Methods and compositions for super-resolution polysome imaging

Abstract

The present disclosure provides methods and systems for the super-resolution (SR) imaging of polysomes in a single cell. Also provided by the present disclosure are methods for diagnosing a disease or disorder in a subject based on a polysome structure profile in a cell, including cells within an intact tissue. Methods of screening for or testing a candidate agent capable of modulating polysome structure are also provided by the present disclosure. The present disclosure also provides methods for treating a disease or disorder in a subject in need thereof. Sets of probes comprising oligonucleotide portions, which may be useful for performing the methods described herein, are also described by the present disclosure. The present disclosure further provides non-naturally-occurring assembled ribosome complexes comprising ribosome subunits and oligonucleotide probes. Additionally, the present disclosure provides kits comprising any of the probes described herein.

Description

Atty. Docket No. 114203-1577METHODS AND COMPOSITIONS FOR SUPER-RESOLUTION POLYSOME IMAGINGCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Patent Application No. 63 / 761,281, filed February 21, 2025, and U.S. Provisional Patent Application No. 63 / 801,336, filed May 7, 2025, the entire contents of each of which are incorporated herein by reference in their entireties.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under Grant No. 1DP2GM146245-01 awarded by the National Institutes of Health. The government has certain rights in the invention.BACKGROUND

[0003] A single mRNA molecule can be bound by multiple ribosomes, simultaneously producing several polypeptide chains. This structure, known as a polysome, can form intricate shapes such as helices within cells and has been implicated in various diseases. Despite its significance in translation — a key step in the central dogma — and disease, polysomes remain understudied. This knowledge gap stems from the lack of technologies that can (1) visualize polysomes with 1-10 nm resolution and (2) simultaneously sequence ribosome-bound mRNA. Accordingly, additional and better systems for accurately visualizing polysome and RNA structure in a single cell are needed.SUMMARY

[0004] Methods, compositions, kits, and systems for super-resolution (SR) polysome imaging are described herein. Such systems represent a crucial technology to understand the relationship between polysome structure and RNA sequence by quantifying / profiling simultaneously polysome structure as a function of RNA sequence a single cell using SR imaging. The present system utilizes agents that recognize a fully-assembled ribosome conjugated to an oligonucleotide probe that recognizes the sequences of corresponding probes annealed to RNA molecules that are bound by ribosomes. These agents can be combined with further agents that directly bind to and report mRNA location and structure in a single cell.14901-5932-3024.1Atty. Docket No. 114203-1577

[0005] In one aspect, the present disclosure provides a method for super-resolution (SR) imaging of a polysome in a cell, the method comprising: (a) contacting the cell with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe; and (c) imaging the cell, thereby imaging a polysome in the cell.

[0006] In one aspect, the present disclosure provides a method for super-resolution (SR) imaging of a polysome comprising a ribosome and an RNA in a cell, the method comprising: (a) contacting the cell with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest; (c) contacting the imaging probe docking site 24901-5932-3024.1Atty. Docket No. 114203-1577region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell; (e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and (f) imaging the cell, thereby imaging RNA in the cell.

[0007] In one aspect, the present disclosure provides a method for diagnosing a disease or disorder in a subject, the method comprising: (a) contacting a cell obtained from a subject with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest; (c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the 34901-5932-3024.1Atty. Docket No. 114203-1577first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell; (e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and (f) imaging the cell, thereby imaging RNA in the cell, wherein a difference in the polysome structure in the cell relative to one or more non-diseased cells indicates that the subject has the disease or disorder.

[0008] In one aspect, the present disclosure provides a method for screening for an agent capable of modulating polysome structure, the method comprising: (a) contacting a cell that is being treated with or has been treated with a candidate agent with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest; (c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the 44901-5932-3024.1Atty. Docket No. 114203-1577imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell; (e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and (f) imaging the cell, thereby imaging RNA in the cell, wherein a difference in the polysome structure in the presence of the candidate agent relative to in the absence of the candidate agent indicates that the candidate agent modulates polysome structure.

[0009] In one aspect, the present disclosure provides a method for treating a disease or disorder in a subject comprising the steps of: (a) contacting a cell that is being treated with or has been treated with a candidate agent with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest; (c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell,54901-5932-3024.1Atty. Docket No. 114203-1577thereby imaging a ribosome in the cell; (e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; (f) imaging the cell, thereby imaging RNA in the cell; and (g) administering a treatment for the disease or disorder to the subject if a difference in the polysome structure in the cell relative to one or more non-diseased cells is observed.

[0010] In one aspect, the present disclosure provides a method for super-resolution (SR) imaging of a polysome in a cell, the method comprising: (a) contacting the cell with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe; and (c) imaging the cell, thereby imaging a polysome in the cell.

[0011] In one aspect, the present disclosure provides a method for super-resolution (SR) imaging of a polysome comprising a ribosome and an RNA in a cell, the method comprising: (a) contacting the cell with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second 64901-5932-3024.1Atty. Docket No. 114203-1577probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest; (c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell; (e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and (f) imaging the cell, thereby imaging RNA in the cell.

[0012] In one aspect, the present disclosure provides a method diagnosing a disease or disorder in a subject, the method comprising: (a) contacting cell obtained from a subject with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an74901-5932-3024.1Atty. Docket No. 114203-1577imaging probe docking site region; (b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest; (c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell; (e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and (f) imaging the cell, thereby imaging RNA in the cell, wherein a difference in the polysome structure in the cell relative to one or more non-diseased cells indicates that the subject has the disease or disorder.

[0013] In one aspect, the present disclosure provides a method for screening for an agent capable of modulating polysome structure, the method comprising: (a) contacting a cell that is being treated with or has been treated with a candidate agent with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the cell with one or more sets of RNA 84901-5932-3024.1Atty. Docket No. 114203-1577target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest; (c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell; (e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and (f) imaging the cell, thereby imaging RNA in the cell, wherein a difference in the polysome structure in the presence of the candidate agent relative to in the absence of the candidate agent indicates that the candidate agent modulates polysome structure.

[0014] In one aspect, the present disclosure provides a method for treating a disease or disorder in a subject, the method comprising: (a) contacting a cell that is being treated with or has been treated with a candidate agent with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe 94901-5932-3024.1Atty. Docket No. 114203-1577docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest; (c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell; (e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; (f) imaging the cell, thereby imaging RNA in the cell; and (g) administering a treatment for the disease or disorder to the subject if a difference in the polysome structure in the cell relative to one or more non-diseased cells is observed.

[0015] In one aspect, the present disclosure provides a set of probes comprising a first probe, a second probe, and a third probe, wherein: (a) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (b) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (c) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region.

[0016] In one aspect, the present disclosure provides a set of probes comprising a first probe, a second probe, and a third probe, wherein: (a) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (b) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (c) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first 104901-5932-3024.1Atty. Docket No. 114203-1577probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region.

[0017] In one aspect, the present disclosure provides an assembled ribosome complex comprising: (a) a first oligonucleotide probe, a second oligonucleotide probe, and a third oligonucleotide probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) a 40S subunit of a ribosome; and (c) a 60S subunit of a ribosome.

[0018] In one aspect, the present disclosure provides an assembled ribosome complex comprising: (a) a first oligonucleotide probe, a second oligonucleotide probe, and a third oligonucleotide probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; and (b) a first subunit of a ribosome; and (c) a second subunit of a ribosome.

[0019] In one aspect, the present disclosure provides a kit comprising any one or more of the probes described above.

[0020] Any of the probes ( / .< ., sets of probes) described herein may be used in the methods, composition, systems, and kits contemplated by the present disclosure.

[0021] It should be appreciated that the foregoing concepts, and additional concepts discussed below, may be arranged in any suitable combination, as the present disclosure is not limited in this respect. Further, other advantages and novel features of the present disclosure will become apparent from the following detailed description of various nonlimiting embodiments when considered in conjunction with the accompanying figures.114901-5932-3024.1Atty. Docket No. 114203-1577BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0023] FIG. 1 is a schematic illustrating an overview of the super-resolution imaging approaches described herein. Previous methods were capable of imaging ribosomes and polysome structures with high-resolution EM or visualizing RNA position and sequence using spatial omics. However, no current technique integrates both capabilities simultaneously. Applicant’s platform leverages multiplexed super-resolution microscopy to visualize polysome structures while simultaneously identifying ribosome-bound mRNA sequences.

[0024] FIGs. 2A-2D show a schematic and panel of images illustrating SR imaging of polysome by targeting individual ribosome subunits. FIG. 2A is a schematic of a polysome, where multiple ribosomes — each composed of a large (60S) and small (40S) subunit — are bound to a mRNA molecule. Each subunit contains a specific rRNA sequence (18S rRNA in 40S, 28S rRNA in 60S, highlighted in red). As ribosomes progress through translation, polypeptide chain lengths vary. FIG. 2B is a schematic showing the individual ribosome subunit labeling strategy. The 18S and 28S rRNAs are targeted by specific probes (black oligos), each carrying an orthogonal DNA-PAINT docking site (inset). The principles of multiplexed DNA-PAINT imaging are highlighted in the inset. In round 1, an imaging probe (II) transiently binds to the 28S probe, enabling 60S visualization. After washing and strand exchange, a new imaging probe (12), conjugated to the same dye as II, binds to the 18S probe, allowing 40S imaging. This sequential imaging approach, known as Exchange-PAINT, has been described elsewhere (Jungmann et al., 2014) and enables highly multiplexed imaging compared to other super-resolution methods. FIG.2C is an image showing a single frame of 18S blinking data, with the inset showing clearly resolved single molecules. FIG. 2D is a super-resolution reconstruction of one-color 18S and 28S DNA-PAINT experiments. White arrow insets highlight spherical and worm-like structures, reminiscent of polysomes observed in EM studies (Baymukhametov et al., 2023).

[0025] FIG. 3 is a schematic showing a workflow for 80S DNA-PAINT labeling. The 80S complex is hybridized with 28S and 18S arms that target their respective ribosomal subunits. An 80S linker binds both arms via linker docking sites, and subsequent ligation enhances stability. The 80S linker carries a DNA-PAINT docking site at its 3' end, enabling super- 124901-5932-3024.1Atty. Docket No. 114203-1577resolution imaging (inset). Harsh washing steps before hybridization and after ligation remove partial hybridization signals. In contrast to the two-round imaging scheme in Figure 2, this approach allows for single-round imaging of the 80S complex. 5’P refers to 5’ phosphate.

[0026] FIG. 4 is a panel of microscopy images showing a comparison of complete and partial hybridization in 80S DNA-PAINT labeling. Super-resolution images show a strong 80S signal in the complete hybridization case, whereas partial hybridization results in significantly weaker signals. For these results, Applicant used the 9-11 80S linker where 9 nucleotides bind to the 18S arm and 11 nucleotides bind to the 28S arm. Contrast and scale bars are consistent across all images for direct comparison.

[0027] FIGs. 5A-5B are a panel of images and quantitative experimental data showing the effect of translation inhibitors on 80S DNA-PAINT imaging. FIG. 5A is a panel of images showing super-resolution images of untreated cells versus drug-treated cells. Cells were treated with either (1) 4ElRCat and puromycin or (2) Harringtonine, both known translation inhibitors (Burke et al., 2017; Sun et al., 2021). Drug-treated cells show a reduced 80S signal compared to untreated cells. A 10-10 linker was used, where the 80S linker binds 10 nucleotides on both the 18S and 28S arms. Contrast and scale bars are consistent across images. FIG. 5B is a graph showing a quantification of translational inhibitor effects.Cytoplasmic localization density was measured across conditions. 10 cells per condition were imaged over 500 frames and cytoplasmic localization density was quantified. 500 frames is not enough to reconstruct a SR image, but these relatively few frames help improve statistical power and throughput. Each individual dot represents an individual cell, while the black dot / error bar in each group indicates the mean ± standard error of the mean (SEM). Drug-treated samples show a statistically significant decrease in localization density compared to untreated cells, confirming the specificity of the present 80S labeling approach. The 9-11 80S linker was used in the quantification for FIG. 5B. Statistical significance was determined using an independent t-test (***p < 0.001).

[0028] FIGs. 6A-6E are a set of schematics showing alternative hybridization schemes for the 80S linker probe. FIG. 6A is a schematic showing complete and partial hybridization schemes. The 18S and 28S arms contain a linker docking site, similar to the design in FIG. 3.Here, the DNA-PAINT 80S linker binds to 11 nucleotides on each arm. To minimize partial hybridization, Applicant introduced eraser strands, which bind to 12 nucleotides on each arm and compete with the 80S linker. When complete hybridization occurs, the complex is stable, preventing 80S linker displacement by the eraser strand. However, in cases of partial134901-5932-3024.1Atty. Docket No. 114203-1577hybridization, the eraser displaces the 80S linker. FIG. 6B is a schematic showing a scheme in which the 18S and 28S arms contain a self-complementary region of 6-9 nucleotides, stabilizing their interaction and facilitating 80S linker binding. FIG. 6C is a schematic showing a scheme similar to that of FIG. 6B, but instead of a self-complementary region, the 18S and 28S arms are stabilized by an additional proximity probe. FIG. 6D is a schematic showing a scheme in which the 18S and 28S arms are self-complementary, as in FIG. 6B, but without an 80S linker. Instead, each arm contains 4-5 nucleotides complementary to the DNA-PAINT imaging probe itself. FIG. 6E is a schematic showing a scheme in which the 18S and 28S arms are first hybridized, followed by washing steps. The probes are then ligated with the 80S linker included in the ligation buffer.

[0029] FIGs. 7A-7B show a schematic and a panel of images demonstrating SR imaging of mRNA directly. FIG. 7A is a schematic of DNA-PAINT mRNA probes. The target mRNA is labeled with complementary probes designed to maximize coverage. Each probe includes a DNA-PAINT docking site at the 3' end (inset). FIG. 7B (Left) is a super-resolution image of NIH 3T3 cells transfected with Firefly Luciferase RNA. Cells were labeled with DNA-PAINT mRNA probes, revealing discrete and bright RNA puncta (inset). FIG. 7B (Right) is a super-resolution image of a control cell without RNA transfection but hybridized with probes, showing minimal signal, demonstrating the specificity of the present approach. Scale bars and contrast are consistent across images.

[0030] FIGs. 8A-8H are schematics, images, and quantitative data illustrating DNA-PAINT combined with expansion microscopy. FIG. 8A is a schematic showing the gelfunctionalization of the 80S ribosome labelling scheme by adding chemical functional groups to the 5’ and 3’ end of the linker probe. Following hybridization, samples are incubated with methyl-acrylate NHS ester (MA-NHS), which converts the linker probe’s amine group into an additional acryl group. These acryl groups enable covalent incorporation of the adapter into the hydrogel network. FIG. 8B is a representative super-resolved cell image obtained using DNA-PAINT in a hydrogel. The data in this image arose from an experiment in which the 28 S single-subunit labelling scheme, as in FIG. 2, with no acryl modification, was utilized. FIG. 8C is a graph showing the quantification, in a hydrogel, of a first DNA PAINT signal, an extinguishing of the first DNA-PAINT signal, and a return of the signal, accomplished by buffer exchange. The data in the image arose from an experiment in which the modifier linker probe for the 80S labelling scheme, as in FIG. 8A, was used. FIG. 8D is a schematic illustrating expansion microscopy. FIG. 8E is a representative image of the cytosol of a cell within a 3x-expanded hydrogel. FIG. 8F is an image corresponding to the contents 144901-5932-3024.1Atty. Docket No. 114203-1577of the top inset of FIG. 8E. Circular polysome structures are shown. FIG. 8G is an image corresponding to the contents of the bottom inset of FIG. 8E. Linear polysome structures are shown. FIG. 8H is a representative line-scan quantification of a single imaged spot. The spot has a length scale of 20 nm, approximately the size of a ribosome. Length scales for FIGs.8E-8H account for 3x expansion.

[0031] FIGs. 9A-9B are schematics and images illustrating successful hydrogel mRNA DNA-PAINT imaging. FIG. 9A is a schematic showing a specific mRNA (i.e., the bottom strand) hybridized with Applicant’s DNA-PAINT probes (denoted in a quasi U-shape). A universal expansion adapter probe (short, segment with functional groups on ends), complementary to the 5' flanking linker on the probes, binds and is subsequently photocrosslinked. This expansion adapter probe is functionalized with both an acryl and an amine group. Photocrosslinking occurs between the CNVK moiety on the adapter and a pyrimidine base — specifically a thymine — in the linker sequence. The covalent linkage formed between CNVK and thymine is illustrated in the inset. Following photocrosslinking, samples are incubated with methyl-acrylate NHS ester (MA-NHS), which converts the adapter’s amine group into an additional acryl group. These acryl groups enable covalent incorporation of the adapter into the hydrogel network. Finally, the 3' end of each mRNA DNA-PAINT probe contains a docking site, facilitating DNA-PAINT imaging. FIG. 9B is a panel of representative DNA-PAINT super-resolution (SR) images obtained using scalable mRNA DNA-PAINT probes. Applicant transfected HeLa cells with exogenous Firefly luciferase mRNA and hybridized approximately 15 probes along its coding region. Left panel: Cells were embedded in a hydrogel, and imaging was performed one day after sample preparation. Strong mRNA signals were clearly visible. Middle panel: The same sample was stored for a total of 11 days — 5-6 days at room temperature and the remaining days at 4 °C. Imaging under the same conditions as Day 1 revealed persistent high mRNA signal, demonstrating the long-term stability of Applicant’s probes and embedding strategy. Insets display magnified views of individual mRNA molecules. Right panel: A control cell that was not transfected with Firefly luciferase mRNA. The signal is minimal compared to labeled samples, confirming probe specificity. All images were acquired using the same DNA-PAINT imaging strand and identical imaging settings. Contrast and scale are consistent across all panels. The scale bar in the main images represents 5 pm; insets represent 500 nm.

[0032] FIGs. 10A-10C are schematics showing multiplexed mRNA imaging strategies described herein. FIG. 10A is a schematic depicting two distinct mRNA species, with one being bound by a ribosome. Each mRNA molecule is divided into five sequential groups,154901-5932-3024.1Atty. Docket No. 114203-1577spanning from the 5' to 3' end (left to right in all illustrations). A unique spatial barcode is assigned to each group to enable transcript-specific identification. The pseudo-colors assigned to each group correspond to DNA-PAINT sequences R1 through R6, following the nomenclature of Strauss & Jungmann (2020). Once the spatial barcodes are assigned, the sample is hybridized with probes, embedded in a hydrogel, expanded, and then imaged through sequential rounds of DNA-PAINT. In the first imaging round, the 5' end of all mRNA species is labeled with the same pseudo-color (red), serving as a reference. In subsequent rounds, different groups along the mRNA are labeled with pseudo-colors in positions specific to each mRNA’s unique barcode — for example, the second group in the top mRNA and the fourth group in the bottom mRNA. The final imaging round (Round 6) targets the 80S ribosomal complex to assess ribosome-bound mRNAs. After imaging, the spatial barcode for each mRNA is decoded to identify the corresponding gene. Gene identities are denoted by the spatial barcode ordering shown in parentheses beneath each gene label. With this design, a total of 24 unique genes can be distinguished. The positions of bound 80S ribosomes can also be determined. FIG. 10B is a schematic showing a comparison of pseudocolor capacity between Design 1 and Design 2. In Design 1, each pseudo-color corresponds to a single DNA-PAINT sequence, selected from a set of five distinct sequences. In contrast, Design 2 defines each pseudo-color as a unique combination of two DNA-PAINT sequences. This combinatorial strategy effectively expands the total number of pseudo-colors to ten, enabling greater multiplexing capacity. FIG. 10C is a schematic illustrating Design 2 applied to RNA segmented into three groups. As in Panel A, the inset depicts two distinct mRNA species. Each mRNA is divided into three segments or "groups," with each group assigned a pseudo-color. In this design, pseudo-colors are defined by unique combinations of two DNA-PAINT sequences, increasing multiplexing capacity. During each round of imaging, one of six possible DNA-PAINT imaging strands is introduced. Each strand samples one or more designated positions along the mRNA or targets the 80S ribosomal complex. After imaging, the data are decoded to determine which imaging strands bound to each group, thereby identifying the corresponding pseudo-colors and reconstructing the spatial barcode. This spatial barcode is then used to identify the mRNA species. With this scheme, a multiplexing capacity of up to 72 unique mRNA targets can be achieved.

[0033] FIGs. 11A-11D are visualizations and quantitative analyses of 80S ribosome organization obtained by 3D MINFLUX imaging. FIG. 11A is a 2D projection of the 3D 80S MINFLUX dataset. The cyan box highlights an inset containing polysomal structures, which are indicated by white arrows. FIG. 1 IB is a plot showing the distribution of the number of 164901-5932-3024.1Atty. Docket No. 114203-1577labels imaged per individual ribosome, providing a measure of labeling density and detection efficiency. FIG. 11C is a plot showing the distribution of ribosome radii calculated from detected localization clusters. Clusters exceeding a predefined threshold radius (red line, 19.13 nm) were excluded from further analysis. FIG. 1 ID is a plot showing the distribution of ribosome stoichiometry for each detected polysome, revealing the number of ribosomes associated within individual polysomal assemblies.

[0034] FIGs. 12A-12D are schematics and images illustrating 3D polysome topologies and multicolor MINFLUX imaging of ribosomes and mRNA. FIG. 12A shows semi-circular polysome topologies, and FIG. 12B shows spiral-shaped polysome topologies; in both panels, dots indicate the centers of individual ribosomes, and the color bar encodes the Z position to depict 3D organization. FIG. 12C is a two-color MINFLUX image of Firefly luciferase mRNA (blurred, irregularly shaped background) and 80S ribosomes (spheres). Four distinct ribosome clusters are visible, overlapping spatially with the Firefly luciferase signal, indicating ribosome association with the mRNA. FIG. 12D is a three-color MINFLUX image resolving mRNA polarity and ribosome association. The Firefly luciferase signal (blurred, irregularly shaped background) is partitioned into two channels to indicate polarity: the 3' end (left of the dotted white line) and the 5' end (right of the dotted white line), shown together with 80S labels (solid spheres). These images demonstrate the directionality of the mRNA in close proximity to the ribosomes. All images in FIG. 12 represent different orientations in 3D space, as indicated by the coordinate axes in the bottom right. Scale bars are 50 nm in all images.

[0035] FIGs. 13A-13B are schematics and images depicting a 55S DNA-PAINT imaging and labeling strategy. FIG. 13A is a schematic illustrating the DNA-PAINT labeling approach for 55 S ribosomes, in which probes may be embedded within a hydrogel and do not strictly require a ligation step between the two rRNA arms, thereby simplifying sample preparation while maintaining specific labeling. FIG. 13B shows DNA-PAINT imaging of 55S ribosomes. The top-left overview image displays a robust 55S signal, while the inset reveals tubular structures characteristic of mitochondrial morphology. The panels on the right are control experiments performed under partial hybridization conditions, in which minimal signal is observed; notably, these control images were acquired without ligation or hydrogel embedding. Contrast is identical across all panels to enable direct comparison, and while the inset scale bar represents 1 pm, all other overview images share a common scale.

[0036] FIGs. 14A-14B are 3D MINFLUX visualizations of 55S ribosomes and 55S polysomes. FIG. 14A is a 2D projection of a 3D 55S MINFLUX dataset; the inset reveals a 174901-5932-3024.1Atty. Docket No. 114203-1577spherical structure enclosed with tubular-like structures, which are reminiscent of electron microscopy (EM) images of mitochondria. FIG. 14B shows 55S polysomes, in which a helical structure is clearly visible. Color encodes the Z position, and points indicate the centers of individual ribosomes, revealing the 3D arrangement of the polysome. The images represent different orientations in 3D space, as denoted by the X,Y,Z orientation axis in the bottom right. The scale bar is 50 nm.

[0037] FIGs. 15A-15C illustrate DNA-PAINT imaging, expansion, and reversible signal control in 80S-labeled HeLa cells. FIG. 15A is an image showing the DNA-PAINT signal in a single frame of an 80S-labeled HeLa cell, with a scale bar of 5 pm. FIG. 15B is an image showing the result of summing the DNA-PAINT signals over 1000 frames, which enables clear outlining of the nucleus and cytoplasm of the cell; in this experiment the sample is approximately 1.5x expanded. The scale in FIG. 15B is the same as in FIG. 15A. FIG. 15C is a graph depicting reversible control of the DNA-PAINT signal by buffer exchange. The DNA-PAINT signal is first generated, then extinguished, and subsequently restored by changing the buffer conditions. The number of single-molecule localizations is quantified under each condition and normalized to the area of the cytoplasm. Data are shown for 10 cells per condition. The data in FIG. 15C use the 80S 5' acrydite and 3' amine probe as described in the original IP document. Error bars indicate the standard error of the mean, p-value brackets show the result of Welch’s t-test between the indicated conditions, with “ns” denoting not significant and “***” indicating p-value < 0.001.

[0038] FIG. 16 is a panel of images showing 80S DNA-PAINT imaging in coronal mouse brain slices under different tissue preparation conditions. The left panel shows an uncleared tissue section exhibiting strong 80S signal, demonstrating that the labeling and imaging strategy is compatible with intact brain tissue. The middle panel shows a cleared tissue section in which strong 80S signal is preserved, indicating that the clearing process does not abolish detectable 80S labeling. The right panel is a negative control processed without 80S probes, in which no signal is observed, confirming the specificity of the labeling. Insets in each panel depict nanoscale structures resolved by DNA-PAINT. Scale bars and contrast settings are consistent across all overview images and, respectively, across all inset images to allow direct qualitative comparison.DETAILED DESCRIPTION

[0039] Ribosomes are critical cellular machines that scan and decode the information encoded in mRNA molecules to produce specific proteins (Lafontaine & Tollervey, 2001;184901-5932-3024.1Atty. Docket No. 114203-1577Steitz, 2008). This process, known as translation (Jackson et al., 2010), is a fundamental step of the central dogma (Crick, 1970), and it has been extensively studied over the past decades. While models often depict a single ribosome translating an individual mRNA, this may not be the case in biological systems. Instead, multiple ribosomes frequently translate a single mRNA molecule simultaneously, producing multiple polypeptide chains at once (Munro et al., 1964). These assemblies, known as "polyribosomes" or "polysomes" (Munro et al., 1964), may form intricate structures, such as spirals and helices (Brandt et al., 2009; de Petris, 1970), in organisms. Polysomes may play a role in regulating translation itself (Xue et al., 2022) and have been implicated in diseases such as Alzheimer’s (Langstrom et al., 1989) and Huntington’s (Eshraghi et al., 2021; Martin-Solana et al., 2024). Several studies have also revealed that polysomal distributions are spatially regulated within neurons (Biever et al., 2020) and are closely linked to RNA condensate and stress granule formation (Balagopal & Parker, 2009; Chantarachot & Bailey-Serres, 2018).

