Conjugated oligonucleotide compounds, methods of making and uses thereof
Novel ligand-conjugated oligonucleotides with galactose derivatives enhance targeted delivery and protection, effectively silencing genes in hepatocytes.
Patent Information
- Application Number
- AU2026205304
- Authority / Receiving Office
- AU · AU
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2026-07-06
- Publication Date
- 2026-07-23
AI Technical Summary
There is a need for novel, ligand-conjugated oligonucleotides that can efficiently target specific cells and protect oligonucleotides from the extracellular environment for therapeutic applications.
Development of novel conjugated oligonucleotide compounds with specific ligand moieties, such as galactose derivatives, linked via linkers to oligonucleotide moieties, enhancing targeted delivery and protection.
The compounds effectively target hepatocytes and provide substantial protection, demonstrating significant gene silencing efficacy in both in vitro and in vivo models.
Smart Images

Figure 00000019_0000 
Figure 00000019_0001 
Figure 00000143_0000
Abstract
Description
FIELD
[0001] The present invention provides novel conjugated oligonucleotide compounds, which are suitable for therapeutic use. Additionally, the present invention provides methods of making these compounds, as well as methods of using such compounds for the treatment of various diseases and conditions. RELATED APPLICATIONS
[0002] This application is related to International Patent Application Number PCT / EP2022 / 052069 and is a divisional of Australian Patent Application No. 2022215065, the contents of both of which are incorporated herein by reference in their entirety. BACKGROUND
[0003] Oligonucleotide compounds have important therapeutic applications in medicine. Oligonucleotides can be used to silence genes that are responsible for a particular disease. Genesilencing prevents formation of a protein by inhibiting translation. Importantly, gene-silencing agents are a promising alternative to traditional small, organic compounds that inhibit the function of the protein linked to the disease. siRNA, antisense RNA, and micro-RNA are oligonucleotides that prevent the formation of proteins by gene-silencing.
[0004] A number of modified siRNA compounds in particular have been developed in the last two decades for diagnostic and therapeutic purposes, including SiRNA / RNAi therapeutic agents for the treatment of various diseases including central-nervous-system diseases, inflammatory diseases, metabolic disorders, oncology, infectious diseases, and ocular diseases.
[0005] Efficient delivery of oligonucleotides to cells in vivo requires specific targeting and substantial protection from the extracellular environment, particularly serum proteins. One method of achieving specific targeting is to conjugate a ligand targeting moiety to the oligonucleotide agent. The ligand targeting moiety helps delivering the oligonucleotide to the required target site. For example, attaching a ligand targeting moiety comprising a terminal galactose or derivative thereof to an oligonucleotide aids targeting to hepatocytes via binding to the asialoglycoprotein receptor (ASGPR). 2026205304 06 Jul 2026
[0006] There exists a need for novel, ligand-conjugated oligonucleotides, and methods for their preparation. SUMMARY
[0007] The present invention provides novel, ligand-conjugated oligonucleotide compounds, methods of making these compounds and uses thereof.
[0008] Provided herein is a compound comprising the following structure: Formula (I) wherein: r and s are independently an integer selected from 1 to 16; and Z is an oligonucleotide moiety.
[0009] Provided herein is a compound of Formula (II): Formula (II)
[0010] Provided herein is a compound of Formula (III): Formula (III) 2026205304 06 Jul 2026
[0011] Provided herein is a compound of Formula (VIII): Formula (VIII)
[0012] Provided herein is a compound of Formula (IX): Oligonucleotide Formula (IX)
[0013] Provided herein is a process of preparing a compound as described anywhere herein, which comprises reacting compounds of Formulae (X) and (XI): 2026205304 06 Jul 2026 Formula (X) Formula (XI) wherein: r and s are independently an integer selected from 1 to 16; and Z is an oligonucleotide moiety; and where appropriate carrying out deprotection of the ligand and / or annealing of a second strand for the oligonucleotide.
[0014] Provided herein is a compound of Formula (X): Formula (X) wherein: r is independently an integer selected from 1 to 16; and Z is an oligonucleotide moiety.
[0015] Provided herein is a compound of Formula (Xa): 2026205304 06 Jul 2026 Formula (Xa)
[0016] Provided herein is a compound of Formula (Xb): Formula (Xb)
[0017] Provided herein is a compound of Formula (XI): Formula (XI) wherein: s is independently an integer selected from 1 to 16; and Z is an oligonucleotide moiety.
[0018] Provided herein is a compound of Formula (XIa): 2026205304 06 Jul 2026 Formula (XIa)
[0019] Provided herein is a compound of Formula (XIb): Formula (XIb)
[0020] Provided herein is use of a compound as described anywhere herein, for the preparation of a compound as described anywhere herein.
[0021] Provided herein is a compound obtained, or obtainable by a process as described anywhere herein. 2026205304 06 Jul 2026
[0022] Provided herein is a pharmaceutical composition comprising of a compound as described anywhere herein, together with a pharmaceutically acceptable carrier, diluent or excipient.
[0023] Provided herein is a compound as described anywhere herein, for use in therapy. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] FIG. 1 shows analysis of hsC5 mRNA expression levels in a total of 45 human-derived cancer cell lysates and lysate of primary human hepatocytes (PHHs). mRNA expression levels are shown in relative light units [RLUs].
[0025] FIG. 2 shows analysis of hsHAO1 mRNA expression levels in a total of 45 human-derived cancer cell lysates and lysate of primary human hepatocytes (PHHs). mRNA expression levels are shown in relative light units [RLUs].
[0026] FIG. 3 shows analysis of hsTTR mRNA expression levels in a total of 45 human-derived cancer cell lysates and lysate of primary human hepatocytes (PHHs). mRNA expression levels are shown in relative light units [RLUs].
[0027] FIGs. 4A-D shows the results from the dose-response analysis of hsTTR targeting GalNAc-siRNAs in HepG2 cells in Example 1.
[0028] FIGs. 5A-D shows the results from the dose-response analysis of hsC5 targeting GalNAc-siRNAs in HepG2 cells in Example 1.
[0029] FIG. 6 shows the analysis of hsTTR (top), hsC5 (middle) and hsHAO1 (bottom) mRNA expression levels in all three batches of primary human hepatocytes BHuf16087 (left), CHF2101 (middle) and CyHuf19009 (right) each after 0h, 24h, 48h and 72h in culture. mRNA expression levels are shown in relative light units [RLUs].
[0030] FIG. 7 shows the analysis of hsGAPDH (top) and hsAHSA1 (bottom) mRNA expression levels in all three batches of primary human hepatocytes BHuf16087 (left), CHF2101 (middle) and CyHuf19009 (right) each after 0h, 24h, 48h and 72h in culture. mRNA expression levels are shown in relative light units [RLUs].
[0031] FIGs. 8A-D shows the results from the dose-response analysis of hsHAO1 targeting GalNAc-siRNAs in PHHs in Example 1. 2026205304 06 Jul 2026
[0032] FIGs. 9A-D shows the results from the dose-response analysis of hsC5 targeting GalNAc-siRNAs in PHHs in Example 1.
[0033] FIGs. 10A-D shows the results from the dose-response analysis of hsTTR targeting GalNAc-siRNAs in PHHs in Example 1.
[0034] FIG. 11 Single dose mouse pharmacology of ETX006. HAO1 mRNA expression is shown relative to the saline control group. Each point represents the mean and standard deviation of 3 mice.
[0035] FIG. 12 Single dose mouse pharmacology of ETX006. Serum glycolate concentration is shown. Each point represents the mean and standard deviation of 3 mice, except for baseline glycolate concentration (day 0) which was derived from a group of 5 mice.
[0036] FIG. 13 Single dose mouse pharmacology of ETX015. C5 mRNA expression is shown relative to the saline control group. Each point represents the mean and standard deviation of 3 mice.
[0037] FIG. 14 Single dose mouse pharmacology of ETX0015. Serum C5 concentration is shown relative to the saline control group. Each point represents the mean and standard deviation of 3 mice.
[0038] FIG. 15 Single dose NHP pharmacology of ETX024. Serum TTR concentration is shown relative to day 1 of the study. Each point represents the mean and standard deviation of 3 animals.
[0039] FIG. 16. Single dose NHP pharmacology of ETX020. Serum TTR concentration is shown relative to day 1 of the study and also pre-dose. Each point represents the mean and standard deviation of 3 animals. Time points up to 84 days are shown.
[0040] FIG. 17 Single dose NHP pharmacology of ETX022. Serum TTR concentration is shown relative to day 1 of the study and also pre-dose. Each point represents the mean and standard deviation of 3 animals. Time points up to 84 days are shown.
[0041] FIG. 18a Single dose NHP pharmacology of ETX024. Serum TTR concentration is shown relative to day 1 of the study and also pre-dose. Each point represents the mean and standard deviation of 3 animals. Time points up to 84 days are shown. 2026205304 06 Jul 2026
[0042] FIG 18b. Sustained suppression of TTR gene expression in the liver after a single 1 mg / kg dose of ETX024. TTR mRNA is shown relative to baseline levels measured pre-dose. Each point represents the mean and standard deviation of 3 animals. Time points up to 84 days are shown.
[0043] FIG 18c. Body weight of animals dosed with a single 1 mg / kg dose of ETX024. Each point represents the mean and standard deviation of 3 animals. Time points up to 84 days are shown.
[0044] FIG 18d ALT concentration in serum from animals treated with a single 1 mg / kg dose of ETX024. Each point represents the mean and standard deviation of 3 animals. The dotted lines show the range of values considered normal for this species (Park et al. 2016 Reference values of clinical pathology parameter in cynomolgus monkeys used in preclinical studies. Lab Anim Res 32:79-86.) Time points up to 84 days are shown.
[0045] FIG 18e. AST concentration in serum from animals treated with a single 1 mg / kg dose of ETX024. Each point represents the mean and standard deviation of 3 animals. The dotted lines show the range of values considered normal for this species (Park et al. 2016 Reference values of clinical pathology parameter in cynomolgus monkeys used in preclinical studies. Lab Anim Res 32:79-86. Time points up to 84 days are shown.
[0046] FIG. 19 Single dose NHP pharmacology of ETX026. Serum TTR concentration is shown relative to day 1 of the study and also pre-dose. Each point represents the mean and standard deviation of 3 animals. Time points up to 84 days are shown.
[0047] FIG.20 Linker and ligand moiety for ETX006, 008, 0015, 0016, 0024 and 0026.
[0048] FIG. 21 Linker and ligand moiety for ETX002, 004, 0011, 0013, 0020 and 0022.
[0049] FIG 22. Total bilirubin concentration in serum from animals treated with a single 1 mg / kg dose of ETX024. Each point represents the mean and standard deviation of 3 animals. The shaded are shows the range of values considered normal at the facility used for the study. The dotted lines show values considered normal for this species (Park et al. 2016 Reference values of clinical pathology parameter in cynomolgus monkeys used in preclinical studies. Lab Anim Res 32:79-86.)
[0050] FIG 23. Blood urea nitrogen (BUN) concentration from animals treated with a single 1 mg / kg dose of ETX024. Each point represents the mean and standard deviation of 3 animals. The 2026205304 06 Jul 2026 shaded are shows the range of values considered normal at the facility used for the study. The dotted lines show values considered normal for this species (Park et al. 2016 Reference values of clinical pathology parameter in cynomolgus monkeys used in preclinical studies. Lab Anim Res 32:79-86.)
[0051] FIG 24. Creatinine (CREA) concentration from animals treated with a single 1 mg / kg dose of ETX024. Each point represents the mean and standard deviation of 3 animals. The shaded are shows the range of values considered normal at the facility used for the study. The dotted lines show values considered normal for this species (Park et al. 2016 Reference values of clinical pathology parameter in cynomolgus monkeys used in preclinical studies. Lab Anim Res 32:79-86.)
[0052] FIG 25-27 are described in more detail below.
[0053] FIG. 28 shows the detail of formulae disclosed herein.
[0054] FIG 29: Figure 29a shows the underlying nucleotide sequences for the sense (SS) and antisense (AS) strands of construct ETX002 as described herein. For ETX002 a galnac linker is attached to the 5’ end region of the sense strand in use (not depicted in Figure 29a). For ETX002 the galnac linker is attached and as shown in Figure 21. Reference to Figure 29a in the subsequent paragraphs is reference to the sequence, construct design and modification pattern of ETX002. iaia as shown at the 3’ end region of the sense strand in Figure 29a represents (i) two abasic nucleotides provided as the penultimate and terminal nucleotides at the 3’ end region of the sense strand, (ii) wherein a 3’-3’ reversed linkage is provided between the antepenultimate nucleotide (namely A at position 21 of the sense strand, wherein position 1 is the terminal 5’ nucleotide of the sense strand, namely terminal G at the 5’end region of the sense strand) and the adjacent penultimate abasic residue of the sense strand, and (iii) the linkage between the terminal and penultimate abasic nucleotides is 5’-3’ when reading towards the 3’ end region comprising the terminal and penultimate abasic nucleotides. For the sense strand of Figure 29a, when reading from position 1 of the sense strand (which is the terminal 5’ nucleotide of the sense strand, namely terminal G at the 5’end region of the sense strand), then: (i) the nucleotides at positions 1 to 6, 8, and 12 to 21 have sugars that are 2’ O-methyl modified, (ii) the nucleotides at positions 7, and 9 to 11 have sugars that are 2’ F modified, (iii) the abasic nucleotides have sugars that have H at positions 1 and 2. 2026205304 06 Jul 2026 For the antisense strand of Figure 29a, when reading from position 1 of the antisense strand (which is the terminal 5’ nucleotide of the antisense strand, namely terminal U at the 5’end region of the antisense strand), then: (i) the nucleotides at positions 1, 3 to 5, 7, 10 to 13, 15, 17 to 23 have sugars that are 2’ O-methyl modified, (ii) the nucleotides at positions 2, 6, 8, 9, 14, 16 have sugars that are 2’ F modified. ETX004 as described herein has the same underlying sequence and galnac linker and attachment as depicted for ETX002 in Figure 29a, but without the terminal iaia motif and with a fully alternating 2’ O-methyl / 2’F modification pattern on the sugars of the nucleotides. For the sense strand, the fully alternating modification pattern starts with a 2’F modification at position 1 at the 5’ end region of the sense strand. For the antisense strand, the fully alternating modification pattern starts with a 2’ O-methyl modification at position 1 at the 5’ end region of the antisense strand. Figure 29b shows the underlying nucleotide sequences for the sense (SS) and antisense (AS) strands of construct ETX006 as described herein. For ETX006 a galnac linker is attached to the 3’ end region of the sense strand in use (not depicted in Figure 29b). For ETX006 the galnac linker is attached and as shown in Figure 20. Reference to Figure 29b in the subsequent paragraphs is reference to the sequence, construct design and modification pattern of ETX006. iaia as shown at the 5’ end region of the sense strand in Figure 29b represents (i) two abasic nucleotides provided as the penultimate and terminal nucleotides at the 5’ end region of the sense strand, (ii) wherein a 5’-5’ reversed linkage is provided between the antepenultimate nucleotide (namely G at position 1 of the sense strand, not including the iaia motif at the 5’ end region of the sense strand in the nucleotide position numbering on the sense strand) and the adjacent penultimate abasic residue of the sense strand, and (iii) the linkage between the terminal and penultimate abasic nucleotides is 3’-5’ when reading towards the 5’ end region comprising the terminal and penultimate abasic nucleotides. For the sense strand of Figure 29b, when reading from position 1 of the sense strand (which is the terminal 5’ nucleotide of the sense strand, namely terminal G at the 5’end region of the sense strand, not including the iaia motif at the 5’ end region of the sense strand in the nucleotide position numbering on the sense strand), then: (i) the nucleotides at positions 1 to 6, 8, and 12 to 21 have sugars that are 2’ O-methyl modified, (ii) the nucleotides at positions 7, and 9 to 11 have sugars that are 2’ F modified, (iii) the abasic nucleotides have sugars that have H at positions 1 and 2. 2026205304 06 Jul 2026 For the antisense strand of Figure 29b, when reading from position 1 of the antisense strand (which is the terminal 5’ nucleotide of the antisense strand, namely terminal U at the 5’end region of the antisense strand), then: (i) the nucleotides at positions 1, 3 to 5, 7, 10 to 13, 15, 17 to 23 have sugars that are 2’ O-methyl modified, (ii) the nucleotides at positions 2, 6, 8, 9, 14, 16 have sugars that are 2’ F modified. ETX008 as described herein has the same underlying sequence and galnac linker and attachment as depicted for ETX006 in Figure 29b, but without the terminal iaia motif and with a fully alternating 2’ O-methyl / 2’F modification pattern on the sugars of the nucleotides. For the sense strand, the fully alternating modification pattern starts with a 2’F modification at position 1 at the 5’ end region of the sense strand. For the antisense strand, the fully alternating modification pattern starts with a 2’ O-methyl modification at position 1 at the 5’ end region of the antisense strand.
[0055] Figure 30: Figure 30a shows the underlying nucleotide sequences for the sense (SS) and antisense (AS) strands of construct ETX011 as described herein. For ETX011 a galnac linker is attached to the 5’ end region of the sense strand in use (not depicted in Figure 30a). For ETX011 the galnac linker is attached and as shown in Figure 21. Reference to Figure 30a in the subsequent paragraphs is reference to the sequence, construct design and modification pattern of ETX011. iaia as shown at the 3’ end region of the sense strand in Figure 30a represents (i) two abasic nucleotides provided as the penultimate and terminal nucleotides at the 3’ end region of the sense strand, (ii) wherein a 3’-3’ reversed linkage is provided between the antepenultimate nucleotide (namely A at position 21 of the sense strand, wherein position 1 is the terminal 5’ nucleotide of the sense strand, namely terminal A at the 5’end region of the sense strand) and the adjacent penultimate abasic residue of the sense strand, and (iii) the linkage between the terminal and penultimate abasic nucleotides is 5’-3’ when reading towards the 3’ end region comprising the terminal and penultimate abasic nucleotides. For the sense strand of Figure 30a, when reading from position 1 of the sense strand (which is the terminal 5’ nucleotide of the sense strand, namely terminal A at the 5’end region of the sense strand), then: (i) the nucleotides at positions 1, 2, 4, 6, 8, 12, 14, 15, 17, 19 to 21 have sugars that are 2’ O-methyl modified, (ii) the nucleotides at positions 3, 5, 7, 9 to 11, 13, 16, 18 have sugars that are 2’ F modified, (iii) the abasic nucleotides have sugars that have H at positions 1 and 2. 2026205304 06 Jul 2026 For the antisense strand of Figure 30a, when reading from position 1 of the antisense strand (which is the terminal 5’ nucleotide of the antisense strand, namely terminal U at the 5’end region of the antisense strand), then: (i) the nucleotides at positions 1, 4, 6, 7, 9, 11 to 13, 15, 17, 19 to 23 have sugars that are 2’ O-methyl modified, (ii) the nucleotides at positions 2, 3, 5, 8, 10, 14, 16, 18 have sugars that are 2’ F modified, (iii) the penultimate and terminal T nucleotides at positions 24, 25 at the 3’ end region of the antisense strand have sugars that have H at position 2. ETX013 as described herein has the same underlying sequence and galnac linker and attachment as depicted for ETX011 in Figure 30a, but without the terminal iaia motif and with a fully alternating 2’ O-methyl / 2’F modification pattern on the sugars of the nucleotides (with the exception of the terminal T nucleotides that have H at position 2). For the sense strand, the fully alternating modification pattern starts with a 2’F modification at position 1 at the 5’ end region of the sense strand. For the antisense strand, the fully alternating modification pattern starts with a 2’ O-methyl modification at position 1 at the 5’ end region of the antisense strand. Figure 30b shows the underlying nucleotide sequences for the sense (SS) and antisense (AS) strands of construct ETX015 as described herein. For ETX015 a galnac linker is attached to the 3’ end region of the sense strand in use (not depicted in Figure 30b). For ETX015 the galnac linker is attached and as shown in Figure 20. Reference to Figure 30b in the subsequent paragraphs is reference to the sequence, construct design and modification pattern of ETX015. iaia as shown at the 5’ end region of the sense strand in Figure 30b represents (i) two abasic nucleotides provided as the penultimate and terminal nucleotides at the 5’ end region of the sense strand, (ii) wherein a 5’-5’ reversed linkage is provided between the antepenultimate nucleotide (namely A at position 1 of the sense strand, not including the iaia motif at the 5’ end region of the sense strand in the nucleotide position numbering on the sense strand) and the adjacent penultimate abasic residue of the sense strand, and (iii) the linkage between the terminal and penultimate abasic nucleotides is 3’-5’ when reading towards the 5’ end region comprising the terminal and penultimate abasic nucleotides. For the sense strand of Figure 30b, when reading from position 1 of the sense strand (which is the terminal 5’ nucleotide of the sense strand, namely terminal A at the 5’end region of the sense strand, not including the iaia motif at the 5’ end region of the sense strand in the nucleotide position numbering on the sense strand), then: (i) the nucleotides at positions 1, 2, 4, 6, 8, 12, 14, 15, 17, 19 to 21 have sugars that are 2’ O-methyl modified, (ii) the nucleotides at positions 2026205304 06 Jul 2026 3, 5, 7, 9 to 11, 13, 16, 18 have sugars that are 2’ F modified, (iii) the abasic nucleotides have sugars that have H at positions 1 and 2. For the antisense strand of Figure 30b, when reading from position 1 of the antisense strand (which is the terminal 5’ nucleotide of the antisense strand, namely terminal U at the 5’end region of the antisense strand), then: (i) the nucleotides at positions 1, 4, 6, 7, 9, 11 to 13, 15, 17, 19 to 23 have sugars that are 2’ O-methyl modified, (ii) the nucleotides at positions 2, 3, 5, 8, 10, 14, 16, 18 have sugars that are 2’ F modified, (iii) the penultimate and terminal T nucleotides at positions 24, 25 at the 3’ end region of the antisense strand have sugars that have H at position 2. ETX017 as described herein has the same underlying sequence and galnac linker and attachment as depicted for ETX015 in Figure 30b, but without the terminal iaia motif and with a fully alternating 2’ O-methyl / 2’F modification pattern on the sugars of the nucleotides (with the exception of the terminal T nucleotides that have H at position 2). For the sense strand, the fully alternating modification pattern starts with a 2’F modification at position 1 at the 5’ end region of the sense strand. For the antisense strand, the fully alternating modification pattern starts with a 2’ O-methyl modification at position 1 at the 5’ end region of the antisense strand.
