Inhibition of apelin signaling to treat acute myeloid leukemia
Patent Information
- Application Number
- PCT/US2026/015965
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-02-20
- Filing Date
- 2026-02-20
- Publication Date
- 2026-08-27
Smart Images

Figure US2026015965_27082026_PF_FP_ABST
Abstract
Description
[0001] Attorney Docket No: 11624-026WO1
[0002] INHIBITION OF APELIN SIGNALING TO TREAT ACUTE MYELOID LEUKEMIA
[0003] CROSS REFERENCE TO RELATED APPLICATIONS
[0004] This application claims the benefit of U. S. Provisional Patent Application 63 / 760,861, filed February 20, 2025, which is incorporated by reference herein in its entirety.
[0005] GOVERNMENT SUPPORT CLAUSE
[0006] This invention was made with government support under Grant Nos. DK140372 and DK134760, awarded by The National Institutes of Health. The government has certain rights in the invention.
[0007] FIELD OF THE INVENTION
[0008] The present invention involves methods of treating pre-cancerous hematopoietic disorders and hematopoietic cancers including but not limited to leukemia comprising administering a therapeutically effective amount of an inhibitor to apelin (APLN) or a receptor thereof.
[0009] INCORPORATION BY REFERENCE
[0010] The contents of the xml file named “11624-026WO1-ST26” which was created on February 18, 2026, and is 3,789 bytes in size, are hereby incorporated by reference in their entirety.
[0011] BACKGROUND OF THE INVENTION
[0012] Hematopoietic stem cells (HSCs) are regulated by endothelial and mesenchymal stromal cells in the marrow niche. Leukemogenesis was long believed to be solely driven by genetic perturbations in hematopoietic cells but introduction of genetic mutations in the microenvironment demonstrated the ability of niche cells to drive disease progression. The mechanisms by which the stem cell niche induces leukemia remain poorly understood.
[0013] There is an urgent need for new compositions and methods for treating pre-cancerous hematopoietic disorders as well as hematopoietic cancers including but not limited to leukemia.Attorney Docket No: 11624-026WO1
[0014] SUMMARY OF THE INVENTION
[0015] It has been surprisingly and unexpectedly discovered that clones of niche endothelial and stromal cells are significantly expanded in leukemic marrows. The pro-angiogenic peptide apelin secreted by leukemic cells induced sinusoidal endothelial cell clonal selection and transcriptional reprogramming towards an angiogenic state to promote leukemogenesis in vivo.
[0016] Overexpression of apelin in normal hematopoietic stem cells led to clonal amplification of the niche endothelial cells and promotes clonal dominance of blood cells. It was surprisingly discovered herein that knock-out of apelin in leukemic zebrafish suppresses clonal expansion of endothelial cells (see, e.g., FIG. 16 of Example 4) and leukemic cells (see, e.g., FIG. 18 of Example 4), resulting in a significant reduction in disease progression and substantially improved survival (see, e.g., FIG. 4C of Example 3; FIG. 14 of Example 4). Indeed, loss of apelin led to lymphoid and myeloid clone maintenance (see, e.g., FIGs. 19-20 of Example 4) to promote healthy hematopoiesis. Furthermore, single-cell RNA sequencing analysis of endothelial cells from apln mutant marrows shows that loss of apelin inhibits leukemia-induced angiogenic progenitor formation and expansion (see, e.g., FIGs. 21-22 of Example 4) and inhibits proliferating and non-proliferating leukemic cells (see, e.g., FIGs. 23-24 of Example 4). The frequencies of leukemic cells was indeed lowest in the apelin homozygous mutant marrows (see, e.g., FIG. 24 of Example 4).
[0017] Surprisingly, it was found herein that administration of an apelin and / or apelin receptor inhibitor, for example ML221, significantly reduces leukemic cell burden in peripheral blood in a dose-dependent manner (see, e.g., FIGs. 25-26 of Example 5). These results provide additional proof-of-concept for inhibiting apelin and / or apelin receptor, or signaling thereof, for the treatment of pre-cancerous hematopoietic disorders and hematopoietic cancers as disclosed herein. The present invention demonstrates that leukemic cells remodel the clonal and transcriptional landscape of the marrow niche to promote leukemogenesis and provide a therapeutic opportunity for anti-apelin and / or anti-apelin receptor treatment.
[0018] Apelin receptor inhibition by ML221 was also unexpectedly shown to slow leukemia progression in vivo. An animal initially showed a disease burden prior to treatment of 3.07% in peripheral blood (see, e.g., FIG. 34 of Example 7), while after 21 days of administration of 5 mM of ML221, there was no remaining AML disease (see, e.g., FIG. 34 of Example 7) in marrow (FIG. 34). These results demonstrate that apelin and / or apelin receptor inhibitor treatment, for example including but not limited to apelin receptor inhibitor ML221, surprisingly eliminates leukemia from the marrow of a subject in need thereof.Attorney Docket No: 11624-026WO1
[0019] The result is remarkable in that the release of a single molecule, apelin, as described herein was solely responsible for recapitulating leukemia in a preclinical model.
[0020] By comparison, the pro-angiogenic factor vegfc (the only VEGF family member found secreted by leukemic cell in the in vivo leukemia model disclosed herein) did not alter endothelial clonality as much as apelin.
[0021] In further support of the mechanism disclosed herein, human AMLs were found to express significantly higher levels of APLN mRNA compared to healthy bone marrow mononucleated cells (see, e.g., FIG. 27 of Example 6). Among AML sub-types, it was surprisingly shown in three independent datasets that the inv(16) AML subtype (CBFB-MYH11) had the highest apelin expression relative to other AML subtypes studied (see, e.g., FIGs. 28 and 29A-29C of Example 6). Immunohistochemistry assaying of AML tissue validates apelin and apelin receptor have increased protein levels compared to healthy controls (see, e.g., FIGs. 30-33 of Example 6).
[0022] This improvement provides a significant advance in the state of the art of hematopoietic disorder treatments.
[0023] In one aspect, provided herein is a method for treating a subject having a pre-cancerous hematopoietic disorder, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0024] In some embodiments, the pre-cancerous hematopoietic di sorder is selected from clonal hematopoiesis, Early myelodysplastic syndrome (MDS), Monoclonal gammopathy of undetermined significance (MGUS), Immunoglobulin M Monoclonal Gammopathy of Undetermined Significance (IgM MGUS), Smoldering multiple myeloma (SMM), Smoldering Waldenstrom macroglobulinemia (SWM), Clonal cytopenia of undetermined significance (CCUS), Monoclonal B cell lymphocytosis (MBL), Lymphoid clonal hematopoiesis (Lymphoid-CH), or low-grade lymphoma. In some embodiments, the pre-cancerous hematopoietic disorder comprises clonal hematopoiesis. In some embodiments, the clonal hematopoiesis comprises Clonal hematopoiesis of indeterminate potential (CHIP).
[0025] In one aspect, provided herein is a method for treating a subject having clonal hematopoiesis, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0026] In one aspect, provided herein is a method for treating a subject having a hematopoietic cancer, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.Attorney Docket No: 11624-026WO1
[0027] In some embodiments, the apelin inhibitor is selected from an antibody or a derivative thereof, an antibody-drug conjugate, a fusion protein, a small molecule, a dsRNA, an siRNA, an anti-sense technology, an aptamer, a gene editing technology, or a combination thereof. In some embodiments, the apelin inhibitor comprises an anti-apelin antibody or a derivative thereof.
[0028] In some embodiments, the apelin receptor inhibitor is selected from ML221, MM54, APJ antagonist-1, ALX 40-4C, ALX 40-4C Trifluoroacetate, (Alal3)-Apelin- 13 TEA, or (Alal3)-Apelin-13, or a pharmaceutically acceptable salt thereof.
[0029] In some embodiments, the apelin receptor inhibitor is ML221, or a pharmaceutically acceptable salt thereof.
[0030] In one aspect, provided herein is a method for treating a subject having a leukemia, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0031] In one aspect, provided herein is a method for treating a subject having AML, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0032] In one aspect, provided herein is a method for reducing angiogenesis in a subject having a pre-cancerous hematopoietic disorder or a hematopoietic cancer, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0033] In one aspect, provided herein is a method for preventing or reducing niche endothelial clonality in a subject having a pre-cancerous hematopoietic disorder or a hematopoietic cancer, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0034] In one aspect, provided herein is a method for preventing or reducing leukemogenesis in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0035] In one aspect, provided herein is a method of treating a subject having a pre-cancerous hematopoietic disorder, comprising: (i) isolating a sample from the subject; (ii) measuring apelin and apelin receptor expression levels using transcriptomics and / or immunohistochemistry; (iii) measuring niche endothelial clonality in the subject sample versus a control sample; (iv) if apelin and / or apelin receptor is elevated and / or the niche endothelial clonality from the subject sample has expanded relative to the control sample, thenAttorney Docket No: 11624-026WO1
[0036] administering to the subject a therapeutically effective amount of apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0037] In one aspect, provided herein is a method of treating a subject having a hematopoietic cancer, comprising: (i) isolating a sample from the subject; (ii) measuring apelin and apelin receptor expression levels using transcriptomics and / or immunohistochemistry; (iii) measuring niche endothelial clonality in the subject sample versus a control sample; (iv) if apelin and / or apelin receptor is elevated and / or the niche endothelial clonality from the subject sample has expanded relative to the control sample, then administering to the subject a therapeutically effective amount of apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0038] In one aspect, provided herein is a method for preventing, reducing, suppressing, or inhibiting clonal expansion of endothelial cells and leukemic cells in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0039] In one aspect, provided herein is a method for increasing, promoting, or initiating healthy hematopoiesis in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof. In some embodiments, healthy hematopoiesis comprises lymphoid and myeloid clone maintenance. In some embodiments, healthy hematopoiesis comprises reducing, suppressing, or inhibiting proliferating and non-proliferating leukemic cells.
[0040] In one aspect, provided herein is a method for preventing, reducing, suppressing, or inhibiting leukemia-induced angiogenic progenitor formation and expansion in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0041] A summary of embodiments of the invention is described in further detail below.
[0042] BRIEF DESCRIPTION OF THE FIGURES
[0043] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate certain examples of the present disclosure and together with the description, serve to explain, without limitation, the principles of the disclosure. Like numbers represent the same elements throughout the figures.
[0044] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0045] FIGs. 1A-1G show Overexpression of MYC induces acute myeloid leukemia.Attorney Docket No: 11624-026WO1
[0046] FIG. 1A shows Survival curves of uninjected (n=70) and drl: MYC injected (n=152) zebrafish demonstrate significantly reduced survival of drkMYC animals. ****p<0.0001.
[0047] FIG. 1B shows Representative example of a drl:mCherry control and drl:MYC leukemic animal in Casper EKK background demonstrating phenotypic manifestations of leukemia. Scale represents 1 centimeter.
[0048] FIG. 1C shows Violin plot of live marrow cells quantified by flow cytometry and gated into five distinct populations as defined by forward and side scatter demonstrating changes in hematopoietic lineages in drkmCherry (n=40) and drkMYC-mCherry marrows (n=48). ****p<0.0001.
[0049] FIG. 1D shows Representative example of May-Grunwald Giemsa staining of cytospins from healthy (n=40) and drl:MYC total marrows (n=34) demonstrating accumulation of leukemic cells in drkMYC marrows. Scale bar represents 10pm.
[0050] FIG. 1E shows Violin plot with all genes differentially expressed between drl:mCherry control (n=2) and drl:MYC-mCherry (n=4) total marrow cells. Purple dots are significantly upregulated (n=1,225 genes) in drkMYC-mCherry marrows and black dots are significantly downregulated (n=3,741 genes) in drkMYC-mCherry marrows with p-value cutoff < 0.05 and log2 fold change < -1 and > 1.
[0051] FIG. 1F shows Zebrabow color barcoding of healthy (n=8) and leukemic (n=6) marrows. Left panel show's single progenitor or leukemic clone size in individual healthy and leukemic animals, respectively. Dashed line represents 30%, threshold for clonal dominance. Numbers 1 or 2 indicate the dominant clone(s) for each leukemic animal. Right panel shows the number of clones, percentage of healthy progenitors or leukemic cells as quantified by flow' cytometry and size of the biggest clones demonstrating that higher leukemic burden is reflected by lower clone number and larger dominant clone.
[0052] FIG. 1G shows GESTALT barcoding of healthy (n=3) and leukemic (n=3) marrows. Left panel shows single progenitor or leukemic clone size in individual healthy and leukemic animals, respectively. Right panel shows a visualization of number of clones, percentage of healthy progenitors or leukemic cells as quantified by flow cytometry and size of the biggest clones demonstrating that higher leukemic burden is reflected by lower clone number and largest dominant clone.
[0053] FIGs. 2A-2F show Leukemia induces clonal and transcriptional remodeling of niche ECs and MSCs.
[0054] FIG. 2A shows Experimental approach for GESTALT cellular barcoding of niche cells in leukemic zebrafish. GESTALT guide and barcode fish are crossed and embryos are injectedAttorney Docket No: 11624-026WO1
[0055] with drl: MYC and gRNAl-4 for early barcoding. Embryos are heat-shocked at 28hpf for late barcoding. Adult zebrafish with leukemia are identified based on phenotypic manifestation of disease and siblings identified as drl: MYC- by PCR on blood samples are included as controls. Marrows are dissected for sorting of kdrl: GFP+ ECs and cxcil2a:dsRed+ MSCs for DNA extraction, GESTALT barcode amplification and sequencing, and single-cell mRNA- sequencing.
[0056] FIG. 2B shows Violin plot of EC (left panel, n=441 for healthy and n=235 for leukemic, mean 1.4 to 3.4) and MSC (right panel, n=545 for healthy and n=240 for leukemic, mean 1.3 to 3.2) clone size of pooled healthy and leukemic marrows revealing clonal selection upon leukemia. **** pcO. OOOl.
[0057] FIG. 2C shows Bar graph of the mean with standard deviation of the size of the top five largest EC (left panel) and MSC (right panel) clones in healthy and leukemic marrows showing selective clonal expansion in leukemic marrows. Mean 8.6 to 13.6 for ECs and 8.2 to 10.8 for MSCs. * p<0.05.
[0058] FIG. 2D shows UMAP dimensionality reduction of scRNA-seq of kdrl: GFP+ ECs and cxcl12a:dsRed+ MSCs from healthy (n=2) and leukemic (n=3) marrows (n=9,176 cells). Colors represent cell types and match the legend in FIG. 2F.
[0059] FIG. 2E shows Pie chart of MSC (upper panel) and EC (lower panel) subpopulation proportions in healthy and leukemic marrows as identified in panel D. Percentage are indicated next to each population on each pie chart.
[0060] FIG. 2F shows Violin plot showing the angiogenesis scGSEA enrichment score in healthy (n=563 cells) and leukemic (n=3,429 cells) sinusoidal ECs demonstrated increased angiogenic activity of ECs in leukemic marrows. **** pcO. OOOl.
[0061] FIGs. 3A-3G show apelin secreted by blood cells regulates EC clonal and transcriptional profile.
[0062] FIG. 3A shows Dot plot highlighting candidate secreted factors identified by DEG analysis between healthy HSPCs (n=4,461 cells) and leukemic cells (n=19,570 cells). Dot size represents the fraction of cells expressing each gene, vegfc, admb and apln were selected for further functional analyses.
[0063] FIG. 3B shows UMAP dimensionality reduction as defined in FIG. 2D. showing the combined expression of the two isoforms of the apln receptor: aplnra and aplnrb in healthy and leukemic marrows. Color represents gene expression level. The receptors are exclusively detected in ECs.Attorney Docket No: 11624-026WO1
[0064] FIG. 3C shows Violin plot of EC done size of pooled drl: BFP control (n=12 fish, n=2 1 clones) and drl:apln-BFP (n=14, n=227 clones) overexpressing marrow's. * p<0.05.
[0065] FIG. 3D shows UMAP dimensionality reduction of scRNA-seq of kdrl:GFP+ ECs and cxcl12a:dsRed+ MSCs from control (n=2) and apln overexpression (n=2) marrows. Colors represent cell types and match the legend in FIG. 3E.
[0066] FIG. 3E shows Pie chart of MSC (upper panel) and EC (lower panel) subpopulation proportions in control and apln overexpressing marrows as identified in FIG. 3D. Percentage are indicated next to each population on each pie chart.
[0067] FIG. 3F shows Violin plot of myeloid, erythroid, lymphoid and multipotent clone size of pooled control (n=12 fish, n=827 myeloid clones, n=600 erythroid clones, n=621 lymphoid clones and n=347 multipotent 5 clones) and apln overexpressing (n=14, n=480 myeloid clones, n=338 erythroid clones, n=579 lymphoid clones and n=233 multipotent clones) marrows revealing clonal expansion of myeloid and erythroid clones upon overexpression of apln. ** pcO. OL
[0068] FIG. 3G shows Pie chart of hematopoietic subpopulation proportions in control (n=18,042 cells) and apln overexpressing (n=29,814 cells) marrows with increased macrophages and erythrocytes. Percentage are indicated next to each population on each pie chart.
[0069] FIGs. 4A-4D show apln mediated EC remodeling drives leukemogenesis.
[0070] FIG. 4A shows Flow cytometry contour plot of a representative example of drl: BFP control (n=6) and drl:apln-BFP abnormal (n=4) marrow showing a leukemia-like profile.
[0071] FIG. 4B shows May-GrUnwald Giemsa staining of cytospins of total control (n=6) and apln overexpressing (n=4) marrows demonstrating accumulation of leukemic cells in drkapln-BFP marrows. Scale bar represents 20um.
[0072] FIG. 4C shows Survival curves of apelin wildtype (aplnwt, n=14), heterozygous (aplnhet, n=51) and homozygous (aplnhom, n=23) mutant animals injected with and positive for drl: MYC overexpression transgene. ** pcO. Ol, *** pcO. OOl.
[0073] FIG. 4D shows APLN immunohistochemistry (left panels) and CD31 immunohistochemi stry (right panels) of one representative example of healthy human marrow and one representative example of AML human marrow. Additional samples in FIG. 12. Scale bar represents 20um (all panels).
[0074] FIGs. 5A-5D show MYC overexpression induces expansion of erythroid progenitors.Attorney Docket No: 11624-026WO1
[0075] FIG. 5A shows Flow cytometry contour plot of a representative example of drl:mCherry control (grey) overlapped with two examples of drl:MYC-mCherry leukemic (purple) marrow showing leukemic cells (n=34) and pro-erythroblasts (n=14).
[0076] FIG. 5B shows Flow cytometry contour plot of a representative example of drl:mCherry control (grey) overlapped with two examples of drl:MYC-mCherry leukemic (purple) peripheral blood samples showing circulating leukemic cells (n=34) and proerythroblasts (n=14).
[0077] FIG. 5C shows Representative example of MYC immunohistochemistry on a drl:MYC marrow section showing a packed marrow with MYC+ leukemic cells. Scale bar represents 100µm.
[0078] FIG. 5D shows Bar graph quantifying the mean with standard deviation of the fraction of lcr: GFP and gatala:dsRed populations in healthy progenitors (left panel, n=4), leukemic cells and proerythroblasts (right panel, n=3) demonstrating the erythroid identity of transformed populations. * p<0.05 between healthy vs. drkMYC lcr+ gatala+ and ** p<0.001 between healthy vs. drkMYC lcr+ gatala-.
[0079] FIGs. 6A-6D show drkMYC leukemic cells are serially transplantable.
[0080] FIG. 6A shows Scatter plot quantifying the percentage of live cells in lymphoid, progenitor and myeloid gates as defined by FSC / SSC and mCherry gate in non-transplanted controls (n=19), primary donors (n=2), primary recipients (n=7) and secondary recipients (n=18).
[0081] FIG. 6B shows Line graph demonstrating the correlation between mCherry+ cells and cells overlapping with the progenitor gate demonstrating that both readouts can be used to measure engraftment.
[0082] FIG. 6C shows Flow cytometry plots of a representative example of donor 1 (left panels) and a subsequent engrafted primary recipient (middle panels) and secondary recipient (right panels). Top row shows contour plots of live cells in FSC / SSC space and percentage in lymphoid, myeloid and progenitor gate are indicated under each gate. Bottom row' shows histograms of live cells gated for mCherry and percentage of mCherry+ cells are indicated above each gate.
[0083] FIG. 6D show's Dot plot of the Gini coefficient for healthy (n=ll) and leukemic (n=9) marrow's as read out by Zebrabow and GESTALT. Line represents mean which is 0.50 for healthy and 0.8 for leukemic. *** p<0.0001.
[0084] FIGs. 7A-7F shows ECs and MSCs from leukemic marrows are clonally expanded.Attorney Docket No: 11624-026WO1
[0085] FIG. 7A shows Flow cytometry plots of a representative example of healthy (top panels, n=6) and leukemic (bottom panels, n=8) enzymatically dissociated marrows in FSC / SSC space (contour plots, left panels) and GFP and dsRed space (pseudo-color plots, right panels). The percentage of live cells is indicated under each gate.
[0086] FIG. 7B shows Violin plot of the number of clones detected in purified FCs (left panel) and MSCs (right panel) in healthy (n=6) and leukemic marrows (n=8) showing decreased clonal complexity upon leukemia. Mean is 73.7 to 29.5 for ECs and 78 to 30.1 for MSCs. * p<0.05, ** pcO. Ol. The red line indicates the median value.
[0087] FIG. 7C show's Violin plot of EC clone size of individual healthy (n=6) and leukemic (n=8) marrows (left panel) and dot plot of mean EC clone size for healthy and leukemic fish (right panel). Red line indicates median. * p<0.05.
[0088] FIG. 7D show's Violin plot of MSC clone size of individual healthy (n=6) and leukemic (n=8) marrows (left panel) and dot plot of mean MSC clone size for healthy and leukemic fish (right panel). Red line indicates median. * p<0.05.
[0089] FIG. 7E shows Dot plot of the percentage of flk1:GFP+ BFP+ cells in 3 dpf embryos injected with drl:BFP (n=3 pools of 6 embryos) and drl:MYC-BFP (n=6 pools of 6 embryos). Line represents mean.
[0090] FIG. 7F shows Dot plot of the percentage of flk1:GFP+ cells in 3 dpf embryos injected with drl:BFP (n=3 pools of 6 embryos) and drl:MYC-BFP (n=6 pools of 6 embryos). Line represents mean.
[0091] FIGs. 8A-8B show Distinct MSC and EC subpopulations can be identified by scRNA-seq.
[0092] FIG. 8A shows UMAP dimensionality reduction (n=9,176 cells) as defined in Fig. 2D. showing the expression of the MSC gene signature (top left), the kitlga+ MSC signature (top middle), the lepr+ MSC signature (top right), kitlga (bottom left) and lepr (bottom middle) in healthy and leukemic marrows combined on the same UMAP. Gene signatures are listed under the subpopulation name. Single genes are indicated above their respective plots. Color represents signature or gene expression level.
[0093] FIG. 8B shows UMAP dimensionality reduction (n=9,176 cells) as defined in Fig. 2D. showing the expression of the EC gene signature (top left), the lymphatic EC signature (top middle), the arterial EC signature (top right), the sinusoidal EC 1 signature (bottom left), the sinusoidal EC 2 signature (bottom middle) and the angiogenic signature (bottom right) in healthy and leukemic marrows combined on the same UMAP. Gene signatures are listed under the subpopulation name. Color represents signature or gene expression level.Attorney Docket No: 11624-026WO1
[0094] FIGs. 9A-9D show lepr+ MSCs are activated in leukemic marrows.