[0040] Despite their critical role in translation, studying polysome-mRNA structure sequence relationships is challenging, primarily due to limitations in visualizing them with high multiplexity. While electron microscopy (EM) provides the spatial resolution necessary (1-10 nm) to visualize ribosomes and polysomes in cells (Baymukhametov et al., 2023; Mahamid et al., 2016), RNA molecules cannot be directly observed with EM as they lack sufficient electron density (Ma et al., 2022) (FIG. 1, left inset). Furthermore, specific labeling of mRNA sequences for visualization is both perturbative and technically demanding (Rouquette et al., 2009). Without detailed mRNA information, direct correlations between polysome structure and RNA sequence remain elusive. Conversely, spatial omics approaches achieve high multiplexity and are able to visualize thousands of distinct biomolecules with subcellular resolution (Bressan et al., 2023; Kiessling & Kuppe, 2024; Rouquette et al., 2009). In particular, Applicant has previously developed RIBOmap, a spatial translatomics method that can simultaneously visualize thousands of ribosome-bound mRNA with subcellular resolution, which provides deep fundamental insights into translation (Zeng et al., 2023). While many of these spatial omics methods capture sequence and spatial positions with high multiplexity, they rely on conventional fluorescence microscopy, which is constrained by the optical diffraction limit (Abbe, 1873). Consequently, their spatial resolution of approximately 300 nm is an order of magnitude too coarse to resolve individual polysomes, leaving polysomal structural information inaccessible in these approaches (FIG.1, middle inset).194901-5932-3024.1Atty. Docket No. 114203-1577

[0041] As no technology currently exists that can simultaneously study polysome structure and mRNA sequence, many fundamental questions about polysomes remain unanswered. For example, how does the mRNA sequence influence polysomal structures? How do polysomes modulate their function? How are polysomal structural distributions regulated in cell location? What factors lead to polysome dysfunction, and how does this contribute to disease? To address these questions, Applicant developed a novel platform, super-resolution RIBOmap (SR-RIBOmap), designed to directly probe polysomes with high mRNA multiplexity (FIG. 1, right inset). This technology employs super-resolution (SR) microscopy probes specifically engineered to target the 80S ribosome and mRNA genes of interest. By leveraging multiplexed single-molecule localization imaging approaches with spatial resolutions of 1-10 nm, SR-RIBOmap enables the direct visualization of polysomal structural and sequence.Definitions

[0042] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton el aL, Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them unless specified otherwise.

[0043] The terms “administer,” “administering,” and “administration” refer to implanting, absorbing, ingesting, injecting, inhaling, or otherwise introducing a treatment or therapeutic agent, or a composition of treatments or therapeutic agents, in or on a subject.

[0044] The term “amplicon” as used herein refers to a nucleic acid (e.g., RNA) that is the product of an amplification reaction ( / .< ., the production of one or more copies of a genetic fragment or target sequence) or replication reaction. Amplicons can be formed artificially using, for example, PCR or other polymerization reactions. The term “concatenated amplicons” refers to multiple amplicons that are joined together to form a single nucleic acid molecule. Concatenated amplicons can be formed, for example, by rolling circle amplification (RCA), in which a circular oligonucleotide is amplified to produce multiple linear copies of the oligonucleotide as a single nucleic acid molecule comprising multiple amplicons that are concatenated.204901-5932-3024.1Atty. Docket No. 114203-1577

[0045] An “antibody” refers to a glycoprotein belonging to the immunoglobulin superfamily. The terms antibody and immunoglobulin are used interchangeably. With some exceptions, mammalian antibodies are typically made of basic structural units each with two large heavy chains and two small light chains. There are several different types of antibody heavy chains, and several different kinds of antibodies, which are grouped together into different isotypes based on which heavy chain they possess. Five different antibody isotypes are known in mammals (IgG, IgA, IgE, IgD, and IgM, which perform different roles, and help direct the appropriate immune response for each different type of foreign object they encounter. The term “antibody” as used herein also encompasses antibody fragments and nanobodies, as well as variants of antibodies and variants of antibody fragments and nanobodies. In some embodiments, an antibody is administered as a treatment for a disease or disorder (e.g., one that is associated with a change in polysome structure in a cell taken from a subject). In some embodiments, an antibody is conjugated to an oligonucleotide probe as described herein. In certain embodiments, the antibody binds to a ribosome (e.g., the antibody is an anti-40S ribosomal protein S3 (RPS3) antibody or an anti-60S ribosomal protein L4 (RPL4) antibody).

[0046] The term “cancer” (including cancers that may be studied, characterized, diagnosed, and / or treated using the methods described herein) refers to a class of diseases characterized by the development of abnormal cells that proliferate uncontrollably and have the ability to infiltrate and destroy normal body tissues. See e.g., Stedman ’s Medical Dictionary, 25th ed.; Hensyl ed.; Williams & Wilkins: Philadelphia, 1990. Cancer is one example of a proliferative disease. Exemplary cancers include, but are not limited to, acoustic neuroma; adenocarcinoma; adrenal gland cancer; anal cancer; angiosarcoma (e.g, lymphangiosarcoma, lymphangioendotheliosarcoma, hemangiosarcoma); appendix cancer; benign monoclonal gammopathy; biliary cancer (e.g, cholangiocarcinoma); bladder cancer; breast cancer (e.g., adenocarcinoma of the breast, papillary carcinoma of the breast, mammary cancer, medullary carcinoma of the breast); brain cancer (e.g., meningioma, glioblastomas, glioma (e.g., astrocytoma, oligodendroglioma), medulloblastoma); bronchus cancer; carcinoid tumor; cervical cancer (e.g., cervical adenocarcinoma); choriocarcinoma; chordoma; craniopharyngioma; colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma); connective tissue cancer; epithelial carcinoma; ependymoma; endotheliosarcoma (e.g., Kaposi’s sarcoma, multiple idiopathic hemorrhagic sarcoma); endometrial cancer (e.g., uterine cancer, uterine sarcoma); esophageal cancer (e.g., adenocarcinoma of the esophagus, Barrett’s adenocarcinoma); Ewing’s sarcoma; ocular cancer (e.g., intraocular melanoma, retinoblastoma); familiar hypereosinophilia; gall bladder 214901-5932-3024.1Atty. Docket No. 114203-1577cancer; gastric cancer (e.g., stomach adenocarcinoma); gastrointestinal stromal tumor (GIST); germ cell cancer; head and neck cancer (e.g. , head and neck squamous cell carcinoma, oral cancer (e.g., oral squamous cell carcinoma), throat cancer (e.g., laryngeal cancer, pharyngeal cancer, nasopharyngeal cancer, oropharyngeal cancer)); hematopoietic cancers (e.g., leukemia such as acute lymphocytic leukemia (ALL) e.g., B-cell ALL, T-cell ALL), acute myelocytic leukemia (AML) (e.g., B-cell AML, T-cell AML), chronic myelocytic leukemia (CML) e.g., B-cell CML, T-cell CML), and chronic lymphocytic leukemia (CLL) e.g., B-cell CLL, T-cell CLL)); lymphoma such as Hodgkin lymphoma (HL) e.g., B-cell HL, T-cell HL) and non-Hodgkin lymphoma (NHL) e.g., B-cell NHL such as diffuse large cell lymphoma (DLCL) e.g., diffuse large B-cell lymphoma), follicular lymphoma, chronic lymphocytic leukemia / small lymphocytic lymphoma (CLL / SLL), mantle cell lymphoma (MCL), marginal zone B-cell lymphomas e.g., mucosa-associated lymphoid tissue (MALT) lymphomas, nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma), primary mediastinal B-cell lymphoma, Burkitt lymphoma, lymphoplasmacytic lymphoma (i.e., Waldenstrom’s macroglobulinemia), hairy cell leukemia (HCL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma and primary central nervous system (CNS) lymphoma; and T-cell NHL such as precursor T-lymphoblastic lymphoma / leukemia, peripheral T-cell lymphoma (PTCL) e.g., cutaneous T-cell lymphoma (CTCL) e.g., mycosis fungoides, Sezary syndrome), angioimmunoblastic T-cell lymphoma, extranodal natural killer T-cell lymphoma, enteropathy type T-cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, and anaplastic large cell lymphoma); a mixture of one or more leukemia / lymphoma as described above; and multiple myeloma (MM)), heavy chain disease (e.g., alpha chain disease, gamma chain disease, mu chain disease); hemangioblastoma; hypopharynx cancer; inflammatory myofibroblastic tumors; immunocytic amyloidosis; kidney cancer (e.g., nephroblastoma a. k.a. Wilms’ tumor, renal cell carcinoma); liver cancer e.g., hepatocellular cancer (HCC), malignant hepatoma); lung cancer e.g., bronchogenic carcinoma, small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), adenocarcinoma of the lung); leiomyosarcoma (LMS); mastocytosis e.g., systemic mastocytosis); muscle cancer; myelodysplastic syndrome (MDS); mesothelioma; myeloproliferative disorder (MPD) e.g., polycythemia vera (PV), essential thrombocytosis (ET), agnogenic myeloid metaplasia (AMM) a.k.a. myelofibrosis (MF), chronic idiopathic myelofibrosis, chronic myelocytic leukemia (CML), chronic neutrophilic leukemia (CNL), hypereosinophilic syndrome (HES)); neuroblastoma; neurofibroma e.g., neurofibromatosis (NF) type 1 or type 2, schwannomatosis); neuroendocrine cancer e.g., gastroenteropancreatic 224901-5932-3024.1Atty. Docket No. 114203-1577neuroendoctrine tumor (GEP-NET), carcinoid tumor); osteosarcoma (e.g., bone cancer); ovarian cancer (e.g., cystadenocarcinoma, ovarian embryonal carcinoma, ovarian adenocarcinoma); papillary adenocarcinoma; pancreatic cancer e.g., pancreatic adenocarcinoma, intraductal papillary mucinous neoplasm (IPMN), Islet cell tumors); penile cancer (e.g., Paget’s disease of the penis and scrotum); pineal oma; primitive neuroectodermal tumor (PNT); plasma cell neoplasia; paraneoplastic syndromes; intraepithelial neoplasms; prostate cancer (e.g., prostate adenocarcinoma); rectal cancer; rhabdomyosarcoma; salivary gland cancer; skin cancer (e.g., squamous cell carcinoma (SCC), keratoacanthoma (KA), melanoma, basal cell carcinoma (BCC)); small bowel cancer (e.g., appendix cancer); soft tissue sarcoma (e.g., malignant fibrous histiocytoma (MFH), liposarcoma, malignant peripheral nerve sheath tumor (MPNST), chondrosarcoma, fibrosarcoma, myosarcoma); sebaceous gland carcinoma; small intestine cancer; sweat gland carcinoma; synovioma; testicular cancer (e.g., seminoma, testicular embryonal carcinoma); thyroid cancer (e.g., papillary carcinoma of the thyroid, papillary thyroid carcinoma (PTC), medullary thyroid cancer); urethral cancer; vaginal cancer; and vulvar cancer (e.g., Paget’s disease of the vulva).

[0047] A “cell,” as used herein, may be present in a population of cells (e.g., in a tissue, a sample, a biopsy, an organ, or an organoid). In some embodiments, a population of cells is composed of a plurality of different cell types. Cells for use in the methods of the present disclosure can be present within an organism, a single cell type derived from an organism, or a mixture of cell types. Included are naturally occurring cells and cell populations, genetically engineered cell lines, cells derived from transgenic animals, cells from a subject, etc. Virtually any cell type and size can be accommodated in the methods and systems described herein. In some embodiments, the cells are mammalian cells (e.g., complex cell populations such as naturally occurring tissues). In some embodiments, the cells are from a human. In certain embodiments, the cells are collected from a subject (e.g., a human) through a medical procedure such as a biopsy. Alternatively, the cells may be a cultured population (e.g., a culture derived from a complex population, or a culture derived from a single cell type where the cells have differentiated into multiple lineages). The cells may also be provided in situ in a tissue sample.

[0048] Cell types contemplated for use in the methods of the present disclosure include, but are not limited to, stem and progenitor cells (e.g., embryonic stem cells, hematopoietic stem cells, mesenchymal stem cells, neural crest cells, efc.), endothelial cells, muscle cells, myocardial cells, smooth and skeletal muscle cells, mesenchymal cells, epithelial cells,234901-5932-3024.1Atty. Docket No. 114203-1577hematopoietic cells, lymphocytes such as T-cells (e.g., Thl T cells, Th2 T cells, ThO T cells, cytotoxic T cells) and B cells (e.g., pre-B cells), monocytes, dendritic cells, neutrophils, macrophages, natural killer cells, mast cells, adipocytes, immune cells, neurons, hepatocytes, and cells involved with particular organs (e.g., thymus, endocrine glands, pancreas, brain, neurons, glia, astrocytes, dendrocytes, and genetically modified cells thereof). The cells may also be transformed or neoplastic cells of different types (e.g., carcinomas of different cell origins, lymphomas of different cell types, etc.) or cancerous cells of any kind (e.g., from any of the cancers disclosed herein). Cells of different origins (e.g., ectodermal, mesodermal, and endodermal) are also contemplated for use in the methods of the present disclosure. In some embodiments, the cells are microglia, astrocytes, oligodendrocytes, excitatory neurons, or inhibitory neurons. In some embodiments, cells of multiple cell types are present within the same sample.

[0049] The term “ribosome” is used herein to refer to a cellular macromolecular complex responsible for translating messenger RNA (mRNA) into polypeptides or proteins, and includes both naturally occurring and engineered ribosomes from any organism or artificial system. Unless otherwise specified, “ribosome” encompasses all structural and functional forms thereof, including cytosolic eukaryotic ribosomes (e.g., 80S ribosomes comprising 40S and 60S subunits), prokaryotic ribosomes (e.g., 70S ribosomes comprising 30S and 50S subunits), archaeal ribosomes, organellar ribosomes such as mitochondrial ribosomes (i.e., mitoribosomes, e.g., 55S mitoribosomes comprising 28S and 39S subunits), chloroplast ribosomes, and ribosomes from bacteria, fungi, plants, animals, and other non-eukaryotic and eukaryotic organisms.

[0050] The term “complementary” is used herein to refer to two oligonucleotide sequences (e.g., DNA or RNA) comprising bases that hydrogen bond to one another. The degree of complementarity between two oligonucleotide sequences can vary, from complete complementarity to no complementarity. For example, two oligonucleotide sequences may be only partially complementary to one another (e.g., in the probes described herein, wherein only a portion of the probe is complementary to another probe, or to an RNA of interest). Two oligonucleotide sequences may be, e.g., 70% or more complementary to one another, 75% or more complementary to one another, 80% or more complementary to one another, 85% or more complementary to one another, 90% or more complementary to one another, 95% or more complementary to one another, 96% or more complementary to one another, 97% or more complementary to one another, 98% or more complementary to one another, 99% or more complementary to one another, or 100% complementary to one another.244901-5932-3024.1Atty. Docket No. 114203-1577

[0051] The terms “polynucleotide”, “nucleotide sequence”, “nucleic acid”, “nucleic acid molecule”, “nucleic acid sequence”, and “oligonucleotide” refer to a series of nucleotide bases (also called “nucleotides”) in DNA and RNA and mean any chain of two or more nucleotides. The polynucleotides can be chimeric mixtures or derivatives or modified versions thereof, and single-stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, its hybridization parameters, etc.

[0052] A “protein,” “peptide,” or “polypeptide” comprises a polymer of amino acid residues linked together by peptide bonds. The term refers to proteins, polypeptides, and peptides of any size, structure, or function. Typically, a protein will be at least three amino acids long. A protein may refer to an individual protein or a collection of proteins. Inventive proteins preferably contain only natural amino acids, although non-natural amino acids ( / .< ., compounds that do not occur in nature but that can be incorporated into a polypeptide chain) and / or amino acid analogs as are known in the art may alternatively be employed. Also, one or more of the amino acids in a protein may be modified, for example, by the addition of a chemical entity such as a carbohydrate group, a hydroxyl group, a phosphate group, a farnesyl group, an isofarnesyl group, a fatty acid group, a linker for conjugation or functionalization, or other modification. A protein may also be a single molecule or may be a multi-molecular complex. A protein may be a fragment of a naturally occurring protein or peptide. A protein may be naturally occurring, recombinant, synthetic, or any combination of these. A protein may also be a therapeutic protein administered as a treatment for a disease or disorder (e.g., one that is associated with a change in the polysome structure in a cell taken from a subject). In certain embodiments, the protein is an antibody.

[0053] A “transcript” or “RNA transcript” is the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence. When the RNA transcript is a complimentary copy of the DNA sequence, it is referred to as the primary transcript, or it may be an RNA sequence derived from post-transcriptional processing of the primary transcript and is referred to as the mature RNA. “Messenger RNA (mRNA)” refers to the RNA that is without introns and can be translated into polypeptides by the cell. “cRNA” refers to complementary RNA, transcribed from a recombinant cDNA template. “cDNA” refers to DNA that is complementary to and derived from an mRNA template.

[0054] The term “RNA of interest,” as used herein, encompasses any ribonucleic acid molecule that is desired to be detected, labeled, imaged, quantified, or otherwise analyzed. In some embodiments, the RNA of interest is a cytosolic messenger RNA (mRNA) transcribed 254901-5932-3024.1Atty. Docket No. 114203-1577from the nuclear genome, including but not limited to mRNAs encoding housekeeping proteins, signaling proteins, synaptic proteins, enzymes, structural proteins, or any other protein-coding transcript present in the cytoplasm. In other embodiments, the RNA of interest is a mitochondrial RNA (mtRNA), including mitochondrial mRNAs, mitochondrial rRNAs, or mitochondrial tRNAs. In some embodiments, the RNA of interest is one of the thirteen protein-coding mitochondrial mRNAs encoded by human (or mammalian) mitochondrial DNA, namely: MT-ND1 (NADH dehydrogenase subunit 1), MT-ND2 (NADH dehydrogenase subunit 2), MT-ND3 (NADH dehydrogenase subunit 3), MT-ND4 (NADH dehydrogenase subunit 4), MT-ND4L (NADH dehydrogenase subunit 4L), MT-ND5 (NADH dehydrogenase subunit 5), MT-ND6 (NADH dehydrogenase subunit 6), MT-CYB (cytochrome b), MT-C01 (cytochrome c oxidase subunit I), MT-C02 (cytochrome c oxidase subunit II), MT-C03 (cytochrome c oxidase subunit III), MT-ATP6 (ATP synthase FO subunit 6), and MT-ATP8 (ATP synthase FO subunit 8). Unless otherwise specified, “RNA of interest” is intended to include each of these RNAs individually or in combination, as well as any allelic variants, polymorphic variants, splice or processing variants, disease-associated variants, and engineered, synthetic, modified, chimeric, or mutated versions thereof.

[0055] The term “sample” or “biological sample” refers to any sample including tissue samples (such as tissue sections, surgical biopsies, and needle biopsies of a tissue); cell samples (e.g., cytological smears (such as Pap or blood smears) or samples of cells obtained by microdissection); or cell fractions, fragments, or organelles (such as obtained by lysing cells and separating the components thereof by centrifugation or otherwise). Other examples of biological samples include, but are not limited to, blood, serum, urine, semen, fecal matter, cerebrospinal fluid, interstitial fluid, mucous, tears, sweat, pus, biopsied tissue (e.g, obtained by a surgical biopsy or needle biopsy), nipple aspirates, milk, vaginal fluid, saliva, swabs (such as buccal swabs), or any material containing biomolecules that is derived from a first biological sample. In some embodiments, a biological sample is a surgical biopsy taken from a subject, for example, a biopsy of any of the tissues described herein. In certain embodiments, a biological sample is a tumor biopsy (e.g, from a subject diagnosed with, suspected of having, or thought to have cancer). In some embodiments, the tumor biopsy captures primary tumor cells and tissue for direct study. In some embodiments, liquid biopsy can be used on tumor cells that have been captured and / or sorted via traditional methods (e.g., FACS, affinity capture, etc.) from blood or other bodily fluids (CNS fluid, lymph, etc.). In some embodiments, the sample is brain tissue. In some embodiments, the tissue is cardiac tissue. In some embodiments, the tissue is muscle tissue.264901-5932-3024.1Atty. Docket No. 114203-1577

[0056] The term “small molecule” refers to molecules, whether naturally-occurring or artificially created (e.g., via chemical synthesis) that have a relatively low molecular weight. Typically, a small molecule is an organic compound (e.g., it contains carbon). The small molecule may contain multiple carbon-carbon bonds, stereocenters, and other functional groups (e.g., amines, hydroxyl, carbonyls, and heterocyclic rings, etc.). In certain embodiments, the molecular weight of a small molecule is not more than about 1,000 g / mol, not more than about 900 g / mol, not more than about 800 g / mol, not more than about 700 g / mol, not more than about 600 g / mol, not more than about 500 g / mol, not more than about 400 g / mol, not more than about 300 g / mol, not more than about 200 g / mol, or not more than about 100 g / mol. In certain embodiments, the molecular weight of a small molecule is at least about 100 g / mol, at least about 200 g / mol, at least about 300 g / mol, at least about 400 g / mol, at least about 500 g / mol, at least about 600 g / mol, at least about 700 g / mol, at least about 800 g / mol, at least about 900 g / mol, or at least about 1,000 g / mol. Combinations of the above ranges (e.g., at least about 200 g / mol and not more than about 500 g / mol) are also possible. In certain embodiments, the small molecule is a therapeutically active agent such as a drug (e.g., a molecule approved by the U.S. Food and Drug Administration. The small molecule may also be complexed with one or more metal atoms and / or metal ions. Preferred small molecules are biologically active in that they produce a biological effect in animals, preferably mammals, and more preferably humans. In certain embodiments, the small molecule is a drug. Preferably, though not necessarily, the drug is one that has already been deemed safe and effective for use in humans or animals by the appropriate governmental agency or regulatory body.

[0057] A “subject” to which administration is contemplated refers to a human (i.e., male or female of any age group, e.g., pediatric subject (e.g., infant, child, or adolescent) or adult subject (e.g, young adult, middle-aged adult, or senior adult)) or non-human animal. In some embodiments, the non-human animal is a mammal (e.g, primate (e.g., cynomolgus monkey or rhesus monkey) or mouse). The term “patient” refers to a subject in need of treatment of a disease. In some embodiments, the subject is human. In some embodiments, the patient is human. The human may be a male or female at any stage of development. A subject or patient “in need” of treatment of a disease or disorder includes, without limitation, those who exhibit any risk factors or symptoms of a disease or disorder. In some embodiments, a subject is a non-human experimental animal (e.g., a mouse, rat, dog, or non-human primate).

[0058] A “therapeutically effective amount” of a treatment or therapeutic agent is an amount sufficient to provide a therapeutic benefit in the treatment of a condition or to delay or 274901-5932-3024.1Atty. Docket No. 114203-1577minimize one or more symptoms associated with the condition. A therapeutically effective amount of a treatment or therapeutic agent means an amount of the therapy, alone or in combination with other therapies, that provides a therapeutic benefit in the treatment of the condition. The term “therapeutically effective amount” can encompass an amount that improves overall therapy, reduces or avoids symptoms, signs, or causes of the condition, and / or enhances the therapeutic efficacy of another therapeutic agent.

[0059] As used herein, a “tissue” is a group of cells and their extracellular matrix from the same origin. Together, the cells carry out a specific function. The association of multiple tissue types together forms an organ. The cells may be of different cell types. In some embodiments, a tissue is an epithelial tissue. Epithelial tissues are formed by cells that cover an organ surface (e.g., the surface of the skin, airways, soft organs, reproductive tract, and inner lining of the digestive tract). Epithelial tissues perform protective functions and are also involved in secretion, excretion, and absorption. Examples of epithelial tissues include, but are not limited to, simple squamous epithelium, stratified squamous epithelium, simple cuboidal epithelium, transitional epithelium, pseudostratified epithelium, columnar epithelium, and glandular epithelium. In some embodiments, a tissue is a connective tissue. Connective tissues are fibrous tissues made up of cells separated by non-living material (e.g., an extracellular matrix). Connective tissues provide shape to organs and hold organs in place. Connective tissues include fibrous connective tissue, skeletal connective tissue, and fluid connective tissue. Examples of connective tissues include, but are not limited to, blood, bone, tendon, ligament, adipose, and areolar tissues. In some embodiments, a tissue is a muscular tissue. Muscular tissue is an active contractile tissue formed from muscle cells. Muscle tissue functions to produce force and cause motion. Muscle tissue includes smooth muscle (e.g., as found in the inner linings of organs), skeletal muscle (e.g., as typically attached to bones), and cardiac muscle (e.g., as found in the heart, where it contracts to pump blood throughout an organism). In some embodiments, a tissue is a nervous tissue. Nervous tissue includes cells comprising the central nervous system and peripheral nervous system. Nervous tissue forms the brain, spinal cord, cranial nerves, and spinal nerves (e.g., motor neurons). In certain embodiments, a tissue is brain tissue. In certain embodiments, a tissue is placental tissue. In some embodiments, a tissue is heart tissue.