[0056] Figure 31: Figure 31a shows the underlying nucleotide sequences for the sense (SS) and antisense (AS) strands of construct ETX020 as described herein. For ETX020 a galnac linker is attached to the 5’ end region of the sense strand in use (not depicted in Figure 31a). For ETX020 the galnac linker is attached and as shown in Figure 21. Reference to Figure 31a in the subsequent paragraphs is reference to the sequence, construct design and modification pattern of ETX020. iaia as shown at the 3’ end region of the sense strand in Figure 31a represents (i) two abasic nucleotides provided as the penultimate and terminal nucleotides at the 3’ end region of the sense strand, (ii) wherein a 3’-3’ reversed linkage is provided between the antepenultimate nucleotide (namely A at position 21 of the sense strand, wherein position 1 is the terminal 5’ nucleotide of the sense strand, namely terminal U at the 5’end region of the sense strand) and the adjacent penultimate abasic residue of the sense strand, and (iii) the linkage between the terminal and penultimate abasic nucleotides is 5’-3’ when reading towards the 3’ end region comprising the terminal and penultimate abasic nucleotides. For the sense strand of Figure 31a, when reading from position 1 of the sense strand (which is the terminal 5’ nucleotide of the sense strand, namely terminal U at the 5’end region of the sense 2026205304 06 Jul 2026 strand), then: (i) the nucleotides at positions 1 to 6, 8, and 12 to 21 have sugars that are 2’ O-methyl modified, (ii) the nucleotides at positions 7, and 9 to 11 have sugars that are 2’ F modified, (iii) the abasic nucleotides have sugars that have H at positions 1 and 2. For the antisense strand of Figure 31a, when reading from position 1 of the antisense strand (which is the terminal 5’ nucleotide of the antisense strand, namely terminal U at the 5’end region of the antisense strand), then: (i) the nucleotides at positions 1, 3 to 5, 7, 8, 10 to 13, 15, 17 to 23 have sugars that are 2’ O-methyl modified, (ii) the nucleotides at positions 2, 6, 9, 14, 16 have sugars that are 2’ F modified. ETX022 as described herein has the same underlying sequence and galnac linker and attachment as depicted for ETX020 in Figure 31a, but without the terminal iaia motif and with a fully alternating 2’ O-methyl / 2’F modification pattern on the sugars of the nucleotides. For the sense strand, the fully alternating modification pattern starts with a 2’F modification at position 1 at the 5’ end region of the sense strand. For the antisense strand, the fully alternating modification pattern starts with a 2’ O-methyl modification at position 1 at the 5’ end region of the antisense strand. Figure 31b shows the underlying nucleotide sequences for the sense (SS) and antisense (AS) strands of construct ETX024 as described herein. For ETX024 a galnac linker is attached to the 3’ end region of the sense strand in use (not depicted in Figure 31b). For ETX024 the galnac linker is attached and as shown in Figure 20. Reference to Figure 31b in the subsequent paragraphs is reference to the sequence, construct design and modification pattern of ETX024. iaia as shown at the 5’ end region of the sense strand in Figure 31b represents (i) two abasic nucleotides provided as the penultimate and terminal nucleotides at the 5’ end region of the sense strand, (ii) wherein a 5’-5’ reversed linkage is provided between the antepenultimate nucleotide (namely U at position 1 of the sense strand, not including the iaia motif at the 5’ end region of the sense strand in the nucleotide position numbering on the sense strand) and the adjacent penultimate abasic residue of the sense strand, and (iii) the linkage between the terminal and penultimate abasic nucleotides is 3’-5’ when reading towards the 5’ end region comprising the terminal and penultimate abasic nucleotides. For the sense strand of Figure 31b, when reading from position 1 of the sense strand (which is the terminal 5’ nucleotide of the sense strand, namely terminal U at the 5’end region of the sense strand, not including the iaia motif at the 5’ end region of the sense strand in the nucleotide position numbering on the sense strand), then: (i) the nucleotides at positions 1 to 6, 8, and 12 2026205304 06 Jul 2026 to 21 have sugars that are 2’ O-methyl modified, (ii) the nucleotides at positions 7, and 9 to 11 have sugars that are 2’ F modified, (iii) the abasic nucleotides have sugars that have H at positions 1 and 2. For the antisense strand of Figure 31b, when reading from position 1 of the antisense strand (which is the terminal 5’ nucleotide of the antisense strand, namely terminal U at the 5’end region of the antisense strand), then: (i) the nucleotides at positions 1, 3 to 5, 7, 8, 10 to 13, 15, 17 to 23 have sugars that are 2’ O-methyl modified, (ii) the nucleotides at positions 2, 6, 9, 14, 16 have sugars that are 2’ F modified. ETX026 as described herein has the same underlying sequence and galnac linker and attachment as depicted for ETX024 in Figure 31b, but without the terminal iaia motif and with a fully alternating 2’ O-methyl / 2’F modification pattern on the sugars of the nucleotides. For the sense strand, the fully alternating modification pattern starts with a 2’F modification at position 1 at the 5’ end region of the sense strand. For the antisense strand, the fully alternating modification pattern starts with a 2’ O-methyl modification at position 1 at the 5’ end region of the antisense strand. DETAILED DESCRIPTION
[0057] The present invention provides novel, ligand-conjugated oligonucleotide compounds, methods of making these compounds and uses thereof.
[0058] Compounds of the invention comprise an oligonucleotide moiety and / or a linker and / or a ligand moiety, or parts thereof, as disclosed herein. Preferably, compounds of the invention comprise an oligonucleotide moiety, a linker and a ligand moiety. These moieties may be covalently bonded together, such that the oligonucleotide moiety is covalently bonded to the ligand moiety via the linker.
[0059] It will be understood that compounds of the invention can combine any oligonucleotide moiety as described anywhere herein, and / or any linker as described anywhere herein, and / or any ligand moiety as described anywhere herein.
[0060] By way of clarification and for avoidance of doubt, as used herein and except where the context requires otherwise, the term "comprise" and variations of the term, such as "comprising", "comprises" and "comprised", are not intended to exclude further additions, components, integers or steps.
[0061] Exemplary compounds of the invention comprise the following general structure: 2026205304 06 Jul 2026 Formula (I) wherein: r and s are independently an integer selected from 1 to 16; and Z is an oligonucleotide moiety. 1. LIGAND MOIETY
[0062] Exemplary compounds of the invention comprise a ‘ligand moiety’, as depicted in Formula (I).
[0063] In some embodiments, the ligand moiety as depicted in Formula (I) comprises one or more ligands.
[0064] In some embodiments, the ligand moiety as depicted in Formula (I) comprises one or more carbohydrate ligands.
[0065] In some embodiments, the one or more carbohydrates can be a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and / or polysaccharide.
[0066] In some embodiments, the one or more carbohydrates comprise one or more galactose moieties, one or more lactose moieties, one or more N-AcetylGalactosamine moieties, and / or one or more mannose moieties.
[0067] In some embodiments, the one or more carbohydrates comprise one or more N-Acetyl-Galactosamine moieties.
[0068] In some embodiments, the compounds as described anywhere herein comprise two or three N-AcetylGalactosamine moieties.
[0069] In some embodiments, the one or more ligands are attached in a linear configuration, or in a branched configuration, for example each configuration being respectively attached to a branch point in an overall linker. 2026205304 06 Jul 2026
[0070] Exemplary linear configuration, or branched configurations, of ligand moieties can be depicted as follows, using the nomenclature as further explained in sections 2, 3 and 4 hereinafter.
[0071] Exemplary linear configuration: wherein (a) and / or (b) can typically represent connecting bonds or groups, such as phosphate or phosphorothioate groups, and the dotted box encompasses the linker moiety.
[0072] Exemplary branched configuration: wherein the dotted box encompasses the linker moiety.
[0073] In some embodiments, the one or more ligands are attached as a biantennary or triantennary branched configuration. Typically, a triantennary branched configuration can be preferred, such as an N-AcetylGalactosamine triantennary branched configuration. 2026205304 06 Jul 2026 2. LINKER
[0074] Exemplary compounds of the invention comprise a ‘linker moiety’, as depicted in Formula (I), that is part of an overall ‘linker’.
[0075] As will be further understood in the art, exemplary compounds of the invention comprise an overall linker that is located between the oligonucleotide moiety and the ligand moiety of these compounds. The overall linker, thereby ‘links’ the oligonucleotide moiety and the ligand moiety to each other.
[0076] The overall linker is often notionally envisaged as comprising one or more linker building blocks. For example, there is a linker portion that is depicted as the ‘linker moiety’ as represented in Formula (I) positioned adjacent the ligand moiety and attaching the ligand moiety, typically via a branch point, directly or indirectly to the oligonucleotide moiety. The linker moiety as depicted in Formula (I) can also often be referred to as the ‘ligand arm or arms’ of the overall linker. There can also, but not always, be a further linker portion between the oligonucleotide moiety and the branch point, that is often referred to as the ‘tether moiety’ of the overall linker, ‘tethering’ the oligonucleotide moiety to the remainder of the conjugated compound. Such ‘ligand arms’ and / or ‘linker moieties’ and / or ‘tether moieties’ can be envisaged by reference to the linear and / or branched configurations as set out above.
[0077] As can be seen from the claims, and the reminder of the patent specification, the scope of the present invention extends to linear or branched configurations, and with no limitation as to the number of individual ligands that might be present. Furthermore, the addressee will also be aware that there are many structures that could be used as the linker moiety, based on the state of the art and the expertise of an oligonucleotide chemist.
[0078] The remainder of the overall linker (other than the linker moiety) as set out in the claims, and the remainder of the patent specification, is shown by its chemical constituents in Formula (I), which the inventors consider to be particularly unique to the current invention. In more general terms, however, these chemical constituents could be described as a ‘tether moiety’ as hereinbefore described, wherein the ‘tether moiety’ is that portion of the overall linker which comprises the group of atoms between Z, namely the oligonucleotide moiety, and the linker moiety as depicted in Formula (I). 2026205304 06 Jul 2026 2.1 Tether moiety
[0079] In relation to Formula (I), the ‘tether moiety’ comprises the group of atoms between Z, namely the oligonucleotide moiety, and the linker moiety.
[0080] In some embodiments, s is an integer selected from 4 to 12. In some embodiments, s is 6.
[0081] In some embodiments, r is an integer selected from 4 to 14. In some embodiments, r is 6. In some embodiments, r is 12.
[0082] In some embodiments, r is 12 and s is 6.
[0083] Thus, in some embodiments, exemplary compounds of the invention comprise the following structure: Formula (II)
[0084] In some embodiments, r is 6 and s is 6.
[0085] Thus, in some embodiments, exemplary compounds of the invention comprise the following structure: Formula (III) 2.2 Linker moiety
[0086] In relation to Formula (I), the ‘linker moiety’ as depicted in Formula (I) comprises the group of atoms located between the tether moiety as described anywhere herein, and the ligand moiety as described anywhere herein.
[0087] In some embodiments, the moiety: 2026205304 06 Jul 2026 as depicted in Formula (I) as described anywhere herein is any of Formulae (IV), (V) or (VI), preferably Formula (IV): Formula (IV) wherein: AI is hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and b is an integer of 2 to 5; or Formula (V) wherein: AI is hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and 2026205304 06 Jul 2026 c and d are independently integers of 1 to 6; or Formula (VI) wherein: AI is hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and e is an integer of 2 to 10.
[0088] In some embodiments, the moiety: as depicted in Formula (I) is Formula (VIa): Formula (VIa) 2026205304 06 Jul 2026 wherein: AI is hydrogen, or a suitable hydroxy protecting group; a is 3; and b is an integer of 3.
[0089] In some embodiments, the moiety: as depicted in Formula (I) as described anywhere herein is Formula (VII): Formula (VII) wherein: AI is hydrogen; a is an integer of 2 or 3.
[0090] In some embodiments, a = 2. In some embodiments, a = 3. In some embodiments, b = 3. 3. OLIGONUCLEOTIDE MOEITY
[0091] Exemplary compounds of the present invention comprise an oligonucleotide moiety, depicted as ‘Z’ in Formula (I).
[0092] In some embodiments, Z is: 2026205304 06 Jul 2026 wherein: Z1, Z2, Z3, Z4 are independently at each occurrence oxygen or sulfur; and one the bonds between P and Z2, and P and Z3 is a single bond and the other bond is a double bond.
[0093] In some embodiments, the oligonucleotide is an RNA compound capable of modulating expression of a target gene. In some embodiments, the oligonucleotide is an RNA compound capable of inhibiting expression of a target gene.
[0094] In some embodiments, the RNA compound comprises an RNA duplex comprising first and second strands, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, and wherein each of the first and second strands have 5’ and 3’ ends.
[0095] In some embodiments, the first strand is at least 80% complementary to an RNA sequence of a target gene, such as at least 85%, at least 90%, at least 91%, at least 92% at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary, such as 100% complementary over the length of the first strand.
[0096] In some embodiments, the RNA compound is attached at the 5’ end of its second strand to the adjacent phosphate.
[0097] In some embodiments, the RNA compound is attached at the 3’ end of its second strand to the adjacent phosphate.
[0098] It will be understood that where the RNA compound is attached at the 5’end of the second strand, the phosphate group connecting the oligonucleotide to the linker moiety (i.e. the ‘P’ connected to Z1, Z2 Z3 and Z4) is the naturally occurring phosphate group from the 5’ terminal ribose of the oligonucleotide.
[0099] It will be understood that where the RNA compound is attached at the 3’end of the second strand, the phosphate group connecting the oligonucleotide to the linker moiety (i.e. the 2026205304 06 Jul 2026 ‘P’ connected to Z1, Z2 Z3 and Z4) is engineered on to the 3’ terminal ribose of the oligonucleotide, to substitute the naturally occurring hydroxy group at the 3’ position.
[00100] In some embodiments, the oligonucleotide comprises an RNA duplex which further comprises one or more riboses modified at the 2’ position. In some embodiments, the RNA duplex comprises a plurality of riboses modified at the 2’ position. In some embodiments, the modifications are selected from 2’-O-methyl, 2’-deoxy-fluoro, and 2’-deoxy.
[00101] In some embodiments, the oligonucleotide further comprises one or more degradation protective moieties at one or more ends. In some embodiments, said one or more degradation protective moieties are not present at the end of the oligonucleotide strand that carries the linker / ligand moieties. In some embodiments, said one or more degradation protective moieties are not present at the end of the oligonucleotide strand that is adjacent the remainder of the compound as shown in Formula (I), (VII), (IX), (X) or (XI). In some embodiments, said one or more degradation protective moieties is selected from phosphorothioate internucleotide linkages, phosphorodithioate internucleotide linkages and inverted abasic nucleotides, wherein said inverted abasic nucleotides are present at the distal end of the same strand to the end that carries the linker / ligand moieties. 4. EXEMPLARY COMPOUNDS
[00102] Compounds of the invention combine any oligonucleotide moiety as described anywhere herein, any linker moiety as described anywhere herein, and / or any ligand moiety as described anywhere herein, or parts thereof.
[00103] In some embodiments, the compound comprises Formula (VIII): 2026205304 06 Jul 2026
[00104] In some embodiments, the compound comprises Formula (IX): 4.1 Intermediate Compounds
[00105] Compounds of the invention also include intermediate compounds produced or used during the production processes of the invention as described anywhere herein, for the production of compounds as described anywhere herein.
[00106] Thus, in some embodiments, the compound comprises of Formula (X): Formula (X) wherein: r is independently an integer selected from 1 to 16; and Z is an oligonucleotide moiety.
[00107] In some embodiments, the compound comprises Formula (Xa): 2026205304 06 Jul 2026 Formula (Xa)
[00108] In some embodiments, the compound comprises Formula (Xb): Formula (Xb)
[00109] In some embodiments, the compound comprises Formula (XI): Formula (XI) wherein: s is independently an integer selected from 1 to 16; and Z is an oligonucleotide moiety.
[00110] In some embodiments, the compound comprises Formula (XIa): 2026205304 06 Jul 2026 Formula (XIa)
[00111] In some embodiments, the compound comprises Formula (XIb): Formula (XIb) 5. PRODUCTION PROCESSES
[00112] The invention further provides a process of preparing a compound as described anywhere herein. The invention further provides a process of preparing a composition as described anywhere herein.
[00113] In some embodiments, the process comprises reacting compounds of Formulae (X) and 2026205304 06 Jul 2026 (XI): Formula (X) Formula (XI) wherein: r and s are independently an integer selected from 1 to 16; and Z is an oligonucleotide moiety; and where appropriate carrying out deprotection of the ligand and / or annealing of a second strand for the oligonucleotide.
[00114] In some embodiments, Formula (X) is Formula (Xa): Formula (Xa) and compound of Formula (XI) is Formula (XIa): 2026205304 06 Jul 2026 Formula (XIa) wherein the oligonucleotide comprises an RNA duplex comprising first and second strands, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, and wherein each of the first and second strands have 5’ and 3’ ends, and wherein said RNA duplex is attached at the 5’ end of its second strand to the adjacent phosphate.
[00115] In some embodiments, Formula (X) is Formula (Xb): Formula (Xb) and compound of Formula (XI) is Formula (XIa): Formula (XIa) wherein the oligonucleotide comprises an RNA duplex comprising first and second strands, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, and wherein each of 2026205304 06 Jul 2026 the first and second strands have 5’ and 3’ ends, and wherein said RNA duplex is attached at the 3’ end of its second strand to the adjacent phosphate.
[00116] In some embodiments, Formula (XIa) is Formula (XIb): Formula (XIb) 6. USES
[00117] The invention relates to use of the compounds and compositions as described anywhere herein.
[00118] The present invention also relates to uses of a compound as described anywhere herein, for the preparation of another compound as described anywhere herein.
[00119] The present invention also relates to a compound obtained, or obtainable by a process as described anywhere herein. 2026205304 06 Jul 2026
[00120] Thus, the present invention relates to a pharmaceutical composition comprising of a compound as described anywhere herein, together with a pharmaceutically acceptable carrier, diluent or excipient.
[00121] The present invention also relates to a compound or pharmaceutical composition as described anywhere herein, for use in therapy.
[00122] Suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, pro-drug formulations are also encompassed by the present invention.
[00123] The compounds of the invention may be utilized as research reagents for, for example, diagnostics, therapeutics and prophylaxis.
[00124] In therapy, compounds of the invention may be used to specifically modulate the synthesis of a target protein in a cell. This can be achieved by degrading, silencing or inhibiting the mRNA of said target protein, thereby preventing the formation of said protein. Alternatively, compounds of the invention may be used to modulate a non-coding DNA or RNA molecule exerting a regulatory effect on mechanisms within a cell in cells and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a target for therapeutic intervention.
[00125] In preferred embodiments, target protein is in a target cell that comprises asialoglycoprotein receptors (ASPGR) on the surface, such as liver cells, in particular hepatocytes.
[00126] Thus, compounds of the invention may be used as a therapy in an animal or a human, suspected of having a disease or disorder, which can be alleviated or treated by modulating a DNA or RNA encoding a mammalian target polypeptide in said animal or human.
[00127] In preferred embodiments the target nucleic acid is a gene, a messenger RNA (mRNA) or micro RNA (miRNA).
[00128] Further provided are methods of treating a mammal, such as treating a human, suspected of having or being prone to a disease or condition, by administering a therapeutically or prophylactically effective amount of one or more of the compounds or compositions of the invention. 2026205304 06 Jul 2026
[00129] The invention also provides for the use of the compound or conjugate of the invention as described for the manufacture of a medicament for the treatment of a disorder or for a method of the treatment of as a disorder affected by the modulation of a target nucleic acid.
[00130] The invention also provides for a method for treating a disorder, said method comprising administering a compound according to the invention and / or a pharmaceutical composition according to the invention to a patient in need thereof.
[00131] Examples of disorders to be treated are liver diseases such as hepatitis (including viral hepatitis, such as HBV or HCV), hepatic steatosis, atherosclerosis, hyperlipidemia, hypercholesterolemia, familiar hypercholesterolemia e.g. gain of function mutations in Apolipoprotein B, HDL / LDL cholesterol imbalance, dyslipidemias, e.g., familial hyperlipidemia (FCHL), acquired hyperlipidemia, statin-resistant hypercholesterolemia, coronary artery disease (CAD), and coronary heart disease (CHD), cirrhosis and cancer. 7. DEFINITIONS
[00132] Unless defined otherwise, all terms of art, notations and other technical and scientific terms or terminology used herein are intended to have the same meaning as is commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art.
[00133] It is to be understood that this invention is not limited to particular compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the content clearly dictates otherwise.
[00134] The term “about” as used herein refers to the usual error range for the respective value readily known to the skilled person in this technical field. Reference to “about” a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se.
[00135] It is understood that aspects and embodiments of the invention described herein include “comprising,” “consisting,” and “consisting essentially of’ aspects and embodiments. 2026205304 06 Jul 2026
[00136] As used herein, the term “and / or” refers to any one of the items, any combination of the items, or all of the items with which the term is associated. For instance, the phrase “A, B, and / or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or B; A or C; B or C; A and B; A and C; B and C; A and B or C; B and A or C; C and A or B; A (alone); B (alone); and C (alone).
[00137] The term "complementary" means that two sequences are complementary when the sequence of one can bind to the sequence of the other in an anti-parallel sense wherein the 3'-end of each sequence binds to the 5'-end of the other sequence and each A, T(U), G, and C of one sequence is then aligned with a T(U), A, C, and G, respectively, of the other sequence. 8. EXAMPLES
[00138] The invention will be more fully understood by reference to the following examples. They should not, however, be construed as limiting the scope of the invention. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.
