. In some embodiments, the single-stranded adaptor and the primer-cDNA molecule can hybridize to the single-stranded splint oligonucleotide forming a splint complex having a nick between the ends of the single stranded adaptor and the primer-cDNA molecule. The nick can be enzymatically ligatable. In some embodiments, step (d) comprises contacting the primer-cDNA molecules with the plurality of single- stranded adaptors, the plurality of single-stranded splint oligonucleotides and the ligase enzyme, under a condition suitable for (i) hybridizing the 5’ portion of individual single- stranded splint oligonucleotides to at least a portion of individual singlestranded adaptors, and (ii) hybridizing the 3’ portion of the same single-stranded splint oligonucleotide to the 3’ portion of a primer-cDNA molecule, thereby forming a complex having a nick between the ends of the single stranded adaptor and the primer-cDNA molecule, wherein the nick is enzymatically ligatable, and ligating the nick. The ligation of the nick can generate a linear cDNA library molecule comprising a 5’ universal adaptor sequence from the primer, a cDNA sequence that is complementary to the RNA, and a 3’ universal adaptor sequence from the single-stranded adaptor.
[0232] In some embodiments, step (d) is omitted, thereby generating individual linear cDNA library molecules comprising 5’ universal adaptor sequence from the primer, and a cDNA sequence that is complementary to the RNA. When step (d) is omitted, the linearAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)cDNA library molecules lack a 3’ adaptor sequence. In some embodiments, the plurality of primer-cDNA molecules are not contacted with a modifying reagent that can append at least one universal adaptor sequence to the 3’ end of individual primer-cDNA molecules. When step (d) is omitted, the method comprises performing step (e) after step (c).
[0233] In some embodiments, the methods comprise step (e): generating a plurality of open circle cDNA library' molecules by contacting the plurality of linear cDNA library molecules inside the cellular sample with a plurality of circularization primers. In some embodiments, individual circularization primers comprise single-stranded oligonucleotides comprising a 5’ end portion that can hybridize to the 5’ end portion of a linear cDNA library molecule, and a 3’ end portion that can hybridize to the 3’ end portion of the same linear cDNA library molecule. In some embodiments, the circularization primers comprise terminal 3’ extendible ends that can undergo polymerase-catalyzed primer extension reactions. In some embodiments, the circularization primers comprise terminal 3’ non-extendible ends that do not undergo polymerase-catalyzed primer extension reactions. In some embodiments, the terminal 3’ ends of individual circularization primers comprise blocking moieties that can be removed or converted to terminal 3’ extendible ends. In some embodiments, individual open circle cDNA library molecules comprise a nick or gap between the ends of the linear cDNA library molecule. In some embodiments, the contacting of step (e) comprises binding an individual circularization primers to an individual linear cDNA library molecule, thereby generating a plurality of open circle cDNA library molecules. In some embodiments, individual open circle cDNA library molecules comprise (i) a 5’ portion of a circularization primer hybridized to a 5’ end portion of the individual linear cDNA library molecule, (ii) a 3’ portion of the same circularization primer hybridized to a 3’ end portion of the same linear cDNA library molecule, and (iii) a gap or nick between the 5’ and 3’ ends of the linear cDNA library molecule. In some embodiments, the gap or nick can be closed with an enzymatic reaction. In some embodiments, step (e) can be conducted under a condition suitable for moving the plurality of circularization primers into the cellular sample and binding the plurality of circularization primers with the plurality of linear cDNA library molecules.
[0234] In some embodiments, the contacting of step (e) comprises contacting the linear cDNA library molecules of the first sub-population to circularization primers of a first sub¬ population thereby generating a first sub-population of open circle cDNA library molecules. In some embodiments, individual open circle cDNA library’ molecules of the first sub¬ population comprise (i) a 5’ portion of a first sub-population circularization primer hybridized to a 5’ end portion of a first sub-population linear cDNA library molecule, (ii) a 3’Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)portion of the same first sub-population circularization primer hybridized to a 3’ end portion of the same first sub-population linear cDNA library molecule, and (iii) a gap between the 5’ and 3’ ends of the first sub-population linear cDNA library molecule, wherein the gap can undergo a gap fill-in reaction using a gap fill-in reagent.
[0235] In some embodiments, the contacting of step (e) comprises contacting the linear cDNA library molecules of the second sub-population to circularization primers of a second sub-population thereby generating a second sub-population of open circle cDNA library molecules. In some embodiments, individual open circle cDNA library molecules of the second sub-population comprise (i) a 5’ portion of a second sub-population circularization primer hybridized to a 5’ end portion of a second sub-population linear cDNA library molecule, (ii) a 3’ portion of the same second sub-population circularization primer hybridized to a 3’ end portion of the same second sub-population linear cDNA library molecule, and (iii) a gap between the 5’ and 3’ ends of the first sub-population linear cDNA library molecule, wherein the gap can undergo to a gap fill-in reaction using a gap fill-in reagent.
[0236] In some embodiments, the contacting of step (e) comprises contacting linear cDNA library molecules of the first sub-population to circularization primers of a first sub¬ population thereby generating a first sub-population of open circle cDNA library molecules. In some embodiments, individual open circle cDNA library molecules of the first subpopulation comprise (i) a 5’ portion of a first sub-population circularization primer hybridized to a 5’ end portion of a first sub-population linear cDNA library molecule, (ii) a 3’ portion of the same first sub-population circularization primer hybridized to a 3’ end portion of the same first sub-population linear cDNA library molecule, and (iii) a nick between the 5’ and 3’ ends of the first sub-population linear cDNA library molecule. In some embodiments, the nick is enzymatically ligatable using a ligation reagent.
[0237] In some embodiments, the contacting of step (e) comprises contacting the linear cDNA library molecules of the second sub-population to circularization primers of a second sub-population thereby generating a second sub-population of open circle cDNA library molecules. In some embodiments, individual open circle cDNA library molecules of the second sub-population comprise (i) a 5’ portion of a second sub-population circularization primer hybridized to a 5’ end portion of a second sub-population linear cDNA library molecule, (ii) a 3’ portion of the same second sub-population circularization primer hybridized to a 3’ end portion of the same second sub-population linear cDNA library molecule, and (iii) a nick between the 5’ and 3’ ends of the second sub-population linearAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)cDNA library molecule. In some embodiments, the nick is enzymatically ligatable using a ligation reagent.
[0238] In some embodiments, step (e) comprises generating a plurality of open circle cDNA library molecules by contacting the plurality of linear cDNA library molecules inside the first and second cellular samples with a plurality of circularization primers. In some embodiments, individual open circle cDNA library molecules comprise a nick or gap between the ends of the linear cDNA library molecule. In some embodiments, the contacting comprises binding an individual circularization primer to one of the linear cDNA library molecules, thereby generating a plurality of open circle cDNA library molecules. In some embodiments, individual open circle cDNA library molecules comprise (i) a 5’ portion of one of the circularization primers hybridized to a 5' end portion of one of the linear cDNA library molecules, (ii) a 3’ portion of the same circularization primer hybridized to a 3’ end portion of the same linear cDNA library molecule, and (iii) a gap or nick between the 5’ and 3’ ends of the linear cDNA library molecule. In some embodiments, the gap and nick can be closed with an enzymatic reaction using an enzymatic closure reagent, such as a ligation reagent and / or gap fill-in reagent. In some embodiments, step (e) can be conducted under a condition suitable for moving the plurality of circularization primers into the first and second cellular samples and binding the plurality of circularization primers with the plurality of linear cDNA library molecules.
[0239] In some embodiments, the methods comprise step (f): generating a plurality of covalently closed circular cDNA library molecules by contacting the plurality of open circle cDNA library molecules inside cellular sample with an enzymatic closure reagent that can enzymatically close the gaps and / or nicks of the plurality of open circle cDNA library molecules. In some embodiments, step (f) can be conducted under a condition suitable for moving the enzymatic closure reagent into the cellular sample and contacting the enzymatic closure reagent to the plurality of open circle cDNA library molecules. In some embodiments, the enzymatic closure reagent comprises a ligase reagent. In some embodiments, the enzymatic closure reagent comprises a gap fill-in reagent and a ligase reagent. In some embodiments, individual covalently closed circular cDNA library molecules are hybridized to a circularization primer and one of the target polynucleotide molecules thereby generating a closed circle-target complex. In some embodiments, the circularization primers comprise a terminal 3’ extendible end. In some embodiments, the circularization primers comprise a terminal 3’ non-extendible end.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0240] In some embodiments, step (f) comprise contacting the open circle cDNA library molecules of the first sub-population with a gap fill-in reagent and a ligase reagent under a condition suitable for conducting a polymerase-catalyzed gap fill-in reaction thereby synthesizing a DNA strand having a sequence that is complementary to at least a portion of the circularization primer, and generating a nick that is enzymatically ligatable thereby generating a plurality of library-open circle complexes, and the condition is suitable for closing the nick, thereby generating a first sub-population of covalently closed circular cDNA library molecules. In some embodiments, individual covalently closed circular cDNA library' molecules in the first sub-population can be hybridized to a circularization primer and one of the target polynucleotide molecules thereby generating a closed circle-target complex. In some embodiments, the gap fill-in reagent comprises a plurality of DNA polymerases and a plurality of nucleotides. In some embodiments, the plurality of nucleotides comprises dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, the ligase reagent comprises a ligase enzyme.
[0241] In some embodiments, step (f) comprise contacting the open circle cDNA library molecules of the second sub-population with a gap fill-in reagent and a ligase reagent under a condition suitable for conducting a polymerase-catalyzed gap fill-in reaction thereby synthesizing a DNA strand having a sequence that is complementary to at least a portion of the circularization primer, and generating a nick that is enzymatically ligatable, thereby generating a plurality of library-open circle complexes, and the condition is suitable for closing the nick, thereby generating a second sub-population of covalently closed circular cDNA library molecules. In some embodiments, individual covalently closed circular cDNA library molecules in the second sub -population can be hybridized to a circularization primer and one of the target polynucleotide molecules thereby generating a closed circle-target complex. In some embodiments, the gap fill-in reagent comprises a plurality of DNA polymerases and a plurality of nucleotides. In some embodiments, the plurality of nucleotides comprises dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, the ligase reagent comprises a ligase enzyme.
[0242] In some embodiments, step (f) comprises contacting the open circle cDNA library molecules of the first sub-population with a ligase enzyme thereby generating a first sub¬ population of covalently closed circular cDNA library molecules. In some embodiments, individual covalently closed circular cDNA library molecules in the first sub-population can be hybridized to a circularization primer and one of the target polynucleotide molecules thereby generating a closed circle-target complex.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0243] In some embodiments, the contacting of step (f) comprises contacting the open circle cDNA library molecules of the second sub-population with a ligase enzyme, thereby generating a second sub-population of covalently closed circular cDNA library molecules. In some embodiments, individual covalently closed circular cDNA library molecules in the second sub-population can be hybridized to a circularization primer and one of the target polynucleotide molecules thereby generating a closed circle-target complex.
[0244] In some embodiments, the methods comprise step (f): contacting the plurality of open circle cDNA library molecules with a Cre recombinase under a condition suitable for mediating a Cre recombinase circularization reaction, thereby generating a plurality of covalently closed circular cDNA library molecules. In some embodiments, individual open circle cDNA library molecules comprise a linear cDNA library molecule comprising a 5’ universal adaptor sequence from the primer, a cDNA sequence that is complementary to the RNA, and a 3’ universal adaptor sequence comprising a Cre loxP site, according to any of the methods described in step (d) above.
[0245] In some embodiments, step (f) comprises generating a plurality of covalently closed circular cDNA library molecules by contacting the plurality of open circle cDNA library molecules inside the first and second cellular samples with an enzymatic closure reagent that can enzymatically close the gaps and / or nicks of the plurality of open circle cDNA library molecules. In some embodiments, step (f) can be conducted under a condition suitable for moving the enzymatic closure reagent into the first and second cellular samples and contacting the enzymatic closure reagent to the plurality of open circle cDNA library molecules. In some embodiments, the enzymatic closure reagent comprises a ligase reagent for closing a nick. In some embodiments, the enzymatic closure reagent comprises a gap fill- in reagent and a ligase reagent.
[0246] In some embodiments, the methods comprise conducting step (gl) or (g2). In some embodiments, step (gl) can be conducted without a plurality of fastening oligonucleotides. In some embodiments, step (g2) can be conducted with a plurality of fastening oligonucleotides.
[0247] In some embodiments, the methods comprise step (gl): generating a plurality of concatemer template molecules by contacting the plurality of covalently closed circular cDNA library molecules inside the cellular sample with a rolling circle amplification reagent under a condition suitable for conducting a rolling circle amplification reaction. In some embodiments, the rolling circle amplification reaction comprises initiating synthesis of DNA from the extendible 3’ ends of the circularization oligonucleotides and employing theAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)covalently closed circular cDNA library molecules as template molecules, thereby generating a plurality of concatemer template molecules inside the cellular sample. In some embodiments, individual concatemer template molecules comprise tandem repeat polynucleotide units, wherein individual polynucleotide units comprise a sequence that is complementary to one of the covalently closed circular cDNA library molecules. In some embodiments, individual concatemer template molecules can self-collapse to form a polony (e.g., DNA nanoball) having a compact size and shape compared to the individual concatemer template molecule. In some embodiments, the rolling circle amplification reagent comprises a plurality of strand-displacing polymerases and a plurality of nucleotides. In some embodiments, the plurality of nucleotides comprises any combination of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, the plurality of nucleotides comprises aminoallyl-dUTP, which can be subjected to cross-linking chemistry. Without wishing to be bound by theory, it is postulated that by incorporating aminoallyl -dUTP and contacting the cell with a cross-linking reagent such as a homobifunctional NHS ester or a heterobifunctional linkers (e.g., amine-to-azide, amine-to-thiol), aminoallyl-dUTP can be used to cross-link the concatemer template molecules to other polynucleotides or biomolecules, thereby preserving their spatial position(s) in the cellular sample. In some embodiments, step (gl) can be conducted under a condition suitable for moving the rolling circle amplification reagent into the cellular sample and binding the rolling circle reagent to the plurality of covalently closed circular cDNA library molecules.
[0248] In some embodiments, the contacting of step (gl) comprises contacting the first sub-population of covalently closed circular cDNA library molecules with a rolling circle amplification reagent comprising a plurality of a strand-displacing polymerase and a plurality of nucleotides, and conducting a rolling circle amplifi cation reaction, thereby generating a first sub-population of concatemer template molecules inside the cellular sample. In some embodiments, individual concatemer template molecules of the first sub-population comprise tandem repeat polynucleotide units. In some embodiments, individual polynucleotide unit comprise a sequence that is complementary to a covalently closed circular cDNA library molecule of the first sub-population. In some embodiments, the plurality of nucleotides comprises any combination of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, the plurality of nucleotides comprises aminoallyl-dUTP which can be subjected to cross-linking chemistry. In some embodiments, the plurality of nucleotides lacks aminoallyl-dUTP.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0249] In some embodiments, the contacting of step (gl) comprises contacting the second sub-population of covalently closed circular cDNA library molecules with a rolling circle amplification reagent comprising a plurality of a strand-displacing polymerase and a plurality of nucleotides, and conducting a rolling circle amplification reaction thereby generating a second sub-population of concatemer template molecules inside the cellular sample. In some embodiments, individual concatemer template molecules of the second sub-population comprise tandem repeat polynucleotide units. In some embodiments, individual polynucleotide unit comprises a sequence that is complementary to a covalently closed circular cDNA library molecule of the second sub-population. In some embodiments, the plurality of nucleotides comprises any combination of dATP, dGTP, dCTP, dTTP and / or dUTP, In some embodiments, the plurality of nucleotides comprises aminoallyl-dUTP which can be subjected to cross-linking chemistry. In some embodiments, the plurality of nucleotides lacks aminoallyl-dUTP.
[0250] In some embodiments, the methods for conducting direct in-sample sequencing comprise employing fastening oligonucleotides that are designed to retain the spatial position of the closed circle-target complexes inside the cellular sample. In some embodiments, individual closed circle-target complexes comprise a covalently closed circular cDNA library molecule hybridized to a circularization primer and a target polynucleotide. In some embodiments, the circularization primer of individual closed circle-target complexes comprise a terminal 3’ non-extendible end.