[0095] FIG. 9A shows Heatmap of differentially expressed genes (p-value < 0.05) in lepr+ and kitlga+ MSC subpopulations in healthy (n=677 cells) and leukemic (n=2,035 cells) marrows. kitlga+ MSCs gene expression is unchanged upon leukemia while lepr+ MSCs undergo a transcriptional change (bottom blocks on heatmap). Heatmap color represents gene expression level. Top color bars represent MSC subpopulation and sample identity.
[0096] FIG. 9B shows Violin plots of scGSEA pathways identified as differentially enriched in healthy versus leukemic MSCs and involved in MSC function and activation. **** pcO. OOOl.
[0097] FIG. 9C shows UMAP dimensionality reduction (n=9,176 cells) as defined in FIG. 2E. showing the expression of cd248a in healthy (top) and leukemic (bottom) marrows. Color represents gene expression level.
[0098] FIG. 9D shows Representative example of immunohistochemistry for dsRed fluorescent protein on sections from healthy (n=4) and leukemic (n=4) cxcll 2a: dsRed transgenic zebrafish showing distinct regions of MSC density. Scale bar represents 100pm (left panels) and 20pm (right panels).
[0099] FIGs. 10A-10E show Leukemia induces expansion of angiogenic progenitors.
[0100] FIG. 10A shows Heatmap of the top 8 marker genes in arterial ECs (n=816 cells), angiogenic progenitors (n=1,225 cells), sinusoidal EC 1 (n=1,335 cells) and 2 (n=616 cells) subpopulations demonstrating that angiogenic progenitors share marker genes with all other populations. Heatmap color represents gene expression level. Top color bar represents EC subpopulations.
[0101] FIG. 10B shows UMAP of in silico purified ECs (n=3,992 cells) split based on healthy or leukemic marrow of origin after Monocle 3 trajectory analysis starting at the angiogenic progenitor cluster demonstrating two distinct differentiation paths towards arterial or sinusoidal ECs. Red line is monocle inferred trajectory and UMAP is colored based on pseudotime.
[0102] FIG. 10C shows Representative image of live marrow from healthy (n=5) and leukemic (n=3) kdrl:GFP transgenic fish demonstrating a change in vasculature structure with dense and depleted regions. White line indicates regions without tissue. Red arrows indicate vascular dense regions. Scale bar represents 100pm (left panel) and 200pm (right panel).
[0103] FIG. 10D shows Representative images of close-ups (lOOX) from dense vascular regions of healthy and leukemic marrows demonstrating a change in structure and endocytic content of ECs. Scale bar represents 10pm.Attorney Docket No: 11624-026WO1
[0104] FIG. 10E shows UMAP dimensionality reduction showing the expression of early endosome markers in in silico purified ECs (n=3,992 cells) split based on healthy or leukemic marrow of origin. Color represents combined gene expression level.
[0105] FIGs. 11A-11J show apln overexpression induces EC clonal selection and alters HSPC clonal output.
[0106] FIG. 11A shows UMAP dimensionality reduction (n=9,176 cells) as defined in Fig. 2E. showing the expression of the two vegfc receptors kdrl and flt4 in healthy and leukemic marrows demonstrating selective and increased expression in leukemic ECs. Color represents combined gene expression level.
[0107] FIG. 11B shows UMAP dimensionality reduction (n=9,176 cells) as defined in FIG.
[0108] 2E. showing the expression of the three admb receptors ramp2, calcrla and calcrib in healthy and leukemic marrows demonstrating increased expression in leukemic ECs. Color represents combined gene expression level.
[0109] FIG. 11 C shows Violin plot of EC (left panel) and MSC (right panel) clone size of pooled control drkBFP (n=6 fish, n=110 EC clones, n=74 MSC clones) and drl:vegfc-BFP (n=6 fish, n=48 EC clones, n=47 MSC clones) marrows revealing EC clonal expansion driven by relatively small clones. * p<0.05. ns=non-significant.
[0110] FIG. 11D shows Violin plot of EC (left panel) and MSC (right panel) clone size of pooled control drkBFP (n=5 fish, n=192 EC clones, n=152 MSC clones) and drkadmb-BFP (n=ll fish, n=332 EC clones, n=293 MSC clones) marrows revealing no EC or MSC clonal expansion. ns=non-significant.
[0111] FIG. 11E shows APLN immunohistochemistry of wild type control (left), drl:apln-BFP (middle) and drkMYC (right). Scale bar represents 20pm (all panels). Red arrows indicate APLN positive blood cells. Dashed red circles show example of auto fluorescent kidney tubules when present.
[0112] FIG. 11F shows Violin plot of the number of clones detected in purified ECs (left panel) and MSCs (right panel) in drkBFP control (n=12) and drkapln-BFP marrows (n=14) showing no significant decrease in clone number. The red line indicates the median value. ns= non-significant.
[0113] FIG. 11G shows Violin plot of MSC clone size of pooled control drkBFP (n=12 fish, n=303 clones) and drkapln-BFP (n=14 fish, n=469 clones) marrows revealing no MSC clonal expansion. ns=non-significant.
[0114] FIG. 11H shows Dot plot of live marrow cells quantified by flow cytometry and gated into three distinct populations demonstrating no changes in hematopoietic lineages in drkapln-Attorney Docket No: 11624-026WO1
[0115] BFP marrows (n=115) compared to drkBFP controls (n=102). Line shows mean. ns=non-significant.
[0116] FIG. HI shows Dot plot of live marrow cells quantified by flow cytometry and gated for gatala:dsRed erythroid progenitors and lcr: GFP erythrocytes showing a significant increase in erythrocytes in drkapln-BFP marrows (n=30) compared to drkBFP controls (n=32). Line shows mean. **p<0.01. ns=non-significant.
[0117] FIG. 11 J shows Dot plot of live marrow cells quantified by flow cytometry and gated for Runxl+23:mCherry HSPCs showing no difference in drkapln-BFP marrows (n=21) compared to drkBFP (n=24) controls. line shows mean. ns=non significant.
[0118] FIGs. 12A- 12E show Human AMLs express high levels of APLN and have expanded vasculature.
[0119] FIG. 12A shows Dot plot of live marrow cells quantified by flow cytometry and gated into three distinct populations demonstrating changes in hematopoietic lineages in abnormal drkapln-BFP marrows (n=5) compared to drkBFP controls (n=5). * p<0.05. ns=non-significant.
[0120] FIG. 12B shows Dot plot of live marrow cells quantified by flow cytometry and gated into three distinct populations demonstrating changes in hematopoietic lineages in abnormal aplnWT (n=10), aplnHET (n=10) and aplnHOM (n=10). ns=non-significant.
[0121] FIG. 12C shows Violin plot of APLN normalized RPKM from the BEAT AML. study from healthy bone marrow mononucleated cells (n=I9) and AML cells (n=440). **** p<0.0001.
[0122] FIG. 12D shows APLN immunohistochemistry (top panels) and CD31 immunohistochemistry (bottom panels) of healthy human marrows. Scale bar represents 20μm (all panels).
[0123] FIG. 12E shows APLN immunohistochemistry (top panels) and CD31 immunohistochemistry (bottom panels) of AML human marrow. Scale bar represents 20pm (all panels).
[0124] FIGs. 13A-13B show barcoding dynamics during embryo development.
[0125] FIG. 13A shows Line graph of the mean percentage of unedited reads over time in embryos barcoded after injection of cas9 mRNA and gRNAs 1-4 (yellow line) and after heatshock at 37°C for 30 minutes at 28 hpf (blue line). Two independent clutches per experiment and n= 10 total individual embryos per time point. Error bars represent standard deviations.
[0126] FIG. 13B shows Histogram of barcode frequency from all samples.Attorney Docket No: 11624-026WO1
[0127] FIG. 14 shows Apelin knock-out significantly slows down leukemia. Survival curve of leukemic animals of three distinct genotypes: apelin wildtype (aplnWT), apelin heterozygous (aplnHET), and apelin homozygous (aplnHOM). Probability of survival as a percentage is represented on the y-axis while weeks is represented on the x-axis. All animals had disease present in the peripheral blood a determined by PCR for the human MYC oncogene. All animals are leukemic per diagnostic RO bleed.
[0128] FIG. 15 shows Apelin knock-out prevents endothelial niche clonal expansion. Previous dataset of leukemic WT fish. Clone size as a fraction of reads per clone is represented on the y-axis while each bar on the x-axis is a fish, all fish are leukemic, each dot is a clone.
[0129] FIG. 16 shows Apelin knock-out prevents endothelial niche clonal expansion. Violin plot of the number of clones detected in purified FCs from leukemic apelin wild type (left, n=2), heterozygous (middle, n=3) and homozygous (right, n=2) marrows showing that loss of apelin suppresses clonal expansion of endothelial cells. Clone size as a fraction of reads per clone is represented on the y-axis while each bar on the x-axis is a fish, all fish are leukemic, each box is a genotype (WT, HET, HOM), each dot is a clone.
[0130] FIG. 17 shows Apelin knock-out prevents leukemic clonal expansion. Previous dataset of leukemic WT fish. Clone size as a fraction of reads per clone is represented on the y-axis while each bar on the x-axis is a fish, all fish are leukemic, each dot is a clone.
[0131] FIG. 18 shows Apelin knock-out prevents leukemic clonal expansion. Violin plot of the number of clones detected in purified hematopoietic progenitors from leukemic apelin wild type (left, n=2 ), heterozygous (middle, n=3) and homozygous (right, n=2) marrows showing that loss of apelin suppresses clonal expansion of the leukemic clone. Clone size as a fraction of reads per clone is represented on the y-axis while each bar on the x-axis is a fish, all fish are leukemic, each box is a genotype (WT, HET, HOM), each dot is a clone.
[0132] FIG. 19 shows Apelin knock-out allows for maintenance of healthy hematopoiesis. Violin plot of the number of clones detected in purified hematopoietic lymphoid cells from leukemic apelin wild type (left, n=2), heterozygous (middle, n=3) and homozygous (right, n=2) marrows showing that loss of apelin allows for healthy lymphoid clone maintenance. Clone size as a fraction of reads per clone is represented on the y-axis while each bar on the x-axis is a fish, all fish are leukemic, each box is a genotype (WT, HET, HOM), each dot is a clone.
[0133] FIG. 20 shows Apelin knock-out allows for maintenance of healthy hematopoiesis. Violin plot of the number of clones detected in purified hematopoietic myeloid cells from leukemic apelin wild type (left, n=2), heterozygous (middle, n=3) and homozygous (right, n=2) marrows showing that loss of apelin allows for healthy myeloid clone maintenance. Clone sizeAttorney Docket No: 11624-026WO1
[0134] as a fraction of reads per clone is represented on the y-axis while each bar on the x-axis is a fish, all fish are leukemic, each box is a genotype (WT, HET, HOM), each dot is a clone.
[0135] FIG. 21 shows Apelin knock-out inhibits angiogenic progenitor formation. UMAP dimensionality reduction of scRNA-seq of kdrl: GFP+ endothelial cells from healthy control (n=2), leukemic (n=2), leukemic apelin heterozygous (n=l) and leukemic apelin homozygous (n=l) marrows showing that loss of apelin inhibits leukemia-induced angiogenic progenitor expansion.
[0136] FIG. 22 shows Apelin knock-out inhibits angiogenic progenitor formation. Stacked bar graph quantifying the fraction of each endothelial cell subpopulation on the y-axis in healthy control (n=2), leukemic (n=2), leukemic apelin heterozygous (n=l) and leukemic apelin homozygous (n=l) marrows on the x-axis showing that loss of apelin inhibits leukemia- induced angiogenic progenitor expansion.
[0137] FIG. 23 shows Transcriptome of hematopoietic cells in leukemic apelin wild-type (WT), heterozygous (HET), and homozygous (HOM) marrows. UMAP dimensionality reduction of scRNA-seq of hematopoietic cells from leukemic (n=2), leukemic apelin heterozygous (n=l) and leukemic apelin homozygous (n=l) marrows showing that loss of apelin inhibits reduces the amount of proliferating and non proliferating leukemic cells.
[0138] FIG. 24 shows Transcriptome of hematopoietic cells in leukemic apelin wild-type (WT), heterozygous (HET), and homozygous (HOM) marrows. Stacked bar graph quantifying the fraction of each hematopoietic cell subpopulation on the y-axis from leukemic (n=2), leukemic apelin heterozygous (n=l) and leukemic apelin homozygous (n=l) marrows on the x-axis showing that loss of apelin inhibits reduces the amount of proliferating and non proliferating leukemic cells.
[0139] FIG. 25 shows disease burden change in the peripheral blood demonstrates ML221 treatment efficacy. Fold change of the percent of leukemic cells in the peripheral blood of leukemic zebrafish as represented on the y-axis between day 14 and day 21 of treatment with 1mM (n=10) or 3mM (n=10) of ML221 (apelin receptor antagonist) or DMSO control (n=10) as represented on the x-axis showing that ML221 treatment significantly reduces leukemic burden in a dose-dependent manner. (*, pcO. Ol).
[0140] FIG. 26 shows disease burden change in the peripheral blood demonstrates ML221 treatment efficacy. Descriptive change of the percent of leukemic cells in the peripheral blood of leukemic zebrafish as represented on the y-axis between day 14 and day 21 of treatment with 1mM (n=10) or 3mM (n=10) of ML221 (apelin receptor antagonist) or DMSO controlAttorney Docket No: 11624-026WO1
[0141] (n=10) on the x-axis showing that ML221 treatment significantly reduces leukemic burden in a dose dependent manner.
[0142] FIG. 27 shows Human AMLs express high levels of apelin. Violin plot of APLN normalized RPKM from the BEAT AML study from healthy bone marrow mononucleated cells (n=19) and AML cells (n=440). (****, pcO. OOOl). Graph demonstrates that human AMLs express a significantly higher level of APLN mRNA compared to healthy marrows.
[0143] FIG. 28 shows Human AMLs express high levels of apelin. Density plot of APLN normalized RPKM from the BEAT AML study from healthy bone marrow mononucleated cells (n=19) and AML cells (n=440) where AML sample were separated based on disease genotype. Graph demonstrates that inv(16) CBFB-MYH11 AML have the highest levels of apelin.
[0144] FIGs. 29A-29C show three independent datasets which confirm that inv( 16) AMLs express high levels of apelin. Dot plots of APLN normalized RPKM from 3 different patient cohorts (origin indicated above each graph). Graphs validate the BEAT AML dataset and demonstrate that inv(16) CBFB-MYH11 AML have the highest levels of apelin.
[0145] FIG. 29 A shows APLN expression in inv(16) relative to other AML subsets in Mullighan lab of St Jude.
[0146] FIG. 29B shows APLN expression in inv(16) relative to other AML subsets in Andreef lab of MD Anderson.
[0147] FIG. 29C shows APLN expression in inv(16) relative to other AML subsets in Sauvageau of Universite de Montreal.
[0148] FIG. 30 shows inv( 16) AMLs express high levels of apelin. Immunohistochemistry (IHC) for APELIN of one representative healthy marrow (top) and inv( 16) AML marrow' (bottom) validating that inv(16) AML express high levels of the apelin protein.
[0149] FIG. 31 shows inv(16) AMLs express high levels of apelin. Quantification of the APELIN protein levels as represented on the y-axis in healthy (n=4), non-genetically defined AML (n=4) and inv(16) AML (n=16) on the x-axis validating that AMLs have increased protein levels of APELIN compared to healthy controls
[0150] FIG. 32 shows inv(16) AML marrows stained with antibodies against APELIN (APLN) and APELIN RECEPTOR (APLNR). Immunohistochemistry (IHC) for APELIN (left panel) and APLNR (middle and boxed inserts) of two inv(16) AML marrows demonstrating that the apelin receptor is expressed on endothelial cells in leukemic marrows.
[0151] FIG. 33 shows inv(16) AML marrows stained with antibodies against APELIN (APLN) and APELIN RECEPTOR (APLNR). Immunohistochemistry (IHC) for APELIN (left panel)Attorney Docket No: 11624-026WO1
[0152] and APLNR (three right panels) of two inv(16) AML marrows demonstrating that the apelin receptor is expressed on endothelial cells (arrows) in leukemic marrows.
[0153] FIG. 34 shows Apelin receptor inhibition using ML221 significantly slows down leukemia progression in vivo. Flow cytometry plot of one animal treated for 21 days with mM of ML221. Left panel shows disease burden of BFP+ 3.07% in the peripheral blood before treatment. Right panel shows a disease burden of BFP+ 0.01% in marrow after 3 weeks (21 days) of treatment. Each dot is a cell. These results demonstrate that mM treatment of ML221 eliminated leukemia from the marrow of one animal.
[0154] DETAILED DESCRIPTION
[0155] The following description of the disclosure is provided as an enabling teaching of the disclosure in its best, currently known embodiment(s). To this end, those skilled in the relevant art will recognize and appreciate that many changes can be made to the various embodiments of the invention described herein, while still obtaining the beneficial results of the present disclosure. It will also be apparent that some of the desired benefits of the present disclosure can be obtained by selecting some of the features of the present disclosure without utilizing other features. Accordingly, those who work in the art will recognize that many modifications and adaptations to the present disclosure are possible and can even be desirable in certain circumstances and are a part of the present disclosure. Thus, the following description is provided as illustrative of the principles of the present disclosure and not in limitation thereof.
[0156] Reference will now be made in detail to the embodiments of the invention, examples of which are illustrated in the drawings and the examples. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein.
[0157] Definitions
[0158] In this specification and in the claims that follow, reference will be made to many terms, which shall be defined to have the following meanings:
[0159] Throughout the specification and claims, the w ord "comprise" and other forms of the word, such as "comprising" and "comprises," means including but not limited to, and is not intended to exclude, for example, other additives, components, integers, or steps.
[0160] As used in the description and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context dictates otherwise. Thus, for example,Attorney Docket No: 11624-026WO1
[0161] reference to "a composition" includes mixtures of two or more such compositions, reference to "an agonist" includes mixtures of two or more such agonists and the like.
[0162] " Optional" or "optionally" means that the subsequently described event or circumstance can or cannot occur and that the description includes instances where the event or circumstance occurs and instances where it does not.
[0163] An "agonist" is a molecule that interacts with a target to cause or promote increased activation of the target. An "antagonist" is a molecule that opposes the action of an agonist. Antagonists prevent, reduce, inhibit or neutralize the activity of agonists, and antagonists also prevent, inhibit constitutive activity of a target, e.g., a target receptor, even in the absence of an identified agonist, can be reduced or reduced.
[0164] Antisense, Sense, and Antigene: Double-stranded DNA (dsDNA) has two strands, a 5' — >3' strand, referred to as the plus strand, and a 3' — 5' strand (the reverse compliment), referred to as the minus strand. Because RNA polymerase adds nucleic acids in a 5' — 3' direction, the minus strand of the DNA serves as the template for the RNA during transcription. Thus, the RNA formed will have a sequence complementary to the minus strand and identical to the plus strand (except that U is substituted for T). Antisense molecules are molecules that are specifically hybridizable or specifically complementary to either RNA or the plus strand of DNA. Sense molecules are molecules that are specifically hybridizable or specifically complementary to the minus strand of DNA. Antigene molecules are either antisense or sense molecules directed to a dsDNA target.
[0165] Antisense oligonucleotide: A sequence of at least about 8 nucleotides, such as about at least 10, 12, 15, 20, 30 or 50 nucleotides, wherein the sequence is from a gene sequence (such as all or a portion of a cDNA or gene sequence, or the reverse complement thereof), arranged in reverse orientation relative to the promoter sequence in a transformation vector.
[0166] By "reduce" or other forms of the word, such as "reducing" or "reduction," it is meant lowering of an event or characteristic e.g., tumor growth). It is understood that this is typically in relation to some standard or expected value. In other words, it is relative, but it is not always necessary for the standard or relative value to be referred to. For example, "reduces tumor growth" means decreasing the number of tumor cells relative to a standard or a control.
[0167] By "prevent" or other forms of the word, such as "preventing" or "prevention," is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but notAttorney Docket No: 11624-026WO1
[0168] prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed.
[0169] As used herein, "treatment" refers to obtaining beneficial or desired clinical results. Beneficial or desired clinical results include, but are not limited to, any one or more of alleviation of one or more symptoms (such as tumor growth), diminishment of the extent of tumor growth, stabilized (i.e., not worsening) state of cell proliferation, preventing or delaying spread of tumors, delaying occurrence or recurrence of tumors, delay or slowing of tumor progression, and remission (whether partial or total).
[0170] The terms “subject” or "patient" interchangeably refer to a human needing treatment for a hematopoietic disorder for example including but not limited to a human needing a treatment for acute myeloid leukemia (AML). The “subject” or “patient” can include children and adults. However, the term “subject” or "patient" can also refer to non-human animals, preferably mammals such as dogs, cats, horses, cows, pigs, sheep, and non-human primates, among others, that need treatment.
[0171] A "pharmaceutically acceptable" component is suitable for use with humans and / or animals without undue adverse side effects (such as toxicity, irritation, and allergic response) commensurate with a reasonable benefit / risk ratio.
[0172] " Pharmaceutically acceptable salt" refers to a salt that is pharmaceutically acceptable and has the desired pharmacological properties. Such salts include those that may be formed where acidic protons present in the compounds are capable of reacting with inorganic or organic bases. Suitable inorganic salts include those formed with alkali metals, e.g., sodium, potassium, magnesium, calcium, and aluminum. Suitable organic salts include those formed with organic bases such as the amine bases, e.g., ethanolamine, diethanolamine, triethanolamine, tromethamine, N-methylglucamine, and the like. Such salts also include acid addition salts formed with inorganic acids (e.g., hydrochloric and hydrobromic acids) and organic acids (e.g., acetic acid, citric acid, maleic acid, and the alkane- and arene-sulfonic acids such as methanesulfonic acid and benzenesulfonic acid). When two acidic groups are present, a pharmaceutically acceptable salt may be a mono-acid-mono-salt or a di-salt; similarly, where there are more than two acidic groups present, some or all of such groups can be converted into salts.
[0173] " Pharmaceutically acceptable excipient" refers to an excipient that is conventionally useful in preparing a pharmaceutical composition that is generally safe, non-toxic, andAttorney Docket No: 11624-026WO1
[0174] desirable and includes excipients that are acceptable for veterinary use as well as for human pharmaceutical use. Such excipients can be solid, liquid, semisolid, or, in the case of an aerosol composition, gaseous.
[0175] A "pharmaceutically acceptable carrier" is a carrier, such as a solvent, suspending agent, or vehicle, for delivering the disclosed compounds to the patient. The carrier can be liquid or solid and is selected with the planned manner of administration in mind. Liposomes are also a type of pharmaceutical carrier. As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated.