[00139] The following constructs are used in the examples: 2026205304 06 Jul 2026 Table 1: Target ID Sense Sequence 5’ ^ 3’ Antisense Sequence 5’ ^ 3’ hsHAO1 ETX006 (invabasic)(invabasic)gsascuuuCfa UfCfCfuggaaauasusa(NHC6)(ET- GalNAc-T2CO) usAfsuauUfuCfCfaggaUfgAfa agucscsa hsHAO1 ETX002 (ET-GalNAc- T2CO)(NH2C 12)gacuuuCfaUfCfC fuggaaauasusa(invabasic)(invabasi c) usAfsuauUfuCfCfaggaUfgAfa agucscsa hsHAO1 ETX004 (ET-GalNAc- T2CO)(NH2C 12)GfaCfuUfuCfaUf cCfuGfgAfaAfuAfsusAf usAfsuAfuUfuCfcAfgGfaUfg AfaAfgUfcsCfsa hsHAOl ETX008 GfsasCfuUfuCfaUfcCfuGfgAfaAf uAfuAf(NHC6)(ET-GalNAc-T2CO) usAfsuAfuUfuCfcAfgGfaUfg AfaAfgUfcsCfsa hsHAOl ECX008 (lower purity) GfsasCfuUfuCfaUfcCfuGfgAfaAf uAfuAf(NHC6)(ET-GalNAc-T2CO) usAfsuAfuUfuCfcAfgGfaUfg AfaAfgUfcsCfsa hsC5 ETX011 (ET-GalNAc- T2CO)(NH2C 12)aaGfc AfaGfaUfA fUfuUfuuAfuAfasusa(invabasic)(in vabasic) usAfsUfuAfuaAfaAfauaUfcU fuGfcuususudT dT hsC5 ETX015 (invabasic)(invabasic)asasGfcAfaG faUfAfUfuUfuuAfuAfaua(NHC6)( ET-GalNAc-T2CO) usAfsUfuAfuaAfaAfauaUfcU fuGfcuususudT dT hsC5 ETX013 (ET-GalNAc- T2CO)(NH2C 12)AfaGfcAfaGfaUf aUfuUfuUfaUfaAfsusAf usAfsuUfaUfaAfaAfaUfaUfc UfuGfcUfusUfsudTdT hsC5 ETX017 AfsasGfcAfaGfaUfaUfuUfuUfaUf aAfuAf(NHC6)(ET-GalNAc-T2CO) usAfsuUfaUfaAfaAfaU faU fc UfuGfcUfusUfsudTdT 2026205304 06 Jul 2026 Target ID Sense Sequence 5’ -> 3’ Antisense Sequence 5’ -> 3’ hsTTR ETX020 (ET-GalNAc- T2CO)(NH2C 12)ugggauUfuCfAf Ufguaaccaasgsa(invabasic)(invabas ic) usCfsuugGfuuAfcaugAfaAfuc ccasusc hsTTR ETX022 (ET-GalNAc- T2CO)(NH2C 12)UfgGfgAfuUfuC faUfgUfaAfcCfaAfsgsAf usCfsuUfgGfuUfaCfaUfgAfa AfuCfcCfasUfsc hsTTR ETX024 (invabasic)(invabasic)usgsggauUfu CfAfUfguaaccaaga(NHC6)(ET- GalNAc-T2CO) usCfsuugGfuuAfcaugAfaAfuc ccasusc hsTTR ETX026 UfsgsGfgAfuUfuCfaUfgUfaAfcCf aAfgAf(NHC6)(ET-GalNAc-T2CO) usCfsuUfgGfuUfaCfaUfgAfa AfuCfcCfasUfsc In Table 1 the components in brackets having the following nomenclature (NHC6), (NH2C12) and (ET-GalNAc-T2CO) are descriptors of elements of the linkers, and the complete corresponding linker structures are shown in Fig 20 and Fig 21 herein. This correspondence of abbreviation to actual linker structure similarly applies to all other references of the above abbreviations herein. Reference to (invabasic)(invabasic) refers to a polynucleotide in which the terminal 2 sugar moieties are abasic and in an inverted configuration, with the bond between the penultimate sugar moiety and the antepenultimate sugar being a reversed bond (a 5-5 or a 3-3 bond). 2026205304 06 Jul 2026 Table 1A Target ID Short Descriptor Linker plus ligand SiRNA as Table 1 hsHAO1 ETX006 3’-GalNAc T2a inverted abasic Linker + ligand as Figure 20 hsHAOl ETX002 5’-GalNAc T2b inverted abasic Linker + ligand as Figure 21 hsHAO1 ETX004 5’-GalNAc T2b alternating Linker + ligand as Figure 21 hsHAOl ETX008 3’-GalNAc T2a alternating Linker + ligand as Figure 20 hsHAOl ECX008 (lower purity) 3’-GalNAc T2a alternating Linker + ligand as Figure 20 hsC5 ETX011 5’-GalNAc T2b inverted abasic Linker + ligand as Figure 21 hsC5 ETX015 3’-GalNAc T2a inverted abasic Linker + ligand as Figure 20 hsC5 ETX013 5’-GalNAc T2b alternating Linker + ligand as Figure 21 hsC5 ETX017 3’-GalNAc T2a alternating Linker + ligand as Figure 20 hsTTR ETX020 5’-GalNAc T2b inverted abasic Linker + ligand as Figure 21 hsTTR ETX022 5’-GalNAc T2b alternating Linker + ligand as Figure 21 hsTTR ETX024 3’-GalNAc T2a inverted abasic Linker + ligand as Figure 20 hsTTR ETX026 3’-GalNAc T2a alternating Linker + ligand as Figure 20
[00140] The following control constructs are also used in the examples: Table 2: Target ID Sense Sequence 5’ ^ 3’ Antisense Sequence 5’ -> 3’ F-Luc XD-00914 cuuAcGcuGAGuAcuucGAdT s dT UCGAAGuACUcAGCGuAAGdTs dT hsFVII XD-03999 AGAuAuGcAcAcAcAcGGAd TsdT UCCGUGUGUGUGcAuAUCUdT sdT hsAHSA 1 XD-15421 uscsUfcGfuGfgCfcUfuAfaUfg AfaAf(invdT) UfsUfsuCfaUfuAfaGfgCfcAfcGfa Gfasusu 2026205304 06 Jul 2026 Abbreviations: AHSA1 Activator of heat shock protein ATPase1 ASGR1 Asialoglycoprotein Receptor 1 ASO Antisense oligonucleotide bDNA branched DNA bp base-pair C5 complement C5 conc. concentration ctrl. control CV coefficient of variation dG, dC, dA, dT DNA residues F Fluoro FCS fetal calf serum GalNAc N-Acetylgalactosamine GAPDH Glyceraldehyde 3-phosphate dehydrogenase G, C, A, U RNA residues g, c, a, u 2’-O-Methyl modified residues Gf, Cf, Af, Uf 2’-Fluoro modified residues h hour HAO1 Hydroxyacid Oxidase 1 HPLC High performance liquid chromatography Hs Homo sapiens IC50 concentration of an inhibitor where the response is reduced by 50% ID identifier KD knockdown LF2000 Lipofectamine2000 M molar Mf Macaca fascicularis min minute MV mean value n.a. or N / A not applicable NEAA non-essential amino acid nt nucleotide QC Quality control 2026205304 06 Jul 2026 QG2.0 QuantiGene 2.0 RLU relative light unit RNAi RNA interference RT room temperature s Phosphorothioate backbone modification SAR structure-activity relationship SD standard deviation siRNA small interfering RNA TTR Transthyretin 2026205304 06 Jul 2026 8.1 Example 1 - Summary
[00141] GalNAc-siRNAs targeting either hsHAO1, hsC5 or hsTTR mRNA were synthesized and QC-ed. The entire set of siRNAs (except siRNAs targeting HAO1) was first studied in a dose-response setup in HepG2 cells by transfection using RNAiMAX, followed by a doseresponse analysis in a gymnotic free uptake setup in primary human hepatocytes.
[00142] Direct incubation of primary human hepatocytes with GalNAc-siRNAs targeting hsHAO1, hsC5 or hsTTR mRNA resulted in dose-dependent on-target mRNA silencing to varying degrees. - Aim of study
[00143] The aim of this set of experiments was to analyze the in vitro activity of different GalNAc-ligands in the context of siRNAs targeting three different on-targets, namely hsHAO1, hsC5 or hsTTR mRNA.
[00144] Work packages of this study included (i) assay development to design, synthesize and test bDNA probe sets specific for each and every individual on-target of interest, (ii) to identify a cell line suitable for subsequent screening experiments, (iii) dose-response analysis of potentially all siRNAs (by transfection) in one or more human cancer cell lines, and (iv) dose-response analysis of siRNAs in primary human hepatocytes in a gymnotic, free uptake setting. In both settings, IC50 values and maximal inhibition values should be calculated followed by ranking of the siRNA study set according to their potency. - Material and Methods Oligonucleotide synthesis
[00145] Standard solid-phase synthesis methods were used to chemically synthesize siRNAs of interest (see Table 1) as well as controls (see Table 2). Cell culture and in-vitro transfection experiments
[00146] Cell culture, transfection and QuantiGene2.0 branched DNA assay are described below, and siRNA sequences are listed in Tables 1 and 2. HepG2 cells were supplied by American Tissue Culture Collection (ATCC) (HB-8065, Lot #: 63176294) and cultured in ATCC-formulated Eagle's Minimum Essential Medium supplemented to contain 10 % fetal calf serum 2026205304 06 Jul 2026 (FCS). Primary human hepatocytes (PHHs) were sourced from Primacyt (Schwerin, Germany) (Lot#: CyHuf19009HEc). Cells are derived from a malignant glioblastoma tumor by explant technique. All cells used in this study were cultured at 37°C in an atmosphere with 5% CO2 in a humidified incubator.
[00147] For transfection of HepG2 cells with hsC5 or hsTTR targeting siRNAs (and controls), cells were seeded at a density of 20.000 cells / well in regular 96-well tissue culture plates. Transfection of cells with siRNAs was carried out using the commercially available transfection reagent RNAiMAX (Invitrogen / Life Technologies) according to the manufacturer’s instructions. 10 point dose-response experiments of 20 candidates (11x hsC5, 9x hsTTR) were done in HepG2 cells with final siRNA concentrations of 24, 6, 1.5, 0.4, 0.1, 0.03, 0.008, 0.002, 0.0005 and 0.0001 nM, respectively.
[00148] Dose response analysis in PHHs was done by direct incubation of cells in a gymnotic, free uptake setting starting with 1.5pM highest final siRNA concentration, followed by 500nM and from there on going serially down in twofold dilution steps.
[00149] Control wells were transfected into HepG2 cells or directly incubated with primary human hepatocytes at the highest test siRNA concentrations studied on the corresponding plate. All control siRNAs included in the different project phases next to mock treatment of cells are summarized and listed in Table 2. For each siRNA and control, at least four wells were transfected / directly incubated in parallel, and individual data points were collected from each well.
[00150] After 24h of incubation with siRNA post-transfection, media was removed and HepG2 cells were lysed in Lysis Mixture (1 volume of lysis buffer plus 2 volumes of nuclease-free water) and then incubated at 53°C for at least 45 minutes. In the case of PHHs, plating media was removed 5h post treatment of cells followed by addition of 50pl of complete maintenance medium per well. Media was exchanged in that way every 24h up to a total incubation period of 72h. At either 4h or 72h time point, cell culture supernatant was removed followed by addition of 200pl of Lysis Mixture supplemented with 1:1000 v / v of Proteinase K.
[00151] The branched DNA (bDNA) assay was performed according to manufacturer’s instructions. Luminescence was read using a 1420 Luminescence Counter (WALLAC VICTOR Light, Perkin Elmer, Rodgau-Jugesheim, Germany) following 30 minutes incubation in the presence of substrate in the dark. For each well, the on-target mRNA levels were normalized to the hsGAPDH mRNA levels. The activity of any siRNA was expressed as percent on-target 2026205304 06 Jul 2026 mRNA concentration (normalized to hsGAPDH mRNA) in treated cells, relative to the mean on-target mRNA concentration (normalized to hsGAPDH mRNA) across control wells. Assay Development
[00152] QuantiGene2.0 branched DNA (bDNA) probe sets were designed and synthesised specific for Homo sapiens GAPDH, AHSA1, hsHAO1, hsC5 and hsTTR. bDNA probe sets were initially tested by bDNA analysis according to manufacturer’s instructions, with evaluation of levels of mRNAs of interest in two different lysate amounts, namely 10^1 and 50^1, of the following human and monkey cancer cell lines next to primary human hepatocytes: SJSA-1, TF1, NCI-H1650, Y-79, Kasumi-1, EAhy926, Caki-1, Colo205, RPTEC, A253, HeLaS3, Hep3B, BxPC3, DU145, THP-1, NCI-H460, IGR37, LS174T, Be(2)-C, SW 1573, NCI-H358, TC71, 22Rv1, BT474, HeLa, KBwt, Panc-1, U87MG, A172, C42, HepG2, LNCaP, PC3, SupT11, A549, HCT116, HuH7, MCF7, SH-SY5Y, HUVEC, C33A, HEK293, HT29, MOLM 13 and SK-MEL-2. Wells containing only bDNA probe set without the addition of cell lysate were used to monitor technical background and noise signal. - Results Identification of suitable cell types for screening of GalNAc-siRNAs
[00153] Fig. 1 to Fig. 3 show mRNA expression data for the three on-targets of interest, namely hsC5, hsHAO1 and hsTTR, in lysates of a diverse set of human cancer cell lines plus primary human hepatocytes. Cell numbers per lysate volume are identical with each cell line tested, this is necessary to allow comparisons of expression levels amongst different cell types. Fig. 1 shows hsC5 mRNA expression data for all cell types tested.
[00154] The identical type of cells were also screened for expression of hsHAO1 mRNA, results are shown in bar diagrams as part of Fig. 2.
[00155] Lastly, suitable cell types were identified which would allow for screening of GalNAc-siRNAs targeting hsTTR, respective data are part of Fig. 3.
[00156] In summary, mRNA expression levels for all three on-targets of interest are high enough in primary human hepatocytes (PHHs). Further, HepG2 cells could be used to screen GalNAc-siRNAs targeting hsC5 and hsTTR mRNAs, in contrast, no cancer cell line could be identified which would be suitable to test siRNAs specific for hsHAO1 mRNA. Dose-response analysis of hsTTR targeting GalNAc-siRNAs in HepG2 cells 2026205304 06 Jul 2026
[00157] Following transfection optimization, HepG2 cells were transfected with the entire set of hsTTR targeting GalNAc-siRNAs (see Table 1) in a dose-response setup using RNAiMAX. The highest final siRNA test concentration was 24nM, going down in nine fourfold dilution steps. The experiment ended at 4h and 24h post transfection of HepG2 cells. Table 3 lists activity data for all hsTTR targeting GalNAC-siRNAs studied. Table 3: Target, incubation time, external ID, IC20 / IC50 / IC80 values and maximal inhibition of hsTTR targeting siRNAs in HepG2 cells. The listing is ordered according to external ID, with 4h of incubation listed on top and 24h of incubation on the bottom. Target Incubation [h] External ID IC20 [nM] IC50 [nM] IC80 [nM] Max. Inhib. [%] hsTTR 4 ETX020 1,953 #N / A #N / A 37,9 hsTTR 4 ETX022 #N / A #N / A #N / A 15,9 hsTTR 4 ETX024 1,952 #N / A #N / A 48,2 hsTTR 4 ETX026 #N / A #N / A #N / A 0,8 hsTTR 24 ETX020 0,005 0,025 0,133 95,5 hsTTR 24 ETX022 0,007 0,045 0,371 94,9 hsTTR 24 ETX024 0,008 0,029 0,134 95,5 hsTTR 24 ETX026 0,015 0,075 0,383 92,2 Results for the 24h incubation are also shown in Figures 4A-D
[00158] In general, transfection of HepG2 cells with hsTTR targeting siRNAs results in on-target mRNA silencing spanning in general the entire activity range from 0% silencing to maximal inhibition. Data generated 24h post transfection are more robust with lower standard variations, as compared to data generated only 4h post transfection. Further, the extent of on-target knockdown generally increases over time from 4h up to 24h of incubation. hsTTR GalNAc-siRNAs have been identified that silence the on-target mRNA >95% with IC50 values in the low double-digit pM range. Dose-response analysis of hsC5 targeting GalNAc-siRNAs in HepG2 cells
[00159] The second target of interest, hsC5 mRNA, was tested in an identical dose-response setup (with minimally different final siRNA test concentrations, however) by transfection of 2026205304 06 Jul 2026 HepG2 cells using RNAiMAX with GalNAc-siRNAs sharing identical linger / position / GalNAc-ligand variations as with hsTTR siRNAs, but sequences specific for the on-target hsC5 mRNA. Table 4: Target, incubation time, external ID, IC20 / IC50 / IC80 values and maximal inhibition of hsC5 targeting siRNAs in HepG2 cells. The listing is ordered according to external ID, with 4h of incubation listed on top and 24h of incubation on the bottom. Target Incubation [h] External ID IC20 [nM] IC50 [nM] IC80 [nM] Max. Inhib. [%] C5 4 ETX011 0,091 0,424 #N / A 74,6 C5 4 ETX013 0,377 1,174 #N / A 66,5 C5 4 ETX015 0,407 0,578 #N / A 61,9 C5 4 ETX017 1,024 3,328 #N / A 60,4 C5 24 ETX011 0,001 0,005 0,045 88,4 C5 24 ETX013 0,002 0,012 0,166 86,7 C5 24 ETX015 0,003 0,013 0,099 88,8 C5 24 ETX017 0,005 0,019 0,164 83,8 Results for the 24h incubation are also shown in Figures 5A-D
[00160] There is dose-dependent on-target hsC5 mRNA silencing upon transfection of HepG2 cells with the GalNAc-siRNA set specific for hsC5. Some knockdown can already be detected at 4h post-transfection of cells, an even higher on-target silencing is observed after a longer incubation period, namely 24h. hsC5 GalNAc-siRNAs have been identified that silence the on-target mRNA almost 90% with IC50 values in the low single-digit pM range. Identification of a primary human hepatocyte batch suitable for testing of all GalNAc-siRNAs
[00161] The dose-response analysis of the two GalNAc-siRNA sets in human cancer cell line HepG2 should demonstrate (and ensure) that all new GalNAc- / linker / position / cap variants are indeed substrates for efficient binding to AGO2 and loading into RISC, and in addition, able to function in RNAi-mediated cleavage of target mRNA. However, in order to test whether the targeting GalNAc-ligand derivatives allow for efficient uptake into hepatocytes, dose-response analysis experiments should be done in primary human hepatocytes by gymnotic, free uptake setup. Hepatocytes do exclusively express the Asialoglycoprotein receptor (ASGR1) to high levels, and this receptor generally is used by the liver to remove target glycoproteins from 2026205304 06 Jul 2026 circulation. It is common knowledge by now, that certain types of oligonucleotides, e.g. siRNAs or ASOs, conjugated to GalNAc-ligands are recognized by this high turnover receptor and efficiently taken up into the cytoplasm via clathrin-coated vesicles and trafficking to endosomal compartments. Endosomal escape is thought to be the rate-limiting step for oligonucleotide delivery.
[00162] An intermediate assay development experiment was done in which different batches of primary human hepatocytes were tested for their expression levels of relevant genes of interest, namely hsC5, hsTTR, hsHAO1, hsGAPDH and hsAHSA1. Primacyt (Schwerin, Germany) provided three vials of different primary human hepatocyte batches for testing, namely BHuf16087, CHF2101 and CyHuf19009. The cells were seeded on collagen-coated 96-well tissue culture plates, followed by incubation of cells for 0h, 24h, 48h and 72h before cell lysis and bDNA analysis to monitor mRNA levels of interest. Fig. 6 shows the absolute mRNA expression data for all three on-targets of interest - hsTTR, hsC5 and hsHAO1 - in the primary human hepatocyte batches BHuf16087, CHF2101 and CyHuf19009. mRNA expression levels of hsGAPDH and hsAHSA1 are shown in Figure 7.
[00163] In Figure 6 and 7 the left hand column of each data set triplet is BHuf16087, the middle column is CHF2101 and the right hand column is CyHuf19009.
[00164] Overall, the mRNA expression of all three on-targets of interest in the primary human hepatocyte batches BHuf16087 and CyHuf19009 are high enough after 72h to continue with the bDNA assay. Due to the total amount of vials available for further experiments, we continued the experiments with the batch CyHuf19009. Dose-response analysis of hsHAO1 targeting GalNAc-siRNAs in PHHs
[00165] Following the identification of a suitable batch (CyHuf19009) of primary human hepatocytes (PHHs), a gymnotic, free uptake analysis was performed of hsHAO1 targeting GalNAc-siRNAs, listed in Table 1. The highest tested final siRNA concentration was 1.5^M, followed by 500nM, going down in eight two-fold serial dilution steps to the lowest final siRNA concentration of 1.95nM. The experiments ended at 4h and 72h post direct incubation of PHH cells. Table 5 lists activity data for all hsHAO1 targeting GalNAc-siRNAs studied. All control siRNAs included in this experiment are summarized and listed in Table 2. Table 5: Target, incubation time, external ID, IC20 / IC50 / IC80 values and maximal inhibition of hsHAO1 targeting GalNAc-siRNAs in primary human hepatocytes (PHHs). The listing is 2026205304 06 Jul 2026 organized according to external ID, with 4h and 72h incubation listed on top and bottom, respectively. Target Incubation [h] External ID IC20 [nM] IC50 [nM] IC80 [nM] Max. Inhib. [%] hsHAOl (hsGOl) 4 ETX002 #N / A #N / A #N / A 7,2 hsHAOl (hsGOl) 4 ETX004 #N / A #N / A #N / A -2,3 hsHAOl (hsGOl) 4 ETX006 #N / A #N / A #N / A 0,5 hsHAOl (hsGOl) 4 ETX008 #N / A #N / A #N / A 5,4 hsHAOl (hsGOl) 4 ECX008 (lower purity) #N / A #N / A #N / A 2,0 hsHAOl (hsGOl) 72 ETX002 23,9 #N / A #N / A 44,3 hsHAOl (hsGOl) 72 ETX004 2,8 #N / A #N / A 35,5 hsHAOl (hsGOl) 72 ETX006 27,5 617,1 #N / A 53,6 hsHAOl (hsGOl) 72 ETX008 51,5 #N / A #N / A 34,7 hsHAOl (hsGOl) 72 ECX008 (lower purity) 4,9 260,3 #N / A 58,1 Results for the 72h incubation are also shown in Figures 8A-D.
[00166] Gymnotic, free uptake of GalNAc-siRNAs targeting hsHAO1 did not lead to significant on-target silencing within 4h, however after 72h incubation on-target silencing was visible in a range of 35.5 to 58.1% maximal inhibition. Dose-response analysis of hsC5 targeting GalNAc-siRNAs in PHHs
[00167] The second target of interest, hsC5 mRNA, was tested in an identical dose-response setup by gymnotic, free uptake in PHHs with GalNAc-siRNAs sharing identical 2026205304 06 Jul 2026 linker / position / GalNAc-ligand variations as with hsTTR and hsHAO1 tested in the assays before, but sequences specific for the on-target hsC5 mRNA. Sequences for the GalNAc-siRNAs targeting hsC5 and all sequences and information about control siRNAs are listed in Table 1 and Table 2, respectively. The experiment ended after 4h and 72h direct incubation of PHHs. Table 6 lists activity data for all hsC5 targeting GalNAc-siRNAs studied. Table 6: Target, incubation time, external ID, IC20 / IC50 / IC80 values and maximal inhibition of hsC5 targeting GalNAc-siRNAs in PHHs. The listing is organized according to external ID, with 4h and 72h incubation listed on top and bottom, respectively. Target Incubation [h] External ID IC20 [nM] IC50 [nM] IC80 [nM] Max. Inhib. [%] C5 4 ETX011 #N / A #N / A #N / A -2,9 C5 4 ETX013 #N / A #N / A #N / A 1,2 C5 4 ETX015 #N / A #N / A #N / A 7,6 C5 4 ETX017 #N / A #N / A #N / A 4,4 C5 72 ETX011 2,6 295,3 #N / A 62,1 C5 72 ETX013 9,4 322,3 #N / A 57,5 C5 72 ETX015 7,2 315,0 #N / A 57,2 C5 72 ETX017 49,9 #N / A #N / A 40,0 Results for the 72h incubation are also shown in Figures 9A-D.
[00168] No significant on-target silencing of GalNAc-siRNAs is visible after 4h incubation. Data generated after an incubation period of 72h showed a more robust on-target silencing of up to 65.5% maximal inhibition. Dose-response analysis of hsTTR targeting GalNAc-siRNAs in PHHs
[00169] The last target of interest, hsTTR mRNA, was again tested in a gymnotic, free uptake in PHHs in an identical dose-response setup as for the targets hsHAO1 and hsC5, with the only difference being that specific siRNA sequences for the on-target hsTTR mRNA was used (see Table 1).
[00170] The experiment ended after 72h of direct incubation of PHHs. Table 7 lists activity data for all hsTTR targeting GalNAc-siRNAs studied. 2026205304 06 Jul 2026 Table 7: Target, incubation time, external ID, IC20 / IC50 / IC80 values and maximal inhibition of hsTTR targeting GalNAc-siRNAs in primary human hepatocytes (PHHs). The listing is organized according to external ID. Target Incubation [h] External ID IC20 [nM] IC50 [nM] IC80 [nM] Max. Inhib. [%] hsTTR 72 ETX020 2,2 31,0 #N / A 78,4 hsTTR 72 ETX022 0,7 20,4 #N / A 69,5 hsTTR 72 ETX024 9,5 110,0 #N / A 71,3 hsTTR 72 ETX026 4,8 139,0 #N / A 68,0 Results are also shown in Figures 10A-D.
[00171] Gymnotic, free uptake of GalNAc-siRNAs targeting hsTTR did lead to significant on-target silencing within 72h, ranging between 46 to 82.5% maximal inhibition. - Conclusions and Discussion
[00172] The scope of this study was to analyze the in vitro activity of GalNAc-ligands according to the present invention when used in the context of siRNAs targeting three different on-targets, namely hsHAO1, hsC5 and hsTTR mRNA. siRNA sets specific for each target were composed of siRNAs with different linker / cap / modification / GalNAc-ligand chemistries in the context of two different antisense strands each.
[00173] For all targets, GalNAc-siRNAs from Table 1 were identified that showed a high overall potency and low IC50 value. 2026205304 06 Jul 2026 8.2 Example 2 Routes of Synthesis i) Synthesis of the conjugate building blocks TriGalNAc
[00174] Thin layer chromatography (TLC) was performed on silica-coated aluminium plates with fluorescence indicator 254 nm from Macherey-Nagel. Compounds were visualized under UV light (254 nm), or after spraying with the 5% H2SO4 in methanol (MeOH) or ninhydrin reagent according to Stahl (from Sigma-Aldrich), followed by heating. Flash chromatography was performed with a Biotage IsoleraOne flash chromatography instrument equipped with a dual variable UV wavelength detector (200-400 nm) using Biotage Sfar Silica 10, 25, 50 or 100 g columns (Uppsala, Sweden).