[0251] In some embodiments, the methods comprise step (g2): contacting the plurality of closed circle-target complexes inside the cellular sample with (i) a plurality of fastening oligonucleotides and (ii) a rolling circle amplification reagent. In some embodiments, individual fastening oligonucleotides comprise a single-stranded oligonucleotide comprising a 5’ portion that can hybridize to at least a portion of the target polynucleotide molecule and a 3’ portion that can hybridize to at least a portion of the covalently closed circular cDNA library molecule, thereby generating a closed circle-target-fastener complex. In some embodiments, the 5’ portion of the fastening oligonucleotide can hybridize to a portion of the target polynucleotide molecule that is 3’ (e.g., downstream) relative to the hybridization position of the covalently closed circular cDNA library molecule. In some embodiments, the 5’ portion of the fastening oligonucleotide can hybridize to a portion of the target polynucleotide molecule comprising a poly-A sequence or a non-poly-A sequence. In some embodiments, the 5’ end of the fastening oligonucleotide comprises a moiety that can be cross-linked to a biological molecule (e.g., a protein) inside the cellular sample. In someAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)embodiments, the terminal 3’ end of the fastener complex comprises a 3’ extendible end. In some embodiments, the terminal 3’ end of the fastener complex comprises a 3’ nonextendible end that can be converted to a terminal 3’ extendible end. In some embodiments, the circularization primer comprises a terminal 3’ non-extendible end.
[0252] In some embodiments, the fastening oligonucleotide comprises a 5’ portion, a 3’ portion and an internal portion between the 5’ portion and the 3’ portion. In some embodiments, the internal portion comprises a universal binding site for a compaction oligonucleotide.
[0253] In some embodiments, the 3’ portion of the fastening oligonucleotide can serve as a splint molecule by hybridizing to the 5’ and 3’ end regions of the linear cDNA library molecule to bring together the 5’ and 3’ ends of the linear cDNA library molecule, thereby forming a nick or gap. The 5’ portion of the fastening oligonucleotide can hybridize to a portion of the target polynucleotide. In some embodiments, the circularization primer of step (e) can be replaced with the fastening oligonucleotide which can be used as a splint to circularize the linear cDNA library molecule,
[0254] In some embodiments, the contacting of step (g2) is conducted under a condition suitable for hybridizing the 5’ portions of individual fastening oligonucleotides to at least a portion of the target polynucleotide molecules, and hybridizing the 3’ portions of the same fastening oligonucleotides to at least a portion of the covalently closed circular cDNA library molecules, thereby binding together an individual target polynucleotide and an individual covalently closed circular cDNA library molecule. In some embodiments, the spatial position of the closed circle-target-fastener complex inside the cellular sample exhibits little or no movement. In some embodiments, the spatial position of the closed circle-target-fastener complex inside the cellular sample is retained.
[0255] In some embodiments, the contacting of step (g2) is conducted under a condition suitable for conducting a rolling circle amplification reaction comprising initiating synthesis of DNA from the extendible 3’ ends of the fastener oligonucleotides and employing the covalently closed circular cDNA library molecules as template molecules, thereby generating a plurality of concatemer template molecules inside the cellular sample. In some embodiments, individual concatemer template molecules comprise tandem repeat polynucleotide units wherein individual polynucleotide units comprise a sequence that is complementary to an individual covalently closed circular cDNA library molecule. In some embodiments, individual concatemer template molecules can self-collapse to form a polony (e.g., DNA nanoball) having a compact size and shape compared to the individualAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)concatemer template molecule. In some embodiments, the rolling circle amplification reagent comprises a plurality of strand-displacing polymerases and a plurality of nucleotides. In some embodiments, the plurality of nucleotides comprises any combination of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, the plurality of nucleotides comprises aminoallyl-dUTP which can be subjected to cross-linking chemistry. In some embodiments, step (g2) can be conducted under a condition suitable for moving the fastening oligonucleotides and rolling circle amplification reagent into the cellular sample, and hybridizing the fastening oligonucleotides to the closed circle-target complexes.
[0256] In some embodiments, the contacting of step (g2) comprises contacting the first sub-population of covalently closed circular cDNA library molecules with a plurality of fastening oligonucleotides and a rolling circle amplification reagent comprising a plurality of a strand-displacing polymerase and a plurality of nucleotides, and conducting a rolling circle amplification reaction, thereby generating a first sub-population of concatemer template molecules inside the cellular sample. In some embodiments, individual concatemer template molecules of the first sub-population comprise tandem repeat polynucleotide units, wherein individual polynucleotide units comprise a sequence that is complementary to a covalently closed circular cDNA library molecule of the first sub-population. In some embodiments, the plurality of nucleotides comprises any combination of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, the plurality of nucleotides comprises aminoallyl-dUTP which can be subjected to cross-linking chemistry. In some embodiments, the plurality of nucleotides lacks aminoallyl-dUTP.
[0257] In some embodiments, the contacting of step (g2) comprises contacting the second sub-population of covalently closed circular cDNA library molecules with a plurality of fastening oligonucleotides and a rolling circle amplification reagent comprising a plurality of a strand-displacing polymerase and a plurality of nucleotides, and conducting a rolling circle amplification reaction, thereby generating a second sub-population of concatemer template molecules inside the cellular sample. In some embodiments, individual concatemer template molecules of the second sub-population comprise tandem repeat polynucleotide units, wherein individual polynucleotide units comprise a sequence that is complementary to a covalently closed circular cDNA library molecule of the second sub-population. In some embodiments, the plurality of nucleotides comprises any combination of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, the plurality of nucleotides comprises aminoallyl- dUTP which can be subjected to cross-linking chemistry. In some embodiments, the plurality of nucleotides lacks aminoallyl-dUTP.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0258] In some embodiments, the rolling circle amplification reaction of steps (gl) and (g2) generate concatemer template molecules comprising repeat copies of a sequence that can form a guanine tetrad, and the resulting concatemer template molecule can fold to form an intramolecular G-quadruplex structure. In some embodiments, the concatemer template molecules can self-collapse to form compact DNA nanoballs. Formation of the guanine tetrads and G-quadruplexes in the DNA nanoballs may increase the stability of the nanoballs, and increase their ability to retain a compact size and shape which can withstand repeated flows of reagents for conducting any of the sequencing workflows described herein.
[0259] In some embodiments, the rolling circle amplification reaction of steps (gl) and (g2) can optionally include a positively charged metal complex, including for example hexamine (e.g., cobalt hexamine III) which can interact electrostatically with the negatively charged phosphate backbone of DNA and condense the concatemer template molecules into a compact structure. The concatemer template molecules can collapse into a DNA nanoball having a more compact size and / or shape compared to a nanoball generated from a rolling circle amplification reaction conducted without compaction oligonucleotides and / or hexamine (e.g., cobalt hexamine III).
[0260] In some embodiments, the rolling circle amplification reaction of steps (gl) and (g2) can be conducted in the presence or absence of a plurality of compaction oligonucleotides that can bind portions of concatemer template molecules. In some embodiments, individual compaction oligonucleotides comprise single-stranded oligonucleotides, wherein 5’ and 3’ regions of the compaction oligonucleotide can hybridize to different portions of the same concatemer template molecule to pull together distal portions of the concatemer template molecule, causing compaction of the concatemer template molecule to form a DNA nanoball (e.g., see U. S. Patent No, 12,421,545, the contents of which is incorporated by reference herein in its entirety). Inclusion of compaction oligonucleotides and / or hexamine (e g., cobalt hexamine III) in the rolling circle amplification reaction can improve FWHM (full width half maximum) of a spot image of the DNA nanoball. The spot image can be represented as a Gaussian spot and the size can be measured as a FWHM. A smaller spot size as indicated by a smaller FWHM typically correlates with an improved image of the spot. In some embodiments, the FWHM of a DNA nanoball spot can be about 10 um or smaller.
[0261] In some embodiments, steps (gl) and (g2) comprise generating a plurality of concatemer template molecules by contacting the plurality of covalently closed circular cDNA library molecules inside the first and second cellular samples with a rolling circleAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)amplification reagent and a plurality of compaction oligonucleotides under a condition suitable for conducting a rolling circle amplification reaction. In some embodiments, the rolling circle amplification reaction comprises initiating synthesis of DNA from the 3’ ends of the circularization oligonucleotides or the 3’ ends of the fastening oligonucleotides and employing one of the covalently closed circular cDNA library molecules as a template molecule, thereby generating a plurality of concatemer template molecules inside the first and second cellular samples. In some embodiments, individual concatemer template molecules comprise tandem repeat polynucleotide units, wherein individual polynucleotide units comprise a sequence that is complementary to one of the covalently closed circular cDNA library molecules. In some embodiments, the rolling circle amplification reagent comprises a plurality of strand-displacing polymerases and a plurality of nucleotides. In some embodiments, the plurality of nucleotides comprises any combination of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, the plurality of nucleotides comprises aminoallyl-dUTP which can be subjected to cross-linking chemistry. In some embodiments, steps (gl) and (g2) can be conducted under a condition suitable for moving the rolling circle amplification reagent into the first and second cellular samples and binding the rolling circle reagent to the plurality of covalently closed circular cDNA library molecules.
[0262] In some embodiments, the methods comprises conducting step (gl ) or (g2), followed by step (h). In some embodiments, the methods comprise step (h): sequencing the plurality of concatemer template molecules by contacting the plurality of concatemer template molecules inside the cellular sample with a sequencing reagent. In some embodiments, the sequencing reagent comprises a plurality of universal sequencing primers, a plurality of sequencing polymerases, and plurality of nucleotide reagents. In some embodiments, individual universal sequencing primers can hybridize to a universal binding site for a sequencing primer. In some embodiments, individual universal sequencing primers can hybridize to a universal binding site for a forward sequencing primer or a reverse sequencing primer. In some embodiments, the plurality of nucleotide reagents comprises nucleotides, nucleotide analogs and / or multivalent molecules. Exemplary multivalent molecules are shown in FIGS. 1-4. In some embodiments, the plurality of nucleotide reagents comprises non-labeled or detectably labeled nucleotide reagents. In some embodiments, the sequencing of step (h) can be conducted under a condition suitable for performing at least two sequencing cycles (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 25, 30, 35, 40, 50 or more) inside the cellular sample, thereby generating a plurality of sequencing read products. In some embodiments, the sequencing of step (h) comprises sequencing a portion of theAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)concatemer template molecules using non-labeled nucleotide reagents (e.g., conducting dark sequencing) and sequencing a different portion of the same concatemer template molecule using labeled nucleotide reagents.
[0263] In some embodiments, the sequencing of step (h) comprises generating a plurality of sequencing read products that are 10-50, 50-100, 100-200, 200-300, 300-400, 400-500, 500-600, or up to 1000 nucleotides in length.
[0264] In some embodiments, the sequencing of step (h) comprises: sequencing the plurality of concatemer template molecules by contacting the plurality of concatemer template molecules inside the cellular sample with a sequencing reagent. In some embodiments, the sequencing reagent comprises a plurality of universal sequencing primers, a plurality of sequencing polymerases, and plurality of nucleotide reagents. In some embodiments, universal sequencing primers are designed to hybridize to the concatemer template molecules at the universal binding sites for the sequencing primers. In some embodiments, the universal sequencing primers are replaced with target-specific sequencing primers that can hybridize to a target-specific sequence on the concatemer template molecule. In some embodiments, the target-specific sequence comprises at least a portion of the insert sequence region of a concatemer template molecule. The target-specific sequence can be located upstream of the universal binding site for a sequencing primer on the concatemer template molecule. In some embodiments, the sequencing of step (h) can be conducted under a condition suitable for performing at least two sequencing cycles inside the cellular sample thereby generating a plurality of sequencing read products.
[0265] In some embodiments, individual sequencing read products comprise a universal sequencing primer joined to a polynucleotide generated by a polymerase-catalyzed primer extension reaction as part of the sequencing reaction. In some embodiments, the polynucleotide comprises a sequence that is complementary to at least a portion of the concatemer template molecule. In some embodiments, the plurality of sequencing read products comprise detectably labeled read products that are detectable by imaging. For example, the detectable label can comprise a fluorophore detectable by fluorescence imaging. In some embodiments, the detectably labeled read products correspond to a target polynucleotide molecule (e.g., a target RNA molecule or target DNA molecule) which can be detected by imaging. In some embodiments, the spatial location of the target RNA molecule or target DNA molecule inside the cellular sample can be determined.
[0266] In some embodiments, individual sequencing read products comprise a multivalent molecule and a universal sequencing primer hybridized to a portion of aAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)concatemer template molecule, thereby forming a nucleic acid duplex. In some embodiments, a multivalent molecule comprises a core attached to multiple polymer arms wherein individual polymer arms comprise a nucleotide moiety (e.g., FIGS. 1-4). In some embodiments, a complementary nucleotide moiety of the multivalent molecule can bind a 3’ end of the universal sequencing primer opposite a nucleotide in the concatemer template molecule, thereby forming a binding complex. In some embodiments, the binding complex forms under a condition that inhibits polymerase-catalyzed nucleotide incorporation. In some embodiments, a sequencing read product comprises the nucleic acid duplex and the binding complex. In some embodiments, the multivalent molecule comprises a detectably labeled multivalent molecule. In some embodiments, individual sequencing read products comprise a detectably labeled binding complex. In some embodiments, the plurality of sequencing read products comprise a plurality of detectably labeled binding complexes that are detectable by imaging.
[0267] In some embodiments, step (h) comprises contacting the cellular sample with the sequencing reagent under a condition suitable for moving the sequencing reagent into the cellular sample and binding the sequencing primers, nucleotide reagents and / or polymerases of the sequencing reagent to the plurality of concatemer template molecules inside the cellular sample. In some embodiments, the cellular sample that is subjected to the sequencing reaction of step (h) remains positioned on the same support as described in step (a). For example, the cellular sample remains positioned on the same support throughout all of steps (a) - (h) (e.g., FIG. 13).
[0268] In some embodiments, the sequencing of step (h) comprises contacting the first sub-population of concatemer template molecules with a sequencing reagent and conducting at least two sequencing cycles inside the cellular sample, wherein the sequencing reagent comprises a plurality of universal sequencing primers, a plurality of sequencing polymerases, and plurality of nucleotide reagents, thereby generating a first sub-population of sequencing read products. In some embodiments, individual universal sequencing primers can hybridize to a universal binding site for a forward sequencing primer. In some embodiments, the plurality of nucleotide reagents comprises nucleotides, nucleotide analogs and / or multivalent molecules. Exemplary multivalent molecules are shown in FIGS. 1-4. In some embodiments, the plurality of nucleotide reagents comprises non-labeled or detectably labeled nucleotide reagents.
[0269] In some embodiments, the sequencing of step (h) comprises contacting the second sub-population of concatemer template molecules with a sequencing reagent and conductingAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)at least two sequencing cycles inside the cellular sample, wherein the sequencing reagent comprises a plurality of universal sequencing primers, a plurality of sequencing polymerases, and plurality of nucleotide reagents, thereby generating a second sub-population of sequencing read products. In some embodiments, individual universal sequencing primers can hybridize to a universal binding site for a forward sequencing primer. In some embodiments, the plurality of nucleotide reagents comprises nucleotides, nucleotide analogs and / or multivalent molecules. Exemplary multivalent molecules are shown in FIGS. 1-4. In some embodiments, the plurality of nucleotide reagents comprises non-labeled or detectably labeled nucleotide reagents.
[0270] In some embodiments, in step (h), the first sub-population of concatemer template molecules and the second sub-population of concatemer template molecules can be sequenced essentially simultaneously or in separate batches (e.g., batch sequencing).Embodiments of batch sequencing methods are described herein. Batch sequencing in a cellular sample is described, for example, in W02023 / 205707, the contents of which are incorporated by reference in their entirety herein.
[0271] In some embodiments, the sequencing of step (h) comprises conducting single pass sequencing of the plurality of concatemer template molecules, including the first and second sub-populations of concatemer template molecules. In some embodiments, the sequencing of step (h) comprises conducting pairwise sequencing of the plurality of concatemer template molecules, including the first and second sub-population of concatemer template molecules. Embodiments of pairwise sequencing methods are described herein. Pairwise sequencing is described, for example, in WO2022 / 266470, the contents of which are incorporated by reference in their entirety herein.