[0176] The term "scRNA-Seq," as used herein, generally refers to a single-cell RNA sequencing method to obtain expression profiles of individual cells. Methods of preparing scRNA libraries and analyzing thereof are known to a person of skill in the art. For example, single-cell libraries can be prepared from PBMC single-cell suspensions (e.g., from cancer patients). Such single-cell libraries can be assembled by gating for targeted cell populations (e.g., lymphoid, myeloid, and progenitor gates) and sorted in a buffered solution. Sorted cells could then be centrifugated and resuspended for cell counting using a hemocytometer. Live cell concentrations are assessed such that a targeted recovery of 5,000 to 8,000 cells per lane using, for example, the 10X Genomics Chromium Next GEM Single Cell 3’ Reagent Kit v3.1 is performed. Sequencing libraries are generated following manufacturer instructions and the quality of amplified cDNA and final libraries are probed, for example, using high sensitivity DNA D5000 and D1000 tape station kits (Agilent). Libraries are sequenced on, for example, NovaSeq platform (SP flow cell) with a desired targeted minimum of paired end reads per cell.
[0177] Genomic scRNA-seq data is analyzed by certain software, for example, a 10X CellRanger v7.0 package. Sequencing reads are aligned to the genome of the subject. Low quality cells are filtered out. PC A dimensionality is typically performed, followed by clustering and Uniform Manifold Approximation and Projection (UMAP).
[0178] The term “bulk RNA-seq” as used herein generally refers to a bulk RNA sequencing method to obtain expression profiles of bulk cell populations or tissues. For example, total RNA may be isolated from blood samples. Methods of performing bulk RNA-seq are known to a person of skill in the art. For example, total marrow cells may be pelleted and resuspended in buffer for storage. RNA is extracted, for example using a RNeasy Plus Micro Kit (Qiagen),Attorney Docket No: 11624-026WO1
[0179] and isolated RNA is processed using a kit, for example a RiboGone-Mammalian kit (Takara) followed by amplified cDNA generation, for example using the SMARTer Universal Low Input RNA kit (Takara). cDNA quality is assessed, for example using high sensitivity DNA D1000 TapeStation kits (Agilent). Sequencing libraries are generated, for example, using the ThruPLEX DNA-Seq Kit (Takara), and quality is assessed, for example using high sensitivity DNA D1000 TapeStation kits.
[0180] Libraries are then sequenced, for example on an Illumina Hiseq-4000. Quality control of RNA-Seq datasets is performed to remove adaptor sequences and low-quality regions. High- quality reads are aligned to the genome of the subject using an Alignment tool. The raw read count of each gene is then calculated and downstream analyses is performed, for example using R Studio.
[0181] The term “immunohistochemistry” as used herein refers to the laboratory technique of using antibodies to detect and visualize certain antigens in tissue samples. Methods of performing immunohistochemistry (IHC) are known throughout the art for a variety of uses, including diagnostic purposes. For example, IHC can be performed on an automated staining platform using a detection kit. Formalin-fixed paraffin-embedded (FFPE) tissue sections are typically baked and deparaffinized prior to staining. Primary antibodies can be incubated on the sample and visualized (e.g., via DAB), and counterstained with hematoxylin. The slides are then rehydrated in graded alcohol and cover slipped using mounting medium.
[0182] The term “immunocytochemistry” as used herein refers to the laboratory technique of using antibodies to detect and visualize certain antigens in cell samples. Methods of performing immunocytochemistry (ICC) are known throughout the art for a variety of uses, including diagnostic purposes.
[0183] The term “immunofluorescence” as used herein refers to the laboratory technique of using fluorescent antibodies to detect and visualize certain antigens in cell or tissue samples. Methods of performing immunofluorescence (IF) are known throughout the art for a variety of uses, including diagnostic purposes. For example, IF can be performed on a staining platform a detection kit. FFPE tissue sections can be baked and deparaffinized prior to staining. Following staining, slides are counterstained, (e.g., with DAPI) and cover slipped. Following this, primary antibody is incubated, followed by secondary antibody having a fluorophore to enable detection of the antigen in the sample.
[0184] Endothelial Niche CellsAttorney Docket No: 11624-026WO1
[0185] Endothelial niche cells are endothelial cells that provide an instructive niche for the differentiation of HSPCs. Endothelial niche cells are typically found in the bone marrow.
[0186] Endothelial niche cells comprise cells that express one are more genes selected from the group consisting of sele, exoc312a, snx8a, cltca, aqp7, aplhl, Igmn, prep, cldnlla, lyvelh, adrald, hyal2a, hyal2h, till, H13ra2, glula, hexh, slcI6a9a, and seppla. In some embodiments, the endothelial cells are human.
[0187] Methods
[0188] In one aspect, provided herein is a method for treating a subject having a pre-cancerous hematopoietic disorder, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0189] Pre-cancerous or “precursor” conditions are early phases of hematopoietic disorders that may develop into cancers, including but not limited to lymphoma, leukemia, Waldenstrom’s macroglobulinemia, and multiple myeloma. In some embodiments, the pre-cancerous hematopoietic disorder is selected from clonal hematopoiesis, Early myelodysplastic syndrome (MDS), Monoclonal gammopathy of undetermined significance (MGUS), Immunoglobulin M Monoclonal Gammopathy of Undetermined Significance (IgM MGUS), Smoldering multiple myeloma (SMM), Smoldering Waldenstrom macroglobulinemia (SWM), Clonal cytopenia of undetermined significance (CCUS), Monoclonal B cell lymphocytosis (MBL), Lymphoid clonal hematopoiesis (Lymphoid-CH), or low-grade lymphoma. In some embodiments, the pre-cancerous hematopoietic disorder comprises clonal hematopoiesis. In some embodiments, the clonal hematopoiesis comprises Clonal hematopoiesis of indeterminate potential (CHIP).
[0190] In one aspect, provided herein is a method for treating a subject having clonal hematopoiesis, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0191] In one aspect, provided herein is a method for treating a subject having a hematopoietic cancer, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0192] Apelin (APLN) is an evolutionary conserved angiogenic growth factor peptide that acts as the endogenous ligand for the G-protein-coupIed APJ receptor, also called apelin receptor (Tatemoto K et al. Isolation and characterization of a novel endogenous peptide ligand for the human APJ receptor. Biochem. Biophys. Res. Commun. 251: 471-476, 1998). The human APLN gene (NCBI Entrez Gene ID: 8862) encodes for an apelin preproprotein of 77 amino-Attorney Docket No: 11624-026WO1
[0193] acid residues (i.e., apelin-77: UniProt accession code Q9ULZ1). The human APLNR gene (NCBI Gene: 187) encodes for the Apelin receptor (APLNR / APJ) (UniProt P35414 or NCBI Reference Sequence: NP_005152.1) is a G protein -coupled receptor for the apelin peptide that forms the apelin / APJ signaling pathway that regulates cardiovascular function and fluid homeostasis. The apelin / APJ signaling pathway has been previously shown to play a role in angiogenesis. Apelin is an angiogenic factor involved in vascular development and homoeostasis and is necessary for hematopoietic stem cell (HSC) function at steady state. The APLN preprotein gives rise to several APLN fragments, including APLN-55, APLN-36, APLN-17, APLN-13. In some embodiments, provided herein are methods of treating a hematopoietic disorder comprising administering an inhibitor to apelin, or a fragment thereof. A rare subset of niche endothelial cells (ECs) expresses apelin and Apelin+ ECs possess endothelial progenitor potential that promotes vascular regeneration after irradiation-induced damage and is necessary for HSC engraftment upon transplantation.
[0194] In some embodiments, provided herein are methods of treating a pre-cancerous hematopoietic disorder or a hematopoietic disorder comprising administering an inhibitor to apelin receptor.
[0195] In some embodiments, the hematopoietic cancer comprises a lymphoma or a leukemia. In some embodiments, the hematopoietic cancer is selected from myelodysplastic syndrome (MDS), acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myelocytic leukemia (CML), chronic neutrophilic leukemia (CNL), chronic lymphocytic leukemia (CLL), Hodgkin lymphoma (HL), non-Hodgkin lymphoma (NHL), diffuse large cell lymphoma (DLCL), follicular lymphoma, chronic lymphocytic leukemia / small lymphocytic lymphoma (CLL / SLL), mantle cell lymphoma (MCL), myelodysplastic syndrome (MDS), marginal zone B-cell lymphoma, mucosa-associated lymphoid tissue (MALT) lymphoma, nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma, primary mediastinal B-cell lymphoma, Burkitt lymphoma, lymphoplasmacytic lymphoma, hairy cell leukemia (HCL), immunoblastic large cell lymphoma, precursor B -lymphoblastic lymphoma and primary central nervous system (CNS) lymphoma, T-cell acute lymphoblastic leukemia (T-ALL), T-cell NHL, precursor T-lymphoblastic lymphoma / leukemia, peripheral T-cell lymphoma (PTCL), cutaneous T-cell lymphoma (CTCL), angioimmunoblastic T-cell lymphoma, extranodal natural killer T-cell lymphoma, enteropathy type T-cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, anaplastic large cell lymphoma, or a combination thereof.Attorney Docket No: 11624-026WO1
[0196] In some embodiments of any of the aspects disclosed herein, the apelin inhibitor, an apelin receptor inhibitor, or a combination thereof, can be used to treat myelofibrosis. Myelofibrosis is an uncommon type of chronic leukemia. Myelofibrosis can also be associated with development of acute leukemia.
[0197] In another aspect, provided herein is a method for treating a subject having a leukemia, comprising administering to the subject a therapeutically effective amount of apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0198] In some embodiments, the leukemia is selected from acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), chronic myelocytic leukemia (CML), T-cell acute lymphoblastic leukemia (T-ALL), or chronic lymphocytic leukemia (CLL). In some embodiments, the leukemia comprises AML.
[0199] In one aspect, provided herein is a method for treating a subject having AML, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0200] In some embodiments, the AML is selected from acute erythroid leukemia, acute megakaryoblasfic leukemia, acute monoblastic and monocytic leukemia, acute myeloid leukemia NOS, acute myelomonocytic leukemia, acute promyelocytic leukemia with t(15;17)(q22;q12) PML-RARA, AML with inv(16)(p13.1q22) or t(16;16)(p13.1;q22): CBFB-MYH11, AML with inv(3)(q21q26.2) or t(3;3)(q21;q26.2); RPN1-EVI1, AML with maturation, AML with minimal differentiation, AML with mutated CEBPA, AML with mutated NPM1, AML with myelodysplasia-related changes, AML with t(6;9)(p23;q34); DEK-NUP214, AML with t(8;21)(q22;q22); RUNX1-RUNX1T, AML with t(9;ll)(p22;q23); MLLT3-MLL, AML without maturation, atypical chronic myeloid leukemia BCR-ABL, chronic myelomonocytic leukemia, essential thrombocythemia, mixed phenotype acute leukemia T / myeloid, unclassifiable myelodysplastic syndrome, myeloid leukemia associated with Down syndrome, myeloid sarcoma, refractory anemia with excess blasts, or therapy-related myeloid neoplasms.
[0201] In some embodiments, the AML comprises inv(16) CBFB-MYH11 AML. In some embodiments, the AML comprises t(16;16)(pl3.1;q22); CBFB:: MYH11. Either Inv(16)(pl3.1;q22) ort(16;16)(pl3.1;q22) results in the formation of an abnormal core binding factor beta subunit / myosin heavy chain 11 (CBFB-MYH11) fusion gene which is known to initiate leukemogenesis (Panda, Sipra, et al. CBFB-MYH11 is required for the maintenance of Inv (16) AML. (2022): 2995-2996). Most cases show myelomonocytic differentiation with presence of abnormal eosinophils. Diagnosis of AML with inv(16)(p13.1;q22) or t(16;16)(p13.1;q22) can be made even when the blast percentage is less than 20% and prognosisAttorney Docket No: 11624-026WO1
[0202] is generally favorable when compared with other AMLs (Zinzuwadia S, Mittal A, Raouf MF, Gupta R, Kini AR. AML with inv(16)(pl3.1;q22) or t(16;16)(p13.1;q22); CBFB::MYH11 PathologyOutlines website).
[0203] In some embodiments, the AML comprises B-cell ALL.
[0204] In some embodiments, the AML comprises T-cell AML.
[0205] In one aspect, provided herein is a method for reducing angiogenesis in a subject having a pre-cancerous hematopoietic disorder or a hematopoietic cancer, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0206] In one aspect, provided herein is a method for preventing or reducing niche endothelial clonality in a subject having a pre-cancerous hematopoietic disorder or a hematopoietic cancer, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0207] In one aspect, provided herein is a method for preventing or reducing leukemogenesis in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0208] In one aspect, provided herein is a method of treating a subject having a pre-cancerous hematopoietic disorder, comprising: (i) isolating a sample from the subject; (ii) measuring apelin and apelin receptor expression levels using transcriptomics and / or immunohistochemistry; (iii) measuring niche endothelial clonality in the subject sample relative to a control sample; (iv) if apelin and / or apelin receptor is elevated and / or the niche endothelial clonality from the subject sample has expanded relative to the control sample, then administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0209] In another aspect, provided herein is a method of treating a subject having a hematopoietic cancer, comprising: (i) isolating a sample from the subject; (ii) measuring apelin and apelin receptor expression levels using transcriptomics and / or immunohistochemistry; (iii) measuring niche endothelial clonality in the subject sample relative to a control sample; (iv) if apelin and / or apelin receptor is elevated and / or the niche endothelial clonality from the subject sample has expanded relative to the control sample, then administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0210] In some embodiments, the sample is selected from blood, plasma, serum, urine, sputum, spinal fluid, cerebrospinal fluid, pleural fluid, nipple aspirate, lymph fluid, respiratory tractAttorney Docket No: 11624-026WO1
[0211] fluid, intestinal tract fluid, genitourinary tract fluid, tear fluid, saliva, breast milk, lymphatic system fluid, semen, ascitic fluid, tumor cyst fluid, amniotic fluid, tissue, biopsy, or a combination thereof. In some embodiments, the sample comprises plasma.
[0212] In one aspect, provided herein is a method for preventing, reducing, suppressing, or inhibiting clonal expansion of endothelial cells and leukemic cells in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0213] In one aspect, provided herein is a method for increasing, promoting, or initiating healthy hematopoiesis in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof. In some embodiments, healthy hematopoiesis comprises lymphoid and myeloid clone maintenance. In some embodiments, healthy hematopoiesis comprises reducing, suppressing, or inhibiting proliferating and non-proliferating leukemic cells.
[0214] In one aspect, provided herein is a method for preventing, reducing, suppressing, or inhibiting leukemia-induced angiogenic progenitor formation and expansion in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0215] In some embodiments, niche endothelial clonality is measured using RNA-sequencing, single-cell RNA sequencing, immunohistochemistry (IHC), immunocytochemistry, and / or immunofluorescence.
[0216] In some embodiments, the APLN inhibitor is selected from an antibody or a derivative thereof, an antibody-drug conjugate, a fusion protein, a small molecule, a dsRNA, an siRNA, an anti-sense technology, an aptamer, a gene editing technology, or a combination thereof. In some embodiments, the APLN inhibitor comprises an antibody or a derivative thereof.
[0217] In some embodiments, the APLN inhibitor comprises an antibody-drug conjugate. Anti-APLN antibodies suitable for the present invention are known in the prior art. For example, International Application WO 2013 / 012855 Al discloses a monoclonal anti-apelin antibody having an epitope present in all forms of apelin. Another suitable anti-APLN monoclonal antibody includes an antibody specific for at least the apelin- 1 form, as disclosed in, e.g., Kawamata et al. 2001. Another suitable anti-APLN monoclonal antibody includes an antibody raised against apelin-17, as disclosed in, e.g., Reaux et al. 2002. Suitable anti-APLN antibodies are for instance also commercially available from Santa Cruz Biotechnology Inc. (Dallas, TX, USA), ThermoFisher, or Abeam (Cambridge, UK). In some embodiments, the anti-apelin antibody comprises ab 125213.Attorney Docket No: 11624-026WO1
[0218] For example, a monoclonal antibody specific to human apelin can be selected or derived from EPNCIR154 (Abeam, Cat # abl33624) or EPNCIR158 (Abeam, Cat # abl51565).
[0219] For example, a monoclonal antibody specific to human apelin can be selected or derived from 5H5L9 (ThermoFisher, Cat # 702069), HL2980 (ThermoFisher, Cat # MA5-56597), SAA1115 (ThermoFisher, Cat # MA5-54381), or SAA 1317 (ThermoFisher, Cat # MAS- 54382).
[0220] In some embodiments, the anti-APLN antibody is a monoclonal antibody. The monoclonal anti-apelin antibody is preferably humanized. Methods to obtain humanized antibodies are well known in the art.
[0221] In some embodiments, the gene editing technology comprises CRISPR-based methods. CRISPR based gene editing methods are known to those of skill in the art and are reviewed in, e.g., Wang, Joy Y., and Jennifer A. Doudna. " CRISPR technology: A decade of genome editing is only the beginning." Science 379.6629 (2023): eadd8643, incorporated herein by reference.
[0222] In some embodiments, the CRISPR-based gene editing methods comprise using the gRNA GAATGTGAAGATCTTGACGC (SEQ ID NO: 3), or a nucleic acid sequence at least 95% identical thereto.
[0223] In some embodiments, the apelin inhibitor comprises siRNA. Methods RNA interference comprising administering apelin siRNA are disclosed in, for example, Kasai A. et al. Inhibition of apelin expression switches endothelial cells from proliferative to mature state in pathological retinal angiogenesis. Angiogenesis. 2013 Jul;16(3):723-34.
[0224] Anti-APLN or anti-APLN receptor siRNA suitable for the present invention are known in the prior art. Suitable anti-APLN siRNA are for instance also commercially available from ThermoFisher and Qiagen. In some embodiments, the anti-APLN siRNA is derived or selected from one or more of ThermoFisher Assay ID 126951, Catalog # AM16708; ThermoFisher Assay ID 126952, Catalog # AM16708: ThermoFisher Assay ID 147377, Catalog # AM16708; ThermoFisher Assay ID 1780, Catalog # AM16708; ThermoFisher Assay ID 1873, Catalog # AM16708; ThermoFisher Assay ID 202079, Catalog # AM16708; ThermoFisher Assay ID 202278, Catalog # AM16708: ThermoFisher Assay ID 202279, Catalog # AM16708; ThermoFisher Assay ID 24683, Catalog # AM16708; ThermoFisher Assay ID 24774, Catalog # AM16708; ThermoFisher Assay ID 24858, Catalog # AM16708; ThermoFisher Assay ID 46110, Catalog # AM16708; ThermoFisher Assay ID HSS1003624, HSS100325, and / or HSS100326, Catalog # 1299001; ThermoFisher Assay ID HSS113086, HSS113087, and / or HSS 189624, Catalog # 1299001; ThermoFisher Assay ID si 186, Catalog # 4392420; ThermoFisher Assay ID si 187, Catalog # 4392420; ThermoFisher Assay ID si 188, Catalog #Attorney Docket No: 11624-026WO1
[0225] 4392420; ThermoFisher Assay ID s 16925, Catalog # 4392420; ThermoFisher Assay ID S16926, Catalog # 4392420; or ThermoFisher Assay ID s223458, Catalog # 4392420,
[0226] In some embodiments, the APLN inhibitor comprises an apelin peptide decoy.
[0227] In some embodiments, the subject is an adult. In some embodiments, the subject is a child. In some embodiments, the subject is a human.
[0228] In one aspect, hematopoietic disorders, and endothelial clonal expansion therein, may be treated using an inhibitor to an apelin receptor. In some embodiments, the apelin receptor inhibitor is selected from an antibody or a derivative thereof, an antibody-drug conjugate, a fusion protein, a small molecule, a dsRNA, an siRNA, an anti-sense technology, an aptamer, a gene editing technology, or a combination thereof.
[0229] In some embodiments, the apelin receptor inhibitor is selected from ML221, MM54, APJ antagonist-1, ALX 40-4C, ALX 40-4C Tri fluoroacetate, (Alal3)-Apelin-13 TFA, or (Alal3)-Apelin-13.
[0230] In some embodiments, the apelin receptor inhibitor is a small molecule. In some embodiments, the apelin receptor inhibitor comprises ML221 of structure:
[0231]
[0232] , or a pharmaceutically acceptable salt thereof.
[0233] In some embodiments, the apelin receptor inhibitor is MM54, In some embodiments, the apelin receptor inhibitor is ALX 40-4C Tri fluoroacetate.
[0234] Further suitable apelin receptor antagonists are disclosed e.g. in US Pub. No.
[0235] 2014 / 0005181 Al, International Pub. No. WO 2010 / 053545 A2, and International Pub. No. WO 2014 / 044738 Al, each of which are incorporated herein by reference for all purposes. Further apelin antagonists or apelin receptor antagonists are disclosed in International Pub. No. WO 2017 / 140296 A2 which is incorporated by reference herein for all purposes.
[0236] In some embodiments, the methods of any aspect disclosed herein further comprises administering to the subject a therapeutically effective amount of an additional therapeutic agent selected from a chemotherapy, an immunotherapy, a tyrosine kinase inhibitor (TKI), IDH inhibitor, an FLT3 inhibitor, a hypomethylating agent, a stem cell therapy, a radiation therapy, or a combination thereof.
[0237] In some embodiments, the chemotherapeutic agent is selected from carboplatin, cisplatin, paclitaxel, docetaxel, pegylated liposomal doxorubicin (PLD), doxorubicin,Attorney Docket No: 11624-026WO1
[0238] gemcitabine, cytarabine, fludarabine, fluorouracil (5-FU), irinotecan, topotecan, temozolomide, triapine, 5-azacytidine, capecitabine, AraC-FdUMP
[0010] (CF-10), cladribine, decitabine, hydroxyurea, oxaliplatin, bendamustine, bortezomib, carfilzomib, ixazomib, busulfan, cyclophosphamide, capecitabine, dexamethasone, etoposide, daunorubicin, ifosfamide, methotrexate and vincristine, or a pharmaceutically acceptable salt of any of the foregoing. In some embodiments, the chemotherapy is selected from azacitidine, cytarabine, daunorubicin, decitabine, idarubicin, methotrexate, midostaurin, mitoxantrone, or a combination thereof.
[0239] In some embodiments, the immunotherapy comprises rituximab, daratumumab, CAR T-cell therapy, or a combination thereof.
[0240] In some embodiments, the stem cell therapy comprises autologous or allogeneic hematopoietic stem cell transplantation (HCT). In some embodiments, the stem therapy has been contacted with an effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
[0241] In some embodiments, the TKI is selected from imatinib, asciminib, nilotinib, dasatinib, flumatinib, bosutinib, ponatinib, or bafetinib. In some embodiments, the TKI comprises imatinib or asciminib.
[0242] In some embodiments, the FLT3 inhibitor is selected from sunitinib, midostaurin, lestaurtinib, sorafenib, donafenib, ponatinib, tandutinib, KW-2449, crenolanib, gilteritinib, quizartinib, CHIR-258, IMC-EB10, XL 999, GTP 14564, AG1295, AG1296, CEP-5214, CEP-7055, FLX-925, G-749, PLX3397, E6201, AKN-028, famitinib, nilotinib, and DCC-2036, or a pharmaceutically acceptable salt of any one thereof.
[0243] In some embodiments, the additional therapeutic agent is selected from gemtuzumab ozogamicin, midostaurin, quizartinib, revumenib, enasidenib, gilteritinib, glasdegib, ivosidenib, venetoclax, arsenic trioxide, all-trans retinoic acid (ATRA), or a combination thereof.