[00175] All moisture-sensitive reactions were carried out under anhydrous conditions using dry glassware, anhydrous solvents and argon atmosphere. All commercially available reagents were purchased from Sigma-Aldrich and solvents from Carl Roth GmbH + Co. KG. D-Galactosamine pentaacetate was purchased from AK scientific.
[00176] HPLC / ESI-MS was performed on a Dionex UltiMate 3000 RS UHPLC system and Thermo Scientific MSQ Plus Mass spectrometer using an Acquity UPLC Protein BEH C4 column from Waters (300A, 1.7 gm, 2.1 x 100 mm) at 60 °C. The solvent system consisted of solvent A with H2O containing 0.1% formic acid and solvent B with acetonitrile (ACN) containing 0.1% formic acid. A gradient from 5-100% of B over 15 min with a flow rate of 0.4 mL / min was employed. Detector and conditions: Corona ultra-charged aerosol detection (from esa). Nebulizer Temp.: 25 °C. N2 pressure: 35.1 psi. Filter: Corona.
[00177] 1H and 13C NMR spectra were recorded at room temperature on a Varian spectrometer at 500 MHz (1H NMR) and 125 MHz (13C NMR). Chemical shifts are given in ppm referenced to the solvent residual peak (CDCh - 1H NMR: 8 at 7.26 ppm and 13C NMR 8 at 77.2 ppm; DMSO-d6 - 1H NMR: 8 at 2.50 ppm and 13C NMR 8 at 39.5 ppm). Coupling constants are given in Hertz. Signal splitting patterns are described as singlet (s), doublet (d), triplet (t) or multiplet (m). ii) Synthesis route for the conjugate building block TriGalNAc 2026205304 06 Jul 2026
[00178] Preparation of compound 2: D-Galactosamine pentaacetate (3.00 g, 7.71 mmol, 1.0 eq.) was dissolved in anhydrous dichloromethane (DCM) (30 mL) under argon and trimethylsilyl trifluoromethanesulfonate (TMSOTf, 4.28 g, 19.27 mmol, 2.5 eq.) was added. The reaction was stirred at room temperature for 3 h. The reaction mixture was diluted with DCM (50 mL) and washed with cold saturated aq. NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4 and concentrated to afford the title compound as yellow oil, which was purified by flash chromatography (gradient elution: 0-10% MeOH in DCM in 10 CV). The product was obtained as colourless oil (2.5 g, 98%, rf= 0.45 (2% MeOH in DCM)).
[00179] Preparation of compound 4: Compound 2 (2.30 g, 6.98 mmol, 1.0 eq.) and azido-PEG3-OH (1.83 g, 10.5 mmol, 1.5 eq.) were dissolved in anhydrous DCM (40 mL) under argon and molecular sieves 3 A (5 g) was added to the solution. The mixture was stirred at room temperature for 1 h. TMSOTf (0.77 g, 3.49 mmol, 0.5 eq.) was then added to the mixture and the reaction was stirred overnight. The molecular sieves were filtered, the filtrate was diluted with DCM (100 mL) and washed with cold saturated aq. NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4 and the solvent was removed under reduced pressure. The crude material was purified by flash chromatography (gradient elution: 0-3% MeOH in DCM in 10 CV) to afford the title product as light yellow oil (3.10 g, 88%, rf = 0.25 (2% MeOH in DCM)). MS: calculated for C20H32N4O11, 504.21. Found 505.4. 1H NMR (500 MHz, CDCls) 5 6.21-6.14 (m, 1H), 5.30 (dd, J = 3.4, 1.1 Hz, 1H), 5.04 (dd, J = 11.2, 3.4 Hz,1H), 4.76 (d, J = 8.6 Hz, 1H), 4.23-4.08 (m, 3H), 3.91-3.80 (m, 3H), 3.74-3.59 (m, 9H), 3.49-3.41 (m, 2026205304 06 Jul 2026 2H), 2.14 (s, 3H), 2.02 (s, 3H), 1.97 (d, J = 4.2 Hz, 6H). 13C NMR (125 MHz, CDCI3) 5 170.6 (C), 170.5 (C), 170.4 (C), 170.3 (C), 102.1 (CH), 71.6 (CH), 70.8 (CH), 70.6 (CH), 70.5 (CH), 70.3 (CH2), 69.7 (CH2), 68.5 (CH2), 66.6 (CH2), 61.5 (CH2), 23.1 (CH3), 20.7 (3xCH3).
[00180] Preparation of compound 5: Compound 4 (1.00 g, 1.98 mmol, 1.0 eq.) was dissolved in a mixture of ethyl acetate (EtOAc) and MeOH (30 mL 1:1 v / v) and Pd / C (100 mg) was added. The reaction mixture was degassed using vacuum / argon cycles (3x) and hydrogenated under balloon pressure overnight. The reaction mixture was filtered through celite and washed with EtOAc (30 mL). The solvent was removed under reduced pressure to afford the title compound as colourless oil (0.95 g, quantitative yield, rf = 0.25 (10% MeOH in DCM)). The compound was used without further purification. MS: calculated for C20H34N2O11, 478.2. Found 479.4.
[00181] Preparation of compound 7: Tris{[2-(tert-butoxycarbonyl)ethoxy]methyl}-methylamine 6 (3.37 g, 6.67 mmol, 1.0 eq.) was dissolved in a mixture of DCM / water (40 mL 1:1 v / v) and Na2CO3 (0.18 g, 1.7 mmol, 0.25 eq.) was added while stirring vigorously. Benzyl chloroformate (2.94 mL, 20.7 mmol, 3.10 eq.) was added dropwise to the previous mixture and the reaction was stirred at room temperature for 24 h. The reaction mixture was diluted with CH2Cl2 (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na2SO4. The solvent was removed under reduced pressure and the resulting crude material was purified by flash chromatography (gradient elution: 0-10% EtOAc in cyclohexane in 12 CV) to afford the title compound as pale yellowish oil (3.9 g, 91%, rf = 0.56 (10% EtOAc in cyclohexane)). MS: calculated for C33H53NO11, 639.3. Found 640.9. 1H NMR (500 MHz, DMSO-d6) 5 7.38-7.26 (m, 2026205304 06 Jul 2026 5H), 4.97 (s, 2H), 3.54 (t, 6H), 3.50 (s, 6H), 2.38 (t, 6H), 1.39 (s, 27H). 13C NMR (125 MHz, DMSO-d6) 5 170.3 (3xC), 154.5 (C), 137.1 (C), 128.2 (2xCH), 127.7 (CH), 127.6 (2xCH), 79.7 (3xC), 68.4 (3xCH2), 66.8 (3xCH2), 64.9 (C), 58.7 (CH2), 35.8 (3xCH2), 27.7 (9xCH3).
[00182] Preparation of compound 8: Cbz-NH-tris-Boc-ester 7 (0.20 g, 0.39 mmol, 1.0 eq.) was dissolved in CH2Cl2 (1 mL) under argon, trifluoroacetic acid (TFA, 1 mL) was added and the reaction was stirred at room temperature for 1 h. The solvent was removed under reduced pressure, the residue was co-evaporated 3 times with toluene (5 mL) and dried under high vacuum to get the compound as its TFA salt (0.183 g, 98%). The compound was used without further purification. MS: calculated for C21H29NO11, 471.6. Found 472.4.
[00183] Preparation of compound 9: CbzNH-tris-COOH 8 (0.72 g, 1.49 mmol, 1.0 eq.) and GalNAc-PEG3-NH2 5 (3.56 g, 7.44 mmol, 5.0 eq.) were dissolved in N,N-dimethylformamide (DMF) (25 mL). Then N,N,N,N‘-tetramethyl-O-(1H-benzotriazol-1-yl)uronium hexafluorophosphate (HBTU) (2.78 g, 7.44 mmol, 5.0 eq.), 1-hydroxybenzotriazole hydrate (HOBt) (1.05 g, 7.44 mmol, 5.0 eq.) and N,N-diisopropylethylamine (DIPEA) (2.07 mL, 11.9 mmol, 8.0 eq.) were added to the solution and the reaction was stirred for 72 h. The solvent was removed under reduced pressure, the residue was dissolved in DCM (100 mL) and washed with 2026205304 06 Jul 2026 saturated aq. NaHCO3 (100 mL). The organic layer was dried over Na2SO4, the solvent evaporated and the crude material was purified by flash chromatography (gradient elution: 0-5% MeOH in DCM in 14 CV). The product was obtained as pale yellowish oil (1.2 g, 43%, rf = 0.20 (5% MeOH in DCM)). MS: calculated for C81H125N7O41, 1852.9. Found 1854.7. 1H NMR (500 MHz, DMSO-d6) 5 7.90-7.80 (m, 10H), 7.65-7.62 (m, 4H), 7.47-7.43 (m, 3H), 7.38-7.32 (m, 8H), 5.24-5.22 (m, 3H), 5.02-4.97 (m, 4H), 4.60-4.57 (m, 3 H), 4.07-3.90 (m 10H), 3.67-3.36 (m, 70H), 3.23-3.07 (m, 25H), 2.18 (s, 10H), 2.00 (s, 13H), 1.89 (s, 11H), 1.80-1.78 (m, 17H). 13C NMR (125 MHz, DMSO-d6) 5 170.1 (C), 169.8 (C), 169.7 (C), 169.4 (C), 169.2 (C), 169.1 (C), 142.7 (C), 126.3 (CH), 123.9 (CH), 118.7 (CH), 109.7 (CH), 100.8 (CH), 70.5 (CH), 69.8 (CH), 69.6 (CH), 69.5 (CH), 69.3 (CH2), 69.0 (CH2), 68.2 (CH2), 67.2 (CH2), 66.7 (CH2), 61.4 (CH2), 22.6 (CH2), 22.4 (3xCH3), 20.7 (9xCH3).
[00184] Preparation of compound 10: Triantennary GalNAc compound 9 (0.27 g, 0.14 mmol, 1.0 eq.) was dissolved in MeOH (15 mL), 3 drops of acetic acid (AcOH) and Pd / C (30 mg) was added. The reaction mixture was degassed using vacuum / argon cycles (3x) and hydrogenated under balloon pressure overnight. The completion of the reaction was followed by mass spectrometry and the resulting mixture was filtered through a thin pad of celite. The solvent was evaporated and the residue obtained was dried under high vacuum and used for the next step without further purification. The product was obtained as pale yellowish oil (0.24 g, quantitative yield). MS: calculated for C73H119N7O39, 1718.8. Found 1719.3. 2026205304 06 Jul 2026
[00185] Preparation of compound 14: Triantennary GalNAc compound 10 (0.45 g, 0.26 mmol, 1.0 eq.), HBTU (0.19 g, 0.53 mmol, 2.0 eq.) and DIPEA (0.23 mL, 1.3 mmol, 5.0 eq.) were dissolved in DCM (10 mL) under argon. To this mixture, it was added dropwise a solution of compound 13 (0.14 g, 0.53 mmol, 2.0 eq.) in DCM (5 mL). The reaction was stirred at room temperature overnight. The solvent was removed and the residue was dissolved in EtOAc (50 mL), washed with water (50 mL) and dried over Na2SO4. The solvent was evaporated and the crude material was purified by flash chromatography (gradient elution: 0-5% MeOH in DCM in 20 CV). The product was obtained as white fluffy solid (0.25 g, 48%, rf = 0.4 (10% MeOH in DCM)). MS: calculated for C88H137N7O42, 1965.1. Found 1965.6.
[00186] Preparation of TriGalNAc (15): Triantennary GalNAc compound 14 (0.31 g, 0.15 mmol, 1.0 eq.) was dissolved in EtOAc (15 mL) and Pd / C (40 mg) was added. The reaction mixture was degassed by using vacuum / argon cycles (3x) and hydrogenated under balloon pressure overnight. The completion of the reaction was monitored by mass spectrometry and the resulting mixture was filtered through a thin pad of celite. The solvent was removed under reduced pressure and the resulting residue was dried under high vacuum over night. The residue was used for conjugations to oligonucleotides without further purification (0.28 g, quantitative yield). MS: calculated for C81H131N7O42, 1874.9. Found 1875.3. iii) Oligonucleotide Synthesis 2026205304 06 Jul 2026 Table 8: Single strand ID Sequence 5' - 3' Purity by RP HPLC (%) X91382 (NH2- DEG)gacuuuCfaUfCfCfuggaaauasusa(invabasic)(invabasic) 89.5 X91383 (NH2- DEG)aaGfcAfaGfaUfAfUfuUfuuAfUAfasusa(invabasic)(invaba sic) 91.6 X91384 (NH2- DEG)ugggauUfUCfAfUfguaaccaasgsa(invabasic)(invabasic) 94.0 X91385 (NH2-DEG)GfaCfuUfuCfaUfcCfuGfgAfaAfuAfsusAf 90.6 X91386 (NH2-DEG)AfaGfcAfaGfaUfaUfuUfuUfaUfaAfsusAf 91.2 X91387 (NH2-DEG)UfgGfgAfuUfuCfaUfgUfaAfcCfaAfsgsAf 88.7 X91403 (NH2C12)gacuuuCfaUfCfCfuggaaauasusa(invabasic)(invabasic ) 94.2 X91404 (NH2C12)aaGfcAfaGfaUfAfUfuUfuuAfuAfasusa(invabasic)(in vabasic) 96.5 X91405 (NH2C12)ugggauUfuCfAfUfguaaccaasgsa(invabasic)(invabasi c) 91.3 X91406 (NH2C12)GfaCfuUfuCfaUfcCfuGfgAfaAfuAfsusAf 95.0 X91407 (NH2C12)AfaGfcAfaGfaUfaUfuUfuUfaUfaAfsusAf 97.0 X91408 (NH2C12)UfgGfgAfuUfuCfaUfgUfaAfcCfaAfsgsAf 90.0 X91415 (invabasic)(invabasic)gsascuuuCfaUfCfCfuggaaauasusa(NH2C 6) 96.4 X91416 (invabasic)(invabasic)asasGfcAfaGfaUfAfUfuUfuuAfuAfaua( NH2C6) 77.4 X91417 (invabasic)(invabasic)usgsggauUfuCfAfUfguaaccaaga(NH2C6) 96.7 X91418 GfsasCfuUfuCfaUfcCfuGfgAfaAfuAfuAf(NH2C6) 96.0 X91419 AfsasGfcAfaGfaUfaUfuUfuUfaUfaAfuAf(NH2C6) 91.8 X91420 UfsgsGfgAfuUfuCfaUfgUfaAfcCfaAfgAf(NH2C6) 93.1 X91379 gsascuuuCfaUfCfCfuggaaauaua(GalNAc) 92.8 X91380 asasGfcAfaGfaUfAfUfuUfuuAfuAfaua(GalNAc) 95.7 X91446 usgsggauUfuCfAfUfguaaccaaga(GalNAc) 92.1 X38483 usAfsuauUfuCfCfaggaUfgAfaagucscsa 91.0 2026205304 06 Jul 2026 Single strand ID Sequence 5' - 3' Purity by RP HPLC (%) X91381 usAfsUfuAfuaAfaAfauaUfcUfuGfcuususudT dT 90.0 X38104 usCfsuugGfuuAfcaugAfaAfucccasusc 95.4 X91398 usAfsuAfuUfuCfcAfgGfaUfgAfaAfgUfcsCfsa 90.0 X91400 usAfsuUfaUfaAfaAfaU faUfcUfuGfcUfusU fsudT dT 88.7 X91402 usCfsuUfgGfuUfaCfaUfgAfaAfuCfcCfasUfsc 89.6 Af, Cf, Gf, Uf: 2’-F RNA nucleotides a, c, g, u: 2’-O-Me RNA nucleotides dT : DNA nucleotides s: Phosphorothioate invabasic: 1,2-dideoxyribose NH2-DEG: Aminoethoxyethyl linker NH2C12: Aminododecyl linker NH2C6: Aminohexyl linker
[00187] Oligonucleotides were synthesized on solid phase according to the phosphoramidite approach. Depending on the scale either a Mermade 12 (BioAutomation Corporation) or an AKTA Oligopilot (GE Healthcare) was used.
[00188] Syntheses were performed on commercially available solid supports made of controlled pore glass either loaded with invabasic (CPG, 480 A, with a loading of 86 pmol / g; LGC Biosearch cat. # BCG-1047-B) or 2’-F A (CPG, 520 A, with a loading of 90 umol g; LGC Biosearch cat. # BCG-1039-B) or NH2C6 (CPG, 520 A, with a loading of 85 umol g LGC Biosearch cat. # BCG-1397-B) or GalNAc (CPG, 500 A, with a loading of 57 p.mol / g; Primetech) or 2’-O-Methyl C (CPG, 500 A, with a loading of 84 umol g LGC Biosearch cat. # BCG-10-B) or 2’-O-Methyl A (CPG, 497 A, with a loading of 85 ^mol / g, LGC Biosearch, Cat. # BCG-1029-B) or dT (CPG, 497 A, with a loading of 87 umol g LGC Biosearch, cat. # BCG-1055-B). 2026205304 06 Jul 2026
[00189] 2’-O-Me, 2’-F RNA phosphoramidites and ancillary reagents were purchased from SAFC Proligo (Hamburg, Germany).
[00190] Specifically, the following 2'-O-Methyl phosphoramidites were used: 5'-(4,4'-dimethoxytrityl)-N-benzoyl-adenosine 2'-O-methyl-3'- [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-benzoyl-cytidine 2'-O-methyl-3'- [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-dimethylformamidine-guanosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-uridine 2'-O-methyl-3'-[(2-cyanoethyl)- (N,N-diisopropyl)]-phosphoramidite.
[00191] The following 2’-F phosphoramidites were used: 5'-dimethoxytrityl-N-benzoyl-deoxyadenosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N-acetyl-deoxycytidine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N-isobutyryl-deoxyguanosine 2'-fluoro-3'- [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite and 5'-dimethoxytrityl-deoxyuridine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.
[00192] In order to introduce the required amino linkers at the 5 '-end of the oligonucleotides the 2-[2-(4-Monomethoxytrityl)aminoethoxy]ethyl-(2-cyanoethyl)-N,N-diisopropyl)-phosphoramidite (Glen Research Cat. # 1905) and the 12-(trifluoroacetylamino)dodecyl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (ChemGenes Cat. # CLP-1575) were employed. The invabasic modification was introduced using 5-O-dimethoxytrityl-1,2-dideoxyribose-3-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (ChemGenes Cat. # ANP-1422).
[00193] All building blocks were dissolved in anhydrous acetonitrile (100 mM (Mermade12) or 200 mM (AKTA Oligopilot)) containing molecular sieves (3 A) except 2’-O-methyl-uridine phosphoramidite which was dissolved in 50% anhydrous DCM in anhydrous acetonitrile. Iodine (50 mM in pyridine / H2O 9:1 v / v) was used as oxidizing reagent. 5-Ethyl thiotetrazole (ETT, 500 mM in acetonitrile) was used as activator solution. Thiolation for introduction of phosphorthioate linkages was carried out using 100 mM xanthane hydride (TCI, Cat. # 6846-35-1) in acetonitrile / pyridine 4:6 v / v.
[00194] Coupling times were 5.4 minutes except when stated otherwise. 5' amino modifications were incorporated into the sequence employing a double coupling step with a coupling time of 11 minutes per each coupling (total coupling time 22 min). The oxidizer contact time was set to 1.2 min and thiolation time was 5.2 min. 2026205304 06 Jul 2026
[00195] Sequences were synthesized with removal of the final DMT group, with exception of the MMT group from the NH2DEG sequences.
[00196] At the end of the synthesis, the oligonucleotides were cleaved from the solid support using a 1:1 volume solution of 28-30% ammonium hydroxide (Sigma-Aldrich, Cat. #221228) and 40% aqueous methylamine (Sigma-Aldrich, Cat. #8220911000) for 16 hours at 6°C. The solid support was then filtered off, the filter was thoroughly washed with H2O and the volume of the combined solution was reduced by evaporation under reduced pressure. The pH of the resulting solution was adjusted to pH 7 with 10% AcOH (Sigma-Aldrich, Cat. # A6283).
[00197] The crude materials were purified either by reversed phase (RP) HPLC or anion exchange (AEX) HPLC.
[00198] RP HPLC purification was performed using a XBridge C18 Prep 19 x 50 mm column (Waters) on an AKTA Pure instrument (GE Healthcare). Buffer A was 100 mM triethylammonium acetate (TEAAc, Biosolve) pH 7 and buffer B contained 95% acetonitrile in buffer A. A flow rate of 10 mL / min and a temperature of 60°C were employed. UV traces at 280 nm were recorded. A gradient of 0% B to 100% B within 120 column volumes was employed. Appropriate fractions were pooled and precipitated in the freezer with 3 M sodium acetate (NaOAc) (Sigma-Aldrich), pH 5.2 and 85% ethanol (VWR). Pellets were isolated by centrifugation, redissolved in water (50 mL), treated with 5 M NaCl (5 mL) and desalted by Size exclusion HPLC on an Akta Pure instrument using a 50 x 165mm ECO column (YMC, Dinslaken, Germany) filled with Sephadex G25-Fine resin (GE Healthcare).
[00199] AEX HPLC purification was performed using a TSK gel SuperQ-5PW 20 x 200 mm (BISCHOFF Chromatography) on an AKTA Pure instrument (GE Healthcare). Buffer A was 20 mM sodium phosphate (Sigma-Aldrich) pH 7.8 and buffer B was the same as buffer A with the addition of 1.4 M sodium bromide (Sigma-Aldrich). A flow rate of 10 mL / min and a temperature of 60°C were employed. UV traces at 280 nm were recorded. A gradient of 10% B to 100% B within 27 column volumes was employed. Appropriate fractions were pooled and precipitated in the freezer with 3 M NaOAc, pH 5.2 and 85% ethanol. Pellets were isolated by centrifugation, redissolved in water (50 mL), treated with 5 M NaCl (5 mL) and desalted by size exclusion chromatography. 2026205304 06 Jul 2026
[00200] The MMT group was removed with 25% acetic acid in water. Once the reaction was complete the solution was neutralized and the samples were desalted by size exclusion chromatography.
[00201] Single strands were analyzed by analytical LC-MS on a 2.1 x 50 mm XBridge C18 column (Waters) on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system combined either with a LCQ Deca XP-plus Q-ESI-TOF mass spectrometer (Thermo Finnigan) or with a Compact ESI-Qq-TOF mass spectrometer (Bruker Daltonics). Buffer A was 16.3 mM triethylamine, 100 mM 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP) and 1% MeOH in H2O and buffer B contained buffer A in 95% MeOH. A flow rate of 250 ^L / min and a temperature of 60°C were employed. UV traces at 260 and 280 nm were recorded. A gradient of 1-40% B within 0.5 min followed by 40 to 100% B within 13 min was employed. Methanol (LC-MS grade), water (LC-MS grade), 1,1,1,3,3,3-hexafluoro-2-propanol (puriss. p.a.) and triethylamine (puriss. p.a.) were purchased from Sigma-Aldrich. iv) TriGalNAc tether 2 (GalNAc-T2) conjugation at 5’-end or 3’-end 5’-GalNAc-T2 conjugates 3’-GalNAc-T2 conjugates o 2026205304 06 Jul 2026
[00202] Preparation of TriGalNAc tether 2 NHS ester: To a solution of carboxylic acid tether 2 (compound 15, 227 mg, 121 pmol) in DMF (2.1 mL), N-hydroxysuccinimide (NHS) (15.3 mg, 133 pmol) and N,N‘-diisopropylcarbodiimide (DIC) (19.7 pL, 127 pmol) were added. The solution was stirred at room temperature for 18 h and used without purification for the subsequent conjugation reactions.