[0272] In some embodiments, step (h) comprises sequencing the plurality of concatemer template molecules by contacting the plurality of concatemer template molecules inside the first cellular sample with a sequencing reagent under a condition suitable for conducting at least two sequencing cycles inside the first cellular sample, thereby generating a plurality of sequencing read products that correspond to target polynucleotide molecules (for example, target RNA molecules) expressed by the first cellular sample which has been exposed to at least one challenge condition. In some embodiments, step (h) comprises contacting the first cellular sample with the sequencing reagent under a condition suitable for moving the sequencing reagent into the first cellular sample and binding the sequencing primers, nucleotide reagents and / or polymerases of the sequencing reagent to the plurality of concatemer template molecules inside the first cellular sample.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0273] In some embodiments, step (h) comprises sequencing the plurality of concatemer template molecules by contacting the plurality of concatemer template molecules inside the second cellular sample with a sequencing reagent under a condition suitable for conducting at least two sequencing cycles inside the second cellular sample, thereby generating a plurality of sequencing read products that correspond to target polynucleotide molecules (for example, target RNA molecules) expressed by the second cellular sample which has not been exposed to at least one challenge condition. In some embodiments, step (h) comprises contacting the second cellular sample with the sequencing reagent under a condition suitable for moving the sequencing reagent into the second cellular sample and binding the sequencing primers, nucleotide reagents and / or polymerases of the sequencing reagent to the plurality of concatemer template molecules inside the second cellular sample. In some embodiments, the target RNA molecules expressed by the first and second cellular samples are encoded by the same gene in the first and second cellular samples.
[0274] In some embodiments, in step (h), the sequencing read products of the first and second cellular samples differ from each other, indicating a change in RNA expression in the first cellular sample compared to the second cellular sample. In some embodiments, the sequencing read products of the first and second cellular samples differ in expression level and / or subcellular localization.
[0275] In some embodiments, in step (h), the first and second cellular samples can be contacted with a sequencing reagent comprising a plurality of universal sequencing primers, a plurality of sequencing polymerases, and plurality of nucleotide reagents. In some embodiments, the plurality of nucleotide reagents comprises nucleotides, nucleotide analogs and / or multivalent molecules. Exemplary multivalent molecules are shown in FIGS. 1-4. In some embodiments, the plurality of nucleotide reagents comprises non-labeled or detectably labeled nucleotide reagents.
[0276] In some embodiments, in step (h), individual sequencing read products in the first and second cellular samples comprise a universal sequencing primer joined to a polynucleotide generated by a polymerase-catalyzed primer extension reaction of the sequencing reaction. In some embodiments, the polynucleotide comprises a sequence that is complementary to at least a portion of the concatemer template molecule. In some embodiments, the plurality of sequencing read products in the first and second cellular samples comprise detectably labeled read products that are detectable by imaging. For example the detectable label comprises a fluorophore, and the imaging comprises fluorescent imaging. In some embodiments, the detectably labeled read products in the first and secondAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)cellular samples correspond to a target polynucleotide molecule (e.g., a target RNA molecule) which can be detected by imaging. In some embodiments, the spatial location of the target polynucleotide molecule inside the first and second cellular sample can be determined. In some embodiments, sequencing the first and second cellular samples can generate images of polonies that correspond to target polynucleotide molecules inside the first and second cellular samples, respectively.
[0277] In some embodiments, the first and second cellular samples that are subjected to the sequencing reaction of step (h) remain positioned on the same support as described in step (a). The first and second cellular samples remain positioned on the same support throughout all of steps (a) - (h) (e.g., FIG. 13).
[0278] In some embodiments, the method comprises step (i): observing a difference between the sequences of the sequencing read products from the first and second cellular samples. In some embodiments, the target polynucleotide molecules comprise RNA expressed by the cells of the cellular samples, and observing the differences between sequencing read products thereby observes a change in RNA expression exhibited by the first cellular sample in response to exposure to the at least one challenge condition. In some embodiments, step (i) can be omitted.
[0279] In some embodiments, in step (i), the change in RNA expression exhibited by the first cellular sample comprises, without limitation, an increase or decrease in the amount of one or more target RNAs expressed by the cellular sample, an increase or decrease in stability of one or more target RNAs in the cellular sample, a change in splicing of one or more target RNAs in the cellular sample, a change in modification of one or more target RNAs in the cellular sample, a change in polyadenylation of one or more target RNAs in the cellular sample, a change in 5’ capping of one or more target RNAs in the cellular sample, an increase or decrease in transportation to the cytoplasm of one or more target RNAs in the cellular sample, and / or a change in subcellular localization of one or more RNAs in the cellular sample.
[0280] In some embodiments, in step (h), sequencing the first and second cellular samples can generate images of polonies that correspond to one or more target RNA molecules inside the first and second cellular samples, respectively.
[0281] In some embodiments, the observing of step (i) comprises counting the number of polonies in the first and second cellular samples. The number of polonies in the first cellular sample can increase or decrease compared to the number of polonies in the second cellular sample. The change in polony counts in the first cellular sample, compared to the polonyAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)counts in the second cellular sample, can result from subjecting the first cellular sample to the at least one challenge condition.
[0282] In some embodiments, in the first and / or second cellular sample, the number of polonies assigned to a particular target polynucleotide (e.g., target RNA) can be about 1-5 polonies per cell, about 5-10 polonies per cell, about 10-50 polonies per cell, about 50-100 polonies per cell. In some embodiments, in the first and / or second cellular sample, the number of polonies assigned to a particular target polynucleotide can be about 100-500 per cell, about 500-1000 per cell, or more than 1000 per cell. In some embodiments, in the first and / or second cellular sample, the number of polonies assigned to a particular target polynucleotide can be about 1000-10,000 per cell.
[0283] In some embodiments, the observing of step (i) comprises visualizing the spatial location of the polonies in the first and second cellular samples by imaging the cellular samples. In some embodiments, the spatial location of the polonies in the first and second cellular sample can differ. For example, the polonies in the first cellular sample can be located in the nucleus and the polonies in the second cellular sample can be located in the cytoplasm. The change in spatial location of the polonies in the first cellular sample, compared to the spatial location of the polonies in the second cellular sample, can result from subjecting the first cellular sample to the at least one challenge condition.
[0284] In some embodiments, the observing of step (i) comprises comparing the sequences of the sequencing read products of the first and second cellular samples. In some embodiments, the sequences of the sequencing read products of the first and second cellular samples can differ. For example, the sequence of the sequencing read products of the first cellular sample comprise at least one intron sequence that is absent in the sequence of the sequencing read product of the second cellular sample. The presence of the at least one intron sequence in the sequencing read products of the first cellular sample, compared to the absence of the intron sequence in the sequencing read products of the second cellular sample, can indicate that subjecting the first cellular sample to the at least one challenge condition inhibited RNA splicing in the first cellular sample.
[0285] The skilled artisan will recognize that many other changes in RNA expression of the first cellular sample compared to the second cellular sample can be determined by comparing the sequencing read products of the first and second cellular samples.
[0286] In some embodiments, the methods comprise step (j): correlating the observed morphological changes of the first cellular sample in response to exposure to the at least one challenge condition (e.g., according to step (a)), and the change in RNA expression observedAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)in the same first cellular sample in response to exposure to the at least one challenge condition (e.g., as described in step (i)). In some embodiments, step (j) can be omitted.
[0287] In some embodiments, the cellular samples of step (a) can be treated with a chemical fixation reagent to preserve biological molecules including polynucleotides (e.g., DNA and RNA), proteins and the spatial arrangement of molecular complexes inside the cellular sample. The chemical fixation reagents form covalent crosslinks that can reduce the efficiency of subsequent in situ nucleic acid hybridization and sequencing reactions by impeding access to the biological molecules. The crosslinks can be removed by treating the cellular sample with de-crosslinking reagent.
[0288] In some embodiments, the cellular sample of step (a) comprises a fresh frozen tissue. In some embodiments, the fresh frozen tissue can be treated with a fixation reagent comprising an aldehyde (e.g., formaldehyde, paraformaldehyde or glutaraldehyde), an NHS ester (e.g., N-hydroxysuccinimide), an imidoester, or any combination thereof. In some embodiments, the fixed fresh frozen tissue sample can be treated with a de-crosslinking reagent.
[0289] In some embodiments, the cellular sample of step (a) comprises an organoid. In some embodiments, the organoid is not treated with a fixation reagent. In some embodiments, the organoid can be treated with a de-crosslinking reagent.
[0290] In some embodiments, the cellular sample of step (a) comprises a formalin-fixed-paraffin-embedded (FFPE) tissue sample. In some embodiments, the FFPE tissue sample can be de-paraffinized and rehydrated. In some embodiments, the FFPE tissue sample can be treated with a de-crosslinking reagent.
[0291] In some embodiments, the cellular sample of step (a) can be contacted with a de¬ crosslinking reagent under a condition suitable to remove the cross-links (e.g., cross-links formed by the fixation reagent). In some embodiments, the de-crosslinking reagent comprises any one or any combination of 2-amino-5-methyl-benzoic acid; 2-amino-5-nitro-benzoic acid; (2-amino-5-methylphenyl)-phosphonic acid; 2-amino-5-methyl- benzenesulfonic acid; 2,5-diamino-benzenesulfonic acid; 2-amino-3,5-dimethylbenzene-sulfonic acid; (2S,4R)-4-hydroxy- pyrrolidine-2-carboxylic (“trans-4-hydroxy- L-proline”); (2S,4S)-4-[(pyridin-4-yl)oxy]pyrrol-idine-2-carboxylic acid; 3,5-Dioxocyclohexane carboxylic acid (DCH); 1,3- cyclohexanedione (CAS RN: 504-02-9, from Tokyo Chemical Industry); an aminophenyboronic acid; a cyclic boronic acid ester; a phosphonic acid ester; and / or a bismuth salt. In some embodiments, the cellular sample can be permeabilized after de-crosslinking or the permeabilization step can be omitted.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0292] In some embodiments, the cellular sample of step (a) comprises poly-adenylated and / or non-polyadenylated RNA transcripts. The poly-adenylated RNA transcripts can be detected and sequenced by practicing any of the methods described herein and employing nucleic acid primers comprising a homopolymer-T 3’ region. When the sequences of the non-polyadenylated RNA are known, they can be detected and sequenced by practicing any of the methods described herein and employing nucleic acid primers comprising a target-specific 3’ region. Without a priori knowledge of the sequences of the non-polyadenylated RNA, they are difficult to detect and sequence. Described herein is a method that employs a poly¬ adenylation reagent for converting non-polyadenylated RNA into poly-adenylated RNA which can be detected and sequenced.
[0293] In some embodiments, the cellular samples of step (a) can be treated with a polyadenylation reagent to generate a plurality of poly-adenylated RNAs inside the cellular sample. In some embodiments, the poly-adenylation reagent comprises E. coli poly(A) polymerase. E. coli poly(A) polymerase can add an adenosine homopolymer to the 3’ end of any RNA molecule. In some embodiments, the poly-adenylation reagent appends a nontemplate adenosine homopolymer to the 3’ ends of any RNA molecules inside the cellular sample. Addition of the poly-adenylation reagent appends a homopolymer A-tail to non-polyadenylated RNA including mRNA, rRNA, small nuclear RNA (snRNA), small interfering RNA (siRNA), long non-coding RNA (IncRNA), and microRNA (miRNA). In some embodiments, step (b) comprises generating a plurality of target-primer duplexes by contacting the plurality of target polynucleotides (e.g., newly poly-adenylated RNA) inside the cellular sample with a plurality of nucleic acid primers. In some embodiments, individual nucleic acid primers comprise (i) a 5’ region comprising at least one universal adaptor sequence, and optionally one or more identification tag sequences, and (ii) a 3’ region comprising a homopolymer-T sequence that is complementary to the poly-adenylated sequence appended by the poly-adenylation reagent of step (a).
[0294] In some embodiments, the method comprises generating a plurality of blocked target-primer duplexes by contacting the plurality of target polynucleotide molecules (e.g., target RNA molecules) inside the cellular sample with a plurality of target-specific nucleic acid primers and a plurality of blocking oligonucleotides as described in step (b) above. In some embodiments, individual blocking oligonucleotides hybridize to a predetermined location on a given target RNA molecule, wherein the 5’ end of the blocking oligonucleotide is a known distance from the 3’ end of a given target-specific nucleic acid primer. In some embodiments, step (b) comprises contacting the plurality of blocked target-primer duplexesAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)with a plurality of modified circularization primers to generate a plurality of RNA multi -primer complexes. In some embodiments, individual modified circularization primers comprises an oligonucleotide comprising: (i) an amine group at the 5’ end; (ii) a 5’ overhang end; (iii) an internal portion that can hybridize to a 5’ portion of the nucleic acid primer; and (iv) a 3’ overhang end. In some embodiments, the 3’ overhang ends of individual modified circularization primers comprise a sequence that is the same as a portion of the target RNA molecule between the hybridization sites of the nucleic acid primer and the blocking oligonucleotide. In some embodiments, step (c) comprises conducting a reverse transcription reaction thereby generating a plurality of RNA / cDNA multi-primer complexes wherein individual cDNA molecules having predetermined lengths and predetermined sequences based on the location of the hybridized blocking oligonucleotides. In some embodiments, step (d) comprises contacting the plurality of RNA / cDNA multi-primer complexes with a modifying reagent. In some embodiments, the modifying reagent comprises a homobifunctional crosslinking compound and an RNase enzyme. In some embodiments, step (d) comprises contacting the RNA / cDNA multi-primer complexes with the homo-bifunctional crosslinking compound under a condition suitable for the homo-bifunctional crosslinking compound to crosslink the amine group of individual modified circularization primers to an intracellular protein thereby generating a plurality of crosslinked RNA / cDNA multi-primer complexes. In some embodiments, the crosslinking reaction retains the intracellular spatial position of the target RNA molecules and their complementary cDNA molecules. In some embodiments, the homo-bifunctional crosslinking compound comprises a PEGylated bis(sulfosuccinimidyl)suberate) (e.g., BS(PEG)9 from Thermo Fisher Scientific™, catalog No. 21582). In some embodiments, step (d) comprises removing the target RNA molecules and the blocking oligonucleotides by contacting the plurality of crosslinked RNA / cDNA multi-primer complexes with an RNase enzyme thereby generating a plurality of crosslinked cDNA multi-primer complexes. In some embodiments, individual crosslinked cDNA multiprimer complexes comprise a nucleic acid primer with an extended cDNA molecule wherein the 5’ portion of the nucleic acid primer is hybridized to a portion of the modified circularization primer, wherein the modified circularization primer comprises a 5’ overhang end that is crosslinked to an intracellular protein, and wherein the modified circularization primer comprises a 3’ overhang end comprising a sequence that can hybridize to a portion of the 3’ end of the cDNA molecule. In some embodiments, step (d) comprises incubating the plurality of crosslinked cDNA multi-primer complexes under a condition suitable for hybridizing the 3’ portion of individual cDNA molecules to the 3’ portion of the 3’ overhangAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)end of the modified circularization primer thereby generating an open circle cDNA multi¬ primer complex comprising a nick or gap between the 5’ end of the nucleic acid primer and the 3’ end of the cDNA molecule. In some embodiments, the gap can be 2-100 nucleotides in length. In some embodiments, methods that employ the blocking oligonucleotides and the modified circularization primers can proceed to step (e) as described below to close the nick or gap using an enzymatic closure reagent.Methods for Simultaneous Sequencing or Batch Sequencing
[0295] In some embodiments, any of the sequencing steps described herein comprise using the plurality of concatemer template molecules as template molecules and conducting two or more polymerase-catalyzed sequencing reactions (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 or more sequencing reactions) using a plurality of sequencing polymerases, a plurality of sequencing primers and a plurality of nucleotide reagents. In some embodiments, the plurality of nucleotide reagents comprises nucleotides, nucleotide analogs and / or multivalent molecules. In some embodiments, the plurality of nucleotide reagents comprises non-labeled or detectably labeled nucleotide reagents.