[0244] As used herein, "alleviating a symptom" of a hematopoietic disorder is ameliorating any condition or symptom associated with the of a hematopoietic disorder. As compared with an equivalent untreated control, such reduction is by at least 5%, 10%, 20%, 40%, 50%, 60%, 80%, 90%, 95%, 99% or more as measured by any standard technique.
[0245] A variety of means for administering the compositions described herein to subjects are known to those of skill in the art. Such methods can include, but are not limited to oral, parenteral, intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol),Attorney Docket No: 11624-026WO1
[0246] pulmonary, cutaneous, topical, injection, or intratumoral administration. Administration can be local or systemic.
[0247] The term “effective amount" as used herein refers to the amount of apelin inhibitor needed to alleviate at least one or more symptom of the disease or disorder, and relates to a sufficient amount of pharmacological composition to provide the desired effect. The term "therapeutically effective amount" therefore refers to an amount of apelin inhibitor that is sufficient to provide a particular anti-myelofibrosis or anti-myeloproliferative disorder effect when administered to a typical subject.
[0248] An effective amount as used herein, in various contexts, would also include an amount sufficient to delay the development of a symptom of the disease, alter the course of a symptom disease (for example but not limited to, slowing the progression of a symptom of the disease), or reverse a symptom of the disease. Thus, it is not generally practicable to specify an exact “effective amount". However, for any given case, an appropriate “effective amount" can be determined by one of ordinary skill in the art using only routine experimentation.
[0249] Effective amounts, toxicity, and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dosage can vary depending upon the dosage form employed and the route of administration utilized. The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio LD50 / ED50. Compositions and methods that exhibit large therapeutic indices are preferred.
[0250] A therapeutically effective dose can be estimated initially from cell culture assays. Also, a dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (e.g., the concentration of apelin inhibitor) which achieves a half- maximal inhibition of symptoms) as determined in cell culture, or in an appropriate animal model. Levels in plasma can be measured, for example, by high performance liquid chromatography. The effects of any particular dosage can be monitored by a suitable bioassay. The dosage can be determined by a physician and adjusted, as necessary, to suit observed effects of the treatment.
[0251] Effective amounts of a compound or composition described herein for treating a mammalian subject can include about 0.1 to about 1000 mg / Kg of body weight of the subject / day, such as from about 1 to about 100 mg / Kg / day, especially from about 10 to about 100 mg / Kg / day. The doses can be acute or chronic. A range of disclosed composition dosages is believed to be safe and effective.Attorney Docket No: 11624-026WO1
[0252] Pharmaceutically acceptable carriers and diluents include saline, aqueous buffer solutions, solvents and / or dispersion media. The use of such carriers and diluents is well known in the art. Some non-limiting examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as com starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository’ waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; (22) C2-C 12 alcohols, such as ethanol; and (23) other non-toxic compatible substances employed in pharmaceutical formulations. Wetting agents, coloring agents, release agents, coating agents, sweetening agents, flavoring agents, perfuming agents, preservative and antioxidants can also be present in the formulation. The terms such as "excipient", "carrier", "pharmaceutically acceptable carrier" or the like are used interchangeably herein. In some embodiments, the carrier inhibits the degradation of the active agent, e.g. apelin inhibitors as described herein.
[0253] In some embodiments, the pharmaceutical composition comprising an apelin inhibitor as described herein can be a parenteral dose form. Since administration of parenteral dosage forms typically bypasses the patient's natural defenses against contaminants, parenteral dosage forms are preferably sterile or capable of being sterilized prior to administration to a patient. Examples of parenteral dosage forms include, but are not limited to, solutions ready for injection, dry products ready to be dissolved or suspended in a pharmaceutically acceptable vehicle for injection, suspensions ready for injection, and emulsions. In addition, controlled-release parenteral dosage forms can be prepared for administration of a patient, including, but not limited to, DEROS®-type dosage forms and dose dumping.
[0254] Suitable vehicles that can be used to provide parenteral dosage forms of apelin inhibitor as disclosed within are well known to those skilled in the art.Attorney Docket No: 11624-026WO1
[0255] Examples include, without limitation: sterile water; water for injection ETSP; saline solution; glucose solution; aqueous vehicles such as but not limited to, sodium chloride injection, Ringer's injection, dextrose Injection, dextrose and sodium chloride injection, and lactated Ringer's injection; water-miscible vehicles such as, but not limited to, ethyl alcohol, polyethylene glycol, and propylene glycol; and non-aqueous vehicles such as, but not limited to, corn oil, cotonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate.
[0256] In some embodiments of any of the aspects disclosed herein, the apelin inhibitor as described herein is administered as a monotherapy, e.g., another treatment for the myelofibrosis or a myeloproliferative disorder is not administered to the subject.
[0257] In some embodiments of any of the aspects disclosed herein, the methods described herein can further comprise administering a second agent and / or treatment to the subject, e.g. as part of a combinatorial therapy. Non-limiting examples of a second agent and / or treatment can include radiation therapy, surgery, chemotherapy, or immunotherapy. In some embodiments, the immunotherapy comprises immune checkpoint inhibitor therapy. In some embodiments, the immune checkpoint inhibitor is selected from a PD-1 inhibitor, a PD-L1 inhibitor, or a CTLA-4 inhibitor.
[0258] In some embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after treatment biweekly for three months, treatment can be repeated once per month, for six months or a year' or longer. Treatment according to the methods described herein can reduce levels of a marker or symptom of a condition by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80 % or at least 90% or more.
[0259] The dosage of an apelin inhibitor as described herein can be determined by a physician and adjusted, as necessary, to suit observed effects of the treatment. With respect to duration and frequency of treatment, it is typical for skilled clinicians to monitor subjects in order to determine when the treatment is providing therapeutic benefit, and to determine whether to increase or decrease dosage, increase or decrease administration frequency, discontinue treatment, resume treatment, or make other alterations to the treatment regimen.
[0260] The dosing schedule can vary from once a week to daily depending on a number of clinical factors, such as the subject's sensitivity to an apelin inhibitor. The desired dose or amount of activation can be administered at one time or divided into subdoses, e.g., 2-4 subdoses and administered over a period of time, e.g., at appropriate intervals through the dayAttorney Docket No: 11624-026WO1
[0261] or other appropriate schedule. In some embodiments, administration can be chronic, e.g., one or more doses and / or treatments daily over a period of weeks or months.
[0262] Examples of dosing and / or treatment schedules are administration daily, twice daily, three rimes daily or four or more times daily over a period of 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months, or more. A composition comprising apelin inhibitor can be administered over a period of time, such as over a 5 minute, 10 minute, 15 minute, 20 minute, 25 minute, 30 minute, 1 hour, 2 hour, or 4 hour period.
[0263] A treatment is considered an “effective treatment," as the term is used herein, if one or more of the signs or symptoms of a condition described herein are altered in a beneficial manner, other clinically accepted symptoms are improved, or even ameliorated, or a desired response is induced e.g., by at least 10% following treatment according to the methods described herein. Efficacy can be assessed, for example, by measuring a marker, indicator, symptom, and / or the incidence of a condition treated according to the methods described herein or any other measurable parameter appropriate, e.g. blood cell counts. Efficacy can also be measured by a failure of an individual to worsen as assessed by hospitalization, or need for medical interventions (i.e., progression of the disease is halted).
[0264] Methods of measuring these indicators are known to those of skill in the art and / or are described herein. Treatment includes any treatment of a disease in an individual or an animal (some non limiting examples include a human or an animal) and includes: (1) inhibiting the disease, e.g., preventing a worsening of symptoms (e.g. pain or inflammation); or (2) relieving the severity of the disease, e.g., causing regression of symptoms. An effective amount for the treatment of a disease means that amount which, when administered to a subject in need thereof, is sufficient to result in effective treatment as that term is defined herein, for that disease. Efficacy of an agent can be determined by assessing physical indicators of a condition or desired response. It is well within the ability of one skilled in the art to monitor efficacy of administration and / or treatment by measuring any one of such parameters, or any combination of parameters. Efficacy can be assessed in animal models of a condition described herein, for example treatment of a hematopoietic disorder. Wien using an experimental animal model, efficacy of treatment is evidenced when a statistically significant change in a marker is observed.
[0265] Kits
[0266] One aspect herein provides for a kit for testing endothelial cell clonality in a sample isolated from a subject. In some embodiments, the sample comprises blood. In addition, the kitAttorney Docket No: 11624-026WO1
[0267] can include one or more antibodies that bind a cell marker, or primers for an RT-PCR or PCR reaction, e.g., a semi- quantitative or quantitative RT-PCR or PCR reaction. Such components can be used to assess the activation of markers or the loss of markers of endothelial niche cells.
[0268] In another aspect, provided herein is a kit for treating a subject having a pre-cancerous hematopoietic disorder or a hematopoietic cancer, comprising an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof. In some embodiments, the kit is for treating AML.
[0269] In some embodiments, the components described herein can be provided singularly or in any combination as a kit. In some embodiments, the kit further comprises one or more additional therapeutic agents.
[0270] The kit will typically be provided with its various elements included in one package, e.g., a fiber-based, e.g., a cardboard, or polymeric, e.g., a Styrofoam box. The enclosure can be configured so as to maintain a temperature differential between the interior and the exterior, e.g., it can provide insulating properties to keep the reagents at a preselected temperature for a preselected time.
[0271] EMBODIMENTS
[0272] 1. A method for treating a subject having a hematopoietic cancer, comprising administering to the subject a therapeutically effective amount of an inhibitor to apelin (APLN) or an APLN receptor.
[0273] 2. The method of embodiment 1, wherein the hematopoietic cancer comprises a lymphoma or a leukemia.
[0274] 3. The method of embodiment 1, wherein the hematopoietic cancer is selected from myelodysplastic syndrome (MDS), acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myelocytic leukemia (CML), chronic neutrophilic leukemia (CNL), chronic lymphocytic leukemia (CLL), Hodgkin lymphoma (HL), non-Hodgkin lymphoma (NHL), diffuse large cell lymphoma (DLCL), follicular lymphoma, chronic lymphocytic leukemia / small lymphocytic lymphoma (CLL / SLL), mantle cell lymphoma (MCL), myelodysplastic syndrome (MDS), marginal zone B-cell lymphoma, mucosa-associated lymphoid tissue (MALT) lymphoma, nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma, primary mediastinal B-cell lymphoma, Burkitt lymphoma, lymphoplasmacytic lymphoma, hairy cell leukemia (HCL), immunoblastic large cell lymphoma, precursor B -lymphoblastic lymphoma and primary central nervous system (CNS) lymphoma, T-cell NHL, precursor T-lymphoblastic lymphoma / Ieukemia, peripheral T-cell lymphoma (PTCL), cutaneous T-cell lymphoma (CTCL), angioimmunoblastic T-cellAttorney Docket No: 11624-026WO1
[0275] lymphoma, extranodal natural killer T-cell lymphoma, enteropathy type T-cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, anaplastic large cell lymphoma, or a combination thereof.
[0276] 4. A method for treating a subject having a leukemia, comprising administering to the subject a therapeutically effective amount of an inhibitor to APLN or an APLN receptor. 5. The method of embodiment 4, wherein the leukemia is selected from AML, ALT,, CML, or CLL.
[0277] 6. The method of embodiment 4 or 5, wherein the leukemia comprises AML.
[0278] 7. A method for treating a subject having AML, comprising administering to the subject a therapeutically effective amount of an inhibitor to APLN or an APLN receptor.
[0279] 8. The method of embodiment 7, wherein the AML comprises B-cell AIL.
[0280] 9. The method of embodiment 7, wherein the AML comprises T-cell AMI...
[0281] 10. A method for reducing angiogenesis in a subject having a hematopoietic cancer, comprising administering to the subject a therapeutically effective amount of an inhibitor to APLN or an APLN receptor.
[0282] 11. A method for preventing or reducing niche endothelial clonality in a subject having a hematopoietic cancer, comprising administering to the subject a therapeutically effective amount of an inhibitor to APLN or an APLN receptor.
[0283] 12. A method for preventing or reducing leukemogenesis in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an inhibitor to APLN or an APLN receptor.
[0284] 13. A method of treating a subject having a hematopoietic cancer, comprising:
[0285] (i) measuring niche endothelial clonality in a sample isolated from the subject versus a control sample;
[0286] (ii) if the niche endothelial clonality from the subject sample has expanded relative to the control, then administering to the subject a therapeutically effective amount of an inhibitor to APLN or an APLN receptor.
[0287] 14. The method of embodiments 1-13, wherein the APLN inhibitor is selected from an antibody or a derivative thereof, an antibody-drug conjugate, a fusion protein, a small molecule, a dsRNA, an siRNA, an anti-sense technology, an aptamer, a gene editing technology, or a combination thereof.
[0288] 15. The method of embodiment 14, wherein the APLN inhibitor comprises an antibody or a derivative thereof.Attorney Docket No: 11624-026WO1
[0289] 16. The method of embodiment 14, wherein the APLN inhibitor comprises an antibody¬ drug conjugate.
[0290] 17. The method of embodiment 14, wherein the gene editing technology comprises CRISPR-based methods.
[0291] 18. The method of embodiment 17, wherein the CRISPR-based gene editing methods comprise using the gRNA GAATGTGAAGATCTTGACGC (SEQ ID NO: 3), or a nucleic acid sequence at least 95% identical thereto.
[0292] 19. The method of embodiments 1-18, wherein the subject is an adult.
[0293] 20. The method of embodiments 1-18, wherein the subject is a child.
[0294] 21. The method of embodiments 1-20, wherein the subject is a human.
[0295] EXAMPLES
[0296] The following examples are set forth below to illustrate the compositions, devices, methods, and results according to the disclosed subject matter. These examples are not intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrate representative methods and results. These examples are not intended to exclude equivalents and variations of the present invention which are apparent to one skilled in the ait.
[0297] Example 1. Cellular barcoding of the leukemic niche reveals an apelin-mediated clonal expansion of niche endothelial and mesenchymal stromal cells
[0298] Hematopoietic stem and progenitor cells (HSPCs) reside in niches that provide regulatory signals for their function. HSPC clones have been examined by cellular barcoding but the clonality of niche endothelial (ECs) and stromal cells (SCs) is unknown. It was hypothesized that perturbations such as acute leukemia alter EC and SC clones to support leukemogenesis. A zebrafish model of acute erythroid leukemia (AEL) was developed by overexpressing CMYC under the blood promoter draculin (drl). drkCMYC marrows demonstrated an expansion of serially transplantable (7 / 7, 17 / 18) progenitors overexpressing gatala (p=0.01) and fetal hemoglobins hbbel.1 / 2 (p=0.0004). GESTALT was used to barcode cells using CRISPR-CAS9, injected barcoded embryos with drkCMYC to induce AEL and perform HSPC and niche clone tracing. HSPC clones were decreased by half (p=0.008) indicative of a clonal expansion of AEL. Barcode and scRNA-Seq of niche ECs revealed a decrease in EC clones (p<0.05) paired with the discovery of an AEL venous EC population upregulating 99 angiogenesis genes. AEL marrows had less niche SC clones (pcO. Ol) and scRNA-Seq of SCs revealed an increased fraction of lepr+ SCs (66 vs 24%). It wasAttorney Docket No: 11624-026WO1
[0299] hypothesized that AEL progenitors secrete a signal to remodel niche clones to promote disease progression. The hormone apelin was identified as upregulated in AEL progenitors (p<0.0001) and receptors aplnra / b expressed on AEL ECs. It was tested if apelin alone could remodel the niche by overexpressing apelin in blood cells and found fewer niche clones compared to controls (p=0.004). EC and SC clone size was increased (p<0.02) and blood analysis revealed more myeloid clones (p<0.0001) demonstrating a niche-mediated alteration of hematopoiesis via apelin signaling. These data reveal that apelin signaling is responsible for AEL-induced clonal and transcriptional niche remodeling to promote disease progression.
[0300] Example 2. Leukemia-derived apelin selects endothelial niche clones to promote tumorigenesis
[0301] Hematopoietic stem cells (HSCs) are essential to produce all mature blood cells during the entire life of an organism. HSCs reside in a complex microenvironment or niche that provides signals for their differentiation and self-renewal. Endothelial and mesenchymal stromal cells (ECs and MSCs, respectively) are two key cellular components of the stem cell niche that are indispensable for HSC function. Most HSCs reside near sinusoidal ECs and ablation of ECs results in HSC loss highlighting the crucial role of ECs in the niche. A rare subset of niche ECs expresses apelin, an angiogenic growth factor necessary for HSC function at steady state. Apelin+ ECs possess endothelial progenitor potential that promotes vascular regeneration after irradiation -induced damage and is necessary for HSC engraftment upon transplantation. MSCs are a cell type tightly associated with HSC function as specific ablation of MSC secreting high levels of CXCL12 was demonstrated to deplete HSCs from the niche. Endothelial and stromal cells provide an environment that is conducive to the growth and function of normal HSCs.
[0302] Malignant transformation and abnormal proliferation of an HSC clone results in hematological malignancies such as acute myeloid leukemia (AML,). The HSC niche has been proposed to contribute to leukemogenesis as genetic alterations of APC, Dicer or RB in niche cells have been shown to induce myelodysplastic syndrome (MDS) and pre-leukemic states. Leukemia induces extensive niche remodeling including angiogenesis, a process by which new blood vessels are formed. At steady state, angiogenesis is tightly regulated by a balance of pro-and anti-angiogenic factors. Active and abnormal angiogenesis has been demonstrated in the marrow of patients with diverse subtypes of acute and chronic leukemia. Studies showed that leukemic cells secrete pro-angiogenic factors that stimulate ECs to support leukemic growth. In Hits study, a CRISPR-Cas9 based genetic lineage tracing method was used paired withAttorney Docket No: 11624-026WO1
[0303] single-cell mRNA-Sequencing (scRNA-seq) to investigate the clonal and transcriptional response of niche ECs and MSCs upon leukemia formation in vivo. Using genetic overexpression and knock-out zebrafish models and human primary samples, apelin secreted by leukemic cells was demonstrated to induce selection of niche endothelial clones and transcriptional remodeling towards an endothelial progenitor state driving abnormal angiogenesis. This endothelial clonal selection is linked via apelin signaling to leukemia progression demonstrating for the first time that excessive production of a secreted ligand by leukemic cells remodels the endothelial niche to support leukemogenesis.
[0304] Overexpression of human MYC in blood cells leads to acute myeloid leukemia in zebrafish To generate a myeloid leukemia model in zebrafish, mosaic overexpression of the human oncogene MYC under the early blood lineage specific draculin promotor (drkMYC). DrkMYC injected zebrafish died significantly quicker than non-injected controls (FIG. 1). These animals were smaller in size, exhibiting bleeding, cardiac oedema secondary to anemia and difficulty swimming (Fig. IB). Flow cytometry analysis demonstrated that drkMYC marrows had leukemic blast-like population that overlapped with the progenitor gate in healthy marrows and a significant decrease of mature myeloid, lymphoid and erythroid cells (as defined in forward and side scatter space, FSC and SSC, respectively, FIG. 1; FIG. 5). Large pro¬ erythroblasts were sometimes detected instead of or in combination with leukemic cells (FIG.
[0305] 5). Staining of total marrows with May-Grunwald Giemsa solution revealed abundant dark purple leukemic cells with a high nuclear to cytoplasmic ratio compared to control (FIG. 1). Flow cytometry analysis of peripheral blood samples also detected circulating blasts (FIG. 5). Immunohistochemistry on whole marrow sections demonstrated a high abundance of MYC+ leukemic cells (FIG. 5). Bulk RNA-Sequencing of control drkmCherry and drkMYC-mCherry total marrow cells revealed a significant upregulation of embryonic hemoglobins hbbe1.1 and hbbe1.2 and the master erythroid transcription factor gata1a confirming the erythroid identity of leukemic cells (FIG. 1). The embryonic globin expression suggested the cell of origin was developmental in nature. This result was validated using the zebrafish transgenic lines lcr: GFP and gatala:dsRed which label mature erythrocytes and erythroid progenitors, respectively, and demonstrated that drkMYC marrows are significantly enriched in lcr:GFP+;gata1:dsRed+ leukemic cells and / or lcr:GFP+;gata1:dsRed- pro-erythroblasts revealing leukemic transformation at different stages of erythropoiesis (FIG. 5). Total marrows were serially transplanted from drl: MYC:mCherry donors into sub-lethally irradiated recipients and observed robust and rapid engraftment and disease propagation (7 / 7 recipients upon primaryAttorney Docket No: 11624-026WO1
[0306] and 17 / 18 recipients upon secondary transplant, FIG. 6). In conclusion, overexpression of MYC led to a robust erythroleukemia in adult zebrafish and this model was used for further studies of clonality.
[0307] Two independent clone tracing methods, Zebrabow and GESTALT, were used to probe healthy progenitor and leukemic cells. Zebrabow is a color-labeling based approach that allows for flow cytometric analysis of gated healthy progenitor and leukemic cell clones. Most leukemic cells were composed of 1 or 2 dominant clone(s), contrasting with polyclonal healthy progenitors with 10 or more clones (FIG. 1). Furthermore, leukemic marrows with fewer clones were associated with a higher disease burden, suggesting eventual outgrowth of the leukemic clone over non-mutant hematopoiesis (FIG. 1). GESTALT is a CRISPR Cas9-based genetic lineage tracing method in which DNA barcodes are introduced in an artificial cassette during embryonic development and can be sequenced in adult sorted blood populations. GESTALT barcodes were sequenced from sorted heathy progenitor and leukemic cells. A total of 33 to 68 total clones were detected in healthy progenitors and 19 to 21 clones in leukemic cells with a single dominant clone in leukemic cells compared to healthy progenitors (FIG. 1). The higher clone number detected with GESTALT compared to Zebrabow is expected due to the higher complexity of DNA barcodes compared to color barcodes. Overall, these orthogonal methods revealed that mosaic overexpression of human MYC in blood cells results in clonal expansion of 1 or 2 progenitors leading to leukemic transformation.
[0308] Leukemia induces clonal selection of niche endothelial and stromal cells
[0309] It was next aimed to probe the clonality of niche ECs and MSCs using the GESTALT system. A GESTALT barcode transgenic line was generated that carries the endothelial reporter kdrl:GFP and the stromal reporter cxcl12a:dsRed (FIG. 2). This line was crossed to the GESTALT guide line and injected resulting 1-cell stage embryos expressing guide RNA (gRNA) targeting sites 1 to 4 of the GESTALT cassette and cas9 mRNA to induce dynamic barcoding in the first four sites of the cassette during early embryogenesis. The drl: MYC construct or control construct was injected to induce leukemia in adults. Embryos were heat shocked at 28 hours post fertilization (hpf) to induce Cas9 expression and triggering barcodes in sites 5 through 9 of the cassette at the time of FISC birth. Barcoded adults were raised to adulthood and monitored for disease onset. Zebrafish with more than 60% of leukemic cells in the marrows were retained for analysis and matched to healthy control samples. Endothelial and stromal populations were sorted for DNA extraction, GESTALT cassette amplification and next-generation sequencing (FIG. 7). It was found that leukemic marrows had significantlyAttorney Docket No: 11624-026WO1
[0310] decreased EC and MSC clone numbers compared to healthy controls indicative of a clonal selection (FIG. 2). Clone size analysis revealed that leukemic endothelial and stromal clones were significantly larger than healthy clones suggesting a niche clonal expansion (FIG. 2; FIG.