[00203] General procedure for triGalNAc tether 2 conjugation: Amine-modified single strand was dissolved at 700 OD / mL in 50 mM carbonate / bicarbonate buffer pH 9.6 / DMSO 4:6 (v / v) and to this solution was added one molar equivalent of Tether 2 NHS ester (57 mM) solution in DMF. The reaction was carried out at room temperature and after 1 h another molar equivalent of the NHS ester solution was added. The reaction was allowed to proceed for one more hour and reaction progress was monitored by LCMS. At least two molar equivalent excess of the NHS ester reagent relative to the amino modified oligonucleotide were needed to achieve quantitative consumption of the starting material. The reaction mixture was diluted 15-fold with water, filtered once through 1.2 pm filter from Sartorius and then purified by reserve phase (RP HPLC) on an Akta Pure (GE Healthcare) instrument.
[00204] The purification was performed using a XBridge C18 Prep 19 x 50 mm column from Waters. Buffer A was 100 mM TEEAc pH 7 and buffer B contained 95% acetonitrile in buffer A. A flow rate of 10 mL / min and a temperature of 60°C were employed. UV traces at 280 nm were recorded. A gradient of 0-100% B within 60 column volumes was employed.
[00205] Fractions containing full-length conjugated oligonucleotides were pooled together, precipitated in the freezer with 3 M NaOAc, pH 5.2 and 85% ethanol and then dissolved at 1000 OD / mL in water. The O-acetates were removed with 20% ammonium hydroxide in water until completion (monitored by LC-MS).
[00206] The conjugates were desalted by size exclusion chromatography using Sephadex G25 Fine resin (GE Healthcare) on an Akta Pure (GE Healthcare) instrument to yield the conjugated oligonucleotides in an isolated yield of 60-80%. 2026205304 06 Jul 2026 Table 9: Sense strand ID Sense strand sequence 5' - 3' Purity by RP HPLC (%) X91409 (GalNAc- T2)(NH2C12)gacuuuCfaUfCfCfuggaaauasusa(invabasic)(invabasic) 85.0 X91410 (GalNAc- T2)(NH2C 12)aaGfcAfaGfaUfAfUfuUfuuAfuAfasusa(invabasic)(in vabasic) 92.3 X91411 (GalNAc- T2)(NH2C 12)ugggauUfuCfAfUfguaaccaasgsa(invabasic)(invabasic ) 92.7 X91412 (GalNAc-T2)(NH2C 12)GfaCfuUfuCfaUfcCfuGfgAfaAfuAfsusAf 89.7 X91413 (GalNAc-T2)(NH2C 12)AfaGfcAfaGfaUfaUfuUfuUfaUfaAfsusAf 85.1 X91414 (GalNAc-T2)(NH2C 12)UfgGfgAfuUfuCfaUfgUfaAfcCfaAfsgsAf 85 X91433 (mvabasic)(mvabasic)gsascuuuCfaUfCfCfuggaaauasusa(NHC6)(Ga lNAc-T2) 85.3 X91434 (invabasic)(invabasic)asasGfcAfaGfaUfAfUfuUfuuAfuAfaua(NHC 6)(GalNAc-T2) 85.8 X91435 (invabasic)(invabasic)usgsggauUfuCfAfUfguaaccaaga(NHC6)(Gal NAc-T2) 84.0 X91436 GfsasCfuUfuCfaUfcCfuGfgAfaAfuAfuAf(NHC6)(GalNAc-T2) 80.0 X91437 AfsasGfcAfaGfaUfaUfuUfuUfaUfaAfuAf(NHC6)(GalNAc-T2) 87.5 X91438 UfsgsGfgAfuUfuCfaUfgUfaAfcCfaAfgAf(NHC6)(GalNAc-T2) 85.2
[00207] The conjugates were characterized by HPLC-MS analysis with a 2.1 x 50 mm XBridge C18 column (Waters) on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system equipped with a Compact ESI-Qq-TOF mass spectrometer (Bruker Daltonics). Buffer A was 16.3 mM triethylamine, 100 mM HFIP in 1% MeOH in H2O and buffer B contained 95% MeOH in buffer A. A flow rate of 250 uL min and a temperature of 60°C were employed. UV traces at 260 and 280 nm were recorded. A gradient of 1-100% B within 31 min was employed. 2026205304 06 Jul 2026 v) Duplex Annealing
[00208] To generate the desired siRNA duplex, the two complementary strands were annealed by combining equimolar aqueous solutions of both strands. The mixtures were placed into a water bath at 70°C for 5 minutes and subsequently allowed to cool to ambient temperature within 2 h. The duplexes were lyophilized for 2 days and stored at -20°C.
[00209] The duplexes were analyzed by analytical SEC HPLC on Superdex™ 75 Increase 5 / 150 GL column 5 x 153-158 mm (Cytiva) on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system. Mobile phase consisted of 1x PBS containing 10% acetonitrile. An isocratic gradient was run in 10 min at a flow rate of 1.5 mL / min at room temperature. UV traces at 260 and 280 nm were recorded. Water (LC-MS grade) was purchased from Sigma-Aldrich and Phosphate-buffered saline (PBS; 10x, pH 7.4) was purchased from GIBCO (Thermo Fisher Scientific).
[00210] GalNAc conjugates prepared are compiled in the table below. These were directed against 3 different target genes. siRNA coding along with the corresponding single strands, sequence information as well as purity for the duplexes is captured. Table 10: Target Duplex ID ssRN ID ssRNA-Sequence 5'-3' Duplex Purity by HPLC (%) GO ETX002 X91409 (GalNAc- T2)(NH2C 12)gacuuuCfaUfCfCfuggaaauas usa(invabasic)(invabasic) 94.1 X38483 usAfsuauUfuCfCfaggaUfgAfaagucscsa ETX004 X91412 (ET-GalNAc- T2CO)(NH2C 12)GfaCfuUfuCfaUfcCfuGf gAfaAfuAfsusAf 96.4 X91398 usAfsuAfuUfuCfcAfgGfaUfgAfaAfgUfcsC fsa ETX006 X91433 (invabasic)(invabasic)gsascuuuCfaUfCfCfu ggaaauasusa(NHC6)(GalNAc-T2) 94.1 X38483 usAfsuauUfuCfCfaggaUfgAfaagucscsa ETX008 X91436 GfsasCfuUfuCfaUfcCfuGfgAfaAfuAfuAf( NHC6)(GalNAc-T2) 96.7 2026205304 06 Jul 2026 Target Duplex ID ssRN ID ssRNA-Sequence 5'-3' Duplex Purity by HPLC (%) X91398 usAfsuAfuUfuCfcAfgGfaUfgAfaAfgUfcsC fsa C5 ETX011 X91410 (GalNAc- T2)(NH2C 12)aaGfcAfaGfaUfAfUfuUfuuA fuAfasusa(invabasic)(invabasic) 93.5 X91381 usAfsUfuAfuaAfaAfauaUfcUfuGfcuususu dTdT ETX013 X91413 (GalNAc- T2)(NH2C 12)AfaGfcAfaGfaUfaUfuUfuUf aUfaAfsusAf 95.3 X91400 usAfsuUfaUfaAfaAfaU faU fcUfuGfcUfusU fsudTdT ETX015 X91434 (invabasic)(invabasic)asasGfcAfaGfaUfAf UfuUfuuAfuAfaua(NHC6)(GalNAc-T2) 95.3 X91381 usAfsUfuAfuaAfaAfauaUfcUfuGfcuususu dTdT ETX017 X91437 AfsasGfcAfaGfaUfaUfuUfuUfaUfaAfuAf( NHC6)(GalNAc-T2) 97.1 X91400 usAfsuUfaUfaAfaAfaU faUfcUfuGfcUfusU fsudTdT TTR ETX020 X91411 (GalNAc- T2)(NH2C12)ugggauUfuCfAfUfguaaccaas gsa(invabasic)(invabasic) 97.5 X38104 usCfsuugGfuuAfcaugAfaAfucccasusc ETX022 X91414 (GalNAc- T2)(NH2C 12)UfgGfgAfuUfuCfaUfgUfaAf cCfaAfsgsAf 91.9 X91402 usCfsuUfgGfuUfaCfaUfgAfaAfuCfcCfasU fsc ETX024 X91435 (invabasic)(invabasic)usgsggauUfuCfAfUf guaaccaaga(NHC6)(GalNAc-T2) 95.3 X38104 usCfsuugGfuuAfcaugAfaAfucccasusc 2026205304 06 Jul 2026 Target Duplex ID ssRN ID ssRNA-Sequence 5'-3' Duplex Purity by HPLC (%) ETX026 X91438 UfsgsGfgAfuUfuCfaUfgUfaAfcCfaAfgAf( NHC6)(GalNAc-T2) 98.1 X91402 usCfsuUfgGfuUfaCfaUfgAfaAfuCfcCfasU fsc The following schemes further set out the routes of synthesis: Scheme 1: o\ CM Scheme 2: 2026205304 06 Jul 2026 Scheme 3: o\ OO Scheme 4: 2026205304 06 Jul 2026 Example 3 Mouse data for GalNAc-siRNA constructs ETX006 and ETX015 ETX006 (Targeting HAO1 mRNA) T2a inverted abasic
[00211] An in vivo mouse pharmacology study was performed showing knockdown of HAO1 mRNA in liver tissue and a concomitant increase in serum glycolate levels following a single subcutaneous dose of up to 3 mg / kg GalNAc conjugated modified siRNA ETX006.
[00212] Male C57BL / 6 mice with an age of about 8 weeks were randomly assigned into groups of 21 mice. On day 0 of the study, the animals received a single subcutaneous dose of 0.3 or 3 mg / kg GalNAc-siRNA dissolved in saline (sterile 0.9% sodium chloride) or saline only as control. At day 1, day 2, day 4, day 7, day 14, day 21, and day 28 of the study, 3 mice from each group were euthanised and serum and liver samples taken.
[00213] Serum was taken from a group of 5 untreated mice at day 0 to provide a baseline measurement of glycolate concentration.
[00214] Serum was stored at -80°C until further analysis. Liver sample (approximately 50 mg) were treated with RNAlater and stored overnight at 4°C, before being stored at -80°C.
[00215] Liver samples were analysed using quantitative real-time PCR for HAO1 mRNA (Thermo assay ID Mm00439249_m1) and the housekeeping gene GAPDH mRNA (Thermo assay ID Mm99999915_g1). The delta delta Ct method was used to calculated changes in HAO1 expression normalised to GAPDH and relative to the saline control group.
[00216] A single 3 mg / kg dose of ETX006 inhibited HAO1 mRNA expression by than 80% after 7 days (FIG 11). The suppression of HAO1 expression was durable and continued until the end of the study, with ETX006 maintaining greater than 60% inhibition of HAO1 mRNA at day 28. A single dose of 0.3 mg / kg also inhibited HAO1 expression when compared with the saline control group, with HAO1 expression levels reaching normal levels only at day 28 of the study.
[00217] Suppression of HAO1 mRNA expression is expected to cause an increase in serum glycolate levels. Serum glycolate concentration was measured using LC-MS / MS (FIG 12). A single 3 mg / kg dose of ETX006 caused a significant increase in serum glycolate concentration, reaching peak levels 14 days after dosing and remaining higher than baseline levels (day 0) and the saline control group until the end of the study at day 28. A single 0.3 mg / kg dose of ETX006 showed a smaller and more transient increase in serum glycolate concentration above the level 2026205304 06 Jul 2026 seen in a baseline and saline control groups, demonstrating that a very small dose can also affect the concentration of a metabolic biomarker in serum. ETX015 (Targeting C5 mRNA) T2a inverted abasic
[00218] An in vivo mouse pharmacology study was performed showing knockdown of C5 mRNA in liver tissue and the resulting decrease in serum C5 protein concentration following a single subcutaneous dose of up to 3 mg / kg GalNAc conjugated modified siRNA ETX015.
[00219] Male C57BL / 6 mice with an age of about 8 weeks were randomly assigned into groups of 21 mice. On day 0 of the study, the animals received a single subcutaneous dose of 0.3, 1, or 3 mg / kg GalNAc-siRNA dissolved in saline (sterile 0.9% sodium chloride) or saline only as control. At day 1, day 2, day 4, day 7, day 14, day 21, and day 28 of the study, 3 mice from each group were euthanised and serum and liver samples taken.
[00220] Serum was stored at -80°C until further analysis. Liver sample (approximately 50 mg) were treated with RNAlater and stored overnight at 4°C, before being stored at -80°C.
[00221] Liver samples were analysed using quantitative real-time PCR for C5 mRNA (Thermo assay ID Mm00439275_m1) and the housekeeping gene GAPDH mRNA (Thermo assay ID Mm99999915_g1). The delta delta Ct method was used to calculated changes in C5 expression normalised to GAPDH and relative to the saline control group.
[00222] ETX015 inhibited C5 mRNA expression in a dose-dependent manner (FIG 13) with the 3 mg / kg dose achieving greater than 85% reduction of C5 mRNA. The suppression of C5 expression was durable, with the 3 mg / kg dose of each molecule showing clear knockdown of C5 mRNA until the end of the study at day 28. Mice dosed with 3 mg / kg ETX015 still exhibited less than 50% of normal liver C5 mRNA levels 28 days after dosing.
[00223] For C5 protein level analysis, serum samples were measured using a commercially available C5 ELISA kit (Abcam ab264609). Serum C5 levels were calculated relative to the saline group means at matching timepoints.
[00224] Serum protein data support the mRNA analysis (FIG 14). ETX015 caused a dosedependent decrease in serum C5 protein concentration. The 3 mg / kg and 1 mg / kg doses of ETX015 achieved greater than 90% reduction of serum C5 protein levels. The highest dose exhibited durable suppression of C5 protein expression, with a greater than 70% reduction of C5 at day 28 of the study compared to saline control. 2026205304 06 Jul 2026 Example 4 NHP data for GalNAc-siRNA constructs ETX024
[00225] ETX024 pharmacology was evaluated in non-human primate (NHP) by quantifying serum transthyretin (TTR) protein levels. A single subcutaneous dose of 1 mg / kg GalNAc conjugated modified siRNA ETX024 demonstrated durable suppression of TTR protein expression.
[00226] Male cynomolgus monkeys (3-5 years old, 2-3 kg) were assigned into groups of 3 animals. Animals were acclimatised for 2 weeks, and blood taken 14 days prior to dosing to provide baseline TTR concentration. A liver biopsy was performed 18 or 38 days prior to dosing to provide baseline mRNA levels. On day 0 of the study, the animals received a single subcutaneous dose of 1 mg / kg GalNAc-siRNA ETX024 dissolved in saline (sterile 0.9% sodium chloride). At day 3, day 14, day 28, day 42, day 56, day 70 and day 84 of the study, a liver biopsy was taken and RNA extracted for measurement of TTR mRNA. At day 1, day 3, day 7, day 14, day 28, day 42, day 56, 70 and day 84 of the study, a blood sample was taken for measurement of serum TTR concentration and clinical blood chemistry analysis.
[00227] Suppression of TTR mRNA expression is expected to cause a decrease in serum TTR protein levels. Serum TTR protein concentration was measured by a commercially available ELISA kit (Abcam ab231920). TTR concentration as a fraction of day 1 was calculated for each individual animal and this was plotted as mean and standard deviation for the group of 3 animals (FIG 15).
[00228] A single 1 mg / kg dose of ETX024 caused a rapid and significant reduction in serum TTR concentration, reaching nadir 28 days after dosing and remaining suppressed until day 70.
[00229] Data was further obtained with ETX024 until day 84. Identical experiments were carried out using ETX020, 022 and 026. Data is provided for 84 days in Figures 16, 17, 18a and 19 (ETX 020, 022, 024 and 026 respectively).
[00230] TTR mRNA was measured by real-time quantitative PCR using a TaqMan Gene expression kit TTR (Thermo, assay ID Mf02799963_m1). GAPDH expression was also measured (Thermo, assay ID Mf04392546_g1) to provide a reference. Relative TTR expression for each animal was calculated normalised to GAPDH and relative to pre-dose levels by the DDCt method. A single 1 mg / kg dose of ETX024 caused a rapid and significant reduction in liver TTR mRNA, reaching nadir 14 days after dosing and remaining suppressed until day 84 (FIG 18b). 2026205304 06 Jul 2026
[00231] Animal body weight was measured once a week during the study. No fluctuations or decrease in body weight was associated with dosing ETX024 and animals continued to gain weight throughout the study (FIG 18c).
[00232] Serum was analysed within 2 hours using an automatic biochemical analyser. A significant increase in ALT (alanine transaminase) and AST (aspartate transaminase) are commonly used to demonstrate liver toxicity. No increase in ALT (FIG 18d) or ALT (FIG 18e) was associated with dosing of ETX024.
[00233] In preferred aspects, compounds of the invention are able to depress serum protein level of a target protein to a value below the initial (starting) concentration at day 0, over a period of up to at least about 14 days after day 0, up to at least about 21 days after day 0, up to at least about 28 days after day 0, up to at least about 35 days after day 0, up to at least about 42 days after day 0, up to at least about 49 days after day 0, up to at least about 56 days after day 0, up to at least about 63 days after day 0, up to at least about 70 days after day 0, up to at least about 77 days after day 0, or up to at least about 84 days after day 0, hereinafter referred to as the “dose duration”. “Day 0” as referred to herein is the day when dosing of a compound of the invention to a patient is initiated, in other words the start of the dose duration or the time post dose.
[00234] In preferred aspects, compounds of the invention are able to depress serum protein level of a target protein to a value of at least about 90% or below of the initial (starting) concentration at day 0, such as at least about 85% or below, at least about 80% or below, at least about 75% or below, at least about 70% or below, at least about 65% or below, at least about 60% or below, at least about 55% or below, at least about 50% or below, at least about 45% or below, at least about 40% or below, at least about 35% or below, at least about 30% or below, at least about 25% or below, at least about 20% or below, at least about 15% or below, at least about 10% or below, at least about 5% or below, of the initial (starting) concentration at day 0. Typically such depression of serum protein can be maintained over a period of up to at least about 14 days after day 0, up to at least about 21 days after day 0, up to at least about 28 days after day 0, up to at least about 35 days after day 0, up to at least about 42 days after day 0, up to at least about 49 days after day 0, up to at least about 56 days after day 0, up to at least about 63 days after day 0, up to at least about 70 days after day 0, up to at least about 77 days after day 0, or up to at least about 84 days after day 0. More preferably, at a period of up to at least about 84 days after day 0, the serum protein can be depressed to a value of at least about 90% or below of the initial (starting) concentration at day 0, such as at least about 85% or below, at least about 2026205304 06 Jul 2026 80% or below, at least about 75% or below, at least about 70% or below, at least about 65% or below, at least about 60% or below, at least about 55% or below, at least about 50% or below, at least about 45% or below, at least about 40% or below, of the initial (starting) concentration at day 0.
[00235] In preferred aspects, compounds of the invention are able to achieve a maximum depression of serum protein level of a target protein to a value of at least about 50% or below of the initial (starting) concentration at day 0, such as at least about 45% or below, at least about 40% or below, at least about 35% or below, at least about 30% or below, at least about 25% or below, at least about 20% or below, at least about 15% or below, at least about 10% or below, at least about 5% or below, of the initial (starting) concentration at day 0. Typically such maximum depression of serum protein occurs at about day 14 after day 0, at about day 21 after day 0, at about day 28 after day 0, at about day 35 after day 0, or at about day 42 after day 0. More typically, such maximum depression of serum protein occurs at about day 14 after day 0, at about day 21 after day 0, or at about day 28 after day 0.
[00236] Specific compounds of the invention can typically achieve a maximum % depression of serum protein level of a target protein and / or a % depression over a period of up to at least about 84 days as follows:
[00237] ETX020 can typically achieve at least 30% depression of serum protein level of a target protein, typically TTR, typically at about 7 to 21 days after day 0, in particular at about 14 days after day 0, and / or can typically maintain at least 80% depression of serum protein level of a target protein, typically TTR, over a period of up to at least about 84 days after day 0 (as hereinbefore described, “day 0” as referred to herein is the day when dosing of a compound of the invention to a patient is initiated, and as such denotes the time post dose);
[00238] ETX022 can typically achieve at least 60% depression of serum protein level of a target protein, typically TTR, typically at about 7 to 21 days after day 0, in particular at about 14 days after day 0, and / or can typically maintain at least 80% depression of serum protein level of a target protein, typically TTR, over a period of up to at least about 84 days after day 0 (as hereinbefore described, “day 0” as referred to herein is the day when dosing of a compound of the invention to a patient is initiated, and as such denotes the time post dose);
[00239] ETX024 can typically achieve at least 20% depression of serum protein level of a target protein, typically TTR, typically at about 7 to 21 days after day 0, in particular at about 14 days after day 0, and / or can typically maintain at least 60% depression of serum protein level of a 2026205304 06 Jul 2026 target protein, typically TTR, over a period of up to at least about 84 days after day 0 (as hereinbefore described, “day 0” as referred to herein is the day when dosing of a compound of the invention to a patient is initiated, and as such denotes the time post dose);
[00240] ETX026 can typically achieve at least 40% depression of serum protein level of a target protein, typically TTR, typically at about 7 to 21 days after day 0, in particular at about 14 days after day 0, and / or can typically maintain at least 70% depression of serum protein level of a target protein, typically TTR, over a period of up to at least about 84 days after day 0 (as hereinbefore described, “day 0” as referred to herein is the day when dosing of a compound of the invention to a patient is initiated, and as such denotes the time post dose).Suitably the depression of serum level is determined in non-human primates by delivering a single subcutaneous dose of 1 mg / kg of the relevant active agent, eg ETX0024, dissolved in saline (sterile 0.9% sodium chloride). Suitable methods are described herein. It will be appreciated that this is not limiting and other suitable methods with appropriate controls may be used.
[00241] Example 5 ETX024 (Targeting TTR mRNA) T2a inverted abasic
[00242] Total bilirubin levels remained stable throughout the study (FIG 22)
[00243] Kidney health was monitored by assessment of urea (blood urea nitrogen, BUN) and creatinine concentration throughout the study. Both blood urea concertation (BUN) and creatinine levels remained stable and within the expected range after a single 1 mg / kg dose of ETX024 (FIG 23 and 24).
[00244] The present invention is not intended to be limited in scope to the particular disclosed embodiments, which are provided, for example, to illustrate various aspects of the invention. Various modifications to the compositions and methods described will become apparent from the description and teachings herein. Such variations may be practiced without departing from the true scope and spirit of the disclosure and are intended to fall within the scope of the present disclosure.
[00245] A further aspect of the invention is described below, with non-limiting examples described in the following Figures 25-27 and Examples 6-15. The compounds described below are suitable for use in any of the aspects and embodiments disclosed above, for example in respect of the uses, nucleic acid lengths, definitions, pharmaceutically acceptable compositions, dosing, methods for inhibiting gene expression, and methods of treating or preventing diseases associated with gene expression, unless otherwise immediately apparent from the disclosure. 2026205304 06 Jul 2026
[00246] FIG. 25A depicts a tri-antennary GalNAc (N-acetylgalactosamine) unit.
[00247] FIG. 25B depicts an alternative tri-antennary GalNAc according to one embodiment of the invention, showing variance in linking groups.
[00248] FIG. 26A depicts tri-antennary GalNAc-conjugated siRNA according to the invention, showing variance in the linking groups.