[0296] In some embodiments, the nucleotide reagents comprise canonical nucleotides. In some embodiments, the nucleotide reagents comprise nucleotide analogs comprising detectably labeled nucleotides. In some embodiments, the nucleotide reagents comprise non¬ labeled nucleotide analogs. In some embodiments, the nucleotide reagents comprise nucleotides carrying a removable or non-removable chain terminating moiety. In some embodiments, the nucleotide reagents comprise multivalent molecules. In some embodiments, individual multivalent molecules comprise a core attached to multiple polymer arms, wherein individual polymer arms comprise a nucleotide moiety (e.g., FIGS. 1-4). In some embodiments, the sequencing reactions employ binding non-labeled nucleotides without incorporation. In some embodiments, the sequencing reactions employ incorporating non-labeled nucleotide analogs. In some embodiments, the sequencing reactions employ incorporating detectably labeled nucleotides having removable chain terminating moiety. In some embodiments, the sequencing reactions employ a two-stage sequencing reaction comprising binding detectably labeled multivalent molecules without incorporation, and incorporating nucleotide analogs. In some embodiments, the sequence reactions employ¬ incorporating a nucleotide moiety from an arm of a multivalent molecule. In some embodiments, the sequencing reactions employ phosphate chain-labeled nucleotides.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0297] In some embodiments, the plurality of concatemer template molecules inside the cellular sample can be sequenced essentially simultaneously or in separate batches.Sequencing Essentially Simultaneously
[0298] In some embodiments, the sequencing comprises contacting the cellular sample with a plurality of sequencing polymerases, a plurality of sequencing primers and a plurality of nucleotide reagents, and sequencing the plurality of concatemer template molecules essentially simultaneously while the plurality of concatemer template molecules are located inside the cellular sample. In some embodiments, the plurality of sequencing primers comprise one population of sequencing primers, wherein the sequencing primers comprise the same sequence, and wherein the sequencing primers can selectively bind their cognate sequencing primer binding site of a concatemer template molecule. In some embodiments, the plurality of sequencing primers comprise two or more sub-populations of sequencing primers, wherein the sequencing primers of different sub-populations comprise a sequence that differs from the sequencing primers of other sub-populations, and wherein the sequencing primers of each sub-population can selectively bind their cognate sequencing primer binding site on a concatemer template molecule. In some embodiments, the sequencing comprises essentially simultaneously imaging the fluorophore signals emitted during sequencing.Batch Sequencing
[0299] In some embodiments, the sequencing comprises contacting the cellular sample with a plurality of sequencing polymerases, a plurality of sequencing primers and a plurality of nucleotide reagents, and sequencing different sub-populations of concatemer template molecules in separate batches while the plurality of concatemer template molecules are located inside the cellular sample. In some embodiments, the different sub-populations of concatemer template molecules comprise at least a first and second sub-population of concatemer template molecules. In some embodiments, the sequencing comprises separately- sequencing different sub-populations of concatemer template molecules. In some embodiments, the plurality of sequencing primers comprise different sub-populations of sequencing primers (e.g., batch-specific sequencing primers), wherein the sequencing primers of each sub-population comprise a sequence that differs from the sequencing primers of other sub-populations, and wherein the sequencing primers of each sub-population can selectively bind their cognate sequencing primer binding site of a concatemer template molecule. InAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)some embodiments, the sequencing comprises separately imaging the fluorophore signals emitted during different batches of sequencing. Different embodiments of batch sequencing are described herein.Methods for Conducting Batch Sequencing: Essentially Simultaneously Batch Sequencing
[0300] In some embodiments, the batch sequencing comprises (a) providing a cellular sample comprising a first and second sub-population of concatemer template molecules; and (b) conducting first batch sequencing and second batch sequencing inside the cellular sample essentially simultaneously.
[0301] In some embodiments, the method for conducting batch sequencing comprises step (a): providing a cellular sample comprising a plurality of concatemer template molecules, the plurality of concatemer template molecules including at least a first and second sub-population of concatemer template molecules. In some embodiments, the concatemer template molecules can be generated from covalently closed circular cDNA library' molecules prepared using any of the workflows disclosed herein.
[0302] In some embodiments, the method comprises step (bl): contacting the first subpopulation of concatemer template molecules with a first batch sequencing reagent comprising (i) a plurality of first sub-population of universal sequencing primers that bind the first sub-population of concatemer template molecules, (ii) a plurality of sequencing polymerases, and (iii) a plurality of nucleotide reagents, wherein the contacting is conducted under a condition suitable for hybridizing the plurality of first sub-population of universal sequencing primers to their respective universal sequencing primer binding sites on the first sub-population concatemer template molecules, and conducting a plurality of polymerase-catalyzed sequencing cycles, thereby generating a first sub-population of sequencing read products inside the cellular sample. In some embodiments, individual sequencing read products of the first sub-population comprise a first sub-population universal sequencing primer joined to a polynucleotide generated by the polymerase-catalyzed sequencing reactions, wherein the polynucleotide comprises a sequence that is complementary to at least a portion of one of the concatemer template molecules of the first sub-population of concatemer template molecules.
[0303] In some embodiments, the method comprises step (b2): contacting the second sub-population of concatemer template molecules with a second batch sequencing reagent comprising (i) a plurality of second sub-population of universal sequencing primers that bind the second sub-population of concatemer template molecules, (ii) a plurality of sequencingAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)polymerases, and (iii) a plurality of nucleotide reagents, wherein the contacting is conducted under a condition suitable for hybridizing the plurality of second sub-population of universal sequencing primers to their respective universal sequencing primer binding sites on the second sub-population concatemer template molecules, and conducting a plurality of polymerase-catalyzed sequencing cycles, thereby generating a second sub-population of sequencing read products inside the cellular sample. In some embodiments steps (bl) and (b2) are conducted inside the cellular sample essentially simultaneously. In some embodiments, individual sequencing read products of the second sub-population comprise a second sub-population universal sequencing primer joined to a polynucleotide generated by the polymerase-catalyzed sequencing reactions, wherein the polynucleotide comprises a sequence that is complementary to at least a portion of one of the concatemer template molecules of the second sub-population of concatemer template molecules.
[0304] In some embodiments, the first sub-population of universal sequencing primers and the second sub-population of universal sequencing primers comprise different sequences.
[0305] In some embodiments, the insert sequences of the first and second sub-population of concatemer template molecules comprise the same sequence or different sequences.Methods for Conducting Batch Sequencing: Batch-Specific Sequencing Primers
[0306] In some embodiments, the batch sequencing comprises: (a) providing a cellular sample comprising a first and second sub-population of concatemer template molecules; (b) conducting a first batch sequencing reaction of the first sub-population of concatemer template mol ecules thereby generating a first sub-population of sequencing read products; (c) removing the first sub-population of sequencing read products while retaining the second sub-population of concatemer template molecules inside the cellular sample; and (d) conducting a second batch sequencing reaction of the second sub-population of concatemer template molecules, thereby generating a second sub-population of sequencing read products, wherein the first and second batch sequencing reactions are conducted in separate batches inside the cellular sample.
[0307] In some embodiments, the method for conducting batch sequencing comprises step (a): providing a cellular sample comprising a plurality of concatemer template molecules including at least a first and second sub-population of concatemer template molecules. In some embodiments, the concatemer template molecules can be generated from covalently closed circular cDNA library molecules prepared using any of the workflows disclosed herein.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0308] In some embodiments, the method comprises step (b): contacting the first sub¬ population of concatemer template molecules with a first batch sequencing reagent comprising (i) a plurality of first batch-specific universal sequencing primers that bind the first sub-population of concatemer template molecules, (ii) a plurality of sequencing polymerases, and (iii) a plurality of nucleotide reagents, wherein the contacting is conducted under a condition suitable for hybridizing the plurality of first batch-specific universal sequencing primers to their respective universal sequencing primer binding sites on the first sub-population concatemer template molecules, and conducting a plurality of polymerase-catalyzed sequencing cycles thereby generating a first sub-population of sequencing read products inside the cellular sample. In some embodiments, individual sequencing read products of the first sub-population of comprise a first batch-specific universal sequencing primer joined to a polynucleotide generated by the polymerase-catalyzed sequencing reactions, wherein the polynucleotide comprises a sequence that is complementary to at least a portion of one of the concatemer template molecules of the first sub-population of concatemer template molecules. In some embodiments, the plurality of first batch-specific universal sequencing primers do not bind the second sub-population of concatemer template molecules and the second sub-population of concatemer template molecules do not undergo sequencing.
[0309] In some embodiments, the method comprises step (c): removing the first sub¬ population of sequencing read products from the first sub-population of concatemer template molecules using a denaturation reagent, and retaining the second sub-population of concatemer template molecules inside the cellular sample. Embodiments of the denaturation reagent is described herein.
[0310] In some embodiments, the method comprises step (d): contacting the second subpopulation of concatemers inside the cellular sample with a second batch sequencing reagent comprising (i) a plurality of second batch-specific universal sequencing primers that bind the second sub-population of concatemer template molecules (ii ) a plurality of sequencing polymerases, and (iii) a plurality of nucleotide reagents, wherein the contacting is conducted under a condition suitable for hybridizing the plurality of second batch-specific universal sequencing primers to their respective universal sequencing primer binding sites on the second sub-population concatemer template molecules, and conducting a plurality of polymerase-catalyzed sequencing cycles, thereby generating a second sub-population of sequencing read products inside the cellular sample. In some embodiments, the individual sequencing read products of the second sub-population comprise a second batch-specificAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)universal sequencing primer joined to a polynucleotide generated by the polymerase-catalyzed sequencing reactions, wherein the polynucleotide comprises a sequence that is complementary to at least a portion of one of the concatemer template molecules of the second sub-population of concatemer template molecules. In some embodiments, the plurality of second batch-specific universal sequencing primers do not bind the first subpopulation of concatemer template molecules and the first sub-population of concatemer template molecules do not undergo sequencing.
[0311] In some embodiments, the plurality of first batch-specific universal sequencing primers and the plurality of second batch-specific universal sequencing primers comprise different sequences.
[0312] In some embodiments, the insert sequences of the first and second sub-population of concatemer template molecules comprise the same sequence or different sequences.Methods for Conducting Batch Sequencing: Extendible and Blocked Sequencing Primers
[0313] In some embodiments, the batch sequencing comprises: (a) providing a cellular sample comprising a first and second sub-population of concatemer template molecules; (b) contacting the first and second sub-population of concatemer template molecules essentially simultaneously with a mixture of batch-specific sequencing primers comprising (i) a plurality of first batch-specific sequencing primers comprising terminal 3’ extendible ends and (ii) a plurality of second batch-specific sequencing primers comprising terminal 3’ non-extendible ends; (c) conducting a first batch sequencing reaction of the first sub-population of concatemer template molecules using the plurality of first batch-specific sequencing primers, thereby generating a first sub-population of sequencing read products; (d) appending a blocking moiety to the terminal 3’ ends of the first sub-population of sequencing read products; (e) converting the blocking moi eties at the terminal 3’ ends of the plurality of second batch-specific sequencing primers into extendible 3’ moi eties, thereby generating a plurality of second batch-specific extendible sequencing primers; and (f) conducting a second batch sequencing reaction of the second sub-population of concatemer template molecules using the plurality of second batch-specific extendible sequencing primers, thereby generating a second sub-population of sequencing read products, wherein the first and second batch sequencing reactions are conducted in separate batches inside the cellular sample.
[0314] In some embodiments, the method for conducting batch sequencing comprises step (a): providing a cellular sample comprising a plurality of concatemer template molecules including at least a first and second sub-population of concatemer templateAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)molecules. In some embodiments, the concatemer template molecules can be generated from covalently closed circular cDNA library molecules prepared using any of the workflows disclosed herein.
[0315] In some embodiments, the method comprises step (b): contacting the first and second sub-population of concatemer template molecules with a sequencing reagent comprising a mixture of batch-specific sequencing primers, a plurality of sequencing polymerases, and plurality of nucleotide reagents. In some embodiments, the mixture of batch-specific sequencing primers comprises (i) a plurality of first batch-specific sequencing primers comprising terminal 3’ extendible ends that can undergo polymerase-catalyzed primer extension reactions, and (ii) a plurality of second batch-specific sequencing primers comprising terminal 3’ non-extendible ends that do not undergo polymerase-catalyzed primer extension reactions. In some embodiments, individual second batch-specific sequencing primers comprise a blocking moiety at the terminal 3’ end wherein the blocking moiety can be removed or converted to a 3’ terminal extendible end.
[0316] In some embodiments, in step (b), the first and second sub-population of concatemer template molecules can be contacted essentially simultaneously with the mixture of batch-specific sequencing primers under a condition suitable for hybridizing the first batch-specific sequencing primers to their respective universal sequencing primer binding sites of the first sub-population of concatemer template molecules, and hybridizing the second batch-specific sequencing primers to their respective universal sequencing primer binding sites of the second sub-population of concatemer template molecules.
[0317] In some embodiments, the method comprises step (c): conducting polymerase-catalyzed sequencing reactions inside the cellular sample, thereby generating a first sub¬ population of sequencing read products inside the cellular sample, while the second batchspecific sequencing primers which are hybridized to their respective universal sequencing primer binding sites on the second sub-population concatemer template molecules are non-extendible and do not undergo polymerase-catalyzed sequencing reactions. In some embodiments, individual first sub-population sequencing read products comprise a first batch-specific universal sequencing primer joined to a polynucleotide generated by a polymerase-catalyzed primer extension reaction, wherein the polynucleotide comprises a sequence that is complementary to at least a portion of one of the concatemer template molecules of the first sub-population of concatemer template molecules.
[0318] In some embodiments, the method comprises step (d): appending a blocking moiety to the terminal 3’ ends of the first sub-population of sequencing read products,Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)thereby blocking polymerase-catalyzed primer extension reactions of the first sub-population of sequencing read products.
[0319] In some embodiments, the method comprises step (e): converting the blocking moieties at the terminal 3’ ends of the plurality of second batch-specific universal sequencing primer into extendible 3’ moieties, while the first sub-population of sequencing read products retains their blocking moieties at their terminal 3’ ends.
[0320] In some embodiments, the method comprises step (f): conducting polymerase-catalyzed sequencing reactions inside the cellular sample thereby generating a second sub¬ population of sequencing read products inside the cellular sample, while the first subpopulation of sequencing read products are non-extendible and do not undergo polymerase- catalyzed sequencing reactions. In some embodiments, individual second sub-population sequencing read products comprise a second batch-specific universal sequencing primer joined to a polynucleotide generated by a polymerase-catalyzed primer extension reaction, wherein the polynucleotide comprises a sequence that is complementary to at least a portion of one of the concatemer template molecules of the second sub-population of concatemer template molecules.
[0321] In some embodiments, the plurality of first batch-specific universal sequencing primers and the plurality of second batch-specific universal sequencing primers comprise different sequences.
[0322] In some embodiments, the insert sequences of the first and second sub-population of concatemer template molecules comprise the same sequence or different sequences.
[0323] In some embodiments, any of the simultaneous or sequential batch sequencing methods described herein can generate a sequencing read product that is 10-50, 50-100, 100-200, 200-300, 300-400, 400-500, 500-600, or up to 1000 nucleotides in length.
[0324] In some embodiments, any of the simultaneous or sequential batch sequencing methods described herein can detect the sequencing read products by imaging.
[0325] In some embodiments, any of the simultaneous or sequential batch sequencing methods described herein can employ an optical imaging system comprising a field-of-view (FOV) greater than 1.0 mm2.Cell Paint Primers
[0326] The present disclosure provides cell paint primers and methods that employ cell paint primers for conducting sequencing-based cell painting. The sequencing-based cell painting can be used for target-specific detecting and identifying organellar nucleic acids. InAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)some embodiments, individual cell paint primers comprise an oligonucleotide comprising (i) a 5’ region comprising at least one universal adaptor sequence and a cell paint barcode, and (ii) a 3’ region comprising a target-specific sequence that can selectively hybridize to at least a portion of a target nucleic acid sequence inside an organelle.
[0327] In some embodiments, the 3’ region of a cell paint primer can selectively hybridize to a target DNA or RNA sequence inside an organelle, including without limitation a mitochondria, nucleus or chloroplast.
[0328] In some embodiments, the 3’ regions of individual cell paint primers can hybridize to at least a portion of an untranslated region in the 5’ or 3’ region of a target DNA or RNA molecule. In some embodiments, the 3’ region of individual cell paint primers can hybridize to at least a portion of a target DNA or RNA sequence at an intron region, an exon region, or an intron-exon junction region. In some embodiments, the 3’ region of individual cell paint primers can hybridize to at least a portion of a rearranged VDJ region of a target DNA molecule. In some embodiments, the 3’ regions of individual cell paint primers can hybridize to at least a portion of a wild type sequence or a variant sequence of a target DNA or RNA molecule. In some embodiments, the variant sequence comprises a single nucleotide polymorphism (SNP), including, and without limitation, a single base substitution, a single base insertion or a single base deletion. In some embodiments, the variant sequence comprises two or more base variations including and without limitation two or more base substitutions, two or more base insertions and / or two or more base deletions.