[0311] 7). A significant increase in median endothelial clone size was found suggesting an important endothelial clonal remodeling in leukemia marrows (FIG. 7). The five largest clones had a significantly larger average size in leukemic marrows emphasizing a leukemia-driven niche selective clonal expansion (FIG. 2). Overall, these data revealed that leukemia induced a significant clonal redistribution with clonal selection within the niche cells.
[0312] Clonally selected lepr+ mesenchymal stromal cells have a unique gene expression signature in leukemic marrows
[0313] It was reasoned that clonal remodeling of the niche is accompanied by transcriptional remodeling and functional change. To understand molecular changes in niche cells, scRNA-seq of purified kdrl: GFP+ ECs and cxcl12a:dsRed+ MSCs was performed from healthy and leukemic marrows. Combined data analysis identified 7 sub-populations (FIG. 2). Two MSC subpopulations could be identified based on the differential expression of the niche markers kitlga and lepr (FIG. 8, Tables 1-7). Both kitlga+ and lepr+ MSC proportions were altered upon leukemia with an expansion of the lepr+ MSC subpopulation (FIG. 2; FIG. 9). To further understand the transcriptional changes in these populations, single-cell GSEA analysis was performed between healthy and leukemic MSCs. This analysis revealed a significant increase of IL6 / JAK / STAT3, TGF beta signaling and interferon alpha response (FIG. 9). Differential gene expression analysis identified the stromal cell activation marker cd248a expressed exclusively in lepr+ MSCs and upregulated in leukemic marrow (FIG. 9). Immunohistochemistry for dsRed in healthy marrows revealed an even distribution of cxcl12a:dsRed+ MSCs (FIG. 9). In leukemic marrows, two distinct MSC regions could be observed: MSC-depleted regions with rare MSCs packed between leukemic cells and MSC-dense regions with a higher density of MSCs. The clonal, transcriptional and imaging analysis of MSCs in leukemic marrows suggested a spatially restricted clonal activation of lepr+ MSC.
[0314] Endothelial progenitors are expanded and. drive spatially defined angiogenesis in leukemic marrows
[0315] Prior work demonstrated that sinusoidal ECs intimately interact with HSCs and drive normal stem cell retention and division in the niche. Endothelial fates are also demonstrated to drive ectopic hematopoietic niche formation. To define the endothelial populations present inAttorney Docket No: 11624-026WO1
[0316] the zebrafish leukemic marrow, scRNA-seq data was used to identify arterial, lymphatics and sinusoidal ECs, with sinusoidal ECs further subdivided into three distinct subpopulations (FIG.
[0317] 8, Tables 1-7). This included two subpopulations of sinusoidal ECs, with subpopulation 2 expressing marker genes reported as niche factors in the zebrafish embryonic stem cell niche and subpopulation 1 expressing several angiogenic factors and sharing marker genes with arterial and sinusoidal ECs (FIG. 10). Trajectory analysis using Monocle3 supported the notion that these angiogenic progenitors differentiate towards arterial and sinusoidal ECs (FIG. 10). EC subpopulations were altered in leukemic marrows with a higher proportion of angiogenic progenitors (FIG. 2). Live imaging of kdrl:GFP healthy and leukemic marrows showed a change in spatial organization of the vasculature in leukemia. In healthy marrows, kdrl: GFP cells were evenly distributed forming complex sinusoidal networks (FIG. 10). In leukemic marrows, regions of dense sinusoidal vasculature could be identified (FIG. 10) with EC exhibiting high endosomal content, a cellular requirement for angiogenesis (FIG. 10). This finding was validated by higher expression of endosome markers in leukemic marrows with scRNA-seq (FIG. 10). Single-cell GSEA analysis between healthy and leukemic sinusoidal ECs revealed a significant enrichment of angiogenesis-related genes (FIG. 2). Altogether, GESTALT, scRNA-seq and imaging analyses suggest that leukemia induces clonal angiogenesis via activation of angiogenic progenitors to generate spatially altered sinusoidal networks.
[0318] The leukemia-secreted angiogenic factor apelin mediates endothelial cell clonal expansion It was hypothesized that leukemic cells must produce a factor to induce angiogenic progenitor activation and sinusoidal EC clonal expansion to promote disease progression. scRNA-seq of healthy hematopoietic and leukemic cells was performed to identify ligand(s) significantly upregulated by leukemic cells that had paired receptor(s) upregulated on leukemic ECs. Three candidates were identified: vascular endothelial growth factor c (vegfc), adrenomedullin b (admb) and apelin (apln) (FIG. 3; FIG. 11). Draculin-driven overexpression constructs were generated for these three candidates and these were injected into GESTALT embryos to test their individual ability to drive niche clonal and transcriptional changes in the absence of leukemia. Overexpression of vegfc induced a moderate EC clonal expansion that stemmed from small clones without MSC clonal expansion, and overexpression of admb did not induce any clone expansion (FIG. 11). The apln receptors are only expressed by ECs and apln overexpression resulted in a significant EC clonal expansion but no MSC clonal changes (FIG. 3; FIG. 11). To assess the transcriptional changes in niche cells upon apln overexpression,Attorney Docket No: 11624-026WO1
[0319] scRNA-seq of purified kdrl: GFP+ ECs and cxcl12a:dsRed+ MSCs was performed from healthy and apln overexpression marrows (FIG. 3; FIG. 8). It was found that apln overexpression induced an increase in angiogenic progenitors and differentiation into niche sinusoidal ECs similar to drkMYC leukemia (FIG. 3).
[0320] It was then posited that overexpression of apln leads to increased production of EC's altering hematopoiesis. To test this, the clonality and cell type output was examined in control and drl:apln-BFP marrows. It was found that overexpression of apelin significantly increased myeloid and erythroid clone size (FIG. 3). Flow cytometric analysis of marrows showed no significant changes in the overall hematopoietic output (FIG. 11 ). scRNA-seq of hematopoietic cells from control and apln overexpressing marrows revealed an increase in mature erythroid cells upon apln overexpression while the fraction of erythroid progenitors remains unchanged (FIG. 3). Using transgenic reporter lines, it was confirmed that the number of gatala:dsRed+ erythroid progenitors was unchanged but significantly more lcr: GFP+ mature erythroid cells were present upon apln overexpression (FIG. 11). scRNA-seq demonstrated an increase in the fraction of macrophages at the expense of neutrophils. A difference was not found in the fraction and transcriptional state of HSCs and HSPCs and confirmed this result using the runxl+23:mCherry transgenic line which revealed no difference in HSPC number upon apln overexpression (FIG. 11). Although HSCs did not show a clonal change or change in gene expression upon apln overexpression, the more sensitive clonal output of myeloid and erythroid cells (which in zebrafish maintain their nucleus) suggests HSC clonal output and differentiation changes to a myelo-erythroid fate via niche ECs.
[0321] apln-mediated EC remodeling is necessary and sufficient to drive leukemogenesis
[0322] In the apln overexpression model, 7% of animals (5 out of 71) exhibited evidence of leukemic disease with a significant increase of progenitor-like cells with concomitant block in myeloid differentiation (FIG. 4; FIG. 12). May-Grunwald Giemsa staining of marrow cell cytospins revealed an abundance of dark purple blasts with high nuclear-to-cytoplasmic ratio, recapitulating the phenotype observed in drkMYC leukemic animals (FIG. 1; FIG. 4). Next, it was asked if apln was required for MYC-driven leukemogenesis. To lest this, a stable apln loss-of-function zebrafish line was generated. The apln heterozygous animals were crossed and embryos were injected with drkMYC. Animals with confirmed drl:MYC transgene were followed for leukemia incidence. Compared to WT zebrafish, aplnhet and aplnhom mutants had a dose-dependent lower incidence of leukemia (FIG. 4). In fact, no death was observeddueAttorney Docket No: 11624-026WO1
[0323] to leukemia in the aplnhom mutants at 25 weeks. These data showed that apln secreted by leukemia cells is necessary and sufficient to induce disease progression.
[0324] Lastly, it was asked if human AMLs express APLN. Analysis of the BEAT AML dataset revealed a significant upregulation of APLN in leukemic samples compared to healthy bone marrow mononuclear cells (FIG. 12). To validate this result, immunohistochemistry was performed for APLN and immunofluorescence for the EC marker CD31 on adjacent sections of healthy and AML marrows. All AML marrows had higher APLN staining compared to controls, although heterogeneity in expression was noted (FIG. 4; FIG. 12). CD31 staining revealed higher vessel density in APLN high-expressing AML marrows compared to control suggesting APLN-driven angiogenesis in human disease, These results indicated that human AML cells produced high levels of APLN and that the marrow vasculature is affected in these patients.
[0325] Discussion
[0326] The clonality of the leukemic niche was evaluated in vivo using a novel zebrafish model of AML. It was demonstrated that MYC-driven AML induces a clonal selection of niche ECs and MSCs. The leukemia-secreted angiogenic peptide apln was identified as responsible for EC clonal expansion and reprogramming towards an EC progenitor state driving angiogenesis. By genetically overexpressing apln in absence of MYC, it was demonstrated niche EC clonal selection is associated with an alteration of HSCs clonal output in the myelo-erythroid lineage. Apelin independently was able to drive leukemogenesis, albeit with reduced penetrance. Genetic ablation of apln reduced the incidence of leukemia in a short follow-up period in the drl: MYC leukemia model. This supports the proposed cellular mechanism of leukemic cells remodeling the endothelial niche via the secretion of a single ligand which will reciprocally promotes leukemic cell growth. The role of the marrow niche in hematological disorders has been demonstrated by introducing mutations solely in niche compartments which resulted in MDS and / or pre-leukemic states. This work demonstrates for the first time that a secreted ligand inducing niche remodeling can promote malignant transformation, emphasizing the role of the niche in disease onset and progression.
[0327] The VEGF family is the most characterized family of secreted pro -angiogenic factors that have been shown to promote vascular growth and remodeling and its levels have been shown to be increased in AML patients. It was found that apln is more potent to trigger EC clonal selection than vegfc, the only VEGF family member found secreted by leukemic cells in vivo in the leukemia model disclosed herein. Clinical trials testing anti-VEGF therapy wereAttorney Docket No: 11624-026WO1
[0328] terminated due to lack of efficiency and this work places APLN signaling as a prime candidate for clinical intervention. It was demonstrated the involvement of APLN signaling in human disease by probing for the expression of APLN in AML marrows by immunohistochemistry and observing a strong increase in APLN levels in tandem with increase vessel density as measured by CD31 expression. The relevance of APLN in human leukemias is supported by the identification of a risk variant in the APLNR gene in a Genome-wide association study (GWAS) of pediatric acute lymphoid leukemia patients. While anti-VEGF therapy may still have an important role but developing antibody therapy to APLN could help treat leukemia. Other growth factors may regulate niche clonality in different types of leukemia and tumors. Additionally, growth factors that drive MSC clonal changes remain to be uncovered. It is anticipated that the methods disclosed herein will initiate studies centered on targeting niche clonality in cancer.
[0329] Materials and methods
[0330] Animal models
[0331] Wild-type zebrafish Tubingen (TU), Casper EKK, and transgenic lines GESTALT barcode and guide lines28, draculin: CreERT229, Zebrabow-M43, kdrl: GFP44, cxcl12a:dsRed245, Runx1+23:mCherry14, gata1a:dsRed30 and lcr: GFP31 were used in this study. All animals were housed at Boston Children’s Hospital and handled according to approved Institutional Animal Care and Use Committee (IACUC) of Boston Children’s Hospital protocols.
[0332] Transgenesis
[0333] Overexpression constructs were generated by DNA synthesis of desired cDNA (MYC, apln, vegfc, admb), D-TOPO cloning into pME Gateway, and ER Gateway Reaction to generate constructs with the draculin promoter driving a T2A fused with TagBFP, mCherry or GFP, followed by a SV40 poly A signal, all flanked by Tol2 integration sites. 'The fidelity of all constructs was confirmed by sequencing prior to injection. Constructs were injected in embryos at a concentration ranging from 5 to 25 ng / ul (determined experimentally to maximize embryo survival and mosaicism) with Tol2 mRNA at 25 ng / ul in the injection mix.
[0334] Zebrafish apelin mutant generation
[0335] To generate the apelin mutant, advantage was taken of a previously described genome¬ editing method. Specifically, tracrRNA and crRNA (IDT) was used to form functional gRNA duplexes targeting the ORF of the apelin gene (5’-GAATGTGAAGATCTTGACGC-3’) (SEQ ID NO: 1). Co-injection of the gRNAs with the Cas-9 protein (IDT) resulted in indels in theAttorney Docket No: 11624-026WO1
[0336] apln gene coding sequence, identified by Sanger sequencing and analyzed with ICE software (Synthego) in F0 injected embryos. F0 carriers for mutations in the apelin locus in the germline were identified by sequencing the alleles on the clutches and were then outcrossed to obtain Fl heterozygous mutants. Mutations (indels) leading to a premature stop codon were identified by ICE analysis (Synthego) of the Sanger sequencing results. F2 apln homozygous mutants were also identified by sequencing. The apelin mutant harbors a 26-bp insertion leading to a stop codon at position 18 of the peptide.
[0337] Leukemic cell transplants
[0338] Recipients were 3 months old Casper EKK zebrafish irradiated on days -2 and -1 with 14-Gy each day for a total of 28-Gy sublethal dose. Donors were two drl: MYC-mCherry animals exhibiting a leukemic phenotype. On day 0, each donor was dissected and marrows were collected as described below. Six WT I'll marrows were collected to serve as helper marrows. A small fraction of cells from leukemic single cell suspension from both donors were taken for flow cytometry analysis to confirm the presence of mCherry+ leukemic cells prior to transplantation. The rest of the marrow suspensions were counted then washed twice with IX PBS. Helper marrow cells were pooled and divided over all recipients. 2.5 pl of cells (mix of leukemic and helper cells) were transplanted retro-orbitally in each recipient. For donor 1, 3,165,000 cells were transplanted per recipient (n=4) and for donor 2 4,650,000 cells were transplanted per recipient (n=3). Recipients were monitored weekly for phenotypical manifestation of leukemia and were sacrificed for analysis prior to disease-induced death (within 5 to 10 weeks post-transplant). Marrows from recipients were dissected and analyzed by flow' cytometry and engraftment was defined as >2% mCherry+ cells or >25% cells in the progenitor gate (as defined by FSC / SSC in WT TU marrows). Cells from engrafted recipients from both primary donors were counted and transplanted in irradiated secondary Casper EKK recipients following the same procedure as described above. For donor 1, 591,000, 594,000, 555,000 and 198,000 cells were transplanted in secondary recipients (n=6). For donor 2, 323,000, 1,395,000 and 602,000 cells were transplanted in secondary recipients (n=13). All secondary recipients exhibited signs of disease within 6 weeks and were analyzed as described above.
[0339] Zebrabow color labeling
[0340] Zebrabow-M adults were crossed with draculin: CreERT2adult and embryos were injected with drl: MYC and Tol2 mRNA. At 28 hours post fertilization (hpf) embryos were transferred to 6-well plates at a density of 25-35 embryos per well and treated with 15 pM 4-hydroxytamoxifen (4-OITT) for 3-5 hours in the dark at 28.5°C.Attorney Docket No: 11624-026WO1
[0341] GESTALT embryo barcoding
[0342] Barcoding was performed as described previously in 28. Briefly. GESTALT barcode females were crossed with a GESTALT guide male to minimize maternal inheritance of gRNA 5-9 (FIG. 2). Single cell embryos were injected with gRNA 1-4 (each gRNA at 17.5 ng / ul in injection mix) and cas9 mRNA (150 ng / pl in injection mix). Overexpression constructs were included in the injection mix as appropriate. At 28 hpf, embryos were transferred to 1.5 ml tubes at a density of 25-35 embryos in 500 pl of embryo water and heated at 37°C for 30 minutes.
[0343] GESTALT barcoded zebrafish genotyping
[0344] At 2 months post fertilization, all barcoded animals were fin clipped and DNA from fin samples was extracted (Zymo Quick DNA miniprep). The GESTALT cassette was amplified by PCR using Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB) with the following conditions: 98°C 3 minutes, [98°C 10 seconds, T annealing = 63°C 10 seconds, 72°C 10 seconds] x 35 cycles, 72°C 5 minutes and using primers FW: CTGCCATTTGTCTCGAGGTC (SEQ ID NO: 2) and RV: CTGCCATTTGTCTCGAGGTC. The editing level was assess using 1 ) gel electrophoresis to detect the presence of a smear below the 310 base pairs (bp) unedited cassette band and 2) next generation sequencing for samples with a smear detected on gel. Reads were mapped using the pipeline described below. Animals with 75% and above edited reads were selected for further analysis.
[0345] Marrow dissection and flow cytometry
[0346] Zebrafish were euthanized according to IACUC guidelines and kidney marrows were dissected under a Leica MZ75 light microscope. For hematopoietic cell collection, tissue was collected in cold IX DPBS (Gibco) with 2% fetal bovine serum (FBS, Gemini Bio-Products) and 1 USP units / mL heparin (Sigma) (blood buffer), and then mechanically dissociated by repeated pipetting and filtered through a 40-gm nylon mesh prior to adding 3 nM of DRAQ-7 (Abeam) for viability assessment for flow cytometry analysis and / or sorting. For EC and MSC recovery, tissue was collected in cold IX PBS and incubated in Liberase (Roche) for 25 minutes at 37°C with 600rpm agitation and mechanical dissociation using a p200 pipet tip after 10 and 20 minutes. Pure FCS was added to reach 10% volume and stop the enzymatic reaction. Cell suspension was filtered through a 40-pm nylon mesh and washed with 1ml of cold IX DPBS with 2% FBS at 400g for 5 minutes. Pellet 'as resuspended in cold IX DPBS with 2% FBS with 3nM of DRAQ-7 for flow cytometry analysis and / or sorting. Flow cytometric analysis and sorting was performed on a BD FACSAria II or FACSFortessa (BD Biosciences). Gates were drawn using negative controls and all data was analyzed using FlowJo. For all animals,Attorney Docket No: 11624-026WO1
[0347] two types of unsorted samples were kept for DNA extraction 1) an aliquot of 10,000-50,000 total unsorted marrow cells 2) a peripheral blood sample collected by cardiac aspiration using a plO tip coated with heparin and deposited in 300 pl of cold blood buffer and filtered through a 40- pm nylon mesh.
[0348] Adult Zebrabow color analysis
[0349] Color barcodes from Zebrabow kidney marrow samples were quantified using previously published pipelines adapted to a Python-based interface. The progenitor (as defined by FSC / SSC gating) color output was chosen as a read out of clonal changes.
[0350] Single cell RNA-Sequencing library preparation
[0351] Single cells gated for targeted cell populations (lymphoid, myeloid, progenitor gates as defined by FSC / SSC or kdrl: GFP+ and cxcl12a:dsRed+ ECs and MSCs, respectively) were sorted in 300 pl of PBS supplemented with 0.5% Bovine Serum Albumin (Gemini BioProducts). Sorted cell numbers were ranging between 18,000 and 100,000 cells. Samples were centrifuged at 500g for 5 minutes and cells were resuspended in 30 pl for cell counting using a hemocytometer. Live cell concentrations were assessed and aimed for a targeted recovery of 5,000 to 8,000 cells per lane using the 10X Genomics Chromium Next GEM Single Cell 3’ Reagent Kit v3.1. Sequencing libraries were generated following manufacturer’s instructions and amplified cDNA and final libraries quality was probed using high sensitivity DNA D5000 and D1000 tape station kits (Agilent). Libraries were sequenced on NovaSeq platform (SPflow cell) with a targeted minimum of 20,000 paired end reads per cell.
[0352] Single cell RNA-Sequencing data analysis
[0353] lOx genomic scRNA-seq data was analyzed by lOx CellRanger v7.0 package. The sequencing reads were aligned to the zebrafish genome Ensembl GRCz11. The CellRanger count command with -include-introns option generates gene-barcode matrix for each sample, which were imported into R using the Seurat suite version 3.047-50. Briefly, low quality cells were filtered out by selecting cells with the following parameters: nFeature_RNA > 600 & nFeature. RNA < 5000 & percent.mt < 12. The filtered samples were integrated across samples groups using the 5000 most variable genes as anchors. PCA dimensionality reduction using 30 PCs was performed, followed by clustering and Uniform Manifold Approximation and Projection (UMAP) using a value of 0.4 for the resolution. Downstream differential gene expression (DGE) analyses were performed with the FindMarkers() functions. Cell type signatures were generated using the AddModuleScore() function based on unbiased DGE analyses and curated lists from published literature. For single-cell GSEA analysis, the Escape package was used with the Hallmark gene set from the Human Molecular Signatures DatabaseAttorney Docket No: 11624-026WO1
[0354] (MSigDB). For Monocle 3, the SeuratWrappers package was used to create a Monocle object from a Seurat object. Downstream analysis of ECs was performed using the cluster of angiogenic progenitors as root. Pseudotime values were added to the Seurat object and plotted using the DimPlot() function.
[0355] GESTALT barcode library preparation
[0356] Single cells gated for targeted cell populations (lymphoid, myeloid, progenitor gates as defined by FSC / SSC or kdrl: GFP+ and cxcl12a:dsRed+ ECs and MSCs, respectively) were sorted in 300 pl of cold IX DPBS (Gibco) with 2% fetal bovine serum (FBS, Gemini Bio¬ Products) and 1 USP units / mL heparin (Sigma). At least 2,000 single cells were sorted for each individual sample and animals for which at least one cell population did not reach 2,000 viable sorted cells were excluded for further analysis. Sorted cells were spun down and DNA was extracted (Zymo Quick DNA miniprep). GESTALT cassette amplification was performed using Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB) with the following conditions: 98°C 3 minutes, [98°C 10 seconds, T annealing = 63°C 10 seconds, 72°C 10 seconds] x 35 cycles, 72°C 5 minutes and using primers FW: CTGCCATTTGTCTCGAGGTC (SEQ ID NO: 2) and RV: CTGCCATTTGTCTCGAGGTC (SEQ ID NO: 3). PCR amplicons were purified on Qiagen MinElute or PCR purification kit columns prior to sequencing. An aliquot of the purified sample was run on gel to confirm purity and the presence of a smear below 310bp to confirm editing. Sequencing was performed on the Illumina MiSeq.