[0060] The terms “treatment,” “treat,” and “treating” refer to reversing, alleviating, delaying the onset of, or inhibiting the progress of a disease described herein (e.g., cancer). In some embodiments, treatment may be administered after one or more signs or symptoms of the disease have developed or have been observed (e.g., prophylactically (as may be further 284901-5932-3024.1Atty. Docket No. 114203-1577described herein) or upon suspicion or risk of disease). In other embodiments, treatment may be administered in the absence of signs or symptoms of the disease. For example, treatment may be administered to a susceptible subject prior to the onset of symptoms (e.g., in light of a history of symptoms in the subject, or family members of the subject). Treatment may also be continued after symptoms have resolved, for example, to delay or prevent recurrence. In some embodiments, treatment may be administered after using the methods disclosed herein and observing a change in the polysome structure in a cell or tissue in comparison to a healthy cell or tissue.

[0061] The aspects described herein are not limited to specific embodiments, systems, compositions, methods, or configurations, and as such can, of course, vary. The terminology used herein is for the purpose of describing particular aspects only and, unless specifically defined herein, is not intended to be limiting.

[0062] The present disclosure provides methods, compositions, and systems for superresolution (SR) polysome imaging in a cell. The present disclosure also provides methods for diagnosing a disease or disorder in a subject based on polysome structure in a cell, including cells within an intact tissue. Methods of screening for or testing a candidate agent capable of modulating polysome structure are also provided by the present disclosure. The present disclosure also provides methods for treating a disease or disorder in a subject in need thereof. Sets of oligonucleotide probes, which may be useful for performing the methods described herein, are also described by the present disclosure, as well as kits comprising any of the oligonucleotide probes described herein.Methods for super -re solution (SR) imaging of a polysome in a cell

[0063] In one aspect, the present disclosure provides methods for super-resolution (SR) imaging of a polysome in a cell. In the methods disclosed herein, a cell may be contacted with one or more sets of probes, which are described further herein and may be used to image ribosome subunits, fully-assembled ribosomes, or polysomes, or may be used to image RNA transcripts directly. Advantageously, the disclosed methods enable SR imaging of polysome structure and RNA structure within a single cell, enabling the study of the relationship between polysome structure and RNA sequence. The methods provided herein have several advantages over previously disclosed methods and systems, including, but not limited to, the ability to simultaneously image, at super-resolution scale, polysome structures and RNA structures in a cell without disrupting the spatial information of other subcellular structures, cell morphology, and / or tissue organization in the cell. The methods provided herein are also 294901-5932-3024.1Atty. Docket No. 114203-1577compatible with the use of additional modalities, including but not limited to in situ sequencing of RNA.

[0064] In some embodiments, the present disclosure provides a method for super-resolution (SR) imaging of a polysome in a cell, the method comprising: (a) contacting the cell with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe; and (c) imaging the cell, thereby imaging a polysome in the cell.

[0065] The methods disclosed herein contemplate the use of a set probes comprising a first probe, a second probe, and a third probe. The first probe and second probe each comprises a portion that recognizes a ribosome. The ribosome can be but is not limited to eukaryotic ribosomes. Rather, it is to be understood that while the present disclosure shows a reduction to practice in an exemplified eukaryotic ribosome (e.g., 80S ribosomes comprising 40S and 60S subunits), the same general concept could be applied to other ribosomes, including but not limited to, prokaryotic ribosomes (e.g., 70S ribosomes comprising 30S and 50S subunits), archaeal ribosomes, organellar ribosomes such as mitochondrial ribosomes (i.e., mitoribosomes, e.g., 55S mitoribosomes comprising 28S and 39S subunits), chloroplast ribosomes, and ribosomes from bacteria, fungi, plants, animals, and other non-eukaryotic and eukaryotic organisms. For example, 80S eukaryotic cytosolic ribosomes can be recognized by probes that recognize the 40S subunit and the 60S subunit of the ribosome, such as by binding to ribosomal RNA (rRNA) associated with each subunit (e.g., the 18S rRNA associated with the 40S subunit, and the 28S rRNA associated with the 60S subunit). As an 304901-5932-3024.1Atty. Docket No. 114203-1577additional example, a mammalian mitochondrial ribosome (i.e., mitoribosome, ~55S) can be recognized by probes that recognize the 28S small subunit and the 39S large subunit of the mitoribosome, such as by binding to mitochondrial ribosomal RNA (mt-rRNA) associated with each subunit (e.g., the 12S mt-rRNA associated with the 28S subunit, and the 16S mt-rRNA associated with the 39S subunit).

[0066] The portion of the probe that recognizes a ribosome may be a protein, peptide, nucleic acid, or small molecule. In some embodiments, the portion of the first probe or second probe that recognizes a ribosome is an agent that binds an antibody, or an antibody variant or fragment. In certain embodiments, the portion of the first probe or second probe that recognizes the ribosome comprises an antibody (e.g., a secondary antibody), or an antibody variant or fragment. When the portion of the first probe or second probe that recognizes the ribosome is a secondary antibody, the method may optionally further comprise contacting the cell with a primary antibody that recognizes a ribosome and is recognized by the secondary antibody of the second probe. The primary antibody may recognize any portion of the ribosome, for example, any protein, nucleic acid (e.g., rRNA), or combination thereof of the ribosome. In some embodiments, the primary antibody is an anti-40S ribosomal protein S3 (RPS3) antibody (e.g., an anti-RPS3 monoclonal antibody), for the first probe. In some embodiments, the antibody is an anti-60S ribosomal protein L4 (RPL4) antibody (e.g., an anti-RPL4 polyclonal antibody), for the second probe. In place of an antibody, the present disclosure also contemplates the use of any agent capable of recognizing the ribosome on the probes described herein. In some embodiments, the portion of the first probe or second probe that recognizes the ribosome comprises an oligonucleotide that is complementary to a portion of the ribosomal RNA (rRNA) within the ribosome. In some embodiments, the portion of the first probe or second probe that recognizes the ribosome comprises an oligonucleotide that is complementary to a portion of the 40S small ribosomal subunit (including, e.g., the 18S rRNA) (for the first probe) or to a portion of the 60S large ribosomal subunit (including, e.g., the 5S rRNA, the 28S rRNA, and the 5.8S rRNA) (for the second probe). In some embodiments, the portion of the first probe that recognizes the 40S subunit of a ribosome comprises an oligonucleotide that is complementary to a portion of the 18S rRNA. In some embodiments, the portion of the second probe that recognizes the 60S subunit of a ribosome comprises an oligonucleotide that is complementary to a portion of the 28S rRNA. In certain embodiments, the oligonucleotide complementary to a portion of rRNA is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more than 30 nucleotides in length. In certain314901-5932-3024.1Atty. Docket No. 114203-1577embodiments, the oligonucleotide complementary to a portion of rRNA is about 25 nucleotides in length.

[0067] In addition to the portion that recognizes the ribosome, the each of the first probe and the second probe also comprises a portion that is complementary to a portion of the third probe.

[0068] In some embodiments, the portion of the first probe that is complementary to a portion of the third probe is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides in length. In some embodiments, the portion of the first probe that is complementary to a portion of the third probe is 9-15 nucleotides in length. In some embodiments, the portion of the first probe that is complementary to a portion of the third probe is 9-11 nucleotides in length. In some embodiments, the portion of the first probe that is complementary to a portion of the third probe is 9 nucleotides in length. In some embodiments, the portion of the first probe that is complementary to a portion of the third probe is 10 nucleotides in length. In some embodiments, the portion of the first probe that is complementary to a portion of the third probe is 11 nucleotides in length.

[0069] In certain embodiments, the portion of the first probe that is complementary to a portion of the third probe and the portion of the first probe that recognizes the 40S subunit of the ribosome are joined by a poly- A nucleotide linker. In some embodiments, the poly- A nucleotide linker of the first probe is about 10-20 nucleotides in length. In some embodiments, the poly-A nucleotide linker of the first probe is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the poly-A nucleotide linker of the first probe is about 10 nucleotides in length. In some embodiments, the poly-A nucleotide linker of the first probe is 10 nucleotides in length.

[0070] The present disclosure contemplates any arrangement of the portions of the first probe. In some embodiments, the first probe used in the methods described herein comprises the structure:5 '-[portion recognizing the 40S subunit of the ribosome]-[portion complementary to the third probe]-3'; or5 '-[portion recognizing the 40S subunit of the ribosome]-[poly-A linker]-[portion complementary to the third probe]-3'5 '-[portion complementary to the third probe]-[portion recognizing the 40S subunit of the ribosome]-3'; or5 '-[portion complementary to the third probe]-[poly-A linker]-[portion recognizing the 40S subunit of the ribosome]-3'324901-5932-3024.1Atty. Docket No. 114203-1577wherein ]-[ comprises an optional linker (e.g., nucleotide linker, e.g., a poly-A linker). In some embodiments, ]-[ represents a direct linkage between two portions of the third oligonucleotide probe ( / .< ., a phosphodiester bond).

[0071] In some embodiments, the portion of the second probe that is complementary to a portion of the third probe is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides in length. In some embodiments, the portion of the second probe that is complementary to a portion of the third probe is 9-15 nucleotides in length. In some embodiments, the portion of the second probe that is complementary to a portion of the third probe is 9-11 nucleotides in length. In some embodiments, the portion of the second probe that is complementary to a portion of the third probe is 9 nucleotides in length. In some embodiments, the portion of the second probe that is complementary to a portion of the third probe is 10 nucleotides in length. In some embodiments, the portion of the second probe that is complementary to a portion of the third probe is 11 nucleotides in length.

[0072] In certain embodiments, the portion of the second probe that is complementary to a portion of the third probe and the portion of the second probe that recognizes the 60S subunit of the ribosome are joined by a poly-A nucleotide linker. In some embodiments, the poly-A nucleotide linker of the second probe is about 10-20 nucleotides in length. In some embodiments, the poly-A nucleotide linker of the second probe is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the poly-A nucleotide linker of the second probe is about 10 nucleotides in length. In some embodiments, the poly-A nucleotide linker of the second probe is 10 nucleotides in length.

[0073] The present disclosure contemplates any arrangement of the portions of the second probe. In some embodiments, the second probe used in the methods described herein comprises the structure:5 '-[portion complementary to the third probe]-[portion recognizing the 60S subunit of the ribosome]-3'; or5 '-[portion complementary to the third probe]-[poly-A linker]-[portion recognizing the 60S subunit of the ribosome]-3'; or5 '-[portion recognizing the 60S subunit of the ribosome]-[portion complementary to the third probe]-3'; or5 '-[portion recognizing the 60S subunit of the ribosome]-[poly-A linker]-[portion complementary to the third probe]-3';334901-5932-3024.1Atty. Docket No. 114203-1577wherein ]-[ comprises an optional linker (e.g., nucleotide linker, e.g., a poly-A linker). In some embodiments, ]-[ represents a direct linkage between two portions of the third oligonucleotide probe ( / .< ., a phosphodiester bond).

[0074] In some embodiments, the portion of the third probe that is complementary to a portion of the first probe is 9-11 nucleotides in length, and the portion of the third probe that is complementary to a portion of the second probe is 9-11 nucleotides in length. In some embodiments, the portion of the third probe that is complementary to a portion of the first probe is 9 nucleotides in length, and the portion of the third probe that is complementary to a portion of the second probe is 11 nucleotides in length. In some embodiments, the portion of the third probe that is complementary to a portion of the first probe is 10 nucleotides in length, and the portion of the third probe that is complementary to a portion of the second probe is 10 nucleotides in length.

[0075] As described herein, the third probe (also referred to herein as a “splint probe” or as a “blocked probe”) comprises a portion that is complementary to a portion of the first probe and a portion that is complementary to a portion of the second probe, thereby recognizing a ribosome ( / .< ., a ribosome that is bound to and is actively translating the RNA of interest). The third probe also comprises an imaging probe docking site region. The imaging probe docking site region can be contacted by an imaging probe. In some embodiments, an imaging probe hybridizes to the imaging probe docking site region. In some embodiments, the imaging probe docking site region is about 2 to about 25 nucleotides in length. In some embodiments, the imaging probe docking site region is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleotides in length. In some embodiments, the imaging probe docking site region is about 7-10 nucleotides in length. In some embodiments, the imaging probe docking site region is 7-10 nucleotides in length. In some embodiments, the imaging probe docking site region is a 3’ DNA-PAINT docking site region.

[0076] In addition to the portion that recognizes the ribosome, the third probe also comprises a portion that is complementary to a portion of the first probe. In some embodiments, the portion of the third probe that is complementary to a portion of the first probe is 5-15, 6-14, 7-13, 8-12, or 9-11 nucleotides in length. In some embodiments, the portion of the third probe that is complementary to a portion of the first probe is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides in length.

[0077] In addition to the portion that recognizes the ribosome, the third probe also comprises a portion that is complementary to a portion of the second probe. In some embodiments, the 344901-5932-3024.1Atty. Docket No. 114203-1577portion of the third probe that is complementary to a portion of the second probe is 5-15, 6-14, 7-13, 8-12, or 9-11 nucleotides in length. In some embodiments, the portion of the third probe that is complementary to a portion of the second probe is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides in length.

[0078] In certain embodiments, the portion of the third probe that is complementary to a portion of the first probe and the portion of the third probe that is complementary to a portion of the second probe are joined to the imaging probe docking site region by a poly-A nucleotide linker. In some embodiments, the poly-A nucleotide linker is about 10-20 nucleotides in length. In some embodiments, the poly-A nucleotide linker of the third probe is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the poly-A nucleotide linker is about 10 nucleotides in length. In some embodiments, the poly-A nucleotide linker is 10 nucleotides in length.

[0079] The present disclosure contemplates any arrangement of the portions of the third probe. In some embodiments, the third probe used in the methods described herein comprises the structure:5 '-[portion complementary to portion of second probe]-[portion complementary to portion of first probe]-[imaging probe docking site region]-3'; or5 '-[portion complementary to portion of second probe]-[portion complementary to portion of first probe]-[poly-A linker] -[imaging probe docking site region]-3'; or 5 '-[portion complementary to portion of first probe]-[portion complementary to portion of second probe]-[imaging probe docking site region]-3'; or5 '-[portion complementary to portion of first probe]-[portion complementary to portion of second probe]-[poly-A linker]-[imaging probe docking site region]-3' wherein ]-[ comprises an optional linker (e.g., nucleotide linker). In some embodiments, ]-[ represents a direct linkage between two portions of the third oligonucleotide probe.

[0080] In some embodiments, the third probe comprises one or more acryl functional groups. In some embodiments, the third probe comprises two, three, four, or five or more acryl functional groups. In some embodiments, the third probe comprises two acryl functional groups. In some embodiments, the third probe comprises an acryl functional group on its 5’-end or 3 ’-end, wherein the method further comprises incubating the cell with methyl-acrylate NHS ester (MA-NHS) under conditions sufficient to permit the conversion of a remaining terminal amine group of the third probe to an acryl functional group, thereby generating a third probe comprising a 5’ acryl functional group and a 3’ acryl functional group. In some embodiments, the third probe comprises one or more acryl function groups on one or more 354901-5932-3024.1Atty. Docket No. 114203-1577internal nucleobases. In some embodiments, the third probe used in the methods described herein comprises the structure:5'-[Acryl functional group]-[portion complementary to portion of first probe]-[portion complementary to portion of second probe]-[imaging probe docking site region]-3'; or 5'-[Acryl functional group]-[portion complementary to portion of second probe]- [portion complementary to portion of first probe]-[imaging probe docking site region] -3'; or5 '-[portion complementary to portion of first probe]-[portion complementary to portion of second probe]-[imaging probe docking site region]- [Acryl functional group]-3'; or5 '-[portion complementary to portion of second probe]-[portion complementary to portion of first probe]-[imaging probe docking site region] -[Acryl functional group]- 3'; or5 '-[Acryl functional group]-[portion complementary to portion of first probe]-[portion complementary to portion of second probe]-[imaging probe docking site region]- [Acryl functional group]-3'; or5 '-[Acryl functional group]-[portion complementary to portion of second probe]- [portion complementary to portion of first probe]-[imaging probe docking site region] -[Acryl functional group]-3'.

[0081] In some embodiments, the methods provided herein further comprise ligating the first probe and the second probe. Ligation of the first and second robes can enhance the stability of the first and second probes upon binding by the third probe. In some embodiments, the first probe comprises a 5’ phosphate group. In some embodiments, the second probe comprises a 5’ phosphate group.

[0082] In some embodiments, the first imaging probe used in the methods disclosed herein comprises an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a label. In some embodiments, the label is a fluorescent label. In some embodiments, the first imaging probe comprises an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe and a fluorescent label. The label can be present on the 3’ end or on the 5’ end of the first imaging probe. In some embodiments, the label (e.g., fluorescent label) is present in the 3’ end of the first imaging probe. In some embodiments, the label (e.g., fluorescent label) is present on the 5’ end of the first imaging probe. In some embodiments, the first imaging probe is a single-stranded oligonucleotide probe. In some 364901-5932-3024.1Atty. Docket No. 114203-1577embodiments, the first imaging probe is about 4-25, about 5-20, about 5-15, or about 7-10 nucleotides in length. In some embodiments, the first imaging probe is 4-25, 5-20, 5-15, or 7-10 nucleotides in length. In some embodiments, the first imaging probe is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleotides in length.

[0083] The present disclosure contemplates any arrangement of the portions of the first imaging probe. In some embodiments, the first imaging probe used in the methods described herein comprises the structure:5 '-[portion complementary to imaging probe docking site region of the third probe]- [fluorescent label]-3'; or5 '-[fluorescent label]-[portion complementary to imaging probe docking site region of the third probe]-3'; or5 '-[portion complementary to imaging probe docking site region of the third probe]- [linker]- [fluorescent label]-3 '; or5 '-[fluorescent label]-[linker]-[portion complementary to imaging probe docking site region of the third probe]-3',wherein ]-[ comprises an optional linker (e.g., nucleotide linker). In some embodiments, ]-[ represents a direct linkage between two portions of the first imaging probe.

[0084] The provided methods as described herein contemplate the use of one or more RNA target probes. In some embodiments, the methods provided herein further comprise contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest.

[0085] In some embodiments, the RNA target probe used in the methods disclosed herein comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region. The imaging probe docking site region of the RNA target probe can be contacted by an imaging probe. In some embodiments, an imaging probe hybridizes to the imaging probe docking site region of the RNA target probe. In some embodiments, the imaging probe docking site region is about 2 to about 25 nucleotides in length. In some embodiments, the imaging probe docking site region is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleotides in length. In some embodiments, the imaging probe docking site region is about 7-10 nucleotides in length. In some embodiments, the imaging probe docking site region is 7-10 nucleotides in length. In some embodiments, the portion of the RNA target probe that is complementary to 374901-5932-3024.1Atty. Docket No. 114203-1577an RNA of interest is about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or about 30 nucleotides long. In some embodiments, the first probe is about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, or about 40 nucleotides long or longer. In some embodiments, each of the probes of the set of RNA target probes hybridize to the same RNA of interest. In some embodiments, the methods provided herein contemplate contacting the cell with at least two sets of RNA target probes, wherein each set of RNA target probes comprises probes that target different RNAs of interest. In some embodiments, the methods provided herein contemplate contacting the cell with at least two, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, or at least 30 sets of RNA target probes, wherein each set of RNA target probes comprises probes that target different RNAs of interest.

[0086] The present disclosure contemplates any arrangement of the portions of the RNA target probe. In some embodiments, the RNA target probe used in the methods described herein comprises the structure:5'-[portion complementary to RNA of interest]-[imaging probe docking site region]- 3'; or5'-[imaging probe docking site region]-[portion complementary to RNA of interests',wherein ]-[ comprises an optional linker (e.g., nucleotide linker). In some embodiments, ]-[ represents a direct linkage between two portions of the RNA target probe.

[0087] In some embodiments, the RNA target probe comprises an adapter sequence capable of binding to an expansion adapter probe. The adapter sequence can be from about 5 to about 50 nucleotides in length. In some embodiments, the adapter sequence is about 20 nucleotides in length. In some embodiments, the adapter sequence is 20 nucleotides in length. The adapter sequence can be separated from the portion of the RNA target probe that is complementary to the RNA of interest by an adenosine linker. The adenosine linker can be at least 2, at least 3, at least 5, at least 10, or at least 20 nucleotides in length. In some embodiments, the adenosine linker comprises about 5 adenosine nucleotides. In some embodiments, the adenosine linker comprises 5 adenosine nucleotides.384901-5932-3024.1Atty. Docket No. 114203-1577

[0088] In some embodiments, the RNA target probe used in the methods described herein comprises the structure:5'-[adapter sequence]-[portion complementary to RNA of interest] -[imaging probe docking site region]-3'; or5'-[imaging probe docking site region]-[portion complementary to RNA of interest]- [adapter sequence]-3'; or5'-[adapter sequence] -[adenosine linker]-[portion complementary to RNA of interest]- [imaging probe docking site region]-3'; or5'-[imaging probe docking site region]-[portion complementary to RNA of interest]- [adenosine linker] -[adapter sequence] -3',wherein ]-[ comprises an optional linker (e.g., nucleotide linker). In some embodiments, ]-[ represents a direct linkage between two portions of the RNA target probe.

[0089] An expansion adapter probe can include one or more acryl functional groups. In some embodiments, the expansion adapter probe comprises two, three, four, or five or more acryl functional groups. The one or more acryl functional groups can be located on the 5 ’-end of the expansion adapter probe, the 3 ’-end of the expansion adapter probe, or both the 5 ’-end and the 3 ’-end of the expansion adapter probe. In some embodiments, the method comprises contacting the RNA target probe with the expansion adapter probe. In some embodiments, the method comprises photocrosslinking the expansion adapter probe to the RNA target probe. In some embodiments, the expansion adapter probe comprises an acryl functional group on its 5 ’-end or 3 ’-end, wherein the method further comprises incubating the cell with methyl-acrylate NHS ester (MA-NHS) under conditions sufficient to permit the conversion of a remaining terminal amine group of the expansion adapter probe to an acryl functional group, thereby generating an expansion adapter probe comprising a 5’ acryl functional group and a 3’ acryl functional group. In some embodiments, the expansion adapter probe comprises one or more acryl function groups on one or more internal nucleobases.

[0090] In some embodiments, the imaging probe docking site region of the third probe and the imaging probe docking site region of any of the RNA target probes are not identical.

[0091] The provided methods as described herein contemplate the use of a second imaging probe. In some embodiments, the methods provided herein further comprise contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein 394901-5932-3024.1Atty. Docket No. 114203-1577contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe.

[0092] In some embodiments, the second imaging probe used in the methods disclosed herein comprises an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a label. In some embodiments, the label is a fluorescent label. In some embodiments, the second imaging probe comprises an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe and a fluorescent label. The label can be present on the 3’ end or on the 5’ end of the second imaging probe. In some embodiments, the label (e.g., fluorescent label) is present in the 3’ end of the second imaging probe. In some embodiments, the label (e.g., fluorescent label) is present in the 5’ end of the second imaging probe. In some embodiments, the second imaging probe is a single-stranded oligonucleotide probe. In some embodiments, the second imaging probe is about 4-25, about 5-20, about 5-15, or about 7-10 nucleotides in length. In some embodiments, the second imaging probe is 4-25, 5-20, 5-15, or 7-10 nucleotides in length. In some embodiments, the second imaging probe is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleotides in length.

[0093] The present disclosure contemplates any arrangement of the portions of the second imaging probe. In some embodiments, the second imaging probe used in the methods described herein comprises the structure:5 '-[portion complementary to imaging probe docking site region of the RNA target probe] -[fluorescent lab el] -3'; or5 '-[fluorescent label]-[portion complementary to imaging probe docking site region of the RNA target probe]-3'; or5 '-[portion complementary to imaging probe docking site region of the RNA target probe]-[linker]-[fluorescent label]-3 '; or5 '-[fluorescent label]-[linker]-[portion complementary to imaging probe docking site region of the RNA target probe]-3'.wherein ]-[ comprises an optional linker (e.g., nucleotide linker). In some embodiments, ]-[ represents a direct linkage between two portions of the second imaging probe.

[0094] In some embodiments, the methods provided herein contemplate contacting and imaging probe docking site region with an imaging probe. In some embodiments, contacting the imaging probe docking site region of a probe is performed under conditions sufficient to 404901-5932-3024.1Atty. Docket No. 114203-1577permit stochastic binding of the imaging probe to the imaging probe docking site region the probe.

[0095] In some embodiments, the first imaging probe and the second imaging probe are imaged simultaneously. In some embodiments, the first imaging probe and the second imaging probe are imaged sequentially. In some embodiments, within each set of RNA target probes, each RNA target probe comprises the same imaging probe docking site region. In some embodiments, within each set of RNA target probes, each RNA target probe comprises an imaging probe docking site region that is not identical to the imaging probe docking site region of any probe in any other set of RNA target probes.

[0096] In one aspect, the present disclosure provides a method for super-resolution (SR) imaging of RNA in a cell, the method comprising: (a) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest; (b) contacting the imaging probe docking site region of the RNA target probe with an imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the imaging probe to the imaging probe docking site region of the RNA target probe; and (c) imaging the cell, thereby imaging RNA in the cell.

[0097] In one aspect, the present disclosure provides a method for super-resolution (SR) imaging of a polysome in a cell, the method comprising: (a) contacting the cell with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is 414901-5932-3024.1Atty. Docket No. 114203-1577complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe; and (c) imaging the cell, thereby imaging a polysome in the cell.

[0098] In one aspect, the present disclosure provides a method for super-resolution (SR) imaging of a polysome comprising a ribosome and an RNA in a cell, the method comprising: (a) contacting the cell with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest; (c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell; (e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic424901-5932-3024.1Atty. Docket No. 114203-1577binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and (f) imaging the cell, thereby imaging RNA in the cell.