[00249] FIG. 26B depicts a genera of tri-antennary GalNAc-conjugated siRNAs according to one embodiment of the invention.
[00250] FIG. 26C depicts a genera of bi-antennary GalNAc-conjugated siRNAs according to one embodiment of the invention, showing variance in the linking groups.
[00251] FIG. 26D depicts a genera of bi-antennary GalNAc-conjugated siRNAs according to another embodiment of the invention, showing variance in the linking groups.
[00252] FIG. 27A depicts another embodiment of the tri-antennary GalNAc-conjugated siRNA according to one embodiment of the invention.
[00253] FIG. 27B depicts a variant shown in Fig. 27A, having an alternative branching GalNAc conjugate.
[00254] FIG. 27C depicts a genera of tri-antennary GalNAc-conjugated siRNAs according to one embodiment of the invention, showing variance in the linking groups.
[00255] FIG. 27D depicts a genera of bi-antennary GalNAc-conjugated siRNAs according to one embodiment the invention, showing variance in the linking groups.
[00256] The further aspect discloses forms of ASGP-R ligand-conjugated, chemically modified RNAi agents, and methods of making and uses of such conjugated molecules.
[00257] In certain embodiments, the ASGP-R ligand comprises N-acetylgalactosamine (GalNAc). In certain embodiments, the invention provides an siRNA conjugated to tri-antennary or biantennary units of GalNAc of the following formula (I): 2026205304 06 Jul 2026 Formula I* In Formula I*, n is 0, 1, 2, 3, or 4. In some embodiments, the number of the ethylene-glycol units may vary independently from each other in the different branches. For example, the middle branch may have n=4, while the side branches may have n=3, etc. Other embodiments my contain only two branches, as depicted in Formulae (II-a) Formula II*-a
[00258] In Formulae II* and II*-a, n is chosen from 0, 1, 2, 3, or 4. In some embodiments, the number of the ethylene-glycol units may vary independently from each other in the different branches. For example, the one branch may have n=4 or 3, while the other branche(s) may have n=3 or 2, etc.
[00259] Additional GalNAc branches can also be added, for example, 4-, 5-, 6-, 7-, 8-, 9-branched GalNAc units may be used.
[00260] In related embodiments, the branched GalNAc can be chemically modified by the addition of another targeting moiety, e.g., a lipids, cholesterol, a steroid, a bile acid, targeting (poly)peptide, including polypeptides and proteins, (e.g., RGD peptide, transferrin, polyglutamate, polyaspartate, glycosylated peptide, biotin, asialoglycoprotein insulin and EGF. Option 1. In further embodiments, the GalNAc units may be attached to the RNAi agent via a tether, such as the one shown in Formula (III*): 2026205304 06 Jul 2026 Formula III* In Formula III*, m is chosen from 0, 1, 2, 3, 4, or 5, and p is chosen from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14, independently of m, and X is either CH2 or O.
[00261] In yet further embodiments, the tether can attach to the oligo via phosphate (Z=O) or a phosphorothioate group (Z=S), as shown in formula (IV*): Formula IV*
[00262] Such an attachment of the GalNAc branched units via the specified tethers is preferably at a 3’ or a 5’ end of the sense strand of the RNAi agent. In one embodiment, the attachment to the 3’ of RNAi agent is through C6 amino linker as shown in Formula (V*): Formula V* This linker is the starting point of the synthesis as shown in Example 12.
[00263] The same linkers and tethers as described above can be used with alternative branched GalNAc structures as shown in Formulas VI* and VII*: 2026205304 06 Jul 2026 Formula VI* Formula VII*
[00264] Similarly to Formula II*-a, a bi-antennary form of ligand based on Formulae VI* and VII* can be used in the compositions of the invention. Option 2. In further embodiments, the GalNAc units may be attached to the RNAi agent via a tether, such as the one shown in Formula (III*-2): Formula III*-2 In Formula III*-2, q is chosen from 1, 2, 3, 4, 5, 6, 7, or 8.
[00265] In yet further embodiments, the tether can attach to the oligo via phosphate (Z=O) or a phosphorothioate group (Z=S), as shown in formula (IV*): 2026205304 06 Jul 2026 Formula IV*
[00266] Such an attachment of the GalNAc branched units via the specified tethers preferably at a 3’ or a 5’ end of the sense strand of the double stranded RNAi agent. In one embodiment, the attachment to the 3’ of RNAi agent is as shown in Example 14. In one embodiment when the GalNAc tether is at attached to the 3’ site, the transitional linker between the tether and the 3’ end of the oligo comprises the structure of the formula (V*-a; see also Fig. 27C) or another suitable linker may be used, for example, C6 amino linker shown in Formula (V*-b): Formula V*-a Formula V*-b
[00267] Additional and / or alternative conjugation sites may include any non-terminal nucleotide, including sugar residues, phosphate groups, or nucleic acid bases.
[00268] The same linkers and tether can be used with alternative branched GalNAc structures as shown in Formulas VI*-2 and VII*-2: 2026205304 06 Jul 2026 Formula VI*-2 Formula VII*-2 Characteristics of RNAi agents of the invention and their chemical modifications
[00269] In certain embodiments, the conjugated oligomeric compound (referred herein as RNA interference compound (RNAi compound)) comprises two strands, each having sequence of from 8 to 55 linked nucleotide monomer subunits (including inverted abasic (ia) nucleotide(s)) in either the antisense strand or in the sense strand. In certain embodiments, the conjugated oligomeric compound strands comprise, for example, a sequence of 16 to 55, 53, 49, 40, 25, 24, 23, 21, 20, 19, 18, 17, or up to (about) 18-25, 18-23, 21-23 linked nucleotide monomer subunits. In certain embodiments, RNAi agent of the invention may have a hairpin structure, having a single strand of the combined lengths of both strands as described above. (The term “nucleotide” as used throughout, may also refer to nucleosides (i.e., nucleotides without phosphate / phosphonothioate groups) where context so requires.)
[00270] In certain embodiments, the double stranded RNAi agent is blunt-ended or has an overhang at one or both ends. In some embodiments, the overhang is 1-6, 1-5, 1-4, 1-3, 2-4, 4, 3, 2 or 1 nucleotide(s) (at 3’ end or at 5’ end) of the antisense strand as well as 2-4, 3, or 2 or 1 nucleotide(s) (at 3’ end or at 5’ end) of the sense strand. In certain exemplary embodiments, see Ex.6, constructs 6.1, 6.2, and 6.3, the RNAi agent comprises 2 nucleotide overhang at the 3’ end 2026205304 06 Jul 2026 of the antisense strand and 2 nucleotide overhang at 3’ end of the sense strand. In certain other exemplary embodiments, see Ex. 7, constructs 7.1 and 7.3, Ex. 8, constructs 8.1 and 8.3; and Ex. 9, constructs 9.1 and 9.3, the RNAi agents comprise 2 nucleotide overhang at the 3’ end of the antisense strand and are blunt-ended on the other end. In certain other exemplary embodiment, see Ex. 7, construct 7.3, the construct is blunt-ended on both ends. In another exemplary embodiment, see Ex. 9, construct 9.2, the RNAi agent comprises 4 nucleotide overhang in the 3’ end of the antisense strand and blunt-ended on the other end.
[00271] In certain embodiments, the constructs are modified with a degradation protective moiety that prevents or inhibits nuclease cleavage by using a terminal cap, one or more inverted abasic nucleotides, one or more phosphorothioate linkages, one of more deoxynucleotides (e.g., D-ribonucleotide, D-2'-deoxyribonucleotide or another modified nucleotide), or a combination thereof. Such degradation protective moieties may be present at any one or all ends that are not conjugated to the ASGP-R ligand. In certain embodiments, the degradation protective moiety is chosen alone or as any combination from a group consisting of 1-4, 1-3, 1-2, or 1 phosphorothioate linkages, 1-4 1-3, 1-2, or 1 deoxynucleotides, and 1-4, 1-3, 1-2, or 1 inverted abasic nucleotides. In certain exemplary embodiments, the degradation protective moieties are configured as in one of the constructs 6.1, 6.2, 6.3, 7.1, 7.2, 7.3, 8.1, 8.2, 8.3, 9.1, 9.2, and 9.3, as shown in the Examples 6-15. Such exemplary protective moieties’ configurations can be used in conjunction with any RNAi agents of the invention.
[00272] In certain embodiments, all or some riboses of the nucleotides in the sense and / or antisense strand (s) are modified. In certain embodiments, at least 50%, 60%, 70%, 80%, 90% or more (e.g., 100%) of riboses in the RNAi agent are modified. In certain embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more riboses are not modified.
[00273] In preferred embodiments, ribose modifications include 2’ substituent groups such as 2’-O-alkyl modifications, including 2’-O-methyl, and 2’-deoxyfluoro. Additional modifications are known in the art, including 2’-deoxy, LNA (e.g., 2'-O, 4'-C methylene bridge or 2'-O, 4'-C ethylene bridge), 2’-methoxythoxy (MOE), 2’-O-(CH2)OCH3, etc.
[00274] In certain embodiments, a number of modifications provide a distinct pattern of modifications, for example, as shown in constructs in the Examples 6-15, or as described in US Patents Nos. 7,452,987; 7,528,188; 8,273,866; 9,150,606; and 10,266,825; all of which are incorporated by reference herein. 2026205304 06 Jul 2026
[00275] In some embodiments, the siRNA comprises one or more thermally destabilizing nucleotides, e.g., GNA, ENA, etc., for example, at positions 11 (preferred), 12, 13 of the antisense strand and / or positions 9 and 10 (preferred) of the sense strand.
[00276] Additionally, nucleic acid bases could be modified, for example, at the C4 position as described in US Patent No. 10,119,136.
[00277] In general, the RNAi agents of the invention are directed against therapeutic targets, inhibition of which will result in prevention, alleviation, or treatment of a disease, including undesirable or pathological conditions. A great number of such targets is known in the art. Nonlimiting examples of such targets include: ApoC, ApoB, ALAS1, TTR, GO, C5 (see Examples), etc. Generally, due to the abundant expression of ASGP-R on the surface of hepatocytes, such targets are preferably expressed in the liver, however, they could also be expressed in other tissues or organs. In preferred embodiments, targets are human, while the RNAi agent comprise an antisense strand fully or partially complementary to such a target. In certain embodiments, the RNAi agents may comprise two or more chemically linked RNAi agents directed against the same or different targets. EXAMPLES Example 6: Inverted abasic chemistry with 5’-GalNAc
[00278] In all RNAi agents depicted in the Examples, the following conventions are used: ia = inverted abasic nucleotide; m = 2’-O-methyl nucleotide; f = 2’-deoxy-2’-fluoro nucleotide; s = phosphorothioate internucleotide linkage; Xd = 2’-deoxy-nucleotide; ~ = tether. 2026205304 06 Jul 2026
[00279] Using standard synthesis techniques, the following constructs are synthesized in various versions, with tethers 1 and 2, and with various tri-antennary GalNAc units according to the invention, as described above or depicted in Figures 26A-27B. 6.1. (Top strand (sense (ss)): SEQ ID NO:1; bottom strand (antisense) SEQ ID NO:2) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 5’ GalNAc~Gm-Am-Cm-Um-Um-Um-Cf-Am-Uf-Cf-Cf-Um-Gm-Gm-Am-Am-Am-Um-AmsUmsAm-ia-ia 3’ 3’ AmsCms-Cm-Um-Gm-Am-Am-Af-Gm-Uf-Am-Gm-Gm-Am-Cf-Cf-Um-Uf-Um-Am-UmsAfsUm 5’ 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 6.2. (Top strand (sense (ss)): SEQ ID NO:3; bottom strand (antisense) SEQ ID NO:4) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 5’ GalNAc~Am-Am-Gf-Cm-Af-Am-Gf-Am-Uf-Af-Uf-Um-Uf-Um-Um-Af-Um-Af-AmsUmsAm-ia-ia 3’ 3’ Td-Td-UmsUmsUm-Um-Cm-Gf-Um-Uf-Cm-Uf-Am-Um-Am-Af-Am-Af-Am-Um-Af-Um-UfsAfsUm 5’ 25 25 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 6.3. (Top strand (sense (ss)): SEQ ID NO:5; bottom strand (antisense) SEQ ID NO:6) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 5’GalNAc~Um-Gm-Gm-Gm-Am-Um-Uf-Um-Cf-Af-Uf-Gm-Um-Am-Am-Cm-Cm-Am-AmsGmsAm-ia-ia 3’ 3’ CmsUmsAm-Cm-Cm-Cm-Um-Af-Am-Af-Gm-Um-Am-Cm-Af-Um-Um-Gf-Gm-Um-UmsCfsUm 5’ 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 Example 7: Inverted abasic chemistry with 3’-GalNAc
[00280] Using standard synthesis techniques, the following constructs are synthesized in various versions, with tethers 1 and 2 according to the invention, and with various tri-antennary GalNAc units according to the invention, as described above or depicted in Figures 26A-27B. Same sequences as in Example 6 are shown for consistency. 2026205304 06 Jul 2026 7.1 (Top strand (sense (ss)): SEQ ID NO:7; bottom strand (antisense) SEQ ID NO:8) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 5’ ia-ia-GmsAmsCm-Um-Um-Um-Cf-Am-Uf-Cf-Cf-Um-Gm-Gm-Am-Am-Am-Um-Am-Um-Am~GalNAc 3’ 3’ AmsCmsCm-Um-Gm-Am-Am-Af-Gm-Uf-Am-Gm-Gm-Am-Cf-Cf-Um-Uf-Um-Am-UmsAfsUm 5’ 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 7.2 (Top strand (sense (ss)): SEQ ID NO:9; bottom strand (antisense) SEQ ID NO:10) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 5’ ia-ia-AmsAmsGf-Cm-Af-Am-Gf-Am-Uf-Af-Uf-Um-Uf-Um-Um-Af-Um-Af-Am-Um-Am~GalNAc 3’ 3’Td-Td-UmsUmsUm-Um-Cm-Gf-Um-Uf-Cm-Uf-Am-Um-Am-Af-Am-Af-Am-Um-Af-Um-UfsAfsUm 5’ 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 7.3. (Top strand (sense (ss)): SEQ ID NO:11; bottom strand (antisense) SEQ ID NO:12) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 5’ ia-ia-UmsGmsGm-Gm-Am-Um-Uf-Um-Cf-Af-Uf-Gm-Um-Am-Am-Cm-Cm-Am-Am-Gm-Am~GalNAc 3’ 3’ CmsUmsAm-Cm-Cm-Cm-Um-Af-Am-Af-Gm-Um-Am-Cm-Af-Um-Um-Gf-Gm-Um-UmsCfsUm 5’ 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 Example 8: Inverted abasic chemistry with 5’-GalNAc with alternative modification patterns
[00281] Using standard synthesis techniques, the following constructs are synthesized in various versions, with tethers 1 and 2 according to the invention, and with various tri-antennary GalNAc units according to the invention, as described above or depicted in Figures 26A-27B. Same sequences as in Example 6 are shown here for consistency. 8.1. (Top strand (sense (ss)): SEQ ID NO:13; bottom strand (antisense) SEQ ID NO:14) 2026205304 06 Jul 2026 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 5’GalNAc~Gf-Am-Cf-Um-Uf-Um-Cf-Am-Uf-Cm-Cf-Um-Gf-Gm-Af-Am-Af-Um-AfsUmsAf 3’ 3’ AmsCfsCm-Uf-Gm-Af-Am-Af-Gm-Uf-Am-Gf-Gm-Af-Cm-Cf-Um-Uf-Um-Af-UmsAfsUm 5’ 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 8.2 (Top strand (sense (ss)): SEQ ID NO:15; bottom strand (antisense) SEQ ID NO:16) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 5’ GalNAc~Af-Am-Gf-Cm-Af-Am-Gf-Am-Uf-Am-Uf-Um-Uf-Um-Uf-Am-Uf-Am-AfsUmsAf 3’ 3’ Td-Td-UmsUfsUm-Uf-Cm-Gf-Um-Uf-Cm-Uf-Am-Uf-Am-Af-Am-Af-Am-Uf-Am-Uf-UmsAfsUm 5’ 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 8.3. (Top strand (sense (ss)): SEQ ID NO:17; bottom strand (antisense) SEQ ID NO:18) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 5’ GalNAc~Uf-Gm-Gf-Gm-Af-Um-Uf-Um-Cf-Am-Uf-Gm-Uf-Am-Af-Cm-Cf-Am-AfsGmsAf 3’ 3’ CmsUfsAm-Cf-Cm-Cf-Um-Af-Am-Af-Gm-Uf-Am-Cf-Am-Uf-Um-Gf-Gm-Uf-UmsCfsUm 5’ 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 Example 9: Inverted abasic chemistry with 5’-GalNAc with alternative modification patterns
[00282] Using standard synthesis techniques, the following constructs are synthesized in various versions, with tethers 1 and 2 according to the invention, and with various tri-antennary GalNAc units according to the invention, as described above or depicted in Figures 26A-27B. Same sequences as in Example 6 are shown for consistency. 9.1. (Top strand (sense (ss)): SEQ ID NO:19; bottom strand (antisense) SEQ ID NO:20) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 5’ GfsAmsCf-Um-Uf-Um-Cf-Am-Uf-Cm-Cf-Um-Gf-Gm-Af-Am-Af-Um-Af-Um-Af~GalNAc 3’ 2026205304 06 Jul 2026 3’ AmsCfsCm-Uf-Gm-Af-Am-Af-Gm-Uf-Am-Gf-Gm-Af-Cm-Cf-Um-Uf-Um-Af-UmsAfsUm 5’ 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 9.2 (Top strand (sense (ss)): SEQ ID NO:21; bottom strand (antisense) SEQ ID NO:22) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 5’ AfsAmsGf-Cm-Af-Am-Gf-Am-Uf-Am-Uf-Um-Uf-Um-Uf-Am-Uf-Am-Af-Um-Af~GalNAc 3’ 3’ Td-Td-UmsUfsUm-Uf-Cm-Gf-Um-Uf-Cm-Uf-Am-Uf-Am-Af-Am-Af-Am-Uf-Am-Uf-UmsAfsUm 5’ 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 9.3 (Top strand (sense (ss)): SEQ ID NO:23; bottom strand (antisense) SEQ ID NO:24) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 5’ UfsGmsGf-Gm-Af-Um-Uf-Um-Cf-Am-Uf-Gm-Uf-Am-Af-Cm-Cf-Am-Af-Gm-Af~GalNAc 3’ 3’ CmsUfsAm-Cf-Cm-Cf-Um-Af-Am-Af-Gm-Uf-Am-Cf-Am-Uf-Um-Gf-Gm-Uf-UmsCfsUm 5’ 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 Example 10: Benchmarking of siRNA-GalNAc Conjugates
[00283] The constructs used in Examples 6-15 are referred to by their numbers and are listed in Table 11. Tether 1 and Tether 2 are shown in Fig 26 and 27 respectively. Table 11. Construct Target A (GO) Target B (C5) Target C (TTR) Tether 1 6.1 6.2 6.3 Tether 2 6.1 6.2 6.3 Tether 1 8.1 8.2 8.3 Tether 2 8.1 8.2 8.3 Tether 1 7.1 7.2 7.3 Tether 2 7.1 7.2 7.3 Tether 1 9.1 9.2 9.3 Tether 2 9.1 9.2 9.3 2026205304 06 Jul 2026 Construct Target A (GO) Target B (C5) Target C (TTR) 3’-GalNAc control (eg see Fig 25A) The following Table 12 reflects benchmarking to be performed with various select constructs of the invention. Table 12. In vitro Experiments for Benchmarking siRNA-GalNAc Target Benchmark RNAI agents A B C In Vitro siRNA Group Human Primary hepatocyte uptake ASPGR human hepatocyte binding Human Primary hepatocyte uptake ASPGR human hepatocyte binding Human Primary hepatocyte uptake ASPGR human hepatocyte binding 1 tether option 1 at 5’-end of sense strand 0, 4 (update), and 24 hr (silencing) incubations, or Hep3B Transfection w / RNAiMax for 24h Determine KD for ASPGR binding with siRNA-GalNAc 0, 4 (update), and 24 hr (silencing) incubations, or Hep3B Transfection w / RNAiMax for 24h Determine KD for ASPGR binding with siRNA-GalNAc 0, 4 (update), and 24 hr (silencing) incubations, or Hep3B Transfection w / RNAiMax for 24h Determine KD for ASPGR binding with siRNA-GalNAc Inverted abasic chemistry 2 tether option 2 at 5’-end of sense strand Inverted abasic chemistry 3 tether option 1 at 5’ end of sense strand Alternating chemistry 4 tether option 2 at 5’ -end of sense strand Alternating Chemistry 5 tether option 1 at 3 ’ -end of sense strand Inverted abasic chemistry 6 tether option 2 at 3 ’ -end of sense strand Inverted abasic chemistry 7 tether option 1 at 3 ’ -end of sense strand Alternating chemistry 8 tether option 2 at 3 ’ end of sense strand Alternating chemistry 9 3’-GalNAc control (eg see Fig 25A) 2026205304 06 Jul 2026 In Vitro Pharmacodynamic Characterization
[00284] The in vitro pharmacodynamics activity, binding affinity, and liver uptake for 8 constructs, listed in Table 11 (GO1 siRNA-GalNAc, C5 siRNA-GalNAc, and TTR siRNA-GalNAc analogues) are benchmarked against the clinically validated versions of these molecules.
[00285] Human Liver Cell Line (HepG2 or Hep3B) Transfection Assay--Each GO1 siRNA-GalNAc, C5 siRNA-GalNAc, and TTR siRNA-GalNAc analogue molecule is incubated at 370C for 0 and 24 hours at 10 different concentrations in human liver cell line in the presence of transfection reagent (e.g RNAiMAX). All incubations at each concentration are run in quadruplicate. Following incubations, each sample is lysed and analyzed for HAO1 C5, TTR and housekeeping gene (such as GAPDH) mRNA concentrations by bDNA or RT-qPCR assay. mRNA concentrations data obtained is used for analysis to determine the silencing activity and IC50 for each of the GO1 siRNA-GalNAc, C5 siRNA-GalNAc, and TTR siRNA-GalNAc molecules.
[00286] Primary Human Hepatocytes Uptake Assay--The liver uptake and silencing activity for each of the GO1 siRNA-GalNAc, C5 siRNA-GalNAc, and TTR siRNA-GalNAc molecules are evaluated in primary human hepatocytes. Each GO1 siRNA-GalNAc, C5 siRNA-GalNAc, and TTR siRNA-GalNAc analogues molecule is incubated at 370C for 0, 4, and 72 hours at 10 different concentrations in primary human hepatocytes. All incubations at each concentration are run in quadruplicate. Following incubations, each sample is lysed and analyzed forHAO1, C5, TTR and housekeeping gene(s) (such as GAPDH) mRNA concentrations by bDNA or RT-qPCR assay. mRNA concentrations data obtained are used for analysis to determine the silencing activity, uptake and IC50 for each of the GO1 siRNA-GalNAc, C5 siRNA-GalNAc, and TTR siRNA-GalNAc molecules. In Vivo Pharmacodynamic Characterization
[00287] The in vivo pharmacodynamics activity for 8 constructs each of GO1 siRNA-GalNAc, C5 siRNA-GalNAc, and TTR siRNA-GalNAc analogues is compared to the in vivo pharmacodynamic activity of clinically validated of each GO1siRNA-GalNAc, C5 siRNA-GalNAc, and TTR siRNA-GalNAc molecules following a single subcutaneous administration to male mice or cynomolgus monkeys.