[0357] GESTALT barcode data analysis
[0358] DNA sequencing amplicons were aligned and collapsed by unique molecular identifier using a modified version of previous pipelines. Insertion and deletion events were called at each target site, generating a set of target site calls for each unique molecule, and statis tics files on each collapsed read were generated. Mapped read count files were loaded into R Studio for downstream analysis. Samples were blinded regarding their healthy and leukemic status for the analysis that follows. Briefly, barcodes from all samples in this manuscript were collated and frequency of barcodes were plotted. Barcodes detected in more than 25% of samples were considered common barcodes and excluded for further analysis. For each zebrafish, barcodes from all samples were merged and only barcodes with more than 10 mapped reads were considered for clonality analyses. For niche analyses, blood barcodes were identified from unsorted peripheral blood samples and subtracted from endothelial and stromal samples to exclude potential red blood cell contamination. Overlap between endothelial / stromal barcodes and other sorted hematopoietic population (lymphoid, myeloid and progenitors based on FSC / SSC gating) was examined and hematopoietic barcodes were removed from endothelialAttorney Docket No: 11624-026WO1
[0359] and stromal barcodes when detected at a frequency lower than 10%. This approach excluded all hematopoietic clones from stromal samples. However, this approach allows for preservation of a small fraction of barcodes in endothelial samples, likely reflective of the endothelial origin of the hematopoietic system. Only barcodes unique to endothelial, stromal or hematopoietic populations were kept for further quantification of barcode / clone numbers and clone fraction were calculated for each sample. For hematopoietic lineage analysis, multipotent clones are defined as clones detected in erythroid (peripheral blood), lymphoid and myeloid gates. Erythroid clones are defined as clones detected in the peripheral blood sample. Lymphoid and myeloid clones are defined as clones detected in their sorted respective gates based on FSC / SSC gating. Erythroid, myeloid and lymphoid clones include clones unique to each lineage and multipotent clones.
[0360] Bulk RNA-Seq library generation
[0361] Total marrow cells were pelleted at 400g for 5 minutes and resuspended and vortexed in RLT buffer (Qiagen) supplemented with 1 % beta-mercaptoethanol prior to storage at -80°C. RNA was extracted using a RNeasy Plus Micro Kit (Qiagen). 100 ng of RNA was processed using the RiboGone-Mammalian kit (Takara) followed by amplified cDNA generation using the SMARTer Universal Low Input RNA kit (Takara). cDNA quality was assessed using high sensitivity DNA D1000 tape station kits (Agilent). Sequencing libraries were generated using the ThruPLEX DNA-Seq Kit (Takara) and quality was assessed using high sensitivity DNA DI 000 tape station kits (Agilent).
[0362] Bulk RNA-Seq sequencing and data analysis
[0363] Libraries were sequenced on an Illumina Hiseq-4000. Quality control of RNA-Seq datasets was performed by FastQC and Cutadapt to remove adaptor sequences and low-quality regions. The high-quality reads were aligned to Ensembl GRCz11 of zebrafish genome using STAR 2.7.0 Spliced Transcripts Alignment tool55. The raw read counts of each gene is calculated by HTSeq56. Downstream analyses were performed using R Studio.
[0364] Cytospin
[0365] 100-200 pl of total single cell suspensions from marrow samples were loaded on cytology funnels with filter cards (Fisherbrand) and spun down at 500rpm for 5 minutes at medium acceleration in Shandon Cytospin Centrifuge onto glass slides. Slides were immediately stained using May-Grünwald Giemsa stain for 4 minutes followed by two washes in deionized water (4 minutes each). Slides were air dried at room temperature over-night prior to imaging using a Nikon Eclipse E600 equipped with a DS-Ri3 camera. All images were acquired and processed using NIS-Elements (Nikon).Attorney Docket No: 11624-026WO1
[0366] Immunohistochemistry
[0367] Zebrafish were euthanized according to IACUC guidelines and fixed in 10% neutral Buffered Formalin (VWR) for 24 hours at room temperature. Immunohistochemistry was performed on the Leica Bond III automated staining platform using the Leica Biosystems Refine Detection Kit (Leica; DS9800). FFPE tissue sections were baked for 30 minutes at 60°C and deparaffinized (Leica AR9222) prior to staining. Primary antibodies were incubated for 30 minutes, visualized via DAB, and counterstained with hematoxylin (Leica DS9800). The slides were rehydrated in graded alcohol and cover slipped using the HistoCore Spectra CV mounting medium (Leica 3801733).
[0368] The following antibodies were used:
[0369] Anti mCherry (Abeam ab 167453, 1:600 with a 20M EDTA antigen retrieval (Leica ER2 AR9640)).
[0370] Anti GFP (Cell Signaling Technology 2956, clone D5.1, 1:50 with a 20M EDTA antigen retrieval (Leica ER2 AR9640)).
[0371] Anti APELIN (Abeam, ab125213, 1:100 with a 20M EDTA antigen retrieval (Leica ER2 AR9640)).
[0372] Immunofluorescence
[0373] Immunofluorescent staining was performed on the Leica Bond RX automated staining platform using the Leica Biosystems Refine Detection Kit (Leica DS9800). FFPE tissue sections were baked for 30 minutes at 60°C and deparaffinized (Leica AR9222) prior to staining. Following staining, slides were counterstained with DAPI (Nucblue; Invitrogen R37606) and cover slipped (Prolong Diamond; Invitrogen P36961), The following antibody was used: anti CD31 (CST, 3528, clone 89C2, 1:1600, antigen retrieval Leica ER1 AR9961 for 30min).
[0374] Live imaging of marrows
[0375] Zebrafish were euthanized according to IACUC guidelines and immediately dissected for marrow collection. Marrows were slowly collected in one piece and placed in a glass bottom 6-well plate. A drop of cold PBS was deposited above the tissue and a round coverslip was superposed to maintain the tissue in contact with the glass bottom. Live imaging microscopy was performed using a Yokogawa CSU-X1 spinning disk mounted on an inverted Nikon Eclipse Ti microscope equipped with dual Andor iXon EMCCD cameras and a motorized x-y stage to facilitate tiling and imaging of multiple specimens simultaneously. All images were acquired using NIS-Elements (Nikon) and processed using Imaris (Bitplane).
[0376] StatisticsAttorney Docket No: 11624-026WO1
[0377] Graphs and statistical analysis are done with R Studio (Posit) and Prism (GraphPad Software, Inc.). Quantitative graphs provide the mean and standard deviation or the median, as indicated in the figure legends. Statistical tests used were 2way ANOVA or t-test and p-values are indicated in the figure legends.
[0378] Example 3. Leukemia-derived apelin selects endothelial niche clones to promote tumorigenesis
[0379] Leukemogenesis was long believed to be solely driven by genetic perturbations in hematopoietic cells but prior studies have shown that genetic mutations in stromal cells of the marrow can drive disease progression. The mechanisms by which the stem cell niche promotes leukemia remain poorly understood. Here, using CRISPR-CAS9-mediated cellular barcoding, it was demonstrated that individual niche endothelial clones are selected from a pool of polyclonal vascular cells to promote leukemic growth. The leukemia-secreted pro-angiogenic peptide apelin was identified as the mediator of endothelial cell clonal selection. By genetic overexpression and knock-out, apelin was demonstrated as necessary and sufficient to promote tumorigenesis by niche clonal remodeling. This work provides a potential therapeutic opportunity for anti-apelin therapy to treat the leukemic niche at a clonal level.
[0380] Hematopoietic stem cells (HSCs) are essential to produce all mature blood cells during the entire life of an organism. Hematopoiesis is a clonal process and cellular barcoding technologies have been used to analyze the clonal dynamics of HSC in vivo at steady state and upon disease. To date, the clonality of the HSC niche, a microenvironment that provides signals for their differentiation and self-renewal, has not been investigated in vivo. Endothelial and mesenchymal stromal cells (ECs and MSCs, respectively) are two key cellular components of the stem cell niche that are indispensable for HSC function. Most HSCs reside near marrow sinusoidal ECs and ablation of ECs results in HSC loss highlighting the crucial role of EC's in the niche. A rare subset of niche ECs expresses apelin, an angiogenic growth factor necessary for HSC function at steady state. Apelin+ ECs possess endothelial progenitor potential that promotes vascular regeneration after irradiation-induced damage and is necessary for HSC engraftment upon transplantation. MSCs are a cell type tightly associated with HSC function as specific ablation of MSC secreting high levels of CXCL12 was demonstrated to deplete HSCs from the niche. Endothelial and stromal cells provide an environment that is conducive to the growth and function of normal HSCs. Malignant transformation and abnormal proliferation of an HSC clone results in hematological malignancies such as acute myeloid leukemia (AML). The HSC niche has been proposed to contribute to leukemogenesis as geneticAttorney Docket No: 11624-026WO1
[0381] alterations of APC, DICER 1 or RB 1 in niche cells have been shown to induce myelodysplastic syndrome (MDS) and pre-leukemic states. Leukemia induces extensive niche remodeling that includes angiogenesis, a process by which new blood vessels are formed. At steady state, angiogenesis is tightly regulated by a balance of pro- and anti-angiogenic factors. Active and abnormal angiogenesis has been demonstrated in the marrow of patients with diverse subtypes of acute and chronic leukemia. Leukemic niche endothelial cells have been probed by immunostaining, but no single-cell transcriptomics has been performed on primary marrow endothelial cells. Immunohistochemical studies showed thatleukemic cells secrete pro- angiogenic factors that stimulate ECs to support leukemic growth. In this study, a CRISPR-CAS9-mediated cellular barcoding technology was used called GESTALT paired with single-cell mRNA-Sequencing (scRNA-seq) to investigate the clonal and transcriptional response of niche ECs and MSCs upon leukemia formation in vivo. Surprisingly, an oligoclonal selection of niche endothelial and mesenchymal stromal cells was found in animals with leukemia. Using genetic overexpression and knock-out zebrafish models and expression studies in human primary AML samples, it was demonstrated that apelin secreted by leukemic cells induces selection of niche endothelial clones and transcriptional remodeling towards an endothelial progenitor state driving abnormal angiogenesis. It was shown that apelin is necessary and sufficient to clonally select niche endothelial cells to drive leukemia progression, demonstrating for the first time that excessive production of a single secreted ligand by leukemic cells remodels the endothelial niche to support leukemogenesis.
[0382] Overexpression of human MYC in blood cells leads to acute myeloid leukemia in zebrafish.
[0383] To generate a myeloid leukemia model in zebrafish, the human oncogene MYC was overexpressed under the early blood lineage-specific draculin promotor (drl: MYC). Plasmid injections were performed to achieve overexpression of MYC in blood cells in a mosaic pattern, generating animals with various fractions blood cells overexpressing MYC. This approach led to heterogeneity in cell(s) of leukemic origin and disease progression dynamics allowing us to select the plasmid concentration to induce disease robustly and quickly. DrkMYC injected zebrafish died significantly quicker than non-injected controls and increased death was noted in early larval stages (<10 weeks) reflective of the premature death of highly mosaic animals (FIG. 1A). These animals were smaller in size, exhibiting bleeding, cardiac oedema secondary to anemia and difficulty swimming (FIG. IB). Flow cytometry analysis demonstrated that drl: MYC marrows had a leukemic blast-like population that overlapped with the progenitor gate in healthy marrows and a significant decrease of mature myeloid, lymphoid and erythroid cells (as defined in forward and side scatter space, FSC and SSC, respectively, FIG. 1C; FIG.Attorney Docket No: 11624-026WO1
[0384] 5A). Large proerythroblasts were detected in 14 out of 48 animals in combination with leukemic cells (FIG. 5A). Staining of total marrows with May-Grünwald Giemsa solution revealed abundant dark purple leukemic cells with a high nuclear to cytoplasmic ratio compared to controls (FIG. ID). Flow cytometry analysis of peripheral blood samples also detected circulating blasts (FIG. 5B). Immunohistochemistry on whole marrow sections demonstrated a high abundance of MYC+ leukemic cells (FIG. 5C). Bulk RNA-Sequencing of control drl:mCherry and drl:MYC-mCherry total marrow cells revealed a significant upregulation of embryonic hemoglobins hbbe1.1 and hbbe1.2 and the master erythroid transcription factor gata1a confirming the erythroid identity of leukemic cells (FIG. IE). The embryonic globin expression suggested the cell of origin was developmental in nature. This result was validated using the zebrafish transgenic lines lcr: GFP and gatala: dsRed, which label mature erythrocytes and erythroid progenitors, respectively, and demonstrated that drl: MYC marrows are significantly enriched in lcr:GFP+;gata1:dsRed+ leukemic cells and / or lcr:GFP+;gata1:dsRed- pro-erythroblasts revealing leukemic transformation at different stages of erythropoiesis (FIG. 5D). The top 1,500 genes upregulated by zebrafish leukemic cells were compared to the 1,500 genes upregulated in human acute erythro-leukemia samples and found 649 common genes (43.2%) suggesting a conserved transcriptional profile between zebrafish and human AEL. Total marrows from drl: MYC:mCherry donors were serially transplanted into sub-lethally irradiated recipients, observing robust and rapid engraftment and disease propagation (7 / 7 recipients upon primary and 17 / 18 recipients upon secondary transplant, FIG.
[0385] 6). In conclusion, overexpression of MYC led to robust erythroleukemia in adult zebrafish and used this model for further clonality studies. 'Two independent clone tracing methods were used, Zebrabow and GESTALT, to probe healthy progenitor and leukemic cells. Zebrabow is a color-labeling approach that allows for flow cytometric analysis of gated healthy progenitor and leukemic cell clones. In 5 marrows out of 6, leukemic cells were composed of 1 or 2 dominant clone(s), contrasting with polyclonal healthy progenitors with 10 or more clones in 6 out of 8 healthy fish (FIG. IF, left panel). Variability was observed with 2 healthy animals out of 8 exhibiting a done > 30% (a threshold used to define clonal dominance), a known incidence in zebrafish hematopoiesis probed using Zebrabow. In contrast, occasionally a leukemic animal can have multiple largest clones. In one leukemic animal out of 6 there were 2 large clones (each < 30%), consistent with the mosaic nature of the leukemia model. Furthermore, leukemic marrows with fewer clones were associated with a higher disease burden, suggesting eventual outgrowth of the leukemic clone over non-mutant hematopoiesis (FIG. IF, right panel). GESTALT is a CRISPR-CAS9-based cellular barcoding method inAttorney Docket No: 11624-026WO1
[0386] which DNA barcodes are introduced in an artificial cassette during embryonic development and can be sequenced in adult-sorted blood populations. GESTALT barcodes from sorted healthy progenitors and leukemic cells were sequenced. A total of 33 to 68 total clones were detected in healthy progenitors and 19 to 21 clones in leukemic cells with a single dominant clone in leukemic cells compared to healthy progenitors (FIG. 1G). The higher clone number detected with GESTALT compared to Zebrabow is expected due to the higher complexity of DNA barcodes compared to color barcodes. The Gini coefficient, a measure of inequality, was calculated and it was found that leukemic marrows had a higher Gini than healthy marrows, reflective of higher clonal skewing (FIG. 6D). Using both tools, heterogeneity was observed in hematopoietic clonal profiles reflective of the mosaicism aspect of the experimental design. Overall, these orthogonal barcoding methods revealed that mosaic overexpression of human MYC in blood cells results in clonal expansion of 1 or 2 progenitors leading to leukemic transformation.
[0387] Leukemia induces clonal selection of niche endothelial and stromal cells.
[0388] It was next aimed to probe the clonality of niche FCs and MSCs, which have never been investigated before, using the GESTALT system. A GESTALT barcode transgenic line that carries the endothelial reporter kdrl:GFP and the stromal reporter cxcl12a:dsRed was generated (FIG. 2A). This line was crossed to the GESTALT guide line and injected resulting 1-cell stage embryos with guide RNA (gRNA) targeting sites 1 to 4 of the GESTALT cassette and cas9 mRNA to induce dynamic barcoding in the first four sites of the cassette during early embryogenesis. The drl: MYC construct or control construct was injected to induce leukemia in adults. Embryos were heat shocked at 28 hours post fertilization (hpf) to induce Cas9 expression at the time of HSC birth, triggering barcode lineage recording at sites 5 through 9 of the cassette. The heat shock timing was chosen to maximize the time window of active barcoding to overlap with endothelial to-hematopoietic transition and glomerular primordia vascularization (see methods). Barcoded adults were raised to adulthood and monitored for disease onset. Zebrafish between 7 and 15 weeks of age with more than 60% of leukemic cells in the marrows were retained for analysis and clutch-matched to healthy control samples. Endothelial and stromal populations were sorted for DNA extraction, GESTALT cassette amplification and next-generation sequencing (FIG. 7 A). For all 14 animals analyzed, barcode diversity was maintained and it was found that leukemic marrows had significantly decreased EC and MSC clone numbers compared to healthy controls (FIG. 7B). Clone size analysis revealed that leukemic endothelial and stromal clones were significantly larger than healthy clones suggesting a niche clonal expansion (FIG. 2B for all clones; FIG. 7C-7D for cloneAttorney Docket No: 11624-026WO1
[0389] mean). To rule out that a MYC-driven clonal expansion of EC due to the activity of the draculin promoter in mesodermal ancestors during embryogenesis, 3 dpf kdrl: GFP+ embryos injected with drl: BFP or drl: MYC-BFP were analyzed by flow cytometry. An increase was not found in the percentage of FCs expressing BFPin drl: MYC-BFP injected embryos compared to drl: BFP controls(FIG. 7E). Additionally, only 0.5% of all ECs in the embryo body were expressing MYC: BFP+, demonstrating the low activity of the draculin promoter in ECs during embryogenesis. Finally, it was found that the fraction of ECs in drl: BFP and drl: MYC-BFP injected embryos was unchanged, demonstrating an absence of expansion of ECs during embryogenesis, prior to leukemia onset (FIG. 7F). The five largest clones had a significantly larger average size in leukemic marrows emphasizing a leukemia-driven niche selective clonal expansion (FIG. 2C). Overall, these data revealed that leukemia induces a significant niche clonal redistribution characterized by an expansion of a subset of EC and MSC clones. This novel observation suggests that leukemic cells select clones of niche cells to support their survival and demonstrates the importance of probing the cancer niche via cellular barcoding and dissecting the mechanisms responsible for this clonal selection.
[0390] Clonally selected lepr+ mesenchymal stromal cells have a unique gene expression signature in leukemic marrows.
[0391] It was reasoned that clonal remodeling of the niche is accompanied by transcriptional remodeling and functional change. To understand the molecular changes in niche cell populations, scRNA-seq of purified kdrl: GFP+ ECs and cxcl12a:dsRed+ MSCs was performed from healthy and leukemic marrows. To date, no scRNA-Seq dataset of primary niche cells from in vivo genetically induced leukemic marrows in any species has been generated. Combined data analysis identified 7 subpopulations (FIG. 2D). Two MSC subpopulations could be identified based on the differential expression of the niche markers kitlga and lepr (FIG. 8 A, Tables 1-7). Both kitlga+ and lepr+ MSC proportions were altered upon leukemia with an expansion of the lepr+ MSC subpopulation (FIG. 2E; FIG. 9A). To further understand the transcriptional changes in these populations, single-cell GSEA analysis was performed between healthy and leukemic MSCs. This analysis revealed a significant increase of IL6 / JAK / STAT3, TGF beta signaling and interferon alpha response (FIG. 9B). Differential gene expression analysis identified the stromal cell activation marker cd248a as a marker of lepr+ MSCs in leukemic marrow (FIG. 9C). Immunohistochemistry for dsRed in healthy marrows revealed an even distribution of cxcl12a:dsRed+ MSCs (FIG. 9D). In leukemic marrows, two distinct MSC regions could be observed: MSC-depleted regions with rare MSCs packed between leukemic cells and MSC-dense regions with a higher density ofAttorney Docket No: 11624-026WO1
[0392] MSCs. This clonal, transcriptional and imaging analysis of MSCs in leukemic marrows suggested a spatially restricted clonal activation of lepr+ MSC.
[0393] Endothelial progenitors are expanded and. drive spatially defined angiogenesis in leukemic marrows.
[0394] Prior work demonstrated that sinusoidal EC's intimately interact with HSCs and drive normal stem cell retention and division in the niche. It was also demonstrated that endothelial fates drive ectopic hematopoietic niche formation. To define the endothelial populations present in the zebrafish leukemic marrow, scRNA-seq data was used to identify arterial, lymphatics and sinusoidal ECs, with sinusoidal ECs further subdivided into three distinct subpopulations (FIG. 8B, Tables 1-7). This included two subpopulations of sinusoidal ECs, with subpopulation 1 expressing several angiogenic factors and sharing marker genes with arterial and sinusoidal ECs and subpopulation 2 expressing marker genes reported as niche factors in the zebrafish embryonic stem cell niche (FIG. 10A). Trajectory analysis using Monocle3 supported the notion that these angiogenic progenitors differentiate towards arterial and sinusoidal EC's (FIG. 10B). EC subpopulations were altered in leukemic marrows with a higher proportion of angiogenic progenitors (FIG. 2E). Live imaging of kdrl:GFP healthy and leukemic marrows showed a change in spatial organization of the vasculature in leukemia. In healthy marrows, kdrl:GFP cells were evenly distributed forming complex sinusoidal networks (FIG. 10C). In leukemic marrows, regions of dense sinusoidal vasculature could be identified (FIG. 10C, red arrows) with ECs exhibiting high endosomal content, a cellular requirement for angiogenesis (FIG. 10D). This finding was validated by higher expression of endosome markers in leukemic marrows with scRNA-seq (FIG. 10E). Single-cell GSEA analysis between healthy and leukemic sinusoidal ECs revealed a significant enrichment of angiogenesis-related genes (FIG. 2F). Altogether, GESTALT, scRNA-seq and imaging analyses suggest that leukemia induces clonal angiogenesis via activation of angiogenic progenitors to generate spatially altered sinusoidal networks.
[0395] The leukemia-secreted angiogenic factor apelin mediates endothelial cell clonal expansion.
[0396] It was hypothesized that leukemic cells must produce a factor to induce angiogenic progenitor activation and sinusoidal EC clonal expansion to promote disease progression. scRNA-seq of healthy hematopoietic and leukemic cells was performed to identify ligand(s) significantly upregulated by leukemic cells that had paired receptor(s) upregulated on leukemic ECs. Three candidates were identified: vascular endothelial growth factor c (vegfc), adrenomedullin b (admb) and apelin (apln) (FIG. 3A-3B; FIG. 11A-11B). Draculin-driven overexpression constructs were generated for these three candidates and these were injectedAttorney Docket No: 11624-026WO1
[0397] into GESTALT embryos to test their individual ability to drive niche clonal and transcriptional changes in the absence of leukemia. Overexpression of vegfc induced a moderate EC clonal expansion that stemmed from small clones without MSC clonal expansion, and overexpression of admb did not induce any clone expansion (FIG. 11C-11D). The apln receptors are only expressed by EC's (and not leukemic cells) and it was confirmed that the apln overexpression construct led to a substantial increased production of APLN protein as detected by IHC in adult marrows (FIG. HE). It was found that apln overexpression resulted in a significant EC clonal expansion but no MSC clonal changes (FIG. 3C; FIG. 11F-11G). To assess the transcriptional changes in niche cells upon apln overexpression, scRNA-seq of purified kdrl: GFP+ ECs and cxcl12a:dsRed+ MSCs was performed from healthy and apln overexpression marrows (FIG.
[0398] 3D; FIG. 8). It was found that apln overexpression induced an increase in angiogenic progenitors and differentiation into niche sinusoidal ECs similar to drl: MYC leukemia (FIG.