[0099] The use of any type of cell in the methods disclosed herein is contemplated by the present disclosure (e.g., any of the cell types described herein). In some embodiments, the cell is a mammalian cell. In certain embodiments, the cell is a human cell. The present disclosure also contemplates performing the methods described herein on multiple cells simultaneously (e.g., more than 100 cells, more than 200 cells, more than 300 cells, more than 400 cells, more than 500 cells, more than 1000 cells, more than 10,000 cells, more than 20,000 cells, more than 30,000 cells, more than 40,000 cells, or more than 50,000 cells simultaneously). In some embodiments, the method is performed on multiple cells of the same cell type. In some embodiments, the method is performed on multiple cells comprising cells of different cell types. The cell types in which polysomes may be imaged using the methods disclosed herein include, but are not limited to, stem cells, progenitor cells, neuronal cells, astrocytes, dendritic cells, endothelial cells, microglia, oligodendrocytes, muscle cells, myocardial cells, mesenchymal cells, epithelial cells, immune cells, hepatic cells, smooth and skeletal muscle cells, hematopoietic cells, lymphocytes, monocytes, neutrophils, macrophages, natural killer cells, mast cells, adipocytes, and neurons. In certain embodiments, the cell or cells are present within an intact tissue (e.g., of any of the tissue types described herein). In certain embodiments, the intact tissue is a fixed tissue sample. In some embodiments, the intact tissue comprises multiple cell types. In certain embodiments, the tissue is cardiac tissue, lymph node tissue, liver tissue, muscle tissue, bone tissue, eye tissue, or ear tissue. In certain embodiments, the tissue is brain tissue.

[0100] The RNAs of interest for which RNA and polysome imaging may be performed in the methods described herein may be transcripts that have been expressed from the genomic DNA of the cell. In some embodiments, the RNAs of interest are mRNA. The methods described herein may be used to profile one RNA being translated in a cell at a time, or multiple RNAs of interest simultaneously. In some embodiments, polysome structure in a cell, or multiple cells, is profiled for more than 1, more than 2, more than 3, more than 4, more than 5, more than 10, more than 20, more than 30, more than 40, more than 50, more than 100, more than 200, more than 500, more than 1000, more than 2000, more than 3000 RNAs, more than 4000 RNAs, or more than 5000 RNAs simultaneously.

[0101] In some embodiments, the methods for super-resolution polysome imaging in a single cell described herein may be combined with methods for profiling additional molecules within the cell. For example, expression of non-translating RNAs may be profiled alongside 434901-5932-3024.1Atty. Docket No. 114203-1577polysome and RNA structure using probes that do not comprise a portion that recognizes a ribosome. RNAs in other subcellular locations that are not actively being translated may be profiled alongside polysome structure as well. Profiling of protein expression (e.g., using traditional proteomics methods) may also be combined with the methods described herein, as well as profiling of the transcriptome, lipids, and / or small molecules. In some embodiments, any of the methods provided herein further comprise a step of overexpressing or knocking out one or more genes in the cell to determine whether the one or more genes are involved in regulating polysome structure.

[0102] The methods provided herein are compatible with super-resolution imaging techniques known in the art. For example, super-resolution imaging can include but is not limited to DNA-PAINT (nature.com / articles / nprot.2017.024), MINFLUX (nature.com / articles / s41592-022-01577-1), RESI (nature.com / articles / s41586-023-05925-9), expansion microscopy (science.org / doi / 10.1126 / science.1260088), or STORM (pmc.ncbi.nlm.nih.gov / articles / PMC2700296 / ).

[0103] In some embodiments, the methods for super-resolution (SR) of a polysome in a cell and / or RNA in a cell comprise expansion microscopy (science.org / doi / 10.1126 / science.1260088). In some embodiments, the method comprises embedding the cell in a hydrogel that is capable of expanding following salt-free or low-salt hydration. The hydrogel can include acrylamide and bis-acrylamide. In some embodiments, the hydrogel can include N,N-dimethylacrylamide (DMAA) and sodium acrylate (SA) (nature.com / articles / s41592-024-02454-9).

[0104] In some embodiments, the method comprises expanding the hydrogel, in effect expanding the cell embedded in the hydrogel. In some embodiments, the method comprises, before contacting the imaging probe docking site region of the third probe with an imaging probe, re-embedding the hydrogel in a second hydrogel. In some embodiments, the method comprises, before contacting the imaging probe docking site region of the third probe with an imaging probe, passivating the hydrogel to allow an imaging probe to bind to an imaging probe docking site. Passivation is a chemical process in which carboxylic acid functional groups in the expanded hydrogel are converted to amides. Passivation can include transforming the carboxylic acid functional groups into non-charged amides. This can be achieved by using carbodiimide crosslinker chemistry to form amide bonds between the carboxylic acids and ethanolamine. Passivation can be performed in two steps: an activation step, using EDCNHS at pH 6.5 to activate carboxylic acids, and a coupling step at pH 8.5 to efficiently form amide bonds with ethanolamine.444901-5932-3024.1Atty. Docket No. 114203-1577

[0105] In some embodiments, the cell is expanded by a factor of at least 1.5x, at least 2x, at least 3x, at least 4x, at least 5x, at least lOx, at least 15x, or at least 20x.

[0106] In some aspects, the present disclosure provides a method for multiplexed superresolution (SR) imaging of RNA in a cell, the method comprising: (a) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest; (b) contacting the RNA target probes with an expansion adapter probe; (c) embedding the cell in a hydrogel that is capable of expanding following salt-free or low-salt hydration; (d) expanding the hydrogel; (e) contacting the imaging probe docking site region of the RNA target probe with an imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the imaging probe to the imaging probe docking site region of the RNA target probe; and (f) imaging the cell, thereby imaging RNA in the cell. In some embodiments, the method enables multiplexed imaging of at least 10, at least 20, at least 50, at least 100, at least 200, at least 500, or at least 1000 RNAs of interest. In some embodiments, the method enables multiplexed imaging of 24 RNAs of interest. In some embodiments, the method comprises, before contacting the imaging probe docking site region of the RNA target probe with an imaging probe, re-embedding the hydrogel in a second hydrogel. In some embodiments, the method comprises, before contacting the imaging probe docking site region of the RNA target probe with an imaging probe, passivating the hydrogel to allow an imaging probe to bind to an imaging probe docking site. In some embodiments, the method enables multiplexed imaging of 72 RNAs of interest. In some embodiments, the method enables multiplexed imaging of 504 RNAs of interest. The methods provided herein enable multiplexed RNA imaging at a spatial resolution of 3-5 nm.

[0107] In some embodiments, the method comprises spatially segmenting in silico each of the RNAs of interest into at least 2 segments, at least 3 segments, at least 4 segments, or at least 5 segments, wherein the segments are arranged sequentially along the length of an RNA of interest. For example, one RNA of interest of a plurality of RNAs of interest can be segmented into 5 segments, with the structure 5’-Rl-R2-R3-R4-R5-3’, wherein Rl, R2, R3, R4, and R5 represent individual segments. Another RNA of interest of the same plurality of454901-5932-3024.1Atty. Docket No. 114203-1577RNAs of interest may be segmented into 5 segments, with the structure 5’-Rl-R3-R5-R2-R4-3’.

[0108] In some embodiments, each of the RNAs of interest is segmented in silico into 5 segments, wherein R1 is a segment nearest the 5’ end of the RNA of interest, and R2, R3, R4, and R5 are remaining segments. In some embodiments, each of the RNAs of interest is segmented in silico such that for each RNA of interest, Rl, R2, R3, R4, and R5 are positioned in a unique order. In some embodiments, each of the imaging probes hybridized to an RNA target probe hybridized to Rl of an RNA of interest (Rl imaging probes) comprise the same fluorescent label; wherein each of the imaging probes hybridized to an RNA target probe hybridized to R2 of an RNA of interest (R2 imaging probes) comprise the same fluorescent label; wherein each of the imaging probes hybridized to an RNA target probe hybridized to R3 of an RNA of interest (R3 imaging probes) comprise the same fluorescent label; wherein each of the imaging probes hybridized to an RNA target probe hybridized to R4 of an RNA of interest (R4 imaging probes) comprise the same fluorescent label; wherein each of the imaging probes hybridized to an RNA target probe hybridized to R5 of an RNA of interest (R5 imaging probes) comprise the same fluorescent label; and wherein the Rl imaging probes, the R2 imaging probes, the R3 imaging probes, the R4 imaging probes, and the R5 imaging probes comprise different fluorescent labels. Imaging the cell can involve sequential imaging of each of the sets of imaging probes comprising different fluorophores. Imaging the cell can involve simultaneous imaging of each of the sets of imaging probes comprising different fluorophores. In some embodiments, the method further comprises contacting the cell with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; contacting the imaging probe docking site region of the third probe with an imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe and a fluorescent label (an R6 imaging probe); and imaging the cell, thereby imaging a 464901-5932-3024.1Atty. Docket No. 114203-1577polysome in the cell. In some embodiments, contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the R6 imaging probe to the imaging probe docking site region of the third probe. In some embodiments, the fluorescent label of the R6 imaging probe is not identical to the fluorescent label of any of the Rl, R2, R3, R4, and R5 imaging probes. In some embodiments, the method comprises. In some embodiments, the method further comprises decoding the image to extract an identity, ribosome count, and / or location of each imaged RNA of interest.

[0109] In some embodiments, each of the RNAs of interest is segmented in silico into 3 or 4 segments, wherein each segment is hybridized to RNA target probes hybridized to imaging probes of a pair of sets of imaging probes selected from Rl imaging probes, R2 imaging probes, R3 imaging probes, R4 imaging probes, and R5 imaging probes. Each of the RNAs of interest can be segmented in silico such that for each RNA of interest, the pair of sets of imaging probes are positioned in a unique order along the length of the segmented RNA. In some embodiments, each of the Rl imaging probes comprise the same fluorescent label; each of the R2 imaging probes comprise the same fluorescent label; each of the R3 imaging probes comprise the same fluorescent label; each of the R4 imaging probes comprise the same fluorescent label; each of the R5 imaging probes comprise the same fluorescent label; and the Rl imaging probes, the R2 imaging probes, the R3 imaging probes, the R4 imaging probes, and the R5 imaging probes comprise different fluorescent labels. Imaging the cell con involve sequential imaging of each of the sets of imaging probes comprising different fluorophores. In some embodiments, the method can involve contacting the cell with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; contacting the imaging probe docking site region of the third probe with an imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe and a fluorescent label (an R6 imaging probe); and imaging the cell, thereby imaging a 474901-5932-3024.1Atty. Docket No. 114203-1577polysome in the cell. In some embodiments, contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the R6 imaging probe to the imaging probe docking site region of the third probe. In some embodiments, the fluorescent label of the R6 imaging probe is not identical to the fluorescent label of any of the Rl, R2, R3, R4, and R5 imaging probes. In some embodiments, the method further comprises decoding the image to extract an identity, ribosome count, and / or location of each imaged RNA of interest.

[0110] Any of the methods described herein may also be used to determine the cell type and / or cell state of one or more cells. In some embodiments, any of the methods provided herein further comprise a step of determining the cell type of the profiled or imaged cell, or the cell types of multiple profiled cells, by comparing the polysome structure profile of the cell or cells to reference data comprising polysome structure profiles of cells of various cell types. In some embodiments, any of the methods provided herein further comprise a step of determining the cell state of the profiled cell, or the cell states of multiple profiled cells, by comparing the polysome structure profile of the cell or cells to reference data comprising polysome structure profiles of cells of various cell states.Methods for diagnosing a disease or disorder in a subject[OHl] In another aspect, the present disclosure provides methods for diagnosing a disease or disorder in a subject. For example, the methods for super-resolution polysome imaging described herein may be performed on a cell or multiple cells taken from a subject (e.g., a subject who is thought to have or is at risk of having a disease or disorder, or a subject who is healthy or thought to be healthy). The polysome structure with respect to RNAs of interest in the cell can then be compared to the polysome structure with respect to the same RNAs of interest in a non-diseased cell or a cell from a non-diseased tissue sample (e.g., a cell from a healthy individual, or multiple cells from a population of healthy individuals). Any difference in the polysome structure profile of the cell (including of polysomes associated with a single RNA or of multiple RNAs of interest, e.g., a specific disease signature) relative to one or more non-diseased cells may indicate that the subject has the disease or disorder. Polysome structure in one or more non-diseased cells may be profiled alongside expression in a diseased cell as a control experiment. Polysome structure in one or more non-diseased cells may have also been profiled previously, and polysome structure in a diseased cell may be compared to this reference data for a non-diseased cell.484901-5932-3024.1Atty. Docket No. 114203-1577

[0112] In some embodiments, the present disclosure provides a method for diagnosing a disease or disorder in a subject, the method comprising: (a) contacting a cell obtained from a subject with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest; (c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell; (e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and (f) imaging the cell, thereby imaging RNA in the cell, wherein a difference in the polysome structure in the cell relative to one or more non-diseased cells indicates that the subject has the disease or disorder.

[0113] In one aspect, the present disclosure provides a method diagnosing a disease or disorder in a subject, the method comprising: (a) contacting cell obtained from a subject with 494901-5932-3024.1Atty. Docket No. 114203-1577a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest; (c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell; (e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and (f) imaging the cell, thereby imaging RNA in the cell, wherein a difference in the polysome structure in the cell relative to one or more non-diseased cells indicates that the subject has the disease or disorder.

[0114] Diagnosis of any disease or disorder is contemplated by the methods described herein. In some embodiments, the disease or disorder is a genetic disease, a proliferative disease, an inflammatory disease, an autoimmune disease, a liver disease, a spleen disease, a lung disease, a hematological disease, a neurological disease, a psychiatric disease, a504901-5932-3024.1Atty. Docket No. 114203-1577gastrointestinal (GI) tract disease, a genitourinary disease, an infectious disease, a musculoskeletal disease, an endocrine disease, a metabolic disorder, an immune disorder, a central nervous system (CNS) disorder, or a cardiovascular disease. In certain embodiments, the disease is cancer.

[0115] In some embodiments, the cell is present in a tissue (e.g., epithelial tissue, connective tissue, muscular tissue, or nervous tissue). In some embodiments, the tissue is a tissue sample from a subject. In some embodiments, the subject is a non-human experimental animal (e.g., a mouse, a rat, a dog, a pig, or a non-human primate). In some embodiments, the subject is a domesticated animal. In some embodiments, the subject is a human. In some embodiments, the tissue sample comprises a fixed tissue sample. In certain embodiments, the tissue sample is a biopsy (e.g., bone, bone marrow, breast, gastrointestinal tract, lung, liver, pancreas, prostate, brain, nerve, renal, endometrial, cervical, lymph node, muscle, or skin biopsy). In certain embodiments, the biopsy is a tumor biopsy. In certain embodiments, the tissue is brain tissue. In certain embodiments, the tissue is from the central nervous system.Methods of screening for an agent capable of modulating polysome structure

[0116] In another aspect, the present disclosure provides methods for screening for an agent capable of modulating polysome structure. For example, the methods for super-resolution polysome imaging described herein may be performed in a cell in the presence of one or more candidate agents. The polysome structure in the cell (e.g, a normal cell, or a diseased cell) can then be compared to the polysome structure in a cell that was not exposed to the one or more candidate agents. Any difference in the polysome structure profile relative to that in the cell that was not exposed to the candidate agent(s) may indicate that polysome structure is modulated by the candidate agent(s). In some embodiments, a particular signature (e.g, polysome structure with respect to one or more particular RNAs) that is known to be associated with treatment of the disease may be used to identify a candidate agent capable of modulating polysome structure in a desired manner. The methods described herein may also be used to identify drugs that have certain side effects, for example, by looking for specific polysome structure signatures when one or more cells is treated with a candidate agent or known drug.

[0117] In some embodiments, the present disclosure provides a method for screening for an agent capable of modulating polysome structure, the method comprising: (a) contacting a cell that is being treated with or has been treated with a candidate agent with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed 514901-5932-3024.1Atty. Docket No. 114203-1577for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest; (c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell; (e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and (f) imaging the cell, thereby imaging RNA in the cell, wherein a difference in the polysome structure in the presence of the candidate agent relative to in the absence of the candidate agent indicates that the candidate agent modulates polysome structure.

[0118] In one aspect, the present disclosure provides a method for screening for an agent capable of modulating polysome structure, the method comprising: (a) contacting a cell that is being treated with or has been treated with a candidate agent with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the 524901-5932-3024.1Atty. Docket No. 114203-1577second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest; (c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell; (e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and (f) imaging the cell, thereby imaging RNA in the cell, wherein a difference in the polysome structure in the presence of the candidate agent relative to in the absence of the candidate agent indicates that the candidate agent modulates polysome structure.

[0119] In some embodiments, the candidate agent is a small molecule, a protein, a peptide, a nucleic acid, a lipid, or a carbohydrate. In some embodiments, the candidate agent comprises a known drug or an FDA-approved drug. In certain embodiments, the protein is an antibody. In certain embodiments, the protein is an antibody fragment or an antibody variant. In certain embodiments, the protein is a receptor. In certain embodiments, the protein is a cytokine. In certain embodiments, the nucleic acid is an mRNA, an antisense RNA, an miRNA, an 534901-5932-3024.1Atty. Docket No. 114203-1577siRNA, an RNA aptamer, a double stranded RNA (dsRNA), a short hairpin RNA (shRNA), or an antisense oligonucleotide (ASO). Any candidate agent may be screened using the methods described herein. In particular, any candidate agents thought to be capable of modulating polysome structure may be screened using the methods described herein. In some embodiments, modulation of polysome structure by the candidate agent is associated with reducing, relieving, or eliminating the symptoms of a disease or disorder, or preventing the development or progression of the disease or disorder. In some embodiments, the disease or disorder modulated by the candidate agent is a genetic disease, a proliferative disease, an inflammatory disease, an autoimmune disease, a liver disease, a spleen disease, a lung disease, a hematological disease, a neurological disease, a psychiatric disease, a gastrointestinal (GI) tract disease, a genitourinary disease, an infectious disease, a musculoskeletal disease, an endocrine disease, a metabolic disorder, an immune disorder, a central nervous system (CNS) disorder, or a cardiovascular disease. In certain embodiments, the disease or disorder modulated by the candidate agent is cancer.Methods for treating a disease or disorder in a subject

[0120] In another aspect, the present disclosure provides methods for treating a disease or disorder in a subject. For example, the methods for super-resolution imaging of polysomes described herein may be performed in a cell from a sample taken from a subject (e.g., a subject who is thought to have or is at risk of having a disease or disorder). The polysome structure profile in the cell can then be compared to that in a cell from a non-diseased tissue sample. A treatment for the disease or disorder may then be administered to the subject if any difference in the polysome structure profile relative to a non-diseased cell is observed. Polysome structure in one or more non-diseased cells may be profiled alongside polysome structure in a diseased cell as a control experiment. Polysome structure in one or more nondiseased cells may have also been profiled previously, and polysome structure in a diseased cell may be compared to this reference data for a non-diseased cell.

[0121] In some embodiments, the present disclosure provides a method for treating a disease or disorder in a subject comprising the steps of: (a) contacting a cell that is being treated with or has been treated with a candidate agent with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third 544901-5932-3024.1Atty. Docket No. 114203-1577probe; (ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest; (c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell; (e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; (f) imaging the cell, thereby imaging RNA in the cell; and (g) administering a treatment for the disease or disorder to the subject if a difference in the polysome structure in the cell relative to one or more non-diseased cells is observed.

[0122] In one aspect, the present disclosure provides a method for treating a disease or disorder in a subject, the method comprising: (a) contacting a cell that is being treated with or has been treated with a candidate agent with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a 554901-5932-3024.1Atty. Docket No. 114203-1577ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest; (c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell; (e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; (f) imaging the cell, thereby imaging RNA in the cell; and (g) administering a treatment for the disease or disorder to the subject if a difference in the polysome structure in the cell relative to one or more non-diseased cells is observed.

[0123] In some embodiments, polysome structure in one or more non-diseased cells is profiled simultaneously using the methods disclosed herein as a control experiment. In some embodiments, the polysome structure data in one or more non-diseased cells that is compared to polysome structure in a diseased cell comprises reference data from a time the method was performed on a non-diseased cell previously.

[0124] In some embodiments, the treatment comprises administering a therapeutic agent. In some embodiments, the treatment comprises surgery. In some embodiments, the treatment comprises imaging. In some embodiments, the treatment comprises performing further diagnostic methods. In some embodiments, the treatment comprises radiation therapy. In some embodiments, the therapeutic agent is a small molecule, a protein, a peptide, a nucleic 564901-5932-3024.1Atty. Docket No. 114203-1577acid, a lipid, or a carbohydrate. In some embodiments, the therapeutic agent is a known drug and / or an FDA-approved drug. In certain embodiments, the protein is an antibody. In certain embodiments, the protein is an antibody fragment or antibody variant. In certain embodiments, the protein is a receptor, or a fragment or variant thereof. In certain embodiments, the protein is a cytokine. In certain embodiments, the nucleic acid is an mRNA, an antisense RNA, an miRNA, an siRNA, an RNA aptamer, a double stranded RNA (dsRNA), a short hairpin RNA (shRNA), or an antisense oligonucleotide (ASO).

[0125] Treatment of any disease or disorder is contemplated by the methods described herein. In some embodiments, the disease or disorder is a genetic disease, a proliferative disease, an inflammatory disease, an autoimmune disease, a liver disease, a spleen disease, a lung disease, a hematological disease, a neurological disease, a gastrointestinal (GI) tract disease, a genitourinary disease, an infectious disease, a musculoskeletal disease, an endocrine disease, a metabolic disorder, an immune disorder, a central nervous system (CNS) disorder, a neurological disorder, an ophthalmic disease, or a cardiovascular disease. In certain embodiments, the disease is cancer.

[0126] In some embodiments, the subject is a human. In some embodiments, the sample comprises a biological sample. In some embodiments, the sample comprises a tissue sample. In certain embodiments, the tissue sample is a biopsy (e.g., bone, bone marrow, breast, gastrointestinal tract, lung, liver, pancreas, prostate, brain, nerve, renal, endometrial, cervical, lymph node, muscle, or skin biopsy). In certain embodiments, the biopsy is a tumor biopsy. In certain embodiments, the biopsy is a solid tumor biopsy. In some embodiments, the tissue sample is a brain tissue sample. In certain embodiments, the tissue sample is a central nervous system tissue sample.Probes

[0127] The present disclosure also provides sets of probes for use in the methods and systems described herein. In one aspect, the present disclosure provides a set of probes comprising a first probe, a second probe, and a third probe, wherein: (a) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (b) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (c) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first574901-5932-3024.1Atty. Docket No. 114203-1577probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region.

[0128] In one aspect, the present disclosure provides a set of probes comprising a first probe, a second probe, and a third probe, wherein: (a) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (b) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (c) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region.

[0129] All of the probes described herein may optionally have spacers or linkers of various nucleotide lengths in between each of the recited components, or the components of the oligonucleotide probes may be joined directly to one another (z.e., by a phosphodiester bond). All of the probes described herein may comprise standard nucleotides, or some of the standard nucleotides may be substituted for any modified nucleotides known in the art.

[0130] The set of probes described herein comprises a first probe, a second probe, and a third probe. The first probe and second probe each comprises a portion that recognizes a ribosome. The portion of the probe that recognizes a ribosome may be a protein, peptide, nucleic acid, or small molecule. In some embodiments, the portion of the first probe or second probe that recognizes a ribosome is an agent that binds an antibody, or an antibody variant or fragment. In certain embodiments, the portion of the first probe or second probe that recognizes the ribosome comprises an antibody (e.g., a secondary antibody), or an antibody variant or fragment. The primary antibody may recognize any portion of the ribosome, for example, any protein, nucleic acid (e.g, rRNA), or combination thereof of the ribosome. In some embodiments, the primary antibody is an anti-40S ribosomal protein S3 (RPS3) antibody (e.g, an anti-RPS3 monoclonal antibody), for the first probe. In some embodiments, the antibody is an anti-60S ribosomal protein L4 (RPL4) antibody (e.g., an anti-RPL4 polyclonal antibody), for the second probe. In place of an antibody, the present disclosure also contemplates the use of any agent capable of recognizing the ribosome on the probes described herein. In some embodiments, the portion of the first probe or second probe that recognizes the ribosome comprises an oligonucleotide that is complementary to a portion of the ribosomal RNA (rRNA) within the ribosome. In some embodiments, the portion of the first probe or second probe that recognizes the ribosome comprises an oligonucleotide that is 584901-5932-3024.1Atty. Docket No. 114203-1577complementary to a portion of the 40S small ribosomal subunit (including, e.g., the 18S rRNA) (for the first probe) or to a portion of the 60S large ribosomal subunit (including, e.g., the 5S rRNA, the 28S rRNA, and the 5.8S rRNA) (for the second probe). In some embodiments, the portion of the first probe that recognizes the 40S subunit of a ribosome comprises an oligonucleotide that is complementary to a portion of the 18S rRNA. In some embodiments, the portion of the second probe that recognizes the 60S subunit of a ribosome comprises an oligonucleotide that is complementary to a portion of the 28S rRNA. In certain embodiments, the oligonucleotide complementary to a portion of rRNA is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more than 30 nucleotides in length. In certain embodiments, the oligonucleotide complementary to a portion of rRNA is about 25 nucleotides in length.

[0131] In addition to the portion that recognizes the ribosome, the each of the first probe and the second probe also comprises a portion that is complementary to a portion of the third probe.

[0132] In some embodiments, the portion of the first probe that is complementary to a portion of the third probe is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides in length. In some embodiments, the portion of the first probe that is complementary to a portion of the third probe is 9-15 nucleotides in length. In some embodiments, the portion of the first probe that is complementary to a portion of the third probe is 9-11 nucleotides in length. In some embodiments, the portion of the first probe that is complementary to a portion of the third probe is 9 nucleotides in length. In some embodiments, the portion of the first probe that is complementary to a portion of the third probe is 10 nucleotides in length. In some embodiments, the portion of the first probe that is complementary to a portion of the third probe is 11 nucleotides in length.