[0329] In some embodiments, the 3’ region of a cell paint primer comprises an organellar-specific sequence, for example a sequence specific to mitochondrial RNA.
[0330] In some embodiments, the 3’ regions of individual cell paint primers comprise a sequence that can selectively hybridize to RNA encoding mitochondrial proteins that are part of oxidative phosphorylation, including, without limitation, MT-ND1 and MT-ND6 which encode subunits of Complex 1 (NADU dehydrogenase) and MT-ATP6 which encodes Complex V ( ATP synthase).
[0331] In some embodiments, the 3’ regions of individual cell paint primers comprise a sequence that can selectively hybridize to at least a portion of a mitochondrial tRNA including, without limitation, MT-TL1 (tRNA-Leu) and MT-TQ (tRNA-Gln).
[0332] In some embodiments, the 3’ regions of individual cell paint primers comprise a sequence that can selectively hybridize to at least a portion of a small mitochondrial RNA including, without limitation, mt-tRNA-Met.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0333] In some embodiments, the 3’ regions of individual cell paint primers comprise a sequence that can selectively hybridize to at least a portion of mitochondrial ribosomal RNA including, without limitation, MT-RNR1 and MT-RNR2.
[0334] In some embodiments, the 3’ regions of a cell paint primer comprise a sequence that can selectively hybridize to at least a portion of a human mitochondrial 16S rRNA (e g., MT-RNR2). In some embodiments, the 3’ region of the cell paint primer comprises the sequence5’- TTAGGACCTGTGGGTTTGTTAGGTACTGTTTGCATTAATAAATTAA -3’ (SEQ ID NO: 5), or a sequence having I, 2, 3, 4, or 5 insertions, substitutions or deletions relative thereto.
[0335] In some embodiments, the 5’ portions of individual cell paint primers comprise one or more universal adaptor sequences comprising any one, or any combination of two or more adaptor sequences, including a universal binding site for a forward sequencing primer, a universal binding site for a reverse sequencing primer, a universal binding site for a compaction oligonucleotide and / or a universal binding site for an amplification primer.
[0336] In some embodiments, the 5’ portions of individual cell paint primers comprise a cell paint barcode sequence that can be designed to enable detection and identification of an organellar target nucleic acid sequence by conducting one or more sequencing cycles and employing multi-color imaging (e g., see the Table at FIG. 16). In some embodiments, the cell paint barcode can be 4-30 nucleotides in length (for example 4-20, 5-30, 5-15, 10-40, 15-30 or any range therebetween). In some embodiments, the cell paint barcode can be employed for sequencing-based cell painting.
[0337] In some embodiments, the 5’ portions of the cell paint primers exhibit little or no hybridization to the target nucleic acid sequences inside the organelle.
[0338] In some embodiments, the 5’ ends of the cell paint primers comprise a phosphate group.
[0339] In some embodiments, the cell paint primer can be used to generate a first concatemer template molecule comprising a cell paint barcode sequence (or a complementary sequence thereof), wherein the first concatemer template molecule corresponds to an organellar target nucleic acid sequence inside a cellular sample. In some embodiments, a primary antibody bridge complex comprising a target barcode sequence (1200) can be used to generate a second concatemer template molecule comprising a target barcode sequence (or a complementary sequence thereof), wherein the second concatemer template molecule corresponds to a target analyte inside the cellular sample. Exemplary target analytes include aAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)polypeptide, enzyme, polysaccharide or lipid. In some embodiments, the cell paint barcode regions of the first concatemer template molecules and the target barcode sequences (1200) of the second concatemer template molecules can be sequenced essentially simultaneously or sequenced separately inside the cellular sample to detect and identify the organellar target nucleic acid sequence and the target analyte respectively. In some embodiments, the cell paint primers can be used to detect and identify target organellar nucleic acid sequences and the primary antibody bridge complex can be used to detect and identify target analytes (e.g., polypeptides, enzymes, polysaccharides and lipids) by conducting sequencing-based cell painting in the same cellular sample.
[0340] In some embodiments, the cell paint primer can be used to generate a first concatemer template molecule comprising a cell paint barcode sequence (or a complementary sequence thereof), wherein the first concatemer template molecule corresponds to an organellar target nucleic acid sequence inside a cellular sample. In some embodiments, a bipartite complex comprising a target barcode sequence (1200) can be used to generate a second concatemer template molecule comprising a target barcode sequence (or a complementary sequence thereof) wherein the second concatemer template molecule corresponds to a target analyte including a polypeptide, enzyme, polysaccharide or lipid inside the same cellular sample. In some embodiments, the cell paint barcode regions of the first concatemer template molecules and the target barcode sequences (1200) of the second concatemer template molecules can be sequenced essentially simultaneously or sequenced separately inside the cellular sample to detect and identify the organellar target nucleic acid sequence and the target analyte respectively. In some embodiments, the cell paint primers can be used to detect and identify target organellar nucleic acid sequences and the bipartite complex can be used to detect and identify target analytes (e.g., polypeptides, enzymes, polysaccharides and lipids) by conducting sequencing-based cell painting in the same cellular sample.
[0341] In some embodiments, the cell paint primers comprise oligonucleotides comprising DNA, RNA, DNA / RNA chimeric or analogs thereof. In some embodiments, the cell paint primers are about 10 - 200 nucleotides in length. In some embodiments, the cell paint primers comprise 3’ extendible ends or 3’ non-extendible ends. In some embodiments, the 3’ non-extendible ends comprise a blocking moiety7. In some embodiments, the 3’ non-extendible ends comprise a 3’ chain terminating moiety. In some embodiments, the 3’ non-extendible ends can be converted to 3’ extendible ends. In some embodiments, a 3’Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)extendible end of a cell paint primer can be used to initiate a polymerase-catalyzed extension reaction including a reverse transcription reaction.
[0342] In some embodiments, the cell paint primers comprise one or more phosphorothioate linkage at their 5’ and / or 3’ ends to confer exonuclease resistance. In some embodiments, the cell paint primers comprise one or more phosphorothioate linkages at an internal position to confer endonuclease resistance. In some embodiments, the cell paint primers comprise one or more 2 ’-O-methyl cytosine bases at their 5’ and / or 3’ ends, or at an internal position. In some embodiments, the 5’ ends of the cell paint primers are phosphorylated or non-phosphorylated. In some embodiments, the 3’ ends of the cell paint primers comprise a terminal 3’ OH group or a terminal 3’ blocking group that can be converted to a 3’ OH group.
[0343] In some embodiments, the cell paint primers comprise one or more amines modified 5’ ends and / or amine modified internal nucleotides.Methods for Conducting Cell Painting Using Cell Paint Primers
[0344] The present disclosure provides methods for conducting sequencing-based cell painting comprising: step (a): providing a cellular sample on a support, wherein the cellular sample comprises at least one organelle that harbors a plurality of target organellar polynucleotides. Target organellar polynucleotides include a plurality of target organellar DNA molecules and / or a plurality of target organellar RNA molecules. In some embodiments, the target organellar polynucleotides are located at one or more spatial positions inside the at least one organelle. In some embodiments, the target organellar polynucleotides are located on the exterior of the at least one organelle. In some embodiments, the at least one organelle comprises a mitochondria, nucleus or chloroplast. In some embodiments, the cellular sample is fixed and permeabilized. In some embodiments, the cellular sample is fixed but is not permeabilized. In some embodiments, the cellular sample is not fixed or permeabilized.
[0345] In some embodiments, in step (a), the cellular sample comprises a single cell, cell suspension, multiple cells, a tissue, purified cells from a blood sample, tumor cells from a patient sample, subcultures or cells adhered to a support. In some embodiments, cells purified from a blood sample comprise white blood cells including lymphocytes, monocytes, granulocytes and stem cells. In some embodiments, the cellular sample comprises a first and second cellular sample.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0346] In some embodiments, in step (a), the cellular sample comprises a plurality of target organellar polynucleotides including at least a first sub-population of target organellar DNA and a second sub-population of target organellar DNA.
[0347] In some embodiments, in step (a), the cellular sample comprises a plurality of target organellar polynucleotides including at least a first sub-population of target organellar RNA and a second sub-population of target organellar RNA.
[0348] In some embodiments, the cellular sample of step (a) comprises 1-25 different target organellar polynucleotide molecules, or 25-50 different target organellar polynucleotide molecules, or 50-75 different target organellar polynucleotide molecules, or 75-100 different target organellar polynucleotide molecules. In some embodiments, the cellular sample comprises more than 100 different target organellar polynucleotide molecules, or more than 250 different target organellar polynucleotide molecules, or more than 500 different target organellar polynucleotide molecules, or more than 1000 different target organellar polynucleotide molecules, or more. In some embodiments, the cellular sample comprises more than 10,000 different target organellar polynucleotide molecules.
[0349] In some embodiments, in step (a), the cellular sample can be deposited (e.g., seeded) onto a support comprising a planar or non-planar support. In some embodiments, the support comprises a solid or semi-solid support. In some embodiments, the support comprises a porous, semi-porous or non-porous support. The support can be made of any material such as glass, plastic or a polymer material. In some embodiments, the surface of the support can be coated with one or more compounds to produce a passivated layer on the support. In some embodiments, the passivated layer forms a porous or semi-porous layer.
[0350] In some embodiments, in step (a), the cellular sample can be deposited (e.g., seeded) onto a support comprising a planar surface and having walls to contain the cellular sample and liquids, such as for example, liquid cell culture medium and reagents for library preparation and sequencing. The support can be configured to include walls that form at least two wells. In some embodiments, individual wells can be loaded with different types of cellular samples. In some embodiments, the support comprises a flowcell, for example a flowcell compatible with the sequencing systems described herein.
[0351] In some embodiments, in step (a), the cellular sample comprises a first and second cellular sample. In some embodiments, step (a) comprises exposing the first and / or second cellular sample to a challenge condition that causes a change of an organelle inside the first and / or second cellular sample. In some embodiments, the change of the organelle comprises a change in morphology of the organelle, a change in RNA expression of the organelle and / or aAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)change in protein expression of the organelle. In some embodiments, exposing the first and / or second cellular sample to a challenge condition can be omitted.
[0352] In some embodiments, step (a) comprises exposing the first and / or second cellular sample to the at least one challenge condition before or after depositing the cellular sample onto the support.
[0353] In some embodiments, step (a) comprises exposing the first and / or second cellular sample to the at least one challenge condition prior to cell fixation and permeabilization.
[0354] In some embodiments, step (a) comprises exposing the first and / or second cellular sample to one or any combination of two or more challenge conditions including a temperature change, a pH change, a change in light exposure, a change in a dark condition, nutrient deprivation, nutrient addition, toxin exposure, chemical compound exposure and / or drug exposure.
[0355] In some embodiments, step (a) comprises exposing the first and / or second cellular sample to at least one challenge condition for different lengths of time.
[0356] In some embodiments, step (a) comprises exposing the first and / or second cellular sample to different concentrations of at least one nutrient, at least one toxin, at least one chemical compound and / or at least one drug.
[0357] In some embodiments, step (a) comprises observing a morphological or phenotypic change of the first and / or second cellular sample in response to the at least one challenge condition. In some embodiments, step (a) comprises comparing the morphological or phenotypic change of the first and second cellular samples. In some embodiments, observing a morphol ogical or phenotypic change of the first and second cellular samples is omitted.
[0358] In some embodiments, in step (a), the morphological or phenotypic changes exhibited by the first and / or second cellular sample after exposure to the at least one challenge condition includes without limitation a change in cell size (e.g., change in cell diameter and / or cell area), a change in cell shape, a change in cell division, a change in growth pattern, a change in the level of confluency, a change in cell motility, a change in nuclear size, a change in the cellular location of a protein-of-interest, a change in intracellular protein-protein interaction, a change in the presence or absence of a cell surface protein, and / or a change in the structure or arrangement of organelles including mitochondria. In some embodiments, the morphological or phenotypic change includes a change in cell resistance or a change in cell sensitivity to a challenge condition. In some embodiments, the morphological or phenotypic change includes apoptosis. The skilled artisan will appreciateAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)that the first and / or second cellular sample can exhibit other morphological or phenotypic changes in response to the at least one challenge condition.
[0359] In some embodiments, the methods comprise step (b): generating a plurality of organellar target-primer duplexes by contacting the plurality of target organellar polynucleotides inside the cellular sample with a plurality of cell paint primers. In some embodiments, individual cell paint primers comprise an oligonucleotide comprising (i) a 5’ region comprising at least one universal adaptor sequence and a cell paint barcode, and (ii) a 3’ region comprising a target-specific sequence that can selectively hybridize to at least a portion of a target organellar polynucleotide inside the organelle. In some embodiments, the 5’ regions of the cell paint primers are designed to exhibit little or no hybridization to the target organellar polynucleotides. In some embodiments, the contacting of step (b) can be conducted under a condition suitable for moving the plurality of cell paint primers into the cellular sample and into the organelles.
[0360] In some embodiments, in step (b), the plurality of organellar target-primer duplexes comprises at least a first and second sub-population of organellar target-primer duplexes.
[0361] In some embodiments, in step (b), the 3’ region of a cell paint primer can selectively hybridize to at least a portion of a target organellar DNA or RNA sequence inside the cellular sample. In some embodiments, the 3’ region of individual cell paint primers can hybridize to at least a portion of an untranslated regions in the 5’ or 3’ regions of target organellar DNA or RNA molecules. In some embodiments, the 3’ regions of individual cell paint primers can hybridize to at least a portion of a target organellar DNA or RNA sequence at an intron region, an exon region, or an intron-exon junction region. In some embodiments, the 3’ region of individual cell paint primers can hybridize to at least a portion of a rearranged VDJ region of a target DNA molecule. In some embodiments, the 3’ region of individual cell paint primers can hybridize to at least a portion of a wild type sequence or a variant sequence of a target DNA or RNA molecule. In some embodiments, the variant sequence comprises a single nucleotide polymorphism (SNP) including and without limitation a single base substitution, a single base insertion or a single base deletion. In some embodiments, the variant sequence comprises two or more base variations including and without limitation two or more base substitutions, two or more base insertions and / or two or more base deletions.
[0362] In some embodiments, in step (b), the 3’ region of a cell paint primer comprises an organellar-specific sequence that can hybridize with mitochondrial RNA.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0363] In some embodiments, in step (b), the 3’ regions of individual cell paint primers comprise a sequence that can selectively hybridize to at least a portion of RNA encoding mitochondrial proteins that are part of oxidative phosphorylation including, without limitation, MT-ND1 and MT-ND6 which encode subunits of Complex 1 (NADU dehydrogenase) and MT-ATP6 which encodes Complex V (ATP synthase).
[0364] In some embodiments, in step (b), the 3’ regions of individual cell paint primers comprise a sequence that can selectively hybridize to at least a portion of mitochondrial tRNA including, without limitation, MT-TL1 (tRNA-Leu) and MT-TQ (tRNA-Gln).
[0365] In some embodiments, in step (b), the 3’ regions of individual cell paint primers comprise a sequence that can selectively hybridize to at least a portion of a small mitochondrial RNA including, without limitation, mt-tRNA-Met,
[0366] In some embodiments, in step (b), the 3’ region of individual cell paint primers compri se a sequence that can selectively hybridize to at least a portion of mitochondrial ribosomal RNA including, without limitation, MT-RNR1 and MT-RNR2.
[0367] In some embodiments, in step (b), the 3’ regions of a cell paint primer comprises a sequence that can selectively hybridize to at least a portion of a human mitochondrial 16S rRNA (e.g., MT-RNR2). In some embodiments, the 3’ region of the cell paint primer comprises the sequence 5’-TTAGGACCTGTGGGTTTGTTAGGTACTGTTTGCATTAATAAATTAA -3’ (SEQ ID NO: 5), or a sequence having 1, 2, 3, 4, or 5 insertions, substitutions or deletions relative thereto.
[0368] In some embodiments, in step (b), the terminal 3’ ends of individual cell paint primers comprise moieties that permit polymerase-catalyzed extension. In some embodiments, the individual cell paint primers comprise 3’ extendible ends.
[0369] In some embodiments, in step (b), the terminal 3’ ends of individual cell paint primers comprise blocking moieties that inhibits polymerase-catalyzed extension. In some embodiments, the individual cell paint primers comprise 3’ non-extendible ends. In some embodiments, the blocking moiety can be removed or converted into a 3’ OH extendible moiety.