[00288] For the in vivo mice pharmacology of GO1 siRNA-GalNAc of each of analogues is evaluated following a single subcutaneous dose at 0.3 or 3 mg / kg as provided in Table 13 below. 2026205304 06 Jul 2026 There are 2 dose groups in which each of the GO1 siRNA-GalNAc analogues is administered subcutaneously to C57BL / 6 male mice (n=3 / timepoint / group) at 0.3 or 1 mg / kg. Blood samples to obtain serum samples and liver biopsy samples are obtained at various time points to determine the concentration of serum glycolate by LCMS and to determine the concentration of HAO1 mRNA by RT-qPCR or bDNA assay. The animals from each group at each specified time point are sacrificed and blood (approximately 0.5 mL / animal) and liver (approximately 100 mg) are collected. For Groups 1 through 9, blood (approximately 0.5 mL / animal) and liver (approximately 100 mg) are collected from 3 animals / time point / group at 24, 48, 96, 168, 336, 504, and 672 hours post-dosing. Group 10 (n=3) is a control group that is not dosed to provide baseline values for serum glycolate and mRNA HAO1 concentrations. The pharmacodynamic effect of the increase of serum glycolate and the silencing of HAO1 mRNA in the liver at various time points post-dosing is compared to the Group 10 control serum and liver samples. 2026205304 06 Jul 2026 Table 13. GO1 siRNA-GalNAc Analogues Mice Pharmacology Study Design Group Number of Animals Dose Route Number of Doses / Animal Target Dose Level (mg / kg) Target Dose Concentration (mg / mL) Target Dose Volume (mL / kg) Male 1 21 SC 1 0.3 or 3 3 1.5 2 21 SC 1 0.3 or 3 3 1.5 3 21 SC 1 0.3 or 3 3 1.5 4 21 SC 1 0.3 or 3 3 1.5 5 21 SC 1 0.3 or 3 3 1.5 6 21 SC 1 0.3 or 3 3 1.5 7 21 SC 1 0.3 or 3 3 1.5 8 21 SC 1 0.3 or 3 3 1.5 9 21 SC 1 0.3 or 3 3 1.5 10a 5 NA NA NA NA NA Table Legend: SC Subcutaneous NA Not Applicable a Group 10 animals are control animals and are not be dosed c Animals in Groups 1 to 9 are dosed on Day 1 2026205304 06 Jul 2026 Example 11: 5’ Conjugation using click-chemistry (Option 1) 5' Conjugation Option 1 SS 5' Last coupling on solid support followed by cleavage and deprotection and purification 3' to 5' sense strand synthesis on SS followed by detritilation 101 NHAc H
[00289] In this embodiment, the sense strand of the oligonucleotide 101 is synthesized on solid support and coupled with the commercially available octyne amidite 102 to give the required oligonucleotide with the click chemistry precursor on the solid support. This after standard cleavage and deprotection provides the pure oligo nucleotide 103. The azide 104 is dissolved in DMSO (150 pL / mg) and this solution is added to 10 OD of oligo 103 in 100 pL of water. The reaction mixture is then incubated at room temperature overnight. The conjugated oligo 105 is desalted on a Glen Gel-Pak™ to remove organics and the acetoxy protecting groups were removed by treating with methylamine followed by prep HPLC to give pure Oligo 106 which is annealed with an equimolar amount of sense strand to give the final duplex. 2026205304 06 Jul 2026 Example 12: 5’ Conjugation (Option 2)
[00290] In this embodiment, the sense strand of the oligonucleotide 101 is synthesized on solid support and coupled with the commercially available amidite 108 to give the required oligonucleotide on the solid support. This after standard cleavage and deprotection provides the pure oligo nucleotide 109. The amine 109 is dissolved in water (15 ^L / OD) and this solution is added to a solution of the acid 110 in DMSO (100 mL / mg) followed by 10 molar equivalents of EDC and 10 equivalents of HOBT and the reaction mixture is incubated at room temperature overnight. The conjugated oligo 111 is then desalted on a Glen Gel-Pak™ to remove organics and the acetoxy protecting groups were removed by treating with methylamine followed by prep HPLC to give pure Oligo 112 which is annealed with an equimolar amount of sense strand to give the final duplex. 2026205304 06 Jul 2026 5' Conjugation Option 2 3' to 5' sense strand synthesis on SS followed by detritilation 101 Last coupling on solid support followed by cleavage and deprotection and purification Example 13: 5’ Conjugation using click-chemistry (Option 1) 2026205304 06 Jul 2026 3' Conjugation Option 1 Starting the synthesis from C6 amino linker solid support, synthesis, deprotection and purification post synthetic conjugation 113
[00291] For the synthesis of oligo construct 119 a similar approach is adapted where the triantennary GalNAc conjugate is loaded on to the solid support 118 (CPG) and the oligo synthesis is performed. After cleavage and deprotection and purification provides the pure oligo 119 which is annealed with antisense strand to give the required final duplex in a pure form. In another approach the 3’ conjugate is also synthesized analogous to the synthesis of 116 starting from amino linked oligo 113 and post synthetically conjugating the GalNAc carboxylic acid to give the conjugated oligo 119. 2026205304 06 Jul 2026 Example 14: 3’ Conjugation (Option 2)
[00292] For the synthesis of oligo construct 119 a similar approach is adapted where the tri-antennary GalNAc conjugate is loaded on to the solid support 118 (CPG) and the oligo synthesis is performed. After cleavage and deprotection and purification provided the pure oligo 119 which is annealed with antisense strand to give the required final duplex in a pure form. In another approach, the 3’ conjugate is also synthesized analogous to the synthesis of 116 starting from amino linked oligo 113 and post synthetically conjugating the GalNAc carboxylic acid to give the conjugated oligo 119. 2026205304 06 Jul 2026 Example 15: Post-synthetic conjugation approach Anealing with antisense strand
[00293] In this approach, the 3’ conjugate is also synthesized analogous to the synthesis of 116 starting from amino linked oligo 113 and post synthetically conjugating the GalNAc carboxylic acid to give the conjugated oligo 121 which is annealed with antisense strand to give the required final duplex in a pure form. 2026205304 06 Jul 2026
[00294] The preceding Examples are not intended to be limiting. Those of skill in the art will, in light of the present disclosure, appreciate that many changes can be made in the specific materials and which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention. 2026205304 06 Jul 2026 STATEMENTS 1. A modified RNAi agent comprising an RNA interference compound (RNAi compound) conjugated via a tether to an ASGP-R ligand, wherein the tether comprises: 0 (Formula III*) wherein m is chosen from 0, 1, 2, 3, 4, or 5, and p is chosen from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14, independently of m; and X is chosen from O and CH2. 2. The modified RNAi agent of statement 1, wherein m=1. 3. The modified RNAi agent of statement 1, wherein x is O. 4. The modified RNAi agent of statement 1, wherein p=6. 5. The modified RNAi agent of statement 1, wherein m=1, p=6, and x is O. 6. The modified RNAi agent of statement 1, wherein the ASGP-R ligand comprises a branched GalNAc. 7. The modified RNAi agent of statement 6, wherein the branched GalNAc is selected from the group consisting of: Formula I* and Formula II*-a 2026205304 06 Jul 2026 wherein n is 0, 1, 2, 3, or 4. 8. The modified RNAi agent of statement 7, wherein n=1. 9. The modified RNAi agent of statement 6, wherein the branched GalNAc comprises Formula VI*, or a bi-antennary form thereof. 10. The modified RNAi agent of statement 6, wherein the branched GalNAc comprises or a bi-antennary form thereof. Formula VII*, or a bi-antennary form thereof. 11. The modified RNAi agent of statement 1, wherein the tether is attached to the 5’ end of the sense strand. 12. The modified RNAi agent of statement 11, wherein the tether is attached as shown in Formula IV*. 2026205304 06 Jul 2026 wherein Z is P or S. 13. The modified RNAi agent of statement 11, wherein the tether is attached to the 3’ end of the sense strand. 14. The modified RNAi agent of statement 13, wherein the tether is attached as shown in Formulae V*-a or V*-b: Formula V*-a Formula V*-b 15. The modified RNAi agent of statement 1, as shown in Figs. 26A, 26B, 26C, or 26D. 16. The modified RNAi agent of statement 15, wherein the RNAi compound comprises modified riboses that are modified at the 2’ position. 17. The modified RNAi agent of statement 16, wherein the modifications are chosen from 2’-O-methyl, 2’-deoxy-fluoro, and 2’-deoxy. 18. The modified RNAi agent of statement 1, wherein RNAI compound contains one or more degradation protective moieties at any or all ends that are not conjugated to the ASGP-R ligand. 19. The modified RNAi agent of statement 18, wherein the degradation protective moiety is chosen alone or as any combination from a group consisting of 1-4 phosphorothioate linkages, 1-4 deoxynucleotides, and 1-4 inverted abasic nucleotides. 2026205304 06 Jul 2026 20. The modified RNAi agent of statement 19, wherein the degradation protective moieties are chosen from the configuration present in one of the following constructs 6.1, 6.2, 6.3, 7. 1, 7.2, 7.3, 8,1, 8.2, 8.3, 9.1, 9.2, and 9.3. 21. A modified RNAi agent comprising an RNA interference compound (RNAi compound) conjugated via a tether to an ASGP-R ligand, wherein the tether comprises: (Formula III*-2) wherein q is chosen from 1, 2, 3, 4, 5, 6, 7, or 8. 22. The modified RNAi agent of statement 21, wherein q=1. 23. The modified RNAi agent of statement 21, wherein the ASGP-R ligand comprises a branched GalNAc. 24. The modified RNAi agent of statement 23, wherein the branched GalNAc is selected from the group consisting of: HO / OH VV o HO X.--'^. O NHAc HO / OH tV 0 r HOS^^° NHAc HO zOH VV o HO X.--'-i O NHAc H Nn N H Formula I* and 2026205304 06 Jul 2026 Formula II*-a wherein n is 0, 1, 2, 3, or 4. 25. The modified RNAi agent of statement 24, wherein n=1. 26. The modified RNAi agent of statement 23, wherein the branched GalNAc comprises Formula VI*, or a bi-antennary form thereof. 27. The modified RNAi agent of statement 23, wherein the branched GalNAc comprises or a bi-antennary form thereof. Formula VII*, or a bi-antennary form thereof. 2026205304 06 Jul 2026 28. The modified RNAi agent of statement 21, wherein the tether is attached to the 5’ end of the sense strand. 29. The modified RNAi agent of statement 28, wherein the tether is attached as shown in Formula IV*. wherein Z is P or S. 30. The modified RNAi agent of statement 28, wherein the tether is attached to the 3’ end of the sense strand. 31. The modified RNAi agent of statement 30, wherein the tether is attached as shown in Formulae V*-a or V*-b: Formula V*-a Formula V*-b 32. The modified RNAi agent of statement 31, as shown in Figs. 27A, 27B, 27C, or 27D. 33. The modified RNAi agent of statement 21, wherein the RNAi compound comprises modified riboses that are modified at the 2’ position. 34. The modified RNAi agent of statement 33, wherein the modifications are chosen from 2’-O-methyl, 2’deoxy-fluoro, and 2’-deoxy. 2026205304 06 Jul 2026 35. The modified RNAi agent of statement 21, wherein siRNA contains one or more degradation protective moieties at any or all ends that are not conjugated to the ASGP-R ligand. 36. The modified RNAi agent of statement 35, wherein the degradation protective moiety is chosen alone or as any combination from a group consisting of 1-4 phosphorothioate linkages, 1-4 deoxynucleotides, and 1-4 inverted abasic nucleotides. 37. The modified RNAi agent of statement 36, wherein the degradation protective moieties are chosen from the configuration present in one of the following constructs 6.1, 6.2, 6.3, 7. 1, 7.2, 7.3, 8,1, 8.2, 8.3, 9.1, 9.2, and 9.3. 39. A method of making the RNAi agent of statements 1 or 2, said method being shown in Examples 11-15. 40. A method of preventing, alleviating, or treating a disease in a subject, the method comprising administering, to the subject, the RNAi agent of statements 1 or 2 in a therapeutically amount effective to prevent, alleviate or treat the disease, thereby preventing, alleviating, or treating a disease. 41. The method of statement 40, wherein the subject is human. Table A: Summary of Sequences Seq ID Duplex ID ssRN ID Sense Sequence Antisense Sequence Clean Sequence 1. 5 ’ GalNAc~Gm-Am-Cm-Um-Um-Um-Cf-Am-Uf- Cf-Cf-Um-Gm-Gm-Am-Am-Am-Um- AmsUmsAm-ia-ia 3 ’ gacuuucauccuggaaauaua 2. 3’ AmsCms-Cm-Um-Gm- Am-Am-Af-Gm-Uf-Am-Gm- Gm-Am-Cf-Cf-Um-Uf-Um- Am-UmsAfsUm 5’ accugaaaguaggaccuuuauau 3. 5 ’ GalN Ac-Am- Am-Gf-Cm- Af- Am-Gf- Am- Uf-Af-Uf-Um-Uf-Um-Um-Af-Um-Af- AmsUmsAm-ia-ia 3 ’ aagc aagauauuuuuauaaua 4. 3’ Td-Td-UmsUmsUm-Um- Cm-Gf-Um-Uf-Cm-Uf-Am- Um-Am-Af-Am-Af-Am-Um- Af-Um-UfsAfsUm 5’ uuuucguucuauaaaaauauuau 5. 5 ’ GalN Ac~Um-Gm-Gm-Gm- Am-Um-Uf-Um-Cf- Af-Uf-Gm-Um-Am-Am-Cm-Cm-Am- AmsGmsAm-ia-ia 3 ’ ugggauuucauguaaccaaga Seq ID Duplex ID ssRN ID Sense Sequence Antisense Sequence Clean Sequence 6. 3’ CmsUmsAm-Cm-Cm-Cm- Um-Af-Am-Af-Gm-Um-Am- Cm-Af-Um-Um-Gf-Gm-Um- UmsCfsUm 5’ cuacccuaaaguacauugguucu 7. 5 ’ ia-ia-GmsAmsCm-Um-Um-Um-Cf-Am-Uf-Cf- Cf-Um-Gm-Gm-Am-Am-Am-Um-Am-Um- Am~GalNAc3’ gacuuucauccuggaaauaua 8. 3’ AmsCmsCm-Um-Gm- Am-Am-Af-Gm-Uf-Am-Gm- Gm-Am-Cf-Cf-Um-Uf-Um- Am-UmsAfsUm 5’ accugaaaguaggaccuuuauau 9. 5 ’ ia-ia-AmsAmsGf-Cm-Af-Am-Gf-Am-Uf-Af- Uf-Um-Uf-Um-Um-Af-Um-Af-Am-Um- Am~GalNAc3’ aagc aagauauuuuuauaaua 10. 3 ’ T d-Td-UmsUmsUm-Um- Cm-Gf-Um-Uf-Cm-Uf-Am- Um-Am-Af-Am-Af-Am-Um- Af-Um-UfsAfsUm 5’ uuuucguucuauaaaaauauuau o 00 Seq ID Duplex ID ssRN ID Sense Sequence Antisense Sequence Clean Sequence 11. 5 ’ ia-ia-UmsGmsGm-Gm-Am-Um-Uf-Um-Cf-Af- Uf-Gm-Um-Am-Am-Cm-Cm-Am-Am-Gm- Am~GalNAc3’ ugggauuucauguaaccaaga 12. 3’ CmsUmsAm-Cm-Cm-Cm- Um-Af-Am-Af-Gm-Um-Am- Cm-Af-Um-Um-Gf-Gm-Um- UmsCfsUm 5’ cuacccuaaaguacauugguucu 13. 5 ’ GalNAc~Gf-Am-Cf-Um-Uf-Um-Cf-Am-Uf-Cm- Cf-Um-Gf-Gm-Af-Am-Af-Um-AfsUmsAf 3 ’ gacuuucauccuggaaauaua 14. 3’ AmsCfsCm-Uf-Gm-Af- Am-Af-Gm-Uf-Am-Gf-Gm- Af-Cm-Cf-Um-Uf-Um-Af- UmsAfsUm 5’ accugaaaguaggaccuuuauau 15. 5 ’ GalN Ac~Af- Am-Gf-Cm- Af- Am-Gf- Am-Uf- Am-Uf-Um-Uf-Um-Uf-Am-Uf-Am-AfsUmsAf 3 ’ aagc aagauauuuuuauaaua 16. 3’ Td-Td-UmsUfsUm-Uf- Cm-Gf-Um-Uf-Cm-Uf-Am- uuuucguucuauaaaaauauuau o Seq ID Duplex ID ssRN ID Sense Sequence Antisense Sequence Clean Sequence Uf-Am-Af-Am-Af-Am-Uf- Am-Uf-UmsAfsUm 5’ 17. 5 ’ GalN Ac~Uf-Gm-Gf-Gm-Af-Um-Uf-Um-Cf- Am-Uf-Gm-Uf-Am-Af-Cm-Cf-Am-AfsGmsAf 3 ’ ugggauuucauguaaccaaga 18. 3’ CmsUfsAm-Cf-Cm-Cf- Um-Af-Am-Af-Gm-Uf-Am- Cf-Am-Uf-Um-Gf-Gm-Uf- UmsCfsUm5’ cuacccuaaaguacauugguucu 19. 5 ’ GfsAmsCf-Um-Uf-Um-Cf-Am-Uf-Cm-Cf-Um-Gf-Gm-Af-Am-Af-Um-Af-Um-Af~GalNAc 3’ gacuuucauccuggaaauaua 20. 3’ AmsCfsCm-Uf-Gm-Af- Am-Af-Gm-Uf-Am-Gf-Gm- Af-Cm-Cf-Um-Uf-Um-Af- UmsAfsUm 5’ accugaaaguaggaccuuuauau 21. 5 ’ AfsAmsGf-Cm-Af-Am-Gf-Am-Uf-Am- Uf-Um-Uf-Um-Uf-Am-Uf-Am-Af-Um- Af~GalNAc3’ aagc aagauauuuuuauaaua Seq ID Duplex ID ssRN ID Sense Sequence Antisense Sequence Clean Sequence 22. 3’ Td-Td-UmsUfsUm-Uf- Cm-Gf-Um-Uf-Cm-Uf-Am- Uf-Am-Af-Am-Af-Am-Uf- Am-Uf-UmsAfsUm 5’ uuuucguucuauaaaaauauuau 23. 5 ’ UfsGmsGf-Gm-Af-Um-Uf-Um-Cf-Am-Uf- Gm-Uf-Am-Af-Cm-Cf-Am-Af-Gm-Af~GalNAc 3 ’ ugggauuucauguaaccaaga 24. 