[0133] In certain embodiments, the portion of the first probe that is complementary to a portion of the third probe and the portion of the first probe that recognizes the 40S subunit of the ribosome are joined by a poly- A nucleotide linker. In some embodiments, the poly- A nucleotide linker of the first probe is about 10-20 nucleotides in length. In some embodiments, the poly-A nucleotide linker of the first probe is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the poly-A nucleotide linker of the first probe is about 10 nucleotides in length. In some embodiments, the poly-A nucleotide linker of the first probe is 10 nucleotides in length.

[0134] The present disclosure contemplates any arrangement of the portions of the first probe. In some embodiments, the first probe comprises the structure:594901-5932-3024.1Atty. Docket No. 114203-15775 '-[portion recognizing the 40S subunit of the ribosome]-[portion complementary to the third probe]-3'; or5 '-[portion recognizing the 40S subunit of the ribosome]-[poly-A linker]-[portion complementary to the third probe]-3'5 '-[portion complementary to the third probe]-[portion recognizing the 40S subunit of the ribosome]-3'; or5 '-[portion complementary to the third probe]-[poly-A linker]-[portion recognizing the 40S subunit of the ribosome]-3'wherein ]-[ comprises an optional linker (e.g., nucleotide linker, e.g., a poly-A linker). In some embodiments, ]-[ represents a direct linkage between two portions of the third oligonucleotide probe ( / .< ., a phosphodiester bond).

[0135] In some embodiments, the portion of the second probe that is complementary to a portion of the third probe is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides in length. In some embodiments, the portion of the second probe that is complementary to a portion of the third probe is 9-15 nucleotides in length. In some embodiments, the portion of the second probe that is complementary to a portion of the third probe is 9-11 nucleotides in length. In some embodiments, the portion of the second probe that is complementary to a portion of the third probe is 9 nucleotides in length. In some embodiments, the portion of the second probe that is complementary to a portion of the third probe is 10 nucleotides in length. In some embodiments, the portion of the second probe that is complementary to a portion of the third probe is 11 nucleotides in length.

[0136] In certain embodiments, the portion of the second probe that is complementary to a portion of the third probe and the portion of the second probe that recognizes the 60S subunit of the ribosome are joined by a poly-A nucleotide linker. In some embodiments, the poly-A nucleotide linker of the second probe is about 10-20 nucleotides in length. In some embodiments, the poly-A nucleotide linker of the second probe is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the poly-A nucleotide linker of the second probe is about 10 nucleotides in length. In some embodiments, the poly-A nucleotide linker of the second probe is 10 nucleotides in length.

[0137] The present disclosure contemplates any arrangement of the portions of the second probe. In some embodiments, the second probe comprises the structure:5 '-[portion complementary to the third probe]-[portion recognizing the 60S subunit of the ribosome]-3'; or604901-5932-3024.1Atty. Docket No. 114203-15775 '-[portion complementary to the third probe]-[poly-A linker]-[portion recognizing the 60S subunit of the ribosome]-3'; or5 '-[portion recognizing the 60S subunit of the ribosome]-[portion complementary to the third probe]-3'; or5 '-[portion recognizing the 60S subunit of the ribosome]-[poly-A linker]-[portion complementary to the third probe]-3';wherein ]-[ comprises an optional linker (e.g., nucleotide linker, e.g., a poly-A linker). In some embodiments, ]-[ represents a direct linkage between two portions of the third oligonucleotide probe ( / .< ., a phosphodiester bond).

[0138] In some embodiments, the portion of the third probe that is complementary to a portion of the first probe is 9-11 nucleotides in length, and the portion of the third probe that is complementary to a portion of the second probe is 9-11 nucleotides in length. In some embodiments, the portion of the third probe that is complementary to a portion of the first probe is 9 nucleotides in length, and the portion of the third probe that is complementary to a portion of the second probe is 11 nucleotides in length. In some embodiments, the portion of the third probe that is complementary to a portion of the first probe is 10 nucleotides in length, and the portion of the third probe that is complementary to a portion of the second probe is 10 nucleotides in length.

[0139] As described herein, the third probe (also referred to herein as a “splint probe” or as a “blocked probe”) comprises a portion that is complementary to a portion of the first probe and a portion that is complementary to a portion of the second probe, thereby recognizing a ribosome ( / .< ., a ribosome that is bound to and is actively translating the RNA of interest). The third probe also comprises an imaging probe docking site region. The imaging probe docking site region can be contacted by an imaging probe. In some embodiments, an imaging probe hybridizes to the imaging probe docking site region. In some embodiments, the imaging probe docking site region is about 2 to about 25 nucleotides in length. In some embodiments, the imaging probe docking site region is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleotides in length. In some embodiments, the imaging probe docking site region is about 7-10 nucleotides in length. In some embodiments, the imaging probe docking site region is 7-10 nucleotides in length.

[0140] In addition to the portion that recognizes the ribosome, the third probe also comprises a portion that is complementary to a portion of the first probe. In some embodiments, the portion of the third probe that is complementary to a portion of the first probe is 5-15, 6-14, 7-13, 8-12, or 9-11 nucleotides in length. In some embodiments, the portion of the third 614901-5932-3024.1Atty. Docket No. 114203-1577probe that is complementary to a portion of the first probe is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides in length.

[0141] In addition to the portion that recognizes the ribosome, the third probe also comprises a portion that is complementary to a portion of the second probe. In some embodiments, the portion of the third probe that is complementary to a portion of the second probe is 5-15, 6-14, 7-13, 8-12, or 9-11 nucleotides in length. In some embodiments, the portion of the third probe that is complementary to a portion of the second probe is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides in length.

[0142] In certain embodiments, the portion of the third probe that is complementary to a portion of the first probe and the portion of the third probe that is complementary to a portion of the second probe are joined to the imaging probe docking site region by a poly-A nucleotide linker. In some embodiments, the poly-A nucleotide linker is about 10-20 nucleotides in length. In some embodiments, the poly-A nucleotide linker of the third probe is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the poly-A nucleotide linker is about 10 nucleotides in length. In some embodiments, the poly-A nucleotide linker is 10 nucleotides in length.

[0143] The present disclosure contemplates any arrangement of the portions of the third probe. In some embodiments, the third probe comprises the structure:5 '-[portion complementary to portion of second probe]-[portion complementary to portion of first probe]-[imaging probe docking site region]-3'; or5 '-[portion complementary to portion of second probe]-[portion complementary to portion of first probe]-[poly-A linker] -[imaging probe docking site region]-3'; or 5 '-[portion complementary to portion of first probe]-[portion complementary to portion of second probe]-[imaging probe docking site region]-3'; or5 '-[portion complementary to portion of first probe]-[portion complementary to portion of second probe]-[poly-A linker]-[imaging probe docking site region]-3' wherein ]-[ comprises an optional linker (e.g., nucleotide linker). In some embodiments, ]-[ represents a direct linkage between two portions of the third oligonucleotide probe.

[0144] In some embodiments, the first imaging probe comprises an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a label. In some embodiments, the label is a fluorescent label. In some embodiments, the first imaging probe comprises an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe and a fluorescent label. The label can be present on the 3’ end or on the 5’ end of the 624901-5932-3024.1Atty. Docket No. 114203-1577first imaging probe. In some embodiments, the label (e.g., fluorescent label) is present in the 3’ end of the first imaging probe. In some embodiments, the label (e.g., fluorescent label) is present on the 5’ end of the first imaging probe. In some embodiments, the first imaging probe is a single-stranded oligonucleotide probe. In some embodiments, the first imaging probe is about 4-25, about 5-20, about 5-15, or about 7-10 nucleotides in length. In some embodiments, the first imaging probe is 4-25, 5-20, 5-15, or 7-10 nucleotides in length. In some embodiments, the first imaging probe is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleotides in length.

[0145] The present disclosure contemplates any arrangement of the portions of the first imaging probe. In some embodiments, the first imaging probe comprises the structure:5 '-[portion complementary to imaging probe docking site region of the third probe]- [fluorescent label]-3'; or5 '-[fluorescent label]-[portion complementary to imaging probe docking site region of the third probe]-3'; or5 '-[portion complementary to imaging probe docking site region of the third probe]- [linker]- [fluorescent label]-3 '; or5 '-[fluorescent label]-[linker]-[portion complementary to imaging probe docking site region of the third probe]-3',wherein ]-[ comprises an optional linker (e.g., nucleotide linker). In some embodiments, ]-[ represents a direct linkage between two portions of the first imaging probe.

[0146] The present disclosure provides one or more RNA target probes. In some embodiments, an RNA target probe comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region.

[0147] In some embodiments, the RNA target probe comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region. The imaging probe docking site region of the RNA target probe can be contacted by an imaging probe. In some embodiments, an imaging probe hybridizes to the imaging probe docking site region of the RNA target probe. In some embodiments, the imaging probe docking site region is about 2 to about 25 nucleotides in length. In some embodiments, the imaging probe docking site region is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleotides in length. In some embodiments, the imaging probe docking site region is about 7-10 nucleotides in length. In some embodiments, the imaging probe docking site region is 7-10 nucleotides in length. In some embodiments, the portion of the RNA target probe that is complementary to an RNA of interest is about 5, about 6, about 7, about 8, about 634901-5932-3024.1Atty. Docket No. 114203-15779, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or about 30 nucleotides long. In some embodiments, the first probe is about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, or about 40 nucleotides long or longer. In some embodiments, each of the probes of the set of RNA target probes hybridize to the same RNA of interest.

[0148] The present disclosure contemplates any arrangement of the portions of the RNA target probe. In some embodiments, the RNA target probe comprises the structure:5'-[portion complementary to RNA of interest]-[imaging probe docking site region]- 3'; or5'-[imaging probe docking site region]-[portion complementary to RNA of interests',wherein ]-[ comprises an optional linker (e.g., nucleotide linker). In some embodiments, ]-[ represents a direct linkage between two portions of the RNA target probe.

[0149] In some embodiments, the imaging probe docking site region of the third probe and the imaging probe docking site region of any of the RNA target probes are not identical.

[0150] The present disclosure provides a second imaging probe. In some embodiments, the second imaging probe comprises an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a label. In some embodiments, the label is a fluorescent label. In some embodiments, the second imaging probe comprises an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe and a fluorescent label. The label can be present on the 3’ end or on the 5’ end of the second imaging probe. In some embodiments, the label (e.g., fluorescent label) is present in the 3’ end of the second imaging probe. In some embodiments, the label (e.g, fluorescent label) is present in the 5’ end of the second imaging probe. In some embodiments, the second imaging probe is a single-stranded oligonucleotide probe. In some embodiments, the second imaging probe is about 4-25, about 5-20, about 5-15, or about 7-10 nucleotides in length. In some embodiments, the second imaging probe is 4-25, 5-20, 5-15, or 7-10 nucleotides in length. In some embodiments, the second imaging probe is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleotides in length.644901-5932-3024.1Atty. Docket No. 114203-1577

[0151] The present disclosure contemplates any arrangement of the portions of the second imaging probe. In some embodiments, the second imaging probe comprises the structure:5 '-[portion complementary to imaging probe docking site region of the RNA target probe] -[fluorescent lab el] -3'; or5 '-[fluorescent label]-[portion complementary to imaging probe docking site region of the RNA target probe]-3'; or5 '-[portion complementary to imaging probe docking site region of the RNA target probe]-[linker]-[fluorescent label]-3 '; or5 '-[fluorescent label]-[linker]-[portion complementary to imaging probe docking site region of the RNA target probe]-3'.wherein ]-[ comprises an optional linker (e.g., nucleotide linker). In some embodiments, ]-[ represents a direct linkage between two portions of the second imaging probe.

[0152] In some embodiments, within each set of RNA target probes, each RNA target probe comprises the same imaging probe docking site region. In some embodiments, within each set of RNA target probes, each RNA target probe comprises an imaging probe docking site region that is not identical to the imaging probe docking site region of any probe in any other set of RNA target probes.

[0153] In some embodiments, the present disclosure provides a plurality of probes comprising multiple sets of probes as described herein. In certain embodiments, each set of probes in the plurality of probes comprises oligonucleotide portions that are complementary to a different RNA of interest.Kits

[0154] Also provided by the disclosure are kits. In one aspect, the kits provided may comprise one or more of the probes as described herein. In some embodiments, the kits comprise any of the sets of probes described herein, or multiple sets of probes. In some embodiments, the kits may further comprise a container (e.g., a vial, ampule, bottle, and / or dispenser package, or other suitable container). The kits may also comprise cells for performing control experiments. In some embodiments, the kits may further comprise other reagents for performing the methods disclosed herein (e.g., enzymes such as a ligase or a polymerase, amine-modified nucleotides as described herein, primary antibodies, secondary antibodies, buffers, reagents and monomers for making a polymeric matrix (e.g., a polyacrylamide matrix), and / or imaging reagents). In some embodiments, the kits are useful for profiling polysome structure in a cell. In some embodiments, the kits are useful for 654901-5932-3024.1Atty. Docket No. 114203-1577diagnosing a disease in a subject. In some embodiments, the kits are useful for screening for an agent capable of modulating polysome structure. In some embodiments, the kits are useful for diagnosing a disease or disorder in a subject. In some embodiments, the kits are useful for treating a disease or disorder in a subject. In certain embodiments, a kit described herein further includes instructions for using the kit.Systems

[0155] In one aspect, the present disclosure provides systems for super-resolution polysome imaging in a cell. In some embodiments, such a system comprises: (a) a cell; (b) one or more set of probes comprising a first probe, a second probe, and a third probe, wherein: (i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (c) a microscope; and (d) a computer.

[0156] Any of the probes (z.e., the pairs of probes or sets of probes) described herein may be used in the systems contemplated by the present disclosure. In some embodiments, the microscope is a confocal microscope. In some embodiments, the microscope is a superresolution microscope. In some embodiments, the system further comprises a CPU. In some embodiments, the system further comprises computer storage and / or memory, or a storage device. In some embodiments, the system further comprises a camera. In some embodiments, the system further comprises a CCD. In some embodiments, the system further comprises software for performing microscopy and / or for image analysis. In some embodiments, the system further comprises a ligase. In some embodiments, the system further comprises a polymerase. In some embodiments, the system further comprises amine-modified nucleotides. In some embodiments, the system further comprises reagents for making a polymeric matrix (e.g., a polyacrylamide matrix). In some embodiments, the system further comprises an imaging reagent. The cell in the systems of the present disclosure may be of any of the cell types disclosed herein. In some embodiments, the system comprises multiple cells. In some embodiments, the cells are of different cell types.664901-5932-3024.1Atty. Docket No. 114203-1577In certain embodiments, the cells are present in a tissue. In some embodiments, the tissue is a tissue sample provided by or from a subject. In certain embodiments, the subject is a human.Assembled ribosome complexes

[0157] In one aspect, the present disclosure provides assembled ribosome complexes. In some embodiments, such assembled ribosome complexes are not naturally-occurring. In some embodiments, an assembled ribosome complex provided herein comprises: (a) a first oligonucleotide probe, a second oligonucleotide probe, and a third oligonucleotide probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; (b) a 40S subunit of a ribosome; and (c) a 60S subunit of a ribosome.

[0158] In one aspect, the present disclosure provides an assembled ribosome complex comprising: (a) a first oligonucleotide probe, a second oligonucleotide probe, and a third oligonucleotide probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; (ii) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; and (b) a first subunit of a ribosome; and (c) a second subunit of a ribosome.

[0159] In some embodiments, the assembled ribosome complex further comprises a target RNA of interest.

[0160] In some embodiments, the assembled ribosome complex further comprises a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a label (e.g., fluorescent label).674901-5932-3024.1Atty. Docket No. 114203-1577

[0161] In some embodiments, the assembled ribosome complex further comprises one or more RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to the RNA of interest and an imaging probe docking site region.

[0162] In some embodiments, the assembled ribosome complex further comprises a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label.EXAMPLES

[0163] These examples are provided for illustrative purposes only and not to limit the scope of the claims provided herein.Example 1: Super-resolution (SR) polysome imaging by individual targeting of ribosome subunits

[0164] The 80S ribosome, responsible for translating mRNA in eukaryotic cells, consists of two distinct subunits: the smaller 40S subunit and the larger 60S subunit (Yusupova & Yusupov, 2014). Each subunit is a self-assembled complex comprising multiple proteins and ribosomal RNA (rRNA) (Evans et al., 1974). To fluorescently label polysomes, probes must target each component of the polysome, which includes the 40S and 60S subunits, as well as the ribosome-bound mRNA (FIG. 2A). To first label the 80S ribosome, Applicant first designed a set of highly specific DNA FISH probes that target the rRNAs of each individual subunit (18S rRNA and 28S rRNA for 40S and 60S complex respectively, see FIG. 2B for schematic). Compared to antibodies, oligonucleotide probes offer smaller size, improving labeling efficiency and reducing linkage errors that can introduce artifacts in future nanoscopic measurements (Friih et al., 2021).

[0165] To minimize off-target binding, Applicant filtered the probes (referred now as the 18S and 28 S probes for each subunit) based on the number of off-target hits identified through BLAST searches and verified their accessibility to rRNA by examining rRNA secondary structures (Holmberg et al., 1994). In this initial approach, Applicant can image each subunit in a separate color channel. The 80S complex will form only when the subunits are in close proximity, and one can infer the positions of the 80S complex based on the colocalization of the individual subunits. Given the high specificity and 1-10 nm spatial resolution of recently developed single-molecule-based SR approaches such as MINFLUX (Balzarotti et al., 2017) and expansion STORM (Zwettler et al., 2020), Applicant modified probes to be compatible 684901-5932-3024.1Atty. Docket No. 114203-1577with these approaches. These methods fundamentally rely on imaging single molecules. Thus, Applicant designed polysome probes to enable DNA-PAINT (Jungmann et al., 2014; Schnitzbauer et al., 2017), a single-molecule imaging method (FIG. 2B, inset). In DNA-PAINT, a short 7-10-mer fluorescent oligo stochastically and transiently binds to a target labeled with a complementary docking site. This binding generates an "on" and "off blinking signal, which prevents optical overcrowding during imaging and enables single-molecule detection (Mbeki & Moerner, 2020; Moemer, 2012). The blinking signals from individual molecules can then be subsequently localized with high precision. By collecting and processing thousands of camera frames containing low-density blinking emitters, a SR image can then be generated, as described in previous DNA-PAINT studies (Chung et al., 2022; Jungmann et al., 2014). DNA-PAINT is particularly advantageous for the present approach because it offers high multiplexity — a critical feature for in situ polysome SR sequencing experiments.

[0166] Recent studies have demonstrated that SR DNA-PAINT imaging can visualize nearly 10-30 different types of targets (Schueder et al., 2024; Unterauer et al., 2024), representing a significant improvement in multiplexity compared to earlier single-molecule-based SR methods (Bates et al., 2007). To harness this capability, Applicant appended a DNA-PAINT docking site region to the 3' end of the probes. Additionally, a 10-adenosine spacer was added between the rRNA and DNA-PAINT docking sites to enhance probe flexibility (FIG. 2B, inset). These probes were hybridized to fixed 3T3 NIH fibroblast cells, followed by stringent washing to remove unbound or nonspecific probes. Since Applicant designed the DNA-PAINT docking sites for the 18S and 28S probes to be orthogonal, their imaging probe sequences differ. Each target can be imaged in sequential rounds using different imaging probes but the same dye, a key principle that enables highly multiplexed super-resolution imaging (Bates et al., 2007; Jungmann et al., 2014).

[0167] The samples were imaged using a single-molecule microscope with 1 nM ATTO 655-labeled complementary oligo (“imaging probe”) in solution. For this experiment, Applicant imaged both samples separately in a one-color imaging experiment. Applicant observed strong blinking signals (FIG. 2C) and subsequently captured nearly 40,000 frames of data for both subunits. Reconstruction of the data (FIG. 2D) generated SR images of both subunits, revealing potential polysome structures (white arrows in insets). This standard DNA-PAINT imaging approach provides a resolution of approximately 20 nm (Jungmann et al., 2014). While this precision is lower than that of other more complex SR methods, standard DNA-PAINT imaging enables significantly higher throughput and serves as an effective694901-5932-3024.1Atty. Docket No. 114203-1577benchmarking strategy for imaging using the present technologies. Other experiments combine DNA-PAINT with lower throughput and more challenging techniques such as MINFLUX (Balzarotti et al., 2017) or expansion microscopy (Chen et al., 2015) to achieve higher spatial resolutions of 1-10 nm, enabling more detailed visualization of polysomes. Example 2: Super-resolution (SR) polysome imaging by targeting fully-assembled 80S ribosomes

[0168] While imaging each ribosomal subunit separately is feasible, this approach presents several significant challenges. First, a primary interest lies in the 80S ribosome complex, not the individual subunits. To identify the 80S complex after separately imaging the 40S and 60S subunits, a computational strategy is required to determine when the subunits are in sufficiently close proximity to form the complex. As the cell is densely packed with ribosomes, disentangling whether two subunits are part of the same 80S ribosome or belong to adjacent ribosomes can be computationally demanding, leading to considerable inaccuracies. Second, this approach necessitates two-color imaging to visualize a single target — the 80S complex. For 1-10 nm spatial resolution super-resolution techniques like MINFLUX (Balzarotti et al., 2017), which are already low-throughput, adding an additional imaging round further reduces scalability. Finally, as there are many individual subunits not assembled into a complex, imaging these unassembled targets does not provide information about the polysome. These non-specific labels will lead to increased challenges in computationally identifying the 80S complex, and, as more unnecessary targets must be localized and imaged, further decrease throughput and scalability.

[0169] To address the limitations, Applicant designed and developed a scheme to specifically target the 80S complex for SR imaging. In this approach, the DNA-PAINT docking sites from the 18S and 28S probes described previously are replaced with a “linker docking site” ( / .< ., an oligonucleotide portion that is complementary to a portion of the linker probe (i.e., the third probe”) (FIG.3). Each subunit probe is assigned a distinct 9- to 11 -nucleotide sequence. Additionally, an 80S “linker probe” is introduced, which binds to the linker docking sites on both of the 18S and 28S probes. Critically, if the 80S linker binds to only one arm (partial hybridization), the interaction is insufficient to withstand subsequent harsh washing steps, and the 80S linker is removed. For the 80S linker to remain stable, it must bind to both arms, a condition that occurs only when the individual subunits are in close proximity during 80S assembly and translation. To further enhance probe stability, the 28S probe is designed with a 5' phosphate group, enabling the ligation of the 18S and 28S probes upon stable 80S linker binding. This ligation step strengthens the attachment of the 80S probe 704901-5932-3024.1Atty. Docket No. 114203-1577and allows for an additional harsh wash to remove residual partial hybridization, improving specificity. The final 80S-specific probe is designed with an additional 10-adenosine linker followed by a DNA-PAINT docking site, facilitating single-molecule SR imaging. The workflow for this method is outlined step-by-step throughout FIG. 3.

[0170] To validate the method, Applicant targeted and imaged the 80S ribosome in HeLa cells and included controls where either the 18S or 28S probes were omitted during hybridization. FIG. 4 shows a high 80S signal with extremely low partial hybridization signal.

[0171] As an additional test, Applicant treated cells with various translational inhibitor drug cocktails (FIG. 5A). These inhibitors are known to significantly disrupt 80S assembly (Burke et al., 2017; Sun et al., 2021). FIG. 5 A demonstrates that treatment with two different drug cocktails results in a significant decrease in the 80S SR signal. Further quantification of the localization density corroborates this result (FIG. 5B).

[0172] Applicant’s findings showcase a novel approach to specifically target the 80S ribosome for SR experiments. In addition to this optimized and highly specific scheme, Applicant has also tested several alternative strategies to label the 80S ribosome (FIG. 6). Example 3. Super-resolution (SR) polysome imaging by targeting specific mRNA sequences

[0173] As mentioned above, the polysome consists of the 80S ribosome and ribosome-bound mRNA. To selectively label mRNA, Applicant developed DNA-PAINT probes targeting Firefly luciferase, a gene not expressed in human or mouse mammalian cells (FIG. 7A) (Thorne et al., 2010). This strategy allows Applicant to benchmark the method and assess probe specificity by comparing non-transfected cells to cells transfected with Firefly luciferase. This is a generalized strategy to label RNA and can be extended to other sequences. To visualize the nanoscopic shape of RNA with 1-10 nm resolution SR methods, it is essential to sample as many positions along the RNA coding region of interest as possible. Without dense labeling, certain regions of the RNA will be absent in the final SR image.

[0174] While a few probes were excluded due to off-target binding to the cell transcriptome, Applicant designed a comprehensive set of probes to sample as much of the Firefly luciferase RNA as possible. These probes include a Firefly luciferase binding region, a 10-adenosine linker, and a DNA-PAINT docking site. The docking site is orthogonal to the 80S DNA-PAINT docking site, enabling future multi-color imaging of both 80S ribosomes and mRNA to visualize polysomes. Applicant observed strong signals in transfected cells and extremely 714901-5932-3024.1Atty. Docket No. 114203-1577low signals in non-transfected cells (FIG. 7B). Based on the clear separation of individual mRNA puncta in the Firefly Luciferase sample, computationally assigning and aligning specific ribosomes to individual RNA molecules is feasible in multi-color 1-10 nm SR experiments.Example 4. Super-resolution (SR) polysome imaging by Expansion DNA-PAINT

[0175] Alone, DNA-PAINT does not offer the necessary spatial resolution to visualize polysome structures. While it is possible to combine DNA-PAINT with MINFLUX to reach 1-10 nm spatial resolution (Ostersehlt et al., 2022), the method is low-throughput, making it challenging for high multiplexed mRNA imaging. Expansion microscopy offers an alternative strategy to increase the spatial resolution without compromising the throughput (Chen et al., 2015), with implementations now reaching spatial resolution close to DNA-PAINT (Wang et al., 2024).