[0370] In some embodiments, in step (b), the 5’ portions of individual cell paint primers comprise one or more universal adaptor sequences comprising any one or any combination of two or more adaptor sequences including a universal binding site for a forward sequencing primer, a universal binding site for a reverse sequencing primer, a universal binding site for a compaction oligonucleotide and / or a universal binding site for an amplification primer.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0371] In some embodiments, in step (b), the 5’ portions of individual cell paint primers comprise a cell paint barcode sequence that can be designed for detecting and identifying an organellar target nucleic acid sequence by conducting one or more sequencing cycles and employing multi-color imaging (e.g., see the Table at FIG. 16). In some embodiments, the cell paint barcode can be 4-30 nucleotides (for example 4-20, 5-30, 5-15, 10-40, 15-30 or any range therebetween) in length. In some embodiments, the cell paint barcode can be employed for sequencing-based cell painting.
[0372] In some embodiments, in step (b), the 5’ portions of the cell paint primers exhibit little or no hybridization to the target nucleic acid sequence inside the organelle.
[0373] In some embodiments, in step (b), the 5’ ends of the cell paint primers comprise a phosphate group. In some embodiments, the 5’ ends of the cell paint primers lack a phosphate group.
[0374] In some embodiments, for example those embodiments in which the target polynucleotides comprise RNA, the methods comprise step (c): conducting a reverse transcription reaction by contacting the plurality of organellar target-primer duplexes inside cellular sample with a reverse transcription reagent under a condition suitable for initiating synthesis of cDNA from the plurality of organellar target-primer duplexes thereby generating a plurality of organellar primer-cDNA molecules each bound to their target organellar RNA molecule. In some embodiments, the plurality of organellar primer-cDNA molecules comprises at least a first and second sub-population of organellar primer-cDNA molecules.
[0375] Alternatively, for example in those embodiments in which the target polynucleotides comprise DNA, step (c) comprises contacting the plurality of organellar target-primer duplexes inside cellular sample with a polymerase reagent under a condition suitable for initiating synthesis of complementary DNA (cDNA) from the plurality of organellar target-primer duplexes thereby generating a plurality of organellar primer-cDNA molecules each bound to their target organellar DNA molecule. Exemplary polymerase reagents comprise DNA-dependent DNA polymerases.
[0376] In some embodiments, in step (c), the reverse transcription reagent comprises a plurality of reverse transcriptase enzymes and a plurality of nucleotides. In some embodiments, the plurality of nucleotides comprises any combination of dATP, dGTP, dCTP and / or dTTP. In some embodiments, step (c) can be conducted under a condition suitable for moving the reverse transcription reagent into the cellular sample, and into the organelle, and binding the plurality of organellar target-primer duplexes with the reverse transcription reagent. In some embodiments, the length of the synthesized cDNA can be about 10-30Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)nucleotides, or about 30-50 nucleotides, or about 50-80 nucleotides, or about 80-110 nucleotides, or about 110-150 nucleotides. In some embodiments, the length of the synthesized cDNA can be about 150-200 nucleotides. In some embodiments, the length of the synthesized cDNA can be about 200-2000 nucleotides, or about 2000-5000 nucleotides. In some embodiments, after the reverse transcription reaction, the target organellar RNA molecules can be enzymatically degraded using an RNase enzyme. In some embodiments, after the reverse transcription reaction, the target organellar RNA molecules are not enzymatically degraded using an RNase enzyme.
[0377] In some embodiments, the organellar target-primer duplexes comprise at least a first sub-population of target-primer duplexes and a second sub-population of target-primer duplexes, and the target polynucleotides comprise RNA. In some embodiments, the contacting of step (c) comprises contacting the organellar target-primer duplexes of the first sub-population with a plurality of reverse transcriptase enzymes and a plurality of nucleotides under a condition suitable for conducting a primer extension reaction and initiating synthesis of cDNA from the plurality of cell paint primers, thereby generating a first sub-population of organellar primer-cDNA molecules comprising a sequence that is complementary to at least a portion of the target organellar RNA molecules of the first sub-population, wherein individual organellar primer-cDNA molecules of the first sub-population are bound to their target RNA molecule.
[0378] In some embodiments, the contacting of step (c) comprises contacting the organellar target-primer duplexes of the second sub-population with a plurality of reverse transcriptase enzymes and a plurality of nucleotides under a condition suitable for conducting a primer extension reaction and initiating synthesis of cDNA from the plurality of cell paint primers, thereby generating a second sub-population of organellar primer-cDNA molecules comprising a sequence that is complementary to at least a portion of the target organellar RNA molecules of the second sub-population, wherein individual organellar primer-cDNA molecules of the second sub-population are bound to their target RNA molecule.
[0379] In some embodiments, the organellar target-primer duplexes comprise at least a first sub-population of target-primer duplexes and a second sub-population of target-primer duplexes, and the target polynucleotides comprise DNA. In some embodiments, the contacting of step (c) comprises contacting the organellar target-primer duplexes of the first sub-population with a plurality of polymerases and a plurality of nucleotides under a condition suitable for conducting a primer extension reaction and initiating synthesis of cDNA from the plurality of cell paint primers, thereby generating a first sub-population ofAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)organellar primer-cDNA molecules comprising a sequence that is complementary to at least a portion of the target organellar DNA molecules of the first sub-population, wherein individual organellar primer-cDNA molecules of the first sub-population are bound to their target DNA molecule.
[0380] In some embodiments, the organellar target-primer duplexes comprise at least a first sub-population of target-primer duplexes and a second sub-population of target-primer duplexes, and the target polynucleotides comprise DNA. In some embodiments, the contacting of step (c) comprises contacting the organellar target-primer duplexes of the second sub-population with a plurality of polymerases and a plurality of nucleotides under a condition suitable for conducting a primer extension reaction and initiating synthesis of cDNA from the plurality of cell paint primers, thereby generating a second sub-population of organellar primer-cDNA molecules comprising a sequence that is complementary to at least a portion of the target organellar DNA molecules of the second sub-population, wherein individual organellar primer-cDNA molecules of the second sub-population are bound to their target DNA molecule.
[0381] In some embodiments, the methods comprise step (d): generating a plurality of linear organellar cDNA library molecules by contacting the plurality of organellar primer- cDNA molecules inside the cellular sample with a modifying reagent that can append at least one universal adaptor sequence to the 3’ end of individual organellar primer-cDNA molecules. In some embodiments, the plurality of linear organellar cDNA library molecules comprises at least a first and second sub-population of linear organellar cDNA library molecules. The modifying reagent can comprise any combination of at least one modifying enzyme, a plurality of nucleotides and / or oligonucleotides that mediate appending at least one universal adaptor sequence to the 3’ end of the organellar primer-cDNA molecules.
[0382] In some embodiments, step (d) can be conducted under a condition suitable for moving the modifying reagent into the cellular sample and binding the organellar primer-cDNA molecules inside the organelle with the modifying reagent.
[0383] In some embodiments, step (d) can be conducted under a condition suitable for moving the modifying reagent into the cellular sample and binding the organellar primer- cDNA molecules at the exterior of the organelle with the modifying reagent. Exemplary' embodiments of step (d) are described below.
[0384] In some embodiments, the methods comprise step (e): generating a plurality of open circle organellar cDNA library molecules by contacting the plurality of linear organellar cDNA library molecules inside the cellular sample with a plurality of circularization primers.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)In some embodiments, individual open circle organellar cDNA library molecules comprise a nick or gap between the ends of the linear organellar cDNA library molecule. In some embodiments, the contacting comprises binding individual circularization primers to one of the linear organellar cDNA library molecules thereby generating a plurality of open circle organellar cDNA library molecules. In some embodiments, individual open circle organellar cDNA library molecules comprise (i) a 5 ' portion of one of the circularization primers hybridized to a 5’ end portion of one of the linear organellar cDNA library molecules, (ii) a 3’ portion of the same circularization primer hybridized to the 3’ end portion of the same linear organellar cDNA library molecule, and (iii) a gap or nick between the 5’ and 3’ ends of the linear organellar cDNA library molecule. In some embodiments, the gap and nick can be closed with an enzymatic reaction. In some embodiments, the plurality of open circle organellar cDNA library' molecules comprises at least a first and second sub-population of open circle organellar cDNA library molecules. In some embodiments, step (e) can be conducted under a condition suitable for moving the plurality of circularization primers into the cellular sample and binding the plurality of circularization primers with the plurality of linear organellar cDNA library molecules.
[0385] In some embodiments, the first and second sub-populations of organellar primer-cDNA molecules generate a first and second sub-population of linear organellar cDNA molecules. In some embodiments, the contacting of step (e) comprises contacting the linear organellar cDNA library molecules of the first sub-population to a first sub-population circularization primers, thereby generating a first sub-population of open circle organellar cDNA library molecules. In some embodiments, individual open circle organellar cDNA library molecules of the first sub-population comprise (i) a 5’ portion of a first sub-population circularization primer hybridized to a 5’ end portion of a first sub-population linear organellar cDNA library molecule, (ii) a 3’ portion of the same first sub-population circularization primer hybridized to a 3’ end portion of the same first sub-population linear organellar cDNA library molecule, and (iii) a gap between the 5’ and 3’ ends of the first sub-population linear organellar cDNA library molecule. In some embodiments, the gap can undergo a gap fill-in reaction using a gap fill-in reagent.
[0386] In some embodiments, the contacting of step (e) comprises contacting the linear organellar cDNA library molecules of the second sub-population to a second sub-population of circularization primers, thereby generating a second sub-population of open circle organellar cDNA library molecules. In some embodiments, individual open circle organellar cDNA library molecules of the second sub-population comprise (i) a 5’ portion of a secondAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)sub-population circularization primer hybridized to a 5’ end portion of a second sub¬ population linear organellar cDNA library molecule, (ii) a 3’ portion of the same second subpopulation circularization primer hybridized to a 3’ end portion of the same second sub¬ population linear organellar cDNA library molecule, and (iii) a gap between the 5’ and 3’ ends of the first sub-population linear organellar cDNA library molecule. In some embodiments, the gap can undergo to a gap fill-in reaction using a gap fill-in reagent.
[0387] In some embodiments, the contacting of step (e) comprises contacting the linear organellar cDNA library molecules of the first sub-population to a first sub-population circularization primers, thereby generating a first sub-population of open circle organellar cDNA library molecules. In some embodiments, individual open circle organellar cDNA library' molecules of the first sub-population comprise (i) a 5’ portion of a first sub-population circularization primer hybridized to a 5’ end portion of a first sub-population linear organellar cDNA library mol ecule, (ii) a 3’ portion of the same first sub-population circularization primer hybridized to a 3’ end portion of the same first sub-population linear organellar cDNA library' molecule, and (iii) a nick between the 5’ and 3’ ends of the first sub-population linear organellar cDNA library molecule. In some embodiments, the nick is enzymatically ligatable using a ligation reagent.
[0388] In some embodiments, the contacting of step (e) comprises contacting the linear organellar cDNA library molecules of the second sub-population to a second sub-population of circularization primers, thereby generating a second sub-population of open circle organellar cDNA library molecules. In some embodiments, individual open circle organellar cDNA library molecules of the second sub-population comprise (i) a 5’ portion of a second sub-population circularization primer hybridized to a 5’ end portion of a second sub¬ population linear organellar cDNA library molecule, (ii) a 3’ portion of the same second subpopulation circularization primer hybridized to a 3’ end portion of the same second sub¬ population linear organellar cDNA library molecule, and (iii) a nick between the 5’ and 3’ ends of the second sub-population linear organellar cDNA library' molecule. In some embodiments, the nick is enzymatically ligatable using a ligation reagent.
[0389] In some embodiments, the methods comprise step (f): generating a plurality of covalently closed circular organellar cDNA library' molecules by contacting the plurality of open circle organellar cDNA library molecules inside the cellular sample with an enzymatic closure reagent that can enzymatically close the gaps and / or nicks of the plurality of open circle organellar cDNA library molecules. In some embodiments, step (f) can be conducted under a condition suitable for moving the enzymatic closure reagent into the cellular sampleAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)and contacting the enzymatic closure reagent to the plurality of open circle organellar cDNA library molecules. In some embodiments, the enzymatic closure reagent comprises a ligase reagent. In some embodiments, the enzymatic closure reagent comprises a gap fill-in reagent and a ligase reagent.
[0390] In some embodiments, step (f) comprise contacting the open circle organellar cDNA library molecules of the first sub-population with a gap fill-in reagent and a ligase reagent under a condition suitable for conducting a polymerase-catalyzed gap fill-in reaction thereby synthesizing a DNA strand having a sequence that is complementary to at least a portion of the circularization primer, and generating a nick that is enzymatically ligatable thereby generating a plurality of organellar library-open circle complexes, and the condition is suitable for closing the nick thereby generating a first sub-population of covalently closed circular organellar cDNA library molecules. In some embodiments, the gap fill-in reagent compri ses a plurality of DNA polymerases and a plurality of nucl eotides. In some embodiments, the plurality of nucleotides comprises dATP, dGTP, dCTP, dTTP and / or dUTP, In some embodiments, the ligase reagent comprises a ligase enzyme.
[0391] In some embodiments, step (f) comprise contacting the open circle organellar cDNA library molecules of the second sub-population with a gap fill-in reagent and a ligase reagent under a condition suitable for conducting a polymerase-catalyzed gap fill-in reaction thereby synthesizing a DNA strand having a sequence that is complementary to at least a portion of the circularization primer, and generating a nick that is enzymatically ligatable thereby generating a plurality of organellar library-open circle complexes, and the condition is suitable for closing the nick thereby generating a second sub-population of covalently closed circular organellar cDNA library molecules. In some embodiments, the gap fill-in reagent comprises a plurality of DNA polymerases and a plurality of nucleotides. In some embodiments, the plurality of nucleotides comprises dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, the ligase reagent comprises a ligase enzyme,
[0392] In some embodiments, step (f) comprises contacting the open circle organellar cDNA library molecules of the first sub-population with a ligase enzyme thereby generating a first sub-population of covalently closed circular organellar cDNA library molecules.
[0393] In some embodiments, the contacting of step (f) comprises contacting the open circle organellar cDNA li brary molecules of the second sub-population with a ligase enzyme thereby generating a second sub-population of covalently closed circular organellar cDNA library molecules.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)
[0394] In some embodiments, the methods comprise alternative step (f): contacting the plurality of open circle organellar cDNA library molecules with a Cre recombinase under a condition suitable for mediating a Cre recombinase circularization reaction thereby generating a plurality of covalently closed circular organellar cDNA library molecules. In some embodiments, individual open circle organellar cDNA library molecules comprise a linear organellar cDNA library molecule comprising a 5’ universal adaptor sequence from the cell paint primer, a cDNA sequence that is complementary to the RNA, and a 3’ universal adaptor sequence comprising a Cre loxP site, according to any of the methods described in step (d) above.
[0395] In some embodiments, the methods comprise step (g): generating a plurality of organellar concatemer template molecules by contacting the plurality of covalently closed circular organellar cDNA library molecules inside the cellular sample with a rolling circle amplification reagent under a condition suitable for conducting a rolling circle amplification reaction. In some embodiments, the rolling circle amplification reaction comprises initiating synthesis of DNA from the 3’ ends of the circularization oligonucleotides and employing the covalently closed circular organellar cDNA library molecules as a template molecule, thereby generating a plurality of organellar concatemer template molecules inside the cellular sample. In some embodiments, individual organellar concatemer template molecules comprise tandem repeat polynucleotide units wherein individual polynucleotide units comprise a sequence that is complementary to one of the covalently closed circular organellar cDNA library molecules. In some embodiments, the rolling circle amplification reagent comprises a plurality of strand-displacing polymerases and a plurality of nucleotides. In some embodiments, the plurality of nucleotides comprises any combination of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, the plurality of nucleotides comprises aminoallyl-dUTP which can be subjected to cross-linking chemistry'. In some embodiments, step (g) can be conducted under a condition suitable for moving the rolling circle amplification reagent into the cellular sample and binding the rolling circle reagent to the plurality of covalently closed circular organellar cDNA library molecules.
[0396] In some embodiments, the contacting of step (g) comprises contacting the first sub-population of covalently closed circular organellar cDNA library molecules with a rolling circle amplification reagent comprising a plurality of a strand-displacing polymerase and a plurality of nucleotides, and conducting a rolling circle amplification reaction thereby generating a first sub-population of organellar concatemer template molecules inside the cellular sample. In some embodiments, individual organellar concatemer template moleculesAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)of the first sub-population comprise tandem repeat polynucleotide units wherein individual polynucleotide units comprise a sequence that is complementary to a covalently closed circular organellar cDNA library molecule of the first sub-population. In some embodiments, the plurality of nucleoti des comprises any combination of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, the plurality of nucleotides comprises aminoallyl -dUTP which can be subjected to cross-linking chemistry. In some embodiments, the plurality of nucleotides lacks aminoallyl-dUTP.