3’ CmsUfsAm-Cf-Cm-Cf- Um-Af-Am-Af-Gm-Uf-Am- Cf-Am-Uf-Um-Gf-Gm-Uf- UmsCfsUm 5’ cuacccuaaaguacauugguucu Seq ID Duple xID ssRN ID Sense Sequence 5’ -> 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 25. ETXO 05 (invabasic)(invabasic)gsascu uuCfaUfCfCfuggaaauasusa( NHC6)(MFC0)(ET-GalNAc-TlN3) gacuuucauccuggaaauaua 26. ETXO 05 usAfsuauUfuCfCfaggaUfgAfaagucscsa uauauuuccaggaugaaagucca 27. ETXO 01 (ET-GalNAc-T1N3)(MFCO)(NH-DEG)gacuuuCfaUfCfCfugg aaauasusa(invabasic)(invaba sic) gacuuucauccuggaaauaua 28. ETXO 01 usAfsuauUfuCfCfaggaUfgAfaagucscsa uauauuuccaggaugaaagucca 29. ETXO 14 (invabasic)(invabasic)asasGf c AfaGfaU fAfU fuU fuuAfuA faua(NHC6)(MFC0)(ET-GalNAc-TlN3) aagcaagauauuuuuauaaua Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 30. ETXO 14 us AfsU fuAfuaAfaAfauaU fcU fuGfcuus usudTdT uauuauaaaaauaucuugcuuuu 31. ETXO 10 (ET-GalNAc-T1N3)(MFCO)(NH-DEG)aaGfcAfaGfaUfAfUfu UfuuAfuAfasusa(invabasic)( invabasic) aagcaagauauuuuuauaaua 32. ETXO 10 us AfsU fuAfuaAfaAfauaU fcU fuGfcuus usudTdT uauuauaaaaauaucuugcuuuu 33. ETXO 19 (ET-GalNAc-T1N3)(MFCO)(NH-DEG)ugggauUfuCfAfUfgua accaasgsa(invabasic)(invaba sic) ugggauuucauguaaccaaga 34. ETXO 19 usCfsuugGfuuAfcaugAfaAfucccasusc ucuugguuac augaaauc ccauc 35. ETXO 23 (invabasic)(invabasic)usgsg gauUfuC fAfUfguaac c aaga( ugggauuucauguaaccaaga Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence NHC6)(MFC0)(ET- GalNAc-TlN3) 36. ETXO 23 usCfsuugGfuuAfcaugAfaAfucccasusc ucuugguuac augaaauc ccauc 37. XD- 00914 cuuAcGcuGAGuAcuucGAd TsdT cuuacgcugaguacuucga 38. XD- 00914 UCGAAGuACUcAGCGuAAGdTsdT ucgaaguacucagcguaag 39. XD- 03999 AGAuAuGcAcAcAcAcGG AdTsdT agauaugcacacacacgga 40. XD- 03999 UCCGUGUGUGUGcAuAUCUdTsdT uccgugugugugcauaucu 41. XD- 15421 uscsUfcGfuGfgCfcUfuAfaU fgAfaAf(invdT) ucucguggccuuaaugaaa 42. XD- 15421 UfsUfsuCfaUfuAfaGfgCfcAfcGfaGfas usu uuucauuaaggccacgagauu 43. X9138 2 (NH2- DEG)gacuuuCfaUfCfCfugg gacuuucauccuggaaauaua 114 Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence aaauasusa(invabasic)(invaba sic) 44. X9138 3 (NH2- DEG)aaGfcAfaGfaUfAfUfu UfuuAfuAfasusa(invabasic)( invabasic) aagcaagauauuuuuauaaua 45. X9138 4 (NH2- DEG)ugggauUfuCfAfUfgua accaasgsa(invabasic)(invaba sic) ugggauuucauguaaccaaga 46. X9140 3 (NH2C12)gacuuuCfaUfCfC fuggaaauasusa(invabasic)(in vabasic) gacuuucauccuggaaauaua 47. X9140 4 (NH2C12)aaGfc AfaGfaUfA fU fuU fuuAfuAfasusa(invab asic)(invabasic) aagcaagauauuuuuauaaua Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 48. X9140 5 (NH2C12)ugggauUfuCfAfU fguaaccaasgsa(invabasic)(in vabasic) ugggauuucauguaaccaaga 49. X9141 5 (invabasic)(invabasic)gsascu uuCfaUfCfCfuggaaauasusa( NH2C6) gacuuucauccuggaaauaua 50. X9141 6 (invabasic)(invabasic)asasGf c AfaGfaU fAfU fuU fuuAfuA faua(NH2C6) aagcaagauauuuuuauaaua 51. X9141 7 (invabasic)(invabasic)usgsg gauUfuC fAfUfguaac c aaga( NH2C6) ugggauuucauguaaccaaga 52. X9137 9 gsascuuuCfaUfCfCfuggaaau aua(GalNAc) gacuuucauccuggaaauaua 53. X9138 0 asasGfc AfaGfaU fAfU fuU fu uAfuAfaua(GalNAc) aagcaagauauuuuuauaaua 54. X9144 6 usgsggauUfuCfAfUfguaacca aga(GalNAc) ugggauuucauguaaccaaga Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 55. X3848 3 usAfsuauUfuCfCfaggaUfgA faagucscsa uauauuuccaggaugaaagucca 56. X9138 1 us AfsU fuAfuaAfaAfauaU fc U fuGfcuususudT dT uauuauaaaaauaucuugcuuuu 57. X3810 4 usCfsuugGfuuAfcaugAfaAf ucccasusc ucuugguuacaugaaaucccauc 58. X9138 8 (MFCO)(NH- DEG)gacuuuCfaUfCfCfugg aaauasusa(invabasic)(invaba sic) gacuuucauccuggaaauaua 59. X9138 9 (MFCO)(NH- DEG)aaGfcAfaGfaUfAfUfu UfuuAfuAfasusa(invabasic)( invabasic) aagcaagauauuuuuauaaua 60. X9139 0 (MFCO)(NH- DEG)ugggauUfuCfAfUfgua accaasgsa(invabasic)(invaba sic) ugggauuucauguaaccaaga Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 61. X9142 1 (invabasic)(invabasic)gsascu uuCfaUfCfCfuggaaauasusa( NHC6) (MFCO) gacuuucauccuggaaauaua 62. X9142 2 (invabasic)(invabasic)asasGf c AfaGfaU fAfU fuU fuuAfuA faua(NHC6)(MFCO) aagcaagauauuuuuauaaua 63. X9142 3 (invabasic)(invabasic)usgsg gauUfuC fAfUfguaac c aaga( NHC6) (MFCO) ugggauuucauguaaccaaga 64. X9139 4 (GalNAc-T 1 )(MFCO)(NH-DEG)gacuuuCfaUfCfCfugg aaauasusa(invabasic)(invaba sic) gacuuucauccuggaaauaua 65. X9139 5 (GalNAc-T 1 )(MFCO)(NH-DEG)aaGfcAfaGfaUfAfUfu UfuuAfuAfasusa(invabasic)( invabasic) aagcaagauauuuuuauaaua Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 66. X9139 6 (GalNAc-T 1 )(MFCO)(NH-DEG)ugggauUfuCfAfUfgua accaasgsa(invabasic)(invaba sic) ugggauuucauguaaccaaga 67. X9142 7 (invabasic)(invabasic)gsascu uuCfaUfCfCfuggaaauasusa( NHC6)(MFCO)(GalNAc-Tl) gacuuucauccuggaaauaua 68. X9142 8 (invabasic)(invabasic)asasGf c AfaGfaU fAfU fuU fuuAfuA faua(NHC6)(MFC0)(GalN Ac-Tl) aagcaagauauuuuuauaaua 69. X9142 9 (invabasic)(invabasic)usgsg gauUfuC fAfUfguaac c aaga( NHC6)(MFCO)(GalN Ac-Tl) ugggauuucauguaaccaaga 70. ETXO 01 X9139 4 (GalNAc- T1 )(MFCO)(NHDEG)gacuu gacuuucauccuggaaauaua Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence uCfaUfCfCfuggaaauasusa(in vabasic)(invabasic) 71. X3848 3 usAfsuauUfuCfCfaggaUfgA faagucscsa uauauuuccaggaugaaagucca 72. ETXO 05 X9142 7 (invabasic)(invabasic)gsascu uuCfaUfCfCfuggaaauasusa( NHC6)(MFCO)(GalNAc-Tl) gacuuucauccuggaaauaua 73. X3848 3 usAfsuauUfuCfCfaggaUfgA faagucscsa uauauuuccaggaugaaagucca 74. ETXO 10 X9139 5 (GalNAc-T 1 )(MFCO)(NH-DEG)aaGfcAfaGfaUfAfUfu UfuuAfuAfasusa(invabasic)( invabasic) aagcaagauauuuuuauaaua 75. X9138 1 us AfsU fuAfuaAfaAfauaU fc U fuGfcuususudT dT uauuauaaaaauaucuugcuuuu 76. ETXO 14 X9142 8 (invabasic)(invabasic)asasGf c AfaGfaU fAfU fuU fuuAfuA aagcaagauauuuuuauaaua Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence faua(NHC6)(MFC0)(GalN Ac-Tl) 77. X9138 1 us AfsU fuAfuaAfaAfauaU fc U fuGfcuususudT dT uauuauaaaaauaucuugcuuuu 78. ETXO 19 X9139 6 (GalNAc-T 1 )(MFCO)(NH-DEG)ugggauUfuCfAfUfgua accaasgsa(invabasic)(invaba sic) ugggauuucauguaaccaaga 79. X3810 4 usCfsuugGfuuAfcaugAfaAf ucccasusc ucuugguuacaugaaaucccauc 80. ETXO 23 X9142 9 (invabasic)(invabasic)usgsg gauUfuC fAfUfguaac c aaga( NHC6)(MFCO)(GalN Ac-Tl) ugggauuucauguaaccaaga 81. X3810 4 usCfsuugGfuuAfcaugAfaAf ucccasusc ucuugguuacaugaaaucccauc Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 82. ETXO 06 (invabasic)(invabasic)gsascu uuCfaUfCfCfuggaaauasusa( NHC6)(ET-GalNAc-T2CO) gacuuucauccuggaaauaua 83. ETXO 06 usAfsuauUfuCfCfaggaUfgAfaagucscsa uauauuuccaggaugaaagucca 84. ETXO 02 (ET-GalNAc- T2CO)(NH2C 12)gacuuuCfa UfCfCfuggaaauasusa(invaba sic)(invabasic) gacuuucauccuggaaauaua 85. ETXO 02 usAfsuauUfuCfCfaggaUfgAfaagucscsa uauauuuccaggaugaaagucca 86. ETXO 04 (ET-GalNAc- T2CO)(NH2C 12)GfaCfuUf uCfaUfcCfuGfgAfaAfuAfsu sAf gacuuucauccuggaaauaua 87. ETXO 04 usAfsuAfuUfuCfcAfgGfaUfgAfaAfgUf csCfsa uauauuuccaggaugaaagucca Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 88. ETXO 08 GfsasCfuUfuCfaUfcCfuGfg AfaAfuAfuAf(NHC6)(ET-GalNAc-T2CO) gacuuucauccuggaaauaua 89. ETXO 08 usAfsuAfuUfuCfcAfgGfaUfgAfaAfgUf csCfsa uauauuuccaggaugaaagucca 90. ECXO 08 (lower purity) GfsasCfuUfuCfaUfcCfuGfg AfaAfuAfuAf(NHC6)(ET-GalNAc-T2CO) gacuuucauccuggaaauaua 91. ECXO 08 (lower purity) usAfsuAfuUfuCfcAfgGfaUfgAfaAfgUf csCfsa uauauuuccaggaugaaagucca 92. ETXO 11 (ET-GalNAc-T2CO)(NH2C 12)aaGfc Afa GfaU fAfU fuU fuuAfuAfasus a(invabasic)(invabasic) aagcaagauauuuuuauaaua Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 93. ETXO 11 us AfsU fuAfua AfaAfauaU fcU fuGfcuus usudTdT uauuauaaaaauaucuugcuuuu 94. ETXO 15 (invabasic)(invabasic)asasGf c AfaGfaU fAfU fuU fuuAfuA faua(NHC6)(ET-GalNAc-T2C0) aagcaagauauuuuuauaaua 95. ETXO 15 us AfsU fuAfua AfaAfauaU fcU fuGfcuus usudTdT uauuauaaaaauaucuugcuuuu 96. ETXO 13 (ET-GalNAc- T2CO)(NH2C 12) AfaGfc Afa GfaUfaU fuU fuU faUfaAfsus Af aagcaagauauuuuuauaaua 97. ETXO 13 us AfsuU faU faAfa AfaU faUfcU fuGfcU f usUfsudTdT uauuauaaaaauaucuugcuuuu 98. ETXO 17 AfsasGfc AfaGfaU faU fuU fu UfaUfaAfuAf(NHC6)(ET-GalNAc-T2C0) aagcaagauauuuuuauaaua 124 Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 99. ETXO 17 us AfsuU faU faAfa AfaU faUfcU fuGfcU f usUfsudTdT uauuauaaaaauaucuugcuuuu 100. ETXO 20 (ET-GalNAc- T2CO)(NH2C 12)ugggauUfu CfAfUfguaaccaasgsa(invaba sic)(invabasic) ugggauuucauguaaccaaga 101. ETXO 20 usCfsuugGfuuAfcaugAfaAfucccasusc ucuugguuacaugaaaucccauc 102. ETXO 22 (ET-GalNAc- T2CO)(NH2C 12)UfgGfgAf uUfuCfaUfgUfaAfcCfaAfsg sAf ugggauuucauguaaccaaga 103. ETXO 22 usCfsuUfgGfuUfaCfaUfgAfaAfuCfcCf asUfsc ucuugguuac augaaauc ccauc 104. ETXO 24 (invabasic)(invabasic)usgsg gauUfuC fAfUfguaac c aaga( NHC6)(ET-GalNAc-T2CO) ugggauuucauguaaccaaga Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 105. ETXO 24 usCfsuugGfuuAfcaugAfaAfucccasusc ucuugguuacaugaaaucccauc 106. ETXO 26 UfsgsGfgAfuUfuCfaUfgUfa AfcCfaAfgAf(NHC6)(ET-GalNAc-T2CO) ugggauuucauguaaccaaga 107. ETXO 26 usCfsuUfgGfuUfaCfaUfgAfaAfuCfcCf asUfsc ucuugguuac augaaauc ccauc 108. XD- 00914 cuuAcGcuGAGuAcuucGAd TsdT cuuacgcugaguacuucga 109. XD- 00914 UCGAAGuACUcAGCGuAAGdTsdT ucgaaguacuc agcguaag 110. XD- 03999 AGAuAuGcAcAcAcAcGG AdTsdT agauaugcacacacacgga 111. XD- 03999 UCCGUGUGUGUGcAuAUCUdTsdT uccgugugugugcauaucu 112. XD- 15421 uscsUfcGfuGfgCfcUfuAfaU fgAfaAf(invdT) ucucguggccuuaaugaaa O\ Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 113. XD- 15421 UfsUfsuCfaUfuAfaGfgCfcAfcGfaGfas usu uuucauuaaggccacgagauu 114. X9138 2 (NH2- DEG)gacuuuCfaUfCfCfugg aaauasusa(invabasic)(invaba sic) gacuuucauccuggaaauaua 115. X9138 3 (NH2- DEG)aaGfcAfaGfaUfAfUfu UfuuAfuAfasusa(invabasic)( invabasic) aagcaagauauuuuuauaaua 116. X9138 4 (NH2- DEG)ugggauUfuCfAfUfgua accaasgsa(invabasic)(invaba sic) ugggauuucauguaaccaaga 117. X9138 5 (NH2- DEG)GfaCfuUfuCfaUfcCfu GfgAfaAfuAfsusAf gacuuucauccuggaaauaua Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 118. X9138 6 (NH2- DEG)AfaGfcAfaGfaUfaUfu U fuU faU faAfsus Af aagcaagauauuuuuauaaua 119. X9138 7 (NH2- DEG)UfgGfgAfuUfuCfaUfg UfaAfcCfaAfsgsAf ugggauuucauguaaccaaga 120. X9140 3 (NH2C12)gacuuuCfaUfCfC fuggaaauasusa(invabasic)(in vabasic) gacuuucauccuggaaauaua 121. X9140 4 (NH2C12)aaGfc AfaGfaUfA fU fuU fuuAfuAfasusa(invab asic)(invabasic) aagcaagauauuuuuauaaua 122. X9140 5 (NH2C12)ugggauUfuCfAfU fguaaccaasgsa(invabasic)(in vabasic) ugggauuucauguaaccaaga 123. X9140 6 (NH2C12)GfaCfuUfuCfaUf cCfuGfgAfaAfuAfsusAf gacuuucauccuggaaauaua Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 124. X9140 7 (NH2C12) AfaGfc AfaGfaUf aU fuU fuU faU faAfsus Af aagcaagauauuuuuauaaua 125. X9140 8 (NH2C12)UfgGfgAfuUfuCf aUfgUfaAfcCfaAfsgsAf ugggauuucauguaaccaaga 126. X9141 5 (invabasic)(invabasic)gsascu uuCfaUfCfCfuggaaauasusa( NH2C6) gacuuucauccuggaaauaua 127. X9141 6 (invabasic)(invabasic)asasGf c AfaGfaU fAfU fuU fuuAfuA faua(NH2C6) aagcaagauauuuuuauaaua 128. X9141 7 (invabasic)(invabasic)usgsg gauUfuC fAfUfguaac c aaga( NH2C6) ugggauuucauguaaccaaga 129. X9141 8 GfsasCfuUfuCfaUfcCfuGfg AfaAfuAfuAf(NH2C6) gacuuucauccuggaaauaua 130. X9141 9 AfsasGfc AfaGfaU faU fuU fu UfaUfaAfuAf(NH2C6) aagcaagauauuuuuauaaua Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 131. X9142 0 UfsgsGfgAfuUfuCfaUfgUfa AfcCfaAfgAf(NH2C6) ugggauuucauguaaccaaga 132. X9137 9 gsascuuuCfaUfCfCfuggaaau aua(GalNAc) gacuuucauccuggaaauaua 133. X9138 0 asasGfc AfaGfaU fAfU fuU fu uAfuAfaua(GalNAc) aagcaagauauuuuuauaaua 134. X9144 6 usgsggauUfuCfAfUfguaacca aga(GalNAc) ugggauuucauguaaccaaga 135. X3848 3 usAfsuauUfuCfCfaggaUfgA faagucscsa uauauuuccaggaugaaagucca 136. X9138 1 us AfsU fuAfuaAfaAfauaU fc U fuGfcuususudT dT uauuauaaaaauaucuugcuuuu 137. X3810 4 usCfsuugGfuuAfcaugAfaAf ucccasusc ucuugguuacaugaaaucccauc 138. X9139 8 us AfsuAfuU fuCfc AfgGfaU f gAfaAfgUfcsCfsa uauauuuccaggaugaaagucca 139. X9140 0 us AfsuU faU fa AfaAfaU faUf cUfuGfcUfusUfsudTdT uauuauaaaaauaucuugcuuuu Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 140. X9140 2 usCfsuUfgGfuUfaCfaUfgAf aAfuCfcCfasUfsc ucuugguuac augaaauc ccauc 141. X9140 9 (GalNAc- T2)(NH2C 12)gacuuuCfaUf CfCfuggaaauasusa(invabasic )(invabasic) gacuuucauccuggaaauaua 142. X9141 0 (GalNAc- T2)(NH2C 12)aaGfc AfaGfa U fAfU fuU fuuAfuAfasusa(in vabasic)(invabasic) aagcaagauauuuuuauaaua 143. X9141 1 (GalNAc- T2)(NH2C 12)ugggauUfuCf AfUfguaaccaasgsa(invabasic )(invabasic) ugggauuucauguaaccaaga 144. X9141 2 (GalNAc- T2)(NH2C 12)GfaCfuUfuCf aUfcCfuGfgAfaAfuAfsusAf gacuuucauccuggaaauaua Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 145. X9141 3 (GalNAc- T2)(NH2C 12) AfaGfc AfaGf aU faU fuU fuU faU fa Afsus Af aagcaagauauuuuuauaaua 146. X9141 4 (GalNAc- T2)(NH2C 12)UfgGfgAfuUf uCfaUfgUfaAfcCfaAfsgsAf ugggauuucauguaaccaaga 147. X9143 3 (invabasic)(invabasic)gsascu uuCfaUfCfCfuggaaauasusa( NHC6)(GalNAc-T2) gacuuucauccuggaaauaua 148. X9143 4 (invabasic)(invabasic)asasGf c AfaGfaU fAfU fuU fuuAfuA faua(NHC6)(GalNAc-T2) aagcaagauauuuuuauaaua 149. X9143 5 (invabasic)(invabasic)usgsg gauUfuC fAfUfguaac c aaga( NHC6)(GalNAc-T2) ugggauuucauguaaccaaga 150. X9143 6 GfsasCfuUfuCfaUfcCfuGfg AfaAfuAfuAf(NHC6)(GalN Ac-T2) gacuuucauccuggaaauaua Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 151. X9143 7 AfsasGfc AfaGfaU faU fuU fu UfaUfaAfuAf(NHC6)(GalN Ac-T2) aagcaagauauuuuuauaaua 152. X9143 8 UfsgsGfgAfuUfuCfaUfgUfa AfcCfaAfgAf(NHC6)(GalN Ac-T2) ugggauuucauguaaccaaga 153. ETXO 02 X9140 9 (GalNAc- T2)(NH2C 12)gacuuuCfaUf CfCfuggaaauasusa(invabasic )(invabasic) gacuuucauccuggaaauaua 154. X3848 3 usAfsuauUfuCfCfaggaUfgA faagucscsa uauauuuccaggaugaaagucca 155. ETXO 04 X9141 2 (ET-GalNAc- T2CO)(NH2C 12)GfaCfuUf uCfaUfcCfuGfgAfaAfuAfsu sAf gacuuucauccuggaaauaua 156. X9139 8 us AfsuAfuU fuCfc AfgGfaU f gAfaAfgUfcsCfsa uauauuuccaggaugaaagucca Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 157. ETXO 06 X9143 3 (invabasic)(invabasic)gsascu uuCfaUfCfCfuggaaauasusa( NHC6)(GalNAc-T2) gacuuucauccuggaaauaua 158. X3848 3 usAfsuauUfuCfCfaggaUfgA faagucscsa uauauuuccaggaugaaagucca 159. ETXO 08 X9143 6 GfsasCfuUfuCfaUfcCfuGfg AfaAfuAfuAf(NHC6)(GalN Ac-T2) gacuuucauccuggaaauaua 160. X9139 8 us AfsuAfuU fuCfc AfgGfaU f gAfaAfgUfcsCfsa uauauuuccaggaugaaagucca 161. ETXO 11 X9141 0 (GalNAc- T2)(NH2C 12)aaGfc AfaGfa U fAfU fuU fuuAfuAfasusa(in vabasic)(invabasic) aagcaagauauuuuuauaaua 162. X9138 1 us AfsU fuAfuaAfaAfauaU fc U fuGfcuususudT dT uauuauaaaaauaucuugcuuuu Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 163. ETXO 13 X9141 3 (GalNAc- T2)(NH2C 12) AfaGfc AfaGf aU faU fuU fuU faU fa Afsus Af aagcaagauauuuuuauaaua 164. X9140 0 us AfsuU faU fa AfaAfaU faUf cUfuGfcUfusUfsudTdT uauuauaaaaauaucuugcuuuu 165. ETXO 15 X9143 4 (invabasic)(invabasic)asasGf c AfaGfaU fAfU fuU fuuAfuA faua(NHC6)(GalNAc-T2) aagcaagauauuuuuauaaua 166. X9138 1 us AfsU fuAfuaAfaAfauaU fc U fuGfcuususudT dT uauuauaaaaauaucuugcuuuu 167. ETXO 17 X9143 7 AfsasGfc AfaGfaU faU fuU fu UfaUfaAfuAf(NHC6)(GalN Ac-T2) aagcaagauauuuuuauaaua 168. X9140 0 us AfsuU faU fa AfaAfaU faUf cUfuGfcUfusUfsudTdT uauuauaaaaauaucuugcuuuu 169. ETXO 20 X9141 1 (GalNAc- T2)(NH2C 12)ugggauUfuCf ugggauuucauguaaccaaga Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence AfUfguaaccaasgsa(invabasic )(invabasic) 170. X3810 4 usCfsuugGfuuAfcaugAfaAf ucccasusc ucuugguuacaugaaaucccauc 171. ETXO 22 X9141 4 (GalNAc- T2)(NH2C 12)UfgGfgAfuUf uCfaUfgUfaAfcCfaAfsgsAf ugggauuucauguaaccaaga 172. X9140 2 usCfsuUfgGfuUfaCfaUfgAf aAfuCfcCfasUfsc ucuugguuacaugaaaucccauc 173. ETXO 24 X9143 5 (invabasic)(invabasic)usgsg gauUfuC fAfUfguaac c aaga( NHC6)(GalNAc-T2) ugggauuucauguaaccaaga 174. X3810 4 usCfsuugGfuuAfcaugAfaAf ucccasusc ucuugguuac augaaauc ccauc 175. ETXO 26 X9143 8 UfsgsGfgAfuUfuCfaUfgUfa AfcCfaAfgAf(NHC6)(GalN Ac-T2) ugggauuucauguaaccaaga Seq ID Duple xID ssRN ID Sense Sequence 5’ 3’ Antisense Sequence 5’ -> 3’ Clean Sequence 176. X9140 2 usCfsuUfgGfuUfaCfaUfgAf aAfuCfcCfasUfsc ucuugguuacaugaaaucccauc Key: Key for SEQ ID NOs: 1-24 ia inverted abasic nucleotide (1,2-dideoxyribose) m 2’-O-methyl nucleotide f 2 ’ -deoxy-2 ’ -fluoro nucleotide s phosphorothioate intemucleotide linkage (Phosphorothioate backbone modification) ~ tether Td Deoxythymidine Key for SEQ ID NOs :25-176 dG, dC, dA, dT DNA residues GalNAc N -Ac ety Igalactosamine G, C, A, U RNA residues g, c, a,u 2’-O-Methyl modified residues Gf, Cf, Af, Uf 2’-Fluoro modified residues s Phosphorothioate backbone modification siRNA small interfering RNA MFCO Monofluoro cyclooctyne invabasic 1,2-dideoxyribose (invabasic)(invabasic) Nucleotides in an overall polynucleotide which are the terminal 2 nucleotides which have sugar moieties that are (i) abasic, and (ii) in an inverted configuration, whereby the bond between the penultimate nucleotide and the antepenultimate nucleotide has a reversed linkage, namely either a 5-5 or a 3-3 linkage NH2-DEG / NHDEG Aminoethoxyethyl linker NH2C12 Aminododecyl linker NH2C6 / NHC6 Aminohexyl linker ET (E-therapeutics - company reference) (ET-GalNAc-TlN3)(MFCO)(NH-DEG) tether Tib (ET-GalNAc-T2CO)(NH2C 12) tether T2b (NHC6)(MFCO)(ET-GalNAc-T lN3)tether T1 a (NHC6)(ET-GalNAc-T2CO) tether T2a T1N3 T1 tether T2Co T2 tether (GalNAc-)T 1 GalNac T1 tether (GalNAc-)T2 GalNac T2 tether Note: the key refers to the sense and antisense sequence, whereas the clean sequence contains the underlying RNA nucleotide only. LU 00
Claims
A compound of Formula (VIII) or Formula (IX):Formula (VIII)OligonucleotideFormula (IX)2. A compound according to claim 1, wherein the oligonucleotide comprises an RNA duplex comprising first and second strands, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, and wherein each of the first and second strands have 5’ and 3’ ends, and wherein said RNA duplex is attached at the 5’ end or the 3’ end of its second strand to the adjacent phosphate.2026205304 06 Jul 20263. A process of preparing a compound according to any one of claims 1 or 2, which comprises reacting compounds of Formulae (X) and (XI):Formula (X)Formula (XI)wherein:r is an integer selected from 1 to 16;s is 6; andZ is an oligonucleotide moiety;and where appropriate carrying out deprotection of the ligand and / or annealing of a second strand for the oligonucleotide.
4. A compound of Formula (XI):Formula (XI)wherein:s is independently an integer selected from 1 to 16; and Z is an oligonucleotide moiety.
5. A compound of Formula (XIa):2026205304 06 Jul 2026Formula (XIa)6. A compound of Formula (XIb):Formula (XIb)7. A compound obtained by a process according to claim 3.
8. A pharmaceutical composition comprising of a compound according to any one of claims1, 2 or 4 to 7, together with a pharmaceutically acceptable carrier, diluent or excipient.
9. A compound according to any one of claims 1, 2 or 4 to 7, for use in therapy.