[0176] Applicant combined expansion microscopy with DNA-PAINT (Expansion DNA-PAINT) to reach the desired 1-10 nm spatial resolution. Expansion microscopy involves preparing the sample into a hydrogel which physically expands upon salt-free hydration. Conventional hydrogels can be constructed by crosslinking acrylamide and bis-acrylamide, both of which contain the acryl chemical functional group. Expansion microscopy adds a new reagent during the sample preparation, sodium acrylate, which is incorporated into the hydrogel due to its acryl group. However, this molecule’s acryl group contains a negatively-charged carboxylic acid group, instead of the usual amide group component. Salt ions in solution will screen the charge, but in conditions without salt ions (pure water), the carboxylic acid groups to electrostatically repel each other, causing the gel to expand. The net result is a sample which is 3-20x larger (Chang et al., 2017; Chen et al., 2015; Shaib et al., 2024; Truckenbrodt et al., 2018; Wang et al., 2024).

[0177] Applicant developed a new 80S labelling scheme that allows a linker probe to be embedded in a hydrogel, ensuring compatibility with Expansion microscopy. Applicant added acryl functional groups onto the linker probe, one at each of the 5’ and 3’ ends (FIG.8A).

[0178] Initially, Applicant tested the feasibility of DNA PAINT in a conventional hydrogel (i.e., one that does not expand). It was necessary to know whether the DNA PAINT imaging strands can diffuse sufficiently in a hydrogel and reversibly bind to provide single molecule blinks. After incubating the sample for one hour with the DNA-PAINT imaging strands, this allowed the stands to diffuse in the sample. Applicant observed a clear blinking signal, allowing for the reconstruction of a super-resolution image (FIG. 8B). Applicant was also 724901-5932-3024.1Atty. Docket No. 114203-1577able to extinguish the signal and reintroduce it via simple buffer exchange, which can facilitate multiplexed imaging experiments (FIG. 8C). The signal was higher for the second round due to differences during the incubation of the imaging strands. The signal does not decrease between imaging rounds, providing evidence for its feasibility in multi-round multiplexed imaging.

[0179] Applicant modified the standard expansion microscopy protocol to facilitate DNA-PAINT imaging. The expanded gel is stable in pure water but will shrink in the presence of salt. But for DNA PAINT, the DNA molecules have a negatively charged phosphate backbone, and these backbones will repel each other if not screened by ions, causing DNA hybridization events to be limited. Applicant found that DNA PAINT was possible when using a low salt concentration (e.g., as low as 50 mM NaCl with 0.09x PBS), but at the expense of the signal, which was significantly lower than expected from the conventional salt conditions (500 mM NaCl with 0.9-1. Ox PBS). Therefore, Applicant needed to use the DNA PAINT imaging salt conditions. Applicant stabilized the hydrogel in its expanded conformation by re-embedding it into a second gel. As a further note, Applicant found that the carboxylic acid groups diminished the DNA PAINT imaging signal, likely because of electrostatic repulsions to the phosphate backbone; Applicant found it necessary to transform the functional groups to a neutral charge. Applicant used conventional NHS / EDAC chemistry to convert them to amide groups. This step is called passivation (FIG. 8D) (Alon et al., 2021).

[0180] As shown in FIG. 8E, polysome structures could be visualized using the aforementioned 80S labelling scheme. The expansion factor was 3x and the effective localization precision was 5 nm. Applicant visualized circular (FIG. 8F) and linear (FIG. 8G) polysome structures. Applicant also observed individual spots in the image; these were similar to the length scale of a single ribosome (FIG. 8H). The results in FIG. 8 demonstrate that expansion microscopy can be combined with DNA PAINT using an 80S labelling strategy to enable super-resolution imaging of polysome structures in cells.Example 5. Hydrogel mRNA DNA-PAINT imaging

[0181] Understanding the relationship between mRNA sequence identity and polysome structure, as well as how this relationship varies within subcellular compartments, is critical to achieving a deeper understanding of how mRNA sequence influences polysomal structures, how polysomes modulate their function, how polysomal structural distributions are spatially regulated, what factors lead to polysome dysfunction, and how such factors contribute to disease.734901-5932-3024.1Atty. Docket No. 114203-1577

[0182] To investigate polysome-sequence relationships effectively, two key technical requirements must be met. First, mRNA-targeting DNA-PAINT probes must be embedded in hydrogels and fully compatible with expansion microscopy, allowing for the simultaneous visualization of the 80S complex alongside specific mRNA molecules. Second, one must be able to image hundreds to thousands of distinct mRNAs in a highly multiplexed, high-throughput manner — comparable to current diffraction-limited spatial transcriptomics approaches (see, e.g., Shi et al., 2023; Zeng et al., 2023).

[0183] Applicant first extended their mRNA DNA-PAINT probes to be compatible with expansion microscopy and hydrogel embedding. For an mRNA molecule of approximately 1,000 bases, the total number of requisite DNA-PAINT probes ranges from 30 to 60.Functionalizing each probe with both acryl and amine groups can quickly become cost-prohibitive — especially for multiplexed experiments that require visualization of hundreds to thousands of different mRNA species. To address this, Applicant adopted a scalable hydrogel-embedding probe design previously described (FIG. 9A) (Sui et al., 2024). Briefly, a 20-mer “flanking linker” sequence was appended to the 5' end of each mRNA DNA-PAINT probe, separated from the mRNA-complementary region by a 5-adenosine spacer. This linker sequence - chosen for its minimal off-target binding to the human transcriptome - was designed to be complementary to a secondary adapter probe (i.e., an expansion adapter probe) that is modified with both an acrydite and an amine group (Sui et al., 2024). The acrydite and amine groups can be functionalized at either the 5' or 3' end of the adapter, in any orientation.

[0184] To enhance the stability of the adapter-linker interaction, the probes can be photocrosslinked. The expansion adapter probe can include a nucleoside analog, such as 3-cyanovinylcarbazole nucleoside (CNVK), which enables rapid photocrosslinking upon exposure to 366 nm UV light, eliminating the need for enzymatic ligation (Yoshimura & Fujimoto, 2008). Crucially, the adapter and flanking linker sequences can be identical across all mRNA probes, meaning that only a single acrydite- and amine-modified probe must be synthesized. This can dramatically reduce the overall cost. Following photocrosslinking, the probes are hybridized to their mRNA targets and then embedded into the hydrogel via the acryl functional groups present on the adapter. The DNA-PAINT docking site is appended to the 3' end of these scalable probes, with a 5-adenosine spacer separating it from the mRNA-complementary region.

[0185] To test this approach, Applicant designed scalable hydrogel-embedding DNA-PAINT probes targeting Firefly luciferase, an exogenous mRNA introduced into HeLa cells.Following transfection, Applicant hybridized approximately 15 scalable probes along the 744901-5932-3024.1Atty. Docket No. 114203-1577coding region of the mRNA. The cells were then embedded in a hydrogel and imaged using DNA-PAINT. The super-resolution (SR) imaging results revealed strong mRNA signal with minimal non-specific background (FIG. 9B, left and right panels). An additional benefit of hydrogel embedding is enhanced probe stability; even after storing the sample for a total of 11 days — partly at room temperature and partly at 4 °C — the mRNA signal remained robust (FIG. 9B, middle panel). This high stability supports the feasibility of long-term, multiplexed imaging experiments.Example 6. Multiplexed mRNA super-resolution imaging

[0186] Applicant next investigated the feasibility of highly multiplexed super-resolution (SR) mRNA imaging. As illustrated in FIG. 2, orthogonal DNA-PAINT docking sequences enable multiplexing over different imaging rounds (Jungmann et al., 2014). However, the number of DNA-PAINT sequences is limited. This limited palette stems from constraints related to sequence length and secondary structure. Specifically, imaging strands must avoid strong secondary structure formation, as such structures hinder efficient binding to the docking site (Strauss & Jungmann, 2020). Furthermore, sequences longer than approximately 10 bases exhibit slower binding kinetics, which is incompatible with rapid imaging. These combined constraints significantly restrict the number of viable imaging strands available for fast and efficient multiplexed imaging to only six possible DNA-PAINT sequences (Strauss & Jungmann, 2020).

[0187] A recent study expanded the number of fast-binding DNA-PAINT sequences to 10 (Banerjee et al., 2024), but this still falls far short of the multiplexing capabilities of conventional single-cell RNA sequencing and spatial transcriptomics, which can detect hundreds to thousands of mRNAs (Takei et al., 2025). Two recent studies increased DNA-PAINT multiplexing to nearly 30 targets using a transient adapter strategy (Schueder et al., 2024; Unterauer et al., 2024). Despite this advance, the method remains relatively low throughput. Imaging proceeds one target at a time per round, so the number of mRNAs imaged scales linearly with the number of rounds. In contrast, high-throughput spatial omics platforms like STARmap (Shi et al., 2023) achieve exponential scaling of target detection with each additional round (see Table 1 for a comparison of these methods). A comparable multiplexed detection scheme tailored to the super-resolution mRNA imaging approach would therefore be highly advantageous.

[0188] Applicant’s Expansion DNA-PAINT method achieves localization precision approaching 5 nm. Considering that the helical rise is 0.32 nm for double-stranded DNA and 0.64 nm for single-stranded DNA (Ambia-Garrido et al., 2010), Applicant’s probe design 754901-5932-3024.1Atty. Docket No. 114203-1577results in an average spacing of approximately 7-8 nm between probes. This resolutionallows Applicant to clearly resolve individual probes along the mRNA molecule.

[0189] Building on this capability, Applicant developed a novel multiplexed super-resolution sequencing strategy using two distinct designs. These approaches are expected tosignificantly enhance scalability and throughput, potentially approaching the throughputlevels of spatial transcriptomics (see Table 1 for comparison with previous multiplexedimaging methods). While some methods have been demonstrated using spectrally distinct dyes in a lower-resolution (~20 nm) 2D STORM setup (Cai, 2013; Lubeck & Cai, 2012), the present method offers several advantages. These include superior spatial resolution, the use of more distinct DNA-PAINT imaging strands (hereafter referred to as pseudo-colors), intrinsically higher labeling efficiency due to minimal photobleaching, and the potential for future 3D super-resolution imaging. Together, these features significantly enhance detection accuracy and throughput compared to the earlier 2D STORM-based approach.Table 1. Comparison of spatial resolution, multiplexity, and imaging rounds across in situ sequencing and multiplexed imaging methods.

[0190] As shown in Table 1, Applicant compared various in situ imaging approaches interms of spatial resolution, multiplexing capacity, and the number of required imagingrounds. Applicant’s methods are designated as Design 1, Design 2 (three groups), and Design 2 (four groups). Compared to existing DNA-PAINT -based multiplexed imaging techniques, Applicant’s approaches offer higher spatial resolution and greater multiplexity whilerequiring fewer rounds of imaging. Notably, Design 2 (four groups) achieves multiplexing levels comparable to diffraction-limited spatial transcriptomics methods such as STARmap, but with substantially higher resolution. While transient adapter strategies used in methods like FLASH-PAINT and SUM-PAINT can enhance multiplexity, their scalability is linear with the number of imaging rounds, which significantly reduces throughput relative to764901-5932-3024.1Atty. Docket No. 114203-1577Applicant’s designs. Reported values for FLASH-PAINT, SUM-PAINT, and STARmap are drawn from their original publications. Importantly, all DNA-PAINT -based schemes — including Applicant’s — can achieve a 2- to 3 -fold increase in throughput by incorporating multiple DNA-PAINT colors. The values presented here assume a single-color imaging channel.

[0191] FIG. 10A illustrates Applicant’s DNA-PAINT super-resolution barcoding scheme. Each mRNA of interest was divided into five spatially distinct groups along its length. For all mRNAs, Group 1 (Gl), located nearest the 5' end, was hybridized with probes sharing an identical docking site. This serves as a positional anchor and ensures a consistent starting point across all barcoded mRNAs. Groups 2 through 5 (G2-G5) were each hybridized with mRNA DNA-PAINT probes labeled with distinct pseudo-colors, designated herein as RX (e.g., Rl, corresponding to Gl; R2, corresponding to G2; etc.). While each group within a target mRNA had a unique pseudo-color, the specific sequence of pseudo-colors differed between transcripts. This variation in color ordering serves as a barcode, uniquely identifying each mRNA based on the spatial arrangement of pseudo-colors along its sequence. In this super-resolution barcoding scheme, Gl marks the beginning of the mRNA and serves as the reference point. The next pseudo-color (G2) is determined using a nearest-neighbor algorithm, which identifies the closest spatially adjacent probe; this process is repeated sequentially for all remaining groups. This strategy, which can be referred to as Design 1, enables accurate and high-throughput mRNA identification at nanometer-scale resolution.

[0192] Out of six possible DNA-PAINT pseudo-colors, one is designated for the 80S signal and another for Gl, leaving four remaining pseudo-colors. These can be arranged in 4! (i.e., 24) unique combinations. With this approach, Applicant can visualize the polysomal structure of 24 distinct mRNAs over six rounds of imaging, achieving a spatial resolution of 5 nm. To Applicant’s knowledge, this is the first method capable of such high spatial resolution while multiplexing 24 targets in only six imaging rounds. Notably, spectrally distinct DNA-PAINT imaging colors (Steen et al., 2024) or spectral demixing strategies (Gimber et al., 2022) can also be employed in this strategy. This modification would allow for 5 nm polysome imaging of 24 distinct transcripts in just two-three rounds of imaging. Furthermore, for this method to be successful, it is essential to accurately identify each individual group along the mRNA. Each group must be adequately labeled with a pseudo-color, and the labeling density is proportional to the length of the transcript.

[0193] Applicant has also developed an alternative approach (Design 2 (three groups)) that offers several distinct advantages. In this scheme, the mRNA is divided into three distinct 774901-5932-3024.1Atty. Docket No. 114203-1577groups (Gl, G2, and G3). Within each group, Applicant utilized a pair of pseudo-colors (FIG. 10B). The 5’-most group for each RNA of interest was designed to be targeted by imaging probes carrying the same pair of pseudo-colors. Each unique pair of pseudo-colors constituted a distinct group identifier. Given five possible pseudo-colors, the number of unordered pairs is calculated as 5 * 4 / 2 = 10. By increasing the total number of groups, the multiplexing capacity can be significantly expanded (FIG. 10C). For example, if one designates Gl as the universal reference point ( / .< ., a reference point with a particular pseudo-color combination, e.g., R1R5 as shown in FIG. 10C) for all mRNAs, the total number of unique combinations for G2 and G3 becomes 9 * 8 = 72 (see Table 1). With a relatively low probe density required for identifying each group and assuming the availability of longer mRNAs, one can further divide transcripts into four groups (Design 2 (four groups)). In this case, the number of combinations for groups G2 through G4 would be 9 * 8 x 7 = 504. This represents a substantial increase in multiplexing capability, approaching the scale achieved by some current spatial transcriptomics methods. An additional advantage of this scheme is that, within a group, if probes are designed such that each pseudo-color alternates, the spacing between identical pseudo-colors is approximately 14-15 nm, which approaches the precision limit of standard DNA-PAINT. This enables experiments with enhanced spatial resolution in the 1-10 nm range, with a method similar to high-precision strategies such as RESI (Reinhardt et al., 2023).Example 7. 80S polysome MINFLUX imaging

[0194] Because polysomes are 3D assemblies composed of 15-20 nm ribosomes, standard 2D DNA-PAINT imaging is insufficient to resolve them. To address this, Applicant employed 3D MINFLUX (Gwosch, K. C. et al. MINFLUX nanoscopy delivers 3D multicolor nanometer resolution in cells. Nat Methods 17, 217-224 (2020)) imaging to visualize 80S labels in hydrogel-embedded HeLa cells. MINFLUX provides nearly 2 nm isotropic resolution, which is sufficient to unambiguously resolve individual ribosomes within a polysome chain and reveal underlying structures. Applicant optimized the workflow to ensure low background and high spatial resolution. Briefly, Applicant kept the imaging strand concentration low (100 pmol) and embedded gold beads in the hydrogel to enable active stabilization in the microscope. Since MINFLUX involves imaging single molecules via a quasi-confocal scanning approach, acquisition is time-consuming — particularly for densely packed biomolecules like ribosomes: To sample all 80S labels within a specific region, Applicant empirically determined that a 2^2 pm field of view with a 1 pm axial depth requires approximately 10-12 hours of continuous imaging. Applicant collected 80S784901-5932-3024.1Atty. Docket No. 114203-1577MINFLUX data from several cells across biological replicates and processed the raw data following established protocols. Localizations with a high emission frequency at offset (>~ 300,000) or a center frequency ratio > 1.0 were excluded. Additionally, Applicant removed localizations from the beginning of the acquisition to account for initial background noise prior to photobleaching. Finally, localizations sharing the same TID were identified as originating from the same molecule and merged to improve spatial resolution. These steps yielded an experimental isotropic localization precision of 2 nm. To Applicant’s knowledge, this represents the first instance of MINFLUX imaging successfully performed on a hydrogel-embedded cellular sample.

[0195] FIG. 11A depicts a 2D projection of a 3D 80S MINFLUX dataset. While the insets reveal dense labeling and potential polysome-like structures, visualizing individual polysomes requires a computational approach to isolate ribosomes and reconstruct the chain. Applicant developed a workflow that first groups spatially proximate localizations using the DBSCAN (Hyun, Y. & Kim, D. Recent development of computational cluster analysis methods for single-molecule localization microscopy images. Comput Struct Biotechnol J 21, 879-888 (2023)) algorithm similar to previous polysome detection workflows. In the present labeling strategy, a single ribosome contains a maximum of 14 DNA-PAINT binding sites. Since each ribosome was sampled multiple times, Applicant identified clusters with a diameter corresponding to the ribosomal size with added localization precision measurement error (25-40 nm) as putative individual ribosomes. To ensure data quality, Applicant filtered out non-specific noise and multi-ribosome aggregates by removing clusters with fewer than three localizations or diameters exceeding approximately 40 nm respectively. Finally, Applicant connected the identified ribosomes to reconstruct polysomes, using a maximum connection distance of 70 nm.

[0196] FIGs. 11B-11D display the single ribosome labeling efficiency, the distribution of ribosome diameters, and the relative polysome stoichiometry for a representative dataset. Applicant observed an average of 3.5-4 labels per individual ribosome; consistent with the experimental design, the label count rarely exceeded the theoretical maximum of 14. The measured mean radius of 19 nm falls within the expected range for the size of a ribosome when accounting for the localization precision error of the present approach. Furthermore, the observed ribosome stoichiometry on each polysome chain aligns with electron microscopy measurements previously reported in HeLa cells. While biological variations exist between cells, these general distribution patterns remain consistent across datasets. Applicant selected polysome chains with the highest ribosome counts for detailed visualization (FIGs. 12A- 794901-5932-3024.1Atty. Docket No. 114203-157712B). These high-resolution images reveal spiral, linear, and semi-circular morphologies, consistent with configurations observed in previous electron microscopy studies.

[0197] To demonstrate the ability to extract polysome gene sequence and structure, Applicant performed a targeted MINFLUX experiment on Firefly Luciferase mRNA. Cells were labeled with 80S probes and mRNA DNA-PAINT probes specifically targeting the Luciferase transcript. Samples were hydrogel-embedded and imaged using a ratiometric 2-color MINFLUX approach. Following standard data processing to identify single ribosomes, Applicant co-clustered these coordinates with Firefly Luciferase signals to isolate specific polysome chains. FIGs. 12C-12D display a chain with 4 ribosomes bound to Firefly Luciferase. The 80S signal colocalizes extensively with the mRNA label, demonstrating Applicant’s ability to identify ribosome stoichiometry on specific targets. Finally, to resolve 5’ to 3’ directionality, Applicant split the Luciferase probes into two pools with orthogonal DNA-PAINT docking sites targeting the 5’ and 3’ halves (FIG. 12C). Cells transfected with Firefly Luciferase were labeled with these split probes and 80S probes. Applicant performed a two-step imaging workflow: first ratiometrically imaging both mRNA probe sets, followed by a buffer exchange to image the 80S label. FIG. 12D presents the resulting 3-color data, clearly visualizing the orientation of specific Luciferase molecules relative to their associated ribosomes. These experiments validate the platform's capacity to simultaneously capture polysome sequence and structure, setting the stage for higher multiplexed and throughput applications.Example 8. 55S polysome MINFLUX imaging

[0198] The mitochondria, the organelle responsible for generating ATP, contains its own distinct mitochondrial DNA (mtDNA) separate from the nuclear genome. After transcription, mtDNA produces 13 distinct mitochondrial mRNAs (mtRNAs), each of which is translated by the 55S mitoribosome. Unlike the cytoplasmic 80S ribosome — which contains 18S and 28S rRNA — the 55S ribosome is composed of different rRNA sequences: the 12S and 16S rRNAs, located in the small and large subunits, respectively. Recent electron microscopy publications reveal that mitoribosome polysome structures appear within the mitochondria. Applicant hypothesized that there is also a link between mitochondrial polysome structure and translational regulation, but such a connection has yet to be fully explored.

[0199] To study 55 S translation and polysome assembly, Applicant developed new probes that target the 55S mitoribosome (FIG. 13A). The labeling approach follows the same workflow used for the 80S ribosome, but is adapted to target 12S and 16S rRNA instead of 18S and 28S rRNA. Cells were labeled with 55S labels, and then imaged using standard 804901-5932-3024.1Atty. Docket No. 114203-1577DNA-PAINT microscopy. Applicant observed bright signal that appeared structured as a mitochondria (FIG. 13B) and was completely distinct structurally from 80S images.Furthermore, partial hybridization controls using only the 16S or 12S subunits alongside the linker probe produced very low signal, validating the specificity of the assembly.

[0200] Applicant prepared 55 S mitoribosome samples and embedded them in a hydrogel, following a protocol similar to the 80S workflow. Applicant then performed one-color 3D MINFLUX imaging to visualize single 55S ribosomes, processing the data with the same computational pipeline used for the 80S analysis, albeit with slight adjustments to the hyperparameters. FIG. 14A presents a 2D projection of the 3D MINFLUX dataset. Applicant observed semi-circular structures approximately 500 nm in diameter containing irregular internal patterns. These dimensions and morphologies resemble 2D cross-sections of mitochondria as reported in cryo-electron microscopy studies. The irregular internal patterns likely correspond to the mitochondrial matrix, where 55S ribosomes are localized. Applicant subsequently analyzed individual ribosomes and polysomes within these structures. Although Applicant detected fewer high-stoichiometry polysomes compared to the 80S data, Applicant successfully extracted several examples of larger polysome chains (FIG. 14B). These 3D images reveal 55 S polysomes forming spiral-like architectures. Future studies will incorporate rntRNA labels to investigate how these structural configurations regulate mitochondrial translation.Example 9. Optimization of Expansion DNA-PAINT

[0201] Applicant has optimized the experimental approach to improve the robustness and effectiveness of Expansion DNA-PAINT. For convenience the outline of the sample preparation experimental procedure is presented in Table 2.Table 2. Outline of Sample Preparation Procedure for Expansion DNA-PAINT814901-5932-3024.1Atty. Docket No. 114203-1577824901-5932-3024.1Atty. Docket No. 114203-1577

[0202] Applicant found that the signal to noise ratio of true DNA-PAINT signal to background greatly improved the thinner the gel. Applicant prepared pre-expanded gels which were 500 micron, 170 micron, and finally 60 microns thick, respectively, where the case with a 60 micron thickness pre-expansion provided the best results.

[0203] Applicant also found that the thinner the gel, the better the conditions for multiplexing via DNA-PAINT image strand exchange. With 170 micron thickness pre-expansion, the final expanded gel required 2-3 hours to overnight incubation of the imager strands, and a harsh, 30% formamide, buffer to remove these strands for the exchange of imager strands. By contrast, a 60 micron thickness pre-expansion, only necessitated 5-10 minutes incubation of DNA-PAINT imager strands, and this could be readily rinsed away with salt-free water, as in FIG. 15. Additionally, Applicant found that the present design, which allows labeling of the RNA to be compatible with hydrogels, is also compatible with hydrogels that can be expanded.Example 10. 80S DNA-PAINT imaging in mouse brain tissue sections

[0204] The present Example describes experiments enabling the visualization of polysomes in intact tissue samples. To demonstrate the feasibility of the foregoing approaches with intact tissue samples, Applicant tested the platform in mouse brain tissue samples. Applicant sectioned 20 pm thick 12-week old mouse brain tissues near the cerebellum. These samples were fixed, permeabilized, and hybridized with 80S probes, followed by ligation and hydrogel cross-linking. As the tissue is generally a less penetrative sample compared to cell cultures, Applicant modified the protocol to include harsher permeabilization and longer hybridization and ligation steps. The changes are listed in Table 3, below. For steps that are not listed in the table (e.g. gelation and MA-NHS modification), the steps between tissue and cell culture samples were identical. A negative control where no probes were added in the hybridization buffer was assessed, as well as a condition in which Applicant tissue cleared (also known as digestion) the sample after hydrogel cross-linking.Table 3. Differences between experimental conditions for cell culture and tissue834901-5932-3024.1Atty. Docket No. 114203-1577

[0205] Samples were imaged using standard DNA-PAINT in a TIRF microscope configuration near the coverslip. FIG. 16 presents the results. Applicant observed robust 80S signals in the positive control conditions, whereas the negative control yielded negligible signal. Notably, the tissue-cleared condition exhibited high signal intensity comparable to the non-cleared condition, suggesting its potential utility for deep-tissue single-molecule imaging in future experiments.