[0399] 3E). Identification of apln in this expressing study identified a novel mechanism of clonal selection of endothelial cells in the leukemic marrow. It was then posited that overexpression of apln leads to increased production of particular ECs that alter hematopoiesis. To test this, the clonality and cell type output was examined in control and drl:apln-BFP marrows. It was found that overexpression of apelin significantly increased myeloid and erythroid clone size (FIG. 3F). Flow cytometric analysis of marrows showed no significant changes in the overall hematopoietic output (FIG. 11H). scRNA-seq of hematopoietic cells from control and apln overexpressing marrows revealed an increase in mature erythroid cells upon apln overexpression while the fraction of erythroid progenitors remains unchanged (FIG. 3G). Using transgenic reporter lines, it was confirmed that the number of gatala:dsRed+ erythroid progenitors was unchanged but significantly more lcr: GFP+ mature erythroid cells were present upon apln overexpression (FIG. 111). scRNA-seq demonstrated an increase in the fraction of macrophages at the expense of neutrophils. A difference was not found in the fraction and transcriptional state of HSCs and HSPCs. This result was confirmed using the Runxl+23:mCherry transgenic line which revealed no difference in HSPC number upon apln overexpression (FIG. 111). Although HSCs did not show a clonal change or change in gene expression upon apln overexpression, this sensitive clonal readout of myeloid and erythroid cells using GESTALT (which is only feasible in zebrafish as erythrocytes maintain their nucleus) demonstrates an altered HSC clonal output and perturbed erythro-myeloid differentiation via niche ECs.
[0400] apln-mediated EC remodeling is necessary and sufficient to drive leukemogenesis.Attorney Docket No: 11624-026WO1
[0401] In this apln overexpression model, 7% of animals (5 out of 71) exhibited evidence of leukemic disease with a significant increase of progenitor-like cells with concomitant block in myeloid differentiation (FIG. 4A; FIG. 12A). This effect is mediated via endothelial cells, which are the only marrow cell type expressing the apelin receptors (aplnra and aplnrb). In contrast leukemic cells do not express the apelin receptors, excluding an autocrine effect. May-Grünwald Giemsa staining of marrow cell cytospins revealed an abundance of dark purple blasts with high nuclearto-cytoplasmic ratio, recapitulating the phenotype observed in drkMYC leukemic animals (FIG. ID, 4B). Overall, this data reveals that overexpression of apln alone is capable inducing leukemic transformation through EC niche remodeling. Next, it was asked if apln was required for MYC-driven leukemogenesis. To test this, a stable apln loss- of-function zebrafish line was generated and found that aplnhet and aplnhom mutants were viable. It was examined the cellular composition of aplnwt, aplnhet and aplnhom mutant marrows and did not find a significant difference in the percentage of lymphoid, myeloid and progenitor cells demonstrating that steady-state hematopoiesis is not perturbed in the absence of apln (FIG. 12B). The apln heterozygous animals were crossed and embryos were injected with drkMYC. Animals with confirmed drl:MYC transgene were followed for leukemia incidence. All aplnwt zebrafish died of disease (n=14) while aplnhet and aplnhom mutants had a much lower incidence of leukemia at 40 weeks (>80%, n=51 and n=14, respectively) (FIG.
[0402] 4C). These data showed that apln secreted by leukemia cells is necessary and sufficient to induce disease progression. Lastly, it was asked if human AMLs overexpress APLN. This analysis of the BEAT AML dataset revealed a significant upregulation of APLN in leukemic samples compared to healthy bone marrow mononuclear cells (FIG. 12C). To validate this result, immunohistochemistry was performed for APLN and immunofluorescence for the EC marker CD 31 on adjacent sections of healthy (n=4) and AML (n=4) marrows. All AML marrows had higher APLN staining compared to controls, although heterogeneity in expression was noted (FIG. 4D; FIG. 12D-12E). CD31 staining revealed higher vessel density in APLN high-expressing AML marrows compared to controls suggesting APLN-driven angiogenesis in human disease. These results indicated that human AML cells produced high levels of APLN and that the marrow vasculature is affected in these patients.
[0403] Discussion
[0404] The clonality of the leukemic niche was evaluated in vivo using a novel zebrafish model of AML,. MYC-driven AML induces a clonal selection of niche ECs and MSCs. The leukemia-secreted angiogenic peptide apln and its endothelial-specific receptors were identified as theAttorney Docket No: 11624-026WO1
[0405] ligand receptor pair mediating EC clonal remodeling by single-cell transcriptomics. Using genetic overexpression, it was shown that apln is sufficient to induce EC clonal expansion and reprogramming towards an EC progenitor state driving angiogenesis. Overexpression of apln in blood cells in the absence of MYC demonstrated that niche EC clonal selection is associated with an alteration of HSC clonal output in the myelo-erythroid lineage. Apln was able to independently drive leukemogenesis, albeit with reduced penetrance and genetic ablation of apln reduced the incidence of leukemia in the drl: MYC leukemia model. This supports the proposed cellular mechanism of leukemic cells remodeling the endothelial niche via the secretion of a single ligand, which reciprocally promotes leukemic cell growth. The role of the marrow niche in hematological disorders has been demonstrated by introducing mutations solely in niche compartments resulting in MDS and / or pre-leukemic states. This work demonstrates for the first time that a single secreted ligand inducing niche remodeling can promote malignant transformation, emphasizing the role of the niche in disease onset and progression. To date, high throughput single-cell profiling of niche cells from genetically induced leukemia in animal models or primary human AML samples has not been generated. Only expression data of cultured endothelial cells exists. The scRNA-Seq data of leukemic cells and niche endothelial cells from the same animal as disclosed herein shows the importance of specific endothelial clones in driving disease and allowed for ligand-receptor analysis for robust candidate selection. The identification and validation by orthogonal genetic perturbation methods of an apelin-mediated mechanism supports that the observed clonal phenotype is not due to a stochastic clonal bottleneck. A maintenance of the cellular and transcriptional diversity of EC populations in clonally expanded leukemic marrows was observed, arguing against a random selection of clones. Additionally, niche endothelial clonal selections were found in leukemic animals as young as 7 weeks of age, suggesting that niche clonal expansion occurs early and rapidly. These data suggest that the clones of endothelial progenitor fate selected by apln is associated with support for leukemic growth, whereas marrow venous sinusoids provide better support of normal blood stem cells. Altogether, a novel secreted ligand-mediated mechanism of niche remodeling was identified to promote leukemogenesis via the selection of disease-associated endothelial clones.
[0406] It was found that apln is a strong modulator of niche endothelial clonality. As a comparison, the effect of VEGF on niche clonality was studied. The VEGF family is the most characterized family of secreted pro-angiogenic factors that have been shown to promote vascular growth and remodeling and VEGF levels have been shown to be increased in AML patients. It was found that vegfc, the only VEGF family member found secreted by leukemicAttorney Docket No: 11624-026WO1
[0407] cells in the in vivo leukemia model disclosed herein, did not alter endothelial clonality as much as apln using genetic overexpression. Clinical trials testing anti-VEGF therapy were terminated due to lack of efficiency and this work places APLN signaling as a prime candidate for clinical intervention. It was demonstrated the involvement of APLN signaling in human disease by probing for the expression of APLN in AML marrows by immunohistochemistry and observing a strong increase in APLN levels in tandem with increased vessel density as measured by CD31 expression. The relevance of APLN in human leukemias is supported by the identification of a risk variant in the APLNR gene in a Genome-Wide Association Study (GWAS) of pediatric acute lymphoid leukemia patients. While anti-VEGF therapy may still have an important role, developing antibody therapy to APLN could help treat leukemia. Other growth factors may also regulate niche clonality in different types of leukemia and tumors, and growth factors that drive MSC clonal changes remain to be uncovered. It is anticipated that studies will be initiated centered on targeting niche clonality in cancer.
[0408] Materials and Methods
[0409] Animal models
[0410] Wild-type zebrafish Tubingen (TU), Casper EKK, GESTALT barcode and guide lines and transgenic lines draculin: CreERT2, Zebrabow-M, kdrl:GFP, cxcll2a:dsRed2, Runxl+23:mCherry, gatala:dsRed and lcr: GFP were used in this study. All animals were housed at Boston Children’s Hospital and handled according to approved Institutional Animal Care and Use Committee (IACUC) of Boston Children’s Hospital protocols.
[0411] Transgenesis
[0412] Overexpression constructs were generated by DNA synthesis of desired cDNA (MYC, apln, vegfc, admb), D-TOPO cloning into pME Gateway, and LR Gateway Reaction to generate constructs with the draculin promoter driving a T2A fused with TagBFP, mCherry or GFP, followed by a SV40 Poly A signal, all flanked by Tol2 integration sites. The fidelity of all constructs was confirmed by sequencing prior to injection. Constructs were injected in embryos at a concentration ranging from 5 to 25 ng / ul with Tol2 mRNA at 25 ng / ul in the injection mix. The plasmid concentration was determined experimentally to maximize embryo survival and mosaicism. In brief, different concentrations ranging from 5 to 25 ng / ul of plasmids were injected and clutches with > 80% survival at 24 hpf were selected. These clutches were screened for the transgenesis marker (cryaa: BFP or cryaa: GFP) at 4 dpf and positive embryos from clutches with >50% positivity (reflecting a high plasmid integration frequency) wereAttorney Docket No: 11624-026WO1
[0413] grown to adulthood. Kidney marrows were dissected (see below) and the percentage of TagBFP, mCherry or GFP+ blood cells (indicative of mosaicism level) was quantified. The optimal plasmid concentration was chosen to be the one yielding the highest and broadest mosaicism level.
[0414] Zebrafish apelin mutant generation
[0415] To generate the apelin mutant, a previously described genome-editing method was used. Specifically, tracrRNA and crRNA (IDT) were used to form functional gRNA duplexes targeting the ORF of the apelin gene (5’-GAATGTGAAGATCTTGACGC-3’) (SEQ ID NO: 1). Coinjection of the gRNAs with the Cas-9 protein (IDT') resulted in indels in the apln gene coding sequence, identified by Sanger sequencing and analyzed with ICE software (Synthego) in F0 injected embryos. F0 carriers for mutations in the apelin locus in the germline were identified by sequencing the alleles on the clutches and were then outcrossed to obtain FT heterozygous mutants. Mutations (indels) leading to a premature stop codon were identified by ICE analysis (Synthego ) of the Sanger sequencing results. F2 apln homozygous mutants were also identified by sequencing. The apelin mutant harbors a 26-bp insertion leading to a stop codon at position 18 of the peptide.
[0416] Leukemic cell transplants
[0417] Recipients were 3 months old Casper EKK zebrafish irradiated on days -2 and -1 with 14-Gy each day for a total sublethal dose of 28-Gy. Donors were two drl: MYC-mCherry animals exhibiting a leukemic phenotype. On day 0, each donor was dissected and marrows were collected as described below. Six WT TU marrows were collected to serve as helper marrows. A small fraction of cells from leukemic single cell suspensions from both donors were taken for flow cytometry analysis to confirm the presence of mCherry+ leukemic cells prior to transplantation. The rest of the marrow suspensions were counted then washed twice with IX PBS. Helper marrow cells were pooled and divided over all recipients. 2.5 pl of cells (mix of leukemic and helper cells) were transplanted retro-orbitally in each recipient. For the first donor, 3,165,000 cells were transplanted per recipient (n=4) and for the second donor 4,650,000 cells were transplanted per recipient (n=3). Recipients were monitored weekly for phenotypical manifestation of leukemia and were sacrificed for analysis prior to disease-induced death (within 5 to 10 weeks post-transplant). Marrows from recipients were dissected and analyzed by flow cytometry and engraftment was defined as32% mCherry+ cells or325% cells in the progenitor gate (as defined by FSC / SSC in WT TU marrows). Cells from engrafted recipients from both primary donors were counted and transplanted into irradiated (28-Gy split dose) secondary Casper EKK recipients following the same procedure as described above. ForAttorney Docket No: 11624-026WO1
[0418] the first donor, 591,000, 594,000, 555,000 and 198,000 cells were transplanted in secondary recipients (n=6). For the second donor, 323,000, 1,395,000 and 602,000 cells were transplanted in secondary recipients (n=13). All secondary recipients exhibited signs of disease within 6 weeks and were analyzed as described above.
[0419] Zebrabow color labeling
[0420] Zebrabow-M adults were crossed with draculin: CreERT2 adults and embryos were injected with drl:MYC and Tol2 mRNA. At 28 hours post fertilization (hpf) embryos were transferred to 6- well plates at a density of 25-35 embryos per well and treated with 15 pM 4-hydroxytamoxifen (4-OHT) for 3-5 hours in the dark at 28.5°C.
[0421] GESTALT embryo barcoding
[0422] Barcoding was performed as described previously. Briefly, GESTALT barcode females were crossed with a GESTALT guide male to minimize maternal inheritance of gRNA 5-9 (FIG. 2A). Single cell embryos were injected with gRNA 1-4 (each gRNA at 17.5 ng / pl in injection mix) and cas9 mRNA (150 ng / pl in injection mix). Overexpression constructs were included in the injection mix as appropriate. At 28 hpf, embryos were transferred to 1.5 ml tubes at a density of 25-35 embryos in 500 pl of embryo water and heated at 37°C for 30 minutes. These conditions were determined and validated in the laboratory after a barcoding time course experiment. Two independent clutches were injected as described above and 5 individual embryos from each clutch (n=10 embryos total per time point) were collected at different time points (2 to 29 hpf) (FIG. 13A, yellow line). Next, two independent clutches were heat shocked at 28 hpf, the time of HSC emergence in the AGM, and 5 individual embryos from each clutch (n=10 embryos total per time point) were collected at different time points (29 to 50 hpf) (FIG. 13A, blue line). DNA was extracted from whole embryos for GESTALT barcode amplification by PCR followed by next generation sequencing (see below). Reads were mapped as described below and the mean percentage of unedited barcode was calculated for each time point. Injection of gRNA 1-4 and cas9 mRNA led to editing in -20% of barcodes within 2 hours post-injection and heat-shock at 28 hpf led to editing in -60% between 33 and 46 hpf (or 5 and 18 hours post heat shock) (FIG. 13 A). These conditions allowed for up to 80% editing in embryos with the second wave of barcoding being dynamically active between 33 hpf and 46 hpf, the most active time of endothelial to hematopoietic transition in the ventral part of the dorsal aorta leading to the generation of adult HSCs. This heat shock timing also coincides with active barcoding during glomerular primordia vascularization as capillaries bud form from the dorsal part of the aorta to allow unique labeling of endothelial cell precursors colonizing the kidney.Attorney Docket No: 11624-026WO1
[0423] 3 dpf embryo dissociation
[0424] Embryos were euthanized according to IACUC guidelines and pools of 6 embryos were transferred to 300 pl of PBS and 5 pl of Liberase (Roche). Samples were incubated for 20 minutes at 37°C with 800 rpm agitation and mechanical dissociation using a p200 pipet tip after 10 and 20 minutes. Pure FBS was added to reach 10% volume to stop the enzymatic reaction. Cell suspensions were filtered through a 40-pm nylon mesh and washed with 1 ml of cold IX DPBS with 2% FBS at 400g for 5 minutes. Pellet was resuspended in cold IX DPBS with 2% FBS with 3 nM of DRAQ-7 for flow cytometry analysis. Flow cytometric analysis was performed on a BD FACSFortessa (BD Biosciences). Gates were drawn using negative controls and all data was analyzed using FlowJo.
[0425] GESTALT barcoded zebrafish genotyping
[0426] At 2 months post fertilization, all barcoded animals were fin clipped and DNA from fin samples was extracted (Zymo Quick DNA miniprep). The GESTALT cassette was amplified by PCR using Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB) with the following conditions: 98°C 3 minutes, [98°C 10 seconds, T annealing = 63°C 10 seconds, 72°C 10 seconds] x 35 cycles, 72°C 5 minutes and using primers FW: CTGCCATTTGTCTCGAGGTC (SEQ ID NO: 2) and RV: CTGCCATTTGTCTCGAGGTC (SEQ ID NO: 3). The editing level was assessed using 1) gel electrophoresis to detect the presence of a smear below the 310 base pairs (bp) unedited cassette band and 2) next generation sequencing for samples with a smear detected on the gel. Reads were mapped using the pipeline described below. Animals with 75% and above edited reads were selected for further analysis. Marrow dissection and flow cytometr ’
[0427] Zebrafish were euthanized according to IACUC guidelines and kidney marrows were dissected under a Leica MZ75 light microscope. For hematopoietic cell collection, tissue was collected in cold IX DPBS (Gibco) with 2% fetal bovine serum (FBS, Gemini Bio-Products) and 1 USP units / mL heparin (Sigma) (blood buffer), and then mechanically dissociated by repeated pipetting and filtered through a 40-pm nylon mesh prior to adding 3 nM of DRAQ-7 (Abeam) for viability assessment for flow cytometry analysis and / or sorting. For EC and MSC recovery, tissue was collected in cold IX PBS and incubated in Liberase (Roche) for 25 minutes at 37°C with 600 rpm agitation and mechanical dissociation using a p200 pipet tip after 10 and 20 minutes. Pure FBS was added to reach 10% volume and stop the enzymatic reaction. Cell suspension was filtered through a 40-pm nylon mesh and washed with 1 ml of cold IX DPBS with 2% FBS at 400g for 5 minutes. Pellet was resuspended in cold IX DPBS with 2% FBS wdth 3 nM of DRAQ-7 for flow' cytometry analysis and / or sorting. Flow' cytometric analysisAttorney Docket No: 11624-026WO1
[0428] and sorting was performed on a BD FACSAria II or FACSFortessa (BD Biosciences). Gates were drawn using negative controls and all data was analyzed using FlowJo. For all animals, two types of unsorted samples were kept for DNA extraction 1 ) an aliquot of 10,000-50,000 total unsorted marrow cells and 2) a peripheral blood sample collected by cardiac aspiration using a plO tip coated with heparin and deposited in 300 pl of cold blood buffer and filtered through a 40- pm nylon mesh.
[0429] Adult Zebrabow color analysis
[0430] Color barcodes from Zebrabow kidney marrow samples were quantified using previously published pipelines adapted to a Python-based interface. The progenitor (as defined by FSC / SSC gating) color output was chosen as a read out of clonal changes.
[0431] Single cell RNA-Sequencing library preparation
[0432] Single cells gated for targeted cell populations (lymphoid, myeloid and progenitor gates as defined by FSC / SSC or kdrl: GFP+ and cxcl12a:dsRed+ ECs and MSCs, respectively) were sorted in 300 pl of PBS supplemented with 0.5% Bovine Serum Albumin (Gemini Bio¬ Products). Sorted cell numbers were ranging between 18,000 and 100,000 cells. Samples were centrifuged at 500g for 5 minutes and cells were resuspended in 30 pl for cell counting using a hemocytometer. Live cell concentrations were assessed and a targeted recovery of 5,000 to 8,000 cells per lane was aimed for using the 10X Genomics Chromium Next GEM Single Cell 3’ Reagent Kit v3.1. Sequencing libraries were generated following manufacturer’s instructions and the quality of amplified cDNA and final libraries was probed using high sensitivity DNA D5000 and D1000 tape station kits (Agilent). Libraries were sequenced on NovaSeq platform (SP flow cell) with a targeted minimum of 20,000 paired end reads per cell.
[0433] Single cell RNA-Sequencing data analysis
[0434] 10X genomic scRNA-seq data was analyzed by 10X CellRanger v7.0 package. The sequencing reads were aligned to the zebrafish genome Ensembl GRCz11. The CellRanger count command with -include-introns option generates gene-barcode matrix for each sample, which were imported into R using the Seurat suite version 3.0. Briefly, low quality cells were filtered out by selecting cells with the following parameters: nFeature_RNA > 600 & nFeature_RNA < 5000 & percent.mt < 12. The filtered samples were integrated across samples groups using the 5000 most variable genes as anchors. PCA dimensionality reduction using 30 PCs was performed, followed by clustering and Uniform Manifold Approximation and Projection (UMAP) using a value of 0.4 for the resolution. Downstream differential gene expression (DGE) analyses were performed with the FindMarkers() function. Cell type signatures were generated using the AddModuleScore() function based on unbiased DGEAttorney Docket No: 11624-026WO1
[0435] analyses and curated lists from published literature. For single-cell GSEA analysis, the Escape package was used with the Hallmark gene set from the Human Molecular Signatures Database (MSigDB). For Monocle 3, the SeuratWrappers package was used to create a Monocle object from a Seurat object. Downstream analysis of FCs was performed using the cluster of angiogenic progenitors as root. Pseudotime values were added to the Seurat object and plotted using the DimPlot() function.
[0436] GESTALT barcode library preparation
[0437] Single cells gated for targeted cell populations (lymphoid, myeloid and progenitor gates as defined by FSC / SSC or kdrl: GFP+ and cxcl12a:dsRed+ ECs and MSCs, respectively) were sorted in 300 pl of cold IX DPBS with 2% FBS and 1 USP units / mL heparin. At least 2,000 single cells were sorted for each individual sample and animal for which at least one cell population did not reach 2,000 viable sorted cells were excluded for further analysis. Sorted cells were spun down and DNA was extracted. GESTALT cassette amplification was performed using Phusion High- Fidelity PCR Master Mix with HF Buffer with the following conditions: 98°C 3 minutes, [98°C 10 seconds, T annealing = 63°C 10 seconds, 72°C 10 seconds] x 35 cycles, 72°C 5 minutes and using primers FW: CTGCCATTTGTCTCGAGGTC (SEQ ID NO: 2) and RV: CTGCCATTTGTCTCGAGGTC (SEQ ID NO: 3). A standard and consistent amount of DNA was used for PCR amplification for each animal. PCR amplicons were purified on Qiagen MinElute PCR purification kit columns prior to sequencing. An aliquot of the purified sample was run on gel to confirm purity and the presence of a smear below 310bp to confirm editing. Sequencing was performed on Illumina MiSeq.
[0438] GESTALT barcode data, analysis
[0439] DNA sequencing amplicons were aligned and collapsed by unique molecular identifiers using a modified version of previous pipelines. Insertion and deletion events were called at each target site, generating a set of target site calls for each unique molecule, and statistics files on each collapsed read were generated. Mapped read count files were loaded into R Studio for downstream analysis. Samples were blinded regarding their healthy and leukemic status for analysis. Briefly, barcodes from all samples in this manuscript were collated and frequency of barcodes were plotted. Barcodes detected in more than 25% of samples were considered common barcodes and excluded for further analysis. Excluded barcodes were enriched in sequences with unique deletions larger than 100 bp reflective of barcode homoplasy, common to the GESTALT method. For each zebrafish, barcodes from all samples were merged, normalized and only barcodes with more than 10 mapped reads were considered for clonality analyses. The frequency of all barcodes detected was plotted in all samples from thisAttorney Docket No: 11624-026WO1
[0440] manuscript and observed that most barcodes were found to be unique (FIG. 13B). For niche analyses, erythroid barcodes were identified from unsorted peripheral blood samples and subtracted from endothelial and stromal samples to exclude potential red blood cell contamination. Overlap between endothelial / stromal barcodes and other sorted hematopoietic populations (lymphoid, myeloid and progenitors based on FSC / SSC gating) was examined and hematopoietic barcodes were removed from endothelial and stromal barcodes when detected at a frequency lower than 10%. This approach excluded all hematopoietic clones from stromal samples. However, this approach allows for preservation of a small fraction of barcodes in endothelial samples, reflective of the endothelial origin of the hematopoietic system. Due to demonstrated active barcoding during HSC birth and kidney angiogenesis (FIG. 1 A), this approach preserves the large majority of uniquely barcoded endothelial cells from the adult kidney. Only barcodes unique to endothelial, stromal or hematopoietic populations were kept for further quantification of barcode / clone numbers, and clone fraction was calculated for each sample. For hematopoietic lineage analysis, multipotent clones are defined as clones detected in erythroid (peripheral blood), lymphoid and myeloid gates. Erythroid clones are defined as clones detected in the peripheral blood sample. Lymphoid and myeloid clones are defined as clones detected in their sorted respective gates based on FSC / SSC gating. Erythroid, myeloid and lymphoid clones include clones unique to each lineage and multipotent clones.