[0397] In some embodiments, the contacting of step (g) comprises contacting the second sub-population of covalently closed circular organellar cDNA library molecules with a rolling circle amplification reagent comprising a plurality of a strand-displacing polymerase and a plurality of nucleotides, and conducting a rolling circle amplification reaction thereby generating a second sub-population of organellar concatemer template molecules inside the cellular sample. In some embodiments, individual organellar concatemer template molecules of the second sub-population comprise tandem repeat polynucleotide units, wherein individual polynucleotide units comprise a sequence that is complementary to a covalently closed circular organellar cDNA library molecule of the second sub-population. In some embodiments, the plurality of nucleotides comprises any combination of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, the plurality of nucleotides comprises aminoallyl-dUTP which can be subjected to cross-linking chemistry. In some embodiments, the plurality of nucleotides lacks aminoallyl-dUTP.
[0398] In some embodiments, the rolling circle amplification reaction of step (g) generates organellar concatemer template molecules comprising repeat copies of a sequence that can form a guanine tetrad, and the resulting concatemer template molecule can fold to form an intramolecular G-quadruplex structure. In some embodiments, the organellar concatemer template molecules can self-collapse to form compact DNA nanoballs. Formation of the guanine tetrads and G-quadruplexes in the DNA nanoballs may increase the stability of the nanoballs, allowing them to retain their compact size and shape which can withstand repeated flows of reagents for conducting any of the sequencing workflows described herein.
[0399] In some embodiments, the rolling circle amplification reaction of step (g) can optionally include a positively charged metal complex, including for example hexamine (e.g., cobalt hexamine III) which can interact electrostatically with the negatively charged phosphate backbone of DNA and condense the organellar concatemer template molecules into a compact structure. The organellar concatemer template molecules can collapse into a DNA nanoball having a more compact size and / or shape compared to a nanoball generatedAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)from a rolling circle amplification reaction conducted without compaction oligonucleotides and / or hexamine (e.g,, cobalt hexamine III),
[0400] In some embodiments, the rolling circle amplification reaction of step (g) can be conducted in the presence or absence of a plurality of compaction oligonucleotides that can bind portions of organellar concatemer template molecules generated by conducting a rolling circle amplification region (e.g., see U. S. Patent No. 12,421,545 which is incorporated by reference herein in its entirety ). Inclusion of compaction oligonucleotides and / or hexamine (e.g., cobalt hexamine III) in the rolling circle amplification reaction can improve FWHM (full width half maximum) of a spot image of the DNA nanoball. The spot image can be represented as a Gaussian spot and the size can be measured as a FWHM. A smaller spot size as indicated by a smaller FWHM typically correlates with an improved image of the spot. In some embodiments, the FWHM of a DNA nanoball spot can be about 10 um or smaller.
[0401] In some embodiments, the methods comprise step (h): sequencing the plurality of organellar concatemer template molecules by contacting the plurality of organellar concatemer template molecules with a sequencing reagent under a condition suitable for conducting at least two sequencing cycles inside the cellular sample thereby generating a plurality of organellar sequencing read products. In some embodiments, the sequencing reagent comprises a plurality of universal sequencing primers, a plurality of sequencing polymerases, and plurality of nucleotide reagents. In some embodiments, individual organellar sequencing read products comprise a universal sequencing primer joined to a polynucleotide generated by a polymerase-catalyzed primer extension reaction of the sequencing reaction, wherein the polynucleotide comprises a sequence that is complementary to at least a portion of the organellar concatemer template molecule. In some embodiments, the plurality of organellar sequencing read products comprise detectably labeled read products that are detectable by imaging (for example, the detectable label comprises a fluorophore, and the imaging comprises fluorescence imaging). In some embodiments, the detectably labeled read products correspond to a target RNA or DNA molecule (an organellar RNA or DNA) which can be detected by imaging. In some embodiments, the spatial location of the target RNA or DNA molecule inside the cellular sample can be determined. In some embodiments, the sequencing of step (h) can be used for conducting seque...
Claims
Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)CLAIMSWhat is claimed is:
1. A method for conducting direct in-sample sequencing comprising:a) providing a cellular sample on a support, wherein the cellular sample comprises a plurality of target polynucleotide molecules located at one or more spatial positions inside the cellular sample;b) contacting the cellular sample with a plurality of nucleic acid primers, individual nucleic acid primers comprising (i) a 5’ region comprising at least one universal adaptor sequence and (ii) a 3’ region comprising a sequence that is complementary to at least a portion of an individual target polynucleotide molecule, wherein the contacting is conducted under a condition suitable for moving the plurality of nucleic acid primers into the cellular sample and binding individual nucleic acid primers to at least a portion of an individual target polynucleotide molecule, thereby generating a plurality of target-primer duplexes;c) conducting a polymerization reaction to synthesize complementary DNA (cDNA) by extending the plurality of nucleic acid primers, thereby generating a plurality of primer-cDNA molecules bound to individual target polynucleotide molecules;d) contacting the plurality of primer-cDNA molecules with a modifying reagent that appends at least one universal adaptor sequence to 3’ ends of individual primer-cDNA molecules, thereby generating a plurality of linear cDNA library molecules comprising a 5’ universal adaptor sequence, a cDNA sequence complementary to the individual target polynucleotide molecule, and a 3’ universal adaptor sequence;e) contacting the plurality of linear cDNA library molecules with a plurality of circularization primers under a condition suitable for generating a plurality of open circle cDNA library molecules, individual open circle cDNA library molecules having a gap or nick;f) generating a plurality of covalently closed circular cDNA library molecules by enzymatically closing the gap or nick;g) contacting the plurality of covalently closed circular cDNA library molecules with a rolling circle amplification reagent under a condition suitable forAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)generating a plurality of concatemer template molecules inside the cellular sample; andh) contacting the plurality of concatemer template molecules with a sequencing reagent and conducting at least two sequencing cycles inside the cellular sample.
2. The method of claim 1, wherein the target polynucleotide molecules comprise RNA and the polymerization reaction comprises a reverse transcription reaction.
3. The method of claim 1 or 2, comprising (i) determining the one or more spatial positions of the plurality of target polynucl eotide molecul es inside the cellular sample from the at least two sequencing cycles.
4. The method of any one of claims 1-3, wherein the sequencing reagent comprises a plurality of universal sequencing primers, a plurality of sequencing polymerases, and plurality of nucleotide reagents.
5. The method of any one of claims 1-4, wherein conducting the at least two sequencing cycles comprises generating a plurality of sequencing read products.
6. The method of claim 5, wherein the plurality of sequencing read products correspond to the plurality of target polynucleotide molecules.
7. The method of claim 5 or 6, wherein the plurality of sequencing read products are detected by imaging.
8. The method of any one of claims 1-7, wherein the cellular sample remains positioned on the same support throughout steps (a) - (h).
9. The method of any one of claims 1-8, wherein the plurality of target polynucleotides comprise a plurality of target DNA molecules and / or a plurality of target RNA molecules.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)10. The method of any one of claims 1-9, wherein 5’ regions of the nucleic acid primers comprise at least one universal adaptor or more identification tag sequences.
11. The method of claim 10, wherein the plurality of target polynucleotide molecules comprises a plurality of polynucleotides comprising a same sequence.
12. The method of any one of claims 1-11, wherein the plurality of target polynucleotide molecules comprises a first plurality of polynucleotides comprising a first sequence and second plurality of polynucleotides comprising a second sequence that is not the same as the first sequence.
13. The method of any one of claims 1-12, wherein the plurality of target polynucleotide molecules comprise one or more RNAs encoded by a gene of cells of the cellular sample.
14. The method of any one of claims 1-13, wherein the plurality of target polynucleotide molecules comprise a perturbation polynucleotide that perturbs expression of one or more genes of cells in the cellular sample.
15. The method of claim 14, wherein the perturbation polynucleotide comprises a CRISPR- Cas guide RNA (gRNA), a small interfering RNA (siRNA), an antisense RNA (asRNA), a short hairpin RNA (shRNA) or a microRNA.
16. The method of claim 15, wherein the CRISPR-Cas gRNA comprises a gRNA for a Class 2 Type II or a Class 2 Type V CRISPR-Cas system.
17. The method of claim 16, wherein the Class 2 Type II CRISPR system comprises Cas9.
18. The method of claim 16, wherein the Class 2 Type V CRISPR system comprises Cpfl (Casl2a), CasX (Cas12e), CasY (Cas12e), Cas, CasLambda or Cas12f.
19. The method of any one of claim s 16-18, wherein the gRNA comprises a scaffold sequence and a target specific spacer sequence, wherein the target specific spacer sequence is comple entary' to a sequence of a gene of cells of the cellular sample.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)20. The method of any one of claims 1-19, wherein individual open circle cDNA library molecules comprise (1) the 5’ portion of an individual circularization primer hybridized to a 5’ end portion of a linear cDNA library molecule, (2) a 3’ portion of the circularization primer hybridized to a 3’ end portion of the linear cDNA library molecule, and (3) the gap or nick between the 5’ and 3’ ends of the linear cDNA library molecule.
21. A method for evaluating a cellular sample, comprising:a) generating a cellular sample comprising a plurality of genetically perturbed cells, wherein individual cells in the plurality comprise a plurality of perturbation polynucleotides comprising a sequencing primer binding sequence and a reverse transcription primer binding sequence, and wherein the cellular sample is on a support;b) challenging the cellular sample to induce a morphological change, a physiological change, or a change in gene expression in the plurality of genetically perturbed cells;c) observing the morphological change, physiological change or change in gene expression;d) contacting the cellular sample with a fixation reagent and a permeabilization reagent under a condition suitable for generating a plurality of fixed and permeabilized genetically perturbed cells;e) generating perturbation polynucleotide-primer duplexes by contacting the plurality of perturbation polynucleotides inside the cellular sample with a plurality of nucleic acid primers, wherein individual nucleic acid primers comprise (i) a 5’ region comprising at least one universal adaptor sequence and (ii) a 3’ region comprising a target-specific sequence that is complementary to at least a portion of the reverse transcription primer binding sequence; f) conducting a polymerization reaction to synthesize complementary DNA (cDN / X) by extending the plurality of nucleic acid primers, thereby generating a plurality of primer-cDNA molecules bound to individual perturbation polynucleotides;g) generating a plurality of linear cDNA library molecules by contacting the plurality of primer-cDNA molecules inside the cellular sample with a modifying reagent that appends at least one universal adaptor sequence to 3’Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)ends of individual primer-cDNA molecules, thereby generating a plurality of linear cDNA library molecules comprising a 5’ universal adaptor sequence, a cDNA sequence complementary to the perturbation polynucleotide, and a 3’ universal adaptor sequence;h) contacting the plurality of linear cDNA library molecules with a plurality of circularization primers, thereby generating a plurality of open circle cDNA library molecules, individual open circle cDNA library molecules having a gap or nick;i) generating a plurality of covalently closed circular cDNA library molecules by enzymatically closing the gap or nick;j) generating a plurality of concatemer template molecules by contacting the plurality of covalently closed circular cDNA library molecules with a rolling circle amplification reagent under a condition suitable for conducting a rolling circle amplification reaction comprising initiating synthesis of DNA from the 3’ end of the circularization oligonucleotide and employing one of the covalently closed circular cDNA library molecules as a template molecule; andk) sequencing the plurality of concatemer template molecules by contacting the plurality of concatemer template molecules with a sequencing reagent under a condition suitable for conducting at least two sequencing cycles inside the cellular sample, thereby generating a plurality of sequencing read products.
22. The method of claim 21, wherein the perturbation polynucleotide comprises RNA, and wherein the polymerization reaction comprises a reverse transcription reaction.
23. The method of claim 21 or 22, comprising identifying the perturbation polynucleotide from the at least two sequencing cycles inside the cellular sample.
24. The method of claim 21 or 22, wherein the 5’ region of the individual nucleic acid primer comprising the at least one universal adaptor sequence comprises one or more identification tag sequences.
25. The method of any one of claims 21-24, comprising, after step (e), contacting the plurality of perturbation polynucleotides with a plurality of blocking oligonucleotides,Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)wherein individual blocking oligonucleotides comprise a single-stranded oligonucleotide having a sequence that can hybridize to one of the perturbation polynucleotides at a position that is located 5’ relative to the hybridization position of one of the nucleic acid primers, and wherein individual blocking oligonucleotides comprise a terminal 3’ moiety that is non-extendible.
26. The method of any one of claims 21-25, wherein individual perturbation polynucleotides comprise a sequence complementary to a target RNA, or a target genomic region comprising a gene encoding the target RNA.
27. The method of any one of claims 21-26, wherein individual perturbation polynucleotides comprise a CRISPR-Cas guide RNA (gRNA), a small interfering RNA (siRNA), an antisense RNA (asRNA), a short hairpin RNA (shRNA) or a microRNA.
28. The method of claim 27, wherein the CRISPR-Cas gRNA comprises a gRNA for a Class 2 Type II or a Class 2 Type V CRISPR-Cas system.
29. The method of claim 28, wherein the Class 2 Type II CRISPR system comprises Cas9.
30. The method of claim 28, wherein the Class 2 Type V CRISPR system comprises Cpfl (Casl2a), CasX (Cas12e), CasY (Cas12e), Cas< P, CasLambda or Cas12f.
31. The method of any one of claims 27-30, wherein the genetically perturbed cells express a catalytically active CRISPR-Cas protein that induces a single-stranded or doublestranded break at a target gene.
32. The method of any one of claims 27-30, wherein the genetically perturbed cells express a catalytically inactive CRISPR-Cas protein (dCas) fused to a transcriptional repressor domain, that represses expression of a target gene33. The method of any one of claims 27-30, wherein the genetically perturbed cells express a catalytically inactive CRISPR-Cas protein (dCas) fused to a transcriptional activator domain, that activates expression of a target gene.
34. The method of any one of claims 27-33, wherein the CRISPR-Cas gRNA comprises (i) a target-specific spacer sequence,Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)(ii) the sequencing primer binding sequence,(iii) a scaffold sequence, and(iv) the reverse transcription primer binding sequence, wherein the sequencing primer binding sequence is adjacent to the target-specific spacer sequence.
35. The method of any one of claims 21-34, wherein individual genetically perturbed cells in the plurality comprises a CRISPR gRNA inserted into a genomic region of a genome of the individual genetically perturbed cell.
36. The method of any one of claims 21-35, wherein the genetically perturbed cells exhibit a morphological change compared to a non-perturbed cell that lacks the perturbation polynucleotide.
37. The method of any one of claims 21-36, wherein single genetically perturbed cells are not separated from the plurality of genetically perturbed cells on the support, and wherein single genetically perturbed cells are not partitioned into separate compartments on the support.
38. The method of any one of claims 21-37, wherein the challenge condition comprises a temperature change, a pH change, light exposure, a dark condition, a nutrient deprivation, a nutrient addition, a toxin exposure, a chemical compound exposure and / or a drug exposure.
39. The method of any one of claims 21-38, wherein the morphological change, physiological change or change in gene expression comprises a change in cell size, a change in cell shape, a change in nuclear size, a change in the cellular location of a protein-of-interest, a change in intracellular protein-protein interaction, a change in gene expression, a change in the presence or absence of a cell surface protein, a change in the structure or arrangement of organelles including mitochondria and / or a change in cell motility.
40. The method of any one of claims 21-39, wherein individual open circle cDNA library molecules comprise (1) a 5’ portion of an individual circularization primer hybridizedAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)to a 5’ end portion of a linear cDNA library molecule, (2) a 3’ portion of the individual circularization primer hybridized to a 3’ end portion of the linear cDNA library molecule, and (3) the gap or nick between the 5’ and 3’ ends of the linear cDNA library molecule.
41. The method of any one of claims 21-40, wherein the perturbation polynucleotide comprises a gRNA, and wherein individual covalently closed circular cDNA library molecules comprise: (i) a sequence for binding a reverse transcription primer; (ii) a scaffold sequence; (iii) a universal sequence for binding a sequencing primer; (iv) a target-specific spacer sequence; and (v) the at least one universal adaptor sequence from the modifying reagent, and wherein the universal sequence for binding a sequencing primer is adjacent to the target-specific spacer sequence.