[0206] Generally, single-molecule imaging in tissue remains a significant challenge, particularly at depth. Tissue samples typically exhibit high background levels and induce severe optical aberrations that degrade signal quality. While adaptive optics and other advanced techniques address these issues, they are often complex and difficult to adopt.Consequently, standard tissue imaging often suffers from poor resolution and image quality. In the workflow provided herein, Applicant has addressed this by transforming samples into a hydrogel network composed primarily of polymers and water, with a refractive index (RI) approaching water. Since severe aberrations in tissue usually arise from RI heterogeneity, incorporating tissue clearing steps helps homogenize the mesh to a nearly uniform refractive index. This transformation mitigates optical aberrations, facilitating high-quality imaging844901-5932-3024.1Atty. Docket No. 114203-1577without the need for complex hardware. Furthermore, tissue clearing may reduce background fluorescence, thereby improving single-molecule detection and spatial resolution.854901-5932-3024.1Atty. Docket No. 114203-1577EXEMPLARY SEQUENCESTable 4. 18S arm probesTable 5.28S arm probes864901-5932-3024.1Atty. Docket No. 114203-1577each probe has a 5 ’phosphateTable 6. 80S splint and linker probes*This has a 5’ acrydite and 3’ amine. The bold region is a DNA-PAINT docking site. This can be swapped out for specific DNA-PAINT docking site sequences.Table 7. lOnt lOnt linkerTable 8. Firefly Luciferase probes874901-5932-3024.1Atty. Docket No. 114203-1577884901-5932-3024.1Atty. Docket No. 114203-1577894901-5932-3024.1Atty. Docket No. 114203-1577904901-5932-3024.1Atty. Docket No. 114203-1577914901-5932-3024.1Atty. Docket No. 114203-1577924901-5932-3024.1Atty. Docket No. 114203-1577*“CCTACCAGTACGACGTATTTAGC” is the photocrosslinker region and “AACAACAACAACAACAACAA” is the DNA-PAINT docking site. Between these regions, is the sequence that binds to the Firefly Luciferase sequence. There is a 5 adenosine spacer between the regions. The DNA-PAINT docking site can be swapped to a different docking site sequence.Table 9. 55S probes934901-5932-3024.1Atty. Docket No. 114203-1577*12S probes are shown below; these probes have a 5’ phosphate attached to them to enable ligation to the 16S probesTable 10. 16S probes944901-5932-3024.1Atty. Docket No. 114203-1577

[0207] The present application refers to various issued patent, published patent applications, scientific journal articles, and other publications, all of which are incorporated herein by reference. The details of one or more embodiments of the invention are set forth herein. Other features, objects, and advantages of the invention will be apparent from the Detailed Description, the Figures, the Examples, and the Claims.

[0208] Furthermore, the disclosure encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claims that is dependent on the same base claim. Where elements are presented as lists, e.g., in Markush group format, each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should be understood that, in general, where the invention, or aspects of the invention, is / are referred to as comprising particular elements and / or features, certain embodiments of the disclosure or aspects of the disclosure consist, or consist essentially of, such elements and / or features. For purposes of simplicity, those embodiments have not been specifically set forth in haec verba herein. It is also noted that the terms “comprising” and “containing” are intended to be open and permits the inclusion of additional elements or steps. Where ranges are given, endpoints are included. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

[0209] This application refers to various issued patents, published patent applications, journal articles, and other publications, all of which are incorporated herein by reference. If there is a conflict between any of the incorporated references and the instant specification, the specification shall control. In addition, any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the embodiments. Because such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any954901-5932-3024.1Atty. Docket No. 114203-1577particular embodiment of the invention can be excluded from any embodiment, for any reason, whether or not related to the existence of prior art.

[0210] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments described herein. The scope of the present embodiments described herein is not intended to be limited to the above Description, but rather is as set forth in the appended embodiments. Those of ordinary skill in the art will appreciate that various changes and modifications to this description may be made without departing from the spirit or scope of the present invention, as defined in the following claims.964901-5932-3024.1

Claims

Atty. Docket No. 114203-1577CLAIMSWHAT IS CLAIMED IS:

1. A method for super-resolution (SR) imaging of a polysome in a cell, the method comprising:(a) contacting the cell with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe;(ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and(iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region;(b) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe; and(c) imaging the cell, thereby imaging a polysome in the cell.

2. The method of claim 1, wherein the cell is a fixed cell.

3. The method of claim 1 or 2, further comprising ligating the first probe and the second probe.

4. The method of any one of claims 1-3, wherein the portion of the first probe that recognizes the 40S subunit of a ribosome comprises an oligonucleotide that is complementary to a portion of rRNA within the 40S subunit of a ribosome.974901-5932-3024.1Atty. Docket No. 114203-15775. The method of any one of claims 1-3, wherein the portion of the first probe that recognizes the 40S subunit of a ribosome comprises an oligonucleotide that is complementary to a portion of the 18s ribosomal RNA (rRNA).

6. The method of claim 5, wherein the oligonucleotide that is complementary to a portion of the 18s rRNA is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more than 30 nucleotides in length.

7. The method of any one of claims 5-6, wherein the oligonucleotide that is complementary to a portion of the 18s rRNA is about 25 nucleotides in length.

8. The method of any one of claims 1-7, wherein the portion of the second probe that recognizes the 60S subunit of a ribosome comprises an oligonucleotide that is complementary to a portion of rRNA within the 60S subunit of a ribosome.

9. The method of any one of claims 1-8, wherein the portion of the second probe that recognizes the 60S subunit of a ribosome comprises an oligonucleotide that is complementary to a portion of the 28s ribosomal RNA (rRNA).

10. The method of claim 9, wherein the oligonucleotide that is complementary to a portion of the 28s rRNA is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more than 30 nucleotides in length.

11. The method of any one of claims 9 or 10, wherein the oligonucleotide that is complementary to a portion of the 28s rRNA is about 25 nucleotides in length.

12. The method of any one of claims 1-11, wherein the portion of the third probe that is complementary to a portion of the first probe is 9-11 nucleotides in length.

13. The method of any one of claims 1-12, wherein the portion of the third probe that is complementary to a portion of the second probe is 9-11 nucleotides in length.

14. The method of any one of claims 1-13, wherein(a) the portion of the third probe that is complementary to a portion of the first probe is 9 nucleotides in length, and wherein the portion of the third probe that is complementary to a portion of the second probe is 11 nucleotides in length; or984901-5932-3024.1Atty. Docket No. 114203-1577(b) the portion of the third probe that is complementary to a portion of the first probe is 10 nucleotides in length, and wherein the portion of the third probe that is complementary to a portion of the second probe is 10 nucleotides in length.

15. The method of any one of claims 1-14, wherein the portion of the first probe that recognizes the 40S subunit of a ribosome and the portion of the first probe that is complementary to a portion of the third probe are joined by a poly-A nucleotide linker.

16. The method of claim 15, wherein the poly-A nucleotide linker is 10-20 nucleotides in length.

17. The method of claim 15 or 16, wherein the poly-A nucleotide linker is about 10 nucleotides in length.

18. The method of any one of claims 1-17, wherein the portion of the second probe that recognizes the 60S subunit of a ribosome and the portion of the second probe that is complementary to a portion of the third probe are joined by a poly-A nucleotide linker.

19. The method of claim 18, wherein the poly-A nucleotide linker is 10-20 nucleotides in length.

20. The method of claim 18 or 19, wherein the poly-A nucleotide linker is about 10 nucleotides in length.

21. The method of any one of claims 1-20, wherein the third probe comprises a poly-A nucleotide linker between the imaging probe docking site region, and the portions that are complementary to a portion of the first probe and a portion of the second probe.

22. The method of claim 21, wherein the poly-A nucleotide linker is 10-20 nucleotides in length.

23. The method of claim 22, wherein the poly-A nucleotide linker is about 10 nucleotides in length.

24. The method of any one of claims 1-23, wherein the first probe comprises a 5’ phosphate group.994901-5932-3024.1Atty. Docket No. 114203-157725. The method of any one of claims 1-23, wherein the second probe comprises a 5’ phosphate group.

26. The method of any one of claims 1-25, wherein the first probe comprises the structure: 5'-[portion recognizing the 40S subunit of the ribosome]-[portion complementary to the third probe]-3'.

27. The method of any one of claims 1-26, wherein the second probe comprises the structure: 5 '-[portion complementary to the third probe]-[portion recognizing the 60S subunit of the ribosome]-3'.

28. The method of any one of claims 1-25, wherein the first probe comprises the structure: 5 '-[portion complementary to the third probe]-[portion recognizing the 40S subunit of the ribosome]-3'.

29. The method of any one of claims 1-25 and 28, wherein the second probe comprises the structure: 5'-[portion recognizing the 60S subunit of the ribosome]-[portion complementary to the third probe]- 3'.

30. The method of any one of claims 1-29, wherein the third probe comprises the structure:5 '-[portion complementary to portion of first probe]-[portion complementary to portion of second probe]-[imaging probe docking site region]-3'.

31. The method of any one of claims 1-29, wherein the third probe comprises the structure:5 '-[portion complementary to portion of second probe]-[portion complementary to portion of first probe]-[imaging probe docking site region]-3'.

32. The method of any one of claims 1-31, wherein the first imaging probe is a singlestranded oligonucleotide probe.

33. The method of any one of claims 1-32, wherein the first imaging probe is 4-25, 5-20, 5-15, or 7-10 nucleotides in length.

34. The method of any one of claims 1-33, wherein the first imaging probe comprises the structure:1004901-5932-3024.1Atty. Docket No. 114203-15775 '-[portion complementary to imaging probe docking site region of the third probe]- [fluorescent label]-3'; or5 '-[fluorescent label]-[portion complementary to imaging probe docking site region of the third probe]-3.

35. The method of any one of claims 1-33, wherein the first imaging probe comprises the structure:5 '-[portion complementary to imaging probe docking site region of the third probe]- [linker]- [fluorescent label]-3 '; or5 '-[fluorescent label]-[linker]-[portion complementary to imaging probe docking site region of the third probe]-3'.

36. The method of any one of claims 1-35, wherein the cell is present within an intact tissue.

37. The method of claim 36, wherein the intact tissue is a fixed tissue sample.

38. The method of any one of claims 1-37, wherein the third probe comprises one or more acryl functional groups.

39. The method of claim 38, wherein the third probe comprises an acryl functional group on its 5 ’-end or 3 ’-end, wherein the method further comprises incubating the cell with methyl-acrylate NHS ester (MA-NHS) under conditions sufficient to permit the conversion of a remaining terminal amine group of the third probe to an acryl functional group, thereby generating a third probe comprising a 5’ acryl functional group and a 3’ acryl functional group.

40. The method of claim 38 or 39, further comprising, before (b), embedding the cell in a hydrogel that is capable of expanding following salt-free or low-salt hydration.

41. The method of claim 40, wherein the hydrogel comprises acrylamide and bisacrylamide.

42. The method of claim 40 or 41, further comprising expanding the hydrogel.1014901-5932-3024.1Atty. Docket No. 114203-157743. The method of claim 42, wherein the cell is expanded by a factor of at least 1.5x, at least 2x, at least 3x, at least 4x, at least 5x, at least lOx, at least 15x, or at least 20x.

44. The method of any one of claims 38-43, wherein the third probe comprises the structure:5'-[Acryl functional group]-[portion complementary to portion of first probe]-[portion complementary to portion of second probe]-[imaging probe docking site region]-3'; or5'-[Acryl functional group]-[portion complementary to portion of second probe]- [portion complementary to portion of first probe]-[imaging probe docking site region] -3'; or5 '-[portion complementary to portion of first probe]-[portion complementary to portion of second probe]-[imaging probe docking site region]- [Acryl functional group]-3'; or5 '-[portion complementary to portion of second probe]-[portion complementary to portion of first probe]-[imaging probe docking site region] -[Acryl functional group]- 3'; or5 '-[Acryl functional group]-[portion complementary to portion of first probe]-[portion complementary to portion of second probe]-[imaging probe docking site region]- [Acryl functional group]-3'; or5 '-[Acryl functional group]-[portion complementary to portion of second probe]- [portion complementary to portion of first probe]-[imaging probe docking site region] -[Acryl functional group]-3'.

45. The method of any one of claims 38-44, further comprising embedding the hydrogel in a second hydrogel.

46. The method of any one of claims 1-45, further comprising contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest.1024901-5932-3024.1Atty. Docket No. 114203-157747. The method of claim 46, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical.

48. The method of claim 46 and 47, further comprising contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe.

49. The method of any one of claims 46-48, wherein the second imaging probe is a single-stranded oligonucleotide probe.

50. The method of claim 48 or 49, wherein the second imaging probe is 4-25, 5-20, 5-15, or 7-10 nucleotides in length.

51. The method of any one of claims 46-50, wherein the second imaging probe comprises the structure:5 '-[portion complementary to imaging probe docking site region of the RNA target probe] -[fluorescent lab el] -3'; or5 '-[fluorescent label]-[portion complementary to imaging probe docking site region of the RNA target probe]-3'.

52. The method of any one of claims 46-51, wherein the second imaging probe comprises the structure:5 '-[portion complementary to imaging probe docking site region of the RNA target probe]-[linker]-[fluorescent label]-3 '; or5 '-[fluorescent label]-[linker]-[portion complementary to imaging probe docking site region of the RNA target probe]-[linker]-3'.

53. The method of any one of claims 46-52, wherein each of the probes of the set of RNA target probes hybridize to the same RNA of interest.1034901-5932-3024.1Atty. Docket No. 114203-157754. The method of any one of claims 46-53, comprising contacting the cell with at least two sets of RNA target probes, wherein each set of RNA target probes comprises probes that target different RNAs of interest.

55. The method of claim 46, comprising contacting the cell with at least two, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, or at least 30 sets of RNA target probes, wherein each set of RNA target probes comprises probes that target different RNAs of interest.

56. The method of any one of claims 1-55, wherein the first imaging probe and the second imaging probe are imaged simultaneously.

57. The method of any one of claims 1-55, wherein the first imaging probe and the second imaging probe are imaged sequentially.

58. The method of any one of claims 46-57, wherein within each set of RNA target probes, each RNA target probe comprises the same imaging probe docking site region.

59. The method of any one of claims 46-58, wherein within each set of RNA target probes, each RNA target probe comprises an imaging probe docking site region that is not identical to the imaging probe docking site region of any probe in any other set of RNA target probes.

60. The method of any one of claims 46-59, wherein the RNA target probe comprises an adapter sequence capable of binding to an expansion adapter probe.

61. The method of claim 60, wherein the adapter sequence is about 20 nucleotides in length.

62. The method of claim 60 or 61, wherein the adapter sequence is separated from a target-complementary region of the RNA target probe by an adenosine linker.

63. The method of claim 63, wherein the adenosine linker comprises about 5 adenosine nucleotides.

64. The method of any one of claims 60-63, wherein the expansion adapter probe comprises one or more acryl functional groups.1044901-5932-3024.1Atty. Docket No. 114203-157765. The method of any one of claims 60-64, further comprising contacting the RNA target probe with the expansion adapter probe.

66. The method of claim 65, further comprising photocrosslinking the expansion adapter probe to the RNA target probe.

67. The method of cany one of claims 60-67, wherein the expansion adapter probe comprises an acryl functional group on its 5 ’-end or 3 ’-end, wherein the method further comprises incubating the cell with methyl-acrylate NHS ester (MA-NHS) under conditions sufficient to permit the conversion of a remaining terminal amine group of the expansion adapter probe to an acryl functional group, thereby generating an expansion adapter probe comprising a 5’ acryl functional group and a 3’ acryl functional group.

68. The method of claim 67, further comprising, embedding the cell in a hydrogel that is capable of expanding following salt-free or low-salt hydration.

69. The method of claim 68, wherein the hydrogel comprises acrylamide and bisacrylamide.

70. The method of claim 68 or 69, further comprising expanding the hydrogel.

71. The method of claim 70, wherein the cell is expanded by a factor of at least 1 ,5x, at least 2x, at least 3x, at least 4x, at lease 5x, at least lOx, at least 15x, or at least 20x.

72. The method of any one of claims 60-71, further comprising embedding the hydrogel in a second hydrogel.

73. A method for super-resolution (SR) imaging of a polysome comprising a ribosome and an RNA in a cell, the method comprising:(a) contacting the cell with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe;1054901-5932-3024.1Atty. Docket No. 114203-1577(ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and(iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region;(b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest;(c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell;(e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and(f) imaging the cell, thereby imaging RNA in the cell.

74. A method for super-resolution (SR) imaging of RNA in a cell, the method comprising:(a) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is1064901-5932-3024.1Atty. Docket No. 114203-1577complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest;(b) contacting the imaging probe docking site region of the RNA target probe with an imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the imaging probe to the imaging probe docking site region of the RNA target probe;(c) imaging the cell, thereby imaging RNA in the cell.

75. A method for super-resolution (SR) imaging of RNA in a cell, the method comprising:(a) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest;(b) contacting the RNA target probes with an expansion adapter probe;(c) embedding the cell in a hydrogel that is capable of expanding following salt-free or low-salt hydration;(d) expanding the hydrogel;(e) contacting the imaging probe docking site region of the RNA target probe with an imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the imaging probe to the imaging probe docking site region of the RNA target probe;(f) imaging the cell, thereby imaging RNA in the cell.1074901-5932-3024.1Atty. Docket No. 114203-157776. The method of claim 74 or 75, wherein the imaging probe is a single-stranded oligonucleotide probe.

77. The method of any one of claims 74-76, wherein the imaging probe is 4-25, 5-20, 5- 15, or 7-10 nucleotides in length.

78. The method of any one of claims 74-77, wherein the imaging probe comprises the structure:5 '-[portion complementary to imaging probe docking site region of the RNA target probe] -[fluorescent lab el] -3'; or5 '-[fluorescent label]-[portion complementary to imaging probe docking site region of the RNA target probe]-3'.

79. The method of any one of claims 74-78, wherein the imaging probe comprises the structure:5 '-[portion complementary to imaging probe docking site region of the RNA target probe]-[linker]-[fluorescent label]-3 '; or5 '-[fluorescent label]-[linker]-[portion complementary to imaging probe docking site region of the RNA target probe]-[linker]-3'.

80. The method of any one of claims 74-79, wherein each of the probes of the set of RNA target probes hybridize to the same RNA of interest.

81. The method of any one of claims 74-80, comprising contacting the cell with at least two sets of RNA target probes, wherein each set of RNA target probes comprises probes that target different RNAs of interest.

82. The method of claim 81, comprising contacting the cell with at least two, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, or at least 30 sets of RNA target probes, wherein each set of RNA target probes comprises probes that target different RNAs of interest.

83. The method of any one of claims 74-82, wherein within each set of RNA target probes, each RNA target probe comprises the same imaging probe docking site region.1084901-5932-3024.1Atty. Docket No. 114203-157784. The method of any one of claims 74-83, wherein within each set of RNA target probes, each RNA target probe comprises an imaging probe docking site region that is not identical to the imaging probe docking site region of any probe in any other set of RNA target probes.

85. The method of any one of claims 74-84, wherein the RNA target probe comprises an adapter sequence capable of binding to an expansion adapter probe.

86. The method of claim 85, wherein the adapter sequence is about 20 nucleotides in length.

87. The method of claim 85 or 86, wherein the adapter sequence is separated from a target-complementary region of the RNA target probe by an adenosine linker.

88. The method of claim 87, wherein the adenosine linker comprises about 5 adenosine nucleotides.

89. The method of any one of claims 74-88, wherein the expansion adapter probe comprises one or more acryl functional groups.

90. The method of any one of claim 74, further comprising contacting the RNA target probe with an expansion adapter probe.

91. The method of any one of claims 74-90, further comprising photocrosslinking the expansion adapter probe to the RNA target probe.

92. The method of cany one of claims 75-91, wherein the expansion adapter probe comprises an acryl functional group on its 5 ’-end or 3 ’-end, wherein the method further comprises incubating the cell with methyl-acrylate NHS ester (MA-NHS) under conditions sufficient to permit the conversion of a remaining terminal amine group of the expansion adapter probe to an acryl functional group, thereby generating an expansion adapter probe comprising a 5’ acryl functional group and a 3’ acryl functional group.

93. The method of claim 92, further comprising, embedding the cell in a hydrogel that is capable of expanding following salt-free or low-salt hydration.

94. The method of claim 93, wherein the hydrogel comprises acrylamide and bisacrylamide.1094901-5932-3024.1Atty. Docket No. 114203-157795. The method of claim 93 or 94, further comprising expanding the hydrogel.

96. The method of claim 95, wherein the cell is expanded by a factor of at least 1.5x, at least 2x, at least 3x, at least 4x, at least 5x, at least lOx, at least 15x, or at least 20x.

97. The method of any one of claims 75-96, further comprising embedding the hydrogel in a second hydrogel.

98. A method for super-resolution (SR) multiplexed imaging of RNA in a cell, the method comprising:

99. A method for multiplexed super-resolution (SR) imaging of RNA in a cell, the method comprising:(a) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest;(b) contacting the RNA target probes with an expansion adapter probe;(c) embedding the cell in a hydrogel that is capable of expanding following salt-free or low-salt hydration;(d) expanding the hydrogel;(e) contacting the imaging probe docking site region of the RNA target probe with an imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the imaging probe to the imaging probe docking site region of the RNA target probe;(f) imaging the cell, thereby imaging RNA in the cell.

100. The method of claim 99, comprising contacting a plurality of RNAs of interest.1104901-5932-3024.1Atty. Docket No. 114203-1577101. The method of claim 100, further comprising spatially segmenting in silico each of the RNAs of interest into at least 2 segments, at least 3 segments, at least 4 segments, or at least 5 segments, wherein the segments are arranged sequentially along the length of an RNA of interest.

102. The method of claim 101, wherein each of the RNAs of interest is segmented in silico into 5 segments, wherein R1 is a segment nearest the 5’ end of the RNA of interest, and R2, R3, R4, and R5 are remaining segments.

103. The method of claim 101 or 102, wherein each of the RNAs of interest is segmented in silico such that for each RNA of interest, Rl, R2, R3, R4, and R5 are positioned in a unique order.

104. The method of claim 102, wherein each of the imaging probes hybridized to an RNA target probe hybridized to Rl of an RNA of interest (Rl imaging probes) comprise the same fluorescent label; wherein each of the imaging probes hybridized to an RNA target probe hybridized to R2 of an RNA of interest (R2 imaging probes) comprise the same fluorescent label; wherein each of the imaging probes hybridized to an RNA target probe hybridized to R3 of an RNA of interest (R3 imaging probes) comprise the same fluorescent label; wherein each of the imaging probes hybridized to an RNA target probe hybridized to R4 of an RNA of interest (R4 imaging probes) comprise the same fluorescent label; wherein each of the imaging probes hybridized to an RNA target probe hybridized to R5 of an RNA of interest (R5 imaging probes) comprise the same fluorescent label; and wherein the Rl imaging probes, the R2 imaging probes, the R3 imaging probes, the R4 imaging probes, and the R5 imaging probes comprise different fluorescent labels.

105. The method of any one of claims 102-104, wherein imaging the cell comprises sequential imaging of each of the sets of imaging probes comprising different fluorophores.

106. The method of any one of claims 102-105, further comprising contacting the cell with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein1114901-5932-3024.1Atty. Docket No. 114203-1577(i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe;(ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and(iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region;contacting the imaging probe docking site region of the third probe with an imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe and a fluorescent label (an R6 imaging probe), wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the R6 imaging probe to the imaging probe docking site region of the third probe, wherein the fluorescent label of the R6 imaging probe is not identical to the fluorescent label of any of the Rl, R2, R3, R4, and R5 imaging probes; and imaging the cell, thereby imaging a polysome in the cell.

107. The method of any one of claims 102-106, further comprising decoding the image to extract an identity, ribosome count, and / or location of each imaged RNA of interest.

108. The method of claim 101, wherein each of the RNAs of interest is segmented in silico into 3 or 4 segments, wherein each segment is hybridized to RNA target probes hybridized to imaging probes of a pair of sets of imaging probes selected from Rl imaging probes, R2 imaging probes, R3 imaging probes, R4 imaging probes, and R5 imaging probes.

109. The method of claim 108, wherein each of the RNAs of interest is segmented in silico such that for each RNA of interest, the pair of sets of imaging probes are positioned in a unique order.

110. The method of claim 108 or 109, wherein each of the Rl imaging probes comprise the same fluorescent label; wherein each of the R2 imaging probes comprise the same1124901-5932-3024.1Atty. Docket No. 114203-1577fluorescent label; wherein each of the R3 imaging probes comprise the same fluorescent label; wherein each of the R4 imaging probes comprise the same fluorescent label; wherein each of the R5 imaging probes comprise the same fluorescent label; and wherein the R1 imaging probes, the R2 imaging probes, the R3 imaging probes, the R4 imaging probes, and the R5 imaging probes comprise different fluorescent labels.

111. The method of any one of claims 108-110, wherein imaging the cell comprises sequential imaging of each of the sets of imaging probes comprising different fluorophores.

112. The method of any one of claims 108-111, further comprising contacting the cell with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein(i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe;(ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and(iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region;contacting the imaging probe docking site region of the third probe with an imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe and a fluorescent label (an R6 imaging probe), wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the R6 imaging probe to the imaging probe docking site region of the third probe, wherein the fluorescent label of the R6 imaging probe is not identical to the fluorescent label of any of the Rl, R2, R3, R4, and R5 imaging probes; and imaging the cell, thereby imaging a polysome in the cell.1134901-5932-3024.1Atty. Docket No. 114203-1577113. The method of any one of claims 108-112, further comprising decoding the image to extract an identity, ribosome count, and / or location of each imaged RNA of interest.

114. A method diagnosing a disease or disorder in a subject, the method comprising:(a) contacting cell obtained from a subject with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein(i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe;(ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and(iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region;(b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest;(c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell;(e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is1144901-5932-3024.1Atty. Docket No. 114203-1577complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and(f) imaging the cell, thereby imaging RNA in the cell,wherein a difference in the polysome structure in the cell relative to one or more non-diseased cells indicates that the subject has the disease or disorder.

115. The method of claim 114, wherein polysomes in one or more non-diseased cells are imaged as a control experiment alongside the cell obtained from the subject.

116. The method of claim 114 or 115, wherein the disease or disorder is a genetic disease, a proliferative disease, an inflammatory disease, an autoimmune disease, a liver disease, a spleen disease, a lung disease, a hematological disease, a neurological disease, a psychiatric disease, a gastrointestinal (GI) tract disease, a genitourinary disease, an infectious disease, a musculoskeletal disease, an endocrine disease, a metabolic disorder, an immune disorder, a central nervous system (CNS) disorder, or a cardiovascular disease.

117. The method of any one of claims 114-116, wherein the cell is present in a tissue.

118. The method of claim 117, wherein the tissue is epithelial tissue, connective tissue, muscular tissue, or nervous tissue.