[0441] Bulk RNA-Seq library generation
[0442] Total marrow cells were pelleted at 400g for 5 minutes and resuspended and vortexed in RLT buffer (Qiagen) supplemented with 1% beta-mercaptoethanol prior to storage at -80°C. RNA was extracted using a RNeasy Plus Micro Kit (Qiagen). 100 ng of RNA was processed using the RiboGone-Mammalian kit (Takara) followed by amplified cDNA generation using the SMARTer Universal Low Input RNA kit (Takara). cDNA quality was assessed using high sensitivity DNA D1000 TapeStation kits (Agilent). Sequencing libraries were generated using the ThruPLEX DNA-Seq Kit ('Takara) and quality was assessed using high sensitivity DNA D1000 TapeStation kits.
[0443] Bulk RNA-Seq sequencing and data analysis
[0444] Libraries were sequenced on an Illumina Hiseq-4000. Quality control of RNA-Seq datasets was performed by FastQC and Cutadapt to remove adaptor sequences and low-quality regions. The high-quality reads were aligned to Ensembl GRCz11 of the zebrafish genome using STAR 2.7.0 Spliced Transcripts Alignment tool. The raw read count of each gene was calculated by HTSeq. Downstream analyses were performed using R Studio.
[0445] Cytospin staining and analysisAttorney Docket No: 11624-026WO1
[0446] 100 to 200 pl of total single cell suspensions from marrow samples were loaded on cytology funnels with filter cards (Fisherbrand) and spun down at 500 rpm for 5 minutes with medium acceleration in a Shandon Cytospin Centrifuge onto glass slides. Slides were immediately stained using May-Grunwald Giemsa stain for 4 minutes followed by two washes in deionized water (4 minutes each). Slides were air dried at room temperature over-night prior to imaging using a Nikon Eclipse E600 equipped with a DS-Ri3 camera. All images were acquired and processed using NIS-Elements (Nikon).
[0447] Immunohistochemistry
[0448] Zebrafish were euthanized according to IACUC guidelines and fixed in 10% neutral Buffered Formalin (VWR) for 24 hours at room temperature. Immunohistochemistry was performed on the Leica Bond III automated staining platform using the Leica Biosystems Refine Detection Kit (Leica DS9800). FFPE tissue sections were baked for 30 minutes at 60°C and deparaffinized (Leica AR9222) prior to staining. Primary antibodies were incubated for 30 minutes, visualized via DAB, and counterstained with hematoxylin (Leica DS9800). The slides were rehydrated in graded alcohol and cover slipped using the HistoCore Spectra CV mounting medium (Leica 3801733).
[0449] The following antibodies were used:
[0450] • Anti-mCherry (Abeam ab 167453, 1:600 with a 20M EDTA antigen retrieval (Leica ER2 AR9640)).
[0451] • Anti-GFP (Cell Signaling Technology 2956, clone D5.1, 1:50 with a 20M EDTA antigen retrieval (Leica ER2 AR9640)).
[0452] • Anti-APELIN (Abeam, ab125213, 1:100 with a 20M EDTA antigen retrieval (Leica ER2 AR9640)).
[0453] Immunofluorescence
[0454] Immunofluorescent staining was performed on the Leica Bond RX automated staining platform using the Leica Biosystems Refine Detection Kit (Leica DS9800). FFPE tissue sections were baked for 30 minutes at 60°C and deparaffinized (Leica AR9222) prior to staining. Following staining, slides were counterstained with DAPI (Nucblue; Invitrogen R37606) and cover slipped (Prolong Diamond; Invitrogen P36961), The following antibody was used: anti CD31 (CST, 3528, clone 89C2, 1:1600, antigen retrieval Leica ER1 AR9961 for 30min).
[0455] Live imaging of marrows
[0456] Zebrafish were euthanized according to IACUC guidelines and immediately dissected for marrow collection. Marrows were slowly collected in one piece and placed in a glass bottomAttorney Docket No: 11624-026WO1
[0457] 6-well plate. A drop of cold PBS was deposited above the tissue and a round coverslip was superposed to maintain the tissue in contact with the glass bottom. Live imaging microscopy was performed using a Yokogawa CSU-X1 spinning disk mounted on an inverted Nikon Eclipse Ti microscope equipped with dual Andor iXon EMCCD cameras and a motorized x-y stage to facilitate tiling and imaging of multiple specimens simultaneously. All images were acquired using NIS-Elements (Nikon) and processed using Imaris (Bitplane).
[0458] Statistics
[0459] Graphs and statistical analysis were generated with R Studio (Posit) and Prism (GraphPad Software, Inc.). Quantitative graphs provide the mean and standard deviation or the median, as indicated in the figure legends. Statistical tests used were 2way ANOVA or t-test and p-values are indicated in the figure legends.
[0460] Example 4. Study of apelin mutant leukemic zebrafish
[0461] To assess the effects of apelin loss of function in leukemic zebrafish, survival and clonal analyses were conducted.
[0462] Survival curve analyses of leukemic animals of three distinct genotypes, including apelin wildtype (aplnWT), apelin heterozygous (aplnHET), and apelin homozygous (apln11OM) show apelin knock-out significantly slows down leukemia (FIG. 14). All animals had disease present in the peripheral blood as determined by PCR for the human MYC oncogene.
[0463] In comparison to endothelial clone sizes of leukemic wild-type fish in a previous dataset (FIG. 15), the number of clones detected in purified endothelial clones from leukemic aplnWT, aplnHET, and aplnHOMmarrows show's that loss of apelin suppresses clonal expansion of endothelial cells (FIG. 16).
[0464] Similarly, and in comparison to progenitor clone sizes of leukemic wild-type fish in a previous dataset (FIG. 17), the number of clones detected in purified hematopoietic progenitors from leukemic aplnWT, ap / n™1, and aplnHUMmarrows shows that loss of apelin suppresses leukemic clonal expansion (FIG. 18).
[0465] In contrast, it was shown that loss of apelin allows for healthy lymphoid clone maintenance (FIG. 19) and healthy myeloid clone maintenance (FIG. 20) to provide maintenance of healthy hematopoiesis. scRNA-seq analysis of kdrl: GFP+ endothelial cells from healthy control versus leukemic aplnWT, aplnHET, and aplnHOMmarrows demonstrates that loss of apelin inhibits leukemia-induced angiogenic progenitor formation and expansion (FIG.
[0466] 21). The fraction of each endothelial cell subpopulation in healthy control versus leukemicAttorney Docket No: 11624-026WO1
[0467] aplnWT, aplnHET, and aplnHOMmarrows shows that loss of apelin inhibits leukemia-induced angiogenic progenitor expansion (FIG. 22).
[0468] Transcriptome analysis of the scRNA-seq of hematopoietic cells surprisingly demonstrated that loss of apelin inhibits reduces the amount of both proliferating and non proliferating leukemic cells (FIG. 23). As shown in FIG. 24, less proliferating leukemic cells and less leukemic cells were seen with increasing apelin loss of function, with the lowest frequencies of these cells seen in the aplnHOMmarrows.
[0469] Example 5. Treatment of leukemic zebrafish with an apelin receptor inhibitor
[0470] The efficacy of the apelin receptor inhibitor ML221 was next studied. Zebrafish were treated with 1 mM (n=10) or 3 mM (n=10) of ML221 versus DMSO control (n=10) and the fold change in the percent of leukemic cells in peripheral blood at days 14 and 21 of treatment was analyzed. ML221 treatment significantly reduces leukemic burden in a dose-dependent manner. (FIG. 25). A description qualitative change of the percent of leukemic cells in the peripheral blood of leukemic zebrafish also showed that ML221 treatment significantly reduces leukemic burden in a dose-dependent manner (FIG. 26).
[0471] Example 6. Analysis of human AML samples
[0472] APLN normalized RPKM from the BEAT AML study (McLeod et al, 2021; Fontenod et al. 2021) from healthy bone marrow mononucleated cells (n=19) and AML cells (n=440) demonstrate that human AMLs express a significantly higher level of APLN mRNA compared to healthy marrows (****, p<0.0001) (FIG. 27). A density plot of APLN normalized RPKM from the BEAT AML study from healthy bone marrow mononucleated cells (n=19) and AML cells (n=440) where AML samples were separated based on disease genotype demonstrates that inv(16) CBFB-MYH11 AML have the highest levels of apelin (FIG. 28). In agreement with this, three independent datasets confirm that inv(16) AMLs consistently express the highest levels of apelin (FIGs. 29A-29C).
[0473] Immunohistochemistry (IHC) of healthy and inv(16) AML marrow validates that AMLs have increased APELIN protein level compared to healthy controls (FIGs. 30, 31). Furthermore, IHC for APELIN and the apelin receptor APLNR of two inv(16) AML marrows demonstrates that the apelin receptor APLNR is expressed on endothelial cells in leukemic marrows (FIGs. 32, 33).
[0474] Example 7. Apelin receptor inhibition slows leukemia progression in vivoAttorney Docket No: 11624-026WO1
[0475] An animal was treated with 5 mM of Apelin receptor inhibitor ML221 for 21 days. Flow cytometry analyses of the animal showed disease burden of 3.07% in peripheral blood prior to treatment (FIG. 34), while there was no AML disease (0.01%) in marrow after treatment (FIG. 34).
[0476] This results demonstrate that 5mM treatment of ML221 surprisingly eliminated leukemia from the marrow of one animal.
Claims
Attorney Docket No: 11624-026WO1CLAIMSWhat is claimed is:
1. A method for treating a subject having a pre-cancerous hematopoietic disorder or a hematopoietic cancer, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
2. The method of claim 1, wherein the apelin inhibitor is selected from an antibody or a derivative thereof, an antibody-drug conjugate, a fusion protein, a small molecule, a dsRNA, an siRNA, an anti-sense technology, an aptamer, a gene editing technology, or a combination thereof.
3. The method of claim 1, the apelin inhibitor comprises an anti-apelin antibody or a derivative thereof.
4. The method of any one of claims 1-3, wherein the apelin receptor inhibitor is selected from ML221, MM54, APJ antagonist- 1, ALX 40-4C, ALX 40-4C Trifluoroacetate, (Alal3)- Apelin- 13 TEA, or (Alal3)-Apelin-13, or a pharmaceutically acceptable salt thereof.
5. The method of any one of claims 1-3, wherein the apelin receptor inhibitor is ML221, or a pharmaceutically acceptable salt thereof.
6. The method of any one of claims 1-5, wherein the pre-cancerous hematopoietic disorder is selected from clonal hematopoiesis, Early myelodysplastic syndrome (MDS), Monoclonal gammopathy of undetermined significance (MGUS), Immunoglobulin M Monoclonal Gammopathy of Undetermined Significance (IgM MGUS), Smoldering multiple myeloma (SMM), Smoldering Waldenstrom macroglobulinemia (SWM), Clonal cytopenia of undetermined significance (CCUS), Monoclonal B cell lymphocytosis (MBL), Lymphoid clonal hematopoiesis (Lymphoid-CH), or low-grade lymphoma.
7. The method of any one of claims 1 -5, wherein the pre-cancerous hematopoietic disorder comprises clonal hematopoiesis8. The method of claim 7, wherein the clonal hematopoiesis comprises Clonal hematopoiesis of indeterminate potential (CHIP).
9. The method of any one of claims 1-5, wherein the hematopoietic cancer comprises a lymphoma or a leukemia.
10. The method of any one of claims 1 -, wherein the hematopoietic cancer is selected from myelodysplastic syndrome (MDS), acute lymphocytic leukemia (ALL), acute myeloidAttorney Docket No: 11624-026WO1leukemia (AML), chronic myelocytic leukemia (CML), chronic neutrophilic leukemia (CNL), chronic lymphocytic leukemia (CLL), Hodgkin lymphoma (HL), non-Hodgkin lymphoma (NHL), diffuse large cell lymphoma (DLCL), follicular lymphoma, chronic lymphocytic leukemia / small lymphocytic lymphoma (CLL / SLL), mantle cell lymphoma (MCL), myelodysplastic syndrome (MDS), marginal zone B-cell lymphoma, mucosa-associated lymphoid tissue (MALT) lymphoma, nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma, primary mediastinal B-cell lymphoma, Burkitt lymphoma, lymphopiasmacytic lymphoma, hairy cell leukemia (HCL), immunoblastic large cell lymphoma, precursor B -lymphoblastic lymphoma and primary central nervous system (CNS) lymphoma, T-cell acute lymphoblastic leukemia (T-ALL), T-cell NHL, precursor T-lymphoblastic lymphoma / leukemia, peripheral T-cell lymphoma (PTCL), cutaneous T-cell lymphoma (CTCL), angioimmunoblastic T-cell lymphoma, extranodal natural killer T-cell lymphoma, enteropathy type T-cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, anaplastic large cell lymphoma, or a combination thereof.
11. A method for treating a subject having a leukemia, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
12. The method of claim 11, wherein the apelin inhibitor is selected from an antibody or a derivative thereof, an antibody-drug conjugate, a fusion protein, a small molecule, a dsRNA, an siRNA, an anti-sense technology, an aptamer, a gene editing technology, or a combination thereof.
13. The method of claim 11, the apelin inhibitor comprises an anti-apelin antibody or a derivative thereof.
14. The method of any one of claims 11-13, wherein the apelin receptor inhibitor is selected from ML221, MM54, APJ antagonist-1, ALX 40-4C, ALX 40-4C Trifluoroacetate, (Alal3)- Apelin- 13 TFA, or (Alar3)-Apelin-13, or a pharmaceutically acceptable salt thereof.
15. The method of any one of claims 11-1, wherein the apelin receptor inhibitor is ML221, or a pharmaceutically acceptable salt thereof.
16. The method of any one of claims 11-15, wherein the leukemia is selected from acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), chronic myelocytic leukemia (CML), T-cell acute lymphoblastic leukemia (T-ALL), or chronic lymphocytic leukemia (CLL).Attorney Docket No: 11624-026WO117. The method of any one of claims 11-15, wherein the leukemia comprises AML.
18. A method for treating a subject having acute myeloid leukemia (AML), comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
19. The method of claim 18, wherein the apelin inhibitor is selected from an antibody or a derivative thereof, an antibody-drug conjugate, a fusion protein, a small molecule, a dsRNA, an siRNA, an anti-sense technology, an aptamer, a gene editing technology, or a combination thereof.
20. The method of claim 18, the apelin inhibitor comprises an anti-apelin antibody or a derivative thereof.
21. The method of any one of claims 18-20, wherein the apelin receptor inhibitor is selected from ML221, MM54, APJ antagonist-1, ALX 40-4C, ALX 40-4C Trifluoroacetate, (Alal3)-Apelin-13 TFA, or (Alal3)-Apelin-13, or a pharmaceutically acceptable salt thereof.
22. The method of any one of claims 18-20, wherein the apelin receptor inhibitor is ML221, or a pharmaceutically acceptable salt thereof.
23. The method of any one of claims 17-22, wherein the AML is selected from acute erythroid leukemia, acute megakaryoblastic leukemia, acute monoblastic and monocytic leukemia, acute myeloid leukemia NOS, acute myelomonocytic leukemia, acute promyelocytic leukemia with t(15;17)(q22;q12)PML-RARA, AML with inv(16)(pl3.1q22) ort(16;16)(pl3.1;q22); QBFB-MYHll, AML with inv(3)(q21q26.2) or t(3;3)(q21;q26.2); RPNl -EVI1, AML with maturation, AML with minimal differentiation, AML with mutated CEBPA, AML with mutated NPM1, AML with myelodysplasia-related changes, AML with t(6;9)(p23;q34); DEK-NUP214, AML with t(8;21)(q22;q22); RUNX1-RUNX1T, AML with t(9;ll)(p22;q23); MLLT3-MLL, AML without maturation, atypical chronic myeloid leukemia BCR- AB, chronic myelomonocytic leukemia, essential thrombocythemia, mixed phenotype acute leukemia T / myeloid, unclassifiable myelodysplastic syndrome, myeloid leukemia associated with Down syndrome, myeloid sarcoma, refractory anemia with excess blasts, or therapy-related myeloid neoplasms.
24. The method of any one of claims 17-22, wherein the AML comprises inv(16) CBFB- MYH11 AML.
25. The method of any one of claims 17-22, wherein the AML comprises B-cell ALL.
26. The method of any one of claims 17-22, wherein the AML comprises T-cell AML.Attorney Docket No: 11624-026WO127. A method for reducing angiogenesis in a subject having a pre-cancerous hematopoietic disorder or a hematopoietic cancer, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
28. The method of claim 27, wherein the apelin inhibitor is selected from an antibody or a derivative thereof, an antibody-drug conjugate, a fusion protein, a small molecule, a dsRNA, an siRNA, an anti-sense technology, an aptamer, a gene editing technology, or a combination thereof.
29. The method of claim 27, the apelin inhibitor comprises an anti-apelin antibody or a derivative thereof.
30. The method of any one of claims 27-29, wherein the apelin receptor inhibitor is selected from ML221, MM54, APJ antagonist-1, ALX 40-4C, ALX 40-4C Trifluoroacetate, (Alal3)-Apelin-13 TFA, or (Alal3)-Apelin-13, or a pharmaceutically acceptable salt thereof.
31. The method of any one of claims 27 -29, wherein the apelin receptor inhibitor is ML221, or a pharmaceutically acceptable salt thereof.
32. A method for preventing or reducing niche endothelial clonality in a subject having a pre-cancerous hematopoietic disorder or a hematopoietic cancer, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
33. The method of claim 32, wherein the apelin inhibitor is selected from an antibody or a derivative thereof, an antibody-drug conjugate, a fusion protein, a small molecule, a dsRNA, an siRNA, an anti-sense technology, an aptamer, a gene editing technology, or a combination thereof.
34. The method of claim 32, the apelin inhibitor comprises an anti-apelin antibody or a derivative thereof.
35. The method of any one of claims 32-34, wherein the apelin receptor inhibitor is selected from ML221, MM54, APJ antagonist-1, ALX 40-4C, ALX 40-4C Trifluoroacetate, (Alai 3)- Apelin- 13 TFA, or (Alal3)-Apelin-13, or a pharmaceutically acceptable salt thereof.
36. The method of any one of claims 32-34, wherein the apelin receptor inhibitor is ML221, or a pharmaceutically acceptable salt thereof.Attorney Docket No: 11624-026WO137. A method for preventing or reducing leukemogenesis in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
38. The method of claim 37, wherein the apelin inhibitor is selected from an antibody or a derivative thereof, an antibody-drug conjugate, a fusion protein, a small molecule, a dsRNA, an siRNA, an anti-sense technology, an aptamer, a gene editing technology, or a combination thereof.
39. The method of claim 37, the apelin inhibitor comprises an anti-apelin antibody or a derivative thereof.
40. The method of any one of claims 37-39, wherein the apelin receptor inhibitor is selected from ML221, MM54, APJ antagonist- 1, ALX 40-4C, ALX 40-4C Trifluoroacetate, (Alal3)-Apelin-13 TFA, or (Alal3)-Apelin-13, or a pharmaceutically acceptable salt thereof.
41. The method of any one of claims 37-39, wherein the apelin receptor inhibitor is ML221, or a pharmaceutically acceptable salt thereof.
42. A method of treating a subject having a pre-cancerous hematopoietic disorder or a hematopoietic cancer, comprising:(i) isolating a sample from the subject(ii) measuring apelin and apelin receptor expression levels using transcriptomics and / or immunohistochemistry';(iii) measuring niche endothelial clonality in the subject sample relative to a control sample;(iv ) if apelin and / or apelin receptor is elevated and / or the niche endothelial clonality from the subject sample has expanded relative to the control sample, then administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
43. The method of claim 42, wherein the apelin inhibitor is selected from an antibody or a derivative thereof, an antibody-drug conjugate, a fusion protein, a small molecule, a dsRNA, an siRNA, an anti-sense technology, an aptamer, a gene editing technology, or a combination thereof.
44. The method of claim 42, the apelin inhibitor comprises an anti-apelin antibody or a derivative thereof.
45. The method of any one of claims 42-44, wherein the apelin receptor inhibitor is selected from ML221, MM54, APJ antagonist- 1, ALX 40-4C, ALX 40-4C Trifluoroacetate,Attorney Docket No: 11624-026WO1(Alal3)-Apelin-13 TFA, or (Alal3)-Apelin-13, or a pharmaceutically acceptable salt thereof.
46. The method of any one of claims 42-44, wherein the apelin receptor inhibitor is ML221, or a pharmaceutically acceptable salt thereof.
47. The method of any one of claims 42-44, wherein the sample is selected from blood, plasma, serum, urine, sputum, spinal fluid, cerebrospinal fluid, pleural fluid, nipple aspirate, lymph fluid, respiratory tract fluid, intestinal tract fluid, genitourinary tract fluid, tear fluid, saliva, breast milk, lymphatic system fluid, semen, ascitic fluid, tumor cyst fluid, amniotic fluid, tissue, biopsy, or a combination thereof.
48. A method for preventing, reducing, suppressing, or inhibiting clonal expansion of endothelial cells and leukemic cells in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
49. A method for increasing, promoting, or initiating healthy hematopoiesis in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
50. The method of claim 49, wherein healthy hematopoiesis comprises lymphoid and myeloid clone maintenance.
51. The method of claim 49 or 50, wherein healthy hematopoiesis comprises reducing, suppressing, or inhibiting proliferating and non-proliferating leukemic cells.
52. A method for preventing, reducing, suppressing, or inhibiting leukemia-induced angiogenic progenitor formation and expansion in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an apelin inhibitor, an apelin receptor inhibitor, or a combination thereof.
53. The method of any one of claims 48-52, wherein the apelin inhibitor is selected from an antibody or a derivative thereof, an antibody-drug conjugate, a fusion protein, a small molecule, a dsRNA, an siRNA, an anti-sense technology, an aptamer, a gene editing technology, or a combination thereof.
54. The method of any one of claims 48-52, the apelin inhibitor comprises an anti-apelin antibody or a derivative thereof.
55. The method of any one of claims 48-54, wherein the apelin receptor inhibitor is selected from ML221, MM54, APJ antagonist- 1, ALX 40-4C, ALX 40-4C Trifluoroacetate, (Alal3)-Apelin-13 TFA, or (Alal3)-Apelin-13, or a pharmaceutically acceptable salt thereof.Attorney Docket No: 11624-026WO156. The method of any one of claims 48-54, wherein the apelin receptor inhibitor is ML221, or a pharmaceutically acceptable salt thereof.
57. The method of claims 1-56, further comprising administering to the subject a therapeutically effective amount of an additional therapeutic agent selected from a chemotherapy, an immunotherapy, a tyrosine kinase inhibitor (TKI), IDH inhibitor, an FLT3 inhibitor, a hypomethylating agent, a stem cell therapy, a radiation therapy, or a combination thereof.
58. The method of claims 1-57, wherein the subject is an adult.
59. The method of claims 1 -57, wherein the subject is a child.
60. The method of claims 1-59, wherein the subject is a human.