42. The method of claim 41, wherein the sequencing comprises sequencing the target¬ specific spacer region, thereby identifying the genomic target region of the genetically perturbed cells.
43. The method of any one of claims 21-42, wherein the cellular sample remains on the same support throughout steps (a) - (k).
44. The method of any one of claims 21-43, wherein the sequencing of step (k) identifies individual target genomic regions of individual genetically perturbed cells, and wherein individual target genomic regions of individual genetically perturbed cells correlate with the morphological change exhibited by individual genetically perturbed cells when the plurality of genetically perturbed cells are challenged.
45. The method of any one of claims 21-44, wherein the sequencing of step (k) comprises contacting the plurality of concatemer template molecules with a sequencing reagent and conducting at least two sequencing cycles inside the cellular sample, wherein the sequencing reagent comprises a plurality of sequencing primers, a plurality of sequencing polymerases, a plurality of labeled multivalent molecules and a plurality of non-labeled nucleotides, wherein individual multivalent molecules comprise a core attached to multiple polymer arms, and wherein individual polymer arms comprise a nucleotide moiety.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)46. The method of any one of claim s 1-45, wherein conducting the at least two sequencing cycles comprises:a) contacting a first plurality of polymerases to (i) the plurality of concatemer template molecules and (ii) a plurality of sequencing primers, wherein the contacting is conducted under a condition suitable to bind the first plurality of polymerases to the plurality of concatemer template molecules and the plurality of sequencing primers, thereby forming a first plurality of complexed polymerases each comprising a polymerase bound to a nucleic acid duplex, wherein the nucleic acid duplex comprises a concatemer template molecule hybridized to a sequencing primer;b) contacting the first plurality of complexed polymerases with a plurality of multivalent molecules to form a plurality of multivalent-binding complexes, wherein individual multivalent molecules in the plurality comprise a core attached to multiple nucleotide arms and individual nucleotide arms are attached to a nucleotide moiety, wherein the contacting is conducted under a condition suitable for binding complementary nucleotide moieties of the multivalent molecules to at least two of the first plurality of complexed polymerases thereby forming a plurality of multivalent-binding complexes, and the condition is suitable for inhibiting incorporation of the complementary nucleotide moieties into the nucleic acid primers of the plurality of multivalent-binding complexes;c) detecting the plurality of multivalent-binding complexes; andd) identifying the nucleobase of the complementary nucleotide moieties in the plurality of multivalent-binding complexes, thereby determining the sequence of the concatemer template molecules;e) dissociating the plurality of multivalent-binding complexes by removing the first plurality of polymerases and their bound multivalent molecul es, and retaining the plurality of nucleic acid duplexes;f) contacting the plurality of the nucleic acid duplexes retained at step (e) with a second plurality of a polymerases under a condition suitable for binding the second plurality of polymerases to the plurality of the nucleic acid duplexes, thereby forming a second plurality of complexed polymerases, individualAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)complexed polymerases comprising a polymerase bound to a nucleic acid duplex; andg) contacting the second plurality of second polymerases with a plurality of nucleotides, wherein the contacting is conducted under a condition suitable for binding complementary nucleotides from the plurality of nucleotides to at least two of the complexed polymerases, thereby forming a plurality of nucleotide- binding complexes, and the condition is suitable for promoting nucleotide incorporation of the bound complementary nucleotides into the nucleic acid primers of the nucleotide-binding complexes; andh) repeating steps (a) - (g) at least once.
47. The method of claim 46, further comprising: detecting the complementary nucleotides which are incorporated into the nucleic acid primers of the nucleotide-complexed polymerases.
48. The method of claim 46, further comprising: detecting the complementary nucleotides which are incorporated into the nucleic acid primers of the nucleotide-complexed polymerases and identifying the nucleobases of the complementary nucleotides which are incorporated into the primers of the nucleotide-complexed polymerases.
49. The method of claim 46, wherein the complementary nucleotides which are incorporated into the nucleic acid primers of the nucleotide-complexed polymerases are not detected or identified.
50. The method of any one of claims 46-49, wherein the contacting the first plurality of complexed polymerases with the plurality of multivalent molecules of step (b) is conducted in the presence of a non-catalytic divalent cation that inhibits polymerase- catalyzed nucleotide incorporation, optionally wherein the non-catalytic divalent cation comprises strontium or barium.
51. The method of any one of claim 46-50, wherein the contacting the second plurality of complexed polymerases with the plurality of nucleotides of step (g) is conducted in the presence of a catalytic divalent cation that promotes polymerase-catalyzed nucleotideAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)incorporation, optionally wherein the catalytic divalent cation comprises magnesium or manganese.
52. The method of any one of claims 46-51, wherein individual concatemer template molecules in the plurality comprise a concatemer template molecule having two or more tandem copies of a target sequence.
53. The method of any one of claims 46-52, wherein individual multivalent molecules in the plurality of multivalent molecules comprise: (a) a core; and (b) a plurality of nucleotide arms which comprise (i) a core attachment moiety, (ii) a spacer, (iii) a linker, and (iv) a nucleotide moiety, wherein the core is attached to the plurality of nucleotide arms via their core attachment moiety, wherein the spacer is attached to the linker, and wherein the linker is attached to the nucleotide moiety.
54. The method of claim 53, wherein the linker comprises an aliphatic chain having 2-6 subunits or an oligo ethylene glycol chain having 2-6 subunits.
55. The method of claim 53 or 54, wherein the plurality of nucleotide arms attached to a given core have the same type of nucleotide moieties, and wherein the types of nucleotide moieties comprise dATP, dGTP, dCTP, dTTP or dUTP.
56. The method of claim 53 or 54, wherein the plurality of multivalent molecules comprise one type of a multivalent molecule wherein each multivalent molecule in the plurality has the same type of nucleotide moiety selected from a group consisting of dATP, dGTP, dCTP, dTTP and dUTP.
57. The method of claim 53 or 54, wherein the plurality of multivalent molecules comprise a mixture of any combination of two or more types of multivalent molecules each type having nucleotide moieties selected from a group consisting of dATP, dGTP, dCTP, dTTP and / or dUTP.
58. The method of any one of claims 46-57, wherein at least one multivalent molecule in the plurality of multivalent molecules is labeled with a fluorophore.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)59. The method of any one of claims 46-58, wherein at least one multivalent molecule in the plurality of multivalent molecules comprises a core that is labeled with a fluorophore.
60. The method of any one of claims 46-59, wherein at least one multivalent molecule in the plurality of multivalent molecules comprises one or more nucleotide moieties that are labeled with a fluorophore.
61. The method of any one of claims 46-60, wherein individual nucleotides in the plurality of nucleotides in step (g) comprise an aromatic base, a five carbon sugar, and 1-10 phosphate groups.
62. The method of any one of cl aims 46-61, wherein the plurality of nucleotides of step (g) comprise one type of nucleotide selected from a group consisting of dATP, dGTP, dCTP, dTTP and dUTP, or comprise a mixture of any combination of two or more types of nucleotides selected from a group consisting of dATP, dGTP, dCTP, dTTP and / or dUTP.
63. The method of any one of claims 46-62, wherein at least one of the nucleotides in the plurality of nucleotides in step (g) is labeled with a fluorophore.
64. The method of any one of claims 46-62, wherein the plurality of nucleotides in step (g) lack a fluorophore label.
65. The method of any one of claim s 46-64, wherein at least one of the nucleotides in the plurality of nucleotides of step (g) comprises a removable chain terminating moiety attached to the 3’ carbon position of the sugar group, wherein the removable chain terminating moiety comprises an alkyl group, alkenyl group, alkynyl group, allyl group, aryl group, benzyl group, azide group, azido group, O-azidomethyl group, amine group, amide group, keto group, isocyanate group, phosphate group, thio group, disulfide group, carbonate group, urea group, or silyl group, and wherein the removable chain terminating moiety is cleavable with a chemical compound to generate an extendible 3 ’OH moiety on the sugar group.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)66. The method of any one of claims 46-65, further comprising forming a plurality of binding complexes, comprising the steps:a) binding a first sequencing primer, a first polymerase, and a first multivalent molecule to a first portion of a concatemer template molecule, thereby forming a first binding complex, wherein a first nucleotide moiety of the first multivalent molecule binds to the first polymerase; andb) binding a second sequencing primer, a second polymerase, and the first multivalent molecule to a second portion of the concatemer template molecule, thereby forming a second binding complex, wherein a second nucleotide moiety of the first multivalent molecule binds to the second polymerase, andwherein the first and second binding complexes which include the same multivalent molecule form an avidity complex.
67. The method of any one of claims 46-65, further comprising:a) contacting the first plurality of polymerases and the plurality of sequencing primers with different portions of a concatemer template molecule to form at least first and second complexed polymerases on the immobilized concatemer template molecule;b) contacting a plurality of multivalent molecules to the at least first and second complexed polymerases, under conditions suitable to bind a single multivalent molecule from the plurality to the first and second complexed polymerases, wherein at least a first nucleotide moiety of the single multivalent molecule is bound to the first complexed polymerase which includes a first sequencing primer hybridized to a first portion of the concatemer template molecule, thereby forming a first binding complex, and wherein at least a second nucleotide moiety of the single multivalent molecule is bound to the second complexed polymerase which includes a second sequencing primer hybridized to a second portion of the concatemer template molecule, thereby forming a second binding complex, and• wherein the contacting is conducted under a condition suitable to inhibit polymerase-catalyzed incorporation of the bound first and second nucleotide moi eties in the first and second binding complexes, andAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)• wherein the first and second binding complexes which are bound to the same multivalent molecule form an avidity complex;c) detecting the first and second binding complexes on the concatemer template molecule; andd) identifying the first nucleotide moiety in the first binding complex thereby determining the sequence of the first portion of the concatemer template molecule, and identifying the second nucleotide moiety in the second binding complex thereby determining the sequence of the second portion of the concatemer template molecule.
68. The method of any one of claims 1-67, wherein the cellular sample comprises (i) a first plurality of concatemer template molecules that correspond to a plurality of target polynucleotides and (ii) a plurality of target analytes located at spatial positions inside the cellular sample, optionally wherein the plurality of target analytes comprises target polypeptides, target lipids or target polysaccharides.
69. The method of claim 68, further comprising:a) contacting the cellular sample with a plurality of analyte detection complexes, wherein individual analyte detection complexes comprise (i) an antibody that binds a target analyte, (ii) a bridge oligonucleotide comprising a 5’ end and a 3’ end, wherein the 5’ end is attached to the antibody and the 3’ end comprises an extendible end, and (iii) a circularized barcoded oligonucleotide hybridized to a portion of the bridge oligonucleotide, wherein the circularized barcoded oligonucleotide comprises a universal sequencing primer binding site sequence, a target barcode sequence that corresponds to the target analyte, and a universal circularized region that hybridizes to the bridge oligonucleotide, and wherein the contacting is conducted under a condition suitable for moving the plurality of analyte detection complexes into the cellular sample and binding individual analyte detection complexes to one of the target analytes;b) contacting the plurality of analyte detection complexes with a rolling circle amplification reagent under a condition suitable for generating a second plurality of concatemer template molecules using the 3’ end of the bridge oligonucleotides to initiate DNA synthesis and employing the circularizedAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)barcoded oligonucleotides as template molecules, wherein individual concatemer template molecules in the second plurality comprise tandem repeat polynucleotide units, wherein individual polynucleotide units comprise a sequence that is complementary to the circularized barcoded oligonucleotide, and wherein the second plurality of concatemer template molecules correspond to the plurality of target analytes;c) conducting at least two sequencing cycles of the first plurality of concatemer template molecules thereby generating a plurality of sequencing read products that correspond to the plurality of target polynucleotides; andd) conducting at least two sequencing cycles of the second plurality of concatemer template molecules, thereby generating a plurality of sequencing read products that correspond to the plurality of target analytes.
70. The method of claim 69, further comprising:a) contacting the cellular sample with a plurality of analyte detection complexes, wherein individual analyte detection complexes comprise (i) a first antibody that binds the target analyte, (ii) a second antibody that is attached to the first antibody, wherein the second antibody exhibits little or no binding to the target analyte, (iii) a bridge oligonucleotide comprising a 5’ end and a 3’ end, wherein the 5’ end is attached to the second antibody and the 3’ end comprises an extendible end, and (iv) a circularized barcoded oligonucleotide which is hybridized to a portion of the bridge oligonucleotide, wherein the circularized barcoded oligonucleotide comprises a universal sequencing primer binding site sequence, a target barcode sequence that corresponds to the target analyte, and a universal circularized region that hybridizes to the bridge oligonucleotide, wherein the contacting is conducted under a condition suitable for moving the plurality of analyte detection complexes into the cellular sample and binding individual analyte detection complexes to one of the target analytes; b) contacting the plurality of analyte detection complexes with a rolling circle amplification reagent under a condition suitable for generating a second plurality of concatemer template molecules using the 3’ end of the bridge oligonucleotide to initiate DNA synthesis and employing the circularized barcoded oligonucleotides as template molecules, wherein individual concatemer template molecules in the second plurality comprise tandem repeatAttorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)polynucleotide units, wherein individual polynucleotide units comprise a sequence that is complementary to the circularized barcoded oligonucleotide, and wherein the second plurality of concatemer template molecules correspond to the plurality of target analytes;c) conducting at least two sequencing cycles of the first plurality of concatemer template molecules thereby generating a plurality of sequencing read products that correspond to the plurality of target polynucleotides; andd) conducting at least two sequencing cycles of the second plurality of concatemer template molecules thereby generating a plurality of sequencing read products that correspond to the plurality of target analytes.
71. The method of claim 69 or 70, wherein the sequencing comprises sequencing essentially simultaneously the first plurality of concatemer template molecules and the second plurality of concatemer template molecules, wherein the sequencing generates a first plurality of sequencing read products that correspond to the plurality of target polynucleotides and a second plurality of sequencing read products that correspond to the plurality of target analytes.
72. The method of claim 71, wherein the sequencing comprisesa) contacting the cellular sample with a sequencing reagent comprising a plurality of universal sequencing primers, a plurality of sequencing polymerases, and plurality of nucleotide reagents, wherein the plurality of universal sequencing primers binds the first plurality of concatemer template molecules and the second plurality of concatemer template molecules; and b) and conducting at least two sequencing cycles, thereby generating the plurality of sequencing read products and the second plurality of sequencing read products.
73. The method of claim 72, wherein the sequencing comprises detecting by imaging essentially simultaneously the first plurality of sequencing read products and the second plurality of sequencing read products, thereby determining the spatial positions of the plurality of target polynucleotide molecules inside the cellular sample and determining the spatial positions of the plurality of the target analytes inside the cellular sample.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)74. The method of claim 69 or 70, wherein the sequencing comprises sequencing in separate batches the first plurality of concatemer template molecules and the second plurality of concatemer template molecules, wherein the sequencing generates a first plurality of sequencing read products that correspond to the plurality of target polynucleotides and a second plurality of sequencing read products that correspond to the plurality of target analytes.
75. The method of claim 74, wherein the sequencing comprises:a) contacting the cellular sample with a first sequencing reagent comprising a first plurality of batch-specific sequencing primers, a first plurality of sequencing polymerases, and a first plurality of nucleotide reagents, wherein the first plurality of batch-specific sequencing primers binds the first plurality of concatemer template molecules, and conducting at least two sequencing cycles, thereby generating the plurality of sequencing read products; andb) contacting the cellular sample with a second sequencing reagent comprising a second plurality of batch-specific sequencing primers, a second plurality of sequencing polymerases, and a second plurality of nucleotide reagents, wherein the second plurality of batch-specific sequencing primers binds the second plurality of concatemer template, and conducting at least two sequencing cycles, thereby generating the second plurality of sequencing read products.
76. The method of claim 75, wherein step b) is conducted prior to step a), or step a) is conducted prior to step b).
77. The method of claim 75, wherein the sequencing comprises:a) detecting by imaging the first plurality of sequencing read products, thereby determining the spatial positions of the plurality of target polynucleotide molecules inside the cellular sample; andb) detecting by imaging the second plurality of sequencing read products, thereby determining the spatial positions of the plurality of the target analytes inside the cellular sample.Attorney Docket No.: 43914-02767 / WO (ELEM-040 / 001WO)78. The method of claim 77, wherein step b) is conducted prior to step a), or step a) is conducted prior to step b).