119. The method of claim 117 or 118, wherein the tissue is brain tissue.

120. The method of any one of claims 114-119, wherein the tissue is a tissue sample taken from a subject.

121. The method of claim 120, wherein the subject is a non-human experimental animal.

122. The method of claim 121, wherein the non-human experimental animal is a mouse, a rat, a dog, a pig, or a non-human primate.

123. The method of claim 120, wherein the subject is a human.

124. A method for screening for an agent capable of modulating polysome structure, the method comprising:1154901-5932-3024.1Atty. Docket No. 114203-1577(a) contacting a cell that is being treated with or has been treated with a candidate agent with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe;(ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and(iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region;(b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest;(c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell;(e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions1164901-5932-3024.1Atty. Docket No. 114203-1577sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and(f) imaging the cell, thereby imaging RNA in the cell,wherein a difference in the polysome structure in the presence of the candidate agent relative to in the absence of the candidate agent indicates that the candidate agent modulates polysome structure.

125. The method of claim 124, wherein the candidate agent is a small molecule, a protein, a peptide, a nucleic acid, a lipid, or a carbohydrate.

126. The method of any one of claims 124 or 125, where the candidate agent is a known drug or an FDA-approved drug.

127. The method of claim 125 or 126, wherein the protein is an antibody, or an antibody variant or fragment.

128. The method of claim 125 or 126, wherein the nucleic acid is an mRNA, an antisense RNA, a miRNA, an siRNA, an RNA aptamer, a double stranded RNA (dsRNA), a short hairpin RNA (shRNA), or an antisense oligonucleotide (ASO).

129. The method of any one of claims 124-128, wherein modulating polysome structure is associated with reducing, relieving, or eliminating the symptoms of a disease or disorder.

130. The method of claim 129, wherein the disease or disorder is a genetic disease, a proliferative disease, an inflammatory disease, an autoimmune disease, a liver disease, a spleen disease, a lung disease, a hematological disease, a neurological disease, a psychiatric disease, a gastrointestinal (GI) tract disease, a genitourinary disease, an infectious disease, a musculoskeletal disease, an endocrine disease, a metabolic disorder, an immune disorder, a central nervous system (CNS) disorder, or a cardiovascular disease.

131. A method for treating a disease or disorder in a subject, the method comprising:(a) contacting a cell that is being treated with or has been treated with a candidate agent with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein1174901-5932-3024.1Atty. Docket No. 114203-1577(i) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe;(ii) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and(iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region;(b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest;(c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell;(e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and(f) imaging the cell, thereby imaging RNA in the cell; and1184901-5932-3024.1Atty. Docket No. 114203-1577(g) administering a treatment for the disease or disorder to the subject if a difference in the polysome structure in the cell relative to one or more non-diseased cells is observed.

132. The method of claim 131, wherein polysome structure in one or more non-diseased cells is imaged simultaneously as a control experiment.

133. The method of claim 131 or 132, wherein the treatment comprises administering a therapeutic agent, surgery, or radiation therapy.

134. The method of any one of claims 131-133, wherein the therapeutic agent is a small molecule, a protein, a peptide, a nucleic acid, a lipid, or a carbohydrate.

135. The method of any one of claims 131-134, where the therapeutic agent is a known drug or an FDA-approved drug.

136. The method of claim 134 or 135, wherein the protein is an antibody, or an antibody variant or fragment.

137. The method of claim 134 or 135, wherein the nucleic acid is an mRNA, an antisense RNA, a miRNA, an siRNA, an RNA aptamer, a double stranded RNA (dsRNA), a short hairpin RNA (shRNA), or an antisense oligonucleotide (ASO).

138. The method of any one of claims 131-137, wherein the disease or disorder is a genetic disease, a proliferative disease, an inflammatory disease, an autoimmune disease, a liver disease, a spleen disease, a lung disease, a hematological disease, a neurological disease, a psychiatric disease, a gastrointestinal (GI) tract disease, a genitourinary disease, an infectious disease, a musculoskeletal disease, an endocrine disease, a metabolic disorder, an immune disorder, a central nervous system (CNS) disorder, or a cardiovascular disease.

139. A set of probes comprising a first probe, a second probe, and a third probe, wherein:(a) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe;1194901-5932-3024.1Atty. Docket No. 114203-1577(b) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and(c) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region.

140. The set of probes of claim 139, further comprising a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label.

141. The set of probes of claim 139 or 140, wherein the portion of the first probe that recognizes the 40S subunit of a ribosome comprises an oligonucleotide that is complementary to a portion of rRNA within the 40S subunit of a ribosome.

142. The set of probes of any one of claims 139-141, wherein the portion of the first probe that recognizes the 40S subunit of a ribosome comprises an oligonucleotide that is complementary to a portion of the 18s ribosomal RNA (rRNA).

143. The set of probes of claim 142, wherein the oligonucleotide that is complementary to a portion of the 18s rRNA is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more than 30 nucleotides in length.

144. The set of probes of any one of claims 142 or 143, wherein the oligonucleotide that is complementary to a portion of the 18s rRNA is about 25 nucleotides in length.

145. The set of probes of any one of claims 139-144, wherein the portion of the second probe that recognizes the 60S subunit of a ribosome comprises an oligonucleotide that is complementary to a portion of rRNA within the 60S subunit of a ribosome.

146. The set of probes of any one of claims 139-145, wherein the portion of the second probe that recognizes the 60S subunit of a ribosome comprises an oligonucleotide that is complementary to a portion of the 28s ribosomal RNA (rRNA).

147. The set of probes of claim 146, wherein the oligonucleotide that is complementary to a portion of the 28s rRNA is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more than 30 nucleotides in length.1204901-5932-3024.1Atty. Docket No. 114203-1577148. The set of probes of any one of claims 146 or 147, wherein the oligonucleotide that is complementary to a portion of the 28s rRNA is about 25 nucleotides in length.

149. The set of probes of any one of claims 139-148, wherein the portion of the third probe that is complementary to a portion of the first probe is 9-11 nucleotides in length.

150. The set of probes of any one of claims 139-149, wherein the portion of the third probe that is complementary to a portion of the second probe is 9-11 nucleotides in length.

151. The set of probes of any one of claims 139-150, wherein(a) the portion of the third probe that is complementary to a portion of the first probe is 9 nucleotides in length, and wherein the portion of the third probe that is complementary to a portion of the second probe is 11 nucleotides in length; or(b) the portion of the third probe that is complementary to a portion of the first probe is 10 nucleotides in length, and wherein the portion of the third probe that is complementary to a portion of the second probe is 10 nucleotides in length.

152. The set of probes of any one of claims 139-151, wherein the portion of the first probe that recognizes the 40S subunit of a ribosome and the portion of the first probe that is complementary to a portion of the third probe are joined by a poly-A nucleotide linker.

153. The set of probes of claim 152, wherein the poly-A nucleotide linker is 10-20 nucleotides in length.

154. The set of probes of claim 152 or 153, wherein the poly-A nucleotide linker is about 10 nucleotides in length.

155. The set of probes of any one of claims 139-154, wherein the portion of the second probe that recognizes the 60S subunit of a ribosome and the portion of the second probe that is complementary to a portion of the third probe are joined by a poly-A nucleotide linker.

156. The set of probes of claim 155, wherein the poly-A nucleotide linker is 10-20 nucleotides in length.1214901-5932-3024.1Atty. Docket No. 114203-1577157. The set of probes of claim 155 or 156, wherein the poly-A nucleotide linker is about 8-12 nucleotides in length.

158. The set of probes of any one of claims 139-157, wherein the third probe comprises a poly-A nucleotide linker between the imaging probe docking site region, and the portions that are complementary to a portion of the first probe and a portion of the second probe.

159. The set of probes of claim 158, wherein the poly-A nucleotide linker is 10-20 nucleotides in length.

160. The set of probes of claim 159, wherein the poly-A nucleotide linker is about 10 nucleotides in length.

161. The set of probes of any one of claims 139-160, wherein the first probe comprises a 5’ phosphate group.

162. The set of probes of any one of claims 139-160, wherein the second probe comprises a 5’ phosphate group.

163. The set of probes of any one of claims 139-162, wherein the first probe comprises the structure: 5'-[portion recognizing the 40S subunit of the ribosome]-[portion complementary to the third probe]-3'.

164. The set of probes of any one of claims 139-163, wherein the second probe comprises the structure: 5'-[portion complementary to the third probe]-[portion recognizing the 60S subunit of the ribosome]-3'.

165. The set of probes of any one of claims 139-162, wherein the first probe comprises the structure: 5'-[portion complementary to the third probe]-[portion recognizing the 40S subunit of the ribosome]-3'.

166. The set of probes of any one of claims 139-162 and 165, wherein the second probe comprises the structure: 5 '-[portion recognizing the 60S subunit of the ribosome]- [portion complementary to the third probe]- 3'.

167. The set of probes of any one of claims 139-166, wherein the third probe comprises the structure:1224901-5932-3024.1Atty. Docket No. 114203-15775 '-[portion complementary to portion of first probe]-[portion complementary to portion of second probe]-[imaging probe docking site region]-3'.

168. The set of probes of any one of claims 139-166, wherein the third probe comprises the structure:5 '-[portion complementary to portion of second probe]-[portion complementary to portion of first probe]-[imaging probe docking site region]-3'.

169. The set of probes of any one of claims 139-166, wherein the third probe comprises the structure:5'-[Acryl functional group]-[portion complementary to portion of first probe]-[portion complementary to portion of second probe]-[imaging probe docking site region]-3'; or 5'-[Acryl functional group]-[portion complementary to portion of second probe]- [portion complementary to portion of first probe]-[imaging probe docking site region] -3'; or5 '-[portion complementary to portion of first probe]-[portion complementary to portion of second probe]-[imaging probe docking site region]- [Acryl functional group]-3'; or5 '-[portion complementary to portion of second probe]-[portion complementary to portion of first probe]-[imaging probe docking site region] -[Acryl functional group]- 3'; or5 '-[Acryl functional group]-[portion complementary to portion of first probe]-[portion complementary to portion of second probe]-[imaging probe docking site region]- [Acryl functional group]-3'; or5 '-[Acryl functional group]-[portion complementary to portion of second probe]- [portion complementary to portion of first probe]-[imaging probe docking site region] -[Acryl functional group]-3'.

170. The set of probes of any one of claims 139-169, wherein the first imaging probe is a single-stranded oligonucleotide probe.

171. The set of probes of any one of claims 139-170, wherein the first imaging probe is 4- 25, 5-20, 5-15, or 7-10 nucleotides in length.1234901-5932-3024.1Atty. Docket No. 114203-1577172. The set of probes of any one of claims 139-171, wherein the first imaging probe comprises the structure:5 '-[portion complementary to imaging probe docking site region of the third probe]- [fluorescent label]-3'; or5 '-[fluorescent label]-[portion complementary to imaging probe docking site region of the third probe]-3'.

173. The set of probes of any one of claims 139-171, wherein the first imaging probe comprises the structure:5 '-[portion complementary to imaging probe docking site region of the third probe]- [linker]- [fluorescent label]-3 '; or5 '-[fluorescent label]-[linker]-[portion complementary to imaging probe docking site region of the third probe]-3'.

174. The set of probes of any one of claims 139-173, further comprising one or more RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to the RNA of interest and an imaging probe docking site region.

175. The set of probes of any one of claims 139-174, further comprising a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label.

176. The set of probes of claim 175, wherein the second imaging probe is a single-stranded oligonucleotide probe.

177. The set of probes of claim 174 or 175, wherein the second imaging probe is 4-25, 5- 20, 5-15, or 7-10 nucleotides in length.

178. The set of probes of any one of claims 174-176, wherein the second imaging probe comprises the structure:1244901-5932-3024.1Atty. Docket No. 114203-15775 '-[portion complementary to imaging probe docking site region of the RNA target prob e] - [fluore scent 1 ab el ] -3 '5 '-[fluorescent label]-[portion complementary to imaging probe docking site region of the RNA target probe]-3'.

179. The set of probes of any one of claims 174-177, wherein the second imaging probe comprises the structure:5 '-[portion complementary to imaging probe docking site region of the RNA target probe]-[linker]-[fluorescent label]-3 '; or5 '-[fluorescent label]-[linker]-[portion complementary to imaging probe docking site region of the RNA target probe]-[linker]-3.

180. The set of probes of any one of claims 139-179, further comprising an expansion adapter probe.

181. The set of probes of claim 180, wherein the RNA target probe comprises an adapter sequence capable of binding to the expansion adapter probe.

182. The set of probes of claim 181, wherein the adapter sequence is about 20 nucleotides in length.

183. The set of probes of claim 181 or 182, wherein the adapter sequence is separated from a target-complementary region of the RNA target probe by an adenosine linker.

184. The set of probes of claim 183, wherein the adenosine linker comprises about 5 adenosine nucleotides.

185. The set of probes of any one of claims 180-184, wherein the expansion adapter probe comprises one or more acryl functional groups.

186. A kit comprising the set of probes of any one of claims 139-185.

187. An assembled ribosome complex comprising:(i) a first oligonucleotide probe, a second oligonucleotide probe, and a third oligonucleotide probe, wherein1254901-5932-3024.1Atty. Docket No. 114203-1577(a) the first probe comprises an oligonucleotide portion that recognizes the 40S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe;(b) the second probe comprises an oligonucleotide portion that recognizes the 60S subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and (c) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; and(ii) a 40S subunit of a ribosome; and(iii) a 60S subunit of a ribosome.

188. The assembled ribosome complex of claim 187, further comprising a target RNA of interest.

189. The assembled ribosome complex of claim 187 or 188, further comprising a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label.

190. The assembled ribosome complex of any one of claims 187-189, further comprising one or more RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to the RNA of interest and an imaging probe docking site region.

191. The assembled ribosome complex of claim 190, further comprising a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label.

192. The method of any one of claims 1-138, the set of probes of any one of claims 139- 185, the kit of claim 186, or the assembled ribosome complex of any one of claims 187-191, wherein the imaging probe docking site region is a 3’ DNA-PAINT docking site region.1264901-5932-3024.1Atty. Docket No. 114203-1577193. The method of any one of claims 1-138 and 192, wherein imaging comprises superresolution (SR) microscopy.

194. The method of any one of claims 1-138 and 192-193, wherein imaging comprises one or more of DNA-PAINT, MINFLUX, RESI, expansion microscopy, and STORM.

195. A method for super-resolution (SR) imaging of a polysome in a cell, the method comprising:(a) contacting the cell with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe;(ii) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and(iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region;(b) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe; and(c) imaging the cell, thereby imaging a polysome in the cell.

196. The method of claim 195, wherein the ribosome is selected from the group consisting of a cytosolic eukaryotic ribosome, a prokaryotic ribosome, an archaeal ribosome, and an organellar ribosome.1274901-5932-3024.1Atty. Docket No. 114203-1577197. The method of claim 196, wherein the organellar ribosome is a mitochondrial ribosome (mitoribosome).

198. The method of any one of claims 195-197, wherein the ribosome is a 55S mitoribosome, wherein the first subunit is a 28S subunit of a mitoribosome, and the second subunit is a 39S subunit of a mitoribosome.

199. The method of any one of claims 195-198, wherein the cell is a fixed cell.

200. The method of any one of claims 195-199, further comprising ligating the first probe and the second probe.

201. The method of any one of claims 198-200, wherein the portion of the first probe that recognizes the 28S subunit of a mitoribosome comprises an oligonucleotide that is complementary to a portion of rRNA within the 28 S subunit of the mitoribosome.

202. The method of any one of claims 198-201, wherein the portion of the first probe that recognizes the 28S subunit of a ribosome comprises an oligonucleotide that is complementary to a portion of the 12s ribosomal RNA (rRNA).

203. The method of claim 202, wherein the oligonucleotide that is complementary to a portion of the 12s rRNA is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more than 30 nucleotides in length.

204. The method of claim 202 or 203, wherein the oligonucleotide that is complementary to a portion of the 12s rRNA is about 25 nucleotides in length.

205. The method of any one of claims 198-204, wherein the portion of the second probe that recognizes the 39S subunit of a mitoribosome comprises an oligonucleotide that is complementary to a portion of rRNA within the 39S subunit of a mitoribosome.

206. The method of any one of claims 198-205, wherein the portion of the second probe that recognizes the 39S subunit of a mitoribosome comprises an oligonucleotide that is complementary to a portion of the 16s ribosomal RNA (rRNA).

207. The method of claim 206, wherein the oligonucleotide that is complementary to a portion of the 16s rRNA is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more than 30 nucleotides in length.1284901-5932-3024.1Atty. Docket No. 114203-1577208. The method of any one of claims 206 or 207, wherein the oligonucleotide that is complementary to a portion of the 16s rRNA is about 25 nucleotides in length.

209. A method for super-resolution (SR) imaging of a polysome comprising a ribosome and an RNA in a cell, the method comprising:(a) contacting the cell with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe;(ii) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and(iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region;(b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest;(c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell;(e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is1294901-5932-3024.1Atty. Docket No. 114203-1577complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and(f) imaging the cell, thereby imaging RNA in the cell.

210. The method of claim 209, wherein the ribosome is selected from the group consisting of a cytosolic eukaryotic ribosome, a prokaryotic ribosome, an archaeal ribosome, and an organellar ribosome.

211. A method diagnosing a disease or disorder in a subject, the method comprising:(a) contacting cell obtained from a subject with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein(i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe;(ii) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and(iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region;(b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest;(c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a1304901-5932-3024.1Atty. Docket No. 114203-1577fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell;(e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and(f) imaging the cell, thereby imaging RNA in the cell,wherein a difference in the polysome structure in the cell relative to one or more non-diseased cells indicates that the subject has the disease or disorder.

212. The method of claim 211, wherein the ribosome is selected from the group consisting of a cytosolic eukaryotic ribosome, a prokaryotic ribosome, an archaeal ribosome, and an organellar ribosome.

213. A method for screening for an agent capable of modulating polysome structure, the method comprising:(a) contacting a cell that is being treated with or has been treated with a candidate agent with a set of probes comprising a first probe, a second probe, and a third probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe;(ii) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and(iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion1314901-5932-3024.1Atty. Docket No. 114203-1577that is complementary to a portion of the second probe, and an imaging probe docking site region;(b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest;(c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell;(e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and(f) imaging the cell, thereby imaging RNA in the cell,wherein a difference in the polysome structure in the presence of the candidate agent relative to in the absence of the candidate agent indicates that the candidate agent modulates polysome structure.

214. The method of claim 213, wherein the ribosome is selected from the group consisting of a cytosolic eukaryotic ribosome, a prokaryotic ribosome, an archaeal ribosome, and an organellar ribosome.

215. A method for treating a disease or disorder in a subject, the method comprising:(a) contacting a cell that is being treated with or has been treated with a candidate agent with a set of probes comprising a first probe, a second probe, and a third1324901-5932-3024.1Atty. Docket No. 114203-1577probe, wherein contacting is performed for a time sufficient to permit hybridization of the third probe to the first probe and the second probe, wherein (i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe;(ii) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and(iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region;(b) contacting the cell with one or more sets of RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to an RNA of interest and an imaging probe docking site region, wherein contacting is performed for a time sufficient to permit hybridization of the RNA target probe to the RNA of interest;(c) contacting the imaging probe docking site region of the third probe with a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the third probe is performed under conditions sufficient to permit stochastic binding of the first imaging probe to the imaging probe docking site region of the third probe, wherein the imaging probe docking site region of the third probe and the imaging probe docking site region of the RNA target probes are not identical; (d) imaging the cell, thereby imaging a ribosome in the cell;(e) contacting the imaging probe docking site region of the RNA target probe with a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label, wherein contacting the imaging probe docking site region of the RNA target probe is performed under conditions sufficient to permit stochastic binding of the second imaging probe to the imaging probe docking site region of the RNA target probe; and(f) imaging the cell, thereby imaging RNA in the cell; and1334901-5932-3024.1Atty. Docket No. 114203-1577(g) administering a treatment for the disease or disorder to the subject if a difference in the polysome structure in the cell relative to one or more non-diseased cells is observed.

216. The method of claim 215, wherein the ribosome is selected from the group consisting of a cytosolic eukaryotic ribosome, a prokaryotic ribosome, an archaeal ribosome, and an organellar ribosome.

217. A set of probes comprising a first probe, a second probe, and a third probe, wherein:(a) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe;(b) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and(c) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region.

218. The set of probes of claim 217, further comprising a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label.

219. The set of probes of claim 217 or 218, wherein the ribosome is selected from the group consisting of a cytosolic eukaryotic ribosome, a prokaryotic ribosome, an archaeal ribosome, and an organellar ribosome.

220. The set of probes of claim 219, wherein the organellar ribosome is a mitochondrial ribosome (mitoribosome).

221. The set of probes of any one of claims 217-220, wherein the ribosome is a 55S mitoribosome, wherein the first subunit is a 28S subunit of a mitoribosome, and the second subunit is a 39S subunit of a mitoribosome.1344901-5932-3024.1Atty. Docket No. 114203-1577222. The set of probes of any one of claims 217-221, wherein the portion of the first probe that recognizes the 28S subunit of a mitoribosome comprises an oligonucleotide that is complementary to a portion of rRNA within the 28S subunit of the mitoribosome.

223. The set of probes of any one of claims 217-222, wherein the portion of the first probe that recognizes the 28S subunit of a ribosome comprises an oligonucleotide that is complementary to a portion of the 12s ribosomal RNA (rRNA).

224. The set of probes of claim 223, wherein the oligonucleotide that is complementary to a portion of the 12s rRNA is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more than 30 nucleotides in length.

225. The set of probes of claim 223 or 224, wherein the oligonucleotide that is complementary to a portion of the 12s rRNA is about 25 nucleotides in length.

226. The set of probes of any one of claims 217-225, wherein the portion of the second probe that recognizes the 39S subunit of a mitoribosome comprises an oligonucleotide that is complementary to a portion of rRNA within the 39S subunit of a mitoribosome.

227. The set of probes of any one of claims 217-226, wherein the portion of the second probe that recognizes the 39S subunit of a mitoribosome comprises an oligonucleotide that is complementary to a portion of the 16s ribosomal RNA (rRNA).

228. The set of probes of claim 227, wherein the oligonucleotide that is complementary to a portion of the 16s rRNA is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more than 30 nucleotides in length.

229. The set of probes of any one of claims 227 or 228, wherein the oligonucleotide that is complementary to a portion of the 16s rRNA is about 25 nucleotides in length.

230. The set of probes of any one of claims 217-229, wherein the portion of the third probe that is complementary to a portion of the first probe is 9-11 nucleotides in length.

231. The set of probes of any one of claims 217-230, wherein the portion of the third probe that is complementary to a portion of the second probe is 9-11 nucleotides in length.

232. The set of probes of any one of claims 217-231, wherein1354901-5932-3024.1Atty. Docket No. 114203-1577(a) the portion of the third probe that is complementary to a portion of the first probe is 9 nucleotides in length, and wherein the portion of the third probe that is complementary to a portion of the second probe is 11 nucleotides in length; or(b) the portion of the third probe that is complementary to a portion of the first probe is 10 nucleotides in length, and wherein the portion of the third probe that is complementary to a portion of the second probe is 10 nucleotides in length.

233. The set of probes of any one of claims 217-232, wherein the portion of the first probe that recognizes the first subunit of a ribosome and the portion of the first probe that is complementary to a portion of the third probe are joined by a poly-A nucleotide linker.

234. The set of probes of claim 233, wherein the poly-A nucleotide linker is 10-20 nucleotides in length.

235. The set of probes of claim 233 or 234, wherein the poly-A nucleotide linker is about 10 nucleotides in length.

236. The set of probes of any one of claims 217-235, wherein the portion of the second probe that recognizes the second subunit of a ribosome and the portion of the second probe that is complementary to a portion of the third probe are joined by a poly-A nucleotide linker.

237. The set of probes of claim 236, wherein the poly-A nucleotide linker is 10-20 nucleotides in length.

238. The set of probes of claim 236 or 237, wherein the poly-A nucleotide linker is about 8-12 nucleotides in length.

239. The set of probes of any one of claims 217-238, wherein the third probe comprises a poly-A nucleotide linker between the imaging probe docking site region, and the portions that are complementary to a portion of the first probe and a portion of the second probe.

240. The set of probes of claim 239, wherein the poly-A nucleotide linker is 10-20 nucleotides in length.1364901-5932-3024.1Atty. Docket No. 114203-1577241. The set of probes of claim 159, wherein the poly-A nucleotide linker is about 10 nucleotides in length.

242. The set of probes of any one of claims 217-241, wherein the first probe comprises a 5’ phosphate group.

243. The set of probes of any one of claims 217-242, wherein the second probe comprises a 5’ phosphate group.

244. A kit comprising the set of probes of any one of claims 217-243.

245. An assembled ribosome complex comprising:(a) a first oligonucleotide probe, a second oligonucleotide probe, and a third oligonucleotide probe, wherein(i) the first probe comprises an oligonucleotide portion that recognizes a first subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe;(ii) the second probe comprises an oligonucleotide portion that recognizes a second subunit of a ribosome and an oligonucleotide portion that is complementary to a portion of the third probe; and(iii) the third probe comprises an oligonucleotide portion that is complementary to a portion of the first probe, an oligonucleotide portion that is complementary to a portion of the second probe, and an imaging probe docking site region; and(b) a first subunit of a ribosome; and(c) a second subunit of a ribosome.

246. The assembled ribosome complex of claim 245, further comprising a target RNA of interest.

247. The assembled ribosome complex of claim 245 or 246, further comprising a first imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the third probe, and a fluorescent label.1374901-5932-3024.1Atty. Docket No. 114203-1577248. The assembled ribosome complex of any one of claims 245-247, further comprising one or more RNA target probes, wherein each of the RNA target probes comprises an oligonucleotide portion that is complementary to the RNA of interest and an imaging probe docking site region.

249. The assembled ribosome complex of claim 248, further comprising a second imaging probe comprising an oligonucleotide portion that is complementary to at least a portion of the imaging probe docking site region of the RNA target probe, and a fluorescent label.1384901-5932-3024.1

Images